#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CAMTA1	23261	broad.mit.edu	37	1	7725216	7725216	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:7725216T>A	ENST00000303635.7	+	9	2816	c.2609T>A	c.(2608-2610)gTg>gAg	p.V870E	CAMTA1_ENST00000439411.2_Missense_Mutation_p.V870E	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	870					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V870E(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		AGCGGACGGGTGTTCATGGTG	0.687			T	WWTR1	epitheliod hemangioendothelioma																																		uc001aoi.2		NA		Dom	yes		1	1p36.31-p36.23	611501		calmodulin binding transcription activator 1			M					1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9						c.(2608-2610)GTG>GAG		calmodulin-binding transcription activator 1							40.0	32.0	34.0					1																	7725216		2156	4225	6381	SO:0001583	missense	23261				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding	g.chr1:7725216T>A	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.2609T>A	1.37:g.7725216T>A	ENSP00000306522:p.Val870Glu		Somatic					p.V870E	NM_015215	NP_056030	WXS	Illumina HiSeq	Unspecified	Q9Y6Y1	CMTA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)	9	2816	+	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)	870					A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	c.2609T>A	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	t	14.96	2.691636	0.48097	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.21031	2.03;2.03	5.34	5.34	0.76211	Immunoglobulin-like fold (1);	0.090924	0.47455	D	0.000230	T	0.12860	0.0312	N	0.08118	0	0.41537	D	0.988497	P	0.43169	0.8	B	0.38562	0.276	T	0.10800	-1.0614	10	0.72032	D	0.01	-11.442	15.301	0.73952	0.0:0.0:0.0:1.0	.	870	Q9Y6Y1	CMTA1_HUMAN	E	870	ENSP00000306522:V870E;ENSP00000402561:V870E	ENSP00000306522:V870E	V	+	2	0	CAMTA1	7647803	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.642000	0.83385	2.031000	0.59945	0.391000	0.25812	GTG		0.687	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215		18	24	0	0	0	0.00499	0	18	24				
PRAMEF11	440560	broad.mit.edu	37	1	12887606	12887606	+	Missense_Mutation	SNP	C	C	G	rs58074988	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:12887606C>G	ENST00000535591.1	-	3	446	c.251G>C	c.(250-252)tGc>tCc	p.C84S		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	84					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.C84S(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						ATTGAGGAAGCACCCATGGGC	0.483																																							uc001auk.2		NA																	1	Substitution - Missense(1)		endometrium(1)		0						c.(250-252)TGC>TCC		PRAME family member 11																																				SO:0001583	missense	440560							g.chr1:12887606C>G	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.251G>C	1.37:g.12887606C>G	ENSP00000439551:p.Cys84Ser		Somatic					p.C84S	NM_001146344	NP_001139816	WXS	Illumina HiSeq	Unspecified	O60813	PRA11_HUMAN			3	447	-			84						Missense_Mutation	SNP	ENST00000535591.1	37	c.251G>C	CCDS53268.1	.	.	.	.	.	.	.	.	.	.	.	8.676	0.903882	0.17760	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.18016	2.24;2.24	1.48	-0.635	0.11512	.	1.371720	0.04624	N	0.402516	T	0.15825	0.0381	L	0.54908	1.71	0.09310	N	1	P	0.44816	0.844	B	0.41764	0.366	T	0.23904	-1.0175	10	0.16896	T	0.51	.	3.692	0.08350	0.2835:0.4381:0.2784:0.0	rs58074988	84	O60813	PRA11_HUMAN	S	84;125;84	ENSP00000439551:C84S;ENSP00000391839:C84S	ENSP00000328783:C125S	C	-	2	0	PRAMEF11	12810193	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.358000	0.07641	-0.176000	0.10707	-1.934000	0.00508	TGC		0.483	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341		5	259	0	0	0	0.00308	0	5	259				
CATSPER4	378807	broad.mit.edu	37	1	26527428	26527428	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:26527428C>T	ENST00000456354.2	+	8	1162	c.1095C>T	c.(1093-1095)ccC>ccT	p.P365P		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	365					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.P365P(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		CGGGAGGCCCCCTGTCGAACC	0.552																																							uc010oez.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1093-1095)CCC>CCT		cation channel, sperm associated 4							74.0	73.0	73.0					1																	26527428		2203	4300	6503	SO:0001819	synonymous_variant	378807				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity	g.chr1:26527428C>T	BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.1095C>T	1.37:g.26527428C>T			Somatic				CATSPER4_uc010oey.1_Silent_p.P187P|CATSPER4_uc009vsf.2_RNA	p.P365P	NM_198137	NP_937770	WXS	Illumina HiSeq	Unspecified	Q7RTX7	CTSR4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)	8	1095	+		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)	365			Cytoplasmic (Potential).		A1A4W6|Q5VY71	Silent	SNP	ENST00000456354.2	37	c.1095C>T	CCDS30645.1																																																																																				0.552	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019849.2	NM_198137		27	41	0	0	0	0.004656	0	27	41				
KDF1	126695	broad.mit.edu	37	1	27278144	27278144	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:27278144A>G	ENST00000320567.5	-	2	816	c.728T>C	c.(727-729)aTc>aCc	p.I243T		NM_152365.2	NP_689578.2	Q8NAX2	KDF1_HUMAN		243					developmental growth (GO:0048589)|establishment of skin barrier (GO:0061436)|keratinocyte development (GO:0003334)|limb epidermis development (GO:0060887)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|positive regulation of epidermal cell differentiation (GO:0045606)|regulation of epidermal cell division (GO:0010482)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)		p.I243T(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		CTTCTTGAAGATGAGCACATC	0.537																																							uc001bni.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(727-729)ATC>ACC		hypothetical protein LOC126695							46.0	44.0	45.0					1																	27278144		2203	4300	6503	SO:0001583	missense	126695							g.chr1:27278144A>G																												ENST00000320567.5:c.728T>C	1.37:g.27278144A>G	ENSP00000319179:p.Ile243Thr		Somatic					p.I243T	NM_152365	NP_689578	WXS	Illumina HiSeq	Unspecified	Q8NAX2	CA172_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)	2	817	-		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)	243					Q5QP32|Q8N0S7	Missense_Mutation	SNP	ENST00000320567.5	37	c.728T>C	CCDS293.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.77|19.77	3.889186|3.889186	0.72524|0.72524	.|.	.|.	ENSG00000175707|ENSG00000175707	ENST00000320567|ENST00000374109	T|.	0.33865|.	1.39|.	4.77|4.77	4.77|4.77	0.60923|0.60923	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56790|0.56790	0.2009|0.2009	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.53982|0.53982	-0.8361|-0.8361	10|6	0.87932|0.29301	D|T	0|0.29	.|.	14.4671|14.4671	0.67492|0.67492	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	243|.	Q8NAX2|.	CA172_HUMAN|.	T|P	243|204	ENSP00000319179:I243T|.	ENSP00000319179:I243T|ENSP00000363223:S204P	I|S	-|-	2|1	0|0	C1orf172|C1orf172	27150731|27150731	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	8.695000|8.695000	0.91298|0.91298	2.013000|2.013000	0.59113|0.59113	0.454000|0.454000	0.30748|0.30748	ATC|TCT		0.537	C1orf172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012340.1			20	13	0	0	0	0.010504	0	20	13				
CSMD2	114784	broad.mit.edu	37	1	34276420	34276420	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:34276420G>C	ENST00000338325.1	-	3	453	c.41C>G	c.(40-42)aCc>aGc	p.T14S	CSMD2_ENST00000373381.4_Missense_Mutation_p.T457S			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	417						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T417S(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ATTGGGGGAGGTGATGATGCC	0.542																																							uc001bxn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(1249-1251)ACC>AGC		CUB and Sushi multiple domains 2							120.0	118.0	119.0					1																	34276420		2203	4300	6503	SO:0001583	missense	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34276420G>C	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000338325.1:c.41C>G	1.37:g.34276420G>C	ENSP00000340311:p.Thr14Ser		Somatic				CSMD2_uc001bxm.1_Missense_Mutation_p.T457S	p.T417S	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			10	1279	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	417			CUB 3.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000338325.1	37	c.1250C>G		.	.	.	.	.	.	.	.	.	.	G	26.3	4.723986	0.89298	.	.	ENSG00000121904	ENST00000373381;ENST00000338325	T;T	0.17213	2.29;2.29	5.6	5.6	0.85130	CUB (5);	0.000000	0.85682	D	0.000000	T	0.31765	0.0807	L	0.33339	1.005	0.80722	D	1	D;D	0.89917	1.0;0.971	D;D	0.91635	0.999;0.978	T	0.01488	-1.1342	10	0.22109	T	0.4	.	18.6167	0.91305	0.0:0.0:1.0:0.0	.	417;457	Q7Z408;E7EUA6	CSMD2_HUMAN;.	S	457;14	ENSP00000362479:T457S;ENSP00000340311:T14S	ENSP00000241312:T417S	T	-	2	0	CSMD2	34049007	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.761000	0.98940	2.641000	0.89580	0.591000	0.81541	ACC		0.542	CSMD2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000036404.2	NM_052896		40	58	0	0	0	0.011902	0	40	58				
SFPQ	6421	broad.mit.edu	37	1	35652649	35652649	+	Missense_Mutation	SNP	C	C	A	rs144271953		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:35652649C>A	ENST00000357214.5	-	9	2037	c.1939G>T	c.(1939-1941)Ggc>Tgc	p.G647C		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	647					alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.G647C(1)	SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				GGTGGAACGCCAGGATTAGCT	0.443			T	TFE3	papillary renal cell																																		uc001bys.2		NA		Dom	yes		1	1p34.3	6421	T	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)			E	TFE3		papillary renal cell	SFPQ/TFE3(6)	1	Substitution - Missense(1)		lung(1)	kidney(4)|soft_tissue(2)|ovary(1)|skin(1)	8						c.(1939-1941)GGC>TGC		splicing factor proline/glutamine rich							112.0	104.0	107.0					1																	35652649		2203	4300	6503	SO:0001583	missense	6421				alternative nuclear mRNA splicing, via spliceosome|DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|nucleotide binding|protein binding|protein binding|RNA binding	g.chr1:35652649C>A	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.1939G>T	1.37:g.35652649C>A	ENSP00000349748:p.Gly647Cys		Somatic				SFPQ_uc001byr.2_RNA	p.G647C	NM_005066	NP_005057	WXS	Illumina HiSeq	Unspecified	P23246	SFPQ_HUMAN			9	2032	-		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)	647					P30808|Q5SZ71	Missense_Mutation	SNP	ENST00000357214.5	37	c.1939G>T	CCDS388.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383971	0.82792	.	.	ENSG00000116560	ENST00000357214	T	0.28454	1.61	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.56572	0.1994	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56208	-0.8017	10	0.87932	D	0	-20.5441	19.9836	0.97340	0.0:1.0:0.0:0.0	.	647	P23246	SFPQ_HUMAN	C	647	ENSP00000349748:G647C	ENSP00000349748:G647C	G	-	1	0	SFPQ	35425236	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.195000	0.72088	2.726000	0.93360	0.655000	0.94253	GGC		0.443	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066		32	56	1	0	1.74807e-11	0.010818	2.20615e-11	32	56				
PODN	127435	broad.mit.edu	37	1	53544461	53544461	+	Missense_Mutation	SNP	C	C	T	rs145236540		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:53544461C>T	ENST00000312553.5	+	8	1430	c.1423C>T	c.(1423-1425)Cgc>Tgc	p.R475C	RP11-334A14.5_ENST00000447867.1_RNA|PODN_ENST00000371500.3_Missense_Mutation_p.R456C|PODN_ENST00000395871.2_Missense_Mutation_p.R333C	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	427					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)	p.R475C(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CGACGCCTTCCGCAAGCTGCG	0.642																																							uc001cuv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1423-1425)CGC>TGC		podocan		C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	94.0	76.0	82.0		1366,1366,997,1423	4.8	1.0	1	dbSNP_134	82	0,8600		0,0,4300	no	missense,missense,missense,missense	PODN	NM_001199080.1,NM_001199081.1,NM_001199082.1,NM_153703.4	180,180,180,180	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	456/643,456/643,333/520,475/662	53544461	2,13004	2203	4300	6503	SO:0001583	missense	127435				negative regulation of cell migration|negative regulation of cell proliferation	cytoplasm|extracellular space|proteinaceous extracellular matrix	collagen binding	g.chr1:53544461C>T	AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.1423C>T	1.37:g.53544461C>T	ENSP00000308315:p.Arg475Cys		Somatic				PODN_uc001cuw.2_Missense_Mutation_p.R456C|PODN_uc010onr.1_Missense_Mutation_p.R456C|PODN_uc010ons.1_Missense_Mutation_p.R333C	p.R475C	NM_153703	NP_714914	WXS	Illumina HiSeq	Unspecified	Q7Z5L7	PODN_HUMAN			8	1430	+			427					B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	ENST00000312553.5	37	c.1423C>T	CCDS573.1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.888171	0.72524	4.54E-4	0.0	ENSG00000174348	ENST00000371500;ENST00000395871;ENST00000312553	T;T;T	0.57752	0.38;0.38;0.38	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.64627	0.2615	L	0.37750	1.13	0.58432	D	0.999999	P;D;B	0.89917	0.839;1.0;0.372	B;D;B	0.79108	0.224;0.992;0.304	T	0.66488	-0.5911	10	0.54805	T	0.06	.	18.0614	0.89378	0.0:1.0:0.0:0.0	.	333;456;475	Q7Z5L7-4;Q7Z5L7-2;Q7Z5L7-3	.;.;.	C	456;333;475	ENSP00000360555:R456C;ENSP00000379212:R333C;ENSP00000308315:R475C	ENSP00000308315:R475C	R	+	1	0	PODN	53317049	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.715000	0.61909	2.492000	0.84095	0.555000	0.69702	CGC		0.642	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024735.1	NM_153703		31	23	0	0	0	0.009535	0	31	23				
GLIS1	148979	broad.mit.edu	37	1	53995556	53995556	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:53995556C>G	ENST00000312233.2	-	4	1431	c.865G>C	c.(865-867)Gag>Cag	p.E289Q		NM_147193.2	NP_671726.2			GLIS family zinc finger 1									p.E289Q(1)|p.E289K(1)		endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						TACGGCTTCTCGCCCGTGTGG	0.637																																							uc001cvr.1		NA																	2	Substitution - Missense(2)		lung(1)|skin(1)	skin(1)	1						c.(865-867)GAG>CAG		GLIS family zinc finger 1							63.0	67.0	65.0					1																	53995556		2203	4300	6503	SO:0001583	missense	148979				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr1:53995556C>G	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.865G>C	1.37:g.53995556C>G	ENSP00000309653:p.Glu289Gln		Somatic					p.E289Q	NM_147193	NP_671726	WXS	Illumina HiSeq	Unspecified	Q8NBF1	GLIS1_HUMAN			4	1432	-			289						Missense_Mutation	SNP	ENST00000312233.2	37	c.865G>C	CCDS582.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506000	0.85282	.	.	ENSG00000174332	ENST00000312233	T	0.25912	1.77	4.58	4.58	0.56647	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.48286	D	0.000189	T	0.52901	0.1763	M	0.73753	2.245	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.59731	-0.7399	10	0.87932	D	0	.	17.7575	0.88453	0.0:1.0:0.0:0.0	.	289	Q8NBF1	GLIS1_HUMAN	Q	289	ENSP00000309653:E289Q	ENSP00000309653:E289Q	E	-	1	0	GLIS1	53768144	1.000000	0.71417	0.990000	0.47175	0.678000	0.39670	7.776000	0.85560	2.271000	0.75665	0.491000	0.48974	GAG		0.637	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1	NM_147193		18	21	0	0	0	0.007413	0	18	21				
LEPR	3953	broad.mit.edu	37	1	66038102	66038102	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:66038102A>T	ENST00000349533.6	+	5	649	c.464A>T	c.(463-465)tAt>tTt	p.Y155F	LEPR_ENST00000406510.3_5'UTR|LEPR_ENST00000371060.3_Missense_Mutation_p.Y155F|LEPR_ENST00000371059.3_Missense_Mutation_p.Y155F|LEPR_ENST00000344610.8_Missense_Mutation_p.Y155F|LEPR_ENST00000371058.1_Missense_Mutation_p.Y155F|snoU13_ENST00000459362.1_RNA|LEPR_ENST00000462765.1_3'UTR	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)	p.Y155F(3)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TTCAGGAATTATAACTATAAG	0.294																																							uc001dci.2		NA																	3	Substitution - Missense(3)		lung(3)	skin(1)	1						c.(463-465)TAT>TTT		leptin receptor isoform 1							54.0	62.0	60.0					1																	66038102		2188	4279	6467	SO:0001583	missense	3953				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity	g.chr1:66038102A>T	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.464A>T	1.37:g.66038102A>T	ENSP00000330393:p.Tyr155Phe		Somatic				LEPR_uc001dcg.2_Missense_Mutation_p.Y155F|LEPR_uc001dch.2_Missense_Mutation_p.Y155F|LEPR_uc009waq.2_Missense_Mutation_p.Y155F|LEPR_uc001dcj.2_Missense_Mutation_p.Y155F|LEPR_uc001dck.2_Missense_Mutation_p.Y155F	p.Y155F	NM_002303	NP_002294	WXS	Illumina HiSeq	Unspecified	P48357	LEPR_HUMAN		OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)	5	666	+			155			Extracellular (Potential).		Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	c.464A>T	CCDS631.1	.	.	.	.	.	.	.	.	.	.	A	5.260	0.233481	0.09969	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.55052	0.56;0.55;0.56;0.54;0.56	5.31	0.914	0.19360	.	1.429940	0.03896	N	0.279571	T	0.30916	0.0780	M	0.71581	2.175	0.09310	N	0.999998	B;B;B;P	0.47762	0.435;0.411;0.404;0.9	B;B;B;B	0.42522	0.167;0.111;0.302;0.39	T	0.10019	-1.0648	10	0.22706	T	0.39	-4.0857	5.5385	0.17026	0.5565:0.1396:0.0:0.3039	.	155;155;155;155	P48357-4;P48357;P48357-2;P48357-3	.;LEPR_HUMAN;.;.	F	155	ENSP00000340884:Y155F;ENSP00000330393:Y155F;ENSP00000360099:Y155F;ENSP00000360098:Y155F;ENSP00000360097:Y155F	ENSP00000340884:Y155F	Y	+	2	0	LEPR	65810690	0.000000	0.05858	0.006000	0.13384	0.004000	0.04260	-0.091000	0.11146	0.276000	0.22118	0.455000	0.32223	TAT		0.294	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303		13	17	0	0	0	0.016723	0	13	17				
PDE4B	5142	broad.mit.edu	37	1	66713219	66713219	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:66713219C>A	ENST00000329654.4	+	4	545	c.358C>A	c.(358-360)Ctt>Att	p.L120I	PDE4B_ENST00000371049.3_Missense_Mutation_p.L120I|PDE4B_ENST00000423207.2_Missense_Mutation_p.L105I	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	120					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.L105I(1)|p.L120I(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	TGGGCTGGTACTTCACGCCAC	0.537																																							uc001dcn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(358-360)CTT>ATT		phosphodiesterase 4B isoform 1	Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)						140.0	141.0	141.0					1																	66713219		2203	4300	6503	SO:0001583	missense	5142				signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding	g.chr1:66713219C>A	L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.358C>A	1.37:g.66713219C>A	ENSP00000332116:p.Leu120Ile		Somatic				PDE4B_uc009war.2_Missense_Mutation_p.L28I|PDE4B_uc001dco.2_Missense_Mutation_p.L120I|PDE4B_uc001dcp.2_Missense_Mutation_p.L105I	p.L120I	NM_001037341	NP_001032418	WXS	Illumina HiSeq	Unspecified	Q07343	PDE4B_HUMAN			4	549	+			120					A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	ENST00000329654.4	37	c.358C>A	CCDS632.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700744	0.88924	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000412480	T;T;T;T;D	0.84800	-1.06;-1.06;-1.06;-1.05;-1.9	5.64	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.80819	0.4696	L	0.46670	1.46	0.80722	D	1	D;P;P	0.54397	0.966;0.942;0.942	P;B;P	0.48571	0.582;0.378;0.515	T	0.82699	-0.0328	10	0.54805	T	0.06	.	14.9653	0.71188	0.0:0.9301:0.0:0.0699	.	105;110;120	Q07343-3;Q59GM8;Q07343	.;.;PDE4B_HUMAN	I	120;120;120;105;28	ENSP00000332116:L120I;ENSP00000342637:L120I;ENSP00000360088:L120I;ENSP00000392947:L105I;ENSP00000397548:L28I	ENSP00000332116:L120I	L	+	1	0	PDE4B	66485807	0.991000	0.36638	0.997000	0.53966	0.941000	0.58515	2.671000	0.46842	2.654000	0.90174	0.563000	0.77884	CTT		0.537	PDE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025188.3	NM_002600		79	80	1	0	1.39921e-30	0.01441	2.20402e-30	79	80				
RPE65	6121	broad.mit.edu	37	1	68905310	68905310	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:68905310A>G	ENST00000262340.5	-	7	712	c.659T>C	c.(658-660)aTa>aCa	p.I220T		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	220					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)	p.I220T(1)		central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						TGACTTGCTTATTGGATCTTC	0.378																																							uc001dei.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(658-660)ATA>ACA		retinal pigment epithelium-specific protein							179.0	171.0	173.0					1																	68905310		2203	4300	6503	SO:0001583	missense	6121				visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity	g.chr1:68905310A>G	U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.659T>C	1.37:g.68905310A>G	ENSP00000262340:p.Ile220Thr		Somatic					p.I220T	NM_000329	NP_000320	WXS	Illumina HiSeq	Unspecified	Q16518	RPE65_HUMAN			7	713	-			220					A8K1L0|Q5T9U3	Missense_Mutation	SNP	ENST00000262340.5	37	c.659T>C	CCDS643.1	.	.	.	.	.	.	.	.	.	.	a	15.29	2.790779	0.50102	.	.	ENSG00000116745	ENST00000262340	D	0.94650	-3.48	5.56	5.56	0.83823	.	0.128695	0.64402	D	0.000001	D	0.95056	0.8399	M	0.66939	2.045	0.46131	D	0.998888	B	0.20164	0.042	P	0.50490	0.642	D	0.92514	0.6019	10	0.16896	T	0.51	-0.3675	15.7331	0.77822	1.0:0.0:0.0:0.0	.	220	Q16518	RPE65_HUMAN	T	220	ENSP00000262340:I220T	ENSP00000262340:I220T	I	-	2	0	RPE65	68677898	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.771000	0.91751	2.112000	0.64535	0.524000	0.50904	ATA		0.378	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329		43	60	0	0	0	0.009718	0	43	60				
CLCA4	22802	broad.mit.edu	37	1	87040257	87040257	+	Missense_Mutation	SNP	C	C	A	rs555270545		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:87040257C>A	ENST00000370563.3	+	10	1544	c.1502C>A	c.(1501-1503)gCc>gAc	p.A501D	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	501					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)	p.A501D(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		AATAGTAATGCCTGGATGAAC	0.373													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20128	0.0		0.0	False		,,,				2504	0.0						uc009wcs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1501-1503)GCC>GAC		chloride channel accessory 4							82.0	76.0	78.0					1																	87040257		1898	4127	6025	SO:0001583	missense	22802					apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:87040257C>A	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.1502C>A	1.37:g.87040257C>A	ENSP00000359594:p.Ala501Asp		Somatic				CLCA4_uc009wct.2_Missense_Mutation_p.A264D|CLCA4_uc009wcu.2_Missense_Mutation_p.A321D	p.A501D	NM_012128	NP_036260	WXS	Illumina HiSeq	Unspecified	Q14CN2	CLCA4_HUMAN		all cancers(265;0.0202)|Epithelial(280;0.0404)	10	1546	+		Lung NSC(277;0.238)	501					A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	37	c.1502C>A	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	C	8.890	0.953733	0.18431	.	.	ENSG00000016602	ENST00000370563	T	0.29917	1.55	5.88	-11.8	0.00035	Domain of unknown function DUF1973 (1);	3.133360	0.00616	N	0.000429	T	0.01454	0.0047	N	0.01493	-0.835	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.25641	-1.0126	10	0.09084	T	0.74	18.3722	1.0407	0.01558	0.3418:0.0944:0.2138:0.35	.	53;501	Q9NXP1;Q14CN2	.;CLCA4_HUMAN	D	501	ENSP00000359594:A501D	ENSP00000359594:A501D	A	+	2	0	CLCA4	86812845	0.000000	0.05858	0.000000	0.03702	0.314000	0.28054	-3.141000	0.00586	-2.694000	0.00402	0.650000	0.86243	GCC		0.373	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128		33	70	1	0	3.76114e-14	0.019004	5.03488e-14	33	70				
COL11A1	1301	broad.mit.edu	37	1	103548481	103548481	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:103548481C>G	ENST00000370096.3	-	2	466	c.154G>C	c.(154-156)Gag>Cag	p.E52Q	COL11A1_ENST00000358392.2_Missense_Mutation_p.E52Q|COL11A1_ENST00000512756.1_Missense_Mutation_p.E52Q|COL11A1_ENST00000353414.4_Missense_Mutation_p.E52Q	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	52					cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.E52Q(2)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GATATTCCCTCTGGAGAATTG	0.368																																							uc001dul.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(154-156)GAG>CAG		alpha 1 type XI collagen isoform A							111.0	112.0	111.0					1																	103548481		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103548481C>G	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.154G>C	1.37:g.103548481C>G	ENSP00000359114:p.Glu52Gln		Somatic				COL11A1_uc001dum.2_Missense_Mutation_p.E52Q|COL11A1_uc001dun.2_Missense_Mutation_p.E52Q|COL11A1_uc009weh.2_Missense_Mutation_p.E52Q	p.E52Q	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	2	472	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	52			TSP N-terminal.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.154G>C	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	19.26	3.793015	0.70452	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29	5.7	5.7	0.88788	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.053328	0.64402	D	0.000001	T	0.57213	0.2038	M	0.80422	2.495	0.58432	D	0.999992	D;D;P;P	0.71674	0.997;0.998;0.712;0.589	D;D;P;B	0.80764	0.986;0.994;0.529;0.377	T	0.53358	-0.8450	10	0.35671	T	0.21	.	19.8365	0.96659	0.0:1.0:0.0:0.0	.	52;52;52;52	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	Q	52	ENSP00000359114:E52Q;ENSP00000351163:E52Q;ENSP00000302551:E52Q;ENSP00000426533:E52Q;ENSP00000408640:E52Q	ENSP00000302551:E52Q	E	-	1	0	COL11A1	103321069	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.087000	0.71362	2.694000	0.91930	0.467000	0.42956	GAG		0.368	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		35	42	0	0	0	0.012213	0	35	42				
IGSF3	3321	broad.mit.edu	37	1	117122485	117122485	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:117122485C>A	ENST00000369486.3	-	10	3628	c.2863G>T	c.(2863-2865)Gtg>Ttg	p.V955L	IGSF3_ENST00000369483.1_Missense_Mutation_p.V975L|IGSF3_ENST00000318837.6_Missense_Mutation_p.V975L	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	955	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.V955L(1)|p.V975L(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		ACTGTGTCCACCTGCAGGGAA	0.502																																							uc001egr.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(2863-2865)GTG>TTG		immunoglobulin superfamily, member 3 isoform 2							33.0	29.0	30.0					1																	117122485		2198	4293	6491	SO:0001583	missense	3321					integral to membrane		g.chr1:117122485C>A	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2863G>T	1.37:g.117122485C>A	ENSP00000358498:p.Val955Leu		Somatic				IGSF3_uc001egq.1_Missense_Mutation_p.V975L	p.V955L	NM_001007237	NP_001007238	WXS	Illumina HiSeq	Unspecified	O75054	IGSF3_HUMAN		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)	10	3568	-	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)	955			Ig-like C2-type 8.|Extracellular (Potential).		A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	c.2863G>T	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.291815	0.23564	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.04083	3.71;4.05;4.05	4.67	4.67	0.58626	Immunoglobulin-like (1);	0.741169	0.11774	N	0.530811	T	0.02047	0.0064	N	0.25789	0.76	0.53005	D	0.999965	B;B	0.22414	0.015;0.069	B;B	0.22386	0.01;0.039	T	0.50668	-0.8801	10	0.27785	T	0.31	-26.5582	15.1177	0.72416	0.0:1.0:0.0:0.0	.	955;975	O75054;A6NJZ6	IGSF3_HUMAN;.	L	955;975;975	ENSP00000358498:V955L;ENSP00000358495:V975L;ENSP00000321184:V975L	ENSP00000321184:V975L	V	-	1	0	IGSF3	116924008	1.000000	0.71417	1.000000	0.80357	0.207000	0.24258	6.429000	0.73387	2.421000	0.82119	0.462000	0.41574	GTG		0.502	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542		10	15	1	0	1.08611e-07	0.010729	1.25366e-07	10	15				
WARS2	10352	broad.mit.edu	37	1	119575683	119575683	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:119575683C>A	ENST00000235521.4	-	6	960	c.934G>T	c.(934-936)Gag>Tag	p.E312*	WARS2_ENST00000369426.5_3'UTR|WARS2_ENST00000537870.1_Nonsense_Mutation_p.E218*	NM_015836.3|NM_201263.2	NP_056651.1|NP_957715.1	Q9UGM6	SYWM_HUMAN	tryptophanyl tRNA synthetase 2, mitochondrial	312					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)|vasculogenesis (GO:0001570)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)	p.E312*(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(2)	15	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)		Lung(183;0.0629)	L-Tryptophan(DB00150)	GCAAACTTCTCAATCACAGCA	0.517																																							uc001ehn.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(934-936)GAG>TAG		mitochondrial tryptophanyl tRNA synthetase 2	L-Tryptophan(DB00150)						117.0	118.0	118.0					1																	119575683		2203	4300	6503	SO:0001587	stop_gained	10352				tryptophanyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|tryptophan-tRNA ligase activity	g.chr1:119575683C>A	BC021722	CCDS900.1, CCDS30817.1	1p12	2011-07-01	2007-02-23		ENSG00000116874	ENSG00000116874	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12730	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 2, mitochondrial"""	604733				10072595, 10828066	Standard	NM_201263		Approved	TrpRS	uc001ehn.3	Q9UGM6	OTTHUMG00000012335	ENST00000235521.4:c.934G>T	1.37:g.119575683C>A	ENSP00000235521:p.Glu312*		Somatic				WARS2_uc010oxf.1_Nonsense_Mutation_p.E218*|WARS2_uc001ehm.2_3'UTR|WARS2_uc010oxg.1_Nonsense_Mutation_p.E255*|WARS2_uc010oxh.1_3'UTR	p.E312*	NM_015836	NP_056651	WXS	Illumina HiSeq	Unspecified	Q9UGM6	SYWM_HUMAN		Lung(183;0.0629)	6	962	-	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)	312					B1ALR1|B2R9D4|Q53FT4|Q5VUD2|Q86TQ0	Nonsense_Mutation	SNP	ENST00000235521.4	37	c.934G>T	CCDS900.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455858	0.84209	.	.	ENSG00000116874	ENST00000235521;ENST00000537870	.	.	.	5.96	4.04	0.47022	.	0.346045	0.36101	N	0.002786	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-26.3674	16.2938	0.82761	0.0:0.5917:0.4082:0.0	.	.	.	.	X	312;218	.	ENSP00000235521:E312X	E	-	1	0	WARS2	119377206	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.021000	0.49651	1.517000	0.48917	0.655000	0.94253	GAG		0.517	WARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034362.1	NM_015836		58	83	1	0	4.10029e-35	0.01441	6.50766e-35	58	83				
BCL9	607	broad.mit.edu	37	1	147092256	147092256	+	Silent	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:147092256G>C	ENST00000234739.3	+	8	3035	c.2295G>C	c.(2293-2295)gtG>gtC	p.V765V		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	765	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.V765V(1)		breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					AGAAGATGGTGCCACTGCCAT	0.592			T	"""IGH@, IGL@"""	B-ALL																																		uc001epq.2		NA		Dom	yes		1	1q21	607	T	B-cell CLL/lymphoma 9			L	IGH@|IGL@		B-ALL		1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(2)|breast(1)|skin(1)	6						c.(2293-2295)GTG>GTC		B-cell CLL/lymphoma 9							37.0	38.0	37.0					1																	147092256		2203	4300	6503	SO:0001819	synonymous_variant	607				Wnt receptor signaling pathway	nucleus	protein binding	g.chr1:147092256G>C	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.2295G>C	1.37:g.147092256G>C			Somatic				BCL9_uc010ozr.1_Silent_p.V691V	p.V765V	NM_004326	NP_004317	WXS	Illumina HiSeq	Unspecified	O00512	BCL9_HUMAN			8	3035	+	all_hematologic(923;0.115)		765			Pro-rich.		Q5T489	Silent	SNP	ENST00000234739.3	37	c.2295G>C	CCDS30833.1																																																																																				0.592	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326		18	17	0	0	0	0.00499	0	18	17				
SF3B4	10262	broad.mit.edu	37	1	149898282	149898282	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:149898282C>A	ENST00000271628.8	-	3	1276	c.692G>T	c.(691-693)gGg>gTg	p.G231V	MTMR11_ENST00000492824.1_5'Flank	NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	231					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G231V(1)		endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			TGGAGGAAGCCCAGACCCCAA	0.522																																							uc001etj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(691-693)GGG>GTG		splicing factor 3b, subunit 4							49.0	48.0	48.0					1																	149898282		2203	4300	6503	SO:0001583	missense	10262					nucleoplasm|U12-type spliceosomal complex	nucleotide binding|protein binding|RNA binding	g.chr1:149898282C>A	L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.692G>T	1.37:g.149898282C>A	ENSP00000271628:p.Gly231Val		Somatic				SF3B4_uc001eti.1_5'Flank|SF3B4_uc001etk.1_Missense_Mutation_p.G231V|SF3B4_uc009wll.1_Missense_Mutation_p.G231V	p.G231V	NM_005850	NP_005841	WXS	Illumina HiSeq	Unspecified	Q15427	SF3B4_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		3	743	-	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		231					Q5SZ63	Missense_Mutation	SNP	ENST00000271628.8	37	c.692G>T	CCDS941.1	.	.	.	.	.	.	.	.	.	.	C	13.23	2.175475	0.38413	.	.	ENSG00000143368	ENST00000271628;ENST00000457312	T;T	0.28454	1.61;2.64	4.37	4.37	0.52481	.	0.214001	0.48286	D	0.000195	T	0.16896	0.0406	N	0.14661	0.345	0.80722	D	1	D;P	0.60160	0.987;0.82	P;B	0.51945	0.685;0.376	T	0.02471	-1.1154	10	0.30078	T	0.28	.	14.5954	0.68400	0.0:1.0:0.0:0.0	.	231;231	Q53FG6;Q15427	.;SF3B4_HUMAN	V	231;188	ENSP00000271628:G231V;ENSP00000391114:G188V	ENSP00000271628:G231V	G	-	2	0	SF3B4	148164906	0.991000	0.36638	1.000000	0.80357	0.940000	0.58332	2.958000	0.49145	2.437000	0.82529	0.643000	0.83706	GGG		0.522	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033753.1	NM_005850		44	23	1	0	5.34276e-22	0.01441	7.85479e-22	44	23				
NPR1	4881	broad.mit.edu	37	1	153660565	153660565	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:153660565C>A	ENST00000368680.3	+	15	2757	c.2285C>A	c.(2284-2286)cCc>cAc	p.P762H		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	762	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)	p.P762H(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	GAGCAGCCCCCCTTCCGGCCC	0.667																																					Pancreas(141;1349 1870 15144 15830 40702)	Pancreas(141;1349 1870 15144 15830 40702)	uc001fcs.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|stomach(1)|breast(1)	7						c.(2284-2286)CCC>CAC		natriuretic peptide receptor 1 precursor	Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)						49.0	51.0	50.0					1																	153660565		2203	4300	6503	SO:0001583	missense	4881				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity	g.chr1:153660565C>A	BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2285C>A	1.37:g.153660565C>A	ENSP00000357669:p.Pro762His		Somatic				NPR1_uc010pdz.1_Missense_Mutation_p.P508H|NPR1_uc010pea.1_Missense_Mutation_p.P240H	p.P762H	NM_000906	NP_000897	WXS	Illumina HiSeq	Unspecified	P16066	ANPRA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		15	2706	+	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		762			Cytoplasmic (Potential).|Protein kinase.		B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	ENST00000368680.3	37	c.2285C>A	CCDS1051.1	.	.	.	.	.	.	.	.	.	.	C	9.917	1.211164	0.22289	.	.	ENSG00000169418	ENST00000368680;ENST00000428723	D	0.83419	-1.72	4.02	4.02	0.46733	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.435918	0.23678	N	0.045656	D	0.82416	0.5032	M	0.88031	2.925	0.80722	D	1	B;P	0.40660	0.029;0.726	B;P	0.49665	0.114;0.618	T	0.80841	-0.1202	10	0.18276	T	0.48	.	7.7847	0.29085	0.0:0.8875:0.0:0.1125	.	241;762	B7Z4Y7;P16066	.;ANPRA_HUMAN	H	762;241	ENSP00000357669:P762H	ENSP00000357669:P762H	P	+	2	0	NPR1	151927189	0.000000	0.05858	1.000000	0.80357	0.982000	0.71751	-0.307000	0.08167	2.262000	0.75019	0.455000	0.32223	CCC		0.667	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906		35	60	1	0	2.09667e-21	0.017118	3.05036e-21	35	60				
UBAP2L	9898	broad.mit.edu	37	1	154224114	154224114	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:154224114A>G	ENST00000361546.2	+	13	1691	c.1649A>G	c.(1648-1650)tAt>tGt	p.Y550C	UBAP2L_ENST00000343815.6_Missense_Mutation_p.Y550C|AL590431.1_ENST00000517008.1_RNA|UBAP2L_ENST00000428931.1_Missense_Mutation_p.Y550C|UBAP2L_ENST00000271877.7_Missense_Mutation_p.Y561C			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	550					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)	p.Y550C(2)|p.Y46C(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AGTAGCCTGTATACCAGCACG	0.478																																							uc001fep.3		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|central_nervous_system(1)	2						c.(1648-1650)TAT>TGT		ubiquitin associated protein 2-like isoform a							76.0	78.0	77.0					1																	154224114		2203	4300	6503	SO:0001583	missense	9898				binding of sperm to zona pellucida		protein binding	g.chr1:154224114A>G	BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1649A>G	1.37:g.154224114A>G	ENSP00000355343:p.Tyr550Cys		Somatic				UBAP2L_uc009wot.2_Missense_Mutation_p.Y550C|UBAP2L_uc010pek.1_Missense_Mutation_p.Y542C|UBAP2L_uc010pel.1_Missense_Mutation_p.Y560C|UBAP2L_uc010pen.1_Missense_Mutation_p.Y464C	p.Y550C	NM_014847	NP_055662	WXS	Illumina HiSeq	Unspecified	Q14157	UBP2L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		14	1816	+	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		550					B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	37	c.1649A>G	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	A	19.65	3.867447	0.72065	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546	T;T;T;T	0.14391	2.51;2.51;2.52;2.51	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.24586	0.0596	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999	D;D;D;D;D	0.85130	0.99;0.997;0.996;0.996;0.994	T	0.01108	-1.1449	10	0.72032	D	0.01	-5.6613	14.3214	0.66489	1.0:0.0:0.0:0.0	.	464;561;543;550;550	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	C	550;550;46;46;561;550	ENSP00000345308:Y550C;ENSP00000389445:Y550C;ENSP00000271877:Y561C;ENSP00000355343:Y550C	ENSP00000271877:Y561C	Y	+	2	0	UBAP2L	152490738	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.484000	0.73621	2.224000	0.72417	0.529000	0.55759	TAT		0.478	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847		3	130	0	0	0	0.009096	0	3	130				
ASH1L	55870	broad.mit.edu	37	1	155451984	155451984	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:155451984G>A	ENST00000368346.3	-	3	1316	c.677C>T	c.(676-678)aCc>aTc	p.T226I	ASH1L_ENST00000548830.1_3'UTR|ASH1L_ENST00000392403.3_Missense_Mutation_p.T226I			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	226					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.T226I(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AGGAGGACAGGTAGCAATCAG	0.448																																							uc009wqq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11						c.(676-678)ACC>ATC		absent, small, or homeotic 1-like							115.0	109.0	111.0					1																	155451984		2203	4300	6503	SO:0001583	missense	55870				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr1:155451984G>A	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.677C>T	1.37:g.155451984G>A	ENSP00000357330:p.Thr226Ile		Somatic				ASH1L_uc001fkt.2_Missense_Mutation_p.T226I|ASH1L_uc009wqr.1_Missense_Mutation_p.T226I	p.T226I	NM_018489	NP_060959	WXS	Illumina HiSeq	Unspecified	Q9NR48	ASH1L_HUMAN	Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)		3	1157	-	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		226					Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37	c.677C>T		.	.	.	.	.	.	.	.	.	.	G	18.16	3.561470	0.65538	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.92595	-3.07;-3.07	4.74	4.74	0.60224	.	0.000000	0.64402	D	0.000002	D	0.90724	0.7089	N	0.14661	0.345	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.78314	0.981;0.991	D	0.92808	0.6262	10	0.59425	D	0.04	.	17.5113	0.87761	0.0:0.0:1.0:0.0	.	226;226	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	I	226	ENSP00000357330:T226I;ENSP00000376204:T226I	ENSP00000357330:T226I	T	-	2	0	ASH1L	153718608	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.653000	0.67967	2.475000	0.83589	0.563000	0.77884	ACC		0.448	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489		50	115	0	0	0	0.01441	0	50	115				
GON4L	54856	broad.mit.edu	37	1	155717352	155717352	+	IGR	SNP	A	A	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:155717352A>C	ENST00000368331.1	-	0	7640				MSTO1_ENST00000452804.2_Splice_Site|MSTO1_ENST00000538143.1_Splice_Site	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.?(1)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TACTTGTGGCAGGGAAGCAGG	0.547																																							uc010pgn.1		NA																	1	Unknown(1)		lung(1)		0						c.e7-2		misato																																				SO:0001628	intergenic_variant	100129405							g.chr1:155717352A>C	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106		1.37:g.155717352A>C			Somatic				MSTO2P_uc010pgo.1_Splice_Site_p.G187_splice|MSTO2P_uc010pgp.1_Splice_Site	p.G187_splice	NM_018116	NP_060586	WXS	Illumina HiSeq	Unspecified					7	572	+								B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Splice_Site	SNP	ENST00000368331.1	37	c.561_splice		.	.	.	.	.	.	.	.	.	.	A	17.63	3.438412	0.62955	.	.	ENSG00000125459	ENST00000452804	.	.	.	4.05	4.05	0.47172	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4638	0.50225	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MSTO1	153983976	1.000000	0.71417	0.741000	0.31004	0.887000	0.51463	8.154000	0.89641	1.711000	0.51337	0.369000	0.22263	.		0.547	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292		5	25	0	0	0	0.00308	0	5	25				
FCRL3	115352	broad.mit.edu	37	1	157667638	157667638	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:157667638C>G	ENST00000368184.3	-	5	661	c.370G>C	c.(370-372)Gac>Cac	p.D124H	FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Missense_Mutation_p.D124H|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	124	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D124H(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					TTTTTGTTGTCTTTCCCCTGA	0.423																																							uc001frb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(370-372)GAC>CAC		Fc receptor-like 3 precursor							141.0	131.0	135.0					1																	157667638		2203	4300	6503	SO:0001583	missense	115352					integral to membrane|plasma membrane	receptor activity	g.chr1:157667638C>G	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.370G>C	1.37:g.157667638C>G	ENSP00000357167:p.Asp124His		Somatic				FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Missense_Mutation_p.D124H|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_5'UTR|FCRL3_uc001frc.1_Missense_Mutation_p.D124H	p.D124H	NM_052939	NP_443171	WXS	Illumina HiSeq	Unspecified	Q96P31	FCRL3_HUMAN			5	662	-	all_hematologic(112;0.0378)		124			Ig-like C2-type 2.|Extracellular (Potential).		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	ENST00000368184.3	37	c.370G>C	CCDS1167.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.593315	0.46214	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.13089	2.62;2.62	5.41	-9.82	0.00484	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.06142	0.0159	N	0.22421	0.69	0.09310	N	1	B;B	0.34264	0.446;0.392	P;B	0.50314	0.637;0.382	T	0.50659	-0.8802	9	0.51188	T	0.08	.	11.8472	0.52391	0.0969:0.1425:0.0:0.7607	.	124;124	Q96P31;Q96P31-6	FCRL3_HUMAN;.	H	124	ENSP00000357169:D124H;ENSP00000357167:D124H	ENSP00000292392:D124H	D	-	1	0	FCRL3	155934262	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.438000	0.02416	-1.404000	0.02050	-0.367000	0.07326	GAC		0.423	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939		96	58	0	0	0	0.01441	0	96	58				
OR10K2	391107	broad.mit.edu	37	1	158390049	158390049	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:158390049C>A	ENST00000314902.2	-	1	607	c.608G>T	c.(607-609)tGt>tTt	p.C203F		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C203F(1)		NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					GACCAATGTACAGAGCATGAA	0.453																																							uc010pii.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(607-609)TGT>TTT		olfactory receptor, family 10, subfamily K,							145.0	130.0	135.0					1																	158390049		2203	4300	6503	SO:0001583	missense	391107				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158390049C>A	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.608G>T	1.37:g.158390049C>A	ENSP00000324251:p.Cys203Phe		Somatic					p.C203F	NM_001004476	NP_001004476	WXS	Illumina HiSeq	Unspecified	Q6IF99	O10K2_HUMAN			1	608	-	all_hematologic(112;0.0378)		203			Helical; Name=5; (Potential).			Missense_Mutation	SNP	ENST00000314902.2	37	c.608G>T	CCDS30896.1	.	.	.	.	.	.	.	.	.	.	c	9.732	1.162608	0.21538	.	.	ENSG00000180708	ENST00000314902	T	0.33654	1.4	4.13	4.13	0.48395	GPCR, rhodopsin-like superfamily (1);	0.270973	0.26723	N	0.022836	T	0.32763	0.0840	L	0.50919	1.6	0.18873	N	0.999989	P	0.48764	0.915	P	0.51895	0.683	T	0.07635	-1.0762	10	0.72032	D	0.01	.	15.662	0.77193	0.0:1.0:0.0:0.0	.	203	Q6IF99	O10K2_HUMAN	F	203	ENSP00000324251:C203F	ENSP00000324251:C203F	C	-	2	0	OR10K2	156656673	0.000000	0.05858	0.496000	0.27539	0.022000	0.10575	0.242000	0.18087	2.285000	0.76669	0.461000	0.40582	TGT		0.453	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476		37	73	1	0	1.26612e-14	0.015359	1.71684e-14	37	73				
OR6K2	81448	broad.mit.edu	37	1	158670076	158670076	+	Missense_Mutation	SNP	G	G	T	rs371952569	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:158670076G>T	ENST00000359610.2	-	1	410	c.367C>A	c.(367-369)Ctg>Atg	p.L123M		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L123M(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					CATATGGCCAGGTAGTGGTCA	0.473																																							uc001fsu.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(367-369)CTG>ATG		olfactory receptor, family 6, subfamily K,							115.0	106.0	109.0					1																	158670076		2201	4300	6501	SO:0001583	missense	81448				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158670076G>T	BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.367C>A	1.37:g.158670076G>T	ENSP00000352626:p.Leu123Met		Somatic					p.L123M	NM_001005279	NP_001005279	WXS	Illumina HiSeq	Unspecified	Q8NGY2	OR6K2_HUMAN			1	367	-	all_hematologic(112;0.0378)		123			Cytoplasmic (Potential).		B9EH33|Q6IFR6	Missense_Mutation	SNP	ENST00000359610.2	37	c.367C>A	CCDS30902.1	.	.	.	.	.	.	.	.	.	.	G	11.18	1.561580	0.27915	.	.	ENSG00000196171	ENST00000359610	T	0.04551	3.6	4.7	0.327	0.15913	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30235	N	0.010100	T	0.00845	0.0028	L	0.27944	0.81	0.23795	N	0.996827	B	0.29571	0.249	B	0.25884	0.064	T	0.47686	-0.9098	10	0.48119	T	0.1	-4.0553	0.2952	0.00264	0.2735:0.142:0.2927:0.2918	.	123	Q8NGY2	OR6K2_HUMAN	M	123	ENSP00000352626:L123M	ENSP00000352626:L123M	L	-	1	2	OR6K2	156936700	0.000000	0.05858	0.996000	0.52242	0.886000	0.51366	-0.386000	0.07370	0.187000	0.20147	-0.142000	0.14014	CTG		0.473	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279		32	60	1	0	1.99505e-19	0.012213	2.82408e-19	32	60				
CD48	962	broad.mit.edu	37	1	160651121	160651121	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:160651121C>A	ENST00000368046.3	-	3	610	c.523G>T	c.(523-525)Gag>Tag	p.E175*	RP11-404F10.2_ENST00000443928.2_RNA|RP11-404F10.2_ENST00000588034.1_RNA|RP11-404F10.2_ENST00000598917.2_RNA	NM_001778.3	NP_001769.2	P09326	CD48_HUMAN	CD48 molecule	175	Ig-like C2-type 2.				blood coagulation (GO:0007596)|defense response (GO:0006952)|leukocyte migration (GO:0050900)|mast cell activation (GO:0045576)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	anchored component of plasma membrane (GO:0046658)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.E175*(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|stomach(1)	10	all_cancers(52;2.18e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			TTCTGGAGCTCCTTTGGGAAG	0.463																																							uc001fwn.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(523-525)GAG>TAG		CD48 molecule precursor							181.0	163.0	169.0					1																	160651121		2203	4300	6503	SO:0001587	stop_gained	962				blood coagulation|defense response|leukocyte migration	integral to plasma membrane|membrane raft	protein binding	g.chr1:160651121C>A	BC016182	CCDS1208.1, CCDS72955.1	1q21.3-q22	2013-01-29	2006-03-31		ENSG00000117091	ENSG00000117091		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1683	protein-coding gene	gene with protein product		109530	"""CD48 antigen (B-cell membrane protein)"", ""CD48 molecule """	BCM1		2828034	Standard	NM_001256030		Approved	BLAST, mCD48, hCD48, SLAMF2	uc001fwo.2	P09326	OTTHUMG00000024009	ENST00000368046.3:c.523G>T	1.37:g.160651121C>A	ENSP00000357025:p.Glu175*		Somatic				CD48_uc001fwo.1_Nonsense_Mutation_p.E175*	p.E175*	NM_001778	NP_001769	WXS	Illumina HiSeq	Unspecified	P09326	CD48_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0175)		3	555	-	all_cancers(52;2.18e-17)|all_hematologic(112;0.093)		175			Ig-like C2-type 2.		Q5U055|Q8MGR0	Nonsense_Mutation	SNP	ENST00000368046.3	37	c.523G>T	CCDS1208.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361500	0.41801	.	.	ENSG00000117091	ENST00000368046	.	.	.	3.33	0.265	0.15612	.	1.183960	0.05915	N	0.632437	.	.	.	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-11.4739	3.8295	0.08868	0.0:0.5607:0.2018:0.2374	.	.	.	.	X	175	.	ENSP00000357025:E175X	E	-	1	0	CD48	158917745	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.191000	0.03055	0.064000	0.16427	0.655000	0.94253	GAG		0.463	CD48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060471.1	NM_001778		69	145	1	0	1.08321e-29	0.01441	1.69986e-29	69	145				
USP21	27005	broad.mit.edu	37	1	161132420	161132420	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:161132420T>C	ENST00000289865.8	+	5	1018	c.797T>C	c.(796-798)aTt>aCt	p.I266T	USP21_ENST00000368002.3_Missense_Mutation_p.I266T|USP21_ENST00000368001.1_Missense_Mutation_p.I266T	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21	266	USP.				histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.I266T(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GCAGATGTGATTGGTGCCCTC	0.507																																							uc010pke.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|prostate(1)|breast(1)	5						c.(796-798)ATT>ACT		ubiquitin-specific protease 21							43.0	42.0	42.0					1																	161132420		2203	4300	6503	SO:0001583	missense	27005				histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding|NEDD8-specific protease activity|protein binding|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr1:161132420T>C	AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.797T>C	1.37:g.161132420T>C	ENSP00000289865:p.Ile266Thr		Somatic				USP21_uc010pkc.1_Missense_Mutation_p.I266T|USP21_uc010pkd.1_Missense_Mutation_p.I266T|USP21_uc010pkf.1_Missense_Mutation_p.I266T	p.I266T	NM_001014443	NP_001014443	WXS	Illumina HiSeq	Unspecified	Q9UK80	UBP21_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00275)		6	1174	+	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		266					Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Missense_Mutation	SNP	ENST00000289865.8	37	c.797T>C	CCDS30920.1	.	.	.	.	.	.	.	.	.	.	T	15.04	2.714057	0.48622	.	.	ENSG00000143258	ENST00000368002;ENST00000289865;ENST00000368001	T;T;T	0.34072	1.38;1.38;1.38	5.05	5.05	0.67936	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.243632	0.35207	N	0.003369	T	0.27063	0.0663	M	0.66297	2.02	0.40726	D	0.982707	B	0.26708	0.157	B	0.30316	0.114	T	0.20472	-1.0274	10	0.59425	D	0.04	.	13.9292	0.63983	0.0:0.0:0.0:1.0	.	266	Q9UK80	UBP21_HUMAN	T	266	ENSP00000356981:I266T;ENSP00000289865:I266T;ENSP00000356980:I266T	ENSP00000289865:I266T	I	+	2	0	USP21	159399044	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.941000	0.56607	2.116000	0.64780	0.454000	0.30748	ATT		0.507	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080801.1			37	19	0	0	0	0.021022	0	37	19				
SLC9C2	284525	broad.mit.edu	37	1	173478744	173478744	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:173478744G>C	ENST00000367714.3	-	24	3424	c.3002C>G	c.(3001-3003)aCt>aGt	p.T1001S	SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	1001					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.T1001S(1)									CTGATAGGCAGTACTGAGAGC	0.323																																							uc001giz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3001-3003)ACT>AGT		solute carrier family 9, member 11							34.0	34.0	34.0					1																	173478744		2203	4300	6503	SO:0001583	missense	284525				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity	g.chr1:173478744G>C	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.3002C>G	1.37:g.173478744G>C	ENSP00000356687:p.Thr1001Ser		Somatic				SLC9A11_uc009wwe.2_Missense_Mutation_p.T559S	p.T1001S	NM_178527	NP_848622	WXS	Illumina HiSeq	Unspecified	Q5TAH2	S9A11_HUMAN			24	3425	-			1001					Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	c.3002C>G	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	G	7.263	0.605593	0.14002	.	.	ENSG00000162753	ENST00000367714	T	0.04360	3.64	5.64	-3.09	0.05331	.	0.607740	0.15229	N	0.273525	T	0.00784	0.0026	N	0.08118	0	0.09310	N	1	B	0.33379	0.41	B	0.26614	0.071	T	0.41893	-0.9483	10	0.72032	D	0.01	-6.395	11.2052	0.48765	0.4827:0.0:0.5173:0.0	.	1001	Q5TAH2	S9A11_HUMAN	S	1001	ENSP00000356687:T1001S	ENSP00000356687:T1001S	T	-	2	0	SLC9A11	171745367	0.002000	0.14202	0.004000	0.12327	0.111000	0.19643	-0.519000	0.06260	-0.909000	0.03852	-0.136000	0.14681	ACT		0.323	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527		10	15	0	0	0	0.010729	0	10	15				
PRG4	10216	broad.mit.edu	37	1	186276565	186276565	+	Missense_Mutation	SNP	A	A	G	rs558640103	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:186276565A>G	ENST00000445192.2	+	7	1759	c.1714A>G	c.(1714-1716)Acc>Gcc	p.T572A	PRG4_ENST00000367483.4_Missense_Mutation_p.T531A|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Missense_Mutation_p.T529A|PRG4_ENST00000367485.4_Missense_Mutation_p.T479A	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	572	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.T572A(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						TGCACCCACCACCCCCAAGAA	0.642													-|||	2	0.000399361	0.0008	0.0	5008	,	,		7951	0.0		0.001	False		,,,				2504	0.0						uc001gru.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1714-1716)ACC>GCC		proteoglycan 4 isoform A							99.0	99.0	99.0					1																	186276565		2203	4297	6500	SO:0001583	missense	10216				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity	g.chr1:186276565A>G	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1714A>G	1.37:g.186276565A>G	ENSP00000399679:p.Thr572Ala		Somatic				PRG4_uc001grt.3_Missense_Mutation_p.T531A|PRG4_uc009wyl.2_Missense_Mutation_p.T479A|PRG4_uc009wym.2_Missense_Mutation_p.T438A|PRG4_uc010poo.1_Intron	p.T572A	NM_005807	NP_005798	WXS	Illumina HiSeq	Unspecified	Q92954	PRG4_HUMAN			7	1765	+			572			59 X 8 AA repeats of K-X-P-X-P-T-T-X.|29.		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	c.1714A>G	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	a	6.012	0.370698	0.11409	.	.	ENSG00000116690	ENST00000367486;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T	0.05513	3.43;3.54;3.44;3.54	3.96	1.21	0.21127	.	.	.	.	.	T	0.06096	0.0158	L	0.49126	1.545	0.09310	N	1	B;B;B;B	0.18013	0.025;0.025;0.015;0.025	B;B;B;B	0.19666	0.026;0.026;0.011;0.026	T	0.42292	-0.9460	8	.	.	.	.	3.8704	0.09035	0.6441:0.2029:0.1531:0.0	.	438;479;572;531	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	A	529;438;531;479;572	ENSP00000356456:T529A;ENSP00000356453:T531A;ENSP00000356455:T479A;ENSP00000399679:T572A	.	T	+	1	0	PRG4	184543188	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.247000	0.18179	0.012000	0.14892	-0.559000	0.04183	ACC		0.642	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		3	57	0	0	0	0.001984	0	3	57				
CRB1	23418	broad.mit.edu	37	1	197403914	197403914	+	Missense_Mutation	SNP	C	C	G	rs575358595		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:197403914C>G	ENST00000367400.3	+	9	3056	c.2921C>G	c.(2920-2922)aCc>aGc	p.T974S	CRB1_ENST00000535699.1_Missense_Mutation_p.T950S|CRB1_ENST00000367399.2_Missense_Mutation_p.T862S|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367397.1_Missense_Mutation_p.T355S|CRB1_ENST00000544212.1_Missense_Mutation_p.T455S	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	974	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T974S(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						AGAGAACTCACCAATATCACA	0.333													C|||	1	0.000199681	0.0	0.0	5008	,	,		19022	0.001		0.0	False		,,,				2504	0.0						uc001gtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)	9						c.(2920-2922)ACC>AGC		crumbs homolog 1 precursor							75.0	79.0	78.0					1																	197403914		2203	4300	6503	SO:0001583	missense	23418				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding	g.chr1:197403914C>G		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2921C>G	1.37:g.197403914C>G	ENSP00000356370:p.Thr974Ser		Somatic				CRB1_uc010poz.1_Missense_Mutation_p.T950S|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.T862S|CRB1_uc010ppb.1_Intron|CRB1_uc010ppd.1_Missense_Mutation_p.T455S|CRB1_uc001gub.1_Missense_Mutation_p.T623S	p.T974S	NM_201253	NP_957705	WXS	Illumina HiSeq	Unspecified	P82279	CRUM1_HUMAN			9	3056	+			974			Extracellular (Potential).|Laminin G-like 3.		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	c.2921C>G	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301708	0.81136	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38	5.34	5.34	0.76211	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	.	.	.	.	T	0.80449	0.4625	M	0.63428	1.95	0.80722	D	1	D;D;D;D	0.89917	0.998;0.998;1.0;0.997	D;D;D;D	0.91635	0.994;0.987;0.999;0.985	T	0.78879	-0.2030	9	0.39692	T	0.17	.	19.0497	0.93038	0.0:1.0:0.0:0.0	.	950;862;623;974	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	S	950;974;862;455;355;623	ENSP00000438786:T950S;ENSP00000356370:T974S;ENSP00000356369:T862S;ENSP00000444556:T455S;ENSP00000356367:T355S	ENSP00000356367:T355S	T	+	2	0	CRB1	195670537	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.313000	0.78978	2.479000	0.83701	0.655000	0.94253	ACC		0.333	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		88	54	0	0	0	0.01441	0	88	54				
USH2A	7399	broad.mit.edu	37	1	216219863	216219863	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:216219863T>C	ENST00000307340.3	-	32	6621	c.6235A>G	c.(6235-6237)Aaa>Gaa	p.K2079E	USH2A_ENST00000366943.2_Missense_Mutation_p.K2079E	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2079	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.K2079E(2)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTTGCCTTTTTGGGTGGGTTC	0.453										HNSCC(13;0.011)																													uc001hku.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(6235-6237)AAA>GAA		usherin isoform B							108.0	93.0	98.0					1																	216219863		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216219863T>C	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6235A>G	1.37:g.216219863T>C	ENSP00000305941:p.Lys2079Glu	HNSCC(13;0.011)	Somatic					p.K2079E	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	32	6622	-			2079			Extracellular (Potential).|Fibronectin type-III 7.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.6235A>G	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	8.075	0.771109	0.16051	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.52057	0.68;0.68	5.58	-1.33	0.09172	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.281604	0.24922	N	0.034532	T	0.20740	0.0499	N	0.17674	0.51	0.09310	N	1	B	0.20887	0.049	B	0.22386	0.039	T	0.26538	-1.0100	10	0.02654	T	1	.	4.2431	0.10658	0.1186:0.0669:0.3695:0.445	.	2079	O75445	USH2A_HUMAN	E	2079	ENSP00000305941:K2079E;ENSP00000355910:K2079E	ENSP00000305941:K2079E	K	-	1	0	USH2A	214286486	0.189000	0.23263	0.654000	0.29608	0.996000	0.88848	0.330000	0.19715	-0.151000	0.11176	0.533000	0.62120	AAA		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		55	22	0	0	0	0.01441	0	55	22				
SLC30A10	55532	broad.mit.edu	37	1	220100417	220100417	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:220100417T>C	ENST00000366926.3	-	2	832	c.671A>G	c.(670-672)gAa>gGa	p.E224G	SLC30A10_ENST00000536446.1_5'UTR	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	224					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)	p.E224G(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		CATCATGTCTTCTGGCTCATT	0.378																																					Colon(76;360 1614 43677 51136)	Colon(76;360 1614 43677 51136)	uc001hlw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(670-672)GAA>GGA		solute carrier family 30 (zinc transporter),							153.0	142.0	146.0					1																	220100417		2203	4300	6503	SO:0001583	missense	55532				zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity	g.chr1:220100417T>C	AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.671A>G	1.37:g.220100417T>C	ENSP00000355893:p.Glu224Gly		Somatic				SLC30A10_uc001hlu.1_RNA|SLC30A10_uc001hlx.2_5'UTR	p.E224G	NM_018713	NP_061183	WXS	Illumina HiSeq	Unspecified	Q6XR72	ZNT10_HUMAN		GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)	2	882	-			224			Cytoplasmic (Potential).		Q49AL9|Q9NPW0	Missense_Mutation	SNP	ENST00000366926.3	37	c.671A>G	CCDS31026.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.961569	0.74016	.	.	ENSG00000196660	ENST00000366926	T	0.66280	-0.2	5.74	5.74	0.90152	.	0.288034	0.30302	N	0.009933	T	0.61035	0.2315	L	0.46670	1.46	0.80722	D	1	P	0.49185	0.92	P	0.45712	0.491	T	0.60772	-0.7197	9	.	.	.	-22.435	15.7114	0.77631	0.0:0.0:0.0:1.0	.	224	Q6XR72	ZNT10_HUMAN	G	224	ENSP00000355893:E224G	.	E	-	2	0	SLC30A10	218167040	1.000000	0.71417	0.991000	0.47740	0.916000	0.54674	5.480000	0.66820	2.193000	0.70182	0.533000	0.62120	GAA		0.378	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357709.1	NM_018713		63	43	0	0	0	0.01441	0	63	43				
FAM177B	400823	broad.mit.edu	37	1	222923317	222923317	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:222923317C>A	ENST00000445590.2	+	6	660	c.394C>A	c.(394-396)Cct>Act	p.P132T	FAM177B_ENST00000360827.2_Missense_Mutation_p.P132T	NM_207468.2	NP_997351.2	A6PVY3	F177B_HUMAN	family with sequence similarity 177, member B	132								p.P132T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	8						AGCTGAGGTTCCTAATGAAAA	0.448																																							uc001hnt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(394-396)CCT>ACT		hypothetical protein LOC400823							79.0	80.0	80.0					1																	222923317		1941	4156	6097	SO:0001583	missense	400823							g.chr1:222923317C>A	AK125494	CCDS1535.2	1q41	2008-08-08			ENSG00000197520	ENSG00000197520			34395	protein-coding gene	gene with protein product							Standard	NM_207468		Approved	RP11-452F19.2, FLJ43505	uc001hnt.3	A6PVY3	OTTHUMG00000037766	ENST00000445590.2:c.394C>A	1.37:g.222923317C>A	ENSP00000414451:p.Pro132Thr		Somatic				uc001hnr.1_Intron|FAM177B_uc009xeb.2_RNA	p.P132T	NM_207468	NP_997351	WXS	Illumina HiSeq	Unspecified	A6PVY3	F177B_HUMAN			6	660	+			132					Q6ZUN8	Missense_Mutation	SNP	ENST00000445590.2	37	c.394C>A	CCDS1535.2	.	.	.	.	.	.	.	.	.	.	c	14.64	2.596126	0.46318	.	.	ENSG00000197520	ENST00000445590;ENST00000360827	T;T	0.31769	1.48;1.48	5.16	-2.94	0.05581	.	.	.	.	.	T	0.23451	0.0567	L	0.57536	1.79	0.09310	N	1	B	0.33612	0.419	B	0.33690	0.168	T	0.27839	-1.0062	9	0.24483	T	0.36	.	5.3688	0.16129	0.0:0.2379:0.4419:0.3202	.	132	A6PVY3	F177B_HUMAN	T	132	ENSP00000414451:P132T;ENSP00000354070:P132T	ENSP00000354070:P132T	P	+	1	0	FAM177B	220989940	0.022000	0.18835	0.260000	0.24451	0.789000	0.44602	-0.010000	0.12743	-0.084000	0.12595	-0.136000	0.14681	CCT		0.448	FAM177B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092151.2	NM_207468		56	45	1	0	2.30037e-20	0.01441	3.2896e-20	56	45				
RYR2	6262	broad.mit.edu	37	1	237538083	237538083	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:237538083G>T	ENST00000366574.2	+	7	768	c.451G>T	c.(451-453)Gag>Tag	p.E151*	RYR2_ENST00000542537.1_Nonsense_Mutation_p.E135*|RYR2_ENST00000360064.6_Nonsense_Mutation_p.E149*	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	151	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.E149*(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGCTTGCAAGAGGACACCAC	0.493																																							uc001hyl.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(451-453)GAG>TAG		cardiac muscle ryanodine receptor							105.0	99.0	101.0					1																	237538083		1946	4127	6073	SO:0001587	stop_gained	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237538083G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.451G>T	1.37:g.237538083G>T	ENSP00000355533:p.Glu151*		Somatic					p.E151*	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		7	571	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	151			Cytoplasmic (By similarity).|MIR 1.		Q15411|Q546N8|Q5T3P2	Nonsense_Mutation	SNP	ENST00000366574.2	37	c.451G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	38	7.192834	0.98125	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	.	.	.	6.01	6.01	0.97437	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.2926	0.94108	0.0:0.0:1.0:0.0	.	.	.	.	X	151;149;135	.	ENSP00000353174:E149X	E	+	1	0	RYR2	235604706	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.433000	0.97501	2.861000	0.98227	0.650000	0.86243	GAG		0.493	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		19	5	1	0	2.4624e-09	0.008871	2.99056e-09	19	5				
RYR2	6262	broad.mit.edu	37	1	237580397	237580397	+	Silent	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:237580397T>A	ENST00000366574.2	+	11	1139	c.822T>A	c.(820-822)ctT>ctA	p.L274L	RYR2_ENST00000542537.1_Silent_p.L258L|RYR2_ENST00000360064.6_Silent_p.L272L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	274	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.L272L(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CACGTTCCCTTTGGAGACTAG	0.428																																							uc001hyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(820-822)CTT>CTA		cardiac muscle ryanodine receptor							127.0	120.0	122.0					1																	237580397		2036	4201	6237	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237580397T>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.822T>A	1.37:g.237580397T>A			Somatic					p.L274L	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		11	942	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	274			Cytoplasmic (By similarity).|MIR 3.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.822T>A	CCDS55691.1																																																																																				0.428	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		28	21	0	0	0	0.009535	0	28	21				
RYR2	6262	broad.mit.edu	37	1	237947531	237947531	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:237947531A>G	ENST00000366574.2	+	90	12836	c.12519A>G	c.(12517-12519)atA>atG	p.I4173M	RYR2_ENST00000542537.1_Missense_Mutation_p.I4157M|RYR2_ENST00000360064.6_Missense_Mutation_p.I4179M|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4173					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.I4171M(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GACAGTTCATATTTGACGTGG	0.502																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12517-12519)ATA>ATG		cardiac muscle ryanodine receptor							92.0	95.0	94.0					1																	237947531		1956	4166	6122	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947531A>G	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12519A>G	1.37:g.237947531A>G	ENSP00000355533:p.Ile4173Met		Somatic				RYR2_uc010pya.1_Missense_Mutation_p.I588M	p.I4173M	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	12639	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4173					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.12519A>G	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	15.55	2.868171	0.51588	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.98044	-4.68;-4.68;-4.68	5.54	-1.55	0.08558	.	0.071771	0.50627	D	0.000109	D	0.98143	0.9387	M	0.84683	2.71	0.80722	D	1	D;D	0.69078	0.96;0.997	P;D	0.66196	0.777;0.942	D	0.97412	1.0003	10	0.72032	D	0.01	.	11.2177	0.48835	0.4241:0.4792:0.0:0.0967	.	1147;4173	B4DGV4;Q92736	.;RYR2_HUMAN	M	4173;4179;4157;1147	ENSP00000355533:I4173M;ENSP00000353174:I4179M;ENSP00000443798:I4157M	ENSP00000353174:I4179M	I	+	3	3	RYR2	236014154	0.993000	0.37304	0.999000	0.59377	0.784000	0.44337	0.516000	0.22817	0.038000	0.15604	0.533000	0.62120	ATA		0.502	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		34	85	0	0	0	0.015359	0	34	85				
SDCCAG8	10806	broad.mit.edu	37	1	243542029	243542029	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:243542029G>C	ENST00000366541.3	+	13	1598	c.1480G>C	c.(1480-1482)Gag>Cag	p.E494Q	SDCCAG8_ENST00000355875.4_Missense_Mutation_p.E451Q|SDCCAG8_ENST00000343783.6_Missense_Mutation_p.E349Q	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	494	Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)		p.E494Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		TAAGGAAATAGAGAAATTGAG	0.388																																							uc001hzw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1480-1482)GAG>CAG		serologically defined colon cancer antigen 8							81.0	81.0	81.0					1																	243542029		2203	4300	6503	SO:0001583	missense	10806				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding	g.chr1:243542029G>C	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.1480G>C	1.37:g.243542029G>C	ENSP00000355499:p.Glu494Gln		Somatic				SDCCAG8_uc010pyk.1_Missense_Mutation_p.E349Q|SDCCAG8_uc010pyl.1_Missense_Mutation_p.E306Q|SDCCAG8_uc001hzx.2_Missense_Mutation_p.E306Q	p.E494Q	NM_006642	NP_006633	WXS	Illumina HiSeq	Unspecified	Q86SQ7	SDCG8_HUMAN	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)	13	1636	+	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	494			Potential.|Sufficient for homodimerization (By similarity).		O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	ENST00000366541.3	37	c.1480G>C	CCDS31075.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.119328	0.56505	.	.	ENSG00000054282	ENST00000355875;ENST00000366541;ENST00000343783;ENST00000435549	T;T;T;T	0.50277	0.82;0.77;0.77;0.75	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.42200	0.1192	N	0.19112	0.55	0.44570	D	0.997538	P;P	0.45715	0.865;0.865	P;P	0.46585	0.521;0.521	T	0.10870	-1.0611	10	0.18276	T	0.48	-14.8408	19.9525	0.97208	0.0:0.0:1.0:0.0	.	451;494	E9PFS7;Q86SQ7	.;SDCG8_HUMAN	Q	451;494;349;274	ENSP00000348137:E451Q;ENSP00000355499:E494Q;ENSP00000341260:E349Q;ENSP00000410200:E274Q	ENSP00000341260:E349Q	E	+	1	0	SDCCAG8	241608652	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.310000	0.78947	2.719000	0.93026	0.655000	0.94253	GAG		0.388	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642		25	56	0	0	0	0.021523	0	25	56				
SDCCAG8	10806	broad.mit.edu	37	1	243579122	243579123	+	Missense_Mutation	DNP	GA	GA	TG			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:243579122_243579123GA>TG	ENST00000366541.3	+	14	1853_1854	c.1735_1736GA>TG	c.(1735-1737)GAc>TGc	p.D579C	SDCCAG8_ENST00000355875.4_Missense_Mutation_p.D536C|SDCCAG8_ENST00000343783.6_Missense_Mutation_p.D434C	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	579	Gln-rich.|Mediates interaction with OFD1.|Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)		p.D579C(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		GGCCCAGCATGACAAAACTGGT	0.52																																							uc001hzw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1735-1737)GAC>TGC		serologically defined colon cancer antigen 8																																				SO:0001583	missense	10806				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding	g.chr1:243579122_243579123GA>TG	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	Exception_encountered	1.37:g.243579122_243579123delinsTG	ENSP00000355499:p.Asp579Cys		Somatic				SDCCAG8_uc010pyk.1_Missense_Mutation_p.D434C|SDCCAG8_uc010pyl.1_Missense_Mutation_p.D391C|SDCCAG8_uc001hzx.2_Intron	p.D579C	NM_006642	NP_006633	WXS	Illumina HiSeq	Unspecified	Q86SQ7	SDCG8_HUMAN	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)	14	1891_1892	+	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	579			Mediates interaction with OFD1.|Gln-rich.|Potential.|Sufficient for homodimerization (By similarity).		O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	DNP	ENST00000366541.3	37	c.1735_1736GA>TG	CCDS31075.1																																																																																				0.520	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642		5	11	0	0	0	0.004672	0	5	11				
OR2L2	26246	broad.mit.edu	37	1	248201826	248201826	+	Missense_Mutation	SNP	A	A	G	rs375068162		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:248201826A>G	ENST00000366479.2	+	1	353	c.257A>G	c.(256-258)tAt>tGt	p.Y86C	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y86C(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			gattttctgtatggaaacaag	0.418																																							uc001idw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(256-258)TAT>TGT		olfactory receptor, family 2, subfamily L,		A	,CYS/TYR	0,4406		0,0,2203	199.0	182.0	188.0		,257	-3.2	0.2	1		188	1,8599		0,1,4299	no	intron,missense	OR2L2,OR2L13	NM_175911.2,NM_001004686.2	,194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,benign	,86/313	248201826	1,13005	2203	4300	6503	SO:0001583	missense	26246				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248201826A>G	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.257A>G	1.37:g.248201826A>G	ENSP00000355435:p.Tyr86Cys		Somatic				OR2L13_uc001ids.2_Intron	p.Y86C	NM_001004686	NP_001004686	WXS	Illumina HiSeq	Unspecified	Q8NH16	OR2L2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	353	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		86			Extracellular (Potential).		Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	c.257A>G	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	4.128	0.021949	0.08006	0.0	1.16E-4	ENSG00000203663	ENST00000366479	T	0.00397	7.57	1.9	-3.19	0.05171	GPCR, rhodopsin-like superfamily (1);	0.550760	0.13720	U	0.367440	T	0.00109	0.0003	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35549	-0.9784	10	0.39692	T	0.17	.	0.8145	0.01100	0.4242:0.1235:0.1396:0.3127	.	86	Q8NH16	OR2L2_HUMAN	C	86	ENSP00000355435:Y86C	ENSP00000355435:Y86C	Y	+	2	0	OR2L2	246268449	0.000000	0.05858	0.196000	0.23383	0.163000	0.22366	-3.396000	0.00485	-0.090000	0.12462	0.163000	0.16589	TAT		0.418	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686		105	269	0	0	0	0.01441	0	105	269				
OR2M2	391194	broad.mit.edu	37	1	248343519	248343519	+	Missense_Mutation	SNP	G	G	A	rs143926960		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:248343519G>A	ENST00000359682.2	+	1	232	c.232G>A	c.(232-234)Gta>Ata	p.V78I		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V78I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTGCACCACCGTACCCAAGAT	0.507																																							uc010pzf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(232-234)GTA>ATA		olfactory receptor, family 2, subfamily M,		G	ILE/VAL	0,4406		0,0,2203	245.0	241.0	243.0		232	-0.1	0.0	1	dbSNP_134	243	1,8593	1.2+/-3.3	0,1,4296	no	missense	OR2M2	NM_001004688.1	29	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	78/348	248343519	1,12999	2203	4297	6500	SO:0001583	missense	391194				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248343519G>A	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.232G>A	1.37:g.248343519G>A	ENSP00000352710:p.Val78Ile		Somatic					p.V78I	NM_001004688	NP_001004688	WXS	Illumina HiSeq	Unspecified	Q96R28	OR2M2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	232	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		78			Helical; Name=2; (Potential).		A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	c.232G>A	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	g	6.612	0.481325	0.12581	0.0	1.16E-4	ENSG00000198601	ENST00000359682	T	0.02787	4.16	2.03	-0.0877	0.13676	GPCR, rhodopsin-like superfamily (1);	0.329002	0.16682	N	0.203890	T	0.02012	0.0063	L	0.33339	1.005	0.09310	N	1	P	0.44946	0.846	B	0.36959	0.237	T	0.47169	-0.9138	10	0.54805	T	0.06	.	4.0557	0.09816	0.5278:0.1952:0.277:0.0	.	78	Q96R28	OR2M2_HUMAN	I	78	ENSP00000352710:V78I	ENSP00000352710:V78I	V	+	1	0	OR2M2	246410142	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.266000	0.02842	-0.159000	0.11021	0.454000	0.30748	GTA		0.507	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688		25	389	0	0	0	0.00632	0	25	389				
OR14C36	127066	broad.mit.edu	37	1	248512680	248512680	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:248512680C>A	ENST00000317861.1	+	1	604	c.604C>A	c.(604-606)Ctg>Atg	p.L202M		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L202M(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						TGTCTCTGCTCTGGGGGTAGG	0.483																																							uc010pzl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(604-606)CTG>ATG		olfactory receptor, family 14, subfamily C,							153.0	143.0	146.0					1																	248512680		2203	4300	6503	SO:0001583	missense	127066				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248512680C>A	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.604C>A	1.37:g.248512680C>A	ENSP00000324534:p.Leu202Met		Somatic					p.L202M	NM_001001918	NP_001001918	WXS	Illumina HiSeq	Unspecified	Q8NHC7	O14CZ_HUMAN			1	604	+			202			Helical; Name=5; (Potential).		Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	37	c.604C>A	CCDS31112.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.388152	0.42308	.	.	ENSG00000177174	ENST00000317861	T	0.40476	1.03	3.91	-3.51	0.04696	GPCR, rhodopsin-like superfamily (1);	0.687800	0.11876	N	0.520903	T	0.31949	0.0813	L	0.35341	1.055	0.09310	N	1	P	0.46142	0.873	P	0.46339	0.513	T	0.30179	-0.9987	10	0.39692	T	0.17	.	8.6938	0.34282	0.2832:0.225:0.4919:0.0	.	202	Q8NHC7	O14CZ_HUMAN	M	202	ENSP00000324534:L202M	ENSP00000324534:L202M	L	+	1	2	OR14C36	246579303	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	-1.376000	0.02561	-0.396000	0.07703	0.395000	0.25975	CTG		0.483	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918		69	48	1	0	1.48005e-37	0.01441	2.36695e-37	69	48				
OR2T2	401992	broad.mit.edu	37	1	248616203	248616203	+	Silent	SNP	C	C	A	rs528774471		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:248616203C>A	ENST00000342927.3	+	1	127	c.105C>A	c.(103-105)atC>atA	p.I35I		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I35M(1)|p.I35I(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCTTCTCCATCTTTGTGGTGG	0.532													C|||	1	0.000199681	0.0008	0.0	5008	,	,		33183	0.0		0.0	False		,,,				2504	0.0						uc001iek.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	skin(1)	1						c.(103-105)ATC>ATA		olfactory receptor, family 2, subfamily T,							200.0	219.0	213.0					1																	248616203		2203	4300	6503	SO:0001819	synonymous_variant	401992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248616203C>A	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.105C>A	1.37:g.248616203C>A			Somatic					p.I35I	NM_001004136	NP_001004136	WXS	Illumina HiSeq	Unspecified	Q6IF00	OR2T2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	105	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		35			Helical; Name=1; (Potential).		B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	c.105C>A	CCDS31116.1																																																																																				0.532	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136		24	215	1	0	1.64293e-13	0.01892	2.17845e-13	24	215				
VIM	7431	broad.mit.edu	37	10	17271973	17271973	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr10:17271973C>T	ENST00000224237.5	+	1	697	c.552C>T	c.(550-552)cgC>cgT	p.R184R	VIM-AS1_ENST00000605833.1_RNA|VIM_ENST00000544301.1_Silent_p.R184R|VIM_ENST00000485947.1_3'UTR			P08670	VIME_HUMAN	vimentin	184	Coil 1B.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)	p.R184R(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ACATCATGCGCCTCCGGGAGA	0.697																																							uc001iou.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(550-552)CGC>CGT		vimentin							15.0	16.0	16.0					10																	17271973		2180	4269	6449	SO:0001819	synonymous_variant	7431				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton	g.chr10:17271973C>T	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.552C>T	10.37:g.17271973C>T			Somatic				uc001iot.1_RNA|VIM_uc001iov.1_Silent_p.R184R|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Silent_p.R184R|VIM_uc001ioy.1_Silent_p.R184R|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Silent_p.R184R|VIM_uc001ipc.1_Silent_p.R184R	p.R184R	NM_003380	NP_003371	WXS	Illumina HiSeq	Unspecified	P08670	VIME_HUMAN			2	965	+			184			Rod.|Coil 1B.		B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Silent	SNP	ENST00000224237.5	37	c.552C>T	CCDS7120.1																																																																																				0.697	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380		7	3	0	0	0	0.001984	0	7	3				
ARMC3	219681	broad.mit.edu	37	10	23290868	23290868	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr10:23290868G>T	ENST00000298032.5	+	12	1530	c.1446G>T	c.(1444-1446)ttG>ttT	p.L482F	ARMC3_ENST00000409983.3_Missense_Mutation_p.L482F|ARMC3_ENST00000409049.3_Missense_Mutation_p.L482F|ARMC3_ENST00000376528.4_Missense_Mutation_p.L219F	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	482						extracellular vesicular exosome (GO:0070062)		p.L482F(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CTGGTGGATTGGAGCCCCTGG	0.428																																							uc001irm.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1444-1446)TTG>TTT		armadillo repeat containing 3							91.0	86.0	88.0					10																	23290868		2203	4300	6503	SO:0001583	missense	219681						binding	g.chr10:23290868G>T	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1446G>T	10.37:g.23290868G>T	ENSP00000298032:p.Leu482Phe		Somatic				ARMC3_uc010qcv.1_Missense_Mutation_p.L482F|ARMC3_uc010qcw.1_Missense_Mutation_p.L219F	p.L482F	NM_173081	NP_775104	WXS	Illumina HiSeq	Unspecified	Q5W041	ARMC3_HUMAN			12	1529	+			482			ARM 12.		A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	c.1446G>T	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.254186	0.39896	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049;ENST00000376528	T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76	5.91	4.94	0.65067	Armadillo-like helical (1);Armadillo-type fold (1);	0.085413	0.53938	D	0.000047	D	0.86146	0.5863	M	0.79475	2.455	0.53005	D	0.999963	D;D	0.89917	0.999;1.0	D;D	0.97110	0.994;1.0	D	0.87302	0.2306	10	0.72032	D	0.01	-13.2811	16.4409	0.83901	0.0:0.0:0.8167:0.1832	.	482;482	Q5W041-4;Q5W041	.;ARMC3_HUMAN	F	482;482;418;482;219	ENSP00000298032:L482F;ENSP00000386943:L482F;ENSP00000387288:L482F;ENSP00000365711:L219F	ENSP00000298032:L482F	L	+	3	2	ARMC3	23330874	1.000000	0.71417	0.997000	0.53966	0.090000	0.18270	1.329000	0.33770	2.796000	0.96246	0.655000	0.94253	TTG		0.428	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081		15	4	1	0	6.31663e-08	0.003163	7.37233e-08	15	4				
APBB1IP	54518	broad.mit.edu	37	10	26789819	26789819	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr10:26789819G>T	ENST00000376236.4	+	5	687	c.232G>T	c.(232-234)Gct>Tct	p.A78S	APBB1IP_ENST00000356785.4_Missense_Mutation_p.A78S	NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	78					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)		p.A78S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						CATAAGTGAGGCTGAGCAGAG	0.438																																							uc001iss.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|skin(2)|central_nervous_system(1)	7						c.(232-234)GCT>TCT		amyloid beta (A4) precursor protein-binding,							124.0	113.0	117.0					10																	26789819		2203	4300	6503	SO:0001583	missense	54518				blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium		g.chr10:26789819G>T	AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.232G>T	10.37:g.26789819G>T	ENSP00000365411:p.Ala78Ser		Somatic				APBB1IP_uc001isr.2_Missense_Mutation_p.A78S|APBB1IP_uc009xks.1_Missense_Mutation_p.A78S	p.A78S	NM_019043	NP_061916	WXS	Illumina HiSeq	Unspecified	Q7Z5R6	AB1IP_HUMAN			5	553	+			78					Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	ENST00000376236.4	37	c.232G>T	CCDS31167.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406525	0.83230	.	.	ENSG00000077420	ENST00000445780;ENST00000376236;ENST00000356785	T	0.32515	1.45	5.84	5.84	0.93424	.	0.189502	0.56097	D	0.000030	T	0.49081	0.1536	L	0.44542	1.39	0.38863	D	0.956529	D;D;D	0.69078	0.995;0.991;0.997	D;P;D	0.68353	0.911;0.732;0.957	T	0.44605	-0.9317	10	0.56958	D	0.05	.	18.3198	0.90234	0.0:0.0:1.0:0.0	.	78;78;78	B4E100;Q7Z5R6;Q8IYL7	.;AB1IP_HUMAN;.	S	78	ENSP00000365411:A78S	ENSP00000349237:A78S	A	+	1	0	APBB1IP	26829825	1.000000	0.71417	0.997000	0.53966	0.682000	0.39822	5.505000	0.66981	2.759000	0.94783	0.563000	0.77884	GCT		0.438	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047270.1	NM_019043		35	40	1	0	6.53348e-20	0.017118	9.27975e-20	35	40				
NRG3	10718	broad.mit.edu	37	10	84498383	84498383	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr10:84498383C>G	ENST00000404547.1	+	3	1004	c.1004C>G	c.(1003-1005)aCt>aGt	p.T335S	NRG3_ENST00000372141.2_Missense_Mutation_p.T335S|NRG3_ENST00000404576.2_Missense_Mutation_p.T139S|NRG3_ENST00000556918.1_Missense_Mutation_p.T165S|NRG3_ENST00000372142.2_Missense_Mutation_p.T114S			P56975	NRG3_HUMAN	neuregulin 3	335					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.T114S(1)|p.T335S(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CTGCCGAAAACTGATTCCATC	0.408																																							uc001kco.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(5)|breast(1)	6						c.(1003-1005)ACT>AGT		neuregulin 3 isoform 1							158.0	140.0	146.0					10																	84498383		2203	4300	6503	SO:0001583	missense	10718				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity	g.chr10:84498383C>G	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1004C>G	10.37:g.84498383C>G	ENSP00000384796:p.Thr335Ser		Somatic				NRG3_uc010qlz.1_Missense_Mutation_p.T335S|NRG3_uc001kcp.2_Missense_Mutation_p.T114S|NRG3_uc001kcq.2_5'UTR	p.T335S	NM_001010848	NP_001010848	WXS	Illumina HiSeq	Unspecified	P56975	NRG3_HUMAN		GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)	3	1031	+			335			Extracellular (Potential).		A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	37	c.1004C>G	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461092	0.63513	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918	T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36	5.84	5.84	0.93424	.	0.267807	0.30911	N	0.008621	T	0.45915	0.1366	L	0.27053	0.805	0.80722	D	1	P;D;D	0.71674	0.728;0.998;0.998	P;D;D	0.80764	0.706;0.994;0.994	T	0.13548	-1.0505	10	0.13853	T	0.58	-16.053	17.6318	0.88111	0.0:1.0:0.0:0.0	.	335;114;335	B9EGV5;P56975-3;P56975-4	.;.;.	S	335;335;335;114;139;165	ENSP00000361214:T335S;ENSP00000384796:T335S;ENSP00000361215:T114S;ENSP00000385804:T139S;ENSP00000451376:T165S	ENSP00000361214:T335S	T	+	2	0	NRG3	84488363	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.296000	0.78790	2.779000	0.95612	0.655000	0.94253	ACT		0.408	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086		52	8	0	0	0	0.01441	0	52	8				
CCSER2	54462	broad.mit.edu	37	10	86131530	86131530	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr10:86131530C>A	ENST00000224756.8	+	2	907	c.722C>A	c.(721-723)tCa>tAa	p.S241*	CCSER2_ENST00000359979.4_Nonsense_Mutation_p.S241*|CCSER2_ENST00000372088.2_Nonsense_Mutation_p.S241*	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	241					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)		p.S241*(1)									ATAACCAGATCACATTCCTTT	0.363																																							uc001kdh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|skin(1)	4						c.(721-723)TCA>TAA		granule cell antiserum positive 14							71.0	72.0	71.0					10																	86131530		2203	4300	6503	SO:0001587	stop_gained	54462							g.chr10:86131530C>A		CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.722C>A	10.37:g.86131530C>A	ENSP00000224756:p.Ser241*		Somatic				FAM190B_uc001kdg.1_Nonsense_Mutation_p.S241*|FAM190B_uc010qmd.1_Nonsense_Mutation_p.S241*	p.S241*	NM_018999	NP_061872	WXS	Illumina HiSeq	Unspecified	Q9H7U1	F190B_HUMAN			2	916	+			241					B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Nonsense_Mutation	SNP	ENST00000224756.8	37	c.722C>A	CCDS31235.1	.	.	.	.	.	.	.	.	.	.	C	37	6.215017	0.97385	.	.	ENSG00000107771	ENST00000359979;ENST00000224756;ENST00000372088	.	.	.	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.351	17.7874	0.88542	0.0:1.0:0.0:0.0	.	.	.	.	X	241	.	ENSP00000224756:S241X	S	+	2	0	FAM190B	86121510	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.100000	0.76989	2.801000	0.96364	0.655000	0.94253	TCA		0.363	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049132.2	NM_018999		16	62	1	0	2.23348e-06	0.004007	2.50222e-06	16	62				
WAPAL	23063	broad.mit.edu	37	10	88221029	88221029	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr10:88221029T>A	ENST00000298767.5	-	10	2858	c.2386A>T	c.(2386-2388)Atg>Ttg	p.M796L	WAPAL_ENST00000372075.1_Missense_Mutation_p.M63L|WAPAL_ENST00000263070.7_Missense_Mutation_p.M63L	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	796	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)		p.M796L(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						AATGTCTCCATAGCTAAATGC	0.348																																							uc001kdo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2386-2388)ATG>TTG		wings apart-like homolog							76.0	78.0	78.0					10																	88221029		2203	4300	6503	SO:0001583	missense	23063				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding	g.chr10:88221029T>A	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.2386A>T	10.37:g.88221029T>A	ENSP00000298767:p.Met796Leu		Somatic				WAPAL_uc009xsv.2_Missense_Mutation_p.M110L|WAPAL_uc001kdn.2_Missense_Mutation_p.M833L|WAPAL_uc009xsw.2_Missense_Mutation_p.M790L	p.M796L	NM_015045	NP_055860	WXS	Illumina HiSeq	Unspecified	Q7Z5K2	WAPL_HUMAN			10	2828	-			796			WAPL.		A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	c.2386A>T	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.076788	0.55753	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076;ENST00000372075;ENST00000263070	T	0.38401	1.14	5.59	4.44	0.53790	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.32823	0.0842	L	0.46947	1.48	0.80722	D	1	B;B;B;B	0.31519	0.001;0.327;0.001;0.001	B;B;B;B	0.33254	0.002;0.16;0.002;0.003	T	0.04961	-1.0915	10	0.31617	T	0.26	.	12.8182	0.57677	0.0:0.0:0.1367:0.8633	.	790;834;796;833	B2RTX8;E9PH12;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	L	881;796;881;63;63	ENSP00000298767:M796L	ENSP00000263070:M63L	M	-	1	0	WAPAL	88211009	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	0.939000	0.37446	0.533000	0.62120	ATG		0.348	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045		53	5	0	0	0	0.01441	0	53	5				
DMBT1	1755	broad.mit.edu	37	10	124358481	124358481	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr10:124358481C>A	ENST00000338354.3	+	26	3254	c.3148C>A	c.(3148-3150)Cag>Aag	p.Q1050K	DMBT1_ENST00000368955.3_Missense_Mutation_p.Q1040K|DMBT1_ENST00000330163.4_Missense_Mutation_p.Q551K|DMBT1_ENST00000368909.3_Missense_Mutation_p.Q1050K|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368956.2_Missense_Mutation_p.Q551K|DMBT1_ENST00000344338.3_Missense_Mutation_p.Q1040K			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1050	SRCR 8. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.Q1050K(3)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CCGGTTTGGTCAGGGCTCAGG	0.602																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(7)	7						c.(3148-3150)CAG>AAG		deleted in malignant brain tumors 1 isoform b							166.0	163.0	164.0					10																	124358481		2001	4175	6176	SO:0001583	missense	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124358481C>A		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.3148C>A	10.37:g.124358481C>A	ENSP00000342210:p.Gln1050Lys		Somatic				DMBT1_uc001lgl.1_Missense_Mutation_p.Q1040K|DMBT1_uc001lgm.1_Missense_Mutation_p.Q551K|DMBT1_uc009xzz.1_Missense_Mutation_p.Q1050K|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yab.1_Missense_Mutation_p.Q11K	p.Q1050K	NM_007329	NP_015568	WXS	Illumina HiSeq	Unspecified	Q9UGM3	DMBT1_HUMAN			26	3254	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	1050			SRCR 8.		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37	c.3148C>A		.	.	.	.	.	.	.	.	.	.	C	12.42	1.931700	0.34096	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956	T;T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18;0.18	3.57	3.57	0.40892	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.807279	0.10222	U	0.700817	T	0.71022	0.3291	M	0.69185	2.1	0.80722	D	1	B;B;D;P;P	0.61080	0.286;0.314;0.989;0.701;0.746	B;B;D;B;B	0.71184	0.116;0.126;0.972;0.216;0.322	T	0.63287	-0.6671	10	0.23891	T	0.37	.	10.9588	0.47372	0.1872:0.8128:0.0:0.0	.	557;1050;551;1040;1050	Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	K	1050;1050;1050;1050;1050;1050;551;1040;551;551;1050;1040;551	ENSP00000342210:Q1050K;ENSP00000343175:Q1040K;ENSP00000327747:Q551K;ENSP00000357905:Q1050K;ENSP00000357951:Q1040K;ENSP00000357952:Q551K	ENSP00000331522:Q551K	Q	+	1	0	DMBT1	124348471	0.000000	0.05858	0.392000	0.26245	0.071000	0.16799	-0.064000	0.11636	1.716000	0.51395	0.558000	0.71614	CAG		0.602	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		118	14	1	0	1.16775e-40	0.01441	1.88187e-40	118	14				
LOC399815	399815	broad.mit.edu	37	10	124647838	124647838	+	RNA	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr10:124647838C>G	ENST00000425266.1	+	0	0																											ATGCTGGATACAAGCAAATGA	0.393																																							uc001lgu.3		NA																	0					0						c.(205-207)TAC>TAG		RecName: Full=Putative uncharacterized C10orf88-like protein;																																						399815							g.chr10:124647838C>G																													10.37:g.124647838C>G			Somatic				LOC399815_uc010qua.1_Nonsense_Mutation_p.Y31*	p.Y69*			WXS	Illumina HiSeq	Unspecified					7	1105	+									Nonsense_Mutation	SNP	ENST00000425266.1	37	c.207C>G																																																																																					0.393	RP11-564D11.3-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000331659.1			22	5	0	0	0	0.01892	0	22	5				
ADAM12	8038	broad.mit.edu	37	10	127755307	127755307	+	Silent	SNP	C	C	A	rs374002137		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr10:127755307C>A	ENST00000368679.4	-	13	1710	c.1401G>T	c.(1399-1401)ggG>ggT	p.G467G	ADAM12_ENST00000368676.4_Silent_p.G467G|ADAM12_ENST00000467145.1_5'UTR	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	467	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.G467G(3)		biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CACAGCACAGCCCATGTGCGC	0.562																																							uc001ljk.2		NA																	3	Substitution - coding silent(3)		lung(3)	breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9						c.(1399-1401)GGG>GGT		ADAM metallopeptidase domain 12 isoform 1							91.0	80.0	84.0					10																	127755307		2203	4300	6503	SO:0001819	synonymous_variant	8038				cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding	g.chr10:127755307C>A	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1401G>T	10.37:g.127755307C>A			Somatic				ADAM12_uc010qul.1_Silent_p.G418G|ADAM12_uc001ljm.2_Silent_p.G467G|ADAM12_uc001ljn.2_Silent_p.G464G|ADAM12_uc001ljl.3_Silent_p.G464G	p.G467G	NM_003474	NP_003465	WXS	Illumina HiSeq	Unspecified	O43184	ADA12_HUMAN		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)	13	1814	-		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)	467			Extracellular (Potential).|Disintegrin.		O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Silent	SNP	ENST00000368679.4	37	c.1401G>T	CCDS7653.1																																																																																				0.562	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1			11	23	1	0	6.40141e-05	0.010729	6.89509e-05	11	23				
PPP2R2D	55844	broad.mit.edu	37	10	133758916	133758916	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr10:133758916G>A	ENST00000422256.2	+	4	577	c.92G>A	c.(91-93)cGc>cAc	p.R31H	PPP2R2D_ENST00000470416.1_3'UTR			Q66LE6	2ABD_HUMAN	protein phosphatase 2, regulatory subunit B, delta	258					exit from mitosis (GO:0010458)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.R227H(1)|p.R31H(1)		endometrium(3)|large_intestine(3)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13		all_cancers(35;2.16e-12)|all_epithelial(44;2.77e-09)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Colorectal(31;0.0124)|Breast(234;0.023)|all_neural(114;0.0299)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.86e-05)|Epithelial(32;8.82e-05)|all cancers(32;0.000106)|BRCA - Breast invasive adenocarcinoma(275;0.21)		GGGACCATCCGCCTGTGTGAC	0.582																																							uc001lks.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(673-675)CGC>CAC		protein phosphatase 2, regulatory subunit B,							118.0	124.0	122.0					10																	133758916		2202	4300	6502	SO:0001583	missense	55844				cell division|exit from mitosis|mitosis|signal transduction	cytoplasm|protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity	g.chr10:133758916G>A	AF220046	CCDS73224.1	10q26.3	2013-01-10	2010-06-18		ENSG00000175470	ENSG00000175470		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	23732	protein-coding gene	gene with protein product	"""PP2A subunit B isoform delta"""	613992	"""protein phosphatase 2, regulatory subunit B, delta isoform"""			10819331	Standard	XM_005277927		Approved	MDS026	uc001lks.3	Q66LE6	OTTHUMG00000019277	ENST00000422256.2:c.92G>A	10.37:g.133758916G>A	ENSP00000406501:p.Arg31His		Somatic				PPP2R2D_uc001lkr.2_Missense_Mutation_p.R31H|PPP2R2D_uc001lkt.2_Missense_Mutation_p.R31H|PPP2R2D_uc009yay.2_Missense_Mutation_p.R93H	p.R225H	NM_018461	NP_060931	WXS	Illumina HiSeq	Unspecified	Q66LE6	2ABD_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;7.86e-05)|Epithelial(32;8.82e-05)|all cancers(32;0.000106)|BRCA - Breast invasive adenocarcinoma(275;0.21)	5	917	+		all_cancers(35;2.16e-12)|all_epithelial(44;2.77e-09)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Colorectal(31;0.0124)|Breast(234;0.023)|all_neural(114;0.0299)|Melanoma(40;0.123)|Glioma(114;0.203)	258			WD 4.		A8KAK0|Q5SQJ2|Q9P1Y7	Missense_Mutation	SNP	ENST00000422256.2	37	c.674G>A		.	.	.	.	.	.	.	.	.	.	G	15.77	2.932079	0.52866	.	.	ENSG00000175470	ENST00000455566;ENST00000422256	T;T	0.32988	1.43;1.43	3.57	3.57	0.40892	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.54695	0.1874	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.64114	-0.6483	9	0.87932	D	0	-21.1785	15.3552	0.74421	0.0:0.0:1.0:0.0	.	258	Q66LE6	2ABD_HUMAN	H	227;31	ENSP00000399970:R227H;ENSP00000406501:R31H	ENSP00000406501:R31H	R	+	2	0	PPP2R2D	133608906	0.976000	0.34144	0.065000	0.19835	0.287000	0.27160	6.563000	0.73964	2.013000	0.59113	0.655000	0.94253	CGC		0.582	PPP2R2D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_018461		9	32	0	0	0	0.006214	0	9	32				
OR51F1	256892	broad.mit.edu	37	11	4790455	4790455	+	Silent	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:4790455G>A	ENST00000380383.1	-	1	713	c.714C>T	c.(712-714)gcC>gcT	p.A238A	OR51F1_ENST00000343430.3_Silent_p.A231A|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A231A(1)		kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		CTTCAGGGGAGGCAATTCTGA	0.458																																							uc010qyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(691-693)GCC>GCT		olfactory receptor, family 51, subfamily F,							119.0	112.0	115.0					11																	4790455		2201	4298	6499	SO:0001819	synonymous_variant	256892					integral to membrane	olfactory receptor activity	g.chr11:4790455G>A	BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.714C>T	11.37:g.4790455G>A			Somatic					p.A231A	NM_001004752	NP_001004752	WXS	Illumina HiSeq	Unspecified	A6NLW9	A6NLW9_HUMAN		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)	1	693	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)	231						Silent	SNP	ENST00000380383.1	37	c.693C>T																																																																																					0.458	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001004752		48	54	0	0	0	0.01441	0	48	54				
OR2D3	120775	broad.mit.edu	37	11	6942637	6942637	+	Silent	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:6942637C>A	ENST00000317834.3	+	1	433	c.405C>A	c.(403-405)tcC>tcA	p.S135S		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S135S(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CAGTGATGTCCTATGACCGGT	0.502																																							uc010rav.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(403-405)TCC>TCA		olfactory receptor, family 2, subfamily D,							164.0	152.0	156.0					11																	6942637		2201	4296	6497	SO:0001819	synonymous_variant	120775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6942637C>A	BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.405C>A	11.37:g.6942637C>A			Somatic					p.S135S	NM_001004684	NP_001004684	WXS	Illumina HiSeq	Unspecified	Q8NGH3	OR2D3_HUMAN		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	405	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	135			Helical; Name=3; (Potential).		B2RP06|Q6IFG8|Q96R51	Silent	SNP	ENST00000317834.3	37	c.405C>A	CCDS31417.1																																																																																				0.502	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385987.1	NM_001004684		29	75	1	0	7.01153e-11	0.007291	8.7176e-11	29	75				
ZNF215	7762	broad.mit.edu	37	11	6977310	6977310	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:6977310C>T	ENST00000278319.5	+	7	1690	c.1102C>T	c.(1102-1104)Cga>Tga	p.R368*	ZNF215_ENST00000414517.2_Nonsense_Mutation_p.R368*|ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000529903.1_Intron	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	368					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R368*(1)|p.R368G(1)		NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		TACAGATATTCGACACCAAAA	0.333																																							uc001mey.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		NS(1)|lung(1)		0						c.(1102-1104)CGA>TGA		zinc finger protein 215							60.0	59.0	60.0					11																	6977310		2201	4296	6497	SO:0001587	stop_gained	7762				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr11:6977310C>T	AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1102C>T	11.37:g.6977310C>T	ENSP00000278319:p.Arg368*		Somatic				ZNF215_uc010raw.1_3'UTR|ZNF215_uc010rax.1_Nonsense_Mutation_p.R130*|ZNF215_uc001mez.1_Intron	p.R368*	NM_013250	NP_037382	WXS	Illumina HiSeq	Unspecified	Q9UL58	ZN215_HUMAN		Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)	7	1690	+			368					Q96C84	Nonsense_Mutation	SNP	ENST00000278319.5	37	c.1102C>T	CCDS7775.1	.	.	.	.	.	.	.	.	.	.	C	34	5.300171	0.95574	.	.	ENSG00000149054	ENST00000278319;ENST00000414517	.	.	.	4.7	3.79	0.43588	.	1.353490	0.05258	N	0.515302	.	.	.	.	.	.	0.28246	N	0.925451	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	10.6957	0.45896	0.0:0.9043:0.0:0.0957	.	.	.	.	X	368	.	ENSP00000278319:R368X	R	+	1	2	ZNF215	6933886	0.000000	0.05858	0.011000	0.14972	0.005000	0.04900	-1.212000	0.02994	2.608000	0.88229	0.655000	0.94253	CGA		0.333	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384550.1			22	24	0	0	0	0.012319	0	22	24				
ADM	133	broad.mit.edu	37	11	10327535	10327536	+	Silent	DNP	GC	GC	TA			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:10327535_10327536GC>TA	ENST00000528655.1	+	2	755_756	c.138_139GC>TA	c.(136-141)ctGCgg>ctTAgg	p.46_47LR>LR	ADM_ENST00000534464.1_5'UTR|ADM_ENST00000526492.1_Silent_p.46_47LR>LR|ADM_ENST00000530439.1_5'UTR|ADM_ENST00000525063.1_Silent_p.46_47LR>LR|RP11-351I24.1_ENST00000526906.1_RNA|ADM_ENST00000278175.5_Silent_p.46_47LR>LR|ADM_ENST00000528544.1_Silent_p.46_47LR>LR|ADM_ENST00000524948.1_Silent_p.46_47LR>LR			P35318	ADML_HUMAN	adrenomedullin	46					aging (GO:0007568)|androgen metabolic process (GO:0008209)|blood circulation (GO:0008015)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cAMP biosynthetic process (GO:0006171)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|developmental growth (GO:0048589)|female pregnancy (GO:0007565)|G-protein coupled receptor internalization (GO:0002031)|heart development (GO:0007507)|hormone secretion (GO:0046879)|negative regulation of cell proliferation (GO:0008285)|negative regulation of vascular permeability (GO:0043116)|negative regulation of vasoconstriction (GO:0045906)|neural tube closure (GO:0001843)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of heart rate (GO:0010460)|positive regulation of vasculogenesis (GO:2001214)|positive regulation of vasodilation (GO:0045909)|progesterone biosynthetic process (GO:0006701)|receptor internalization (GO:0031623)|regulation of the force of heart contraction (GO:0002026)|response to cold (GO:0009409)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|spongiotrophoblast layer development (GO:0060712)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor binding (GO:0005102)	p.(=)(1)		central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(1)	6				all cancers(16;3.51e-65)|Epithelial(150;1.52e-62)|BRCA - Breast invasive adenocarcinoma(625;0.0257)		AGAGGGAACTGCGGATGTCCAG	0.634																																							uc001mik.1		NA																	1	Unknown(1)		lung(1)	central_nervous_system(1)	1						c.(136-141)CTGCGG>CTTAGG		adrenomedullin precursor																																				SO:0001819	synonymous_variant	133				blood circulation|cAMP biosynthetic process|female pregnancy|negative regulation of vasoconstriction|progesterone biosynthetic process|response to wounding	cytoplasm|extracellular space|soluble fraction	hormone activity	g.chr11:10327535_10327536GC>TA	D14874	CCDS7801.1	11p15.4	2013-02-25			ENSG00000148926	ENSG00000148926		"""Endogenous ligands"""	259	protein-coding gene	gene with protein product		103275				7688224	Standard	NM_001124		Approved	AM	uc001mil.1	P35318	OTTHUMG00000165907	Exception_encountered	11.37:g.10327535_10327536delinsTA			Somatic				ADM_uc001mil.1_Silent_p.46_47LR>LR|ADM_uc001mim.1_5'UTR	p.46_47LR>LR	NM_001124	NP_001115	WXS	Illumina HiSeq	Unspecified	P35318	ADML_HUMAN		all cancers(16;3.51e-65)|Epithelial(150;1.52e-62)|BRCA - Breast invasive adenocarcinoma(625;0.0257)	2	755_756	+			46_47					B2R793|D3DQV3|Q6FGW2	Silent	DNP	ENST00000528655.1	37	c.138_139GC>TA	CCDS7801.1																																																																																				0.634	ADM-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387008.1	NM_001124		10	7	0	0	0	0.004672	0	10	7				
MICAL2	9645	broad.mit.edu	37	11	12263846	12263846	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:12263846G>A	ENST00000256194.4	+	19	2711	c.2423G>A	c.(2422-2424)aGa>aAa	p.R808K	MICAL2_ENST00000527546.1_Intron|MICAL2_ENST00000342902.5_Missense_Mutation_p.R808K|MICAL2_ENST00000379612.3_Intron|MICAL2_ENST00000537344.1_Intron	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	808					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.R808K(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		AGACCTTGGAGAGCCAGAGCC	0.607																																							uc001mjz.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)	2						c.(2422-2424)AGA>AAA		microtubule associated monoxygenase, calponin							54.0	53.0	53.0					11																	12263846		2201	4294	6495	SO:0001583	missense	9645					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr11:12263846G>A	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.2423G>A	11.37:g.12263846G>A	ENSP00000256194:p.Arg808Lys		Somatic				MICAL2_uc010rch.1_Intron|MICAL2_uc001mka.2_Missense_Mutation_p.R808K|MICAL2_uc010rci.1_Missense_Mutation_p.R808K|MICAL2_uc001mkb.2_Intron|MICAL2_uc001mkc.2_Intron|MICAL2_uc001mkd.2_Intron|MICAL2_uc010rcj.1_Intron|MICAL2_uc001mkf.2_RNA	p.R808K	NM_014632	NP_055447	WXS	Illumina HiSeq	Unspecified	O94851	MICA2_HUMAN		Epithelial(150;0.00552)	19	2711	+			808					B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	37	c.2423G>A	CCDS7809.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.621113	0.46736	.	.	ENSG00000133816	ENST00000256194;ENST00000342902	T;T	0.60171	0.21;0.21	5.41	5.41	0.78517	.	0.092045	0.44483	D	0.000454	T	0.46852	0.1414	L	0.47716	1.5	0.80722	D	1	B;B	0.11235	0.004;0.002	B;B	0.11329	0.006;0.003	T	0.37865	-0.9687	10	0.06365	T	0.9	.	13.5088	0.61499	0.0771:0.0:0.9228:0.0	.	808;808	G3XAC8;O94851	.;MICA2_HUMAN	K	808	ENSP00000256194:R808K;ENSP00000344894:R808K	ENSP00000256194:R808K	R	+	2	0	MICAL2	12220422	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	3.286000	0.51724	2.527000	0.85204	0.563000	0.77884	AGA		0.607	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632		9	17	0	0	0	0.010729	0	9	17				
PARVA	55742	broad.mit.edu	37	11	12518121	12518121	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:12518121A>G	ENST00000550549.1	+	5	566	c.517A>G	c.(517-519)Agg>Ggg	p.R173G	PARVA_ENST00000539723.1_Missense_Mutation_p.R173G|PARVA_ENST00000538608.1_Missense_Mutation_p.R120G|PARVA_ENST00000334956.8_Missense_Mutation_p.R213G			Q9NVD7	PARVA_HUMAN	parvin, alpha	173	CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|actin-mediated cell contraction (GO:0070252)|cell junction assembly (GO:0034329)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|heterotypic cell-cell adhesion (GO:0034113)|outflow tract septum morphogenesis (GO:0003148)|regulation of cell shape (GO:0008360)|smooth muscle cell chemotaxis (GO:0071670)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R173G(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)	11				Epithelial(150;0.00624)		ACTTCCTCCCAGGAGCATCAA	0.493																																							uc001mki.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)	3						c.(517-519)AGG>GGG		parvin, alpha							50.0	51.0	51.0					11																	12518121		1907	4116	6023	SO:0001583	missense	55742				cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding	g.chr11:12518121A>G	AF237771	CCDS44541.1, CCDS44541.2	11p15.3	2014-06-13	2005-05-26		ENSG00000197702	ENSG00000197702		"""Parvins"""	14652	protein-coding gene	gene with protein product		608120	"""matrix-remodelling associated 2"""	MXRA2		11171322	Standard	NM_018222		Approved	FLJ12254, FLJ10793	uc001mki.4	Q9NVD7	OTTHUMG00000165778	ENST00000550549.1:c.517A>G	11.37:g.12518121A>G	ENSP00000447198:p.Arg173Gly		Somatic				PARVA_uc010rck.1_Missense_Mutation_p.R120G	p.R173G	NM_018222	NP_060692	WXS	Illumina HiSeq	Unspecified	Q9NVD7	PARVA_HUMAN		Epithelial(150;0.00624)	5	566	+			173			CH 1.		Q96C85|Q9HA48	Missense_Mutation	SNP	ENST00000550549.1	37	c.517A>G		.	.	.	.	.	.	.	.	.	.	A	12.25	1.882269	0.33255	.	.	ENSG00000197702	ENST00000334956;ENST00000539723;ENST00000550549;ENST00000538608;ENST00000528916	T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27	5.58	-1.58	0.08479	Calponin homology domain (5);	0.099254	0.64402	D	0.000001	T	0.36248	0.0960	N	0.21373	0.66	0.51233	D	0.999918	B;B	0.31256	0.316;0.0	B;B	0.36608	0.229;0.004	T	0.02774	-1.1112	10	0.22706	T	0.39	-17.3459	5.3281	0.15918	0.3338:0.4818:0.0676:0.1168	.	120;173	B7Z952;Q9NVD7	.;PARVA_HUMAN	G	213;173;173;120;137	ENSP00000334008:R213G;ENSP00000438967:R173G;ENSP00000447198:R173G;ENSP00000442960:R120G;ENSP00000435860:R137G	ENSP00000334008:R213G	R	+	1	2	PARVA	12474697	0.998000	0.40836	0.996000	0.52242	0.995000	0.86356	0.872000	0.28037	-0.185000	0.10550	0.477000	0.44152	AGG		0.493	PARVA-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018222		7	13	0	0	0	0.004482	0	7	13				
IGSF22	283284	broad.mit.edu	37	11	18731191	18731191	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:18731191G>C	ENST00000513874.1	-	18	2880	c.2741C>G	c.(2740-2742)tCc>tGc	p.S914C	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	813								p.S813C(1)|p.S914C(1)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						GGAGTTGGAGGAATCAGATAC	0.572																																							uc009yht.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|kidney(1)	7						c.(2740-2742)TCC>TGC		immunoglobulin superfamily, member 22							39.0	42.0	41.0					11																	18731191		1953	4138	6091	SO:0001583	missense	283284							g.chr11:18731191G>C	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2741C>G	11.37:g.18731191G>C	ENSP00000421191:p.Ser914Cys		Somatic				IGSF22_uc001mpa.2_RNA	p.S914C	NM_173588	NP_775859	WXS	Illumina HiSeq	Unspecified	Q8N9C0	IGS22_HUMAN			18	2931	-			813			Fibronectin type-III 2.		A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	37	c.2741C>G	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027864	0.54790	.	.	ENSG00000179057	ENST00000513874	T	0.57595	0.39	4.23	4.23	0.50019	.	.	.	.	.	T	0.58090	0.2098	L	0.31294	0.92	0.19300	N	0.99997	D	0.71674	0.998	D	0.81914	0.995	T	0.44726	-0.9309	9	0.41790	T	0.15	.	9.6245	0.39741	0.1008:0.0:0.8992:0.0	.	914	D6RGV7	.	C	914	ENSP00000421191:S914C	ENSP00000322422:S813C	S	-	2	0	IGSF22	18687767	0.999000	0.42202	0.993000	0.49108	0.977000	0.68977	5.644000	0.67902	2.207000	0.71202	0.655000	0.94253	TCC		0.572	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588		5	8	0	0	0	0.001168	0	5	8				
NDUFS3	4722	broad.mit.edu	37	11	47603679	47603679	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:47603679A>G	ENST00000263774.4	+	5	503	c.421A>G	c.(421-423)Atc>Gtc	p.I141V	NDUFS3_ENST00000533507.1_3'UTR	NM_004551.2	NP_004542.1	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)	141					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)	p.I141V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)	9					Doxorubicin(DB00997)	CAACTCACGGATCCGTGTGAA	0.522																																					Pancreas(15;551 601 22438 23457 52512)	Pancreas(15;551 601 22438 23457 52512)	uc001nga.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(421-423)ATC>GTC		NADH dehydrogenase (ubiquinone) Fe-S protein 3	NADH(DB00157)						176.0	162.0	167.0					11																	47603679		2201	4298	6499	SO:0001583	missense	4722				induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding	g.chr11:47603679A>G	AF067139	CCDS7941.1	11p11.11	2011-08-03	2002-08-29		ENSG00000213619	ENSG00000213619	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7710	protein-coding gene	gene with protein product	"""complex I 30kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 3, mitochondrial"""	603846	"""NADH dehydrogenase (ubiquinone) Fe-S protein 3 (30kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004551		Approved	CI-30	uc001nga.2	O75489	OTTHUMG00000166893	ENST00000263774.4:c.421A>G	11.37:g.47603679A>G	ENSP00000263774:p.Ile141Val		Somatic				NDUFS3_uc001nft.3_Missense_Mutation_p.I120V	p.I141V	NM_004551	NP_004542	WXS	Illumina HiSeq	Unspecified	O75489	NDUS3_HUMAN			5	503	+			141					B2R9J1|B4DFM8|Q9UNQ8	Missense_Mutation	SNP	ENST00000263774.4	37	c.421A>G	CCDS7941.1	.	.	.	.	.	.	.	.	.	.	A	15.80	2.939404	0.52972	.	.	ENSG00000213619	ENST00000263774	T	0.80738	-1.41	6.08	4.96	0.65561	NADH:ubiquinone oxidoreductase, 30kDa subunit (2);	0.137742	0.64402	D	0.000003	T	0.74344	0.3704	L	0.28608	0.87	0.80722	D	1	B;B	0.26577	0.153;0.053	B;B	0.35655	0.207;0.086	T	0.70839	-0.4763	10	0.48119	T	0.1	-42.6376	12.0393	0.53444	0.9332:0.0:0.0668:0.0	.	141;67	O75489;Q9UF24	NDUS3_HUMAN;.	V	141	ENSP00000263774:I141V	ENSP00000263774:I141V	I	+	1	0	NDUFS3	47560255	1.000000	0.71417	0.980000	0.43619	0.995000	0.86356	5.659000	0.68010	1.129000	0.42072	0.533000	0.62120	ATC		0.522	NDUFS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391749.1	NM_004551		5	78	0	0	0	0.001168	0	5	78				
FOLH1	2346	broad.mit.edu	37	11	49204782	49204782	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:49204782C>A	ENST00000256999.2	-	7	1099	c.839G>T	c.(838-840)aGg>aTg	p.R280M	FOLH1_ENST00000343844.4_De_novo_Start_InFrame|FOLH1_ENST00000533034.1_Missense_Mutation_p.R265M|FOLH1_ENST00000356696.3_Missense_Mutation_p.R280M|FOLH1_ENST00000340334.7_Missense_Mutation_p.R265M	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	280	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R280M(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	AATTCCACGCCTATAAGCATA	0.343																																							uc001ngy.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(838-840)AGG>ATG		folate hydrolase 1 isoform 1	Capromab(DB00089)|L-Glutamic Acid(DB00142)						69.0	69.0	69.0					11																	49204782		2201	4298	6499	SO:0001583	missense	2346				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity	g.chr11:49204782C>A	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.839G>T	11.37:g.49204782C>A	ENSP00000256999:p.Arg280Met		Somatic				FOLH1_uc001ngz.2_Missense_Mutation_p.R280M|FOLH1_uc009yly.2_Missense_Mutation_p.R265M|FOLH1_uc009ylz.2_Missense_Mutation_p.R265M|FOLH1_uc009yma.2_Translation_Start_Site	p.R280M	NM_004476	NP_004467	WXS	Illumina HiSeq	Unspecified	Q04609	FOLH1_HUMAN			7	1100	-			280			NAALADase.|Extracellular (Probable).		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	c.839G>T	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.283335	0.40394	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	2.76	2.76	0.32466	.	0.000000	0.52532	D	0.000070	T	0.71298	0.3323	M	0.92880	3.355	0.80722	D	1	D;D;D;D	0.65815	0.987;0.994;0.995;0.982	D;D;D;P	0.66351	0.935;0.943;0.912;0.794	T	0.78595	-0.2143	10	0.87932	D	0	.	11.3444	0.49552	0.0:1.0:0.0:0.0	.	265;265;280;280	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	M	280;280;265;265;280	ENSP00000256999:R280M;ENSP00000349129:R280M;ENSP00000344131:R265M;ENSP00000431463:R265M	ENSP00000256999:R280M	R	-	2	0	FOLH1	49161358	1.000000	0.71417	0.938000	0.37757	0.285000	0.27093	6.695000	0.74593	1.579000	0.49836	0.194000	0.17425	AGG		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476		15	43	1	0	1.99824e-07	0.00499	2.2876e-07	15	43				
OR5AS1	219447	broad.mit.edu	37	11	55798274	55798274	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:55798274G>A	ENST00000313555.1	+	1	380	c.380G>A	c.(379-381)tGc>tAc	p.C127Y		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C127Y(1)		endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					GCAGCCATCTGCAACCCACTG	0.463																																							uc010riw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|liver(1)|skin(1)	5						c.(379-381)TGC>TAC		olfactory receptor, family 5, subfamily AS,							146.0	118.0	128.0					11																	55798274		2201	4296	6497	SO:0001583	missense	219447				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55798274G>A	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.380G>A	11.37:g.55798274G>A	ENSP00000324111:p.Cys127Tyr		Somatic					p.C127Y	NM_001001921	NP_001001921	WXS	Illumina HiSeq	Unspecified	Q8N127	O5AS1_HUMAN			1	380	+	Esophageal squamous(21;0.00693)		127			Cytoplasmic (Potential).		Q6IFB8	Missense_Mutation	SNP	ENST00000313555.1	37	c.380G>A	CCDS31516.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.387615	0.42308	.	.	ENSG00000181785	ENST00000313555	T	0.34667	1.35	5.46	4.54	0.55810	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37857	U	0.001904	T	0.50735	0.1633	M	0.75884	2.315	0.37835	D	0.928855	D	0.61080	0.989	P	0.53450	0.726	T	0.60464	-0.7258	10	0.51188	T	0.08	.	13.0805	0.59112	0.0789:0.0:0.9211:0.0	.	127	Q8N127	O5AS1_HUMAN	Y	127	ENSP00000324111:C127Y	ENSP00000324111:C127Y	C	+	2	0	OR5AS1	55554850	1.000000	0.71417	0.764000	0.31436	0.063000	0.16089	7.382000	0.79729	1.301000	0.44836	0.643000	0.83706	TGC		0.463	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921		16	49	0	0	0	0.003163	0	16	49				
OR8J3	81168	broad.mit.edu	37	11	55904560	55904560	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:55904560A>T	ENST00000301529.1	-	1	634	c.635T>A	c.(634-636)aTt>aAt	p.I212N		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I212N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					TAGAACTGTAATCATGGAAAA	0.358																																							uc010riz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(634-636)ATT>AAT		olfactory receptor, family 8, subfamily J,							95.0	98.0	97.0					11																	55904560		2201	4296	6497	SO:0001583	missense	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904560A>T		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.635T>A	11.37:g.55904560A>T	ENSP00000301529:p.Ile212Asn		Somatic					p.I212N	NM_001004064	NP_001004064	WXS	Illumina HiSeq	Unspecified	Q8NGG0	OR8J3_HUMAN			1	635	-	Esophageal squamous(21;0.00693)		212			Helical; Name=5; (Potential).		Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	c.635T>A	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	A	11.14	1.550533	0.27739	.	.	ENSG00000167822	ENST00000301529	T	0.41400	1.0	3.27	0.823	0.18812	GPCR, rhodopsin-like superfamily (1);	0.969977	0.08516	N	0.934182	T	0.49525	0.1562	L	0.59912	1.85	0.09310	N	1	P	0.38767	0.646	P	0.49597	0.616	T	0.47749	-0.9093	10	0.87932	D	0	.	6.7243	0.23348	0.663:0.0:0.337:0.0	.	212	Q8NGG0	OR8J3_HUMAN	N	212	ENSP00000301529:I212N	ENSP00000301529:I212N	I	-	2	0	OR8J3	55661136	0.000000	0.05858	0.000000	0.03702	0.631000	0.37964	-0.485000	0.06520	-0.053000	0.13289	0.247000	0.18012	ATT		0.358	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		37	32	0	0	0	0.019004	0	37	32				
NPAS4	266743	broad.mit.edu	37	11	66191875	66191875	+	Missense_Mutation	SNP	C	C	T	rs200495885		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:66191875C>T	ENST00000311034.2	+	7	1690	c.1514C>T	c.(1513-1515)aCc>aTc	p.T505I		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	505					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.T505I(1)		breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						ACTCCCTGCACCTCCACCTTC	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19968	0.0		0.0	False		,,,				2504	0.0						uc001ohx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1513-1515)ACC>ATC		neuronal PAS domain protein 4							200.0	195.0	196.0					11																	66191875		2200	4295	6495	SO:0001583	missense	266743				transcription, DNA-dependent		DNA binding|signal transducer activity	g.chr11:66191875C>T	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1514C>T	11.37:g.66191875C>T	ENSP00000311196:p.Thr505Ile		Somatic				NPAS4_uc010rpc.1_Missense_Mutation_p.T295I	p.T505I	NM_178864	NP_849195	WXS	Illumina HiSeq	Unspecified	Q8IUM7	NPAS4_HUMAN			7	1690	+			505					B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	37	c.1514C>T	CCDS8138.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	11.94	1.787813	0.31593	.	.	ENSG00000174576	ENST00000311034	T	0.48836	0.8	4.56	4.56	0.56223	.	0.249846	0.28409	N	0.015443	T	0.25344	0.0616	N	0.08118	0	0.40017	D	0.975366	B	0.34015	0.435	B	0.24848	0.056	T	0.18178	-1.0345	10	0.42905	T	0.14	-10.4376	12.7046	0.57054	0.0:1.0:0.0:0.0	.	505	Q8IUM7	NPAS4_HUMAN	I	505	ENSP00000311196:T505I	ENSP00000311196:T505I	T	+	2	0	NPAS4	65948451	0.119000	0.22226	0.998000	0.56505	0.962000	0.63368	2.586000	0.46119	2.374000	0.81015	0.563000	0.77884	ACC		0.587	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864		103	93	0	0	0	0.01441	0	103	93				
SPTBN2	6712	broad.mit.edu	37	11	66455339	66455339	+	Splice_Site	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:66455339C>A	ENST00000533211.1	-	34	6832	c.6501G>T	c.(6499-6501)ccG>ccT	p.P2167P	SPTBN2_ENST00000529997.1_Splice_Site_p.P2167P|SPTBN2_ENST00000309996.2_Splice_Site_p.P2167P			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	2167					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.P2167P(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GGGAACTCACCGGCCCTTCGG	0.607																																							uc001ojd.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(6499-6501)CCG>CCT		spectrin, beta, non-erythrocytic 2							101.0	100.0	100.0					11																	66455339		2200	4295	6495	SO:0001630	splice_region_variant	6712				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton	g.chr11:66455339C>A	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.6501+1G>T	11.37:g.66455339C>A			Somatic				SPTBN2_uc001ojc.1_Missense_Mutation_p.R28L	p.P2167P	NM_006946	NP_008877	WXS	Illumina HiSeq	Unspecified	O15020	SPTN2_HUMAN			33	6573	-			2167					O14872|O14873	Silent	SNP	ENST00000533211.1	37	c.6501G>T	CCDS8150.1																																																																																				0.607	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	Silent	32	35	1	0	1.836e-18	0.017118	2.58149e-18	32	35				
PTPRCAP	5790	broad.mit.edu	37	11	67203241	67203241	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:67203241G>T	ENST00000326294.3	-	2	1031	c.584C>A	c.(583-585)gCa>gAa	p.A195E	AP003419.16_ENST00000535922.1_RNA|CORO1B_ENST00000539724.1_5'Flank	NM_005608.2	NP_005599.1	Q14761	PTCA_HUMAN	protein tyrosine phosphatase, receptor type, C-associated protein	195					defense response (GO:0006952)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A195E(1)		skin(1)|upper_aerodigestive_tract(1)	2			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			GCCCCCAGCTGCCCTGGCGCT	0.687																																							uc001oli.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(583-585)GCA>GAA		protein tyrosine phosphatase, receptor type,							15.0	17.0	16.0					11																	67203241		2179	4268	6447	SO:0001583	missense	5790				defense response	integral to membrane|plasma membrane		g.chr11:67203241G>T		CCDS8163.1	11q13.2	2011-06-09			ENSG00000213402	ENSG00000213402			9667	protein-coding gene	gene with protein product		601577					Standard	NM_005608		Approved	LPAP, CD45-AP	uc001oli.1	Q14761	OTTHUMG00000150325	ENST00000326294.3:c.584C>A	11.37:g.67203241G>T	ENSP00000325589:p.Ala195Glu		Somatic					p.A195E	NM_005608	NP_005599	WXS	Illumina HiSeq	Unspecified	Q14761	PTCA_HUMAN	BRCA - Breast invasive adenocarcinoma(15;3.26e-06)		2	647	-			195					B2R512|O00643|Q6I9S6	Missense_Mutation	SNP	ENST00000326294.3	37	c.584C>A	CCDS8163.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.973358	0.34848	.	.	ENSG00000213402	ENST00000326294	T	0.47528	0.84	5.16	4.23	0.50019	.	1.056810	0.07654	U	0.932450	T	0.45236	0.1332	L	0.29908	0.895	0.09310	N	1	P	0.48016	0.904	P	0.45829	0.494	T	0.36939	-0.9727	10	0.54805	T	0.06	2.7784	12.5939	0.56456	0.0:0.1747:0.8253:0.0	.	195	Q14761	PTCA_HUMAN	E	195	ENSP00000325589:A195E	ENSP00000325589:A195E	A	-	2	0	PTPRCAP	66959817	0.017000	0.18338	0.004000	0.12327	0.312000	0.27988	1.978000	0.40598	1.128000	0.42052	0.561000	0.74099	GCA		0.687	PTPRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317563.1	NM_005608		10	10	1	0	9.70103e-10	0.008291	1.18852e-09	10	10				
GRM5	2915	broad.mit.edu	37	11	88780709	88780709	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:88780709T>A	ENST00000305447.4	-	1	481	c.332A>T	c.(331-333)gAg>gTg	p.E111V	GRM5_ENST00000418177.2_Missense_Mutation_p.E111V|GRM5_ENST00000393297.1_Missense_Mutation_p.E111V|GRM5_ENST00000305432.5_Missense_Mutation_p.E111V|GRM5_ENST00000393294.3_Missense_Mutation_p.E111V|GRM5_ENST00000455756.2_Missense_Mutation_p.E111V	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	111					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.E111V(2)|p.E111A(2)		NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	TCTTATGAACTCAATGCTCTG	0.517																																							uc001pcq.2		NA																	4	Substitution - Missense(4)		lung(2)|kidney(2)	central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(331-333)GAG>GTG		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						75.0	65.0	68.0					11																	88780709		2201	4299	6500	SO:0001583	missense	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88780709T>A	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.332A>T	11.37:g.88780709T>A	ENSP00000306138:p.Glu111Val		Somatic				GRM5_uc009yvm.2_Missense_Mutation_p.E111V|GRM5_uc009yvn.1_Missense_Mutation_p.E111V	p.E111V	NM_001143831	NP_001137303	WXS	Illumina HiSeq	Unspecified	P41594	GRM5_HUMAN			1	532	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	111			Extracellular (Potential).		Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	c.332A>T	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189917	0.78789	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297;ENST00000393294	T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.4	5.4	0.78164	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.80031	0.4549	M	0.69358	2.11	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.964;0.988;0.998	T	0.80365	-0.1413	9	.	.	.	.	15.4282	0.75072	0.0:0.0:0.0:1.0	.	111;111;111	A8MT20;P41594-2;P41594	.;.;GRM5_HUMAN	V	111	ENSP00000402912:E111V;ENSP00000405690:E111V;ENSP00000305905:E111V;ENSP00000306138:E111V;ENSP00000376975:E111V;ENSP00000376972:E111V	.	E	-	2	0	GRM5	88420357	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.884000	0.87274	2.033000	0.60031	0.460000	0.39030	GAG		0.517	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		7	21	0	0	0	0.001984	0	7	21				
FAT3	120114	broad.mit.edu	37	11	92088374	92088374	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:92088374G>T	ENST00000298047.6	+	1	3113	c.3096G>T	c.(3094-3096)gtG>gtT	p.V1032V	FAT3_ENST00000525166.1_Silent_p.V882V|FAT3_ENST00000541502.1_Silent_p.V1032V|FAT3_ENST00000409404.2_Silent_p.V1032V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1032	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V1032V(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGGAAGTGGTGGATGTCAATG	0.468										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(3094-3096)GTG>GTT		FAT tumor suppressor homolog 3							105.0	105.0	105.0					11																	92088374		1981	4156	6137	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92088374G>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3096G>T	11.37:g.92088374G>T		TCGA Ovarian(4;0.039)	Somatic					p.V1032V	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			1	3113	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	1032			Cadherin 9.|Extracellular (Potential).		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.3096G>T																																																																																					0.468	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		20	13	1	0	2.37509e-13	0.010504	3.11963e-13	20	13				
HEPHL1	341208	broad.mit.edu	37	11	93837701	93837701	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:93837701A>G	ENST00000315765.9	+	16	2698	c.2690A>G	c.(2689-2691)tAt>tGt	p.Y897C		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	897	Plastocyanin-like 5.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.Y901C(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CAGGATACGTATAGTGGTTTG	0.353																																							uc001pep.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2689-2691)TAT>TGT		hephaestin-like 1 precursor							91.0	84.0	86.0					11																	93837701		1844	4082	5926	SO:0001583	missense	341208				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity	g.chr11:93837701A>G	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2690A>G	11.37:g.93837701A>G	ENSP00000313699:p.Tyr897Cys		Somatic				uc001pen.1_Intron	p.Y897C	NM_001098672	NP_001092142	WXS	Illumina HiSeq	Unspecified	Q6MZM0	HPHL1_HUMAN			16	2847	+		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)	897			Plastocyanin-like 5.|Extracellular (Potential).		Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	c.2690A>G	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.760747	0.31137	.	.	ENSG00000181333	ENST00000315765	D	0.98701	-5.08	5.52	4.4	0.53042	Cupredoxin (2);	0.173155	0.52532	D	0.000065	D	0.99010	0.9662	M	0.87758	2.905	0.34608	D	0.717229	D	0.89917	1.0	D	0.79108	0.992	D	0.99961	1.1739	10	0.39692	T	0.17	-14.9152	11.2902	0.49245	0.9285:0.0:0.0715:0.0	.	897	Q6MZM0	HPHL1_HUMAN	C	897	ENSP00000313699:Y897C	ENSP00000313699:Y897C	Y	+	2	0	HEPHL1	93477349	0.992000	0.36948	0.040000	0.18447	0.186000	0.23388	4.578000	0.60929	0.931000	0.37242	0.459000	0.35465	TAT		0.353	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947		26	13	0	0	0	0.007291	0	26	13				
CNTN5	53942	broad.mit.edu	37	11	100061936	100061936	+	Silent	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:100061936G>A	ENST00000524871.1	+	14	1949	c.1659G>A	c.(1657-1659)ggG>ggA	p.G553G	CNTN5_ENST00000418526.2_Silent_p.G479G|CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000279463.3_Silent_p.G553G|CNTN5_ENST00000528682.1_Silent_p.G553G|CNTN5_ENST00000527185.1_Silent_p.G553G	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	553	Ig-like C2-type 5.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.G553G(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TTTGCCGAGGGGAAAACGTCT	0.403																																							uc001pga.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(1657-1659)GGG>GGA		contactin 5 isoform long							70.0	73.0	72.0					11																	100061936		1834	4084	5918	SO:0001819	synonymous_variant	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:100061936G>A	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1659G>A	11.37:g.100061936G>A			Somatic				CNTN5_uc009ywv.1_Silent_p.G553G|CNTN5_uc001pfz.2_Silent_p.G553G|CNTN5_uc001pgb.2_Silent_p.G479G|CNTN5_uc010ruk.1_5'UTR	p.G553G	NM_014361	NP_055176	WXS	Illumina HiSeq	Unspecified	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	14	1998	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	553			Ig-like C2-type 5.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	ENST00000524871.1	37	c.1659G>A	CCDS53696.1																																																																																				0.403	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		6	15	0	0	0	0.001984	0	6	15				
NTM	50863	broad.mit.edu	37	11	132081940	132081940	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:132081940C>T	ENST00000374786.1	+	3	904	c.425C>T	c.(424-426)tCt>tTt	p.S142F	NTM_ENST00000539799.1_Missense_Mutation_p.S142F|NTM_ENST00000374791.3_Missense_Mutation_p.S142F|NTM_ENST00000427481.2_Missense_Mutation_p.S133F|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374784.1_Missense_Mutation_p.S142F|NTM_ENST00000425719.2_Missense_Mutation_p.S142F	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	142	Ig-like C2-type 2.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.S142F(2)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GTAGAGATTTCTTCAGATATC	0.393																																							uc001qgp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(424-426)TCT>TTT		neurotrimin isoform 1							79.0	79.0	79.0					11																	132081940		2201	4297	6498	SO:0001583	missense	50863				cell adhesion|neuron recognition	anchored to membrane|plasma membrane		g.chr11:132081940C>T	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.425C>T	11.37:g.132081940C>T	ENSP00000363918:p.Ser142Phe		Somatic				NTM_uc001qgm.2_Missense_Mutation_p.S142F|NTM_uc010sch.1_Missense_Mutation_p.S133F|NTM_uc010sci.1_Missense_Mutation_p.S142F|NTM_uc010scj.1_Missense_Mutation_p.S101F|NTM_uc001qgo.2_Missense_Mutation_p.S142F|NTM_uc001qgq.2_Missense_Mutation_p.S142F|NTM_uc001qgr.2_5'UTR	p.S142F	NM_016522	NP_057606	WXS	Illumina HiSeq	Unspecified	Q9P121	NTRI_HUMAN			3	1089	+			142			Ig-like C2-type 2.		A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	c.425C>T	CCDS8491.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165845	0.78339	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000550167;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T;T	0.36878	1.63;1.63;1.23;1.63;1.63;1.63;1.63	5.87	4.96	0.65561	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.105042	0.64402	D	0.000002	T	0.62196	0.2408	M	0.80847	2.515	0.58432	D	0.999999	D;D;D;D;D;D	0.69078	0.992;0.992;0.997;0.977;0.997;0.971	D;D;D;D;D;D	0.67231	0.95;0.95;0.917;0.95;0.947;0.917	T	0.69461	-0.5139	10	0.87932	D	0	-13.0846	16.7378	0.85452	0.1304:0.8696:0.0:0.0	.	142;133;142;142;142;142	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	F	142;142;133;133;142;142;142	ENSP00000363923:S142F;ENSP00000437668:S142F;ENSP00000448104:S133F;ENSP00000416320:S133F;ENSP00000363918:S142F;ENSP00000396722:S142F;ENSP00000363916:S142F	ENSP00000363916:S142F	S	+	2	0	NTM	131587150	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.357000	0.66058	1.611000	0.50210	0.655000	0.94253	TCT		0.393	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522		14	19	0	0	0	0.020292	0	14	19				
AKAP3	10566	broad.mit.edu	37	12	4737626	4737626	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:4737626C>T	ENST00000545990.2	-	5	966	c.442G>A	c.(442-444)Gat>Aat	p.D148N	AKAP3_ENST00000228850.1_Missense_Mutation_p.D148N|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	148					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)	p.D148N(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						TCAGAGCCATCGATCTTCTCA	0.453																																							uc001qnb.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|large_intestine(1)|ovary(1)|kidney(1)	6						c.(442-444)GAT>AAT		A-kinase anchor protein 3							196.0	184.0	188.0					12																	4737626		2203	4300	6503	SO:0001583	missense	10566				acrosome reaction|cellular component movement	acrosomal vesicle	protein kinase A binding	g.chr12:4737626C>T	U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.442G>A	12.37:g.4737626C>T	ENSP00000440994:p.Asp148Asn		Somatic					p.D148N	NM_006422	NP_006413	WXS	Illumina HiSeq	Unspecified	O75969	AKAP3_HUMAN			4	671	-			148					O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	ENST00000545990.2	37	c.442G>A	CCDS8531.1	.	.	.	.	.	.	.	.	.	.	C	5.244	0.230550	0.09969	.	.	ENSG00000111254	ENST00000228850;ENST00000545990;ENST00000540967	T;T;T	0.34275	3.35;3.35;1.37	4.76	2.89	0.33648	.	0.200393	0.35013	N	0.003501	T	0.25044	0.0608	L	0.36672	1.1	0.19300	N	0.99997	B	0.26195	0.144	B	0.18263	0.021	T	0.16070	-1.0415	10	0.49607	T	0.09	.	7.8469	0.29431	0.0:0.7405:0.169:0.0905	.	148	O75969	AKAP3_HUMAN	N	148	ENSP00000228850:D148N;ENSP00000440994:D148N;ENSP00000442376:D148N	ENSP00000228850:D148N	D	-	1	0	AKAP3	4607887	0.865000	0.29922	0.032000	0.17829	0.103000	0.19146	1.363000	0.34159	0.688000	0.31529	-0.137000	0.14449	GAT		0.453	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398911.2	NM_006422		11	160	0	0	0	0.010729	0	11	160				
GRIN2B	2904	broad.mit.edu	37	12	13717085	13717085	+	Silent	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:13717085G>A	ENST00000609686.1	-	13	3296	c.3087C>T	c.(3085-3087)tcC>tcT	p.S1029S		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1029					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.S1029S(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGTGCTTGGAGGAGGGGAGGC	0.592																																							uc001rbt.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(3085-3087)TCC>TCT		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						86.0	67.0	74.0					12																	13717085		2203	4300	6503	SO:0001819	synonymous_variant	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13717085G>A		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3087C>T	12.37:g.13717085G>A			Somatic					p.S1029S	NM_000834	NP_000825	WXS	Illumina HiSeq	Unspecified	Q13224	NMDE2_HUMAN			13	3266	-			1029			Cytoplasmic (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	ENST00000609686.1	37	c.3087C>T	CCDS8662.1																																																																																				0.592	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			6	21	0	0	0	0.001984	0	6	21				
SLC2A13	114134	broad.mit.edu	37	12	40441975	40441975	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:40441975C>A	ENST00000280871.4	-	2	644	c.594G>T	c.(592-594)gaG>gaT	p.E198D	SLC2A13_ENST00000380858.1_Missense_Mutation_p.E198D	NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	198					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.E179D(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				GTGGTGAGACCTCCGCAATGT	0.403										HNSCC(50;0.14)																													uc010skm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(592-594)GAG>GAT		solute carrier family 2 (facilitated glucose							157.0	148.0	151.0					12																	40441975		2203	4300	6503	SO:0001583	missense	114134					integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity	g.chr12:40441975C>A	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.594G>T	12.37:g.40441975C>A	ENSP00000280871:p.Glu198Asp	HNSCC(50;0.14)	Somatic				SLC2A13_uc001rmf.2_Missense_Mutation_p.E198D	p.E198D	NM_052885	NP_443117	WXS	Illumina HiSeq	Unspecified	Q96QE2	MYCT_HUMAN			2	645	-		Lung NSC(34;0.105)|all_lung(34;0.123)	198			Helical; Name=4; (Potential).		Q17S07	Missense_Mutation	SNP	ENST00000280871.4	37	c.594G>T	CCDS8736.2	.	.	.	.	.	.	.	.	.	.	C	18.37	3.608552	0.66558	.	.	ENSG00000151229	ENST00000280871;ENST00000380858	D;D	0.86497	-2.13;-2.13	5.65	0.702	0.18110	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.044144	0.85682	D	0.000000	D	0.95417	0.8512	H	0.98936	4.375	0.48696	D	0.999698	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93909	0.7195	10	0.87932	D	0	-25.5122	9.9164	0.41436	0.0:0.4345:0.0:0.5655	.	198;198	Q96QE2;E9PE47	MYCT_HUMAN;.	D	198	ENSP00000280871:E198D;ENSP00000370239:E198D	ENSP00000280871:E198D	E	-	3	2	SLC2A13	38728242	0.745000	0.28261	0.982000	0.44146	0.988000	0.76386	-0.071000	0.11505	0.075000	0.16796	-0.150000	0.13652	GAG		0.403	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2			74	109	1	0	2.40982e-25	0.01441	3.65838e-25	74	109				
ARID2	196528	broad.mit.edu	37	12	46230616	46230616	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:46230616A>G	ENST00000334344.6	+	8	1037	c.865A>G	c.(865-867)Att>Gtt	p.I289V	ARID2_ENST00000444670.1_5'Flank|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Missense_Mutation_p.I140V	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	289					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I289V(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GGTACTTCAGATTGCAGTGAT	0.418			"""N, S, F"""		hepatocellular carcinoma																																		uc001ros.1		NA		Rec	yes		12	12q12	196528		AT rich interactive domain 2			E					1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10						c.(865-867)ATT>GTT		AT rich interactive domain 2 (ARID, RFX-like)							167.0	161.0	163.0					12																	46230616		2203	4300	6503	SO:0001583	missense	196528				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:46230616A>G		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.865A>G	12.37:g.46230616A>G	ENSP00000335044:p.Ile289Val		Somatic				ARID2_uc001ror.2_Missense_Mutation_p.I289V|ARID2_uc009zkg.1_5'UTR|ARID2_uc009zkh.1_5'Flank|ARID2_uc001rot.1_5'UTR	p.I289V	NM_152641	NP_689854	WXS	Illumina HiSeq	Unspecified	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)	8	865	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	289					Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	c.865A>G	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	A	10.25	1.299520	0.23650	.	.	ENSG00000189079	ENST00000334344;ENST00000422737	T;T	0.47528	0.84;0.84	5.87	4.7	0.59300	.	0.161420	0.56097	N	0.000033	T	0.32285	0.0824	N	0.16656	0.425	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.05852	-1.0860	10	0.45353	T	0.12	-8.3375	12.0765	0.53647	0.932:0.0:0.068:0.0	.	289	Q68CP9	ARID2_HUMAN	V	289;140	ENSP00000335044:I289V;ENSP00000415650:I140V	ENSP00000335044:I289V	I	+	1	0	ARID2	44516883	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.968000	0.56809	1.004000	0.39156	0.482000	0.46254	ATT		0.418	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		17	126	0	0	0	0.004007	0	17	126				
KMT2D	8085	broad.mit.edu	37	12	49445464	49445465	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:49445464_49445465CC>AA	ENST00000301067.7	-	10	2000_2001	c.2001_2002GG>TT	c.(1999-2004)gaGGaa>gaTTaa	p.667_668EE>D*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	667	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.E668*(2)|p.E667_E668>D*(2)									AAGGGAGATTCCTCAGGCGGTG	0.644																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		4	Substitution - Nonsense(2)|Complex - compound substitution(2)		lung(4)	kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(1999-2004)GAGGAA>GATTAA		myeloid/lymphoid or mixed-lineage leukemia 2																																				SO:0001587	stop_gained	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49445464_49445465CC>AA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2001_2002delinsAA	12.37:g.49445464_49445465delinsAA	ENSP00000301067:p.E667_E668delinsD*	HNSCC(34;0.089)	Somatic					p.667_668EE>D*	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			10	2001_2002	-			667_668			15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.		O14687	Nonsense_Mutation	DNP	ENST00000301067.7	37	c.2001_2002GG>TT	CCDS44873.1																																																																																				0.644	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			27	36	0	0	0	0.004672	0	27	36				
GALNT6	11226	broad.mit.edu	37	12	51773084	51773084	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:51773084C>A	ENST00000543196.2	-	2	687	c.482G>T	c.(481-483)cGa>cTa	p.R161L	GALNT6_ENST00000603203.1_5'Flank|GALNT6_ENST00000356317.3_Missense_Mutation_p.R161L			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	161					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R161L(1)		endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CTCAGGTGGTCGGGTGTCTGG	0.562																																							uc001ryk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(481-483)CGA>CTA		polypeptide N-acetylgalactosaminyltransferase 6							38.0	41.0	40.0					12																	51773084		2203	4300	6503	SO:0001583	missense	11226				protein O-linked glycosylation	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:51773084C>A	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.482G>T	12.37:g.51773084C>A	ENSP00000444171:p.Arg161Leu		Somatic				GALNT6_uc009zma.1_RNA|GALNT6_uc001ryl.1_Missense_Mutation_p.R161L|GALNT6_uc010snh.1_Missense_Mutation_p.R161L	p.R161L	NM_007210	NP_009141	WXS	Illumina HiSeq	Unspecified	Q8NCL4	GALT6_HUMAN			2	707	-			161			Lumenal (Potential).		Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	37	c.482G>T	CCDS8813.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.463702	0.84425	.	.	ENSG00000139629	ENST00000543196;ENST00000356317;ENST00000546163	T;T	0.60797	0.16;0.16	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.82093	0.4962	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86749	0.1959	10	0.87932	D	0	.	17.2315	0.86985	0.0:1.0:0.0:0.0	.	161	Q8NCL4	GALT6_HUMAN	L	161;161;142	ENSP00000444171:R161L;ENSP00000348668:R161L	ENSP00000348668:R161L	R	-	2	0	GALNT6	50059351	1.000000	0.71417	0.888000	0.34837	0.736000	0.42039	7.593000	0.82686	2.793000	0.96121	0.655000	0.94253	CGA		0.562	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210		10	32	1	0	5.50884e-06	0.013537	6.12255e-06	10	32				
KRT2	3849	broad.mit.edu	37	12	53044148	53044148	+	Missense_Mutation	SNP	C	C	A	rs200999971		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:53044148C>A	ENST00000309680.3	-	2	796	c.775G>T	c.(775-777)Gat>Tat	p.D259Y		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	259	Coil 1B.|Rod.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.D259Y(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		TCCACAAGATCCTGCATGTTA	0.463																																							uc001sat.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(775-777)GAT>TAT		keratin 2							209.0	203.0	205.0					12																	53044148		2203	4300	6503	SO:0001583	missense	3849				keratinization|keratinocyte activation|keratinocyte migration|keratinocyte proliferation	Golgi apparatus|keratin filament	protein binding|structural constituent of cytoskeleton	g.chr12:53044148C>A		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.775G>T	12.37:g.53044148C>A	ENSP00000310861:p.Asp259Tyr		Somatic					p.D259Y	NM_000423	NP_000414	WXS	Illumina HiSeq	Unspecified	P35908	K22E_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.19)	2	808	-			259			Coil 1B.|Rod.		Q4VAQ2	Missense_Mutation	SNP	ENST00000309680.3	37	c.775G>T	CCDS8835.1	.	.	.	.	.	.	.	.	.	.	C	19.86	3.905322	0.72868	.	.	ENSG00000172867	ENST00000309680	T	0.79033	-1.23	5.19	4.3	0.51218	Filament (1);	.	.	.	.	D	0.90652	0.7068	H	0.96208	3.785	0.43050	D	0.99465	D	0.89917	1.0	D	0.91635	0.999	D	0.91964	0.5581	9	0.72032	D	0.01	.	10.1062	0.42535	0.0:0.743:0.1767:0.0803	.	259	P35908	K22E_HUMAN	Y	259	ENSP00000310861:D259Y	ENSP00000310861:D259Y	D	-	1	0	KRT2	51330415	0.038000	0.19896	1.000000	0.80357	0.996000	0.88848	1.768000	0.38511	1.327000	0.45338	0.650000	0.86243	GAT		0.463	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423		65	96	1	0	2.81305e-35	0.01441	4.48163e-35	65	96				
SP7	121340	broad.mit.edu	37	12	53722249	53722249	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:53722249C>G	ENST00000536324.2	-	3	1260	c.977G>C	c.(976-978)tGc>tCc	p.C326S	SP7_ENST00000537210.2_Missense_Mutation_p.C308S|SP7_ENST00000303846.3_Missense_Mutation_p.C326S	NM_001173467.1	NP_001166938.1	Q8TDD2	SP7_HUMAN	Sp7 transcription factor	326					hematopoietic stem cell differentiation (GO:0060218)|osteoblast differentiation (GO:0001649)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C326S(1)		cervix(2)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	14						GAGCCAGTTGCAGACGAAGGG	0.612																																							uc001sct.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(976-978)TGC>TCC		osterix							55.0	63.0	60.0					12																	53722249		2203	4300	6503	SO:0001583	missense	121340				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr12:53722249C>G	AF477981	CCDS44897.1, CCDS73475.1	12q13.13	2013-01-08				ENSG00000170374		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	17321	protein-coding gene	gene with protein product		606633				11792318	Standard	NM_152860		Approved	osterix, OSX	uc001sct.3	Q8TDD2		ENST00000536324.2:c.977G>C	12.37:g.53722249C>G	ENSP00000443827:p.Cys326Ser		Somatic				SP7_uc001scu.2_Missense_Mutation_p.C308S|SP7_uc001scv.2_Missense_Mutation_p.C326S	p.C326S	NM_152860	NP_690599	WXS	Illumina HiSeq	Unspecified	Q8TDD2	SP7_HUMAN			2	1084	-			326			C2H2-type 2.		B3KY26|Q3MJ72|Q7Z718	Missense_Mutation	SNP	ENST00000536324.2	37	c.977G>C	CCDS44897.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171824	0.78452	.	.	ENSG00000170374	ENST00000536324;ENST00000303846;ENST00000537210	D;D;D	0.85171	-1.95;-1.95;-1.95	4.33	4.33	0.51752	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94594	0.8258	H	0.95611	3.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96247	0.9180	10	0.87932	D	0	.	16.4596	0.84032	0.0:1.0:0.0:0.0	.	326	Q8TDD2	SP7_HUMAN	S	326;326;308	ENSP00000443827:C326S;ENSP00000302812:C326S;ENSP00000441367:C308S	ENSP00000302812:C326S	C	-	2	0	SP7	52008516	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.776000	0.85560	2.344000	0.79699	0.491000	0.48974	TGC		0.612	SP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406917.1			18	31	0	0	0	0.006122	0	18	31				
MYO1A	4640	broad.mit.edu	37	12	57422590	57422590	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:57422590C>A	ENST00000442789.2	-	29	3368	c.3081G>T	c.(3079-3081)aaG>aaT	p.K1027N	MYO1A_ENST00000300119.3_Missense_Mutation_p.K1027N|MYO1A_ENST00000544473.1_Missense_Mutation_p.K865N|TAC3_ENST00000415231.1_5'UTR	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	1027	Myosin tail. {ECO:0000255}.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.K1027N(1)		breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						TGTAGCGTAGCTTGCTGTTGT	0.542																																							uc001smw.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(2)|urinary_tract(1)	7						c.(3079-3081)AAG>AAT		myosin IA							224.0	181.0	195.0					12																	57422590		2203	4300	6503	SO:0001583	missense	4640				sensory perception of sound|vesicle localization	brush border|cortical actin cytoskeleton|filamentous actin|lateral plasma membrane|microvillus|myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr12:57422590C>A	L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.3081G>T	12.37:g.57422590C>A	ENSP00000393392:p.Lys1027Asn		Somatic				MYO1A_uc010sqz.1_Missense_Mutation_p.K865N|MYO1A_uc009zpd.2_Missense_Mutation_p.K1027N	p.K1027N	NM_005379	NP_005370	WXS	Illumina HiSeq	Unspecified	Q9UBC5	MYO1A_HUMAN			28	3324	-			1027					Q9UQD7	Missense_Mutation	SNP	ENST00000442789.2	37	c.3081G>T	CCDS8929.1	.	.	.	.	.	.	.	.	.	.	C	9.076	0.998018	0.19043	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	T;T;T	0.36878	1.23;1.23;1.23	4.87	1.94	0.25998	Myosin tail 2 (1);	0.280612	0.38959	N	0.001513	T	0.26593	0.0650	L	0.51422	1.61	0.29821	N	0.830795	B	0.02656	0.0	B	0.08055	0.003	T	0.18681	-1.0329	10	0.17832	T	0.49	.	7.5253	0.27652	0.0:0.7242:0.0:0.2758	.	1027	Q9UBC5	MYO1A_HUMAN	N	1027;1027;865	ENSP00000300119:K1027N;ENSP00000393392:K1027N;ENSP00000440514:K865N	ENSP00000300119:K1027N	K	-	3	2	MYO1A	55708857	1.000000	0.71417	0.985000	0.45067	0.056000	0.15407	0.662000	0.25038	0.629000	0.30376	0.467000	0.42956	AAG		0.542	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313833.2	NM_005379		38	39	1	0	6.2361e-21	0.007835	9.0101e-21	38	39				
KIF5A	3798	broad.mit.edu	37	12	57960909	57960909	+	Splice_Site	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:57960909G>T	ENST00000455537.2	+	7	776	c.502G>T	c.(502-504)Ggt>Tgt	p.G168C	KIF5A_ENST00000286452.5_Splice_Site_p.G79C	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	168	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.G168C(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						TCCCCCACAGGGTTGTACTGA	0.383																																							uc001sor.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(502-504)GGT>TGT		kinesin family member 5A							158.0	149.0	152.0					12																	57960909		2203	4300	6503	SO:0001630	splice_region_variant	3798				blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity	g.chr12:57960909G>T	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.502-1G>T	12.37:g.57960909G>T			Somatic				KIF5A_uc010srr.1_Missense_Mutation_p.G79C	p.G168C	NM_004984	NP_004975	WXS	Illumina HiSeq	Unspecified	Q12840	KIF5A_HUMAN			7	710	+			168			Kinesin-motor.		A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	c.502G>T	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175989	0.78564	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	T;T	0.77098	-1.07;-1.07	4.48	4.48	0.54585	Kinesin, motor domain (4);	0.054757	0.64402	D	0.000001	D	0.92496	0.7617	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95197	0.8313	9	.	.	.	.	16.4543	0.84008	0.0:0.0:1.0:0.0	.	79;168	B7Z2M7;Q12840	.;KIF5A_HUMAN	C	168;79	ENSP00000408979:G168C;ENSP00000286452:G79C	.	G	+	1	0	KIF5A	56247176	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	9.077000	0.94016	2.481000	0.83766	0.453000	0.30009	GGT		0.383	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	Missense_Mutation	40	58	1	0	1.57945e-13	0.011902	2.10092e-13	40	58				
PIP4K2C	79837	broad.mit.edu	37	12	57989697	57989697	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:57989697C>T	ENST00000354947.5	+	4	412	c.396C>T	c.(394-396)agC>agT	p.S132S	PIP4K2C_ENST00000540759.2_Silent_p.S132S|PIP4K2C_ENST00000422156.3_Intron|PIP4K2C_ENST00000550465.1_Silent_p.S114S			Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, gamma	132	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|identical protein binding (GO:0042802)	p.S132S(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(13)|pancreas(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Melanoma(17;0.122)					ACCCCCCCAGCGAAAGTGAAG	0.493																																							uc001sou.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|lung(1)	3						c.(394-396)AGC>AGT		phosphatidylinositol-5-phosphate 4-kinase, type							116.0	108.0	110.0					12																	57989697		2203	4300	6503	SO:0001819	synonymous_variant	79837					cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding	g.chr12:57989697C>T	AK125526	CCDS8946.1, CCDS53808.1, CCDS55839.1	12q13.3	2014-09-04	2007-08-14	2007-08-14	ENSG00000166908	ENSG00000166908			23786	protein-coding gene	gene with protein product			"""phosphatidylinositol-4-phosphate 5-kinase, type II, gamma"""	PIP5K2C		9367159	Standard	NM_024779		Approved	FLJ22055	uc001sot.3	Q8TBX8	OTTHUMG00000170144	ENST00000354947.5:c.396C>T	12.37:g.57989697C>T			Somatic				PIP4K2C_uc001sot.2_Silent_p.S132S|PIP4K2C_uc010srs.1_Silent_p.S114S|PIP4K2C_uc010srt.1_Intron	p.S132S	NM_001146258	NP_001139730	WXS	Illumina HiSeq	Unspecified	Q8TBX8	PI42C_HUMAN			4	527	+	Melanoma(17;0.122)		132			PIPK.		B2RDL3|B4DM11|B4DY44|Q9H6N2	Silent	SNP	ENST00000354947.5	37	c.396C>T	CCDS8946.1																																																																																				0.493	PIP4K2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407644.1	NM_024779		7	68	0	0	0	0.00308	0	7	68				
PIP4K2C	79837	broad.mit.edu	37	12	57994654	57994654	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:57994654C>T	ENST00000354947.5	+	8	890	c.874C>T	c.(874-876)Cgg>Tgg	p.R292W	PIP4K2C_ENST00000540759.2_Missense_Mutation_p.R292W|PIP4K2C_ENST00000422156.3_Missense_Mutation_p.R244W|PIP4K2C_ENST00000550465.1_Missense_Mutation_p.R274W			Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, gamma	292	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|identical protein binding (GO:0042802)	p.R292W(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(13)|pancreas(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Melanoma(17;0.122)					CGACATCATTCGGGGCTCTGA	0.562																																							uc001sou.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|lung(1)	3						c.(874-876)CGG>TGG		phosphatidylinositol-5-phosphate 4-kinase, type							190.0	191.0	190.0					12																	57994654		2203	4300	6503	SO:0001583	missense	79837					cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding	g.chr12:57994654C>T	AK125526	CCDS8946.1, CCDS53808.1, CCDS55839.1	12q13.3	2014-09-04	2007-08-14	2007-08-14	ENSG00000166908	ENSG00000166908			23786	protein-coding gene	gene with protein product			"""phosphatidylinositol-4-phosphate 5-kinase, type II, gamma"""	PIP5K2C		9367159	Standard	NM_024779		Approved	FLJ22055	uc001sot.3	Q8TBX8	OTTHUMG00000170144	ENST00000354947.5:c.874C>T	12.37:g.57994654C>T	ENSP00000347032:p.Arg292Trp		Somatic				PIP4K2C_uc001sot.2_Missense_Mutation_p.R292W|PIP4K2C_uc010srs.1_Missense_Mutation_p.R274W|PIP4K2C_uc010srt.1_Missense_Mutation_p.R244W	p.R292W	NM_001146258	NP_001139730	WXS	Illumina HiSeq	Unspecified	Q8TBX8	PI42C_HUMAN			8	1005	+	Melanoma(17;0.122)		292			PIPK.		B2RDL3|B4DM11|B4DY44|Q9H6N2	Missense_Mutation	SNP	ENST00000354947.5	37	c.874C>T	CCDS8946.1	.	.	.	.	.	.	.	.	.	.	C	18.48	3.634052	0.67130	.	.	ENSG00000166908	ENST00000422156;ENST00000540759;ENST00000550465;ENST00000354947	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.0	3.03	0.35002	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.132077	0.52532	D	0.000076	T	0.61590	0.2359	H	0.94847	3.59	0.53005	D	0.999968	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.997;0.959;0.998	T	0.67496	-0.5656	10	0.87932	D	0	-9.6272	8.163	0.31209	0.0:0.7493:0.16:0.0907	.	244;274;292	B4DM11;B4DY44;Q8TBX8	.;.;PI42C_HUMAN	W	244;292;274;292	ENSP00000412035:R244W;ENSP00000439878:R292W;ENSP00000447390:R274W;ENSP00000347032:R292W	ENSP00000347032:R292W	R	+	1	2	PIP4K2C	56280921	0.968000	0.33430	0.999000	0.59377	0.995000	0.86356	2.332000	0.43903	1.234000	0.43709	0.555000	0.69702	CGG		0.562	PIP4K2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407644.1	NM_024779		31	239	0	0	0	0.013726	0	31	239				
IRAK3	11213	broad.mit.edu	37	12	66638982	66638982	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:66638982C>T	ENST00000261233.4	+	11	1675	c.1254C>T	c.(1252-1254)ctC>ctT	p.L418L	IRAK3_ENST00000457197.2_Silent_p.L357L	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3									p.L418L(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		CTGCCAAGCTCTTCTGTTTGG	0.463																																							uc001sth.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8						c.(1252-1254)CTC>CTT		interleukin-1 receptor-associated kinase 3							79.0	81.0	81.0					12																	66638982		2203	4300	6503	SO:0001819	synonymous_variant	11213				interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity	g.chr12:66638982C>T	AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1254C>T	12.37:g.66638982C>T			Somatic				IRAK3_uc010ssy.1_Silent_p.L357L	p.L418L	NM_007199	NP_009130	WXS	Illumina HiSeq	Unspecified	Q9Y616	IRAK3_HUMAN		GBM - Glioblastoma multiforme(28;0.0203)	11	1356	+			418			Protein kinase.			Silent	SNP	ENST00000261233.4	37	c.1254C>T	CCDS8975.1																																																																																				0.463	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1			53	59	0	0	0	0.01441	0	53	59				
TRHDE	29953	broad.mit.edu	37	12	72936110	72936110	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:72936110C>A	ENST00000261180.4	+	7	1723	c.1627C>A	c.(1627-1629)Cat>Aat	p.H543N		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	543					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.H543N(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TTTTATGGGCCATTCAGTTTT	0.308																																							uc001sxa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1627-1629)CAT>AAT		thyrotropin-releasing hormone degrading enzyme							121.0	119.0	120.0					12																	72936110		2203	4299	6502	SO:0001583	missense	29953				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr12:72936110C>A	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1627C>A	12.37:g.72936110C>A	ENSP00000261180:p.His543Asn		Somatic					p.H543N	NM_013381	NP_037513	WXS	Illumina HiSeq	Unspecified	Q9UKU6	TRHDE_HUMAN			7	1657	+			543			Extracellular (Potential).		A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	c.1627C>A	CCDS9004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.62|16.62	3.174249|3.174249	0.57692|0.57692	.|.	.|.	ENSG00000072657|ENSG00000072657	ENST00000261180|ENST00000547300	T|.	0.04454|.	3.62|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	0.054745|.	0.85682|.	D|.	0.000000|.	T|T	0.51092|0.51092	0.1654|0.1654	N|N	0.13098|0.13098	0.295|0.295	0.49687|0.49687	D|D	0.99981|0.99981	B|.	0.32324|.	0.364|.	B|.	0.27170|.	0.077|.	T|T	0.45425|0.45425	-0.9262|-0.9262	10|5	0.19147|.	T|.	0.46|.	.|.	19.1904|19.1904	0.93664|0.93664	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	543|.	Q9UKU6|.	TRHDE_HUMAN|.	N|Q	543|130	ENSP00000261180:H543N|.	ENSP00000261180:H543N|.	H|P	+|+	1|2	0|0	TRHDE|TRHDE	71222377|71222377	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.610000|5.610000	0.67668|0.67668	2.604000|2.604000	0.88044|0.88044	0.561000|0.561000	0.74099|0.74099	CAT|CCA		0.308	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381		18	59	1	0	2.54575e-18	0.010504	3.56745e-18	18	59				
PPFIA2	8499	broad.mit.edu	37	12	81751934	81751934	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:81751934G>A	ENST00000549396.1	-	16	1860	c.1700C>T	c.(1699-1701)tCt>tTt	p.S567F	PPFIA2_ENST00000541570.2_Missense_Mutation_p.S134F|PPFIA2_ENST00000550359.2_Missense_Mutation_p.S414F|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000549325.1_Missense_Mutation_p.S549F|PPFIA2_ENST00000550584.2_Missense_Mutation_p.S567F|PPFIA2_ENST00000541017.1_5'UTR|PPFIA2_ENST00000443686.3_Missense_Mutation_p.S468F|PPFIA2_ENST00000552948.1_Missense_Mutation_p.S567F|PPFIA2_ENST00000407050.4_Missense_Mutation_p.S493F|PPFIA2_ENST00000333447.7_Missense_Mutation_p.S549F|PPFIA2_ENST00000548586.1_Missense_Mutation_p.S567F	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	567					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)		p.S567F(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TCTGTAATCAGACTGGCTGTC	0.418																																							uc001szo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|pancreas(1)	6						c.(1699-1701)TCT>TTT		PTPRF interacting protein alpha 2							48.0	47.0	47.0					12																	81751934		1861	4101	5962	SO:0001583	missense	8499							g.chr12:81751934G>A	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1700C>T	12.37:g.81751934G>A	ENSP00000450337:p.Ser567Phe		Somatic				PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_RNA	p.S567F	NM_003625	NP_003616	WXS	Illumina HiSeq	Unspecified	B7Z663	B7Z663_HUMAN			16	1861	-			493					B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	c.1700C>T	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.528157	0.64860	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948;ENST00000553058	T;T;T;T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19	5.62	5.62	0.85841	.	0.134066	0.52532	D	0.000070	T	0.35335	0.0928	L	0.38175	1.15	0.80722	D	1	B	0.31790	0.34	B	0.33890	0.172	T	0.09143	-1.0688	10	0.45353	T	0.12	-3.4251	19.6484	0.95791	0.0:0.0:1.0:0.0	.	567	O75334	LIPA2_HUMAN	F	567;549;134;493;578;549;567;468;567;148	ENSP00000450337:S567F;ENSP00000450298:S549F;ENSP00000438337:S134F;ENSP00000385093:S493F;ENSP00000327416:S549F;ENSP00000449338:S567F;ENSP00000388373:S468F;ENSP00000447868:S567F;ENSP00000448941:S148F	ENSP00000327416:S549F	S	-	2	0	PPFIA2	80276065	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.230000	0.95299	2.660000	0.90430	0.591000	0.81541	TCT		0.418	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1			4	6	0	0	0	0.009096	0	4	6				
LRRIQ1	84125	broad.mit.edu	37	12	85449837	85449837	+	Silent	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:85449837A>T	ENST00000393217.2	+	8	1327	c.1266A>T	c.(1264-1266)atA>atT	p.I422I		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	422								p.I422I(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AGGGTGATATAGCCAAAAATC	0.323																																							uc001tac.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1264-1266)ATA>ATT		leucine-rich repeats and IQ motif containing 1							83.0	95.0	91.0					12																	85449837		2202	4296	6498	SO:0001819	synonymous_variant	84125							g.chr12:85449837A>T	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1266A>T	12.37:g.85449837A>T			Somatic				LRRIQ1_uc001tab.1_Silent_p.I422I|LRRIQ1_uc001taa.1_Silent_p.I397I	p.I422I	NM_001079910	NP_001073379	WXS	Illumina HiSeq	Unspecified	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	8	1377	+			422					Q567P4|Q9BS17|Q9HA36	Silent	SNP	ENST00000393217.2	37	c.1266A>T	CCDS41816.1																																																																																				0.323	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		49	84	0	0	0	0.01441	0	49	84				
MYBPC1	4604	broad.mit.edu	37	12	102038549	102038549	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr12:102038549G>T	ENST00000550270.1	+	10	865	c.865G>T	c.(865-867)Ggt>Tgt	p.G289C	MYBPC1_ENST00000541119.1_Missense_Mutation_p.G277C|MYBPC1_ENST00000441232.1_Missense_Mutation_p.G289C|MYBPC1_ENST00000361685.2_Missense_Mutation_p.G314C|MYBPC1_ENST00000551300.1_Missense_Mutation_p.G190C|MYBPC1_ENST00000361466.2_Missense_Mutation_p.G314C|MYBPC1_ENST00000360610.2_Missense_Mutation_p.G289C|MYBPC1_ENST00000553190.1_Missense_Mutation_p.G289C|MYBPC1_ENST00000392934.3_Missense_Mutation_p.G276C|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000547509.1_Missense_Mutation_p.G275C|MYBPC1_ENST00000452455.2_Missense_Mutation_p.G289C|RP11-755O11.2_ENST00000552081.1_RNA|MYBPC1_ENST00000549145.1_Missense_Mutation_p.G302C|MYBPC1_ENST00000547405.1_Missense_Mutation_p.G263C|MYBPC1_ENST00000545503.2_Missense_Mutation_p.G289C|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000536007.1_Missense_Mutation_p.G270C			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	289	Ig-like C2-type 2.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.G289C(1)|p.G314C(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						GTATAAAAATGGTCAAGAAAT	0.393																																							uc001tii.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|liver(1)|skin(1)	4						c.(865-867)GGT>TGT		myosin binding protein C, slow type isoform 3							84.0	78.0	80.0					12																	102038549		2203	4300	6503	SO:0001583	missense	4604				cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding	g.chr12:102038549G>T		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.865G>T	12.37:g.102038549G>T	ENSP00000449702:p.Gly289Cys		Somatic				MYBPC1_uc001tif.1_Missense_Mutation_p.G302C|MYBPC1_uc001tig.2_Missense_Mutation_p.G314C|MYBPC1_uc010svq.1_Missense_Mutation_p.G276C|MYBPC1_uc001tih.2_Missense_Mutation_p.G314C|MYBPC1_uc001tij.2_Missense_Mutation_p.G289C|MYBPC1_uc010svr.1_Missense_Mutation_p.G289C|MYBPC1_uc010svs.1_Missense_Mutation_p.G289C|MYBPC1_uc010svt.1_Missense_Mutation_p.G277C|MYBPC1_uc010svu.1_Missense_Mutation_p.G270C|MYBPC1_uc001tik.2_Missense_Mutation_p.G263C	p.G289C	NM_206820	NP_996556	WXS	Illumina HiSeq	Unspecified	Q00872	MYPC1_HUMAN			10	967	+			289			Ig-like C2-type 2.		B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	ENST00000550270.1	37	c.865G>T	CCDS9085.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.800607	0.90538	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000540770;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45	5.8	5.8	0.92144	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000069	D	0.84065	0.5390	H	0.98068	4.14	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.89501	0.3764	10	0.87932	D	0	.	19.6671	0.95896	0.0:0.0:1.0:0.0	.	270;277;289;289;276;263;289;289;314;314;302	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2;F8VZY0	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.;.	C	263;289;289;289;276;275;314;302;289;314;289;270;277;314;190;289	ENSP00000448175:G263C;ENSP00000400908:G289C;ENSP00000388989:G289C;ENSP00000353822:G289C;ENSP00000376665:G276C;ENSP00000447362:G275C;ENSP00000354845:G314C;ENSP00000447660:G302C;ENSP00000447900:G289C;ENSP00000440034:G289C;ENSP00000446128:G270C;ENSP00000442847:G277C;ENSP00000354849:G314C;ENSP00000447116:G190C;ENSP00000449702:G289C	ENSP00000353822:G289C	G	+	1	0	MYBPC1	100562680	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.741000	0.93983	0.655000	0.94253	GGT		0.393	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1			19	27	1	0	8.10497e-08	0.010504	9.43329e-08	19	27				
SACS	26278	broad.mit.edu	37	13	23915110	23915110	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr13:23915110T>A	ENST00000382292.3	-	9	3178	c.2905A>T	c.(2905-2907)Agt>Tgt	p.S969C	SACS_ENST00000402364.1_Missense_Mutation_p.S219C|SACS_ENST00000382298.3_Missense_Mutation_p.S969C			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	969					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.S822C(1)|p.S969C(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TCATCACTACTGTCTATTACT	0.358																																							uc001uon.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(2905-2907)AGT>TGT		sacsin							68.0	68.0	68.0					13																	23915110		2203	4300	6503	SO:0001583	missense	26278				cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding	g.chr13:23915110T>A	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.2905A>T	13.37:g.23915110T>A	ENSP00000371729:p.Ser969Cys		Somatic				SACS_uc001uoo.2_Missense_Mutation_p.S822C|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	p.S969C	NM_014363	NP_055178	WXS	Illumina HiSeq	Unspecified	Q9NZJ4	SACS_HUMAN		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)	10	3494	-		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)	969					O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	c.2905A>T	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	13.84	2.356879	0.41801	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88046	-2.18;-2.33;-2.18	6.05	3.59	0.41128	.	0.185958	0.64402	D	0.000018	T	0.75317	0.3833	N	0.17082	0.46	0.30228	N	0.796173	B	0.02656	0.0	B	0.04013	0.001	T	0.67562	-0.5639	10	0.48119	T	0.1	.	7.9165	0.29820	0.1231:0.0659:0.0:0.811	.	969	Q9NZJ4	SACS_HUMAN	C	969;219;969	ENSP00000371729:S969C;ENSP00000385844:S219C;ENSP00000371735:S969C	ENSP00000371729:S969C	S	-	1	0	SACS	22813110	1.000000	0.71417	0.991000	0.47740	0.995000	0.86356	3.168000	0.50801	0.511000	0.28236	0.528000	0.53228	AGT		0.358	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		43	18	0	0	0	0.00874	0	43	18				
MEDAG	84935	broad.mit.edu	37	13	31495960	31495960	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr13:31495960G>T	ENST00000380482.4	+	4	1089	c.764G>T	c.(763-765)cGa>cTa	p.R255L	TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000586973.1_RNA|TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000588425.1_RNA|TEX26-AS1_ENST00000593246.1_RNA|TEX26-AS1_ENST00000586464.1_RNA|TEX26-AS1_ENST00000451495.2_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	255					positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)		p.R255L(1)									TTCTCTGACCGAAAGTTCAGT	0.363																																							uc001uth.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(763-765)CGA>CTA		hypothetical protein LOC84935							46.0	47.0	47.0					13																	31495960		2203	4300	6503	SO:0001583	missense	84935							g.chr13:31495960G>T	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.764G>T	13.37:g.31495960G>T	ENSP00000369849:p.Arg255Leu		Somatic				uc001utg.1_Intron	p.R255L	NM_032849	NP_116238	WXS	Illumina HiSeq	Unspecified	Q5VYS4	CM033_HUMAN		all cancers(112;0.00914)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.0559)|GBM - Glioblastoma multiforme(144;0.244)	4	1105	+		Lung SC(185;0.0281)	255					Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	ENST00000380482.4	37	c.764G>T	CCDS9338.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.378683	0.82682	.	.	ENSG00000102802	ENST00000380482	T	0.59364	0.27	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000012	T	0.66665	0.2812	L	0.29908	0.895	0.38309	D	0.943207	D	0.67145	0.996	D	0.79108	0.992	T	0.71938	-0.4441	10	0.87932	D	0	-11.9775	16.471	0.84112	0.0:0.0:1.0:0.0	.	255	Q5VYS4	CM033_HUMAN	L	255	ENSP00000369849:R255L	ENSP00000369849:R255L	R	+	2	0	C13orf33	30393960	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	5.741000	0.68638	2.626000	0.88956	0.462000	0.41574	CGA		0.363	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044375.1	NM_032849		29	6	1	0	1.04266e-39	0.021022	1.67385e-39	29	6				
NBEA	26960	broad.mit.edu	37	13	36167465	36167465	+	Splice_Site	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr13:36167465G>A	ENST00000400445.3	+	47	7711	c.7177G>A	c.(7177-7179)Gaa>Aaa	p.E2393K	NBEA_ENST00000540320.1_Splice_Site_p.E2393K|NBEA_ENST00000537702.1_Splice_Site_p.E186K|NBEA_ENST00000379922.3_5'UTR|NBEA_ENST00000379939.2_Splice_Site_p.E2390K|NBEA_ENST00000310336.4_Splice_Site_p.E2393K	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2393	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026, ECO:0000305}.				protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.E2393K(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTTTGCTTAGGAACCTTTCAC	0.408																																							uc001uvb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|large_intestine(2)	11						c.(7177-7179)GAA>AAA		neurobeachin							162.0	146.0	151.0					13																	36167465		1871	4101	5972	SO:0001630	splice_region_variant	26960					cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding	g.chr13:36167465G>A	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.7177-1G>A	13.37:g.36167465G>A			Somatic				NBEA_uc010abi.2_Missense_Mutation_p.E1049K|NBEA_uc010tee.1_Missense_Mutation_p.E186K|NBEA_uc010tef.1_Missense_Mutation_p.E186K|NBEA_uc010teg.1_Missense_Mutation_p.E186K|NBEA_uc001uvd.2_5'UTR	p.E2393K	NM_015678	NP_056493	WXS	Illumina HiSeq	Unspecified	Q8NFP9	NBEA_HUMAN		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)	47	7383	+		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)	2393			BEACH.		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	c.7177G>A	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540649	0.85917	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000543274;ENST00000537702	D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52	5.91	5.91	0.95273	BEACH domain (4);	0.000000	0.85682	D	0.000000	D	0.87537	0.6202	M	0.85859	2.78	0.80722	D	1	B;B	0.23937	0.002;0.094	B;B	0.38156	0.024;0.266	D	0.85083	0.0947	10	0.66056	D	0.02	.	20.2799	0.98512	0.0:0.0:1.0:0.0	.	2393;2390	Q8NFP9;Q5T321	NBEA_HUMAN;.	K	2393;2393;2390;2393;1020;186;186	ENSP00000440951:E2393K;ENSP00000383295:E2393K;ENSP00000369271:E2390K;ENSP00000308534:E2393K;ENSP00000440233:E186K	ENSP00000308534:E2393K	E	+	1	0	NBEA	35065465	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.317000	0.96327	2.794000	0.96219	0.650000	0.86243	GAA		0.408	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	Missense_Mutation	32	5	0	0	0	0.012213	0	32	5				
POTEG	404785	broad.mit.edu	37	14	19553741	19553741	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr14:19553741T>A	ENST00000409832.3	+	1	377	c.325T>A	c.(325-327)Tgc>Agc	p.C109S		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	109								p.C109S(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						CTTCCCCTGCTGCAGGGGGAG	0.592																																							uc001vuz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(325-327)TGC>AGC		POTE ankyrin domain family, member G							230.0	255.0	247.0					14																	19553741		2201	4297	6498	SO:0001583	missense	404785							g.chr14:19553741T>A		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.325T>A	14.37:g.19553741T>A	ENSP00000386971:p.Cys109Ser		Somatic				POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	p.C109S	NM_001005356	NP_001005356	WXS	Illumina HiSeq	Unspecified	Q6S5H5	POTEG_HUMAN			1	377	+			109					A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	c.325T>A	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	t	4.930	0.172773	0.09391	.	.	ENSG00000222036	ENST00000409832	T	0.27557	1.66	0.568	-1.14	0.09741	.	.	.	.	.	T	0.24392	0.0591	L	0.59436	1.845	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.26677	-1.0096	8	0.32370	T	0.25	.	.	.	.	.	109	Q6S5H5	POTEG_HUMAN	S	109	ENSP00000386971:C109S	ENSP00000386971:C109S	C	+	1	0	POTEG	18623741	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.129000	0.10515	-0.414000	0.07495	-0.537000	0.04273	TGC		0.592	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356		44	250	0	0	0	0.01441	0	44	250				
SSTR1	6751	broad.mit.edu	37	14	38679067	38679067	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr14:38679067C>T	ENST00000267377.2	+	3	1090	c.473C>T	c.(472-474)gCc>gTc	p.A158V		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	158					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.A158V(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	CGCTACGTGGCCGTGGTGCAT	0.647																																							uc001wul.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|ovary(1)|lung(1)	5						c.(472-474)GCC>GTC		somatostatin receptor 1	Octreotide(DB00104)						100.0	95.0	97.0					14																	38679067		2203	4299	6502	SO:0001583	missense	6751				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity	g.chr14:38679067C>T		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.473C>T	14.37:g.38679067C>T	ENSP00000267377:p.Ala158Val		Somatic				SSTR1_uc010amu.1_Intron	p.A158V	NM_001049	NP_001040	WXS	Illumina HiSeq	Unspecified	P30872	SSR1_HUMAN	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	3	1090	+	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		158			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000267377.2	37	c.473C>T	CCDS9666.1	.	.	.	.	.	.	.	.	.	.	C	32	5.122058	0.94429	.	.	ENSG00000139874	ENST00000267377	T	0.52057	0.68	4.82	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	0.099404	0.41823	D	0.000812	T	0.70657	0.3249	M	0.79926	2.475	0.58432	D	0.999998	D	0.71674	0.998	D	0.77557	0.99	T	0.75659	-0.3241	10	0.87932	D	0	.	17.0667	0.86561	0.0:1.0:0.0:0.0	.	158	P30872	SSR1_HUMAN	V	158	ENSP00000267377:A158V	ENSP00000267377:A158V	A	+	2	0	SSTR1	37748818	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.625000	0.83145	2.514000	0.84764	0.561000	0.74099	GCC		0.647	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2			39	11	0	0	0	0.007835	0	39	11				
RTN1	6252	broad.mit.edu	37	14	60193880	60193880	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr14:60193880C>A	ENST00000267484.5	-	3	1857	c.1522G>T	c.(1522-1524)Gag>Tag	p.E508*		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	508					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.E508*(1)		central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GGCGCACGCTCCTCGGCCCGG	0.731																																							uc001xen.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(1522-1524)GAG>TAG		reticulon 1 isoform A							7.0	10.0	9.0					14																	60193880		2179	4269	6448	SO:0001587	stop_gained	6252				neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity	g.chr14:60193880C>A	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1522G>T	14.37:g.60193880C>A	ENSP00000267484:p.Glu508*		Somatic				RTN1_uc001xem.1_Nonsense_Mutation_p.E88*	p.E508*	NM_021136	NP_066959	WXS	Illumina HiSeq	Unspecified	Q16799	RTN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0968)	3	1731	-			508					Q16800|Q16801|Q5BKZ4|Q9BQ59	Nonsense_Mutation	SNP	ENST00000267484.5	37	c.1522G>T	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	C	42	9.175638	0.99091	.	.	ENSG00000139970	ENST00000432103;ENST00000267484;ENST00000433623	.	.	.	5.02	4.12	0.48240	.	1.243620	0.05521	N	0.562051	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	15.3435	0.74317	0.0:0.8595:0.1405:0.0	.	.	.	.	X	88;508;434	.	ENSP00000267484:E508X	E	-	1	0	RTN1	59263633	0.561000	0.26578	0.472000	0.27241	0.071000	0.16799	1.956000	0.40382	1.082000	0.41137	0.563000	0.77884	GAG		0.731	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2			3	1	1	0	0.004672	0.004672	0.0048335	3	1				
SPTB	6710	broad.mit.edu	37	14	65289696	65289696	+	Silent	SNP	G	G	T	rs147811055		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr14:65289696G>T	ENST00000389721.5	-	1	149	c.117C>A	c.(115-117)ctC>ctA	p.L39L	SPTB_ENST00000542895.1_Silent_p.L39L|SPTB_ENST00000556626.1_Silent_p.L39L|SPTB_ENST00000389722.3_Silent_p.L39L|SPTB_ENST00000389720.3_Silent_p.L39L	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	39	Actin-binding.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.L39L(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		ACCTCTCAAAGAGCCTGGCTG	0.562											OREG0022736	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001xht.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11						c.(115-117)CTC>CTA		spectrin beta isoform b							132.0	119.0	123.0					14																	65289696		2203	4300	6503	SO:0001819	synonymous_variant	6710				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton	g.chr14:65289696G>T		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.117C>A	14.37:g.65289696G>T			Somatic	OREG0022736	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1083	SPTB_uc001xhr.2_Silent_p.L39L|SPTB_uc001xhs.2_Silent_p.L39L|SPTB_uc001xhu.2_Silent_p.L39L	p.L39L	NM_000347	NP_000338	WXS	Illumina HiSeq	Unspecified	P11277	SPTB1_HUMAN		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)	1	171	-		all_lung(585;4.15e-09)	39			Actin-binding.		Q15510|Q15519	Silent	SNP	ENST00000389721.5	37	c.117C>A	CCDS32100.1																																																																																				0.562	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			41	9	1	0	2.35958e-20	0.009718	3.36281e-20	41	9				
ACOT4	122970	broad.mit.edu	37	14	74061971	74061971	+	Silent	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr14:74061971G>C	ENST00000326303.4	+	3	1133	c.879G>C	c.(877-879)gtG>gtC	p.V293V		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	293					acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)	p.V293V(1)		endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		TGGACATTGTGGATATAAGGA	0.507																																							uc001xoo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(877-879)GTG>GTC		acyl-CoA thioesterase 4							87.0	86.0	86.0					14																	74061971		2203	4300	6503	SO:0001819	synonymous_variant	122970				acyl-CoA metabolic process|dicarboxylic acid metabolic process|long-chain fatty acid metabolic process|saturated monocarboxylic acid metabolic process|short-chain fatty acid metabolic process|succinyl-CoA metabolic process|unsaturated monocarboxylic acid metabolic process|very long-chain fatty acid metabolic process	peroxisome	carboxylesterase activity|palmitoyl-CoA hydrolase activity	g.chr14:74061971G>C	BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.879G>C	14.37:g.74061971G>C			Somatic					p.V293V	NM_152331	NP_689544	WXS	Illumina HiSeq	Unspecified	Q8N9L9	ACOT4_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00331)	3	1133	+			293					Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Silent	SNP	ENST00000326303.4	37	c.879G>C	CCDS9817.1																																																																																				0.507	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404298.2	NM_152331		28	6	0	0	0	0.007291	0	28	6				
SYNDIG1L	646658	broad.mit.edu	37	14	74876055	74876055	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr14:74876055C>T	ENST00000554823.1	-	1	454	c.393G>A	c.(391-393)caG>caA	p.Q131Q	SYNDIG1L_ENST00000331628.3_Silent_p.Q131Q			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	131					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.Q131Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						GGTCATCCTCCTGGTCCCGCA	0.532																																							uc001xpx.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(391-393)CAG>CAA		transmembrane protein 90A							91.0	97.0	95.0					14																	74876055		2061	4191	6252	SO:0001819	synonymous_variant	646658				response to biotic stimulus	Golgi apparatus|integral to membrane		g.chr14:74876055C>T		CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.393G>A	14.37:g.74876055C>T			Somatic					p.Q131Q	NM_001105579	NP_001099049	WXS	Illumina HiSeq	Unspecified	A6NDD5	SYN1L_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00159)	2	641	-			131						Silent	SNP	ENST00000554823.1	37	c.393G>A	CCDS41970.1																																																																																				0.532	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412341.1	XM_938515		75	12	0	0	0	0.01441	0	75	12				
CEP170B	283638	broad.mit.edu	37	14	105350364	105350364	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr14:105350364G>C	ENST00000414716.3	+	9	1476	c.1248G>C	c.(1246-1248)aaG>aaC	p.K416N	CEP170B_ENST00000418279.1_Missense_Mutation_p.K346N|CEP170B_ENST00000453495.1_Missense_Mutation_p.K417N|CEP170B_ENST00000556508.1_Missense_Mutation_p.K346N	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	416						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.K347N(1)|p.K416N(1)									CACCCCGAAAGAAGCGCTCCC	0.652																																							uc010axb.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(1246-1248)AAG>AAC		hypothetical protein LOC283638 isoform 1							30.0	35.0	34.0					14																	105350364		2039	4160	6199	SO:0001583	missense	283638					cytoplasm|microtubule		g.chr14:105350364G>C	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.1248G>C	14.37:g.105350364G>C	ENSP00000404151:p.Lys416Asn		Somatic				INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Missense_Mutation_p.K346N|KIAA0284_uc001yps.2_Missense_Mutation_p.K322N	p.K416N	NM_001112726	NP_001106197	WXS	Illumina HiSeq	Unspecified	Q9Y4F5	K0284_HUMAN	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)	9	1472	+		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	416					Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	37	c.1248G>C	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717560	0.68844	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279;ENST00000556215	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	4.25	1.95	0.26073	.	0.062571	0.64402	D	0.000009	T	0.53610	0.1807	M	0.72118	2.19	0.40724	D	0.982682	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.81914	0.995;0.993;0.964	T	0.56583	-0.7955	10	0.87932	D	0	-22.421	8.9941	0.36041	0.2826:0.0:0.7174:0.0	.	416;416;346	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	N	346;416;417;346;136	ENSP00000451249:K346N;ENSP00000404151:K416N;ENSP00000407238:K417N;ENSP00000415006:K346N	ENSP00000404151:K416N	K	+	3	2	KIAA0284	104421409	1.000000	0.71417	0.962000	0.40283	0.852000	0.48524	2.636000	0.46545	0.763000	0.33175	0.491000	0.48974	AAG		0.652	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726		4	1	0	0	0	0.014758	0	4	1				
NPAP1	23742	broad.mit.edu	37	15	24921226	24921226	+	Missense_Mutation	SNP	C	C	A	rs531772049		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr15:24921226C>A	ENST00000329468.2	+	1	686	c.212C>A	c.(211-213)cCg>cAg	p.P71Q		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	71					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P71Q(1)									CCTAAGAGGCCGTGTCCTCTC	0.701																																							uc001ywo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(211-213)CCG>CAG		hypothetical protein LOC23742							17.0	21.0	20.0					15																	24921226		2189	4273	6462	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24921226C>A	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.212C>A	15.37:g.24921226C>A	ENSP00000333735:p.Pro71Gln		Somatic					p.P71Q	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	686	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	71						Missense_Mutation	SNP	ENST00000329468.2	37	c.212C>A	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	7.495	0.651496	0.14516	.	.	ENSG00000185823	ENST00000329468	T	0.04970	3.52	2.45	-4.91	0.03085	.	2.023030	0.03147	N	0.167404	T	0.04003	0.0112	L	0.29908	0.895	0.09310	N	1	B	0.18166	0.026	B	0.08055	0.003	T	0.37842	-0.9688	10	0.19147	T	0.46	.	1.159	0.01802	0.3923:0.2884:0.1794:0.14	.	71	Q9NZP6	CO002_HUMAN	Q	71	ENSP00000333735:P71Q	ENSP00000333735:P71Q	P	+	2	0	C15orf2	22472319	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.307000	0.02733	-1.916000	0.01075	-1.512000	0.00943	CCG		0.701	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		8	16	1	0	0.00621372	0.006214	0.00641268	8	16				
GABRA5	2558	broad.mit.edu	37	15	27159949	27159949	+	Splice_Site	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr15:27159949G>T	ENST00000335625.5	+	7	1385		c.e7-1		GABRA5_ENST00000557449.1_Splice_Site|GABRA5_ENST00000355395.5_Splice_Site|GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Splice_Site	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5						associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.?(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	TTATTTTTCAGCTTGACCATC	0.448																																							uc001zbd.1		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e8-1		gamma-aminobutyric acid A receptor, alpha 5	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						70.0	71.0	71.0					15																	27159949		1958	4165	6123	SO:0001630	splice_region_variant	2558				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27159949G>T		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.498-1G>T	15.37:g.27159949G>T			Somatic				GABRB3_uc001zbb.2_Intron	p.R166_splice	NM_000810	NP_000801	WXS	Illumina HiSeq	Unspecified	P31644	GBRA5_HUMAN		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	8	837	+		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)						A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Splice_Site	SNP	ENST00000335625.5	37	c.498_splice	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805527	0.70682	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000555182;ENST00000400081;ENST00000554599	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9414	0.86219	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GABRA5	24742695	1.000000	0.71417	0.832000	0.32986	0.699000	0.40488	8.693000	0.91288	2.588000	0.87417	0.655000	0.94253	.		0.448	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		Intron	11	15	1	0	2.27111e-07	0.013537	2.58586e-07	11	15				
RYR3	6263	broad.mit.edu	37	15	33835899	33835899	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr15:33835899G>T	ENST00000389232.4	+	8	793	c.723G>T	c.(721-723)caG>caT	p.Q241H	RYR3_ENST00000415757.3_Missense_Mutation_p.Q241H	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	241	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.Q241H(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CTACAGACCAGAATGATTCCC	0.398																																							uc001zhi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(721-723)CAG>CAT		ryanodine receptor 3							236.0	222.0	227.0					15																	33835899		1946	4146	6092	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33835899G>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.723G>T	15.37:g.33835899G>T	ENSP00000373884:p.Gln241His		Somatic				RYR3_uc010bar.2_Missense_Mutation_p.Q241H	p.Q241H	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	8	793	+		all_lung(180;7.18e-09)	241			MIR 3.|Cytoplasmic (By similarity).		O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.723G>T	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188009	0.57909	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.91686	-2.89;-2.89	5.02	4.11	0.48088	MIR motif (2);MIR (2);	0.254760	0.35262	N	0.003321	D	0.90865	0.7130	L	0.42245	1.32	0.45515	D	0.998479	P;P	0.49253	0.904;0.921	P;P	0.55222	0.66;0.771	D	0.87113	0.2186	10	0.17369	T	0.5	.	9.4919	0.38965	0.1623:0.0:0.8377:0.0	.	241;241	Q15413-2;Q15413	.;RYR3_HUMAN	H	241	ENSP00000373884:Q241H;ENSP00000399610:Q241H	ENSP00000354735:Q241H	Q	+	3	2	RYR3	31623191	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.938000	0.40203	1.344000	0.45657	0.563000	0.77884	CAG		0.398	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			49	92	1	0	2.68985e-26	0.01441	4.12838e-26	49	92				
RYR3	6263	broad.mit.edu	37	15	34130188	34130188	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr15:34130188G>A	ENST00000389232.4	+	89	12077	c.12007G>A	c.(12007-12009)Gaa>Aaa	p.E4003K	RYR3_ENST00000415757.3_Missense_Mutation_p.E3998K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4003					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.E4002K(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AAATCTTTCTGAACACATGCC	0.448																																							uc001zhi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(12007-12009)GAA>AAA		ryanodine receptor 3							121.0	121.0	121.0					15																	34130188		1955	4148	6103	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34130188G>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.12007G>A	15.37:g.34130188G>A	ENSP00000373884:p.Glu4003Lys		Somatic				RYR3_uc010bar.2_Missense_Mutation_p.E3998K	p.E4003K	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	89	12077	+		all_lung(180;7.18e-09)	4003					O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.12007G>A	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511057	0.85389	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	D	0.99032	-5.35	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.99199	0.9722	M	0.73962	2.25	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.73380	0.98;0.978	D	0.99705	1.1005	10	0.62326	D	0.03	.	19.0504	0.93041	0.0:0.0:1.0:0.0	.	3998;4003	Q15413-2;Q15413	.;RYR3_HUMAN	K	4003;3999	ENSP00000373884:E4003K	ENSP00000354735:E3999K	E	+	1	0	RYR3	31917480	1.000000	0.71417	0.911000	0.35937	0.973000	0.67179	9.530000	0.98051	2.737000	0.93849	0.551000	0.68910	GAA		0.448	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			56	61	0	0	0	0.01441	0	56	61				
MGA	23269	broad.mit.edu	37	15	42005461	42005461	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr15:42005461G>T	ENST00000570161.1	+	8	3197	c.3197G>T	c.(3196-3198)cGc>cTc	p.R1066L	MGA_ENST00000545763.1_Missense_Mutation_p.R1066L|MGA_ENST00000566586.1_Missense_Mutation_p.R1066L|MGA_ENST00000389936.4_Missense_Mutation_p.R1066L|MGA_ENST00000219905.7_Missense_Mutation_p.R1066L			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.R1066L(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTGGAGAAGCGCCAACCTGCT	0.448																																							uc001zog.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(3196-3198)CGC>CTC		MAX-interacting protein isoform 2							159.0	151.0	154.0					15																	42005461		1988	4149	6137	SO:0001583	missense	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:42005461G>T	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.3197G>T	15.37:g.42005461G>T	ENSP00000457035:p.Arg1066Leu		Somatic				MGA_uc010ucy.1_Missense_Mutation_p.R1066L|MGA_uc010ucz.1_Missense_Mutation_p.R1066L	p.R1066L	NM_001080541	NP_001074010	WXS	Illumina HiSeq	Unspecified	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	9	3288	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	1066					Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	c.3197G>T	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779937	0.90195	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.15718	2.4;2.4;2.4	5.75	5.75	0.90469	.	0.244013	0.40818	N	0.001004	T	0.29389	0.0732	L	0.29908	0.895	0.38917	D	0.957656	D;D	0.71674	0.998;0.998	D;D	0.73380	0.98;0.93	T	0.03184	-1.1063	10	0.87932	D	0	.	13.1821	0.59660	0.0727:0.0:0.9273:0.0	.	1066;1066	F5H7K2;E7ENI0	.;.	L	1066	ENSP00000219905:R1066L;ENSP00000374586:R1066L;ENSP00000442467:R1066L	ENSP00000219905:R1066L	R	+	2	0	MGA	39792753	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.094000	0.57721	2.716000	0.92895	0.655000	0.94253	CGC		0.448	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		32	33	1	0	5.90632e-09	0.012213	7.11135e-09	32	33				
TGM5	9333	broad.mit.edu	37	15	43552773	43552773	+	Silent	SNP	T	T	C	rs200656120		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr15:43552773T>C	ENST00000220420.5	-	2	22	c.15A>G	c.(13-15)ctA>ctG	p.L5L	TGM5_ENST00000349114.4_Silent_p.L5L	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	5					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.L5L(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GGGCCACTTCTAGCCCTGCAA	0.542													T|||	1	0.000199681	0.0	0.0	5008	,	,		18859	0.001		0.0	False		,,,				2504	0.0						uc001zrd.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(13-15)CTA>CTG		transglutaminase 5 isoform 1	L-Glutamine(DB00130)						76.0	80.0	78.0					15																	43552773		2202	4299	6501	SO:0001819	synonymous_variant	9333				epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr15:43552773T>C	AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.15A>G	15.37:g.43552773T>C			Somatic				TGM5_uc001zre.1_Silent_p.L5L	p.L5L	NM_201631	NP_963925	WXS	Illumina HiSeq	Unspecified	O43548	TGM5_HUMAN		GBM - Glioblastoma multiforme(94;4e-07)	2	23	-		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)	5					O43549|Q0VF40|Q9UEZ4	Silent	SNP	ENST00000220420.5	37	c.15A>G	CCDS32212.1																																																																																				0.542	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432257.1	NM_004245		46	32	0	0	0	0.01441	0	46	32				
ATP8B4	79895	broad.mit.edu	37	15	50154564	50154564	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr15:50154564G>T	ENST00000284509.6	-	27	3316	c.3175C>A	c.(3175-3177)Cga>Aga	p.R1059R	ATP8B4_ENST00000559829.1_Silent_p.R1059R	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	1059						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R1059R(1)		breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		AGGGAATGTCGTGCATTACCT	0.358																																							uc001zxu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|breast(2)|large_intestine(1)	8						c.(3175-3177)CGA>AGA		ATPase class I type 8B member 4							83.0	77.0	79.0					15																	50154564		2196	4295	6491	SO:0001819	synonymous_variant	79895				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:50154564G>T	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.3175C>A	15.37:g.50154564G>T			Somatic				ATP8B4_uc010ber.2_Silent_p.R932R|ATP8B4_uc010ufd.1_Silent_p.R869R|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxt.2_Silent_p.R62R	p.R1059R	NM_024837	NP_079113	WXS	Illumina HiSeq	Unspecified	Q8TF62	AT8B4_HUMAN		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)	27	3317	-		all_lung(180;0.00183)	1059			Extracellular (Potential).		Q9H727	Silent	SNP	ENST00000284509.6	37	c.3175C>A	CCDS32238.1																																																																																				0.358	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		27	26	1	0	9.39395e-14	0.00632	1.25352e-13	27	26				
ATP8B4	79895	broad.mit.edu	37	15	50158550	50158550	+	Silent	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr15:50158550T>A	ENST00000284509.6	-	26	3300	c.3159A>T	c.(3157-3159)ccA>ccT	p.P1053P	ATP8B4_ENST00000559829.1_Silent_p.P1053P	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	1053						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.P1053P(1)		breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TACCAACAAATGGAAACTGGT	0.388																																							uc001zxu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|breast(2)|large_intestine(1)	8						c.(3157-3159)CCA>CCT		ATPase class I type 8B member 4							93.0	84.0	87.0					15																	50158550		2196	4295	6491	SO:0001819	synonymous_variant	79895				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:50158550T>A	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.3159A>T	15.37:g.50158550T>A			Somatic				ATP8B4_uc010ber.2_Silent_p.P926P|ATP8B4_uc010ufd.1_Silent_p.P863P|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxt.2_Silent_p.P56P	p.P1053P	NM_024837	NP_079113	WXS	Illumina HiSeq	Unspecified	Q8TF62	AT8B4_HUMAN		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)	26	3301	-		all_lung(180;0.00183)	1053			Extracellular (Potential).		Q9H727	Silent	SNP	ENST00000284509.6	37	c.3159A>T	CCDS32238.1																																																																																				0.388	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		25	52	0	0	0	0.021523	0	25	52				
C15orf27	123591	broad.mit.edu	37	15	76496245	76496245	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr15:76496245C>T	ENST00000388942.3	+	11	1461	c.1185C>T	c.(1183-1185)acC>acT	p.T395T		NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	395					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)	p.T395T(1)		endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						GCTCAGTCACCCGGGCCCAGA	0.677																																							uc002bbq.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1183-1185)ACC>ACT		hypothetical protein LOC123591							63.0	62.0	62.0					15																	76496245		2197	4294	6491	SO:0001819	synonymous_variant	123591					integral to membrane		g.chr15:76496245C>T	AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.1185C>T	15.37:g.76496245C>T			Somatic				C15orf27_uc010bkp.2_Silent_p.T211T|C15orf27_uc002bbr.2_Silent_p.T211T|C15orf27_uc002bbs.2_Silent_p.T73T	p.T395T	NM_152335	NP_689548	WXS	Illumina HiSeq	Unspecified	Q2M3C6	CO027_HUMAN			11	1340	+			395					Q8N993|Q96LL5	Silent	SNP	ENST00000388942.3	37	c.1185C>T	CCDS10289.2																																																																																				0.677	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286637.2	NM_152335		23	17	0	0	0	0.016522	0	23	17				
ZNF592	9640	broad.mit.edu	37	15	85325992	85325992	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr15:85325992C>T	ENST00000560079.2	+	4	374	c.86C>T	c.(85-87)gCc>gTc	p.A29V	ZNF592_ENST00000299927.3_Missense_Mutation_p.A29V	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	29					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A29V(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCCAAGGAGGCCATCCAGACA	0.537																																							uc002bld.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)	6						c.(85-87)GCC>GTC		zinc finger protein 592							142.0	131.0	135.0					15																	85325992		2203	4299	6502	SO:0001583	missense	9640				cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:85325992C>T	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.86C>T	15.37:g.85325992C>T	ENSP00000452877:p.Ala29Val		Somatic				ZNF592_uc010upb.1_RNA	p.A29V	NM_014630	NP_055445	WXS	Illumina HiSeq	Unspecified	Q92610	ZN592_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		4	422	+			29					Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	c.86C>T	CCDS32317.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670545	0.67814	.	.	ENSG00000166716	ENST00000299927	T	0.01313	5.02	6.17	6.17	0.99709	.	0.156603	0.56097	D	0.000022	T	0.08492	0.0211	M	0.72894	2.215	0.50632	D	0.999888	D	0.76494	0.999	D	0.68943	0.961	T	0.00104	-1.2059	10	0.87932	D	0	-15.026	18.3732	0.90420	0.0:1.0:0.0:0.0	.	29	Q92610	ZN592_HUMAN	V	29	ENSP00000299927:A29V	ENSP00000299927:A29V	A	+	2	0	ZNF592	83126996	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.403000	0.59729	2.941000	0.99782	0.655000	0.94253	GCC		0.537	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		25	64	0	0	0	0.004656	0	25	64				
WDR90	197335	broad.mit.edu	37	16	716315	716315	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr16:716315G>T	ENST00000293879.4	+	37	4705	c.4705G>T	c.(4705-4707)Gcc>Tcc	p.A1569S	WDR90_ENST00000549091.1_Missense_Mutation_p.A1571S|WDR90_ENST00000547543.1_3'UTR|RHOT2_ENST00000315082.4_5'Flank|WDR90_ENST00000547944.1_Missense_Mutation_p.A168S|WDR90_ENST00000315764.4_Missense_Mutation_p.A168S			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1569								p.A1569S(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CCACCAGGGCGCCCCAATCTC	0.627																																							uc002cii.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(4705-4707)GCC>TCC		WD repeat domain 90							47.0	55.0	52.0					16																	716315		2006	4164	6170	SO:0001583	missense	197335							g.chr16:716315G>T	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.4705G>T	16.37:g.716315G>T	ENSP00000293879:p.Ala1569Ser		Somatic				WDR90_uc002cij.1_Intron|WDR90_uc002cil.1_RNA|WDR90_uc002cin.1_Missense_Mutation_p.A184S|WDR90_uc010uul.1_Missense_Mutation_p.A168S|WDR90_uc002cio.1_Missense_Mutation_p.A168S|WDR90_uc010bqx.1_Missense_Mutation_p.A168S|RHOT2_uc010uum.1_5'Flank|RHOT2_uc002cip.2_5'Flank|RHOT2_uc002ciq.2_5'Flank	p.A1569S	NM_145294	NP_660337	WXS	Illumina HiSeq	Unspecified	Q96KV7	WDR90_HUMAN			37	4759	+		Hepatocellular(780;0.0218)	1569			WD 20.		Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	c.4705G>T	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	G	6.104	0.387510	0.11581	.	.	ENSG00000161996	ENST00000549091;ENST00000293879;ENST00000547944;ENST00000315764	T;T;T;T	0.30182	3.46;1.54;3.57;3.86	3.96	1.78	0.24846	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.505542	0.23213	N	0.050652	T	0.13457	0.0326	N	0.13371	0.34	0.27373	N	0.955626	P;P;P;P	0.48162	0.834;0.906;0.593;0.848	B;B;B;B	0.41332	0.279;0.354;0.203;0.193	T	0.09773	-1.0659	10	0.17832	T	0.49	.	4.5666	0.12189	0.1202:0.0:0.585:0.2948	.	168;168;168;1569	Q96KV7-10;Q96KV7-7;G3V201;Q96KV7	.;.;.;WDR90_HUMAN	S	1571;1569;168;168	ENSP00000448122:A1571S;ENSP00000293879:A1569S;ENSP00000449576:A168S;ENSP00000322808:A168S	ENSP00000293879:A1569S	A	+	1	0	WDR90	656316	0.997000	0.39634	0.019000	0.16419	0.255000	0.26057	4.241000	0.58707	0.877000	0.35895	0.561000	0.74099	GCC		0.627	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294		25	26	1	0	2.44723e-14	0.004656	3.28651e-14	25	26				
NAA60	79903	broad.mit.edu	37	16	3533373	3533373	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr16:3533373A>T	ENST00000407558.4	+	6	651	c.348A>T	c.(346-348)ttA>ttT	p.L116F	NAA60_ENST00000575076.1_Missense_Mutation_p.L116F|NAA60_ENST00000573580.1_Missense_Mutation_p.L51F|NAA60_ENST00000360862.5_Missense_Mutation_p.L51F|NAA60_ENST00000610180.1_Missense_Mutation_p.L116F|NAA60_ENST00000576916.1_Intron|NAA60_ENST00000608722.1_Missense_Mutation_p.L116F|NAA60_ENST00000414063.2_Missense_Mutation_p.L116F|LA16c-306E5.3_ENST00000574423.2_RNA|NAA60_ENST00000424546.2_Missense_Mutation_p.L123F|NAA60_ENST00000608993.1_Missense_Mutation_p.L51F|NAA60_ENST00000570819.1_Intron|NAA60_ENST00000572942.1_Intron|NAA60_ENST00000577013.1_Intron|NAA60_ENST00000421765.3_Intron|NAA60_ENST00000572584.1_Missense_Mutation_p.L116F|NAA60_ENST00000570551.1_3'UTR			Q9H7X0	NAA60_HUMAN	N(alpha)-acetyltransferase 60, NatF catalytic subunit	116	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|histone H4 acetylation (GO:0043967)|N-terminal peptidyl-methionine acetylation (GO:0017196)|nucleosome assembly (GO:0006334)	Golgi membrane (GO:0000139)	H4 histone acetyltransferase activity (GO:0010485)|peptide alpha-N-acetyltransferase activity (GO:0004596)	p.L116F(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)	7						GTTCCCTCTTACTTGAAAGTT	0.488																																							uc002cvh.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(346-348)TTA>TTT		N-acetyltransferase 15							77.0	77.0	77.0					16																	3533373		1996	4165	6161	SO:0001583	missense	79903						N-acetyltransferase activity	g.chr16:3533373A>T		CCDS45396.1	16p13.3	2012-07-13	2011-08-02	2011-08-02	ENSG00000122390	ENSG00000122390	2.3.1.48, 2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	25875	protein-coding gene	gene with protein product		614246	"""N-acetyltransferase 15 (GCN5-related, putative)"""	NAT15		12975309, 21750686	Standard	NM_001083600		Approved	FLJ14154	uc010btm.3	Q9H7X0	OTTHUMG00000150268	ENST00000407558.4:c.348A>T	16.37:g.3533373A>T	ENSP00000385903:p.Leu116Phe		Somatic				NAT15_uc010uxb.1_Missense_Mutation_p.L123F|NAT15_uc010btk.1_Missense_Mutation_p.L51F|NAT15_uc010btl.2_Intron|NAT15_uc010btm.2_Missense_Mutation_p.L116F|NAT15_uc010uxc.1_Missense_Mutation_p.L116F|NAT15_uc010uxd.1_Intron|NAT15_uc010uxe.1_Intron|NAT15_uc002cvg.1_Missense_Mutation_p.L116F	p.L116F	NM_001083601	NP_001077070	WXS	Illumina HiSeq	Unspecified	Q9H7X0	NAT15_HUMAN			6	594	+			116			N-acetyltransferase.		B3KRQ0|B4DLZ0|B4DPZ8|B4DYC4|D3DUC2|E7EQ65|Q6IA31|Q6UX26	Missense_Mutation	SNP	ENST00000407558.4	37	c.348A>T	CCDS45396.1	.	.	.	.	.	.	.	.	.	.	a	16.25	3.071308	0.55646	.	.	ENSG00000122390	ENST00000424546;ENST00000407558;ENST00000414063;ENST00000360862	T;T;T;T	0.74526	-0.85;0.47;0.47;-0.33	5.46	4.37	0.52481	.	0.000000	0.85682	D	0.000000	D	0.87470	0.6185	M	0.92122	3.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.87726	0.2576	10	0.87932	D	0	-0.511	8.2129	0.31494	0.8271:0.0:0.1729:0.0	.	123;116	B4DLZ0;Q9H7X0	.;NAA60_HUMAN	F	123;116;116;51	ENSP00000401237:L123F;ENSP00000385903:L116F;ENSP00000393224:L116F;ENSP00000354108:L51F	ENSP00000354108:L51F	L	+	3	2	NAA60	3473374	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	3.514000	0.53422	1.009000	0.39289	0.454000	0.30748	TTA		0.488	NAA60-001	KNOWN	NMD_exception|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317235.2	NM_024845		3	13	0	0	0	0.004672	0	3	13				
GRIN2A	2903	broad.mit.edu	37	16	9857220	9857220	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr16:9857220T>A	ENST00000396573.2	-	14	4490	c.4181A>T	c.(4180-4182)cAg>cTg	p.Q1394L	GRIN2A_ENST00000396575.2_Missense_Mutation_p.Q1394L|GRIN2A_ENST00000562109.1_Missense_Mutation_p.R1280W|GRIN2A_ENST00000535259.1_Missense_Mutation_p.R1123W|GRIN2A_ENST00000330684.3_Missense_Mutation_p.Q1394L|GRIN2A_ENST00000404927.2_Missense_Mutation_p.R1280W	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1394					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.Q1394L(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ATTCACCGCCTGGGATGGCAA	0.542																																							uc002czo.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(4180-4182)CAG>CTG		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						122.0	106.0	111.0					16																	9857220		2197	4300	6497	SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9857220T>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.4181A>T	16.37:g.9857220T>A	ENSP00000379818:p.Gln1394Leu		Somatic				GRIN2A_uc010uym.1_Missense_Mutation_p.Q1394L|GRIN2A_uc010uyn.1_Missense_Mutation_p.R1123W|GRIN2A_uc002czr.3_Missense_Mutation_p.R1280W	p.Q1394L	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			13	4729	-			1394			Cytoplasmic (Potential).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.4181A>T	CCDS10539.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.70|13.70	2.314779|2.314779	0.40996|0.40996	.|.	.|.	ENSG00000183454|ENSG00000183454	ENST00000396573;ENST00000330684;ENST00000396575|ENST00000404927;ENST00000535259	T;T;T|T;T	0.12465|0.12361	2.68;2.68;2.68|2.69;2.69	5.91|5.91	4.8|4.8	0.61643|0.61643	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);|.	0.316553|.	0.32578|.	N|.	0.005917|.	T|T	0.19208|0.19208	0.0461|0.0461	L|L	0.36672|0.36672	1.1|1.1	0.25184|0.25184	N|N	0.990182|0.990182	B|P;P	0.30563|0.50272	0.285|0.933;0.89	B|P;P	0.28916|0.55508	0.096|0.777;0.604	T|T	0.08848|0.08848	-1.0702|-1.0702	9|8	.|.	.|.	.|.	.|.	7.1335|7.1335	0.25515|0.25515	0.0:0.0792:0.1499:0.7709|0.0:0.0792:0.1499:0.7709	.|.	1394|1123;1280	Q12879|F5GZ52;Q17RZ6	NMDE1_HUMAN|.;.	L|W	1394|1280;1123	ENSP00000379818:Q1394L;ENSP00000332549:Q1394L;ENSP00000379820:Q1394L|ENSP00000385872:R1280W;ENSP00000441572:R1123W	.|.	Q|R	-|-	2|1	0|2	GRIN2A|GRIN2A	9764721|9764721	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.914000|0.914000	0.54420|0.54420	3.127000|3.127000	0.50484|0.50484	1.036000|1.036000	0.39998|0.39998	0.533000|0.533000	0.62120|0.62120	CAG|AGG		0.542	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			21	32	0	0	0	0.012319	0	21	32				
NPIPA5	100288332	broad.mit.edu	37	16	15457701	15457701	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr16:15457701G>A	ENST00000360151.4	-	8	867	c.868C>T	c.(868-870)Ctc>Ttc	p.L290F		NM_001277325.1	NP_001264254.1	E9PKD4	NPIA5_HUMAN	nuclear pore complex interacting protein family, member A5	290	Pro-rich.							p.L290F(2)									AGGGGAGTGAGCAGACACTCG	0.562																																							uc010bvf.1		NA																	2	Substitution - Missense(2)		kidney(2)		NA						c.(811-813)GCT>GTT		RecName: Full=NPIP-like protein 1;																																				SO:0001583	missense	0							g.chr16:15457701G>A		CCDS59264.1	16p13.11	2013-06-11			ENSG00000183793	ENSG00000183793			41980	protein-coding gene	gene with protein product							Standard	NM_001277325		Approved			E9PKD4	OTTHUMG00000166305	ENST00000360151.4:c.868C>T	16.37:g.15457701G>A	ENSP00000433597:p.Leu290Phe		Somatic					p.A271V			WXS	Illumina HiSeq	Unspecified					9	812	-								Q0P618	Missense_Mutation	SNP	ENST00000360151.4	37	c.812C>T	CCDS59264.1	.	.	.	.	.	.	.	.	.	.	.	4.044	0.005714	0.07866	.	.	ENSG00000183793	ENST00000360151	T	0.56275	0.47	.	.	.	.	.	.	.	.	T	0.52338	0.1728	M	0.62723	1.935	0.09310	N	1	.	.	.	.	.	.	T	0.44742	-0.9308	4	0.36615	T	0.2	.	.	.	.	.	.	.	.	F	290	ENSP00000433597:L290F	ENSP00000433597:L290F	L	-	1	0	RP11-82O18.1	15365202	.	.	.	.	.	.	.	.	.	.	.	.	CTC		0.562	NPIPA5-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389069.1			4	93	0	0	0	0.001984	0	4	93				
ACSM5	54988	broad.mit.edu	37	16	20451223	20451223	+	Silent	SNP	A	A	G	rs112747866	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr16:20451223A>G	ENST00000331849.4	+	13	1785	c.1638A>G	c.(1636-1638)ccA>ccG	p.P546P	CTD-2194A8.2_ENST00000575772.1_RNA|CTD-2194A8.2_ENST00000574654.1_RNA	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	546					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.P546P(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						TGACTGCTCCATACAAATACC	0.537																																							uc002dhe.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1636-1638)CCA>CCG		acyl-CoA synthetase medium-chain family member 5							90.0	84.0	86.0					16																	20451223		2203	4299	6502	SO:0001819	synonymous_variant	54988				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20451223A>G		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1638A>G	16.37:g.20451223A>G			Somatic					p.P546P	NM_017888	NP_060358	WXS	Illumina HiSeq	Unspecified	Q6NUN0	ACSM5_HUMAN			13	1785	+			546					Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	ENST00000331849.4	37	c.1638A>G	CCDS10585.1																																																																																				0.537	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		22	41	0	0	0	0.012319	0	22	41				
ITGAX	3687	broad.mit.edu	37	16	31372509	31372509	+	Silent	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr16:31372509G>A	ENST00000268296.4	+	9	1108	c.987G>A	c.(985-987)ctG>ctA	p.L329L	ITGAX_ENST00000562522.1_Silent_p.L329L	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	329	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.L329L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						AAAACCAACTGAAGGAGAAGA	0.453																																							uc002ebu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(985-987)CTG>CTA		integrin alpha X precursor							125.0	133.0	130.0					16																	31372509		2197	4300	6497	SO:0001819	synonymous_variant	3687				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity	g.chr16:31372509G>A	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.987G>A	16.37:g.31372509G>A			Somatic				ITGAX_uc002ebt.2_Silent_p.L329L|ITGAX_uc010vfk.1_5'Flank	p.L329L	NM_000887	NP_000878	WXS	Illumina HiSeq	Unspecified	P20702	ITAX_HUMAN			9	1054	+			329			VWFA.|Extracellular (Potential).		Q8IVA6	Silent	SNP	ENST00000268296.4	37	c.987G>A	CCDS10711.1																																																																																				0.453	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887		51	79	0	0	0	0.01441	0	51	79				
CDH8	1006	broad.mit.edu	37	16	61689397	61689397	+	Nonsense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr16:61689397A>T	ENST00000577390.1	-	11	2837	c.1883T>A	c.(1882-1884)tTa>tAa	p.L628*	CDH8_ENST00000299345.6_Nonsense_Mutation_p.L628*|CDH8_ENST00000577730.1_Nonsense_Mutation_p.L628*	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	628					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.L628*(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GATGCATGCTAATATGGCAAT	0.438																																							uc002eog.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|skin(2)|breast(1)	9						c.(1882-1884)TTA>TAA		cadherin 8, type 2 preproprotein							101.0	84.0	90.0					16																	61689397		2203	4300	6503	SO:0001587	stop_gained	1006				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr16:61689397A>T	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1883T>A	16.37:g.61689397A>T	ENSP00000462701:p.Leu628*		Somatic					p.L628*	NM_001796	NP_001787	WXS	Illumina HiSeq	Unspecified	P55286	CADH8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)	11	2135	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	628			Helical; (Potential).		B3KWC1|Q14DC6|Q9ULB2	Nonsense_Mutation	SNP	ENST00000577390.1	37	c.1883T>A	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	A	47	13.039830	0.99715	.	.	ENSG00000150394	ENST00000299345	.	.	.	5.61	5.61	0.85477	.	0.197253	0.36409	N	0.002614	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0016	0.71476	1.0:0.0:0.0:0.0	.	.	.	.	X	628	.	ENSP00000299345:L628X	L	-	2	0	CDH8	60246898	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.904000	0.92590	2.146000	0.66826	0.459000	0.35465	TTA		0.438	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		23	37	0	0	0	0.021523	0	23	37				
CENPT	80152	broad.mit.edu	37	16	67864378	67864378	+	Silent	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr16:67864378G>A	ENST00000562787.1	-	11	1325	c.777C>T	c.(775-777)ccC>ccT	p.P259P	CENPT_ENST00000562947.1_5'UTR|CENPT_ENST00000219172.3_Silent_p.P259P|CENPT_ENST00000564817.1_Silent_p.P259P|CENPT_ENST00000440851.2_Silent_p.P259P	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	259	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P259P(1)		NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GAGGCGTGCAGGGCAGGGAGT	0.597																																							uc002eun.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(775-777)CCC>CCT		centromere protein T							80.0	92.0	88.0					16																	67864378		2110	4230	6340	SO:0001819	synonymous_variant	80152				mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleus	DNA binding	g.chr16:67864378G>A	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.777C>T	16.37:g.67864378G>A			Somatic				CENPT_uc002eum.3_Silent_p.P259P|CENPT_uc010vkc.1_5'UTR|CENPT_uc010vkd.1_Silent_p.P12P|CENPT_uc010vke.1_3'UTR	p.P259P	NM_025082	NP_079358	WXS	Illumina HiSeq	Unspecified	Q96BT3	CENPT_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)	11	1326	-		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)	259					Q96I29|Q96IC6|Q96NK9|Q9H901	Silent	SNP	ENST00000562787.1	37	c.777C>T	CCDS42182.1																																																																																				0.597	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082		7	14	0	0	0	0.001984	0	7	14				
DNAAF1	123872	broad.mit.edu	37	16	84182725	84182725	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr16:84182725G>A	ENST00000378553.5	+	2	362	c.238G>A	c.(238-240)Gac>Aac	p.D80N	DNAAF1_ENST00000334315.5_Missense_Mutation_p.D80N	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	80			Missing (in CILD13). {ECO:0000269|PubMed:19944405}.		axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)	p.D80N(1)		NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						CCCAAGAGAAGACAGGGAAGA	0.488																																							uc002fhl.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(238-240)GAC>AAC		leucine rich repeat containing 50							108.0	104.0	105.0					16																	84182725		2200	4300	6500	SO:0001583	missense	123872	Kartagener_syndrome			axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding	g.chr16:84182725G>A	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.238G>A	16.37:g.84182725G>A	ENSP00000367815:p.Asp80Asn		Somatic				LRRC50_uc010chi.1_RNA	p.D80N	NM_178452	NP_848547	WXS	Illumina HiSeq	Unspecified	Q8NEP3	DAAF1_HUMAN			2	419	+			80		Missing (in CILD13).			B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Missense_Mutation	SNP	ENST00000378553.5	37	c.238G>A	CCDS10943.2	.	.	.	.	.	.	.	.	.	.	G	13.82	2.352101	0.41700	.	.	ENSG00000154099	ENST00000334315;ENST00000378553	T;T	0.35048	1.33;1.77	4.33	3.37	0.38596	.	0.208574	0.31859	N	0.006958	T	0.25717	0.0626	L	0.42245	1.32	0.09310	N	1	P	0.39480	0.675	B	0.34824	0.19	T	0.26608	-1.0098	10	0.62326	D	0.03	-24.5738	7.4386	0.27171	0.1155:0.0:0.8845:0.0	.	80	Q8NEP3	DAAF1_HUMAN	N	80	ENSP00000334593:D80N;ENSP00000367815:D80N	ENSP00000334593:D80N	D	+	1	0	DNAAF1	82740226	0.991000	0.36638	0.150000	0.22450	0.134000	0.20937	2.627000	0.46469	2.399000	0.81585	0.591000	0.81541	GAC		0.488	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250328.3	NM_178452		19	41	0	0	0	0.007413	0	19	41				
SPG7	6687	broad.mit.edu	37	16	89613071	89613071	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr16:89613071G>T	ENST00000268704.2	+	11	1470	c.1455G>T	c.(1453-1455)agG>agT	p.R485S		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	485					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.R485S(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		GGCAGGAGAGGCGGGAGATTT	0.587																																							uc002fnj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1453-1455)AGG>AGT		spastic paraplegia 7 isoform 1							90.0	96.0	94.0					16																	89613071		2198	4300	6498	SO:0001583	missense	6687				cell death|nervous system development|protein catabolic process|proteolysis	integral to membrane|mitochondrial membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding	g.chr16:89613071G>T	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1455G>T	16.37:g.89613071G>T	ENSP00000268704:p.Arg485Ser		Somatic				SPG7_uc002fnk.1_RNA	p.R485S	NM_003119	NP_003110	WXS	Illumina HiSeq	Unspecified	Q9UQ90	SPG7_HUMAN		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)	11	1476	+		all_hematologic(23;0.00824)|Colorectal(91;0.102)	485			Mitochondrial matrix (Potential).		O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	ENST00000268704.2	37	c.1455G>T	CCDS10977.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.615546	0.66672	.	.	ENSG00000197912	ENST00000268704	D	0.95853	-3.83	5.42	3.1	0.35709	Peptidase M41, FtsH (2);	0.000000	0.85682	D	0.000000	D	0.98767	0.9585	H	0.99838	4.83	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97955	1.0334	10	0.87932	D	0	0.2463	11.4549	0.50176	0.2233:0.0:0.7767:0.0	.	485	Q9UQ90	SPG7_HUMAN	S	485	ENSP00000268704:R485S	ENSP00000268704:R485S	R	+	3	2	SPG7	88140572	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	0.971000	0.29396	1.294000	0.44707	0.561000	0.74099	AGG		0.587	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119		3	42	1	0	0.000602214	0.014758	0.000635586	3	42				
SLC13A5	284111	broad.mit.edu	37	17	6610448	6610448	+	Missense_Mutation	SNP	G	G	A	rs554762818		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:6610448G>A	ENST00000433363.2	-	2	363	c.130C>T	c.(130-132)Ctc>Ttc	p.L44F	SLC13A5_ENST00000293800.6_Missense_Mutation_p.L44F|SLC13A5_ENST00000573648.1_Missense_Mutation_p.L44F|SLC13A5_ENST00000381074.4_Intron	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	44					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)	p.L44F(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						ATGGCCATGAGGATGATGACG	0.572																																							uc002gdj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(130-132)CTC>TTC		solute carrier family 13, member 5 isoform a							165.0	145.0	152.0					17																	6610448		2203	4300	6503	SO:0001583	missense	284111					integral to membrane	citrate transmembrane transporter activity	g.chr17:6610448G>A	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.130C>T	17.37:g.6610448G>A	ENSP00000406220:p.Leu44Phe		Somatic				SLC13A5_uc010vtf.1_Missense_Mutation_p.L44F|SLC13A5_uc010clq.2_Intron|SLC13A5_uc002gdk.2_Missense_Mutation_p.L44F|SLC13A5_uc002gdl.1_5'Flank	p.L44F	NM_177550	NP_808218	WXS	Illumina HiSeq	Unspecified	Q86YT5	S13A5_HUMAN			2	218	-			44					B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Missense_Mutation	SNP	ENST00000433363.2	37	c.130C>T	CCDS11079.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.322974	0.60634	.	.	ENSG00000141485	ENST00000293800;ENST00000433363	T;T	0.03094	4.05;4.05	5.4	-0.866	0.10659	.	0.381557	0.30085	N	0.010442	T	0.09379	0.0231	L	0.49455	1.56	0.38311	D	0.94326	D;D;D	0.53885	0.963;0.963;0.963	D;D;D	0.65010	0.931;0.931;0.931	T	0.04961	-1.0915	10	0.59425	D	0.04	.	9.1647	0.37043	0.0:0.2405:0.3897:0.3698	.	44;44;44	B7ZLB4;B3KXR0;Q86YT5	.;.;S13A5_HUMAN	F	44	ENSP00000293800:L44F;ENSP00000406220:L44F	ENSP00000293800:L44F	L	-	1	0	SLC13A5	6551172	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	1.373000	0.34272	0.037000	0.15575	0.655000	0.94253	CTC		0.572	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2	NM_177550		3	12	0	0	0	0.009096	0	3	12				
TP53	7157	broad.mit.edu	37	17	7579414	7579414	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:7579414C>T	ENST00000269305.4	-	4	462	c.273G>A	c.(271-273)tgG>tgA	p.W91*	TP53_ENST00000455263.2_Nonsense_Mutation_p.W91*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Nonsense_Mutation_p.W91*|TP53_ENST00000413465.2_Nonsense_Mutation_p.W91*|TP53_ENST00000445888.2_Nonsense_Mutation_p.W91*|TP53_ENST00000420246.2_Nonsense_Mutation_p.W91*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	91	Interaction with WWOX.		W -> C (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.W91*(13)|p.0?(8)|p.G59fs*23(3)|p.V73fs*9(1)|p.D48fs*55(1)|p.P92fs*57(1)|p.W91fs*57(1)|p.A88fs*52(1)|p.W91fs*13(1)|p.P87fs*54(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGACAGGGGCCAGGAGGGGG	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		33	Substitution - Nonsense(13)|Deletion - Frameshift(11)|Whole gene deletion(8)|Insertion - Frameshift(1)	p.W91*(11)|p.0?(7)|p.G59fs*23(3)|p.V73fs*9(1)|p.D48fs*55(1)|p.P92fs*57(1)|p.W91fs*57(1)|p.A88fs*52(1)|p.W91fs*13(1)|p.P87fs*54(1)|p.P13fs*18(1)|p.S33fs*23(1)	lung(10)|upper_aerodigestive_tract(6)|breast(4)|bone(4)|central_nervous_system(2)|urinary_tract(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)|prostate(1)|liver(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM065495	TP53	M		c.(271-273)TGG>TGA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							44.0	50.0	48.0					17																	7579414		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7579414C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.273G>A	17.37:g.7579414C>T	ENSP00000269305:p.Trp91*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Nonsense_Mutation_p.W91*|TP53_uc002gih.2_Nonsense_Mutation_p.W91*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Nonsense_Mutation_p.W91*|TP53_uc010cni.1_Nonsense_Mutation_p.W91*|TP53_uc002gij.2_Nonsense_Mutation_p.W91*|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Nonsense_Mutation_p.W52*|TP53_uc010cnk.1_Nonsense_Mutation_p.W106*	p.W91*	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	4	467	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	91		W -> C (in a sporadic cancer; somatic mutation).	Interaction with WWOX.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.273G>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552604	0.86127	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.62	4.62	0.57501	.	0.425160	0.22616	N	0.057766	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-8.1711	8.8476	0.35179	0.0:0.8991:0.0:0.1009	.	.	.	.	X	91	.	ENSP00000269305:W91X	W	-	3	0	TP53	7520139	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	1.567000	0.36407	2.561000	0.86390	0.561000	0.74099	TGG		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		39	10	0	0	0	0.005524	0	39	10				
MYH4	4622	broad.mit.edu	37	17	10348183	10348183	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:10348183G>T	ENST00000255381.2	-	38	5610	c.5500C>A	c.(5500-5502)Cag>Aag	p.Q1834K	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1834					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.Q1834K(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TTGTGCTTCTGTTCACTTTCC	0.468																																							uc002gmn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(2)|central_nervous_system(1)	13						c.(5500-5502)CAG>AAG		myosin, heavy polypeptide 4, skeletal muscle							315.0	245.0	269.0					17																	10348183		2203	4300	6503	SO:0001583	missense	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10348183G>T		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5500C>A	17.37:g.10348183G>T	ENSP00000255381:p.Gln1834Lys		Somatic				uc002gml.1_Intron	p.Q1834K	NM_017533	NP_060003	WXS	Illumina HiSeq	Unspecified	Q9Y623	MYH4_HUMAN			38	5611	-			1834			Potential.			Missense_Mutation	SNP	ENST00000255381.2	37	c.5500C>A	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	33	5.282741	0.95489	.	.	ENSG00000141048	ENST00000255381	D	0.83163	-1.69	5.5	5.5	0.81552	Myosin tail (1);	0.000000	0.35772	U	0.002987	D	0.90693	0.7080	M	0.80422	2.495	0.58432	D	0.999999	D	0.63046	0.992	P	0.59825	0.864	D	0.91220	0.5006	10	0.66056	D	0.02	.	19.7739	0.96383	0.0:0.0:1.0:0.0	.	1834	Q9Y623	MYH4_HUMAN	K	1834	ENSP00000255381:Q1834K	ENSP00000255381:Q1834K	Q	-	1	0	MYH4	10288908	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.744000	0.94065	0.655000	0.94253	CAG		0.468	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		56	13	1	0	9.53978e-28	0.01441	1.46955e-27	56	13				
MYH2	4620	broad.mit.edu	37	17	10443380	10443380	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:10443380C>T	ENST00000245503.5	-	12	1396	c.1012G>A	c.(1012-1014)Gct>Act	p.A338T	MYH2_ENST00000397183.2_Missense_Mutation_p.A338T|MYH2_ENST00000532183.2_Missense_Mutation_p.A338T|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	338	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.A338T(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						ATATCAATAGCACTCTGTCAA	0.408																																							uc010coi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(1012-1014)GCT>ACT		myosin heavy chain IIa							114.0	110.0	111.0					17																	10443380		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10443380C>T		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1012G>A	17.37:g.10443380C>T	ENSP00000245503:p.Ala338Thr		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.A338T|MYH2_uc010coj.2_Missense_Mutation_p.A338T	p.A338T	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			12	1140	-			338			Myosin head-like.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.1012G>A	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	35	5.427192	0.96131	.	.	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183	D;D;D	0.81821	-1.54;-1.54;-1.54	5.03	5.03	0.67393	Myosin head, motor domain (2);	0.000000	0.39020	U	0.001488	D	0.93374	0.7887	H	0.97186	3.955	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.87578	0.997;0.998	D	0.95173	0.8292	10	0.87932	D	0	.	17.8989	0.88897	0.0:1.0:0.0:0.0	.	338;338	Q567P6;Q9UKX2	.;MYH2_HUMAN	T	338	ENSP00000433944:A338T;ENSP00000245503:A338T;ENSP00000380367:A338T	ENSP00000245503:A338T	A	-	1	0	MYH2	10384105	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	2.787000	0.95880	0.650000	0.86243	GCT		0.408	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		47	14	0	0	0	0.011902	0	47	14				
HOXB9	3219	broad.mit.edu	37	17	46700481	46700481	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:46700481G>C	ENST00000311177.5	-	2	741	c.534C>G	c.(532-534)aaC>aaG	p.N178K	HOXB7_ENST00000567101.2_Intron|HOXB9_ENST00000550387.1_Missense_Mutation_p.L99V	NM_024017.4	NP_076922.1	P17482	HXB9_HUMAN	homeobox B9	178					anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|embryonic skeletal system development (GO:0048706)|mammary gland development (GO:0030879)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.N178K(1)		breast(2)|endometrium(1)|large_intestine(1)|liver(1)|lung(6)|prostate(1)	12						CGTGCAGCCAGTTGGCGGAGG	0.542																																							uc002inx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(532-534)AAC>AAG		homeobox B9							103.0	98.0	100.0					17																	46700481		2203	4300	6503	SO:0001583	missense	3219				canonical Wnt receptor signaling pathway|cell chemotaxis	mitochondrion|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46700481G>C		CCDS11534.1	17q21.32	2011-06-20	2005-12-22		ENSG00000170689	ENSG00000170689		"""Homeoboxes / ANTP class : HOXL subclass"""	5120	protein-coding gene	gene with protein product		142964	"""homeo box B9"""	HOX2E, HOX2		1973146, 1358459	Standard	NM_024017		Approved		uc002inx.3	P17482	OTTHUMG00000159907	ENST00000311177.5:c.534C>G	17.37:g.46700481G>C	ENSP00000309439:p.Asn178Lys		Somatic					p.N178K	NM_024017	NP_076922	WXS	Illumina HiSeq	Unspecified	P17482	HXB9_HUMAN			2	738	-			178					B2RDB7|Q9H1I1	Missense_Mutation	SNP	ENST00000311177.5	37	c.534C>G	CCDS11534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.0|26.0	4.697080|4.697080	0.88830|0.88830	.|.	.|.	ENSG00000170689|ENSG00000170689	ENST00000550387|ENST00000311177	.|D	.|0.95622	.|-3.76	5.71|5.71	5.71|5.71	0.89125|0.89125	.|Homeodomain-related (1);Homeodomain-like (1);	.|0.111024	.|0.56097	.|D	.|0.000022	D|D	0.95360|0.95360	0.8494|0.8494	M|M	0.73319|0.73319	2.225|2.225	0.31755|0.31755	N|N	0.634118|0.634118	.|B	.|0.27823	.|0.19	.|B	.|0.31686	.|0.134	D|D	0.94672|0.94672	0.7857|0.7857	6|10	0.44086|0.72032	T|D	0.13|0.01	.|.	19.8408|19.8408	0.96685|0.96685	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|178	.|P17482	.|HXB9_HUMAN	V|K	99|178	.|ENSP00000309439:N178K	ENSP00000447530:L99V|ENSP00000309439:N178K	L|N	-|-	1|3	2|2	HOXB9|HOXB9	44055480|44055480	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.103000|5.103000	0.64578|0.64578	2.699000|2.699000	0.92147|0.92147	0.655000|0.655000	0.94253|0.94253	CTG|AAC		0.542	HOXB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358101.2			47	56	0	0	0	0.01441	0	47	56				
SPAG9	9043	broad.mit.edu	37	17	49073994	49073994	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:49073994C>T	ENST00000262013.7	-	16	2108	c.1900G>A	c.(1900-1902)Gca>Aca	p.A634T	SPAG9_ENST00000357122.4_Missense_Mutation_p.A620T|SPAG9_ENST00000505279.1_Missense_Mutation_p.A624T|SPAG9_ENST00000510283.1_Missense_Mutation_p.A477T	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	634					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.A620T(1)		NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			TGAACATGTGCTTTTACCTGA	0.423																																							uc002itc.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|breast(1)	5						c.(1900-1902)GCA>ACA		sperm associated antigen 9 isoform 1							182.0	152.0	162.0					17																	49073994		2203	4300	6503	SO:0001583	missense	9043				positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm		g.chr17:49073994C>T	AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.1900G>A	17.37:g.49073994C>T	ENSP00000262013:p.Ala634Thr		Somatic				SPAG9_uc002itb.2_Missense_Mutation_p.A620T|SPAG9_uc002itd.2_Missense_Mutation_p.A624T|SPAG9_uc002itf.2_Missense_Mutation_p.A455T|SPAG9_uc002ita.2_Missense_Mutation_p.A477T|SPAG9_uc002ite.2_Missense_Mutation_p.A464T	p.A634T	NM_001130528	NP_001124000	WXS	Illumina HiSeq	Unspecified	O60271	JIP4_HUMAN	BRCA - Breast invasive adenocarcinoma(22;4.24e-07)		16	2109	-			634					A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	ENST00000262013.7	37	c.1900G>A	CCDS45740.1	.	.	.	.	.	.	.	.	.	.	C	36	5.671507	0.96754	.	.	ENSG00000008294	ENST00000262013;ENST00000376407;ENST00000357804;ENST00000357791;ENST00000510283;ENST00000505279;ENST00000357122;ENST00000535445	T;T;T;T	0.16597	2.33;2.33;2.33;2.33	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	M	0.81802	2.56	0.80722	D	1	D;D;D;P;D;D	0.89917	1.0;0.999;0.968;0.928;1.0;0.992	D;D;P;P;D;D	0.91635	0.999;0.979;0.793;0.81;0.998;0.943	T	0.44937	-0.9295	10	0.66056	D	0.02	-18.4012	20.2723	0.98479	0.0:1.0:0.0:0.0	.	620;634;624;634;620;477	O60271-5;O60271-3;O60271-2;O60271;O60271-4;E7ENU2	.;.;.;JIP4_HUMAN;.;.	T	634;390;380;170;477;624;620;232	ENSP00000262013:A634T;ENSP00000423165:A477T;ENSP00000426900:A624T;ENSP00000349636:A620T	ENSP00000262013:A634T	A	-	1	0	SPAG9	46428993	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.745000	0.85046	2.793000	0.96121	0.563000	0.77884	GCA		0.423	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971		12	38	0	0	0	0.010729	0	12	38				
TEX14	56155	broad.mit.edu	37	17	56693591	56693591	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:56693591C>A	ENST00000240361.8	-	7	815	c.730G>T	c.(730-732)Gct>Tct	p.A244S	TEX14_ENST00000349033.5_Missense_Mutation_p.A238S|TEX14_ENST00000389934.3_Missense_Mutation_p.A238S			Q8IWB6	TEX14_HUMAN	testis expressed 14	244	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.A244S(1)|p.A238S(1)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCATCATCAGCTTGAATCACT	0.493																																							uc010dcz.1		NA																	2	Substitution - Missense(2)		lung(2)	stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17						c.(730-732)GCT>TCT		testis expressed sequence 14 isoform a							108.0	95.0	99.0					17																	56693591		2203	4300	6503	SO:0001583	missense	56155					cytoplasm	ATP binding|protein kinase activity	g.chr17:56693591C>A	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.730G>T	17.37:g.56693591C>A	ENSP00000240361:p.Ala244Ser		Somatic				TEX14_uc002iwr.1_Missense_Mutation_p.A238S|TEX14_uc002iws.1_Missense_Mutation_p.A238S|TEX14_uc010dda.1_Missense_Mutation_p.A18S	p.A244S	NM_198393	NP_938207	WXS	Illumina HiSeq	Unspecified	Q8IWB6	TEX14_HUMAN			7	848	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		244			Protein kinase.		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	c.730G>T	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.794443	0.90453	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	D;D;T	0.81996	-1.56;-1.53;-1.44	5.65	5.65	0.86999	Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	D	0.88973	0.6583	L	0.59436	1.845	0.38715	D	0.953317	P;D;D	0.57257	0.92;0.979;0.979	P;D;D	0.63703	0.663;0.917;0.917	D	0.89027	0.3439	10	0.45353	T	0.12	-16.1983	18.2836	0.90107	0.0:1.0:0.0:0.0	.	244;238;238	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	S	244;238;238	ENSP00000240361:A244S;ENSP00000374584:A238S;ENSP00000268910:A238S	ENSP00000240361:A244S	A	-	1	0	TEX14	54048590	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.696000	0.54757	2.668000	0.90789	0.655000	0.94253	GCT		0.493	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1			18	24	1	0	1.99824e-07	0.00499	2.2876e-07	18	24				
CD300LD	100131439	broad.mit.edu	37	17	72584765	72584765	+	Silent	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:72584765G>A	ENST00000375352.1	-	2	344	c.264C>T	c.(262-264)caC>caT	p.H88H	C17orf77_ENST00000328023.2_5'Flank|C17orf77_ENST00000392620.1_Intron	NM_001115152.1	NP_001108624.1	Q6UXZ3	CLM4_HUMAN	CD300 molecule-like family member d	88	Ig-like V-type.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H88H(1)		large_intestine(1)|lung(2)|prostate(1)|stomach(1)	5						CGGTGAACACGTGGTTTTTCT	0.428																																							uc002jkz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(262-264)CAC>CAT		CD300 molecule-like family member d precursor							376.0	307.0	328.0					17																	72584765		1568	3582	5150	SO:0001819	synonymous_variant	100131439					integral to membrane|plasma membrane	receptor activity	g.chr17:72584765G>A		CCDS42379.1	17q25.1	2014-05-15			ENSG00000204345	ENSG00000204345		"""Immunoglobulin superfamily / V-set domain containing"""	16848	protein-coding gene	gene with protein product						22291008	Standard	NM_001115152		Approved	CMRF35A4, CD300D	uc002jkz.2	Q6UXZ3	OTTHUMG00000067614	ENST00000375352.1:c.264C>T	17.37:g.72584765G>A			Somatic				C17orf77_uc002jla.1_Intron	p.H88H	NM_001115152	NP_001108624	WXS	Illumina HiSeq	Unspecified	Q6UXZ3	CLM4_HUMAN			2	293	-			88			Extracellular (Potential).|Ig-like V-type.			Silent	SNP	ENST00000375352.1	37	c.264C>T	CCDS42379.1																																																																																				0.428	CD300LD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145099.1	NM_001115152		76	96	0	0	0	0.01441	0	76	96				
GRIN2C	2905	broad.mit.edu	37	17	72846704	72846704	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:72846704T>A	ENST00000293190.5	-	5	1462	c.1316A>T	c.(1315-1317)cAc>cTc	p.H439L	GRIN2C_ENST00000347612.4_Missense_Mutation_p.H439L|GRIN2C_ENST00000578159.1_5'Flank	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	439					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.H439L(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCTGAAGGTGTGGTTGCTCTG	0.642																																							uc002jlt.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(2)	4						c.(1315-1317)CAC>CTC		N-methyl-D-aspartate receptor subunit 2C	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)						66.0	66.0	66.0					17																	72846704		2203	4298	6501	SO:0001583	missense	2905				glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity	g.chr17:72846704T>A		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.1316A>T	17.37:g.72846704T>A	ENSP00000293190:p.His439Leu		Somatic				GRIN2C_uc010wrh.1_RNA|GRIN2C_uc002jlu.1_Missense_Mutation_p.H439L|GRIN2C_uc002jlv.1_3'UTR	p.H439L	NM_000835	NP_000826	WXS	Illumina HiSeq	Unspecified	Q14957	NMDE3_HUMAN			5	1472	-	all_lung(278;0.172)|Lung NSC(278;0.207)		439			Extracellular (Potential).		B2RTT1	Missense_Mutation	SNP	ENST00000293190.5	37	c.1316A>T	CCDS32724.1	.	.	.	.	.	.	.	.	.	.	T	6.068	0.380848	0.11466	.	.	ENSG00000161509	ENST00000293190;ENST00000347612	T	0.10477	2.87	4.57	2.39	0.29439	.	0.702414	0.14870	N	0.293578	T	0.05227	0.0139	N	0.17082	0.46	0.37648	D	0.92229	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.33727	-0.9857	10	0.29301	T	0.29	.	1.4999	0.02474	0.1415:0.1695:0.146:0.5431	.	473;439	Q8IW23;Q14957	.;NMDE3_HUMAN	L	439;473	ENSP00000293190:H439L	ENSP00000293190:H439L	H	-	2	0	GRIN2C	70358299	1.000000	0.71417	0.999000	0.59377	0.014000	0.08584	1.199000	0.32235	0.903000	0.36546	0.459000	0.35465	CAC		0.642	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1			35	42	0	0	0	0.019004	0	35	42				
ENGASE	64772	broad.mit.edu	37	17	77078118	77078118	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:77078118G>T	ENST00000579016.1	+	7	1011	c.1011G>T	c.(1009-1011)gtG>gtT	p.V337V	ENGASE_ENST00000539857.2_Silent_p.V151V|ENGASE_ENST00000584568.1_3'UTR	NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	337	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.					cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)	p.V337V(1)		breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						GAGGGAACGTGGTCGGAGGCC	0.637																																							uc002jwv.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1009-1011)GTG>GTT		endo-beta-N-acetylglucosaminidase							106.0	140.0	129.0					17																	77078118		2148	4248	6396	SO:0001819	synonymous_variant	64772					cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity	g.chr17:77078118G>T	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.1011G>T	17.37:g.77078118G>T			Somatic				ENGASE_uc002jwu.1_Silent_p.V337V|ENGASE_uc010wtz.1_Silent_p.V151V|ENGASE_uc002jww.2_5'UTR	p.V337V	NM_001042573	NP_001036038	WXS	Illumina HiSeq	Unspecified	Q8NFI3	ENASE_HUMAN			7	1019	+			337			BRCT.		Q659F0|Q8TB86|Q9H6U4	Silent	SNP	ENST00000579016.1	37	c.1011G>T	CCDS42394.1																																																																																				0.637	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395807.1	NM_022759		49	51	1	0	1.19451e-25	0.01441	1.82e-25	49	51				
CBX4	8535	broad.mit.edu	37	17	77808278	77808278	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:77808278G>C	ENST00000269397.4	-	5	1340	c.1163C>G	c.(1162-1164)cCc>cGc	p.P388R		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	388	His-rich.|Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.P388R(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			gtggtgatgggggtgcgggtg	0.701																																							uc002jxe.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(1162-1164)CCC>CGC		chromobox homolog 4							6.0	7.0	7.0					17																	77808278		2108	4151	6259	SO:0001583	missense	8535				anti-apoptosis|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|PcG protein complex	enzyme binding|transcription corepressor activity	g.chr17:77808278G>C	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1163C>G	17.37:g.77808278G>C	ENSP00000269397:p.Pro388Arg		Somatic					p.P388R	NM_003655	NP_003646	WXS	Illumina HiSeq	Unspecified	O00257	CBX4_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		5	1326	-			388			His-rich.|Interaction with BMI1.		B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	ENST00000269397.4	37	c.1163C>G	CCDS32758.1	.	.	.	.	.	.	.	.	.	.	g	0.001	-3.046938	0.00039	.	.	ENSG00000141582	ENST00000269397	.	.	.	0.226	0.226	0.15353	.	1.121610	0.06998	U	0.822860	T	0.33323	0.0859	N	0.08118	0	0.32996	D	0.525628	D	0.55605	0.972	P	0.56700	0.804	T	0.45249	-0.9274	8	0.15066	T	0.55	.	.	.	.	.	388	O00257	CBX4_HUMAN	R	388	.	ENSP00000269397:P388R	P	-	2	0	CBX4	75422873	0.259000	0.24043	0.588000	0.28705	0.169000	0.22640	0.000000	0.12993	0.301000	0.22738	0.306000	0.20318	CCC		0.701	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655		3	1	0	0	0	0.004672	0	3	1				
CEP192	55125	broad.mit.edu	37	18	13059303	13059303	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr18:13059303G>A	ENST00000325971.8	+	19	4285	c.2692G>A	c.(2692-2694)Gtt>Att	p.V898I	CEP192_ENST00000506447.1_Missense_Mutation_p.V1494I|CEP192_ENST00000430049.2_Missense_Mutation_p.V1019I			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	898					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.V898I(1)|p.V1494I(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CGAGAGTCCTGTTATTGAGGT	0.428																																							uc010xac.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(4480-4482)GTT>ATT		centrosomal protein 192kDa							124.0	115.0	118.0					18																	13059303		2203	4300	6503	SO:0001583	missense	55125							g.chr18:13059303G>A	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.2692G>A	18.37:g.13059303G>A	ENSP00000317156:p.Val898Ile		Somatic				CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.V1019I|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_5'UTR|CEP192_uc002krs.1_Missense_Mutation_p.V1235I	p.V1494I	NM_032142	NP_115518	WXS	Illumina HiSeq	Unspecified	E9PF99	E9PF99_HUMAN			21	4560	+			1494					A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37	c.4480G>A		.	.	.	.	.	.	.	.	.	.	G	0.813	-0.751492	0.03041	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.78246	-1.16;-1.16;-1.16	5.08	0.236	0.15471	.	0.506723	0.19972	N	0.101978	T	0.59851	0.2224	L	0.43152	1.355	0.25137	N	0.990526	B;B;B	0.29988	0.041;0.169;0.264	B;B;B	0.27796	0.011;0.083;0.082	T	0.40213	-0.9575	10	0.22109	T	0.4	-3.7479	1.2704	0.02019	0.3712:0.2481:0.2538:0.1268	.	1019;1494;898	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	I	1494;898;898;1019	ENSP00000427550:V1494I;ENSP00000317156:V898I;ENSP00000389190:V1019I	ENSP00000317156:V898I	V	+	1	0	CEP192	13049303	0.000000	0.05858	0.084000	0.20598	0.042000	0.13812	-0.377000	0.07456	0.033000	0.15463	-0.904000	0.02843	GTT		0.428	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142		4	87	0	0	0	0.009096	0	4	87				
SYT4	6860	broad.mit.edu	37	18	40850395	40850395	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr18:40850395C>A	ENST00000255224.3	-	4	1557	c.1189G>T	c.(1189-1191)Gca>Tca	p.A397S	SYT4_ENST00000590752.1_Missense_Mutation_p.A379S|SYT4_ENST00000586678.1_5'UTR	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	397					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.A397S(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						GTTCCTTCTGCTGCTGCACCC	0.493																																					NSCLC(85;81 1419 2855 22820 35912)	NSCLC(85;81 1419 2855 22820 35912)	uc002law.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)	5						c.(1189-1191)GCA>TCA		synaptotagmin IV							152.0	150.0	150.0					18																	40850395		2203	4300	6503	SO:0001583	missense	6860					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity	g.chr18:40850395C>A	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.1189G>T	18.37:g.40850395C>A	ENSP00000255224:p.Ala397Ser		Somatic				SYT4_uc010dng.2_RNA|SYT4_uc010xcm.1_Missense_Mutation_p.A379S|SYT4_uc010dnh.2_RNA	p.A397S	NM_020783	NP_065834	WXS	Illumina HiSeq	Unspecified	Q9H2B2	SYT4_HUMAN			4	1558	-			397			Cytoplasmic (Potential).		B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	37	c.1189G>T	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	C	4.840	0.156156	0.09236	.	.	ENSG00000132872	ENST00000255224;ENST00000442661	T	0.70986	-0.53	5.58	5.58	0.84498	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.100660	0.64402	D	0.000002	T	0.60983	0.2311	L	0.33710	1.025	0.53688	D	0.999971	B;B	0.11235	0.004;0.004	B;B	0.15052	0.012;0.012	T	0.57225	-0.7848	10	0.09338	T	0.73	.	19.5717	0.95423	0.0:1.0:0.0:0.0	.	379;397	B4DEU3;Q9H2B2	.;SYT4_HUMAN	S	397;202	ENSP00000255224:A397S	ENSP00000255224:A397S	A	-	1	0	SYT4	39104393	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.698000	0.47068	2.644000	0.89710	0.655000	0.94253	GCA		0.493	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783		86	118	1	0	5.01443e-46	0.01441	8.17527e-46	86	118				
NETO1	81832	broad.mit.edu	37	18	70417732	70417732	+	Missense_Mutation	SNP	C	C	T	rs140307788		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr18:70417732C>T	ENST00000327305.6	-	9	1763	c.1106G>A	c.(1105-1107)cGt>cAt	p.R369H	NETO1_ENST00000299430.2_Missense_Mutation_p.R368H|RNA5SP460_ENST00000516789.1_RNA|NETO1_ENST00000583169.1_Missense_Mutation_p.R369H	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	369					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.R369H(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		ATACTTTTTACGAGGCTGTTT	0.458													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17344	0.0		0.0	False		,,,				2504	0.0						uc002lkw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1105-1107)CGT>CAT		neuropilin- and tolloid-like protein 1 isoform 3		C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	97.0	85.0	89.0		1106,1106	5.2	1.0	18	dbSNP_134	89	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	NETO1	NM_001201465.1,NM_138966.3	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	369/534,369/534	70417732	2,13004	2203	4300	6503	SO:0001583	missense	81832				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity	g.chr18:70417732C>T	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1106G>A	18.37:g.70417732C>T	ENSP00000313088:p.Arg369His		Somatic				NETO1_uc002lkx.1_Missense_Mutation_p.R368H|NETO1_uc002lky.1_Missense_Mutation_p.R369H	p.R369H	NM_138966	NP_620416	WXS	Illumina HiSeq	Unspecified	Q8TDF5	NETO1_HUMAN		READ - Rectum adenocarcinoma(1;0.0487)	9	1390	-		Esophageal squamous(42;0.129)	369			Cytoplasmic (Potential).		Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	c.1106G>A	CCDS12000.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	29.3	4.991700	0.93106	0.0	2.33E-4	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.44881	0.91;0.91	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000009	T	0.64994	0.2649	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.991	T	0.67753	-0.5589	10	0.87932	D	0	-4.4528	19.1774	0.93607	0.0:1.0:0.0:0.0	.	368;369	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	H	369;368	ENSP00000313088:R369H;ENSP00000299430:R368H	ENSP00000299430:R368H	R	-	2	0	NETO1	68568712	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.772000	0.85439	2.594000	0.87642	0.455000	0.32223	CGT		0.458	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999		26	44	0	0	0	0.005443	0	26	44				
ZADH2	284273	broad.mit.edu	37	18	72913607	72913607	+	Missense_Mutation	SNP	C	C	T	rs368098178		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr18:72913607C>T	ENST00000322342.3	-	2	1187	c.898G>A	c.(898-900)Gta>Ata	p.V300I	ZADH2_ENST00000537114.2_Missense_Mutation_p.V177I	NM_175907.4	NP_787103.1	Q8N4Q0	ZADH2_HUMAN	zinc binding alcohol dehydrogenase domain containing 2	300						mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)	p.V300I(1)		endometrium(3)|large_intestine(3)|lung(8)|skin(1)	15		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)		AAGCCCTGTACGCTGGCAGAT	0.493																																							uc002llx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(898-900)GTA>ATA		zinc binding alcohol dehydrogenase domain		C	ILE/VAL	0,4406		0,0,2203	91.0	84.0	86.0		898	-11.2	0.2	18		86	2,8598	2.2+/-6.3	0,2,4298	no	missense	ZADH2	NM_175907.4	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	300/378	72913607	2,13004	2203	4300	6503	SO:0001583	missense	284273					peroxisome	oxidoreductase activity|zinc ion binding	g.chr18:72913607C>T	BC033780	CCDS12008.1	18q22.3	2008-05-29	2008-05-29		ENSG00000180011	ENSG00000180011			28697	protein-coding gene	gene with protein product						12477932	Standard	NM_175907		Approved	MGC45594	uc002llx.3	Q8N4Q0	OTTHUMG00000132858	ENST00000322342.3:c.898G>A	18.37:g.72913607C>T	ENSP00000323678:p.Val300Ile		Somatic				ZADH2_uc010dqv.2_Missense_Mutation_p.V177I	p.V300I	NM_175907	NP_787103	WXS	Illumina HiSeq	Unspecified	Q8N4Q0	ZADH2_HUMAN		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)	2	1166	-		Esophageal squamous(42;0.131)|Prostate(75;0.155)	300					A8KA15|B4DZ91	Missense_Mutation	SNP	ENST00000322342.3	37	c.898G>A	CCDS12008.1	.	.	.	.	.	.	.	.	.	.	C	2.250	-0.371783	0.05034	0.0	2.33E-4	ENSG00000180011	ENST00000322342;ENST00000537114	T;T	0.03717	3.83;3.83	5.61	-11.2	0.00127	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	1.012140	0.07907	N	0.973690	T	0.02156	0.0067	N	0.21508	0.67	0.31531	N	0.661177	B	0.12630	0.006	B	0.09377	0.004	T	0.54682	-0.8257	10	0.26408	T	0.33	-10.5242	11.2571	0.49060	0.0:0.1718:0.2445:0.5837	.	300	Q8N4Q0	ZADH2_HUMAN	I	300;177	ENSP00000323678:V300I;ENSP00000440111:V177I	ENSP00000323678:V300I	V	-	1	0	ZADH2	71042595	0.000000	0.05858	0.170000	0.22879	0.171000	0.22731	-3.110000	0.00600	0.130000	0.18549	0.644000	0.83932	GTA		0.493	ZADH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256332.1	NM_175907		32	42	0	0	0	0.012213	0	32	42				
MATK	4145	broad.mit.edu	37	19	3779791	3779791	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:3779791G>T	ENST00000310132.6	-	9	1145	c.747C>A	c.(745-747)gtC>gtA	p.V249V	MATK_ENST00000585778.1_Silent_p.V249V|MATK_ENST00000395045.2_Silent_p.V250V|MATK_ENST00000395040.2_Silent_p.V208V	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	249	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.V249V(1)|p.V250V(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCCTGCAGGACAGCTGGGG	0.622																																							uc002lyt.2		NA																	2	Substitution - coding silent(2)		lung(2)	stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5						c.(745-747)GTC>GTA		megakaryocyte-associated tyrosine kinase isoform							43.0	45.0	44.0					19																	3779791		2203	4300	6503	SO:0001819	synonymous_variant	4145				cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr19:3779791G>T	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.747C>A	19.37:g.3779791G>T			Somatic				MATK_uc002lyv.2_Silent_p.V250V|MATK_uc002lyu.2_Silent_p.V208V|MATK_uc010dtq.2_Silent_p.V249V	p.V249V	NM_139355	NP_647612	WXS	Illumina HiSeq	Unspecified	P42679	MATK_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)	9	1147	-		Hepatocellular(1079;0.137)	249			ATP (By similarity).|Protein kinase.		B3KNZ9|Q9NST8	Silent	SNP	ENST00000310132.6	37	c.747C>A	CCDS12114.1																																																																																				0.622	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453639.1	NM_139355		17	4	1	0	0.00074312	0.006122	0.000780369	17	4				
ARRDC5	645432	broad.mit.edu	37	19	4896732	4896732	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:4896732T>C	ENST00000381781.2	-	2	451	c.452A>G	c.(451-453)tAc>tGc	p.Y151C		NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	151								p.Y151C(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		AACCAATAAGTACATCCTCTT	0.483																																							uc002mbm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(451-453)TAC>TGC		arrestin domain containing 5							111.0	104.0	106.0					19																	4896732		1923	4126	6049	SO:0001583	missense	645432				signal transduction			g.chr19:4896732T>C		CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.452A>G	19.37:g.4896732T>C	ENSP00000371200:p.Tyr151Cys		Somatic					p.Y151C	NM_001080523	NP_001073992	WXS	Illumina HiSeq	Unspecified	A6NEK1	ARRD5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)	2	452	-			151						Missense_Mutation	SNP	ENST00000381781.2	37	c.452A>G	CCDS45929.1	.	.	.	.	.	.	.	.	.	.	T	13.95	2.389460	0.42410	.	.	ENSG00000205784	ENST00000381781	T	0.18810	2.19	3.82	2.8	0.32819	Immunoglobulin E-set (1);	0.633028	0.13162	N	0.408975	T	0.18509	0.0444	L	0.47716	1.5	0.09310	N	1	B	0.23735	0.09	B	0.26693	0.072	T	0.19418	-1.0306	10	0.38643	T	0.18	-8.3488	7.1155	0.25414	0.0:0.1084:0.0:0.8916	.	151	A6NEK1	ARRD5_HUMAN	C	151	ENSP00000371200:Y151C	ENSP00000371200:Y151C	Y	-	2	0	ARRDC5	4847732	0.076000	0.21285	0.004000	0.12327	0.018000	0.09664	1.478000	0.35442	0.853000	0.35312	0.472000	0.43445	TAC		0.483	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450443.1	XM_292803		26	6	0	0	0	0.007291	0	26	6				
MUC16	94025	broad.mit.edu	37	19	9049765	9049765	+	Silent	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:9049765T>C	ENST00000397910.4	-	5	32069	c.31866A>G	c.(31864-31866)ttA>ttG	p.L10622L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10624	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L10622L(1)|p.L6255L(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATACAGTGTCTAATTCACTGT	0.483																																							uc002mkp.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(31864-31866)TTA>TTG		mucin 16							113.0	105.0	107.0					19																	9049765		1943	4147	6090	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9049765T>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31866A>G	19.37:g.9049765T>C			Somatic					p.L10622L	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			5	32070	-			10624			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.31866A>G	CCDS54212.1																																																																																				0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		48	14	0	0	0	0.013114	0	48	14				
MUC16	94025	broad.mit.edu	37	19	9063480	9063480	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:9063480G>C	ENST00000397910.4	-	3	24169	c.23966C>G	c.(23965-23967)aCa>aGa	p.T7989R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7991	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T7989R(2)|p.T3622R(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTCTGGTAATGTGGAGGAAAC	0.468																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(23965-23967)ACA>AGA		mucin 16							92.0	88.0	89.0					19																	9063480		2004	4176	6180	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9063480G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23966C>G	19.37:g.9063480G>C	ENSP00000381008:p.Thr7989Arg		Somatic					p.T7989R	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	24170	-			7991			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.23966C>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.262	-0.150930	0.06585	.	.	ENSG00000181143	ENST00000397910	T	0.27720	1.65	2.62	-1.11	0.09840	.	.	.	.	.	T	0.40398	0.1115	M	0.61703	1.905	.	.	.	D	0.58268	0.982	P	0.62089	0.898	T	0.44937	-0.9295	8	0.87932	D	0	.	2.1371	0.03765	0.3281:0.0:0.4213:0.2506	.	7989	B5ME49	.	R	7989	ENSP00000381008:T7989R	ENSP00000381008:T7989R	T	-	2	0	MUC16	8924480	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.012000	0.12699	-0.146000	0.11274	-0.362000	0.07510	ACA		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		12	4	0	0	0	0.010729	0	12	4				
MUC16	94025	broad.mit.edu	37	19	9091090	9091090	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:9091090G>T	ENST00000397910.4	-	1	928	c.725C>A	c.(724-726)cCt>cAt	p.P242H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	242	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P242H(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTCCCTTTAGGTGATAGGTC	0.478																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(724-726)CCT>CAT		mucin 16							116.0	113.0	114.0					19																	9091090		1918	4132	6050	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9091090G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.725C>A	19.37:g.9091090G>T	ENSP00000381008:p.Pro242His		Somatic					p.P242H	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	929	-			242			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.725C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	1.502	-0.551836	0.03996	.	.	ENSG00000181143	ENST00000397910	T	0.03301	3.98	1.31	1.31	0.21738	.	.	.	.	.	T	0.01905	0.0060	N	0.08118	0	.	.	.	P	0.46578	0.88	B	0.37346	0.247	T	0.42050	-0.9474	8	0.87932	D	0	.	6.0092	0.19565	0.0:0.0:1.0:0.0	.	242	B5ME49	.	H	242	ENSP00000381008:P242H	ENSP00000381008:P242H	P	-	2	0	MUC16	8952090	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.951000	0.29135	1.027000	0.39758	0.313000	0.20887	CCT		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		38	5	1	0	1.42033e-22	0.019004	2.10289e-22	38	5				
ATG4D	84971	broad.mit.edu	37	19	10655478	10655478	+	Silent	SNP	G	G	T	rs377537664		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:10655478G>T	ENST00000309469.4	+	2	428	c.255G>T	c.(253-255)cgG>cgT	p.R85R	ATG4D_ENST00000540862.1_5'Flank	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	85	Cryptic mitochondrial signal peptide.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)	p.R85R(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TTAAAAGCCGGACCAGCTTTA	0.617																																							uc002mov.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(253-255)CGG>CGT		APG4 autophagy 4 homolog D							96.0	89.0	92.0					19																	10655478		2203	4300	6503	SO:0001819	synonymous_variant	84971				autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity	g.chr19:10655478G>T	AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.255G>T	19.37:g.10655478G>T			Somatic				ATG4D_uc010xlg.1_Silent_p.R108R|ATG4D_uc010xlh.1_Silent_p.R22R|ATG4D_uc010dxh.2_RNA|ATG4D_uc010dxi.2_RNA|ATG4D_uc010dxj.2_5'Flank	p.R85R	NM_032885	NP_116274	WXS	Illumina HiSeq	Unspecified	Q86TL0	ATG4D_HUMAN	Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)		2	375	+			85					Q969K0	Silent	SNP	ENST00000309469.4	37	c.255G>T	CCDS12241.1																																																																																				0.617	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452022.1	NM_032885		31	14	1	0	2.08457e-15	0.010818	2.85436e-15	31	14				
BRD4	23476	broad.mit.edu	37	19	15367954	15367954	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:15367954G>T	ENST00000263377.2	-	8	1593	c.1372C>A	c.(1372-1374)Ccg>Acg	p.P458T	BRD4_ENST00000602230.1_5'UTR|BRD4_ENST00000371835.4_Missense_Mutation_p.P458T|BRD4_ENST00000360016.5_Missense_Mutation_p.P458T	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	458					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)	p.P458T(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GGCTCGTCCGGCATCTTGGCA	0.652			T	C15orf55	lethal midline carcinoma of young people																																		uc002nar.2		NA		Dom	yes		19	19p13.1	23476	T	bromodomain containing 4			E	NUT|C15orf55		lethal midline carcinoma of young people		2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1372-1374)CCG>ACG		bromodomain-containing protein 4 isoform long							29.0	27.0	28.0					19																	15367954		2203	4300	6503	SO:0001583	missense	23476				interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding	g.chr19:15367954G>T	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.1372C>A	19.37:g.15367954G>T	ENSP00000263377:p.Pro458Thr		Somatic				BRD4_uc002nas.2_Missense_Mutation_p.P458T|BRD4_uc002nat.3_Missense_Mutation_p.P458T|BRD4_uc002nau.3_Missense_Mutation_p.P458T	p.P458T	NM_058243	NP_490597	WXS	Illumina HiSeq	Unspecified	O60885	BRD4_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)		8	1594	-			458					O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	37	c.1372C>A	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598997	0.87055	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.19669	2.85;2.13;2.13	5.36	5.36	0.76844	Bromodomain (3);	0.000000	0.64402	D	0.000010	T	0.58047	0.2095	M	0.92317	3.295	0.80722	D	1	D;P;D	0.89917	1.0;0.839;1.0	D;P;D	0.83275	0.996;0.848;0.996	T	0.68891	-0.5289	10	0.72032	D	0.01	-11.6813	17.898	0.88895	0.0:0.0:1.0:0.0	.	458;458;458	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	T	458	ENSP00000263377:P458T;ENSP00000360901:P458T;ENSP00000353112:P458T	ENSP00000263377:P458T	P	-	1	0	BRD4	15228954	1.000000	0.71417	0.998000	0.56505	0.833000	0.47200	9.869000	0.99810	2.523000	0.85059	0.655000	0.94253	CCG		0.652	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243		7	1	1	0	1.26484e-09	0.00308	1.54061e-09	7	1				
SLC35E1	79939	broad.mit.edu	37	19	16664607	16664607	+	Silent	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:16664607G>A	ENST00000595753.1	-	6	1133	c.1116C>T	c.(1114-1116)ctC>ctT	p.L372L	CTD-3222D19.2_ENST00000409035.1_3'UTR|SLC35E1_ENST00000593812.1_5'Flank|CTD-3222D19.11_ENST00000597357.1_RNA	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	372					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.L228L(1)		central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						GGGGGAAGAGGAGGCCGTTGT	0.587																																							uc010xph.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1114-1116)CTC>CTT		solute carrier family 35, member E1							121.0	115.0	117.0					19																	16664607		2203	4300	6503	SO:0001819	synonymous_variant	79939				transport	integral to membrane		g.chr19:16664607G>A	AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.1116C>T	19.37:g.16664607G>A			Somatic				MED26_uc002nee.2_RNA	p.L372L	NM_024881	NP_079157	WXS	Illumina HiSeq	Unspecified	Q96K37	S35E1_HUMAN			6	1134	-			372					Q8NBQ2|Q96JV7	Silent	SNP	ENST00000595753.1	37	c.1116C>T	CCDS12346.2																																																																																				0.587	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881		41	16	0	0	0	0.00874	0	41	16				
KLHL26	55295	broad.mit.edu	37	19	18778558	18778558	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:18778558C>G	ENST00000300976.4	+	3	441	c.351C>G	c.(349-351)atC>atG	p.I117M	KLHL26_ENST00000599006.1_Missense_Mutation_p.I117M|KLHL26_ENST00000596843.1_3'UTR	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	117	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.							p.I117M(1)		breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						TGCGGCACATCATCGACTTCG	0.662																																							uc002njz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(349-351)ATC>ATG		kelch-like 26							71.0	69.0	70.0					19																	18778558		2203	4298	6501	SO:0001583	missense	55295							g.chr19:18778558C>G		CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.351C>G	19.37:g.18778558C>G	ENSP00000300976:p.Ile117Met		Somatic					p.I117M	NM_018316	NP_060786	WXS	Illumina HiSeq	Unspecified	Q53HC5	KLH26_HUMAN			3	378	+			117			BTB.		Q8TAP0|Q9NUX3	Missense_Mutation	SNP	ENST00000300976.4	37	c.351C>G	CCDS12384.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.873189	0.33069	.	.	ENSG00000167487	ENST00000431920;ENST00000300976	T	0.69306	-0.39	5.04	1.11	0.20524	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.053441	0.64402	D	0.000001	T	0.68869	0.3048	L	0.41492	1.28	0.58432	D	0.999992	D	0.89917	1.0	D	0.80764	0.994	T	0.66830	-0.5824	10	0.87932	D	0	.	5.8131	0.18477	0.2344:0.5948:0.0:0.1707	.	117	Q53HC5	KLH26_HUMAN	M	117	ENSP00000300976:I117M	ENSP00000300976:I117M	I	+	3	3	KLHL26	18639558	0.998000	0.40836	0.967000	0.41034	0.224000	0.24922	0.619000	0.24388	0.395000	0.25257	0.591000	0.81541	ATC		0.662	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465145.1	NM_018316		25	23	0	0	0	0.004656	0	25	23				
ZNF43	7594	broad.mit.edu	37	19	21992461	21992461	+	Silent	SNP	C	C	T	rs147543020	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:21992461C>T	ENST00000354959.4	-	4	547	c.378G>A	c.(376-378)gtG>gtA	p.V126V	ZNF43_ENST00000595461.1_Silent_p.V120V|ZNF43_ENST00000598381.1_Silent_p.V120V|ZNF43_ENST00000594012.1_Silent_p.V120V	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	126					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V126V(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		CTCCTCTGTGCACCTTACACT	0.323													C|||	14	0.00279553	0.0	0.0	5008	,	,		15696	0.0		0.003	False		,,,				2504	0.0112						uc002nqj.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(376-378)GTG>GTA		zinc finger protein 43		C		0,4406		0,0,2203	83.0	81.0	81.0		378	-0.3	0.0	19	dbSNP_134	81	4,8594	3.7+/-12.6	0,4,4295	no	coding-synonymous	ZNF43	NM_003423.2		0,4,6498	TT,TC,CC		0.0465,0.0,0.0308		126/810	21992461	4,13000	2203	4299	6502	SO:0001819	synonymous_variant	7594				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21992461C>T	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.378G>A	19.37:g.21992461C>T			Somatic				ZNF43_uc010ecv.2_Silent_p.V120V|ZNF43_uc002nql.2_Silent_p.V120V|ZNF43_uc002nqm.2_Silent_p.V120V|ZNF43_uc002nqk.2_Silent_p.V56V	p.V126V	NM_003423	NP_003414	WXS	Illumina HiSeq	Unspecified	P17038	ZNF43_HUMAN		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)	4	508	-		Renal(1328;0.000219)|Hepatocellular(1079;0.121)	126					A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Silent	SNP	ENST00000354959.4	37	c.378G>A	CCDS12413.2																																																																																				0.323	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423		31	58	0	0	0	0.015359	0	31	58				
ZNF676	163223	broad.mit.edu	37	19	22379529	22379529	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:22379529C>A	ENST00000397121.2	-	0	224					NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TCAATGCTCCCTGGAAAACAC	0.413																																							uc002nqs.1		NA																	0					0						c.(-95--91)CAGGG>CATGG		zinc finger protein 676																																						163223				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22379529C>A	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.-94G>T	19.37:g.22379529C>A			Somatic						NM_001001411	NP_001001411	WXS	Illumina HiSeq	Unspecified	Q8N7Q3	ZN676_HUMAN			1	225	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)						A8MVX5	Translation_Start_Site	SNP	ENST00000397121.2	37	c.-93G>T	CCDS42539.1																																																																																				0.413	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411		30	37	1	0	2.08457e-15	0.010818	2.85436e-15	30	37				
ZNF99	7652	broad.mit.edu	37	19	22942366	22942366	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:22942366T>A	ENST00000596209.1	-	4	435	c.345A>T	c.(343-345)aaA>aaT	p.K115N	ZNF99_ENST00000397104.3_Missense_Mutation_p.K136N	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	115					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K136N(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTTCACAATCTTTTCTTAATC	0.338																																							uc010xrh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(406-408)AAA>AAT		zinc finger protein 99							107.0	100.0	103.0					19																	22942366		1845	4096	5941	SO:0001583	missense	7652							g.chr19:22942366T>A	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.345A>T	19.37:g.22942366T>A	ENSP00000472969:p.Lys115Asn		Somatic					p.K136N	NM_001080409	NP_001073878	WXS	Illumina HiSeq	Unspecified					4	408	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.408A>T	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	7.944	0.743499	0.15642	.	.	ENSG00000213973	ENST00000397104	T	0.06768	3.26	0.257	0.257	0.15574	.	.	.	.	.	T	0.10766	0.0263	M	0.78223	2.4	0.09310	N	1	B	0.28470	0.213	B	0.31547	0.132	T	0.32640	-0.9899	9	0.48119	T	0.1	.	2.6441	0.04979	0.0:0.4159:0.0:0.5841	.	136	A8MXY4	ZNF99_HUMAN	N	136	ENSP00000380293:K136N	ENSP00000380293:K136N	K	-	3	2	ZNF99	22734206	0.001000	0.12720	0.081000	0.20488	0.074000	0.17049	0.919000	0.28692	0.325000	0.23359	0.316000	0.21350	AAA		0.338	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		23	40	0	0	0	0.021523	0	23	40				
RPSAP58	388524	broad.mit.edu	37	19	24010294	24010294	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:24010294C>G	ENST00000496398.1	+	4	754	c.331C>G	c.(331-333)Cag>Gag	p.Q111E	RP11-255H23.4_ENST00000599944.1_lincRNA|RP11-255H23.2_ENST00000471224.1_RNA|RPSAP58_ENST00000354585.4_Missense_Mutation_p.Q111E					ribosomal protein SA pseudogene 58									p.Q111E(12)		endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						CTTCACTAACCAGATCCAGGC	0.567																																							uc002nrn.2		NA																	12	Substitution - Missense(12)		kidney(6)|urinary_tract(2)|prostate(2)|endometrium(2)		0						c.(331-333)CAG>GAG		ribosomal protein SA																																				SO:0001583	missense	388524							g.chr19:24010294C>G			19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.331C>G	19.37:g.24010294C>G	ENSP00000417240:p.Gln111Glu		Somatic					p.Q111E	NM_002295	NP_002286	WXS	Illumina HiSeq	Unspecified					4	754	+									Missense_Mutation	SNP	ENST00000496398.1	37	c.331C>G		.	.	.	.	.	.	.	.	.	.	.	13.90	2.375690	0.42105	.	.	ENSG00000205246	ENST00000496398;ENST00000354585	T;T	0.21932	1.98;1.98	2.52	2.52	0.30459	.	0.000000	0.64402	U	0.000001	T	0.17619	0.0423	.	.	.	0.48830	D	0.999718	B	0.34226	0.443	B	0.32624	0.149	T	0.11084	-1.0602	9	0.72032	D	0.01	.	10.8987	0.47038	0.0:1.0:0.0:0.0	.	111	A6NE09	.	E	111	ENSP00000417240:Q111E;ENSP00000346598:Q111E	ENSP00000346598:Q111E	Q	+	1	0	RPSAP58	23802134	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	4.812000	0.62613	1.477000	0.48234	0.627000	0.83407	CAG		0.567	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350238.1	NR_003662		3	41	0	0	0	0.004672	0	3	41				
ZNF536	9745	broad.mit.edu	37	19	31039889	31039889	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:31039889G>T	ENST00000355537.3	+	4	3510	c.3363G>T	c.(3361-3363)atG>atT	p.M1121I		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1121					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.M1121I(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ACCCAGGCATGGTTGGCTCAG	0.562																																							uc002nsu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|large_intestine(2)|skin(2)	11						c.(3361-3363)ATG>ATT		zinc finger protein 536							72.0	77.0	75.0					19																	31039889		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31039889G>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3363G>T	19.37:g.31039889G>T	ENSP00000347730:p.Met1121Ile		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.M1121I	p.M1121I	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			4	3501	+	Esophageal squamous(110;0.0834)		1121					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.3363G>T	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	1.948	-0.441994	0.04604	.	.	ENSG00000198597	ENST00000355537	T	0.07688	3.17	5.47	3.25	0.37280	.	1.131640	0.06337	N	0.707223	T	0.05181	0.0138	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36163	-0.9759	10	0.09590	T	0.72	-1.7585	8.9675	0.35885	0.0:0.1515:0.5538:0.2947	.	1121;1121	A7E228;O15090	.;ZN536_HUMAN	I	1121	ENSP00000347730:M1121I	ENSP00000347730:M1121I	M	+	3	0	ZNF536	35731729	0.045000	0.20229	0.011000	0.14972	0.030000	0.12068	0.969000	0.29370	1.289000	0.44618	0.655000	0.94253	ATG		0.562	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		17	24	1	0	4.14922e-12	0.004007	5.33289e-12	17	24				
CEP89	84902	broad.mit.edu	37	19	33439179	33439179	+	Silent	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:33439179T>C	ENST00000305768.5	-	5	676	c.588A>G	c.(586-588)caA>caG	p.Q196Q	CEP89_ENST00000590597.2_Silent_p.Q196Q	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	196					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.Q196Q(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						TACCTTTTTGTTGTGTCCGCT	0.353																																							uc002nty.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(586-588)CAA>CAG		coiled-coil domain containing 123							50.0	42.0	45.0					19																	33439179		2203	4300	6503	SO:0001819	synonymous_variant	84902					centrosome|spindle pole		g.chr19:33439179T>C	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.588A>G	19.37:g.33439179T>C			Somatic				CCDC123_uc002ntx.2_5'UTR|CCDC123_uc010edg.2_RNA|CCDC123_uc002ntz.1_Silent_p.Q196Q|CCDC123_uc002nua.2_Silent_p.Q196Q|CCDC123_uc002nub.1_Silent_p.Q88Q	p.Q196Q	NM_032816	NP_116205	WXS	Illumina HiSeq	Unspecified	Q96ST8	CEP89_HUMAN			5	677	-	Esophageal squamous(110;0.137)		196					B9EGA6|Q8N5J8	Silent	SNP	ENST00000305768.5	37	c.588A>G	CCDS32987.1																																																																																				0.353	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816		19	17	0	0	0	0.008871	0	19	17				
KIRREL2	84063	broad.mit.edu	37	19	36350399	36350399	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:36350399G>T	ENST00000360202.5	+	5	737	c.539G>T	c.(538-540)gGg>gTg	p.G180V	NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000262625.7_Missense_Mutation_p.G180V|KIRREL2_ENST00000592409.1_Missense_Mutation_p.G180V|KIRREL2_ENST00000347900.6_Missense_Mutation_p.G130V	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	180	Ig-like C2-type 2.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)		p.G180V(2)		breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTGAAGGAAGGGACCCCTGGG	0.562																																							uc002ocb.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(538-540)GGG>GTG		kin of IRRE-like 2 isoform c							70.0	65.0	67.0					19																	36350399		2203	4300	6503	SO:0001583	missense	84063				cell adhesion	integral to membrane|plasma membrane		g.chr19:36350399G>T	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.539G>T	19.37:g.36350399G>T	ENSP00000353331:p.Gly180Val		Somatic				KIRREL2_uc002obz.3_Missense_Mutation_p.G180V|KIRREL2_uc002oca.3_Missense_Mutation_p.G130V|KIRREL2_uc002occ.3_Missense_Mutation_p.G127V|KIRREL2_uc002ocd.3_Missense_Mutation_p.G177V	p.G180V	NM_199180	NP_954649	WXS	Illumina HiSeq	Unspecified	Q6UWL6	KIRR2_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		5	751	+	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		180			Ig-like C2-type 2.|Extracellular (Potential).		C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	37	c.539G>T	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.391361	0.62066	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	D;D;D	0.87334	-2.24;-2.24;-2.24	5.03	2.43	0.29744	Immunoglobulin subtype (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.623519	0.13817	N	0.360669	D	0.91606	0.7348	H	0.94886	3.595	0.09310	N	0.999993	P;P;P;P;P	0.49783	0.782;0.879;0.864;0.928;0.928	P;P;P;P;P	0.49922	0.455;0.626;0.61;0.603;0.603	D	0.84256	0.0480	10	0.72032	D	0.01	-2.0622	6.426	0.21770	0.2714:0.0:0.7286:0.0	.	180;180;180;130;180	F1T0I2;Q6UWL6-4;Q6UWL6;Q6UWL6-3;Q6UWL6-2	.;.;KIRR2_HUMAN;.;.	V	180;130;180;180	ENSP00000262625:G180V;ENSP00000345067:G130V;ENSP00000353331:G180V	ENSP00000262625:G180V	G	+	2	0	KIRREL2	41042239	1.000000	0.71417	0.005000	0.12908	0.455000	0.32408	3.017000	0.49615	0.567000	0.29293	0.644000	0.83932	GGG		0.562	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123		19	28	1	0	1.64113e-05	0.010504	1.80957e-05	19	28				
RASGRP4	115727	broad.mit.edu	37	19	38905688	38905688	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:38905688C>G	ENST00000587738.1	-	9	1100	c.1030G>C	c.(1030-1032)Gcg>Ccg	p.A344P	RASGRP4_ENST00000454404.2_Missense_Mutation_p.A310P|RASGRP4_ENST00000587753.1_Intron|RASGRP4_ENST00000426920.2_Intron|RASGRP4_ENST00000586305.1_Missense_Mutation_p.A330P|RASGRP4_ENST00000293062.9_Missense_Mutation_p.A247P|RASGRP4_ENST00000433821.2_Intron			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	344	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.A344P(1)		cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CGGAAACCCGCGCAGCCAGCC	0.672																																							uc002oir.2		NA																	1	Substitution - Missense(1)	p.A344E(1)	lung(1)	pancreas(1)|lung(1)|skin(1)	3						c.(1030-1032)GCG>CCG		RAS guanyl releasing protein 4 isoform a							11.0	17.0	15.0					19																	38905688		1974	4156	6130	SO:0001583	missense	115727				activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity	g.chr19:38905688C>G	AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1030G>C	19.37:g.38905688C>G	ENSP00000465772:p.Ala344Pro		Somatic				RASGRP4_uc010efz.1_RNA|RASGRP4_uc010ega.1_RNA|RASGRP4_uc010xua.1_Intron|RASGRP4_uc010xub.1_Missense_Mutation_p.A310P|RASGRP4_uc010xuc.1_Intron|RASGRP4_uc010xud.1_Missense_Mutation_p.A247P|RASGRP4_uc010xue.1_Intron|RASGRP4_uc010egb.2_Missense_Mutation_p.A330P	p.A344P	NM_170604	NP_733749	WXS	Illumina HiSeq	Unspecified	Q8TDF6	GRP4_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		9	1244	-	all_cancers(60;4.21e-06)		344			Ras-GEF.		A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Missense_Mutation	SNP	ENST00000587738.1	37	c.1030G>C	CCDS46068.1	.	.	.	.	.	.	.	.	.	.	C	10.26	1.302271	0.23736	.	.	ENSG00000171777	ENST00000293062;ENST00000405332;ENST00000454404	T	0.30981	1.51	4.72	1.18	0.20946	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.956421	0.08779	N	0.894926	T	0.21062	0.0507	N	0.22421	0.69	0.09310	N	1	B;B;B;P	0.35821	0.087;0.051;0.07;0.523	B;B;B;B	0.41646	0.362;0.05;0.124;0.174	T	0.30794	-0.9966	10	0.56958	D	0.05	-0.1817	0.5277	0.00623	0.1804:0.1975:0.165:0.4571	.	247;310;330;344	C0LTP7;C0LTP4;Q8TDF6-2;Q8TDF6	.;.;.;GRP4_HUMAN	P	247;344;344	ENSP00000293062:A247P	ENSP00000293062:A247P	A	-	1	0	RASGRP4	43597528	0.001000	0.12720	0.002000	0.10522	0.696000	0.40369	-0.136000	0.10405	0.293000	0.22520	-0.458000	0.05436	GCG		0.672	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460540.1	NM_170604		6	5	0	0	0	0.001984	0	6	5				
FCGBP	8857	broad.mit.edu	37	19	40430472	40430472	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:40430472T>G	ENST00000221347.6	-	3	1478	c.1471A>C	c.(1471-1473)Atg>Ctg	p.M491L		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	491	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.M491L(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CAGGTGCCCATCATGTCGTAG	0.687																																							uc002omp.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(1471-1473)ATG>CTG		Fc fragment of IgG binding protein precursor							54.0	36.0	42.0					19																	40430472		2200	4299	6499	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40430472T>G	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.1471A>C	19.37:g.40430472T>G	ENSP00000221347:p.Met491Leu		Somatic					p.M491L	NM_003890	NP_003881	WXS	Illumina HiSeq	Unspecified	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		3	1479	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		491			VWFD 1.		O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.1471A>C	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	T	18.29	3.591306	0.66219	.	.	ENSG00000090920	ENST00000221347	T	0.58506	0.33	5.0	5.0	0.66597	von Willebrand factor, type D domain (3);	0.150621	0.37761	U	0.001956	T	0.63510	0.2517	L	0.56340	1.77	0.24788	N	0.992771	P	0.45283	0.855	P	0.52758	0.708	T	0.56649	-0.7944	10	0.27785	T	0.31	.	13.8454	0.63463	0.0:0.0:0.0:1.0	.	491	Q9Y6R7	FCGBP_HUMAN	L	491	ENSP00000221347:M491L	ENSP00000221347:M491L	M	-	1	0	FCGBP	45122312	0.961000	0.32948	1.000000	0.80357	0.973000	0.67179	0.558000	0.23469	2.109000	0.64355	0.459000	0.35465	ATG		0.687	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		4	6	0	0	0	0.009096	0	4	6				
BCKDHA	593	broad.mit.edu	37	19	41932338	41932338	+	IGR	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:41932338G>T	ENST00000269980.2	+	0	2103				CTC-435M10.6_ENST00000598887.1_RNA|B3GNT8_ENST00000321702.2_Missense_Mutation_p.R116S|B3GNT8_ENST00000601379.1_5'UTR	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)	p.R116S(1)		central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						AAGAAGCGGCGGAGGTCCTTG	0.667																																							uc002oqs.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(346-348)CGC>AGC		UDP-GlcNAc:betaGal							28.0	30.0	30.0					19																	41932338		2201	4300	6501	SO:0001628	intergenic_variant	374907				poly-N-acetyllactosamine biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity|protein N-acetylglucosaminyltransferase activity	g.chr19:41932338G>T	J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128		19.37:g.41932338G>T			Somatic				CYP2F1_uc010xvw.1_Intron|B3GNT8_uc002oqt.1_Intron	p.R116S	NM_198540	NP_940942	WXS	Illumina HiSeq	Unspecified	Q7Z7M8	B3GN8_HUMAN			3	800	-			116			Lumenal (Potential).		B4DP47|E7EW46|Q16034|Q16472	Missense_Mutation	SNP	ENST00000269980.2	37	c.346C>A	CCDS12581.1	.	.	.	.	.	.	.	.	.	.	G	7.605	0.673544	0.14776	.	.	ENSG00000177191	ENST00000321702	T	0.39229	1.09	4.21	3.15	0.36227	.	0.308284	0.21618	U	0.071684	T	0.42607	0.1210	M	0.80422	2.495	0.09310	N	1	B	0.24768	0.111	B	0.26693	0.072	T	0.38045	-0.9679	10	0.40728	T	0.16	.	7.2954	0.26391	0.0:0.1878:0.6182:0.194	.	116	Q7Z7M8	B3GN8_HUMAN	S	116	ENSP00000312700:R116S	ENSP00000312700:R116S	R	-	1	0	B3GNT8	46624178	0.372000	0.25064	0.149000	0.22428	0.173000	0.22820	2.777000	0.47717	1.104000	0.41587	0.462000	0.41574	CGC		0.667	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398313.3	NM_000709		13	20	1	0	0.00244969	0.020292	0.00254065	13	20				
MARK4	57787	broad.mit.edu	37	19	45805710	45805710	+	Silent	SNP	G	G	T	rs200769427		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:45805710G>T	ENST00000262891.4	+	17	2332	c.2001G>T	c.(1999-2001)tcG>tcT	p.S667S	MARK4_ENST00000300843.4_3'UTR	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	667					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)	p.S667S(1)		NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGACCAGCTCGCGCCCTCCTG	0.677																																							uc002pbb.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|large_intestine(1)	3						c.(1999-2001)TCG>TCT		RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;							100.0	105.0	103.0					19																	45805710		2203	4300	6503	SO:0001819	synonymous_variant	57787				microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding	g.chr19:45805710G>T	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.2001G>T	19.37:g.45805710G>T			Somatic				MARK4_uc002pba.1_3'UTR	p.S667S			WXS	Illumina HiSeq	Unspecified	Q96L34	MARK4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0102)	17	2006	+		all_neural(266;0.224)|Ovarian(192;0.231)	667					Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Silent	SNP	ENST00000262891.4	37	c.2001G>T	CCDS56097.1																																																																																				0.677	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417		75	83	1	0	7.25294e-45	0.01441	1.1779e-44	75	83				
DHDH	27294	broad.mit.edu	37	19	49439303	49439303	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:49439303G>A	ENST00000221403.2	+	3	257	c.217G>A	c.(217-219)Ggc>Agc	p.G73S	DHDH_ENST00000523250.1_Intron|DHDH_ENST00000522614.1_Missense_Mutation_p.G73S	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	73					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.G73S(1)		central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GGCCTACATTGGCACCCAGCA	0.682																																							uc002ple.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(217-219)GGC>AGC		dimeric dihydrodiol dehydrogenase							17.0	16.0	16.0					19																	49439303		2201	4297	6498	SO:0001583	missense	27294				carbohydrate metabolic process		binding|D-xylose 1-dehydrogenase (NADP+) activity|electron carrier activity|NAD(P)+ transhydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity	g.chr19:49439303G>A	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.217G>A	19.37:g.49439303G>A	ENSP00000221403:p.Gly73Ser		Somatic					p.G73S	NM_014475	NP_055290	WXS	Illumina HiSeq	Unspecified	Q9UQ10	DHDH_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)	3	257	+		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	73						Missense_Mutation	SNP	ENST00000221403.2	37	c.217G>A	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.648720	0.87958	.	.	ENSG00000104808	ENST00000221403;ENST00000522614	T;T	0.20881	2.04;2.04	5.11	4.0	0.46444	Oxidoreductase, N-terminal (1);NAD(P)-binding domain (1);	0.100443	0.64402	D	0.000002	T	0.29850	0.0746	L	0.31065	0.9	0.53005	D	0.999964	D	0.59357	0.985	P	0.61275	0.886	T	0.01212	-1.1417	10	0.54805	T	0.06	-21.0668	13.6292	0.62186	0.0:0.157:0.843:0.0	.	73	Q9UQ10	DHDH_HUMAN	S	73	ENSP00000221403:G73S;ENSP00000428672:G73S	ENSP00000221403:G73S	G	+	1	0	DHDH	54131115	1.000000	0.71417	0.889000	0.34880	0.805000	0.45488	8.178000	0.89690	2.815000	0.96918	0.650000	0.86243	GGC		0.682	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1	NM_014475		3	10	0	0	0	0.009096	0	3	10				
SIGLEC5	8778	broad.mit.edu	37	19	52115520	52115520	+	Missense_Mutation	SNP	G	G	T	rs551417438		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:52115520G>T	ENST00000534261.2	-	10	2019	c.1620C>A	c.(1618-1620)agC>agA	p.S540R	SIGLEC5_ENST00000222107.4_Missense_Mutation_p.S540R|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.S540R|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.S540R|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.S540R			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	540					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.S540R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		ACTCCGTGGTGCTTGGGGCCT	0.552													G|||	1	0.000199681	0.0	0.0	5008	,	,		18348	0.0		0.0	False		,,,				2504	0.001						uc002pxe.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|breast(1)|central_nervous_system(1)	4						c.(1618-1620)AGC>AGA		sialic acid binding Ig-like lectin 5 precursor							147.0	127.0	133.0					19																	52115520		2203	4300	6503	SO:0001583	missense	8778				cell adhesion	integral to membrane	sugar binding	g.chr19:52115520G>T	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1620C>A	19.37:g.52115520G>T	ENSP00000473238:p.Ser540Arg		Somatic					p.S540R	NM_003830	NP_003821	WXS	Illumina HiSeq	Unspecified	O15389	SIGL5_HUMAN		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)	9	1759	-		all_neural(266;0.0726)	540			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000534261.2	37	c.1620C>A	CCDS33088.1	.	.	.	.	.	.	.	.	.	.	G	8.748	0.920623	0.17982	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.15487	2.42;2.42	3.51	1.3	0.21679	.	.	.	.	.	T	0.12178	0.0296	L	0.40543	1.245	0.09310	N	1	B	0.22851	0.076	B	0.19148	0.024	T	0.27123	-1.0083	9	0.41790	T	0.15	.	4.233	0.10613	0.122:0.0:0.6525:0.2255	.	540	O15389	SIGL5_HUMAN	R	540	ENSP00000222107:S540R;ENSP00000415200:S540R	ENSP00000222107:S540R	S	-	3	2	SIGLEC5	56807332	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	0.069000	0.14552	0.459000	0.27016	0.650000	0.86243	AGC		0.552	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830		41	46	1	0	6.5261e-18	0.00874	9.11479e-18	41	46				
NLRP11	204801	broad.mit.edu	37	19	56320320	56320320	+	Silent	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:56320320A>G	ENST00000589093.1	-	3	1749	c.1656T>C	c.(1654-1656)aaT>aaC	p.N552N	NLRP11_ENST00000592953.1_Silent_p.N453N|NLRP11_ENST00000589824.2_Silent_p.N552N|NLRP11_ENST00000443188.1_Silent_p.N552N|NLRP11_ENST00000360133.3_Silent_p.N552N			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	552							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)	p.N552N(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CTTCTTCCCGATTCTCATAGA	0.433																																							uc010ygf.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(1654-1656)AAT>AAC		NLR family, pyrin domain containing 11							146.0	135.0	138.0					19																	56320320		2203	4300	6503	SO:0001819	synonymous_variant	204801						ATP binding	g.chr19:56320320A>G	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.1656T>C	19.37:g.56320320A>G			Somatic				NLRP11_uc002qlz.2_Silent_p.N453N|NLRP11_uc002qmb.2_Silent_p.N453N|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	p.N552N	NM_145007	NP_659444	WXS	Illumina HiSeq	Unspecified	P59045	NAL11_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	5	2367	-		Colorectal(82;0.0002)	552					C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Silent	SNP	ENST00000589093.1	37	c.1656T>C	CCDS12935.1																																																																																				0.433	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007		53	66	0	0	0	0.01441	0	53	66				
USP29	57663	broad.mit.edu	37	19	57640629	57640629	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:57640629A>G	ENST00000254181.4	+	4	1040	c.586A>G	c.(586-588)Aag>Gag	p.K196E	USP29_ENST00000598197.1_Missense_Mutation_p.K196E	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	196					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.K196E(1)|p.K196*(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAAGAAATATAAGACAGATTC	0.363																																							uc002qny.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(2)	lung(6)|ovary(2)|breast(2)|pancreas(1)	11						c.(586-588)AAG>GAG		ubiquitin specific peptidase 29							82.0	87.0	86.0					19																	57640629		2203	4300	6503	SO:0001583	missense	57663				protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chr19:57640629A>G		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.586A>G	19.37:g.57640629A>G	ENSP00000254181:p.Lys196Glu		Somatic					p.K196E	NM_020903	NP_065954	WXS	Illumina HiSeq	Unspecified	Q9HBJ7	UBP29_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	942	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	196						Missense_Mutation	SNP	ENST00000254181.4	37	c.586A>G	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	A	3.685	-0.064707	0.07273	.	.	ENSG00000131864	ENST00000254181	T	0.47528	0.84	2.79	1.75	0.24633	.	0.721487	0.11418	U	0.566105	T	0.35566	0.0936	L	0.48642	1.525	0.09310	N	1	P	0.36027	0.533	B	0.30943	0.122	T	0.12967	-1.0527	10	0.38643	T	0.18	-4.4144	7.4993	0.27509	0.7811:0.2189:0.0:0.0	.	196	Q9HBJ7	UBP29_HUMAN	E	196	ENSP00000254181:K196E	ENSP00000254181:K196E	K	+	1	0	USP29	62332441	0.010000	0.17322	0.002000	0.10522	0.005000	0.04900	0.637000	0.24659	0.438000	0.26450	0.482000	0.46254	AAG		0.363	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			48	78	0	0	0	0.01441	0	48	78				
ZNF418	147686	broad.mit.edu	37	19	58438312	58438312	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr19:58438312G>A	ENST00000396147.1	-	4	1528	c.1237C>T	c.(1237-1239)Ctt>Ttt	p.L413F	ZNF418_ENST00000425570.3_Missense_Mutation_p.L434F|ZNF418_ENST00000599852.1_Missense_Mutation_p.L328F|ZNF418_ENST00000595830.1_Missense_Mutation_p.L413F|ZNF418_ENST00000599086.1_5'Flank|ZNF418_ENST00000600989.1_Intron	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L413F(1)		cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		TGGTTCCTAAGGTGTCCCTTT	0.463																																							uc002qqs.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1237-1239)CTT>TTT		zinc finger protein 418							160.0	164.0	162.0					19																	58438312		2202	4300	6502	SO:0001583	missense	147686				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58438312G>A	AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.1237C>T	19.37:g.58438312G>A	ENSP00000379451:p.Leu413Phe		Somatic				ZNF418_uc010yhn.1_RNA|ZNF418_uc010yho.1_Missense_Mutation_p.L328F	p.L413F	NM_133460	NP_597717	WXS	Illumina HiSeq	Unspecified	Q8TF45	ZN418_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)	4	1529	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	413			C2H2-type 8.		Q2M1S2|Q670L5|Q96N18	Missense_Mutation	SNP	ENST00000396147.1	37	c.1237C>T	CCDS42642.1	.	.	.	.	.	.	.	.	.	.	.	18.54	3.646389	0.67358	.	.	ENSG00000196724	ENST00000396147;ENST00000425570;ENST00000545403	T;T	0.52057	0.68;0.68	2.3	1.22	0.21188	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.62720	0.2451	M	0.75615	2.305	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.48198	-0.9056	9	0.52906	T	0.07	.	6.1193	0.20144	0.286:0.0:0.714:0.0	.	413	Q8TF45	ZN418_HUMAN	F	413;434;379	ENSP00000379451:L413F;ENSP00000407039:L434F	ENSP00000379451:L413F	L	-	1	0	ZNF418	63130124	0.718000	0.27976	0.001000	0.08648	0.961000	0.63080	1.615000	0.36922	0.306000	0.22856	0.298000	0.19748	CTT		0.463	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466693.1	NM_133460		40	112	0	0	0	0.010771	0	40	112				
DNMT3A	1788	broad.mit.edu	37	2	25470989	25470989	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:25470989C>T	ENST00000264709.3	-	7	1109	c.772G>A	c.(772-774)Gtg>Atg	p.V258M	DNMT3A_ENST00000380746.4_Missense_Mutation_p.V69M|DNMT3A_ENST00000402667.1_Missense_Mutation_p.V35M|DNMT3A_ENST00000321117.5_Missense_Mutation_p.V258M	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	258	Interaction with DNMT1 and DNMT3B.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.V258M(1)|p.V69M(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGGTAGCCACAGTGGGGGAT	0.637			"""Mis, F, N, S"""		AML																																		uc002rgc.2		NA		Rec	yes		2	2p23	1788	Mis|F|N|S	DNA (cytosine-5-)-methyltransferase 3 alpha			L			AML		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140						c.(772-774)GTG>ATG		DNA cytosine methyltransferase 3 alpha isoform							59.0	63.0	62.0					2																	25470989		2203	4300	6503	SO:0001583	missense	1788				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding	g.chr2:25470989C>T		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.772G>A	2.37:g.25470989C>T	ENSP00000264709:p.Val258Met		Somatic				DNMT3A_uc002rgd.2_Missense_Mutation_p.V258M|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.V69M	p.V258M	NM_022552	NP_072046	WXS	Illumina HiSeq	Unspecified	Q9Y6K1	DNM3A_HUMAN			7	1029	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		258			Interaction with DNMT1 and DNMT3B.		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	37	c.772G>A	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516037	0.85495	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.93763	-3.27;-3.28;-3.28;-3.24	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.91449	0.7301	L	0.36672	1.1	0.80722	D	1	P;P	0.50943	0.74;0.94	B;P	0.46110	0.214;0.504	D	0.90827	0.4713	10	0.37606	T	0.19	-9.3262	18.2356	0.89948	0.0:1.0:0.0:0.0	.	258;69	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	M	69;258;258;35	ENSP00000370122:V69M;ENSP00000324375:V258M;ENSP00000264709:V258M;ENSP00000384237:V35M	ENSP00000264709:V258M	V	-	1	0	DNMT3A	25324493	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.054000	0.76649	2.653000	0.90120	0.563000	0.77884	GTG		0.637	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552		30	43	0	0	0	0.012213	0	30	43				
GCKR	2646	broad.mit.edu	37	2	27726407	27726407	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:27726407C>A	ENST00000264717.2	+	9	734	c.671C>A	c.(670-672)tCa>tAa	p.S224*	GCKR_ENST00000424318.2_Nonsense_Mutation_p.S34*	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	224	SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)	p.S224*(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					GACTGGAGTTCAACATTCCGA	0.493																																							uc002rky.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(670-672)TCA>TAA		glucokinase regulatory protein							98.0	79.0	86.0					2																	27726407		2203	4300	6503	SO:0001587	stop_gained	2646				carbohydrate metabolic process|glucose transport|negative regulation of glucokinase activity|positive regulation of gene expression|protein import into nucleus, translocation|regulation of glucose transport|response to fructose stimulus|transmembrane transport|triglyceride homeostasis|urate metabolic process	cytosol|nucleoplasm	fructose-6-phosphate binding|protein binding	g.chr2:27726407C>A	Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	ENST00000264717.2:c.671C>A	2.37:g.27726407C>A	ENSP00000264717:p.Ser224*		Somatic				GCKR_uc010ezd.2_Nonsense_Mutation_p.S224*|GCKR_uc010ylu.1_Nonsense_Mutation_p.S34*	p.S224*	NM_001486	NP_001477	WXS	Illumina HiSeq	Unspecified	Q14397	GCKR_HUMAN			9	737	+	Acute lymphoblastic leukemia(172;0.155)		224			SIS 1.		A1L4C2|B4DPQ2|Q53RY6|Q99522	Nonsense_Mutation	SNP	ENST00000264717.2	37	c.671C>A	CCDS1757.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569761	0.86439	.	.	ENSG00000084734	ENST00000264717;ENST00000424318	.	.	.	4.33	3.42	0.39159	.	0.376083	0.24786	N	0.035619	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0054	11.8009	0.52126	0.0:0.8211:0.1789:0.0	.	.	.	.	X	224;34	.	ENSP00000264717:S224X	S	+	2	0	GCKR	27579911	0.942000	0.31987	0.990000	0.47175	0.996000	0.88848	1.783000	0.38664	0.981000	0.38548	0.462000	0.41574	TCA		0.493	GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250214.1	NM_001486		11	17	1	0	5.16669e-11	0.010729	6.44298e-11	11	17				
GCKR	2646	broad.mit.edu	37	2	27726409	27726409	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:27726409A>T	ENST00000264717.2	+	9	736	c.673A>T	c.(673-675)Aca>Tca	p.T225S	GCKR_ENST00000424318.2_Missense_Mutation_p.T35S	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	225	SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)	p.T225S(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					CTGGAGTTCAACATTCCGACA	0.498																																							uc002rky.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(673-675)ACA>TCA		glucokinase regulatory protein							100.0	81.0	87.0					2																	27726409		2203	4300	6503	SO:0001583	missense	2646				carbohydrate metabolic process|glucose transport|negative regulation of glucokinase activity|positive regulation of gene expression|protein import into nucleus, translocation|regulation of glucose transport|response to fructose stimulus|transmembrane transport|triglyceride homeostasis|urate metabolic process	cytosol|nucleoplasm	fructose-6-phosphate binding|protein binding	g.chr2:27726409A>T	Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	ENST00000264717.2:c.673A>T	2.37:g.27726409A>T	ENSP00000264717:p.Thr225Ser		Somatic				GCKR_uc010ezd.2_Missense_Mutation_p.T225S|GCKR_uc010ylu.1_Missense_Mutation_p.T35S	p.T225S	NM_001486	NP_001477	WXS	Illumina HiSeq	Unspecified	Q14397	GCKR_HUMAN			9	739	+	Acute lymphoblastic leukemia(172;0.155)		225			SIS 1.		A1L4C2|B4DPQ2|Q53RY6|Q99522	Missense_Mutation	SNP	ENST00000264717.2	37	c.673A>T	CCDS1757.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.851863	0.51270	.	.	ENSG00000084734	ENST00000264717;ENST00000424318	T;T	0.68181	-0.31;-0.31	4.33	4.33	0.51752	Sugar isomerase (SIS) (1);	0.068298	0.56097	D	0.000027	T	0.48804	0.1520	N	0.13168	0.305	0.27520	N	0.951433	P;P;P	0.51537	0.946;0.791;0.791	B;B;B	0.43155	0.41;0.181;0.181	T	0.43893	-0.9363	10	0.30854	T	0.27	-3.8682	11.4994	0.50428	1.0:0.0:0.0:0.0	.	35;225;225	F5H1P6;A8K731;Q14397	.;.;GCKR_HUMAN	S	225;35	ENSP00000264717:T225S;ENSP00000409109:T35S	ENSP00000264717:T225S	T	+	1	0	GCKR	27579913	0.999000	0.42202	0.979000	0.43373	0.996000	0.88848	5.160000	0.64929	1.804000	0.52760	0.379000	0.24179	ACA		0.498	GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250214.1	NM_001486		11	16	0	0	0	0.010729	0	11	16				
MSH2	4436	broad.mit.edu	37	2	47643558	47643558	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:47643558A>G	ENST00000233146.2	+	6	1289	c.1066A>G	c.(1066-1068)Ata>Gta	p.I356V	MSH2_ENST00000543555.1_Missense_Mutation_p.I290V|MSH2_ENST00000406134.1_Missense_Mutation_p.I356V	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	356					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.I356V(1)|p.?(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TAAGAACAGAATAGAGGAGAG	0.383			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc002rvy.1		NA	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	D|Mis|N|F|S	mutS homolog 2 (E. coli)			E		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		4	Whole gene deletion(2)|Substitution - Missense(1)|Unknown(1)		haematopoietic_and_lymphoid_tissue(3)|lung(1)	large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55						c.(1066-1068)ATA>GTA	MMR	mutS homolog 2							117.0	117.0	117.0					2																	47643558		2203	4300	6503	SO:0001583	missense	4436	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding	g.chr2:47643558A>G	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.1066A>G	2.37:g.47643558A>G	ENSP00000233146:p.Ile356Val		Somatic				MSH2_uc010yoh.1_Missense_Mutation_p.I290V|MSH2_uc002rvz.2_Missense_Mutation_p.I356V|MSH2_uc010fbg.2_Missense_Mutation_p.I166V	p.I356V	NM_000251	NP_000242	WXS	Illumina HiSeq	Unspecified	P43246	MSH2_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		6	1134	+		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	356					B4E2Z2|O75488	Missense_Mutation	SNP	ENST00000233146.2	37	c.1066A>G	CCDS1834.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.148087	0.78001	.	.	ENSG00000095002	ENST00000233146;ENST00000543555;ENST00000406134;ENST00000419559;ENST00000432737;ENST00000453755;ENST00000448533;ENST00000422810;ENST00000413880	D;D;D	0.95885	-3.84;-3.84;-3.84	5.62	5.62	0.85841	DNA mismatch repair protein MutS, core (3);	0.000000	0.85682	D	0.000000	D	0.97084	0.9047	M	0.85945	2.785	0.80722	D	1	P;P;P	0.47841	0.819;0.901;0.763	B;P;P	0.53224	0.429;0.721;0.67	D	0.97543	1.0087	10	0.66056	D	0.02	-23.9925	15.825	0.78698	1.0:0.0:0.0:0.0	.	290;356;356	B4E2Z2;E9PHA6;P43246	.;.;MSH2_HUMAN	V	356;290;356;356;356;356;356;6;142	ENSP00000233146:I356V;ENSP00000442697:I290V;ENSP00000384199:I356V	ENSP00000233146:I356V	I	+	1	0	MSH2	47497062	1.000000	0.71417	1.000000	0.80357	0.686000	0.39977	9.196000	0.94978	2.138000	0.66242	0.383000	0.25322	ATA		0.383	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250805.3			33	59	0	0	0	0.013726	0	33	59				
MEIS1	4211	broad.mit.edu	37	2	66739408	66739408	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:66739408G>C	ENST00000272369.9	+	8	1327	c.870G>C	c.(868-870)tgG>tgC	p.W290C	MEIS1_ENST00000495021.2_Missense_Mutation_p.W225C|MEIS1_ENST00000407092.2_Missense_Mutation_p.W290C|MEIS1_ENST00000488550.1_Missense_Mutation_p.W290C|MEIS1_ENST00000398506.2_Missense_Mutation_p.W288C|MEIS1_ENST00000444274.2_Intron|MEIS1_ENST00000560281.2_Missense_Mutation_p.W290C|MEIS1_ENST00000409517.1_Intron	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	290					angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.W290C(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						TGAGGGCGTGGCTGTTCCAGC	0.393																																							uc002sdu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(868-870)TGG>TGC		Meis homeobox 1							47.0	50.0	49.0					2																	66739408		2042	4223	6265	SO:0001583	missense	4211						sequence-specific DNA binding transcription factor activity	g.chr2:66739408G>C		CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.870G>C	2.37:g.66739408G>C	ENSP00000272369:p.Trp290Cys		Somatic				MEIS1_uc002sdt.2_Missense_Mutation_p.W290C|MEIS1_uc002sdv.2_Missense_Mutation_p.W288C|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Missense_Mutation_p.W225C|MEIS1_uc002sdw.1_Missense_Mutation_p.W146C	p.W290C	NM_002398	NP_002389	WXS	Illumina HiSeq	Unspecified	O00470	MEIS1_HUMAN			8	1327	+			290			Homeobox; TALE-type.		A8MV50	Missense_Mutation	SNP	ENST00000272369.9	37	c.870G>C	CCDS46309.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.778728	0.70107	.	.	ENSG00000143995	ENST00000272369;ENST00000407092;ENST00000398506;ENST00000495021;ENST00000402908;ENST00000450027	D;D;D;D;D	0.96885	-4.16;-4.16;-4.16;-4.16;-4.16	5.95	5.95	0.96441	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99193	0.9720	H	0.99379	4.54	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;0.999	D	0.98572	1.0646	10	0.87932	D	0	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	225;288;290;290	F5GYS8;O00470-2;O00470;F8W8U3	.;.;MEIS1_HUMAN;.	C	290;290;288;225;146;102	ENSP00000272369:W290C;ENSP00000384461:W290C;ENSP00000381518:W288C;ENSP00000440571:W225C;ENSP00000395827:W102C	ENSP00000272369:W290C	W	+	3	0	MEIS1	66592912	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.869000	0.99810	2.824000	0.97209	0.655000	0.94253	TGG		0.393	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319725.4	NM_002398		11	17	0	0	0	0.016723	0	11	17				
REG3G	130120	broad.mit.edu	37	2	79255397	79255397	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:79255397G>C	ENST00000272324.5	+	6	707	c.523G>C	c.(523-525)Gac>Cac	p.D175H	REG3G_ENST00000409471.1_Missense_Mutation_p.D129H|REG3G_ENST00000393897.2_Missense_Mutation_p.D175H	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	175					acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.D175H(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CAAGTTCAAGGACTAGGGCAG	0.493																																							uc002snw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(523-525)GAC>CAC		regenerating islet-derived 3 gamma precursor							89.0	83.0	85.0					2																	79255397		2203	4300	6503	SO:0001583	missense	130120				acute-phase response	extracellular region	sugar binding	g.chr2:79255397G>C	AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.523G>C	2.37:g.79255397G>C	ENSP00000272324:p.Asp175His		Somatic				REG3G_uc002snx.2_Missense_Mutation_p.D175H|REG3G_uc010ffu.2_Missense_Mutation_p.D129H	p.D175H	NM_198448	NP_940850	WXS	Illumina HiSeq	Unspecified	Q6UW15	REG3G_HUMAN			6	608	+			175					A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	ENST00000272324.5	37	c.523G>C	CCDS1962.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.090973	0.55968	.	.	ENSG00000143954	ENST00000393897;ENST00000272324;ENST00000409471	T;T;T	0.19669	4.07;4.07;2.13	4.66	-1.04	0.10068	.	1.756290	0.02888	N	0.133726	T	0.30103	0.0754	L	0.57536	1.79	0.09310	N	1	D;B	0.54397	0.966;0.138	P;B	0.51945	0.685;0.234	T	0.17776	-1.0358	10	0.72032	D	0.01	.	3.1939	0.06626	0.2924:0.0:0.4023:0.3053	.	129;175	Q3SYE6;Q6UW15	.;REG3G_HUMAN	H	175;175;129	ENSP00000377475:D175H;ENSP00000272324:D175H;ENSP00000387105:D129H	ENSP00000272324:D175H	D	+	1	0	REG3G	79108905	0.000000	0.05858	0.002000	0.10522	0.546000	0.35178	-0.898000	0.04105	-0.299000	0.08909	0.650000	0.86243	GAC		0.493	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328247.1	NM_198448		19	31	0	0	0	0.007413	0	19	31				
ASTL	431705	broad.mit.edu	37	2	96789882	96789882	+	Missense_Mutation	SNP	C	C	A	rs199510888		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:96789882C>A	ENST00000342380.2	-	9	1002	c.1003G>T	c.(1003-1005)Gtt>Ttt	p.V335F		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)									p.V335F(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						CCTGCAGGAACGGGCTGGCCT	0.672																																							uc010yui.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1003-1005)GTT>TTT		astacin-like metalloendopeptidase precursor							35.0	40.0	38.0					2																	96789882		2203	4298	6501	SO:0001583	missense	431705				proteolysis		metalloendopeptidase activity|zinc ion binding	g.chr2:96789882C>A	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.1003G>T	2.37:g.96789882C>A	ENSP00000343674:p.Val335Phe		Somatic					p.V335F	NM_001002036	NP_001002036	WXS	Illumina HiSeq	Unspecified	Q6HA08	ASTL_HUMAN			9	1003	-			335						Missense_Mutation	SNP	ENST00000342380.2	37	c.1003G>T	CCDS33249.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.496348	0.26861	.	.	ENSG00000188886	ENST00000342380	T	0.64991	-0.13	4.42	-3.21	0.05140	.	1.101430	0.07191	N	0.855800	T	0.39572	0.1083	N	0.19112	0.55	0.09310	N	1	B	0.29716	0.255	B	0.23419	0.046	T	0.29488	-1.0010	10	0.72032	D	0.01	-0.015	3.7533	0.08575	0.2628:0.3714:0.0:0.3658	.	335	Q6HA08	ASTL_HUMAN	F	335	ENSP00000343674:V335F	ENSP00000343674:V335F	V	-	1	0	ASTL	96153609	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.316000	0.02710	-0.505000	0.06568	-1.053000	0.02334	GTT		0.672	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1			22	33	1	0	7.41877e-09	0.012319	8.90678e-09	22	33				
CHST10	9486	broad.mit.edu	37	2	101014379	101014379	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:101014379C>A	ENST00000264249.3	-	5	803	c.418G>T	c.(418-420)Gtt>Ttt	p.V140F	CHST10_ENST00000409701.1_Missense_Mutation_p.V140F|CHST10_ENST00000542617.1_Missense_Mutation_p.V188F	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	140					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)	p.V140F(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						CCATTTAGAACAATCAGCACT	0.512																																							uc002tam.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(418-420)GTT>TTT		HNK-1 sulfotransferase							152.0	136.0	141.0					2																	101014379		2203	4300	6503	SO:0001583	missense	9486				carbohydrate biosynthetic process|cell adhesion	Golgi membrane|integral to membrane|membrane fraction		g.chr2:101014379C>A	BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.418G>T	2.37:g.101014379C>A	ENSP00000264249:p.Val140Phe		Somatic					p.V140F	NM_004854	NP_004845	WXS	Illumina HiSeq	Unspecified	O43529	CHSTA_HUMAN			5	777	-			140			Lumenal (Potential).		Q53T18	Missense_Mutation	SNP	ENST00000264249.3	37	c.418G>T	CCDS2047.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.828280	0.71143	.	.	ENSG00000115526	ENST00000264249;ENST00000542617;ENST00000409701;ENST00000409046	T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.87245	0.6129	M	0.83384	2.64	0.80722	D	1	D	0.64830	0.994	D	0.65773	0.938	D	0.87984	0.2745	10	0.59425	D	0.04	-33.0619	19.5766	0.95447	0.0:1.0:0.0:0.0	.	140	O43529	CHSTA_HUMAN	F	140;188;140;140	ENSP00000264249:V140F;ENSP00000438869:V188F;ENSP00000387309:V140F;ENSP00000387121:V140F	ENSP00000264249:V140F	V	-	1	0	CHST10	100380811	1.000000	0.71417	0.504000	0.27639	0.243000	0.25628	7.818000	0.86416	2.627000	0.88993	0.655000	0.94253	GTT		0.512	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253162.1	NM_004854		14	20	1	0	0.000219431	0.020292	0.000233355	14	20				
IL18RAP	8807	broad.mit.edu	37	2	103061712	103061712	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:103061712G>C	ENST00000264260.2	+	9	1573	c.984G>C	c.(982-984)caG>caC	p.Q328H	IL18RAP_ENST00000409369.1_Missense_Mutation_p.Q186H	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	328	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.Q328H(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						AAGTCACTCAGCGTGATCTTC	0.403																																							uc002tbx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(982-984)CAG>CAC		interleukin 18 receptor accessory protein							114.0	105.0	108.0					2																	103061712		2203	4300	6503	SO:0001583	missense	8807				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity	g.chr2:103061712G>C	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.984G>C	2.37:g.103061712G>C	ENSP00000264260:p.Gln328His		Somatic				IL18RAP_uc010fiz.2_Missense_Mutation_p.Q186H	p.Q328H	NM_003853	NP_003844	WXS	Illumina HiSeq	Unspecified	O95256	I18RA_HUMAN			9	1468	+			328			Ig-like C2-type 2.|Extracellular (Potential).		B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	c.984G>C	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.724145	0.30593	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.22539	1.95;1.95	5.63	-0.0138	0.13982	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.313534	0.27871	N	0.017519	T	0.24661	0.0598	L	0.45137	1.4	0.09310	N	1	D	0.63880	0.993	P	0.55260	0.772	T	0.08006	-1.0743	10	0.49607	T	0.09	.	7.786	0.29093	0.6432:0.0:0.3568:0.0	.	328	O95256	I18RA_HUMAN	H	328;186	ENSP00000264260:Q328H;ENSP00000387201:Q186H	ENSP00000264260:Q328H	Q	+	3	2	IL18RAP	102428144	0.002000	0.14202	0.001000	0.08648	0.251000	0.25915	0.281000	0.18810	0.054000	0.16065	-0.140000	0.14226	CAG		0.403	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853		14	22	0	0	0	0.003163	0	14	22				
TFCP2L1	29842	broad.mit.edu	37	2	121999986	121999986	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:121999986G>T	ENST00000263707.5	-	7	814	c.717C>A	c.(715-717)gcC>gcA	p.A239A		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	239					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.A239A(1)		cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					CCTTCTCTTGGGCAGTTCTTT	0.562																																							uc002tmx.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(715-717)GCC>GCA		LBP-9							370.0	350.0	357.0					2																	121999986		2203	4300	6503	SO:0001819	synonymous_variant	29842				female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr2:121999986G>T	AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.717C>A	2.37:g.121999986G>T			Somatic				TFCP2L1_uc010flr.2_Silent_p.A239A	p.A239A	NM_014553	NP_055368	WXS	Illumina HiSeq	Unspecified	Q9NZI6	TF2L1_HUMAN			7	810	-	Renal(3;0.01)		239					Q4ZG43	Silent	SNP	ENST00000263707.5	37	c.717C>A	CCDS2134.1																																																																																				0.562	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338539.1	NM_014553		51	110	1	0	1.83081e-24	0.01441	2.76935e-24	51	110				
TTN	7273	broad.mit.edu	37	2	179403333	179403333	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:179403333C>T	ENST00000591111.1	-	304	94524	c.94300G>A	c.(94300-94302)Gct>Act	p.A31434T	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A24135T|TTN_ENST00000460472.2_Missense_Mutation_p.A24010T|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000456053.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A30507T|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A24202T|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A33075T|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	31434	Fibronectin type-III 129. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A24202T(1)|p.A24010T(1)|p.A30505T(1)|p.A30507T(1)|p.A24135T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATTCTCAGCAAAAACCCTG	0.418																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(91519-91521)GCT>ACT		titin isoform N2-A							143.0	139.0	140.0					2																	179403333		1918	4148	6066	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179403333C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.94300G>A	2.37:g.179403333C>T	ENSP00000465570:p.Ala31434Thr		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.A24202T|TTN_uc010zfi.1_Missense_Mutation_p.A24135T|TTN_uc010zfj.1_Missense_Mutation_p.A24010T	p.A30507T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		303	91743	-			31434					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.91519G>A		.	.	.	.	.	.	.	.	.	.	C	25.5	4.640493	0.87859	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	5.87	5.87	0.94306	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.93556	0.7943	H	0.98276	4.19	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.95119	0.8245	9	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	24010;24135;24202;31434	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	30507;24010;24202;24135;24007	ENSP00000343764:A30507T;ENSP00000434586:A24010T;ENSP00000340554:A24202T;ENSP00000352154:A24135T	ENSP00000340554:A24202T	A	-	1	0	TTN	179111579	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	GCT		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		61	50	0	0	0	0.01441	0	61	50				
TTN	7273	broad.mit.edu	37	2	179437609	179437610	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:179437609_179437610GG>TT	ENST00000591111.1	-	276	68550_68551	c.68326_68327CC>AA	c.(68326-68328)CCa>AAa	p.P22776K	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P15477K|TTN_ENST00000460472.2_Missense_Mutation_p.P15352K|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P21849K|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P15544K|TTN_ENST00000589042.1_Missense_Mutation_p.P24417K|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22776	Fibronectin type-III 65. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P15352K(1)|p.P15477K(1)|p.P21849K(1)|p.P15544K(1)|p.P21847K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAGCCTTTGGAGTTCCAGGA	0.475																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(65545-65547)CCA>AAA		titin isoform N2-A																																				SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179437609_179437610GG>TT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.68326_68327delinsTT	2.37:g.179437609_179437610delinsTT	ENSP00000465570:p.Pro22776Lys		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P15544K|TTN_uc010zfi.1_Missense_Mutation_p.P15477K|TTN_uc010zfj.1_Missense_Mutation_p.P15352K	p.P21849K	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	65769_65770	-			22776					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	DNP	ENST00000591111.1	37	c.65545_65546CC>AA																																																																																					0.475	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		15	18	0	0	0	0.004672	0	15	18				
TTN	7273	broad.mit.edu	37	2	179553413	179553413	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:179553413G>T	ENST00000591111.1	-	124	31461	c.31237C>A	c.(31237-31239)Cgg>Agg	p.R10413R	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Silent_p.R9486R|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.R10730R|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R9486R(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTCGTGCCGCGTGACTTCC	0.388																																							uc010zfg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(28456-28458)CGG>AGG		titin isoform N2-A							100.0	101.0	101.0					2																	179553413		1883	4126	6009	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179553413G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.31237C>A	2.37:g.179553413G>T			Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.R6147R|TTN_uc010fre.1_Intron	p.R9486R	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		123	28680	-			10413					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.28456C>A																																																																																					0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		16	60	1	0	1.02788e-11	0.00499	1.30116e-11	16	60				
TTN	7273	broad.mit.edu	37	2	179593427	179593427	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:179593427G>T	ENST00000591111.1	-	64	18499	c.18275C>A	c.(18274-18276)gCt>gAt	p.A6092D	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A5165D|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.A6409D			Q8WZ42	TITIN_HUMAN	titin	12879	Ig-like 42.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A5165D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTGTTCCAGCCACAACACA	0.383																																							uc010zfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(15493-15495)GCT>GAT		titin isoform N2-A							89.0	83.0	85.0					2																	179593427		1875	4104	5979	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179593427G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18275C>A	2.37:g.179593427G>T	ENSP00000465570:p.Ala6092Asp		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A1826D	p.A5165D	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		63	15718	-			6092					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.15494C>A		.	.	.	.	.	.	.	.	.	.	G	11.14	1.550907	0.27739	.	.	ENSG00000155657	ENST00000342992	T	0.67345	-0.26	5.63	5.63	0.86233	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.58163	0.2103	L	0.28776	0.89	0.80722	D	1	P	0.39352	0.669	B	0.38106	0.265	T	0.63857	-0.6542	9	0.87932	D	0	.	16.3551	0.83233	0.0:0.0:0.8677:0.1323	.	6092	Q8WZ42	TITIN_HUMAN	D	5165	ENSP00000343764:A5165D	ENSP00000343764:A5165D	A	-	2	0	TTN	179301672	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.876000	0.56115	2.826000	0.97356	0.655000	0.94253	GCT		0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		17	20	1	0	1.99824e-07	0.00499	2.2876e-07	17	20				
MSTN	2660	broad.mit.edu	37	2	190926980	190926980	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:190926980T>A	ENST00000260950.4	-	1	475	c.343A>T	c.(343-345)Acg>Tcg	p.T115S	C2orf88_ENST00000478197.1_Intron	NM_005259.2	NP_005250.1	O14793	GDF8_HUMAN	myostatin	115					cellular response to dexamethasone stimulus (GO:0071549)|muscle organ development (GO:0007517)|negative regulation of muscle hypertrophy (GO:0014741)|negative regulation of skeletal muscle tissue growth (GO:0048632)|ovulation cycle process (GO:0022602)|positive regulation of transcription, DNA-templated (GO:0045893)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gravity (GO:0009629)|response to heat (GO:0009408)|response to muscle activity (GO:0014850)|response to testosterone (GO:0033574)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue regeneration (GO:0043403)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)	p.T115S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			ATTGTTTCCGTTGTAGCGTGA	0.438																																							uc002urp.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(343-345)ACG>TCG		myostatin precursor							140.0	127.0	131.0					2																	190926980		2203	4299	6502	SO:0001583	missense	2660				muscle organ development|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity	g.chr2:190926980T>A	AF019627	CCDS2303.1	2q32.1	2014-09-17	2007-06-21	2007-06-21	ENSG00000138379	ENSG00000138379			4223	protein-coding gene	gene with protein product		601788	"""growth differentiation factor 8"""	GDF8		9288100, 10610713, 17003236	Standard	NM_005259		Approved		uc002urp.3	O14793	OTTHUMG00000132663	ENST00000260950.4:c.343A>T	2.37:g.190926980T>A	ENSP00000260950:p.Thr115Ser		Somatic					p.T115S	NM_005259	NP_005250	WXS	Illumina HiSeq	Unspecified	O14793	GDF8_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)		1	476	-			115					A1C2J7|A1C2K0|Q6B0H2	Missense_Mutation	SNP	ENST00000260950.4	37	c.343A>T	CCDS2303.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.518153	0.85495	.	.	ENSG00000138379	ENST00000260950	T	0.63096	-0.02	5.35	5.35	0.76521	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.69214	0.3086	L	0.60904	1.88	0.58432	D	0.999998	P	0.45986	0.87	P	0.55508	0.777	T	0.70865	-0.4756	10	0.54805	T	0.06	-8.1334	9.9131	0.41417	0.0:0.0754:0.0:0.9246	.	115	O14793	GDF8_HUMAN	S	115	ENSP00000260950:T115S	ENSP00000260950:T115S	T	-	1	0	MSTN	190635225	1.000000	0.71417	0.826000	0.32828	0.898000	0.52572	7.868000	0.87116	2.250000	0.74265	0.533000	0.62120	ACG		0.438	MSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255917.2	NM_005259		21	78	0	0	0	0.012319	0	21	78				
ADAM23	8745	broad.mit.edu	37	2	207482345	207482345	+	Silent	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:207482345C>A	ENST00000264377.3	+	26	2821	c.2493C>A	c.(2491-2493)ccC>ccA	p.P831P	ADAM23_ENST00000374415.3_Silent_p.P831P|ADAM23_ENST00000374416.1_Missense_Mutation_p.P801Q	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	831					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P831P(1)|p.P801Q(1)		NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		AGCAAGGCCCCATCTGAATCA	0.453																																					Melanoma(194;1127 2130 19620 24042 27855)	Melanoma(194;1127 2130 19620 24042 27855)	uc002vbq.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	skin(2)|ovary(1)	3						c.(2491-2493)CCC>CCA		ADAM metallopeptidase domain 23 preproprotein							86.0	73.0	77.0					2																	207482345		2203	4300	6503	SO:0001819	synonymous_variant	8745				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr2:207482345C>A	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.2493C>A	2.37:g.207482345C>A			Somatic				ADAM23_uc010ziv.1_RNA	p.P831P	NM_003812	NP_003803	WXS	Illumina HiSeq	Unspecified	O75077	ADA23_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)	26	2716	+			831			Cytoplasmic (Potential).		A2RU59	Silent	SNP	ENST00000264377.3	37	c.2493C>A	CCDS2369.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.92|13.92	2.379902|2.379902	0.42207|0.42207	.|.	.|.	ENSG00000114948|ENSG00000114948	ENST00000431817;ENST00000444281|ENST00000374416	.|T	.|0.01838	.|4.61	5.69|5.69	3.84|3.84	0.44239|0.44239	.|.	.|0.462211	.|0.19877	.|N	.|0.104071	T|T	0.01156|0.01156	0.0038|0.0038	.|.	.|.	.|.	0.27966|0.27966	N|N	0.936588|0.936588	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.42799|0.42799	-0.9430|-0.9430	5|7	0.39692|0.12430	T|T	0.17|0.62	.|.	1.749|1.749	0.02968|0.02968	0.1633:0.4801:0.1586:0.1981|0.1633:0.4801:0.1586:0.1981	.|.	.|.	.|.	.|.	N|Q	671;76|801	.|ENSP00000363537:P801Q	ENSP00000415098:H671N|ENSP00000363537:P801Q	H|P	+|+	1|2	0|0	ADAM23|ADAM23	207190590|207190590	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.642000|0.642000	0.38348|0.38348	0.781000|0.781000	0.26774|0.26774	0.707000|0.707000	0.31934|0.31934	0.655000|0.655000	0.94253|0.94253	CAT|CCA		0.453	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812		9	16	1	0	3.86212e-05	0.008291	4.1923e-05	9	16				
PIKFYVE	200576	broad.mit.edu	37	2	209182591	209182591	+	Splice_Site	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:209182591A>T	ENST00000264380.4	+	16	2166	c.2008A>T	c.(2008-2010)Atc>Ttc	p.I670F		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	670					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.I670F(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GTTCCATTAGATCCCAGGTGG	0.308																																							uc002vcz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						c.(2008-2010)ATC>TTC		phosphatidylinositol-3-phosphate 5-kinase type							177.0	171.0	173.0					2																	209182591		2203	4300	6503	SO:0001630	splice_region_variant	200576				cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding	g.chr2:209182591A>T	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2008-1A>T	2.37:g.209182591A>T			Somatic				PIKFYVE_uc010fun.1_Missense_Mutation_p.I351F|PIKFYVE_uc002vcy.1_Missense_Mutation_p.I614F	p.I670F	NM_015040	NP_055855	WXS	Illumina HiSeq	Unspecified	Q9Y2I7	FYV1_HUMAN			16	2166	+			670					Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	c.2008A>T	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.793303	0.90453	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.80653	-1.4;-1.4	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.90300	0.6966	M	0.84326	2.69	0.80722	D	1	D;D	0.76494	0.999;0.987	D;D	0.83275	0.996;0.979	D	0.90896	0.4765	9	.	.	.	-15.7312	16.3158	0.82923	1.0:0.0:0.0:0.0	.	670;614	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	F	670;246;614	ENSP00000264380:I670F;ENSP00000405736:I614F	.	I	+	1	0	PIKFYVE	208890836	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.779000	0.91792	2.254000	0.74563	0.533000	0.62120	ATC		0.308	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	Missense_Mutation	25	95	0	0	0	0.01892	0	25	95				
TRIP12	9320	broad.mit.edu	37	2	230678748	230678748	+	Splice_Site	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:230678748C>A	ENST00000283943.5	-	12	1859		c.e12-1		TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Splice_Site|TRIP12_ENST00000389045.3_Splice_Site	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.?(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CCAAACCACCCTAAAATATAG	0.348																																							uc002vpw.1		NA																	1	Unknown(1)		lung(1)	ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9						c.e12-1		thyroid hormone receptor interactor 12							41.0	41.0	41.0					2																	230678748		2202	4300	6502	SO:0001630	splice_region_variant	9320				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity	g.chr2:230678748C>A	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1681-1G>T	2.37:g.230678748C>A			Somatic				TRIP12_uc002vpx.1_Splice_Site_p.G609_splice|TRIP12_uc002vpy.1_Splice_Site_p.G264_splice|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Splice_Site_p.G567_splice	p.G561_splice	NM_004238	NP_004229	WXS	Illumina HiSeq	Unspecified	Q14669	TRIPC_HUMAN		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)	12	1790	-		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)						D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Splice_Site	SNP	ENST00000283943.5	37	c.1681_splice	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367659	0.82463	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3201	0.98661	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRIP12	230386992	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.525000	0.81892	2.807000	0.96579	0.551000	0.68910	.		0.348	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	Intron	18	19	1	0	3.51602e-12	0.008871	4.54695e-12	18	19				
NMUR1	10316	broad.mit.edu	37	2	232392962	232392962	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr2:232392962C>A	ENST00000305141.4	-	2	903	c.770G>T	c.(769-771)cGa>cTa	p.R257L		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	257					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)	p.R257L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CCGCCGCAGTCGCAGCCCAAT	0.642																																							uc002vry.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|central_nervous_system(1)|pancreas(1)	5						c.(769-771)CGA>CTA		neuromedin U receptor 1							37.0	38.0	38.0					2																	232392962		2203	4300	6503	SO:0001583	missense	10316				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|calcium ion transport|calcium-mediated signaling|chloride transport|smooth muscle contraction	integral to plasma membrane|membrane fraction	neuromedin U receptor activity	g.chr2:232392962C>A	AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.770G>T	2.37:g.232392962C>A	ENSP00000305877:p.Arg257Leu		Somatic					p.R257L	NM_006056	NP_006047	WXS	Illumina HiSeq	Unspecified	Q9HB89	NMUR1_HUMAN		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)	2	880	-		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)	257			Cytoplasmic (Potential).		O43664|Q7LDP6|Q8NE20	Missense_Mutation	SNP	ENST00000305141.4	37	c.770G>T	CCDS2486.1	.	.	.	.	.	.	.	.	.	.	.	11.67	1.708986	0.30322	.	.	ENSG00000171596	ENST00000305141	T	0.36878	1.23	4.94	-0.348	0.12613	GPCR, rhodopsin-like superfamily (1);	0.539191	0.20131	N	0.098593	T	0.42585	0.1209	L	0.55017	1.72	0.35806	D	0.823526	D	0.61697	0.99	D	0.64321	0.924	T	0.49331	-0.8951	10	0.54805	T	0.06	-12.3885	2.9205	0.05767	0.3303:0.255:0.0:0.4147	.	257	Q9HB89	NMUR1_HUMAN	L	257	ENSP00000305877:R257L	ENSP00000305877:R257L	R	-	2	0	NMUR1	232101206	0.981000	0.34729	0.414000	0.26521	0.086000	0.17979	0.157000	0.16402	-0.134000	0.11516	0.456000	0.33151	CGA		0.642	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056		4	14	1	0	0.00116845	0.001168	0.00121786	4	14				
CRNKL1	51340	broad.mit.edu	37	20	20018200	20018200	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr20:20018200C>A	ENST00000377340.2	-	14	2177	c.2146G>T	c.(2146-2148)Gct>Tct	p.A716S	CRNKL1_ENST00000377327.4_Missense_Mutation_p.A704S|CRNKL1_ENST00000536226.1_Missense_Mutation_p.A555S|CRNKL1_ENST00000521379.1_Intron	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	716					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A716S(1)		breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						TCAAACTGAGCAAAGCTGATC	0.318																																							uc002wrs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(2146-2148)GCT>TCT		crooked neck-like 1 protein							79.0	77.0	78.0					20																	20018200		2203	4300	6503	SO:0001583	missense	51340				spliceosome assembly	catalytic step 2 spliceosome|cytoplasm|nuclear speck	RNA binding	g.chr20:20018200C>A	AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.2146G>T	20.37:g.20018200C>A	ENSP00000366557:p.Ala716Ser		Somatic					p.A716S	NM_016652	NP_057736	WXS	Illumina HiSeq	Unspecified	Q9BZJ0	CRNL1_HUMAN			14	2178	-			716			HAT 14.		A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	ENST00000377340.2	37	c.2146G>T	CCDS33446.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728223	0.89390	.	.	ENSG00000101343	ENST00000377327;ENST00000377340;ENST00000536226	T;T;T	0.58652	1.21;1.21;0.32	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.78515	0.4295	M	0.92970	3.365	0.80722	D	1	P	0.51147	0.942	P	0.54924	0.764	D	0.84388	0.0553	10	0.72032	D	0.01	-14.9221	18.5163	0.90936	0.0:1.0:0.0:0.0	.	716	Q9BZJ0	CRNL1_HUMAN	S	704;716;555	ENSP00000366544:A704S;ENSP00000366557:A716S;ENSP00000440733:A555S	ENSP00000366544:A704S	A	-	1	0	CRNKL1	19966200	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.412000	0.80091	2.596000	0.87737	0.484000	0.47621	GCT		0.318	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000127787.1			34	59	1	0	2.46105e-21	0.010818	3.5681e-21	34	59				
PREX1	57580	broad.mit.edu	37	20	47256395	47256395	+	Silent	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr20:47256395C>A	ENST00000371941.3	-	30	3835	c.3813G>T	c.(3811-3813)cgG>cgT	p.R1271R	PREX1_ENST00000396220.1_Silent_p.R1271R|PREX1_ENST00000496915.1_5'Flank	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1271					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1271R(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGATCAGGCTCCGGCCACGGA	0.557																																							uc002xtw.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(3)|ovary(2)|pancreas(1)	6						c.(3811-3813)CGG>CGT		phosphatidylinositol-3,4,							152.0	147.0	149.0					20																	47256395		2203	4300	6503	SO:0001819	synonymous_variant	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47256395C>A	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3813G>T	20.37:g.47256395C>A			Somatic				PREX1_uc002xtv.1_Silent_p.R568R	p.R1271R	NM_020820	NP_065871	WXS	Illumina HiSeq	Unspecified	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		30	3836	-			1271					E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	37	c.3813G>T	CCDS13410.1																																																																																				0.557	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		72	65	1	0	3.41413e-29	0.01441	5.33777e-29	72	65				
KCNB1	3745	broad.mit.edu	37	20	47989929	47989929	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr20:47989929G>T	ENST00000371741.4	-	2	2334	c.2168C>A	c.(2167-2169)tCc>tAc	p.S723Y		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	723					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)	p.S723Y(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	GTAGATGGAGGACTCTGGGCT	0.572																																							uc002xur.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(2167-2169)TCC>TAC		potassium voltage-gated channel, Shab-related							51.0	53.0	53.0					20																	47989929		2203	4300	6503	SO:0001583	missense	3745				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	g.chr20:47989929G>T	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.2168C>A	20.37:g.47989929G>T	ENSP00000360806:p.Ser723Tyr		Somatic				KCNB1_uc002xus.1_Missense_Mutation_p.S723Y	p.S723Y	NM_004975	NP_004966	WXS	Illumina HiSeq	Unspecified	Q14721	KCNB1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		2	2332	-			723			Cytoplasmic (Potential).		Q14193	Missense_Mutation	SNP	ENST00000371741.4	37	c.2168C>A	CCDS13418.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.588947	0.46110	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	D	0.96104	-3.91	4.97	4.97	0.65823	.	0.900916	0.09782	N	0.756599	D	0.94434	0.8209	L	0.44542	1.39	0.32511	N	0.537494	P	0.47409	0.895	B	0.44278	0.445	D	0.93441	0.6794	10	0.44086	T	0.13	.	18.0323	0.89289	0.0:0.0:1.0:0.0	.	723	Q14721	KCNB1_HUMAN	Y	723;678	ENSP00000360806:S723Y	ENSP00000360806:S723Y	S	-	2	0	KCNB1	47423336	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.767000	0.55288	2.578000	0.87016	0.655000	0.94253	TCC		0.572	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975		28	30	1	0	1.75199e-13	0.007291	2.30843e-13	28	30				
TSHZ2	128553	broad.mit.edu	37	20	51871355	51871355	+	Missense_Mutation	SNP	G	G	T	rs200023336	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr20:51871355G>T	ENST00000371497.5	+	2	2245	c.1358G>T	c.(1357-1359)tGt>tTt	p.C453F	TSHZ2_ENST00000329613.6_Missense_Mutation_p.C450F|TSHZ2_ENST00000603338.2_Missense_Mutation_p.C450F|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	453					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C453F(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GCATCAGATTGTACAGCCTCT	0.453																																							uc002xwo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6						c.(1357-1359)TGT>TTT		teashirt zinc finger homeobox 2							94.0	101.0	99.0					20																	51871355		2203	4300	6503	SO:0001583	missense	128553				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:51871355G>T	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1358G>T	20.37:g.51871355G>T	ENSP00000360552:p.Cys453Phe		Somatic					p.C453F	NM_173485	NP_775756	WXS	Illumina HiSeq	Unspecified	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)		2	2314	+			453					B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	c.1358G>T	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	G	0.650	-0.809801	0.02798	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.29142	1.58;1.58	5.95	4.99	0.66335	.	0.533827	0.23375	N	0.048867	T	0.28499	0.0705	L	0.44542	1.39	0.09310	N	1	B	0.33448	0.412	B	0.28232	0.087	T	0.22068	-1.0227	10	0.87932	D	0	-11.652	16.2145	0.82195	0.0:0.251:0.749:0.0	.	453	Q9NRE2	TSH2_HUMAN	F	453;450	ENSP00000360552:C453F;ENSP00000333114:C450F	ENSP00000333114:C450F	C	+	2	0	TSHZ2	51304762	0.002000	0.14202	0.006000	0.13384	0.004000	0.04260	1.201000	0.32259	1.509000	0.48786	0.643000	0.83706	TGT		0.453	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		50	88	1	0	2.9001e-28	0.01441	4.50053e-28	50	88				
COL9A3	1299	broad.mit.edu	37	20	61467557	61467557	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr20:61467557C>A	ENST00000343916.3	+	28	1423	c.1420C>A	c.(1420-1422)Ctg>Atg	p.L474M	COL9A3_ENST00000462700.1_3'UTR	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	474	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.L474M(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					TCGAGGGGAGCTGGGCCCCAA	0.711																																							uc002ydm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1420-1422)CTG>ATG		alpha 3 type IX collagen precursor							19.0	26.0	24.0					20																	61467557		2201	4295	6496	SO:0001583	missense	1299				axon guidance	collagen type IX		g.chr20:61467557C>A	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1420C>A	20.37:g.61467557C>A	ENSP00000341640:p.Leu474Met		Somatic				COL9A3_uc002ydn.2_5'Flank	p.L474M	NM_001853	NP_001844	WXS	Illumina HiSeq	Unspecified	Q14050	CO9A3_HUMAN			28	1423	+	Breast(26;5.68e-08)		474			Triple-helical region 3 (COL3).		Q13681|Q9H4G9|Q9UPE2	Missense_Mutation	SNP	ENST00000343916.3	37	c.1420C>A	CCDS13505.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933161	0.73442	.	.	ENSG00000092758	ENST00000343916	D	0.93426	-3.22	4.63	4.63	0.57726	.	0.227906	0.37715	N	0.001971	D	0.93739	0.7999	L	0.33293	1	0.47245	D	0.99936	D	0.69078	0.997	D	0.67548	0.952	D	0.93665	0.6985	10	0.46703	T	0.11	.	14.0367	0.64649	0.0:0.848:0.152:0.0	.	474	Q14050	CO9A3_HUMAN	M	474	ENSP00000341640:L474M	ENSP00000341640:L474M	L	+	1	2	COL9A3	60938002	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.325000	0.52030	2.117000	0.64856	0.561000	0.74099	CTG		0.711	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853		16	19	1	0	2.35188e-11	0.006122	2.95041e-11	16	19				
BAGE2	85319	broad.mit.edu	37	21	11049614	11049614	+	RNA	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr21:11049614T>A	ENST00000470054.1	-	0	494							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGTTTGCATCTTCCTTCGCTA	0.373																																							uc002yit.1		NA																	0					0						c.(286-288)AAG>ATG		B melanoma antigen family, member 2 precursor							133.0	94.0	106.0					21																	11049614		692	1591	2283			85319							g.chr21:11049614T>A	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11049614T>A			Somatic					p.K96M	NM_182482	NP_872288	WXS	Illumina HiSeq	Unspecified			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	4	495	-								A8K925|Q08ER0	Missense_Mutation	SNP	ENST00000470054.1	37	c.287A>T																																																																																					0.373	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482		8	126	0	0	0	0.008291	0	8	126				
GRIK1	2897	broad.mit.edu	37	21	31066378	31066378	+	Silent	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr21:31066378C>A	ENST00000399907.1	-	2	534	c.123G>T	c.(121-123)ggG>ggT	p.G41G	GRIK1_ENST00000535441.1_Silent_p.G41G|GRIK1_ENST00000399913.1_Silent_p.G41G|GRIK1_ENST00000472429.1_5'UTR|GRIK1_ENST00000399909.1_Silent_p.G41G|GRIK1_ENST00000327783.4_Silent_p.G41G|GRIK1_ENST00000389125.3_Silent_p.G41G|GRIK1_ENST00000309434.7_Silent_p.G41G|GRIK1_ENST00000389124.2_Silent_p.G41G|GRIK1_ENST00000399914.1_Silent_p.G41G	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	41					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.G41G(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	TTTCAAAAATCCCTCCTGCAG	0.378																																							uc002yno.1		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(1)|ovary(1)|skin(1)	3						c.(121-123)GGG>GGT		glutamate receptor, ionotropic, kainate 1	L-Glutamic Acid(DB00142)|Topiramate(DB00273)						91.0	85.0	87.0					21																	31066378		2203	4300	6503	SO:0001819	synonymous_variant	2897				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity	g.chr21:31066378C>A		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.123G>T	21.37:g.31066378C>A			Somatic				GRIK1_uc002ynn.2_Silent_p.G41G|GRIK1_uc011acs.1_Silent_p.G41G|GRIK1_uc011act.1_Intron|GRIK1_uc010glq.1_Intron|GRIK1_uc002ynr.2_Silent_p.G41G	p.G41G	NM_000830	NP_000821	WXS	Illumina HiSeq	Unspecified	P39086	GRIK1_HUMAN			2	587	-			41			Extracellular (Potential).		Q13001|Q86SU9	Silent	SNP	ENST00000399907.1	37	c.123G>T	CCDS42913.1																																																																																				0.378	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1			25	31	1	0	9.57634e-11	0.01892	1.18713e-10	25	31				
IFNGR2	3460	broad.mit.edu	37	21	34793969	34793969	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr21:34793969C>T	ENST00000290219.6	+	3	1037	c.389C>T	c.(388-390)cCt>cTt	p.P130L	IFNGR2_ENST00000405436.1_Missense_Mutation_p.P51L|IFNGR2_ENST00000381995.1_Missense_Mutation_p.P149L	NM_005534.3	NP_005525.2	P38484	INGR2_HUMAN	interferon gamma receptor 2 (interferon gamma transducer 1)	130					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	interferon-gamma receptor activity (GO:0004906)	p.P130L(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(1)	13					Interferon gamma-1b(DB00033)	GTGACAATGCCTTGGTTTCAA	0.493																																							uc002yrp.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(388-390)CCT>CTT		interferon gamma receptor 2 precursor	Interferon gamma-1b(DB00033)						154.0	131.0	139.0					21																	34793969		2203	4300	6503	SO:0001583	missense	3460				regulation of interferon-gamma-mediated signaling pathway|response to virus	endoplasmic reticulum|integral to plasma membrane	interferon-gamma receptor activity	g.chr21:34793969C>T		CCDS33544.1	21q22.1	2014-09-17			ENSG00000159128	ENSG00000159128		"""Interferons"", ""Fibronectin type III domain containing"""	5440	protein-coding gene	gene with protein product		147569		IFNGT1		3136170	Standard	NM_005534		Approved	AF-1	uc002yrp.4	P38484	OTTHUMG00000065188	ENST00000290219.6:c.389C>T	21.37:g.34793969C>T	ENSP00000290219:p.Pro130Leu		Somatic				IFNGR2_uc002yrq.3_Missense_Mutation_p.P149L|IFNGR2_uc010gma.2_Missense_Mutation_p.P51L|IFNGR2_uc002yrr.3_Missense_Mutation_p.P51L	p.P130L	NM_005534	NP_005525	WXS	Illumina HiSeq	Unspecified	P38484	INGR2_HUMAN			3	1037	+			130			Extracellular (Potential).		Q9BTL5	Missense_Mutation	SNP	ENST00000290219.6	37	c.389C>T	CCDS33544.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.156439	0.78114	.	.	ENSG00000159128	ENST00000290219;ENST00000381995;ENST00000405436	D;D;T	0.87179	-2.22;-2.22;0.89	4.49	3.57	0.40892	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.272250	0.05266	N	0.516522	D	0.85383	0.5684	M	0.64997	1.995	0.22342	N	0.999186	P;P	0.46706	0.883;0.883	B;B	0.39419	0.299;0.299	T	0.72253	-0.4347	10	0.36615	T	0.2	-2.9402	9.5791	0.39477	0.2185:0.7815:0.0:0.0	.	149;130	E7EUY1;P38484	.;INGR2_HUMAN	L	130;149;51	ENSP00000290219:P130L;ENSP00000371425:P149L;ENSP00000385044:P51L	ENSP00000290219:P130L	P	+	2	0	IFNGR2	33715839	0.057000	0.20700	0.059000	0.19551	0.968000	0.65278	1.810000	0.38932	1.189000	0.43028	0.650000	0.86243	CCT		0.493	IFNGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139916.1			38	73	0	0	0	0.00874	0	38	73				
PCBP3	54039	broad.mit.edu	37	21	47333886	47333886	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr21:47333886A>G	ENST00000400314.1	+	10	960	c.622A>G	c.(622-624)Att>Gtt	p.I208V	PCBP3_ENST00000400304.1_Missense_Mutation_p.I176V|PCBP3_ENST00000400310.1_Missense_Mutation_p.I208V|PCBP3_ENST00000400308.1_Intron|PCBP3_ENST00000449640.1_Missense_Mutation_p.I208V|PCBP3_ENST00000400309.1_Missense_Mutation_p.I208V			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	208					mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.I176V(1)|p.I208V(1)		biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		AGGTGCCACCATTCCCTACCG	0.627																																							uc002zhq.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(622-624)ATT>GTT		poly(rC) binding protein 3 isoform 1							71.0	83.0	79.0					21																	47333886		2024	4172	6196	SO:0001583	missense	54039				mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding	g.chr21:47333886A>G	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.622A>G	21.37:g.47333886A>G	ENSP00000383168:p.Ile208Val		Somatic				PCBP3_uc010gqb.2_Missense_Mutation_p.I208V|PCBP3_uc002zhp.1_Missense_Mutation_p.I208V|PCBP3_uc010gqc.1_Intron|PCBP3_uc002zhs.1_Intron|PCBP3_uc002zhr.1_Missense_Mutation_p.I208V|PCBP3_uc002zht.1_Missense_Mutation_p.I176V	p.I208V	NM_020528	NP_065389	WXS	Illumina HiSeq	Unspecified	P57721	PCBP3_HUMAN		Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)	8	747	+	all_hematologic(128;0.24)		208					A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Missense_Mutation	SNP	ENST00000400314.1	37	c.622A>G	CCDS42974.2	.	.	.	.	.	.	.	.	.	.	A	17.78	3.474045	0.63737	.	.	ENSG00000183570	ENST00000400314;ENST00000400310;ENST00000400309;ENST00000449640;ENST00000346743;ENST00000400304	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.50463	0.1617	M	0.83223	2.63	0.80722	D	1	B;B;P;B	0.40534	0.43;0.039;0.72;0.184	B;B;B;B	0.40982	0.207;0.079;0.345;0.074	T	0.56625	-0.7948	10	0.41790	T	0.15	-7.1698	14.9659	0.71193	1.0:0.0:0.0:0.0	.	176;208;208;208	E9PFP8;P57721-4;P57721;P57721-5	.;.;PCBP3_HUMAN;.	V	208;208;208;208;208;176	ENSP00000383168:I208V;ENSP00000383165:I208V;ENSP00000383164:I208V;ENSP00000401198:I208V;ENSP00000383159:I176V	ENSP00000330225:I208V	I	+	1	0	PCBP3	46158314	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.781000	0.91805	1.933000	0.56026	0.460000	0.39030	ATT		0.627	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2			22	36	0	0	0	0.021523	0	22	36				
DIP2A	23181	broad.mit.edu	37	21	47970495	47970495	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr21:47970495G>T	ENST00000417564.2	+	23	2698	c.2677G>T	c.(2677-2679)Gcc>Tcc	p.A893S	DIP2A_ENST00000400274.1_Missense_Mutation_p.A889S|DIP2A_ENST00000427143.2_Missense_Mutation_p.A829S|DIP2A_ENST00000318711.7_Missense_Mutation_p.A894S			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	893					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.A894S(1)|p.A893S(1)|p.A829S(1)		cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GTACTGTCTGGCCCTGGTTCC	0.577																																							uc002zjo.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(2677-2679)GCC>TCC		disco-interacting protein 2A isoform a							67.0	69.0	68.0					21																	47970495		2023	4171	6194	SO:0001583	missense	23181				multicellular organismal development	nucleus	catalytic activity|transcription factor binding	g.chr21:47970495G>T	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2677G>T	21.37:g.47970495G>T	ENSP00000392066:p.Ala893Ser		Somatic				DIP2A_uc011afy.1_Missense_Mutation_p.A829S|DIP2A_uc011afz.1_Missense_Mutation_p.A889S	p.A893S	NM_015151	NP_055966	WXS	Illumina HiSeq	Unspecified	Q14689	DIP2A_HUMAN		Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)	23	2860	+	Breast(49;0.0933)		893					A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	c.2677G>T	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	33	5.232522	0.95207	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000417564	T;T;T;T	0.10763	2.84;2.84;2.84;2.84	5.26	5.26	0.73747	.	0.125422	0.53938	D	0.000060	T	0.35248	0.0925	M	0.73962	2.25	0.80722	D	1	D;P;D	0.89917	0.999;0.947;1.0	D;P;D	0.85130	0.97;0.677;0.997	T	0.02909	-1.1095	10	0.52906	T	0.07	-30.4513	18.2448	0.89981	0.0:0.0:1.0:0.0	.	894;829;893	E9PER1;E7EMA5;Q14689	.;.;DIP2A_HUMAN	S	889;829;894;893	ENSP00000383133:A889S;ENSP00000400528:A829S;ENSP00000323633:A894S;ENSP00000392066:A893S	ENSP00000323633:A894S	A	+	1	0	DIP2A	46794923	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.689000	0.98673	2.639000	0.89480	0.655000	0.94253	GCC		0.577	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151		13	22	1	0	1.5842e-08	0.016723	1.8804e-08	13	22				
GAB4	128954	broad.mit.edu	37	22	17488963	17488963	+	Silent	SNP	T	T	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr22:17488963T>G	ENST00000400588.1	-	1	149	c.42A>C	c.(40-42)ccA>ccC	p.P14P	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	14								p.P14P(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				CCGGGTCAGGTGGGCACAGCT	0.682																																							uc002zlw.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(40-42)CCA>CCC		GRB2-associated binding protein family, member							16.0	20.0	18.0					22																	17488963		2135	4241	6376	SO:0001819	synonymous_variant	128954							g.chr22:17488963T>G	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.42A>C	22.37:g.17488963T>G			Somatic				GAB4_uc010gqs.1_Silent_p.P14P	p.P14P	NM_001037814	NP_001032903	WXS	Illumina HiSeq	Unspecified	Q2WGN9	GAB4_HUMAN			1	150	-		all_epithelial(15;0.112)|Lung NSC(13;0.248)	14						Silent	SNP	ENST00000400588.1	37	c.42A>C	CCDS42976.1																																																																																				0.682	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882		8	4	0	0	0	0.006214	0	8	4				
NAGA	4668	broad.mit.edu	37	22	42456311	42456311	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr22:42456311A>G	ENST00000396398.3	-	9	1740	c.1208T>C	c.(1207-1209)aTc>aCc	p.I403T	NAGA_ENST00000402937.1_Missense_Mutation_p.I403T|NAGA_ENST00000403363.1_Missense_Mutation_p.I403T	NM_000262.2	NP_000253.1	P17050	NAGAB_HUMAN	N-acetylgalactosaminidase, alpha-	403					carbohydrate catabolic process (GO:0016052)|glycolipid catabolic process (GO:0019377)|glycoside catabolic process (GO:0016139)|glycosylceramide catabolic process (GO:0046477)|oligosaccharide metabolic process (GO:0009311)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|alpha-N-acetylgalactosaminidase activity (GO:0008456)|protein homodimerization activity (GO:0042803)	p.I403T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						CAGGTTCTTGATGGGATACAG	0.552																																							uc003bbx.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1207-1209)ATC>ACC		alpha-N-acetylgalactosaminidase precursor							147.0	134.0	139.0					22																	42456311		2203	4300	6503	SO:0001583	missense	4668				glycoside catabolic process|glycosylceramide catabolic process|oligosaccharide metabolic process	lysosome	alpha-galactosidase activity|alpha-N-acetylgalactosaminidase activity|cation binding|protein homodimerization activity	g.chr22:42456311A>G		CCDS14030.1	22q13.2	2010-07-09			ENSG00000198951	ENSG00000198951	3.2.1.49		7631	protein-coding gene	gene with protein product		104170					Standard	NM_000262		Approved	D22S674	uc003bbw.4	P17050	OTTHUMG00000151276	ENST00000396398.3:c.1208T>C	22.37:g.42456311A>G	ENSP00000379680:p.Ile403Thr		Somatic				NAGA_uc003bby.2_Missense_Mutation_p.I403T|NAGA_uc003bbw.3_Missense_Mutation_p.I403T	p.I403T	NM_000262	NP_000253	WXS	Illumina HiSeq	Unspecified	P17050	NAGAB_HUMAN			10	1345	-			403						Missense_Mutation	SNP	ENST00000396398.3	37	c.1208T>C	CCDS14030.1	.	.	.	.	.	.	.	.	.	.	A	8.749	0.920839	0.17982	.	.	ENSG00000198951	ENST00000396398;ENST00000403363;ENST00000402937	D;D;D	0.88509	-2.39;-2.39;-2.39	4.77	1.36	0.22044	Glycosyl hydrolase, family 13, all-beta (1);	0.770306	0.12925	N	0.427835	T	0.78375	0.4273	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.62048	-0.6936	10	0.30078	T	0.28	-4.6733	9.3214	0.37966	0.6148:0.0:0.3852:0.0	.	403	P17050	NAGAB_HUMAN	T	403	ENSP00000379680:I403T;ENSP00000385283:I403T;ENSP00000384603:I403T	ENSP00000379680:I403T	I	-	2	0	NAGA	40786257	0.000000	0.05858	0.021000	0.16686	0.931000	0.56810	0.108000	0.15396	-0.021000	0.14009	0.482000	0.46254	ATC		0.552	NAGA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322056.1			43	88	0	0	0	0.009718	0	43	88				
PTH1R	5745	broad.mit.edu	37	3	46944143	46944143	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:46944143T>C	ENST00000313049.5	+	12	1542	c.1339T>C	c.(1339-1341)Ttc>Ctc	p.F447L	PTH1R_ENST00000430002.2_Missense_Mutation_p.F447L|PTH1R_ENST00000449590.1_Missense_Mutation_p.F447L|PTH1R_ENST00000418619.1_Missense_Mutation_p.F447L			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	447					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)	p.F447L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	TGAGATGCTCTTCAACTCCTT	0.602																																							uc003cqm.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1339-1341)TTC>CTC		parathyroid hormone receptor 1 precursor							89.0	77.0	81.0					3																	46944143		2203	4300	6503	SO:0001583	missense	5745	Ollier_disease_/_Maffucsyndrome				cytoplasm|integral to plasma membrane|nucleus	parathyroid hormone receptor activity|peptide hormone binding|protein self-association	g.chr3:46944143T>C		CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.1339T>C	3.37:g.46944143T>C	ENSP00000321999:p.Phe447Leu		Somatic				PTH1R_uc003cqn.2_Missense_Mutation_p.F447L	p.F447L	NM_000316	NP_000307	WXS	Illumina HiSeq	Unspecified	Q03431	PTH1R_HUMAN			14	1542	+			447			Helical; Name=7; (Potential).		Q2M1U3	Missense_Mutation	SNP	ENST00000313049.5	37	c.1339T>C	CCDS2747.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.316405	0.81469	.	.	ENSG00000160801	ENST00000449590;ENST00000418619;ENST00000427125;ENST00000430002;ENST00000313049;ENST00000313063;ENST00000422115	T;T;T;T;T;T	0.80033	1.31;1.31;1.31;1.31;1.31;-1.33	4.92	4.92	0.64577	GPCR, family 2-like (1);	.	.	.	.	T	0.79341	0.4429	L	0.28776	0.89	0.80722	D	1	P	0.50156	0.932	P	0.55087	0.768	T	0.76291	-0.3013	9	0.23891	T	0.37	.	13.8969	0.63778	0.0:0.0:0.0:1.0	.	447	Q03431	PTH1R_HUMAN	L	447;447;447;447;447;725;19	ENSP00000402723:F447L;ENSP00000411424:F447L;ENSP00000400977:F447L;ENSP00000413774:F447L;ENSP00000321999:F447L;ENSP00000396176:F19L	ENSP00000321999:F447L	F	+	1	0	PTH1R	46919147	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.868000	0.87116	2.065000	0.61736	0.533000	0.62120	TTC		0.602	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257481.1	NM_000316		20	3	0	0	0	0.007413	0	20	3				
GNAT1	2779	broad.mit.edu	37	3	50230772	50230772	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:50230772A>G	ENST00000433068.1	+	3	280	c.224A>G	c.(223-225)cAg>cGg	p.Q75R	GNAT1_ENST00000232461.3_Missense_Mutation_p.Q75R	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	75					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.Q75R(2)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		AACACGTTGCAGTCCATCCTG	0.602																																							uc003cym.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(223-225)CAG>CGG		rod-type transducin alpha subunit							105.0	90.0	95.0					3																	50230772		2203	4300	6503	SO:0001583	missense	2779				detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|negative regulation of cyclic-nucleotide phosphodiesterase activity|rhodopsin mediated phototransduction|sensory perception of umami taste	heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment membrane	acyl binding|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GDP binding|GTP binding|GTPase activity|protein kinase binding|signal transducer activity	g.chr3:50230772A>G		CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.224A>G	3.37:g.50230772A>G	ENSP00000387555:p.Gln75Arg		Somatic				GNAT1_uc003cyl.2_Missense_Mutation_p.Q75R	p.Q75R	NM_144499	NP_653082	WXS	Illumina HiSeq	Unspecified	P11488	GNAT1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)	3	340	+			75					Q4VBN2	Missense_Mutation	SNP	ENST00000433068.1	37	c.224A>G	CCDS2812.1	.	.	.	.	.	.	.	.	.	.	A	31	5.099756	0.94197	.	.	ENSG00000114349	ENST00000232461;ENST00000433068;ENST00000440836	D;D;D	0.86769	-2.17;-2.17;-2.17	5.33	5.33	0.75918	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.89887	0.6845	L	0.58583	1.82	0.80722	D	1	P	0.48162	0.906	P	0.54270	0.747	D	0.90975	0.4823	10	0.87932	D	0	.	14.2852	0.66243	1.0:0.0:0.0:0.0	.	75	P11488	GNAT1_HUMAN	R	75;75;27	ENSP00000232461:Q75R;ENSP00000387555:Q75R;ENSP00000403537:Q27R	ENSP00000232461:Q75R	Q	+	2	0	GNAT1	50205776	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.151000	0.94674	2.026000	0.59711	0.459000	0.35465	CAG		0.602	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345957.1	NM_000172		20	6	0	0	0	0.008871	0	20	6				
FLNB	2317	broad.mit.edu	37	3	58111327	58111327	+	Silent	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:58111327G>C	ENST00000295956.4	+	23	4083	c.3918G>C	c.(3916-3918)gtG>gtC	p.V1306V	FLNB_ENST00000419752.2_Silent_p.V1137V|FLNB_ENST00000429972.2_Silent_p.V1306V|FLNB_ENST00000348383.5_Silent_p.V1306V|FLNB_ENST00000357272.4_Silent_p.V1306V|FLNB_ENST00000493452.1_Silent_p.V1137V|FLNB_ENST00000358537.3_Silent_p.V1306V|FLNB_ENST00000490882.1_Silent_p.V1306V	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1306	Interaction with FBLP1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.V1306V(2)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TAGTGGAGGTGACATATGATG	0.458																																							uc003djj.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19						c.(3916-3918)GTG>GTC		filamin B isoform 2							170.0	143.0	152.0					3																	58111327		2203	4300	6503	SO:0001819	synonymous_variant	2317				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding	g.chr3:58111327G>C	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.3918G>C	3.37:g.58111327G>C			Somatic				FLNB_uc010hne.2_Silent_p.V1306V|FLNB_uc003djk.2_Silent_p.V1306V|FLNB_uc010hnf.2_Silent_p.V1306V|FLNB_uc003djl.2_Silent_p.V1137V|FLNB_uc003djm.2_Silent_p.V1137V	p.V1306V	NM_001457	NP_001448	WXS	Illumina HiSeq	Unspecified	O75369	FLNB_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)	23	4083	+			1306			Filamin 11.|Interaction with FBLP1.		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	ENST00000295956.4	37	c.3918G>C	CCDS2885.1																																																																																				0.458	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457		3	47	0	0	0	0.004672	0	3	47				
CRYBG3	131544	broad.mit.edu	37	3	97605504	97605504	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:97605504C>A	ENST00000182096.4	+	5	1402	c.1338C>A	c.(1336-1338)ttC>ttA	p.F446L		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2394							carbohydrate binding (GO:0030246)	p.F446L(1)		breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TAGAGCTTTTCCCACAATCTG	0.418																																							uc003drx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1336-1338)TTC>TTA		beta-gamma crystallin domain containing 3							134.0	126.0	128.0					3																	97605504		1854	4099	5953	SO:0001583	missense	131544							g.chr3:97605504C>A			3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1338C>A	3.37:g.97605504C>A	ENSP00000182096:p.Phe446Leu		Somatic					p.F446L	NM_153605	NP_705833	WXS	Illumina HiSeq	Unspecified					5	1402	+								B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	ENST00000182096.4	37	c.1338C>A		.	.	.	.	.	.	.	.	.	.	C	9.810	1.182950	0.21870	.	.	ENSG00000080200	ENST00000182096	D	0.82167	-1.58	5.86	3.0	0.34707	Beta/gamma crystallin (2);Gamma-crystallin-related (1);	0.482695	0.23000	N	0.053092	T	0.68943	0.3056	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.58086	-0.7698	10	0.38643	T	0.18	.	8.4172	0.32678	0.0:0.7467:0.0:0.2533	.	446	Q68DQ2	CRBG3_HUMAN	L	446	ENSP00000182096:F446L	ENSP00000182096:F446L	F	+	3	2	CRYBG3	99088194	0.788000	0.28762	0.446000	0.26920	0.454000	0.32378	0.950000	0.29122	0.333000	0.23563	0.655000	0.94253	TTC		0.418	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353751.1	NM_153605		33	231	1	0	1.36615e-20	0.013726	1.96706e-20	33	231				
GAP43	2596	broad.mit.edu	37	3	115395236	115395236	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:115395236G>C	ENST00000305124.6	+	2	773	c.407G>C	c.(406-408)gGc>gCc	p.G136A	GAP43_ENST00000393780.3_Missense_Mutation_p.G172A	NM_002045.3	NP_002036.1	P17677	NEUM_HUMAN	growth associated protein 43	136					axon choice point recognition (GO:0016198)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of filopodium assembly (GO:0051489)|regulation of growth (GO:0040008)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.G136A(1)|p.G172A(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	32				GBM - Glioblastoma multiforme(114;0.164)		GAGAAGGCCGGCTCAGCTGAG	0.582																																							uc003ebq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(406-408)GGC>GCC		growth associated protein 43 isoform 2							32.0	38.0	36.0					3																	115395236		2202	4299	6501	SO:0001583	missense	2596				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding	g.chr3:115395236G>C		CCDS33830.1, CCDS46890.1	3q13.31	2013-09-19			ENSG00000172020	ENSG00000172020			4140	protein-coding gene	gene with protein product	"""neuron growth-associated protein 43"", ""neuromodulin"", ""nerve growth-related peptide GAP43"", ""axonal membrane protein GAP-43"", ""protein F1"", ""calmodulin-binding protein P-57"", ""neural phosphoprotein B-50"""	162060				3272162, 8231732	Standard	NM_002045		Approved	B-50, PP46	uc003ebr.2	P17677	OTTHUMG00000133758	ENST00000305124.6:c.407G>C	3.37:g.115395236G>C	ENSP00000305010:p.Gly136Ala		Somatic				GAP43_uc003ebr.2_Missense_Mutation_p.G172A	p.G136A	NM_002045	NP_002036	WXS	Illumina HiSeq	Unspecified	P17677	NEUM_HUMAN		GBM - Glioblastoma multiforme(114;0.164)	2	793	+			136					A8K0Y4	Missense_Mutation	SNP	ENST00000305124.6	37	c.407G>C	CCDS33830.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285809	0.23478	.	.	ENSG00000172020	ENST00000305124;ENST00000393780	T;T	0.35048	1.33;1.33	5.32	3.46	0.39613	Neuromodulin (GAP-43), C-terminal (1);	0.255913	0.38837	N	0.001558	T	0.17152	0.0412	N	0.15975	0.35	0.31062	N	0.714057	B;B	0.18461	0.028;0.001	B;B	0.17722	0.019;0.004	T	0.14117	-1.0484	10	0.02654	T	1	-2.9374	10.7634	0.46279	0.0:0.2156:0.6684:0.1161	.	172;136	A8K0Y4;P17677	.;NEUM_HUMAN	A	136;172	ENSP00000305010:G136A;ENSP00000377372:G172A	ENSP00000305010:G136A	G	+	2	0	GAP43	116877926	0.995000	0.38212	1.000000	0.80357	0.984000	0.73092	2.591000	0.46163	2.772000	0.95346	0.650000	0.86243	GGC		0.582	GAP43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258216.2	NM_002045		12	28	0	0	0	0.016723	0	12	28				
POLQ	10721	broad.mit.edu	37	3	121208549	121208549	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:121208549G>C	ENST00000264233.5	-	16	3357	c.3229C>G	c.(3229-3231)Ctt>Gtt	p.L1077V		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1077					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.L1212V(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TCTTCACAAAGACTAGGATTA	0.408								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	Pancreas(152;907 1925 26081 31236 36904)	uc003eee.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(3229-3231)CTT>GTT	DNA_polymerases_(catalytic_subunits)	DNA polymerase theta							57.0	65.0	63.0					3																	121208549		2197	4297	6494	SO:0001583	missense	10721				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity	g.chr3:121208549G>C	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.3229C>G	3.37:g.121208549G>C	ENSP00000264233:p.Leu1077Val		Somatic				POLQ_uc003eed.2_Missense_Mutation_p.L249V	p.L1077V	NM_199420	NP_955452	WXS	Illumina HiSeq	Unspecified	O75417	DPOLQ_HUMAN		GBM - Glioblastoma multiforme(114;0.0915)	16	3358	-			1077					O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	c.3229C>G	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	G	1.025	-0.683719	0.03353	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.49720	0.77	4.54	-1.2	0.09554	.	1.582580	0.03221	N	0.177490	T	0.28101	0.0693	N	0.24115	0.695	0.09310	N	1	B;B	0.17667	0.001;0.023	B;B	0.12156	0.001;0.007	T	0.05869	-1.0859	10	0.17832	T	0.49	.	0.7326	0.00959	0.2089:0.1333:0.2722:0.3856	.	1077;249	O75417;O75417-2	DPOLQ_HUMAN;.	V	700;1077;1213	ENSP00000264233:L1077V	ENSP00000264233:L1077V	L	-	1	0	POLQ	122691239	0.000000	0.05858	0.030000	0.17652	0.026000	0.11368	-0.359000	0.07632	-0.035000	0.13691	-0.224000	0.12420	CTT		0.408	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		126	63	0	0	0	0.01441	0	126	63				
CCDC14	64770	broad.mit.edu	37	3	123663717	123663717	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:123663717C>G	ENST00000488653.2	-	9	1556	c.1466G>C	c.(1465-1467)aGt>aCt	p.S489T	CCDC14_ENST00000310351.4_Missense_Mutation_p.S329T|CCDC14_ENST00000489746.1_Missense_Mutation_p.S289T|CCDC14_ENST00000485727.1_Missense_Mutation_p.S289T|CCDC14_ENST00000483247.1_Intron|CCDC14_ENST00000433542.2_Missense_Mutation_p.S448T			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	489					substantia nigra development (GO:0021762)	centrosome (GO:0005813)		p.S448T(1)|p.S329T(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		AGCATTCTCACTTCTTAATGG	0.388																																							uc011bjx.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1465-1467)AGT>ACT		coiled-coil domain containing 14							152.0	127.0	136.0					3																	123663717		2203	4300	6503	SO:0001583	missense	64770					centrosome		g.chr3:123663717C>G	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.1466G>C	3.37:g.123663717C>G	ENSP00000420180:p.Ser489Thr		Somatic				CCDC14_uc003egv.3_Missense_Mutation_p.S130T|CCDC14_uc003egx.3_Missense_Mutation_p.S289T|CCDC14_uc010hrt.2_Missense_Mutation_p.S448T|CCDC14_uc003egy.3_Missense_Mutation_p.S289T|CCDC14_uc003egz.2_Missense_Mutation_p.S289T	p.S489T	NM_022757	NP_073594	WXS	Illumina HiSeq	Unspecified	Q49A88	CCD14_HUMAN		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)	9	1557	-		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)	489			Potential.		B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	ENST00000488653.2	37	c.1466G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.07|15.07	2.724527|2.724527	0.48728|0.48728	.|.	.|.	ENSG00000175455|ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697;ENST00000419247|ENST00000479903	T;T;T;T;T;T;T|.	0.55052|.	0.54;0.54;0.54;0.54;0.54;0.54;0.54|.	5.35|5.35	4.47|4.47	0.54385|0.54385	.|.	0.074733|.	0.56097|.	D|.	0.000024|.	T|T	0.71074|0.71074	0.3297|0.3297	M|M	0.66939|0.66939	2.045|2.045	0.39283|0.39283	D|D	0.964596|0.964596	D;D;D;D|.	0.69078|.	0.995;0.995;0.997;0.995|.	P;P;D;P|.	0.66196|.	0.898;0.898;0.942;0.898|.	T|T	0.70726|0.70726	-0.4793|-0.4793	10|5	0.36615|.	T|.	0.2|.	.|.	13.7194|13.7194	0.62717|0.62717	0.0:0.921:0.0:0.079|0.0:0.921:0.0:0.079	.|.	489;448;289;330|.	Q49A88;Q49A88-6;Q49A88-4;Q49A88-5|.	CCD14_HUMAN;.;.;.|.	T|L	489;329;289;289;448;470;130|71	ENSP00000420180:S489T;ENSP00000312031:S329T;ENSP00000418002:S289T;ENSP00000418403:S289T;ENSP00000395706:S448T;ENSP00000386866:S470T;ENSP00000400957:S130T|.	ENSP00000312031:S329T|.	S|V	-|-	2|1	0|0	CCDC14|CCDC14	125146407|125146407	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.866000|0.866000	0.49608|0.49608	1.959000|1.959000	0.40412|0.40412	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	AGT|GTG		0.388	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757		9	48	0	0	0	0.006214	0	9	48				
HEG1	57493	broad.mit.edu	37	3	124746194	124746194	+	Silent	SNP	C	C	A	rs200926219	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:124746194C>A	ENST00000311127.4	-	3	835	c.768G>T	c.(766-768)tcG>tcT	p.S256S		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	256					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.S256S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						GGCTCCAAGCCGAAGTGGTGG	0.542																																							uc003ehs.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(766-768)TCG>TCT		HEG homolog 1 precursor							60.0	63.0	62.0					3																	124746194		1998	4158	6156	SO:0001819	synonymous_variant	57493					extracellular region|integral to membrane	calcium ion binding	g.chr3:124746194C>A	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.768G>T	3.37:g.124746194C>A			Somatic				HEG1_uc011bke.1_Silent_p.S256S	p.S256S	NM_020733	NP_065784	WXS	Illumina HiSeq	Unspecified	Q9ULI3	HEG1_HUMAN			3	836	-			256			Extracellular (Potential).		Q6NX66|Q8NC40|Q9BSV0	Silent	SNP	ENST00000311127.4	37	c.768G>T	CCDS46898.1																																																																																				0.542	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386		12	40	1	0	0.00010058	0.013537	0.000108059	12	40				
PIK3R4	30849	broad.mit.edu	37	3	130452634	130452634	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:130452634A>C	ENST00000356763.3	-	4	1765	c.1208T>G	c.(1207-1209)cTt>cGt	p.L403R		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	403					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L403R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						AGCCAAATGAAGAATCAGTTC	0.403																																							uc003enj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						c.(1207-1209)CTT>CGT		phosphoinositide-3-kinase, regulatory subunit 4							123.0	118.0	120.0					3																	130452634		2203	4300	6503	SO:0001583	missense	30849				fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr3:130452634A>C	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.1208T>G	3.37:g.130452634A>C	ENSP00000349205:p.Leu403Arg		Somatic					p.L403R	NM_014602	NP_055417	WXS	Illumina HiSeq	Unspecified	Q99570	PI3R4_HUMAN			4	1789	-			403					Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	37	c.1208T>G	CCDS3067.1	.	.	.	.	.	.	.	.	.	.	A	14.61	2.587562	0.46110	.	.	ENSG00000196455	ENST00000356763	T	0.34472	1.36	6.17	6.17	0.99709	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51975	0.1706	L	0.52823	1.66	0.80722	D	1	D	0.67145	0.996	D	0.64506	0.926	T	0.39761	-0.9598	10	0.14656	T	0.56	-22.8042	16.8222	0.85835	1.0:0.0:0.0:0.0	.	403	Q99570	PI3R4_HUMAN	R	403	ENSP00000349205:L403R	ENSP00000349205:L403R	L	-	2	0	PIK3R4	131935324	1.000000	0.71417	0.984000	0.44739	0.019000	0.09904	7.086000	0.76885	2.371000	0.80710	0.533000	0.62120	CTT		0.403	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602		5	260	0	0	0	0.014758	0	5	260				
ASTE1	28990	broad.mit.edu	37	3	130735084	130735084	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:130735084G>T	ENST00000264992.3	-	5	2054	c.1613C>A	c.(1612-1614)aCa>aAa	p.T538K	ATP2C1_ENST00000533801.2_Missense_Mutation_p.C943F|ATP2C1_ENST00000422190.2_Missense_Mutation_p.C938F|ATP2C1_ENST00000359644.3_Missense_Mutation_p.C948F|ATP2C1_ENST00000328560.8_3'UTR|ASTE1_ENST00000514044.1_Missense_Mutation_p.T538K|ATP2C1_ENST00000393221.4_Missense_Mutation_p.C972F|ATP2C1_ENST00000507488.2_Missense_Mutation_p.C922F|ATP2C1_ENST00000504381.1_Missense_Mutation_p.C893F|ATP2C1_ENST00000513801.1_Missense_Mutation_p.C922F	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	538					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.T538K(1)|p.C948F(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						GATGTGAGCTGTGTCTAAGTC	0.527																																						Esophageal Squamous(99;456 1443 27647 34099 42636)	uc011bli.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(2914-2916)TGT>TTT		calcium-transporting ATPase 2C1 isoform 1b	Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)						189.0	164.0	172.0					3																	130735084		2203	4300	6503	SO:0001583	missense	27032	Hailey-Hailey_disease			actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity	g.chr3:130735084G>T	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1613C>A	3.37:g.130735084G>T	ENSP00000264992:p.Thr538Lys		Somatic				ATP2C1_uc011blh.1_Missense_Mutation_p.C943F|ATP2C1_uc003enm.2_3'UTR|ATP2C1_uc003enn.2_Missense_Mutation_p.C922F|ATP2C1_uc003enp.2_3'UTR|ATP2C1_uc003enr.2_3'UTR|ATP2C1_uc003ens.2_Missense_Mutation_p.C948F|ATP2C1_uc003ent.2_Missense_Mutation_p.C938F|ASTE1_uc010htm.1_Missense_Mutation_p.T538K|ASTE1_uc003env.1_Missense_Mutation_p.T538K|ASTE1_uc011blj.1_RNA	p.C972F	NM_001001487	NP_001001487	WXS	Illumina HiSeq	Unspecified	P98194	AT2C1_HUMAN			28	3135	+			Error:Variant_position_missing_in_P98194_after_alignment					B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	37	c.2915G>T	CCDS3068.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	13.60|13.60|13.60	2.284676|2.284676|2.284676	0.40394|0.40394|0.40394	.|.|.	.|.|.	ENSG00000017260|ENSG00000034533|ENSG00000017260	ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000513801;ENST00000359644;ENST00000422190;ENST00000347421|ENST00000514044;ENST00000264992|ENST00000504612	D;D;D;D;D;D;D|.|.	0.92149|.|.	-2.97;-2.92;-2.93;-2.98;-2.92;-2.93;-2.92|.|.	5.71|5.71|5.71	3.9|3.9|3.9	0.45041|0.45041|0.45041	.|.|.	.|0.398050|.	.|0.30658|.	.|N|.	.|0.009147|.	T|T|T	0.47857|0.47857|0.47857	0.1468|0.1468|0.1468	M|M|M	0.63428|0.63428|0.63428	1.95|1.95|1.95	0.09310|0.09310|0.09310	N|N|N	1|1|1	B;B;B;B|B;B|.	0.11235|0.24823|.	0.004;0.002;0.004;0.002|0.112;0.112|.	B;B;B;B|B;B|.	0.13407|0.26310|.	0.009;0.004;0.009;0.004|0.068;0.042|.	T|T|T	0.35724|0.35724|0.35724	-0.9777|-0.9777|-0.9777	9|9|5	0.87932|0.46703|.	D|T|.	0|0.11|.	-3.0334|-3.0334|-3.0334	9.6397|9.6397|9.6397	0.39831|0.39831|0.39831	0.2179:0.0:0.7821:0.0|0.2179:0.0:0.7821:0.0|0.2179:0.0:0.7821:0.0	.|.|.	972;943;938;972|538;538|.	G3XAH8;B4DSW3;P98194-5;B7Z3X9|D6RG30;Q2TB18|.	.;.;.;.|.;ASTE1_HUMAN|.	F|K|L	893;922;972;943;922;948;938;957|538|902	ENSP00000425320:C893F;ENSP00000421326:C922F;ENSP00000376914:C972F;ENSP00000432956:C943F;ENSP00000422872:C922F;ENSP00000352665:C948F;ENSP00000402677:C938F|.|.	ENSP00000306816:C957F|ENSP00000264992:T538K|.	C|T|V	+|-|+	2|2|1	0|0|0	ATP2C1|ASTE1|ATP2C1	132217774|132217774|132217774	0.026000|0.026000|0.026000	0.19158|0.19158|0.19158	0.031000|0.031000|0.031000	0.17742|0.17742|0.17742	0.125000|0.125000|0.125000	0.20455|0.20455|0.20455	2.322000|2.322000|2.322000	0.43814|0.43814|0.43814	1.409000|1.409000|1.409000	0.46915|0.46915|0.46915	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	TGT|ACA|GTG		0.527	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065		34	99	1	0	9.17885e-22	0.015359	1.34005e-21	34	99				
PRR23A	729627	broad.mit.edu	37	3	138724422	138724423	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:138724422_138724423GG>TT	ENST00000383163.2	-	1	687_688	c.688_689CC>AA	c.(688-690)CCt>AAt	p.P230N	MRPS22_ENST00000495075.1_5'Flank	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	230	Pro-rich.							p.P230N(1)		endometrium(3)|kidney(1)|lung(7)	11						AGGTTGGAGAGGTGAGCTGGGG	0.673																																							uc011bms.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(688-690)CCT>AAT		proline rich 23A																																				SO:0001583	missense	729627							g.chr3:138724422_138724423GG>TT		CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.688_689delinsTT	3.37:g.138724422_138724423delinsTT	ENSP00000372649:p.Pro230Asn		Somatic					p.P230N	NM_001134659	NP_001128131	WXS	Illumina HiSeq	Unspecified	A6NEV1	PR23A_HUMAN			1	688_689	-			230			Pro-rich.			Missense_Mutation	DNP	ENST00000383163.2	37	c.688_689CC>AA	CCDS46923.1																																																																																				0.673	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361503.1	NM_001134659		4	10	0	0	0	0.004672	0	4	10				
SLC9A9	285195	broad.mit.edu	37	3	143214238	143214238	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:143214238C>A	ENST00000316549.6	-	10	1350	c.1142G>T	c.(1141-1143)gGc>gTc	p.G381V		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	381					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)	p.G381V(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						CAGTGCCAGGCCCATGTAACA	0.353																																							uc003evn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1141-1143)GGC>GTC		solute carrier family 9 (sodium/hydrogen							118.0	122.0	121.0					3																	143214238		2203	4300	6503	SO:0001583	missense	285195				regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity	g.chr3:143214238C>A	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.1142G>T	3.37:g.143214238C>A	ENSP00000320246:p.Gly381Val		Somatic					p.G381V	NM_173653	NP_775924	WXS	Illumina HiSeq	Unspecified	Q8IVB4	SL9A9_HUMAN			10	1324	-			381			Helical; (Potential).		A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	37	c.1142G>T	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711451	0.89112	.	.	ENSG00000181804	ENST00000316549;ENST00000450105	T	0.73897	-0.79	5.79	5.79	0.91817	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	D	0.90157	0.6924	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91689	0.5364	10	0.87932	D	0	.	20.0332	0.97547	0.0:1.0:0.0:0.0	.	381	Q8IVB4	SL9A9_HUMAN	V	381;264	ENSP00000320246:G381V	ENSP00000320246:G381V	G	-	2	0	SLC9A9	144696928	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.749000	0.94314	0.491000	0.48974	GGC		0.353	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653		38	108	1	0	2.47872e-24	0.010771	3.73592e-24	38	108				
ZIC4	84107	broad.mit.edu	37	3	147108869	147108869	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:147108869T>C	ENST00000383075.3	-	4	1365	c.853A>G	c.(853-855)Atg>Gtg	p.M285V	ZIC4_ENST00000425731.3_Missense_Mutation_p.M323V|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000473123.1_Missense_Mutation_p.M285V|ZIC4_ENST00000525172.2_Missense_Mutation_p.M335V|ZIC4_ENST00000491672.1_Missense_Mutation_p.M79V|ZIC4_ENST00000484399.1_Missense_Mutation_p.M285V	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	285						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M285V(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						TGCACCTTCATGTGCTTACGC	0.637																																							uc003ewd.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(853-855)ATG>GTG		zinc finger protein of the cerebellum 4							36.0	44.0	41.0					3																	147108869		2198	4300	6498	SO:0001583	missense	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147108869T>C	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.853A>G	3.37:g.147108869T>C	ENSP00000372553:p.Met285Val		Somatic				ZIC4_uc003ewc.1_Missense_Mutation_p.M215V|ZIC4_uc011bno.1_Missense_Mutation_p.M335V	p.M285V	NM_032153	NP_115529	WXS	Illumina HiSeq	Unspecified	Q8N9L1	ZIC4_HUMAN			4	1126	-			285			C2H2-type 5.		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	c.853A>G	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.181914	0.78677	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672	T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57	5.05	5.05	0.67936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000031	T	0.61098	0.2320	L	0.37850	1.14	0.43287	D	0.995268	P;D	0.58620	0.616;0.983	P;P	0.62014	0.475;0.897	T	0.70901	-0.4746	9	0.87932	D	0	.	14.795	0.69870	0.0:0.0:0.0:1.0	.	335;285	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	V	285;323;335;285;285;79	ENSP00000372553:M285V;ENSP00000397695:M323V;ENSP00000435509:M335V;ENSP00000417855:M285V;ENSP00000420775:M285V;ENSP00000418277:M79V	ENSP00000372553:M285V	M	-	1	0	ZIC4	148591559	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.208000	0.72165	1.894000	0.54839	0.379000	0.24179	ATG		0.637	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			14	55	0	0	0	0.004007	0	14	55				
SERPINI2	5276	broad.mit.edu	37	3	167183295	167183295	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:167183295C>T	ENST00000476257.1	-	5	943	c.645G>A	c.(643-645)atG>atA	p.M215I	SERPINI2_ENST00000264677.4_Missense_Mutation_p.M215I|SERPINI2_ENST00000461846.1_Missense_Mutation_p.M215I|SERPINI2_ENST00000471111.1_Missense_Mutation_p.M215I			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	215					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.M215I(1)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						GAGCCTTCATCATTGGAATTT	0.318																																							uc003fer.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|urinary_tract(1)	3						c.(643-645)ATG>ATA		serpin peptidase inhibitor, clade I (pancpin),							86.0	85.0	85.0					3																	167183295		2203	4300	6503	SO:0001583	missense	5276				cellular component movement|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity	g.chr3:167183295C>T	AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.645G>A	3.37:g.167183295C>T	ENSP00000420621:p.Met215Ile		Somatic				SERPINI2_uc003fes.1_Missense_Mutation_p.M225I|SERPINI2_uc003fet.1_Missense_Mutation_p.M215I	p.M215I	NM_006217	NP_006208	WXS	Illumina HiSeq	Unspecified	O75830	SPI2_HUMAN			3	703	-			215						Missense_Mutation	SNP	ENST00000476257.1	37	c.645G>A	CCDS3200.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573438	0.65765	.	.	ENSG00000114204	ENST00000476257;ENST00000461846;ENST00000264677;ENST00000471111	D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39	5.74	5.74	0.90152	Serpin domain (3);	0.039880	0.85682	D	0.000000	D	0.92672	0.7671	M	0.93854	3.465	0.46185	D	0.998915	B;B	0.32653	0.379;0.379	B;B	0.35182	0.197;0.13	D	0.92924	0.6358	10	0.87932	D	0	.	17.4314	0.87540	0.0:1.0:0.0:0.0	.	215;215	B4DDY9;O75830	.;SPI2_HUMAN	I	215	ENSP00000420621:M215I;ENSP00000417692:M215I;ENSP00000264677:M215I;ENSP00000419407:M215I	ENSP00000264677:M215I	M	-	3	0	SERPINI2	168665989	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	5.319000	0.65835	2.719000	0.93026	0.655000	0.94253	ATG		0.318	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217		80	51	0	0	0	0.01441	0	80	51				
SEC62	7095	broad.mit.edu	37	3	169710594	169710594	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:169710594A>C	ENST00000337002.4	+	8	1001	c.943A>C	c.(943-945)Agt>Cgt	p.S315R	SEC62_ENST00000480708.1_Missense_Mutation_p.S315R	NM_003262.3	NP_003253.1	Q99442	SEC62_HUMAN	SEC62 homolog (S. cerevisiae)	315					cotranslational protein targeting to membrane (GO:0006613)|posttranslational protein targeting to membrane (GO:0006620)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.S315R(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	9						AAAGTCAGACAGTGAGAAAAA	0.463																																							uc003fgg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(943-945)AGT>CGT		translocation protein 1							77.0	76.0	76.0					3																	169710594		2203	4300	6503	SO:0001583	missense	7095				cotranslational protein targeting to membrane|transmembrane transport	aggresome|endoplasmic reticulum membrane|integral to membrane|intermediate filament cytoskeleton|rough endoplasmic reticulum	protein transporter activity|receptor activity	g.chr3:169710594A>C	D87127	CCDS3210.1	3q26.2	2008-04-22	2008-04-22	2008-04-22	ENSG00000008952	ENSG00000008952			11846	protein-coding gene	gene with protein product		602173	"""translocation protein 1"""	TLOC1		9020021, 10799540	Standard	NM_003262		Approved	Dtrp1, HTP1	uc003fgh.3	Q99442	OTTHUMG00000158753	ENST00000337002.4:c.943A>C	3.37:g.169710594A>C	ENSP00000337688:p.Ser315Arg		Somatic				SEC62_uc003fgh.2_Missense_Mutation_p.S315R	p.S315R	NM_003262	NP_003253	WXS	Illumina HiSeq	Unspecified	Q99442	SEC62_HUMAN			8	974	+			315			Cytoplasmic (Potential).		D3DNQ0|O00682|O00729	Missense_Mutation	SNP	ENST00000337002.4	37	c.943A>C	CCDS3210.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.634370	0.47049	.	.	ENSG00000008952	ENST00000337002;ENST00000537426;ENST00000544081;ENST00000480708	T;T	0.17370	2.28;2.28	5.76	5.76	0.90799	.	0.075850	0.85682	D	0.000000	T	0.27594	0.0678	L	0.27053	0.805	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.04976	-1.0914	10	0.16896	T	0.51	-10.5473	16.0711	0.80936	1.0:0.0:0.0:0.0	.	315	Q99442	SEC62_HUMAN	R	315;39;39;315	ENSP00000337688:S315R;ENSP00000420331:S315R	ENSP00000337688:S315R	S	+	1	0	SEC62	171193288	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	8.671000	0.91174	2.197000	0.70478	0.482000	0.46254	AGT		0.463	SEC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352043.1			20	47	0	0	0	0.008871	0	20	47				
NLGN1	22871	broad.mit.edu	37	3	173993224	173993224	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:173993224A>T	ENST00000457714.1	+	5	1195	c.766A>T	c.(766-768)Act>Tct	p.T256S	NLGN1_ENST00000361589.4_Missense_Mutation_p.T256S|NLGN1_ENST00000545397.1_Missense_Mutation_p.T256S|NLGN1_ENST00000401917.3_Missense_Mutation_p.T296S|NLGN1_ENST00000466350.1_3'UTR	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	273					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)	p.T256S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CTTAAGAATCACTGTTTTTGG	0.428																																							uc003fio.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7						c.(766-768)ACT>TCT		neuroligin 1							98.0	96.0	97.0					3																	173993224		2203	4300	6503	SO:0001583	missense	22871				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity	g.chr3:173993224A>T	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.766A>T	3.37:g.173993224A>T	ENSP00000392500:p.Thr256Ser		Somatic				NLGN1_uc010hww.1_Missense_Mutation_p.T296S|NLGN1_uc003fip.1_Missense_Mutation_p.T256S	p.T256S	NM_014932	NP_055747	WXS	Illumina HiSeq	Unspecified	Q8N2Q7	NLGN1_HUMAN	LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)		5	1189	+	Ovarian(172;0.0025)		273			Extracellular (Potential).		Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	37	c.766A>T	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638865	0.87760	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.91236	0.7238	H	0.94925	3.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	D	0.93546	0.6882	10	0.87932	D	0	.	15.7738	0.78193	1.0:0.0:0.0:0.0	.	296;256	D2X2H5;Q8N2Q7-2	.;.	S	256;256;296;256;296	ENSP00000392500:T256S;ENSP00000354541:T256S;ENSP00000410374:T296S;ENSP00000441108:T256S;ENSP00000385750:T296S	ENSP00000354541:T256S	T	+	1	0	NLGN1	175475918	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.139000	0.94554	2.367000	0.80283	0.528000	0.53228	ACT		0.428	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932		43	111	0	0	0	0.013114	0	43	111				
DGKG	1608	broad.mit.edu	37	3	186015996	186015996	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:186015996T>A	ENST00000265022.3	-	4	706	c.167A>T	c.(166-168)aAg>aTg	p.K56M	DGKG_ENST00000382164.4_Missense_Mutation_p.K56M|DGKG_ENST00000544847.1_Missense_Mutation_p.K56M|DGKG_ENST00000344484.4_Missense_Mutation_p.K56M	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	56					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.K56M(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	CATGAACAGCTTGAAGACATC	0.532																																							uc003fqa.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(166-168)AAG>ATG		diacylglycerol kinase gamma isoform 1	Phosphatidylserine(DB00144)						76.0	70.0	72.0					3																	186015996		2203	4300	6503	SO:0001583	missense	1608				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity	g.chr3:186015996T>A	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.167A>T	3.37:g.186015996T>A	ENSP00000265022:p.Lys56Met		Somatic				DGKG_uc003fqb.2_Missense_Mutation_p.K56M|DGKG_uc003fqc.2_Missense_Mutation_p.K56M|DGKG_uc011brx.1_Missense_Mutation_p.K56M	p.K56M	NM_001346	NP_001337	WXS	Illumina HiSeq	Unspecified	P49619	DGKG_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	4	704	-	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		56					B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	ENST00000265022.3	37	c.167A>T	CCDS3274.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.948932	0.73787	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	5.19	5.19	0.71726	.	0.153066	0.43579	D	0.000547	T	0.65575	0.2704	M	0.71206	2.165	0.38618	D	0.951061	D;D;D;D	0.89917	0.998;0.998;1.0;0.999	D;D;D;D	0.72075	0.951;0.967;0.976;0.947	T	0.71925	-0.4445	10	0.87932	D	0	.	11.7143	0.51643	0.0:0.0:0.0:1.0	.	56;56;56;56	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	M	56;56;56;56;59	ENSP00000265022:K56M;ENSP00000339777:K56M;ENSP00000371599:K56M;ENSP00000440507:K56M	ENSP00000265022:K56M	K	-	2	0	DGKG	187498690	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.944000	0.40263	2.087000	0.62958	0.459000	0.35465	AAG		0.532	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3			11	66	0	0	0	0.008291	0	11	66				
AHSG	197	broad.mit.edu	37	3	186338396	186338396	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:186338396C>G	ENST00000273784.5	+	7	860	c.784C>G	c.(784-786)Cca>Gca	p.P262A	AHSG_ENST00000411641.2_Missense_Mutation_p.P261A	NM_001622.2	NP_001613.2	P02765	FETUA_HUMAN	alpha-2-HS-glycoprotein	261					acute-phase response (GO:0006953)|negative regulation of bone mineralization (GO:0030502)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|ossification (GO:0001503)|pinocytosis (GO:0006907)|positive regulation of phagocytosis (GO:0050766)|regulation of bone mineralization (GO:0030500)|regulation of inflammatory response (GO:0050727)|skeletal system development (GO:0001501)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|kinase inhibitor activity (GO:0019210)	p.P261A(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(2)|stomach(1)	22	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)		ACAGCCCCAACCAGAAGGTGC	0.612																																							uc003fqk.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(781-783)CCA>GCA		alpha-2-HS-glycoprotein							116.0	118.0	117.0					3																	186338396		2203	4300	6503	SO:0001583	missense	197				acute-phase response|negative regulation of bone mineralization|negative regulation of insulin receptor signaling pathway|pinocytosis|positive regulation of phagocytosis|regulation of inflammatory response|skeletal system development	extracellular space	cysteine-type endopeptidase inhibitor activity|protein binding	g.chr3:186338396C>G	D67013, M16961	CCDS3278.1	3q27.3	2006-02-22			ENSG00000145192	ENSG00000145192			349	protein-coding gene	gene with protein product		138680				9322749, 7736783	Standard	NM_001622		Approved	FETUA, A2HS, HSGA	uc003fqk.4	P02765	OTTHUMG00000156605	ENST00000273784.5:c.784C>G	3.37:g.186338396C>G	ENSP00000273784:p.Pro262Ala		Somatic				AHSG_uc003fql.3_Missense_Mutation_p.P262A|AHSG_uc003fqm.3_Missense_Mutation_p.P260A|AHSG_uc010hyp.2_Missense_Mutation_p.P224A	p.P261A	NM_001622	NP_001613	WXS	Illumina HiSeq	Unspecified	P02765	FETUA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)	7	862	+	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		261					A8K9N6|B2R7G1|O14961|O14962|Q9P152	Missense_Mutation	SNP	ENST00000273784.5	37	c.781C>G		.	.	.	.	.	.	.	.	.	.	c	16.12	3.034132	0.54896	.	.	ENSG00000145192	ENST00000411641;ENST00000541510;ENST00000273784	T;T	0.05855	3.39;3.38	5.32	3.48	0.39840	.	0.000000	0.64402	D	0.000020	T	0.06826	0.0174	M	0.75777	2.31	0.26756	N	0.970103	B;B;B	0.25850	0.136;0.007;0.016	B;B;B	0.20184	0.028;0.011;0.015	T	0.43410	-0.9393	10	0.02654	T	1	-0.8681	7.4445	0.27203	0.0:0.7413:0.1681:0.0906	.	327;261;262	F5H0Q5;P02765;C9JV77	.;FETUA_HUMAN;.	A	261;327;262	ENSP00000393887:P261A;ENSP00000273784:P262A	ENSP00000273784:P262A	P	+	1	0	AHSG	187821090	0.002000	0.14202	0.365000	0.25901	0.127000	0.20565	0.476000	0.22180	0.685000	0.31468	0.655000	0.94253	CCA		0.612	AHSG-002	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000344762.1	NM_001622		14	87	0	0	0	0.007291	0	14	87				
PYDC2	152138	broad.mit.edu	37	3	191179085	191179085	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:191179085C>G	ENST00000518817.1	+	1	134	c.134C>G	c.(133-135)aCa>aGa	p.T45R		NM_001083308.1	NP_001076777.1	Q56P42	PYDC2_HUMAN	pyrin domain containing 2	45	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T45R(1)		breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10						GTCCCCCAGACAGAGGTAGAC	0.532																																							uc011bso.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(133-135)ACA>AGA		pyrin domain containing 2							75.0	83.0	81.0					3																	191179085		2200	4298	6498	SO:0001583	missense	152138					cytoplasm|nucleus		g.chr3:191179085C>G			3q28	2008-07-29				ENSG00000253548			33512	protein-coding gene	gene with protein product		615701				17178784	Standard	NM_001083308		Approved	POP2	uc011bso.2	Q56P42		ENST00000518817.1:c.134C>G	3.37:g.191179085C>G	ENSP00000428325:p.Thr45Arg		Somatic					p.T45R	NM_001083308	NP_001076777	WXS	Illumina HiSeq	Unspecified	Q56P42	PYDC2_HUMAN			1	134	+			45			DAPIN.			Missense_Mutation	SNP	ENST00000518817.1	37	c.134C>G		.	.	.	.	.	.	.	.	.	.	C	0.017	-1.492135	0.01009	.	.	ENSG00000253548	ENST00000518817	T	0.48836	0.8	0.621	-1.24	0.09435	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.23611	0.0571	.	.	.	0.09310	N	1	B	0.18610	0.029	B	0.18561	0.022	T	0.16748	-1.0392	7	0.19590	T	0.45	.	.	.	.	.	45	Q56P42	PYDC2_HUMAN	R	45	ENSP00000428325:T45R	ENSP00000428325:T45R	T	+	2	0	PYDC2	192661779	0.030000	0.19436	0.001000	0.08648	0.035000	0.12851	-2.744000	0.00796	-2.675000	0.00411	-2.576000	0.00170	ACA		0.532	PYDC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000343231.2	NM_001083308		69	42	0	0	0	0.01441	0	69	42				
LINC00969	440993	broad.mit.edu	37	3	195400728	195400728	+	lincRNA	SNP	A	A	G	rs12107841	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:195400728A>G	ENST00000445430.1	+	0	1324									long intergenic non-protein coding RNA 969																		GATTGTGCCCAGCCTGTACGC	0.587																																							uc003fuw.2		NA																	0					0						c.(22-24)CCA>CCG		SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);																																						727956							g.chr3:195400728A>G	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195400728A>G			Somatic				SDHAP2_uc011btb.1_Missense_Mutation_p.S156G|SDHAP2_uc011btc.1_RNA|SDHAP2_uc003fuv.2_RNA	p.P8P			WXS	Illumina HiSeq	Unspecified					9	1218	+									Silent	SNP	ENST00000445430.1	37	c.24A>G																																																																																					0.587	LINC00969-038	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000341951.1			3	28	0	0	0	0.009096	0	3	28				
FAM193A	8603	broad.mit.edu	37	4	2674026	2674026	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:2674026A>C	ENST00000324666.5	+	11	1736	c.1385A>C	c.(1384-1386)cAc>cCc	p.H462P	FAM193A_ENST00000505311.1_Missense_Mutation_p.H462P|FAM193A_ENST00000382839.3_Missense_Mutation_p.H462P|FAM193A_ENST00000545951.1_Missense_Mutation_p.H462P|FAM193A_ENST00000502458.1_Missense_Mutation_p.H484P	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	462								p.H462P(1)		NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GTGCCTTTGCACACTGTTCCA	0.567																																							uc010icl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1384-1386)CAC>CCC		hypothetical protein LOC8603							155.0	107.0	123.0					4																	2674026		2203	4300	6503	SO:0001583	missense	8603							g.chr4:2674026A>C	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.1385A>C	4.37:g.2674026A>C	ENSP00000324587:p.His462Pro		Somatic				FAM193A_uc010ick.2_Missense_Mutation_p.H662P|FAM193A_uc003gfd.2_Missense_Mutation_p.H462P|FAM193A_uc011bvm.1_Missense_Mutation_p.H484P|FAM193A_uc011bvn.1_Missense_Mutation_p.H462P|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Missense_Mutation_p.H316P	p.H462P	NM_003704	NP_003695	WXS	Illumina HiSeq	Unspecified	P78312	F193A_HUMAN			11	1736	+			462					B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	c.1385A>C	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	A	19.08	3.758076	0.69648	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.37752	1.19;1.59;1.18;1.19;1.2	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.52224	0.1721	L	0.56769	1.78	0.80722	D	1	D;D;D;D;D	0.63880	0.993;0.993;0.993;0.993;0.993	P;P;P;P;P	0.61132	0.884;0.884;0.884;0.884;0.884	T	0.56547	-0.7961	10	0.87932	D	0	-23.6178	13.8593	0.63550	1.0:0.0:0.0:0.0	.	462;484;462;484;462	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	P	462;462;462;484;316	ENSP00000372290:H462P;ENSP00000324587:H462P;ENSP00000443617:H462P;ENSP00000427505:H484P;ENSP00000427260:H316P	ENSP00000324587:H462P	H	+	2	0	FAM193A	2643824	1.000000	0.71417	0.990000	0.47175	0.933000	0.57130	6.299000	0.72770	1.920000	0.55613	0.528000	0.53228	CAC		0.567	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704		21	25	0	0	0	0.012319	0	21	25				
EVC	2121	broad.mit.edu	37	4	5754652	5754652	+	Silent	SNP	G	G	T	rs367659093		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:5754652G>T	ENST00000264956.6	+	9	1372	c.1188G>T	c.(1186-1188)cgG>cgT	p.R396R	EVC_ENST00000382674.2_Silent_p.R396R|EVC_ENST00000509451.1_Silent_p.R396R	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	396					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R396R(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				CCAGGTGCCGGCTGGCTGCCA	0.627																																							uc003gil.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1186-1188)CGG>CGT		Ellis van Creveld syndrome protein							49.0	46.0	47.0					4																	5754652		2203	4300	6503	SO:0001819	synonymous_variant	2121				muscle organ development	integral to membrane		g.chr4:5754652G>T	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1188G>T	4.37:g.5754652G>T			Somatic				EVC_uc003gim.1_RNA|CRMP1_uc003gin.1_Intron	p.R396R	NM_153717	NP_714928	WXS	Illumina HiSeq	Unspecified	P57679	EVC_HUMAN			9	1372	+		Myeloproliferative disorder(84;0.117)	396						Silent	SNP	ENST00000264956.6	37	c.1188G>T	CCDS3383.1																																																																																				0.627	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1			20	19	1	0	2.94398e-08	0.007413	3.45526e-08	20	19				
CRMP1	1400	broad.mit.edu	37	4	5837732	5837732	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:5837732C>T	ENST00000397890.2	-	11	1405	c.1191G>A	c.(1189-1191)agG>agA	p.R397R	CRMP1_ENST00000512574.1_Silent_p.R395R|CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Silent_p.R511R	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	397					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.R511R(1)		NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TCCGCCCTTTCCTTGGGTACA	0.532																																							uc003gip.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1189-1191)AGG>AGA		collapsin response mediator protein 1 isoform 2							145.0	133.0	137.0					4																	5837732		2203	4300	6503	SO:0001819	synonymous_variant	1400				axon guidance|pyrimidine base catabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding	g.chr4:5837732C>T	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1191G>A	4.37:g.5837732C>T			Somatic				CRMP1_uc003gin.1_Silent_p.R309R|CRMP1_uc003giq.2_Silent_p.R397R|CRMP1_uc003gir.2_Silent_p.R392R|CRMP1_uc003gis.2_Silent_p.R511R	p.R397R	NM_001313	NP_001304	WXS	Illumina HiSeq	Unspecified	Q14194	DPYL1_HUMAN		Colorectal(103;0.0721)	12	1292	-			397					A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000397890.2	37	c.1191G>A	CCDS43207.1																																																																																				0.532	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313		44	77	0	0	0	0.011902	0	44	77				
TBC1D19	55296	broad.mit.edu	37	4	26744202	26744202	+	Nonsense_Mutation	SNP	C	C	T	rs141345574		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:26744202C>T	ENST00000264866.4	+	18	1578	c.1300C>T	c.(1300-1302)Cga>Tga	p.R434*	TBC1D19_ENST00000511789.1_Nonsense_Mutation_p.R369*	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	434	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.R434*(3)		breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				TTATCATCTACGAGAAATTGG	0.373																																							uc003gsf.3		NA																	3	Substitution - Nonsense(3)	p.R434*(1)	large_intestine(1)|lung(1)|breast(1)	breast(1)	1						c.(1300-1302)CGA>TGA		TBC1 domain family, member 19		C	stop/ARG	0,4406		0,0,2203	112.0	114.0	114.0		1300	5.1	1.0	4	dbSNP_134	114	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	TBC1D19	NM_018317.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		434/527	26744202	1,13005	2203	4300	6503	SO:0001587	stop_gained	55296					intracellular	Rab GTPase activator activity	g.chr4:26744202C>T	AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.1300C>T	4.37:g.26744202C>T	ENSP00000264866:p.Arg434*		Somatic				TBC1D19_uc010iew.2_Nonsense_Mutation_p.R434*|TBC1D19_uc011bxu.1_Nonsense_Mutation_p.R369*	p.R434*	NM_018317	NP_060787	WXS	Illumina HiSeq	Unspecified	Q8N5T2	TBC19_HUMAN			18	1570	+		Breast(46;0.0503)	434			Rab-GAP TBC.		B9A6M0|Q9NUX1	Nonsense_Mutation	SNP	ENST00000264866.4	37	c.1300C>T	CCDS3439.1	.	.	.	.	.	.	.	.	.	.	C	36	5.888657	0.97068	0.0	1.16E-4	ENSG00000109680	ENST00000264866;ENST00000511789	.	.	.	5.95	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7472	14.7722	0.69688	0.2632:0.7368:0.0:0.0	.	.	.	.	X	434;369	.	ENSP00000264866:R434X	R	+	1	2	TBC1D19	26353300	0.998000	0.40836	0.995000	0.50966	0.997000	0.91878	3.339000	0.52135	1.487000	0.48415	0.650000	0.86243	CGA		0.373	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2	NM_018317		41	45	0	0	0	0.01441	0	41	45				
KIAA1211	57482	broad.mit.edu	37	4	57181643	57181643	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:57181643C>A	ENST00000504228.1	+	6	2080	c.1975C>A	c.(1975-1977)Ccc>Acc	p.P659T	KIAA1211_ENST00000264229.6_Missense_Mutation_p.P659T|KIAA1211_ENST00000541073.1_Missense_Mutation_p.P652T			Q6ZU35	K1211_HUMAN	KIAA1211	659								p.P659T(1)		endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CCAGGAGTCTCCCAGCAGCGC	0.677																																							uc003hbk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1975-1977)CCC>ACC		hypothetical protein LOC57482							21.0	25.0	24.0					4																	57181643		1945	4124	6069	SO:0001583	missense	57482							g.chr4:57181643C>A	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1975C>A	4.37:g.57181643C>A	ENSP00000423366:p.Pro659Thr		Somatic				KIAA1211_uc010iha.2_Missense_Mutation_p.P652T|KIAA1211_uc011bzz.1_Missense_Mutation_p.P569T|KIAA1211_uc003hbm.1_Missense_Mutation_p.P545T	p.P659T	NM_020722	NP_065773	WXS	Illumina HiSeq	Unspecified	Q6ZU35	K1211_HUMAN			8	2366	+	Glioma(25;0.08)|all_neural(26;0.101)		659					Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	c.1975C>A	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	C	9.632	1.136676	0.21123	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.01902	4.57;4.57;4.57	4.48	-2.77	0.05877	.	.	.	.	.	T	0.02533	0.0077	L	0.54323	1.7	0.09310	N	1	P;P;B	0.42248	0.774;0.774;0.228	B;B;B	0.39805	0.31;0.229;0.121	T	0.40608	-0.9554	9	0.28530	T	0.3	0.1054	6.6336	0.22872	0.0:0.3427:0.3168:0.3406	.	652;652;659	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	T	659;659;652;569	ENSP00000264229:P659T;ENSP00000423366:P659T;ENSP00000444006:P652T	ENSP00000264229:P659T	P	+	1	0	KIAA1211	56876400	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.588000	0.05774	-0.472000	0.06881	-1.080000	0.02220	CCC		0.677	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722		16	21	1	0	2.31682e-05	0.003163	2.53459e-05	16	21				
CXCL6	6372	broad.mit.edu	37	4	74702948	74702948	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:74702948T>G	ENST00000226317.5	+	3	525	c.271T>G	c.(271-273)Tgt>Ggt	p.C91G	CXCL6_ENST00000503446.1_3'UTR|CXCL6_ENST00000515050.1_Missense_Mutation_p.C91G	NM_002993.3	NP_002984.1	P80162	CXCL6_HUMAN	chemokine (C-X-C motif) ligand 6	91					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|heparin binding (GO:0008201)	p.C91G(1)		large_intestine(1)|lung(7)	8	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			GAAGCAAGTTTGTCTGGACCC	0.453																																							uc003hhf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(271-273)TGT>GGT		chemokine (C-X-C motif) ligand 6 (granulocyte							93.0	101.0	98.0					4																	74702948		2203	4300	6503	SO:0001583	missense	6372				cell-cell signaling|chemotaxis|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity|heparin binding	g.chr4:74702948T>G	U83303	CCDS3560.1	4q13.3	2013-02-25	2012-10-17	2002-08-23	ENSG00000124875	ENSG00000124875		"""Endogenous ligands"""	10643	protein-coding gene	gene with protein product	"""granulocyte chemotactic protein 2"""	138965	"""small inducible cytokine subfamily B (Cys-X-Cys), member 6 (granulocyte chemotactic protein 2)"", ""chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2)"""	SCYB6		9465307	Standard	NM_002993		Approved	GCP-2, CKA-3	uc003hhf.3	P80162	OTTHUMG00000130010	ENST00000226317.5:c.271T>G	4.37:g.74702948T>G	ENSP00000226317:p.Cys91Gly		Somatic				IL8_uc011cbh.1_Intron	p.C91G	NM_002993	NP_002984	WXS	Illumina HiSeq	Unspecified	P80162	CXCL6_HUMAN	all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)		3	466	+	Breast(15;0.00102)		91					B2R4X3|Q4W5D4	Missense_Mutation	SNP	ENST00000226317.5	37	c.271T>G	CCDS3560.1	.	.	.	.	.	.	.	.	.	.	T	11.93	1.784838	0.31593	.	.	ENSG00000124875	ENST00000226317;ENST00000515050	T;T	0.57595	0.39;0.39	3.87	3.87	0.44632	CXC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.000000	0.85682	D	0.000000	T	0.79678	0.4487	H	0.97415	4	0.45403	D	0.99838	D	0.89917	1.0	D	0.87578	0.998	D	0.84056	0.0372	10	0.87932	D	0	.	9.2616	0.37616	0.0:0.0:0.0:1.0	.	91	P80162	CXCL6_HUMAN	G	91	ENSP00000226317:C91G;ENSP00000424819:C91G	ENSP00000226317:C91G	C	+	1	0	CXCL6	74921812	0.998000	0.40836	0.306000	0.25113	0.020000	0.10135	4.111000	0.57838	1.747000	0.51819	0.528000	0.53228	TGT		0.453	CXCL6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252283.2	NM_002993		37	30	0	0	0	0.00623	0	37	30				
HSD17B13	345275	broad.mit.edu	37	4	88239557	88239557	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:88239557C>T	ENST00000328546.4	-	2	306	c.242G>A	c.(241-243)cGa>cAa	p.R81Q	RP11-529H2.2_ENST00000508163.1_RNA|HSD17B13_ENST00000302219.6_Intron	NM_178135.3	NP_835236.2	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	81						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)	p.R81Q(1)		endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	8		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)		GCCTAGTTTTCGGCACTCAGC	0.443																																							uc003hqo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(241-243)CGA>CAA		hydroxysteroid (17-beta) dehydrogenase 13							122.0	106.0	111.0					4																	88239557		2203	4300	6503	SO:0001583	missense	345275					extracellular region	binding|oxidoreductase activity	g.chr4:88239557C>T		CCDS3618.1, CCDS47097.1	4q22.1	2011-09-20			ENSG00000170509	ENSG00000170509	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18685	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 3"""	612127				19027726	Standard	NM_178135		Approved	SCDR9, SDR16C3	uc003hqo.2	Q7Z5P4	OTTHUMG00000130602	ENST00000328546.4:c.242G>A	4.37:g.88239557C>T	ENSP00000333300:p.Arg81Gln		Somatic				HSD17B13_uc010ikk.2_Intron	p.R81Q	NM_178135	NP_835236	WXS	Illumina HiSeq	Unspecified	Q7Z5P4	DHB13_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000308)	2	305	-		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)	81					A8K9R9|Q2M1L5|Q86W22|Q86W23	Missense_Mutation	SNP	ENST00000328546.4	37	c.242G>A	CCDS3618.1	.	.	.	.	.	.	.	.	.	.	C	10.45	1.353256	0.24512	.	.	ENSG00000170509	ENST00000328546	D	0.89552	-2.53	4.94	3.22	0.36961	NAD(P)-binding domain (1);	0.504196	0.17929	N	0.157229	T	0.81133	0.4759	L	0.35288	1.05	0.28751	N	0.901459	B	0.28291	0.206	B	0.24701	0.055	T	0.69624	-0.5095	10	0.27082	T	0.32	.	9.838	0.40982	0.0:0.7693:0.0:0.2307	.	81	Q7Z5P4	DHB13_HUMAN	Q	81	ENSP00000333300:R81Q	ENSP00000333300:R81Q	R	-	2	0	HSD17B13	88458581	0.011000	0.17503	0.023000	0.16930	0.028000	0.11728	0.850000	0.27737	0.674000	0.31244	0.591000	0.81541	CGA		0.443	HSD17B13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253052.1	NM_178135		3	55	0	0	0	0.004672	0	3	55				
PDHA2	5161	broad.mit.edu	37	4	96761509	96761509	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:96761509C>A	ENST00000295266.4	+	1	271	c.208C>A	c.(208-210)Cgc>Agc	p.R70S		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	70					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)	p.R70S(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		GCTGACTGTTCGCCGCATGGA	0.493																																							uc003htr.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(208-210)CGC>AGC		pyruvate dehydrogenase E1 alpha 2 precursor	NADH(DB00157)						95.0	82.0	87.0					4																	96761509		2203	4300	6503	SO:0001583	missense	5161				glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity	g.chr4:96761509C>A		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.208C>A	4.37:g.96761509C>A	ENSP00000295266:p.Arg70Ser		Somatic					p.R70S	NM_005390	NP_005381	WXS	Illumina HiSeq	Unspecified	P29803	ODPAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	1	271	+		Hepatocellular(203;0.114)	70					B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	37	c.208C>A	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162990	0.57476	.	.	ENSG00000163114	ENST00000295266	D	0.97924	-4.61	4.81	2.13	0.27403	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98648	0.9547	M	0.92970	3.365	0.54753	D	0.999988	D	0.89917	1.0	D	0.79108	0.992	D	0.98452	1.0592	10	0.87932	D	0	-12.1299	8.6444	0.33996	0.0:0.7347:0.0:0.2653	.	70	P29803	ODPAT_HUMAN	S	70	ENSP00000295266:R70S	ENSP00000295266:R70S	R	+	1	0	PDHA2	96980532	0.850000	0.29656	0.626000	0.29213	0.783000	0.44284	1.605000	0.36815	0.755000	0.32990	0.467000	0.42956	CGC		0.493	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1			21	19	1	0	8.34094e-07	0.008871	9.39476e-07	21	19				
ANK2	287	broad.mit.edu	37	4	114280096	114280096	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:114280096G>A	ENST00000357077.4	+	38	10375	c.10322G>A	c.(10321-10323)cGa>cAa	p.R3441Q	ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.R3408Q|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3441					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R3441Q(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTTACATCCCGATTGCCAGTT	0.478																																							uc003ibe.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(10321-10323)CGA>CAA		ankyrin 2 isoform 1							67.0	74.0	72.0					4																	114280096		2199	4299	6498	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114280096G>A	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10322G>A	4.37:g.114280096G>A	ENSP00000349588:p.Arg3441Gln		Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.R743Q|ANK2_uc011cgb.1_Missense_Mutation_p.R3456Q	p.R3441Q	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	10422	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	3408					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.10322G>A	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500010	0.64298	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	T;T;D	0.97279	-0.71;-0.73;-4.32	5.67	3.96	0.45880	.	0.153716	0.29924	N	0.010847	D	0.96959	0.9007	L	0.57536	1.79	0.80722	D	1	D;D	0.71674	0.993;0.998	P;P	0.58780	0.47;0.845	D	0.95115	0.8241	10	0.32370	T	0.25	.	11.8932	0.52641	0.1396:0.0:0.8604:0.0	.	3408;3441	Q01484;Q01484-4	ANK2_HUMAN;.	Q	3441;3408;451	ENSP00000349588:R3441Q;ENSP00000264366:R3408Q;ENSP00000422498:R451Q	ENSP00000264366:R3408Q	R	+	2	0	ANK2	114499545	1.000000	0.71417	0.598000	0.28837	0.976000	0.68499	4.521000	0.60532	0.753000	0.32945	0.650000	0.86243	CGA		0.478	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		6	32	0	0	0	0.001168	0	6	32				
EXOSC9	5393	broad.mit.edu	37	4	122734443	122734443	+	Silent	SNP	A	A	T	rs370861791		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:122734443A>T	ENST00000243498.5	+	9	990	c.882A>T	c.(880-882)acA>acT	p.T294T	EXOSC9_ENST00000379663.3_Silent_p.T294T|EXOSC9_ENST00000509980.1_3'UTR|EXOSC9_ENST00000512454.1_Silent_p.T278T	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	294					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.T294T(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						AAAGGATCACAGCATTTAAAA	0.418																																							uc003iea.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(880-882)ACA>ACT		exosome component 9 isoform 2							102.0	110.0	107.0					4																	122734443		2203	4300	6503	SO:0001819	synonymous_variant	5393				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|immune response|nuclear mRNA surveillance|nuclear polyadenylation-dependent rRNA catabolic process|positive regulation of cell growth|rRNA processing	cytosol|nuclear exosome (RNase complex)|nucleolus|nucleolus|nucleus	3'-5'-exoribonuclease activity|AU-rich element binding|protein binding	g.chr4:122734443A>T	M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.882A>T	4.37:g.122734443A>T			Somatic				EXOSC9_uc003idz.2_Silent_p.T294T|EXOSC9_uc003ieb.2_Silent_p.T278T|EXOSC9_uc010inp.1_Intron	p.T294T	NM_005033	NP_005024	WXS	Illumina HiSeq	Unspecified	Q06265	EXOS9_HUMAN			9	990	+			294					Q12883|Q4W5P5|Q86Y41|Q86Y48	Silent	SNP	ENST00000243498.5	37	c.882A>T	CCDS3722.2																																																																																				0.418	EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250708.2	NM_005033		43	37	0	0	0	0.006999	0	43	37				
KIAA1109	84162	broad.mit.edu	37	4	123271219	123271219	+	Silent	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:123271219A>T	ENST00000264501.4	+	80	14212	c.13839A>T	c.(13837-13839)tcA>tcT	p.S4613S	KIAA1109_ENST00000388738.3_Silent_p.S4613S			Q2LD37	K1109_HUMAN	KIAA1109	4613					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S4613S(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AAAAAAGTTCACAAGAACAAT	0.333																																							uc003ieh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(13837-13839)TCA>TCT		fragile site-associated protein							86.0	81.0	82.0					4																	123271219		1813	4072	5885	SO:0001819	synonymous_variant	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123271219A>T	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.13839A>T	4.37:g.123271219A>T			Somatic				KIAA1109_uc003iem.2_Silent_p.S969S	p.S4613S	NM_015312	NP_056127	WXS	Illumina HiSeq	Unspecified	Q2LD37	K1109_HUMAN			78	13884	+			4613					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	37	c.13839A>T	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	A	5.569	0.289847	0.10567	.	.	ENSG00000138688	ENST00000306802	.	.	.	5.97	3.53	0.40419	.	.	.	.	.	T	0.60051	0.2239	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56631	-0.7947	4	.	.	.	.	10.1976	0.43065	0.8652:0.0:0.1348:0.0	.	.	.	.	L	989	.	.	H	+	2	0	KIAA1109	123490669	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	0.847000	0.27696	1.042000	0.40150	0.533000	0.62120	CAC		0.333	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		36	27	0	0	0	0.015359	0	36	27				
TDO2	6999	broad.mit.edu	37	4	156831336	156831336	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:156831336G>C	ENST00000536354.2	+	6	655	c.591G>C	c.(589-591)caG>caC	p.Q197H		NM_005651.3	NP_005642.1			tryptophan 2,3-dioxygenase									p.Q197H(2)		breast(3)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	18	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)		AATCTGAGCAGGAAAAGACAC	0.323																																					Colon(57;928 1036 2595 6946 26094)	Colon(57;928 1036 2595 6946 26094)	uc003ipf.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(589-591)CAG>CAC		tryptophan 2,3-dioxygenase	L-Tryptophan(DB00150)						63.0	67.0	65.0					4																	156831336		2203	4300	6503	SO:0001583	missense	6999				tryptophan catabolic process to kynurenine	cytosol	tryptophan 2,3-dioxygenase activity	g.chr4:156831336G>C		CCDS34086.1	4q31-q32	2008-02-05				ENSG00000151790	1.13.11.11		11708	protein-coding gene	gene with protein product		191070					Standard	NM_005651		Approved	TDO, TPH2	uc003ipf.2	P48775		ENST00000536354.2:c.591G>C	4.37:g.156831336G>C	ENSP00000444788:p.Gln197His		Somatic					p.Q197H	NM_005651	NP_005642	WXS	Illumina HiSeq	Unspecified	P48775	T23O_HUMAN		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)	6	655	+	all_hematologic(180;0.24)	Renal(120;0.0854)	197						Missense_Mutation	SNP	ENST00000536354.2	37	c.591G>C	CCDS34086.1	.	.	.	.	.	.	.	.	.	.	G	7.831	0.719765	0.15372	.	.	ENSG00000151790	ENST00000536354	.	.	.	4.92	2.27	0.28462	.	0.209803	0.51477	D	0.000099	T	0.40862	0.1134	L	0.33339	1.005	0.50813	D	0.999899	B	0.06786	0.001	B	0.09377	0.004	T	0.11591	-1.0581	8	.	.	.	-11.7833	8.6471	0.34011	0.4024:0.0:0.5976:0.0	.	197	P48775	T23O_HUMAN	H	197	.	.	Q	+	3	2	TDO2	157050786	0.913000	0.31002	0.958000	0.39756	0.347000	0.29111	0.040000	0.13905	0.231000	0.21079	-0.149000	0.13747	CAG		0.323	TDO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366209.3	NM_005651		10	76	0	0	0	0.006214	0	10	76				
PALLD	23022	broad.mit.edu	37	4	169842780	169842780	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:169842780G>T	ENST00000505667.1	+	18	3119	c.2946G>T	c.(2944-2946)ggG>ggT	p.G982G	PALLD_ENST00000507735.1_Silent_p.G478G|CBR4_ENST00000509108.1_Intron|PALLD_ENST00000335742.7_Silent_p.G807G|PALLD_ENST00000512127.1_Silent_p.G583G|PALLD_ENST00000261509.6_Silent_p.G965G			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	1189					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)	p.G807G(1)|p.G965G(1)		breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		GTGAGAACGGGGTGCACTCTC	0.537									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)	Esophageal Squamous(109;1482 1532 18347 40239 51172)	uc011cjx.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2944-2946)GGG>GGT		palladin isoform 2							103.0	79.0	87.0					4																	169842780		2203	4300	6503	SO:0001819	synonymous_variant	23022	Pancreatic_Cancer_Familial_Clustering_of	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding	g.chr4:169842780G>T	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.2946G>T	4.37:g.169842780G>T			Somatic				CBR4_uc011cjy.1_Intron|PALLD_uc003iru.2_Silent_p.G965G|PALLD_uc003irv.2_Silent_p.G583G|PALLD_uc003irw.2_Silent_p.G467G|PALLD_uc003irx.2_Silent_p.G191G	p.G982G	NM_016081	NP_057165	WXS	Illumina HiSeq	Unspecified	Q8WX93	PALLD_HUMAN		GBM - Glioblastoma multiforme(119;0.204)	18	3157	+		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)	1189			Ig-like C2-type 4.|Interaction with EZR.		B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Silent	SNP	ENST00000505667.1	37	c.2946G>T	CCDS54818.1	.	.	.	.	.	.	.	.	.	.	G	9.408	1.079827	0.20309	.	.	ENSG00000129116	ENST00000503290	T	0.69040	-0.37	5.46	1.45	0.22620	.	0.000000	0.32624	U	0.005856	T	0.67258	0.2874	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66101	-0.6007	7	0.87932	D	0	.	5.09	0.14704	0.0752:0.2976:0.4539:0.1732	.	.	.	.	C	19	ENSP00000425729:G19C	ENSP00000425729:G19C	G	+	1	0	PALLD	170079355	0.274000	0.24191	1.000000	0.80357	0.844000	0.47949	-0.360000	0.07622	0.672000	0.31204	0.555000	0.69702	GGT		0.537	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081		13	14	1	0	2.27111e-07	0.013537	2.58586e-07	13	14				
IRX2	153572	broad.mit.edu	37	5	2749032	2749032	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:2749032C>G	ENST00000382611.6	-	3	1038	c.790G>C	c.(790-792)Gag>Cag	p.E264Q	IRX2_ENST00000502957.1_5'UTR|IRX2_ENST00000302057.5_Missense_Mutation_p.E264Q	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	264					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.E264Q(1)		breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		TCGTCGTCCTCCAGGTCGTCA	0.711																																							uc003jda.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(790-792)GAG>CAG		iroquois homeobox 2							18.0	18.0	18.0					5																	2749032		2195	4282	6477	SO:0001583	missense	153572					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:2749032C>G	AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.790G>C	5.37:g.2749032C>G	ENSP00000372056:p.Glu264Gln		Somatic				IRX2_uc003jdb.2_Missense_Mutation_p.E264Q	p.E264Q	NM_001134222	NP_001127694	WXS	Illumina HiSeq	Unspecified	Q9BZI1	IRX2_HUMAN		GBM - Glioblastoma multiforme(108;0.204)	3	1032	-			264					Q68A19|Q7Z2I7	Missense_Mutation	SNP	ENST00000382611.6	37	c.790G>C	CCDS3868.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.797591	0.50208	.	.	ENSG00000170561	ENST00000382611;ENST00000302057;ENST00000502957	T;T;T	0.66460	-0.21;-0.21;-0.21	4.81	4.81	0.61882	.	0.502564	0.22732	N	0.056309	T	0.67268	0.2875	L	0.54323	1.7	0.46078	D	0.998854	D	0.53151	0.958	P	0.47827	0.558	T	0.64305	-0.6439	10	0.16896	T	0.51	-27.0544	17.511	0.87760	0.0:1.0:0.0:0.0	.	264	Q9BZI1	IRX2_HUMAN	Q	264;264;171	ENSP00000372056:E264Q;ENSP00000307006:E264Q;ENSP00000426151:E171Q	ENSP00000307006:E264Q	E	-	1	0	IRX2	2802032	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	6.852000	0.75430	2.218000	0.71995	0.563000	0.77884	GAG		0.711	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206749.2			19	9	0	0	0	0.008871	0	19	9				
CDH18	1016	broad.mit.edu	37	5	19747077	19747077	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:19747077A>G	ENST00000507958.1	-	6	1487	c.497T>C	c.(496-498)gTt>gCt	p.V166A	CDH18_ENST00000506372.1_Missense_Mutation_p.V166A|CDH18_ENST00000274170.4_Missense_Mutation_p.V166A|CDH18_ENST00000502796.1_Missense_Mutation_p.V166A|CDH18_ENST00000511273.1_Missense_Mutation_p.V166A|CDH18_ENST00000382275.1_Missense_Mutation_p.V166A			Q13634	CAD18_HUMAN	cadherin 18, type 2	166	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V166A(2)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AGGCACAGTAACAATGTATGG	0.343																																							uc003jgc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|large_intestine(1)|skin(1)	7						c.(496-498)GTT>GCT		cadherin 18, type 2 preproprotein							125.0	123.0	124.0					5																	19747077		2203	4300	6503	SO:0001583	missense	1016				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:19747077A>G	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.497T>C	5.37:g.19747077A>G	ENSP00000425093:p.Val166Ala		Somatic				CDH18_uc003jgd.2_Missense_Mutation_p.V166A|CDH18_uc011cnm.1_Missense_Mutation_p.V166A	p.V166A	NM_004934	NP_004925	WXS	Illumina HiSeq	Unspecified	Q13634	CAD18_HUMAN			3	874	-	Lung NSC(1;0.00734)|all_lung(1;0.0197)		166			Extracellular (Potential).|Cadherin 2.		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	c.497T>C	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	A	4.018	0.000797	0.07819	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76	4.88	4.88	0.63580	Cadherin (4);Cadherin-like (1);	0.064389	0.64402	D	0.000008	T	0.21186	0.0510	N	0.02142	-0.665	0.44562	D	0.997528	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.10636	-1.0621	9	.	.	.	.	13.3065	0.60355	1.0:0.0:0.0:0.0	.	166;166	B4DHG6;Q13634	.;CAD18_HUMAN	A	166;166;166;166;166;166;112;166	ENSP00000371710:V166A;ENSP00000425093:V166A;ENSP00000274170:V166A;ENSP00000424931:V166A;ENSP00000422138:V166A;ENSP00000427383:V112A;ENSP00000425854:V166A	.	V	-	2	0	CDH18	19782834	1.000000	0.71417	0.615000	0.29064	0.989000	0.77384	5.852000	0.69488	1.827000	0.53221	0.482000	0.46254	GTT		0.343	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934		119	57	0	0	0	0.01441	0	119	57				
CDH9	1007	broad.mit.edu	37	5	26916033	26916033	+	Splice_Site	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:26916033C>A	ENST00000231021.4	-	3	401		c.e3-1			NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CAGTGTGAAGCTTTAGAGAGG	0.343																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	1	Unknown(1)		lung(1)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.e3-1		cadherin 9, type 2 preproprotein							56.0	58.0	57.0					5																	26916033		2203	4297	6500	SO:0001630	splice_region_variant	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26916033C>A	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.229-1G>T	5.37:g.26916033C>A			Somatic				CDH9_uc010iug.2_Splice_Site_p.L77_splice	p.L77_splice	NM_016279	NP_057363	WXS	Illumina HiSeq	Unspecified	Q9ULB4	CADH9_HUMAN			3	398	-								Q3B7I5	Splice_Site	SNP	ENST00000231021.4	37	c.229_splice	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997056	0.74818	.	.	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1588	0.81683	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDH9	26951790	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.358000	0.79466	2.202000	0.70862	0.585000	0.79938	.		0.343	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	Intron	35	113	1	0	2.42023e-17	0.015359	3.36903e-17	35	113				
RICTOR	253260	broad.mit.edu	37	5	39021212	39021212	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:39021212G>A	ENST00000357387.3	-	3	154	c.124C>T	c.(124-126)Ctc>Ttc	p.L42F	RICTOR_ENST00000296782.5_Missense_Mutation_p.L42F	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2									p.L42F(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					ACATTTTGGAGAATCTCTCTT	0.323																																							uc003jlp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10						c.(124-126)CTC>TTC		rapamycin-insensitive companion of mTOR							127.0	133.0	131.0					5																	39021212		2203	4300	6503	SO:0001583	missense	253260				actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding	g.chr5:39021212G>A		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.124C>T	5.37:g.39021212G>A	ENSP00000349959:p.Leu42Phe		Somatic				RICTOR_uc003jlo.2_Missense_Mutation_p.L42F|RICTOR_uc010ivf.2_5'UTR|RICTOR_uc003jlq.1_Missense_Mutation_p.L26F|RICTOR_uc011cpk.1_Missense_Mutation_p.L42F	p.L42F	NM_152756	NP_689969	WXS	Illumina HiSeq	Unspecified	Q6R327	RICTR_HUMAN			3	148	-	all_lung(31;0.000396)		42						Missense_Mutation	SNP	ENST00000357387.3	37	c.124C>T	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.916033	0.92178	.	.	ENSG00000164327	ENST00000357387;ENST00000296782;ENST00000514735	T;T	0.61627	0.09;0.11	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.75012	0.3792	L	0.61218	1.895	0.80722	D	1	D;D;P;D	0.89917	0.997;1.0;0.949;0.999	D;D;P;D	0.87578	0.991;0.998;0.801;0.996	T	0.76274	-0.3019	10	0.87932	D	0	-5.7599	18.6203	0.91318	0.0:0.0:1.0:0.0	.	42;42;42;42	Q8N6M7;E7ETT0;Q6R327;Q6R327-3	.;.;RICTR_HUMAN;.	F	42;42;26	ENSP00000349959:L42F;ENSP00000296782:L42F	ENSP00000296782:L42F	L	-	1	0	RICTOR	39056969	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.329000	0.90017	2.779000	0.95612	0.591000	0.81541	CTC		0.323	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756		46	186	0	0	0	0.01441	0	46	186				
C6	729	broad.mit.edu	37	5	41142976	41142976	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:41142976C>A	ENST00000263413.3	-	18	3020	c.2756G>T	c.(2755-2757)tGt>tTt	p.C919F	C6_ENST00000337836.5_Missense_Mutation_p.C919F	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	919	C5b-binding domain.|Factor I module (FIM) 2.|Kazal-like 2. {ECO:0000255|PROSITE- ProRule:PRU00798}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.C919F(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CCTGTTTGCACATCTTATAGT	0.433																																							uc003jmk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)	7						c.(2755-2757)TGT>TTT		complement component 6 precursor							243.0	200.0	214.0					5																	41142976		2203	4300	6503	SO:0001583	missense	729				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding	g.chr5:41142976C>A	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.2756G>T	5.37:g.41142976C>A	ENSP00000263413:p.Cys919Phe		Somatic				C6_uc003jml.1_Missense_Mutation_p.C919F	p.C919F	NM_000065	NP_000056	WXS	Illumina HiSeq	Unspecified	P13671	CO6_HUMAN			18	2966	-		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)	919			Complement control factor I module 2.|C5b-binding domain.|Kazal-like 2.			Missense_Mutation	SNP	ENST00000263413.3	37	c.2756G>T	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861181	0.51482	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.73258	-0.73;-0.73	5.71	5.71	0.89125	Factor I / membrane attack complex (1);	0.000000	0.85682	D	0.000000	D	0.86197	0.5875	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87401	0.2369	10	0.87932	D	0	-14.6493	19.472	0.94966	0.0:1.0:0.0:0.0	.	919	P13671	CO6_HUMAN	F	919	ENSP00000338861:C919F;ENSP00000263413:C919F	ENSP00000263413:C919F	C	-	2	0	C6	41178733	1.000000	0.71417	0.984000	0.44739	0.164000	0.22412	5.109000	0.64615	2.712000	0.92718	0.650000	0.86243	TGT		0.433	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1			117	68	1	0	5.16181e-52	0.01441	8.48156e-52	117	68				
PARP8	79668	broad.mit.edu	37	5	50056133	50056133	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:50056133A>T	ENST00000281631.5	+	5	440	c.282A>T	c.(280-282)agA>agT	p.R94S	PARP8_ENST00000503750.2_Missense_Mutation_p.R94S|PARP8_ENST00000505554.1_Missense_Mutation_p.R73S|PARP8_ENST00000511363.2_Intron|PARP8_ENST00000514342.2_5'UTR|PARP8_ENST00000514067.2_Missense_Mutation_p.R94S|PARP8_ENST00000505697.2_Missense_Mutation_p.R94S	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	94						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.R94S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				CAGAATTAAGAAAAACAAATG	0.249																																							uc003jon.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|large_intestine(1)|ovary(1)	5						c.(280-282)AGA>AGT		poly (ADP-ribose) polymerase family, member 8							15.0	16.0	16.0					5																	50056133		2103	4199	6302	SO:0001583	missense	79668					intracellular	NAD+ ADP-ribosyltransferase activity	g.chr5:50056133A>T	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.282A>T	5.37:g.50056133A>T	ENSP00000281631:p.Arg94Ser		Somatic				PARP8_uc011cpz.1_Intron|PARP8_uc003joo.2_Missense_Mutation_p.R94S|PARP8_uc003jop.2_Missense_Mutation_p.R94S	p.R94S	NM_024615	NP_078891	WXS	Illumina HiSeq	Unspecified	Q8N3A8	PARP8_HUMAN			6	464	+		Lung NSC(810;0.0305)|Breast(144;0.222)	94					Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	ENST00000281631.5	37	c.282A>T	CCDS3954.1	.	.	.	.	.	.	.	.	.	.	A	16.29	3.082686	0.55861	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000281631;ENST00000514067;ENST00000503046;ENST00000505554	.	.	.	5.54	-3.11	0.05299	.	0.111918	0.56097	D	0.000027	T	0.36496	0.0969	N	0.22421	0.69	0.80722	D	1	B;B	0.17038	0.02;0.012	B;B	0.15052	0.012;0.01	T	0.09509	-1.0671	8	.	.	.	-14.4052	13.2449	0.60018	0.3942:0.0:0.6058:0.0	.	94;94	Q8N3A8-2;Q8N3A8	.;PARP8_HUMAN	S	94;94;94;94;94;73	.	.	R	+	3	2	PARP8	50091890	0.997000	0.39634	0.965000	0.40720	0.982000	0.71751	0.282000	0.18829	-0.703000	0.05049	0.482000	0.46254	AGA		0.249	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214035.3	NM_024615		7	5	0	0	0	0.001984	0	7	5				
FOXD1	2297	broad.mit.edu	37	5	72743820	72743820	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:72743820A>T	ENST00000499003.3	-	1	532	c.368T>A	c.(367-369)cTg>cAg	p.L123Q	RP11-79P5.2_ENST00000514661.1_lincRNA|FOXD1_ENST00000513595.1_5'Flank	NM_004472.2	NP_004463.1	Q16676	FOXD1_HUMAN	forkhead box D1	123					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in ureteric bud branching (GO:0060678)|metanephric capsule development (GO:0072213)|metanephric capsule specification (GO:0072267)|metanephric nephron development (GO:0072210)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme development (GO:0072076)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of gene expression (GO:0010628)|positive regulation of kidney development (GO:0090184)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L123Q(2)		endometrium(1)|kidney(1)|lung(2)	4		Lung NSC(167;0.00327)|Ovarian(174;0.0175)|Prostate(461;0.151)		OV - Ovarian serous cystadenocarcinoma(47;1.07e-54)		CGGCTTCACCAGCGGGTTCTT	0.736																																							uc003kcp.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(367-369)CTG>CAG		forkhead box D1							15.0	20.0	18.0					5																	72743820		2183	4292	6475	SO:0001583	missense	2297				axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|metanephric capsule specification|negative regulation of transcription, DNA-dependent|neural crest cell migration|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr5:72743820A>T	U59831	CCDS75259.1	5q13.2	2014-06-04			ENSG00000251493	ENSG00000251493		"""Forkhead boxes"""	3802	protein-coding gene	gene with protein product		601091		FKHL8		7957066, 8825632	Standard	NM_004472		Approved	FREAC4	uc003kcp.3	Q16676	OTTHUMG00000162495	ENST00000499003.3:c.368T>A	5.37:g.72743820A>T	ENSP00000462795:p.Leu123Gln		Somatic					p.L123Q	NM_004472	NP_004463	WXS	Illumina HiSeq	Unspecified	Q16676	FOXD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.07e-54)	1	533	-		Lung NSC(167;0.00327)|Ovarian(174;0.0175)|Prostate(461;0.151)	123					Q12949	Missense_Mutation	SNP	ENST00000499003.3	37	c.368T>A																																																																																					0.736	FOXD1-001	KNOWN	sequence_error|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000369154.2	NM_004472		5	10	0	0	0	0.014758	0	5	10				
RASGRF2	5924	broad.mit.edu	37	5	80388641	80388641	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:80388641C>T	ENST00000265080.4	+	10	1479	c.1412C>T	c.(1411-1413)tCc>tTc	p.S471F		NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	471	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S471F(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		CAAGTACCTTCCGTTGAGAGG	0.373																																							uc003kha.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12						c.(1411-1413)TCC>TTC		Ras protein-specific guanine							105.0	105.0	105.0					5																	80388641		2203	4300	6503	SO:0001583	missense	5924				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr5:80388641C>T	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.1412C>T	5.37:g.80388641C>T	ENSP00000265080:p.Ser471Phe		Somatic				RASGRF2_uc011ctn.1_RNA	p.S471F	NM_006909	NP_008840	WXS	Illumina HiSeq	Unspecified	O14827	RGRF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)	10	1412	+		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)	471			PH 2.		B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	c.1412C>T	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.606326	0.28623	.	.	ENSG00000113319	ENST00000265080	T	0.75589	-0.95	5.17	5.17	0.71159	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.75539	0.3863	L	0.47716	1.5	0.58432	D	0.999999	P	0.52842	0.956	P	0.48030	0.564	T	0.78089	-0.2340	10	0.56958	D	0.05	.	19.017	0.92899	0.0:1.0:0.0:0.0	.	471	O14827	RGRF2_HUMAN	F	471	ENSP00000265080:S471F	ENSP00000265080:S471F	S	+	2	0	RASGRF2	80424397	1.000000	0.71417	0.815000	0.32552	0.350000	0.29205	5.981000	0.70524	2.579000	0.87056	0.650000	0.86243	TCC		0.373	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		41	69	0	0	0	0.007835	0	41	69				
XRCC4	7518	broad.mit.edu	37	5	82491599	82491599	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:82491599G>T	ENST00000511817.1	+	4	406	c.326G>T	c.(325-327)gGt>gTt	p.G109V	XRCC4_ENST00000338635.6_Missense_Mutation_p.G109V|XRCC4_ENST00000282268.3_Missense_Mutation_p.G109V|XRCC4_ENST00000396027.4_Missense_Mutation_p.G109V|XRCC4_ENST00000509268.1_3'UTR			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	109					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)	p.G109V(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		TTCAGACTTGGTTCCTTCAAC	0.343								Non-homologous end-joining																															uc003kib.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(325-327)GGT>GTT	NHEJ	X-ray repair cross complementing protein 4							62.0	60.0	61.0					5																	82491599		2202	4300	6502	SO:0001583	missense	7518				DNA ligation involved in DNA repair|double-strand break repair via nonhomologous end joining|initiation of viral infection|positive regulation of ligase activity|provirus integration|response to X-ray	cytosol|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|nucleoplasm	DNA binding|protein C-terminus binding	g.chr5:82491599G>T	AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.326G>T	5.37:g.82491599G>T	ENSP00000421491:p.Gly109Val		Somatic				XRCC4_uc003kia.1_Missense_Mutation_p.G109V|XRCC4_uc003kid.2_Missense_Mutation_p.G109V|XRCC4_uc003kic.2_Missense_Mutation_p.G109V|XRCC4_uc003kie.2_Missense_Mutation_p.G109V|XRCC4_uc003kif.1_Missense_Mutation_p.G109V	p.G109V	NM_022406	NP_071801	WXS	Illumina HiSeq	Unspecified	Q13426	XRCC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)	4	454	+		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)	109					A8K3X4|Q9BS72|Q9UP94	Missense_Mutation	SNP	ENST00000511817.1	37	c.326G>T	CCDS4059.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.498028	0.64186	.	.	ENSG00000152422	ENST00000282268;ENST00000338635;ENST00000396027;ENST00000511817	T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0	5.45	4.57	0.56435	DNA double-strand break repair and VJ recombination XRCC4, N-terminal (2);	0.108239	0.64402	N	0.000006	T	0.79381	0.4436	M	0.78637	2.42	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.82798	-0.0279	10	0.87932	D	0	-0.6545	15.5339	0.75986	0.0:0.0:0.8604:0.1396	.	109;109;109	Q13426-2;Q13426;Q13426-3	.;XRCC4_HUMAN;.	V	109	ENSP00000282268:G109V;ENSP00000342011:G109V;ENSP00000379344:G109V;ENSP00000421491:G109V	ENSP00000282268:G109V	G	+	2	0	XRCC4	82527355	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.564000	0.53791	1.412000	0.46977	-0.188000	0.12872	GGT		0.343	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369624.1	NM_022550		21	28	1	0	1.55795e-14	0.012319	2.09897e-14	21	28				
HAPLN1	1404	broad.mit.edu	37	5	82937473	82937474	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:82937473_82937474GG>TT	ENST00000274341.4	-	5	1756_1757	c.906_907CC>AA	c.(904-909)gaCCgc>gaAAgc	p.302_303DR>ES		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	302	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.D302_R303>ES(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	GCATCACAGCGGTCATATCCGA	0.554																																							uc003kim.2		NA																	1	Complex - compound substitution(1)		lung(1)	large_intestine(3)|ovary(1)|skin(1)	5						c.(904-909)GACCGC>GAAAGC		hyaluronan and proteoglycan link protein 1																																				SO:0001583	missense	1404				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding	g.chr5:82937473_82937474GG>TT		CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.906_907delinsTT	5.37:g.82937473_82937474delinsTT	ENSP00000274341:p.D302_R303delinsES		Somatic				HAPLN1_uc003kin.2_Missense_Mutation_p.302_303DR>ES	p.302_303DR>ES	NM_001884	NP_001875	WXS	Illumina HiSeq	Unspecified	P10915	HPLN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	4	977_978	-		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)	302_303			Link 2.		B2R9A9	Missense_Mutation	DNP	ENST00000274341.4	37	c.906_907CC>AA	CCDS4061.1																																																																																				0.554	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884		53	80	0	0	0	0.004672	0	53	80				
CATSPER3	347732	broad.mit.edu	37	5	134346177	134346177	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:134346177A>T	ENST00000282611.6	+	7	1137	c.1051A>T	c.(1051-1053)Atc>Ttc	p.I351F		NM_178019.2	NP_821138.1	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3	351					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|endoplasmic reticulum (GO:0005783)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.I351F(1)		NS(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTTCATCGATATCTACTTTTC	0.512																																							uc003lag.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1051-1053)ATC>TTC		cation channel, sperm associated 3							139.0	130.0	133.0					5																	134346177		2203	4300	6503	SO:0001583	missense	347732				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity	g.chr5:134346177A>T	AF432876	CCDS4181.1	5q31.2	2011-07-05			ENSG00000152705	ENSG00000152705		"""Voltage-gated ion channels / Cation channels, sperm associated"""	20819	protein-coding gene	gene with protein product		609120				12646162, 12932298, 17227845, 16382101	Standard	NM_178019		Approved	CACRC	uc003lag.3	Q86XQ3	OTTHUMG00000129137	ENST00000282611.6:c.1051A>T	5.37:g.134346177A>T	ENSP00000282611:p.Ile351Phe		Somatic					p.I351F	NM_178019	NP_821138	WXS	Illumina HiSeq	Unspecified	Q86XQ3	CTSR3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		7	1119	+			351					Q86XS6	Missense_Mutation	SNP	ENST00000282611.6	37	c.1051A>T	CCDS4181.1	.	.	.	.	.	.	.	.	.	.	A	10.19	1.282544	0.23392	.	.	ENSG00000152705	ENST00000282611	D	0.97209	-4.29	4.68	-6.28	0.02020	.	1.169940	0.06244	N	0.690878	D	0.94594	0.8258	L	0.46157	1.445	0.23425	N	0.9977	P	0.40476	0.718	B	0.41860	0.368	D	0.90732	0.4643	10	0.72032	D	0.01	-7.3243	11.0396	0.47823	0.7257:0.1045:0.1698:0.0	.	351	Q86XQ3	CTSR3_HUMAN	F	351	ENSP00000282611:I351F	ENSP00000282611:I351F	I	+	1	0	CATSPER3	134374076	0.006000	0.16342	0.002000	0.10522	0.038000	0.13279	-0.594000	0.05733	-1.327000	0.02264	-0.408000	0.06270	ATC		0.512	CATSPER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251191.2	NM_178019		14	37	0	0	0	0.003163	0	14	37				
KIF20A	10112	broad.mit.edu	37	5	137515415	137515415	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:137515415G>T	ENST00000394894.3	+	2	272	c.46G>T	c.(46-48)Gac>Tac	p.D16Y	BRD8_ENST00000230901.5_5'Flank|BRD8_ENST00000254900.5_5'Flank|KIF20A_ENST00000508792.1_Missense_Mutation_p.D16Y|BRD8_ENST00000411594.2_5'Flank|BRD8_ENST00000455658.2_5'Flank|BRD8_ENST00000402931.1_5'Flank	NM_005733.2	NP_005724.1	O95235	KI20A_HUMAN	kinesin family member 20A	16					ATP catabolic process (GO:0006200)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule bundle formation (GO:0001578)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)	p.D16Y(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|liver(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(1)	27			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GCTGTCCGATGACGATGTCGT	0.542																																							uc003lcj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(46-48)GAC>TAC		kinesin family member 20A							123.0	111.0	115.0					5																	137515415		2203	4300	6503	SO:0001583	missense	10112				cytokinesis|M phase of mitotic cell cycle|microtubule-based movement|protein transport|vesicle-mediated transport	Golgi apparatus|microtubule|nucleoplasm	ATP binding|microtubule motor activity|protein binding|transporter activity	g.chr5:137515415G>T	AF070672	CCDS4199.1	5q31	2008-02-05	2003-01-13	2003-01-17	ENSG00000112984	ENSG00000112984		"""Kinesins"""	9787	protein-coding gene	gene with protein product		605664	"""RAB6 interacting, kinesin-like (rabkinesin6)"""	RAB6KIFL		11416179, 10806357	Standard	NM_005733		Approved		uc003lcj.3	O95235	OTTHUMG00000129195	ENST00000394894.3:c.46G>T	5.37:g.137515415G>T	ENSP00000378356:p.Asp16Tyr		Somatic				BRD8_uc003lcc.1_5'Flank|BRD8_uc003lcf.1_5'Flank|BRD8_uc003lcg.2_5'Flank|BRD8_uc003lci.2_5'Flank|BRD8_uc003lch.2_5'Flank|BRD8_uc011cym.1_5'Flank|BRD8_uc010jer.1_5'Flank|BRD8_uc011cyn.1_5'Flank|BRD8_uc010jes.1_5'Flank|KIF20A_uc011cyo.1_Missense_Mutation_p.D16Y	p.D16Y	NM_005733	NP_005724	WXS	Illumina HiSeq	Unspecified	O95235	KI20A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		2	542	+			16					B4DL79|D3DQB6	Missense_Mutation	SNP	ENST00000394894.3	37	c.46G>T	CCDS4199.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348517	0.82132	.	.	ENSG00000112984	ENST00000513276;ENST00000394894;ENST00000508792;ENST00000504621	T;T;T;T	0.72615	0.76;-0.58;-0.67;-0.19	5.43	5.43	0.79202	.	0.173312	0.27375	N	0.019660	T	0.63698	0.2533	N	0.19112	0.55	0.46631	D	0.999136	P;P	0.52061	0.95;0.95	P;P	0.44696	0.458;0.458	T	0.70494	-0.4856	10	0.87932	D	0	-8.2533	19.2282	0.93825	0.0:0.0:1.0:0.0	.	16;16	B4DL79;O95235	.;KI20A_HUMAN	Y	16	ENSP00000422928:D16Y;ENSP00000378356:D16Y;ENSP00000420880:D16Y;ENSP00000424056:D16Y	ENSP00000378356:D16Y	D	+	1	0	KIF20A	137543314	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	7.197000	0.77814	2.547000	0.85894	0.561000	0.74099	GAC		0.542	KIF20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251272.1	NM_005733		5	58	1	0	1.024e-07	0.014758	1.18852e-07	5	58				
CXXC5	51523	broad.mit.edu	37	5	139060145	139060146	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:139060145_139060146GG>TT	ENST00000302517.3	+	2	751_752	c.37_38GG>TT	c.(37-39)GGc>TTc	p.G13F	CXXC5_ENST00000511048.1_Missense_Mutation_p.G13F	NM_016463.7	NP_057547.5	Q7LFL8	CXXC5_HUMAN	CXXC finger protein 5	13					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.G13F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGATGCCGgcggcagtagcagc	0.688																																							uc010jfg.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(37-39)GGC>TTC		CXXC finger 5																																				SO:0001583	missense	51523				positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|nucleus	DNA binding|signal transducer activity|zinc ion binding	g.chr5:139060145_139060146GG>TT	AK024338	CCDS43370.1	5q31.3	2014-02-18	2011-12-01						26943	protein-coding gene	gene with protein product	"""retinoid-inducible nuclear factor"", ""WT1-induced Inhibitor of Dishevelled"""	612752				11042152, 19001364, 19182210, 20220130	Standard	NM_016463		Approved	HSPC195, RINF, WID	uc010jfg.1	Q7LFL8		Exception_encountered	5.37:g.139060145_139060146delinsTT	ENSP00000302543:p.Gly13Phe		Somatic				CXXC5_uc003let.2_Missense_Mutation_p.G13F	p.G13F	NM_016463	NP_057547	WXS	Illumina HiSeq	Unspecified	Q7LFL8	CXXC5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		2	327_328	+			13					B3KND0|C8CBA8|Q8TB79|Q9NV51|Q9P0S8	Missense_Mutation	DNP	ENST00000302517.3	37	c.37_38GG>TT	CCDS43370.1																																																																																				0.688	CXXC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372744.1	NM_016463		4	3	0	0	0	0.004672	0	4	3				
PCDHA12	56137	broad.mit.edu	37	5	140256399	140256399	+	Missense_Mutation	SNP	G	G	A	rs571648883		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:140256399G>A	ENST00000398631.2	+	1	1342	c.1342G>A	c.(1342-1344)Gtg>Atg	p.V448M	PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000506939.2_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	448	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V448M(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGGCCGACGTGAACGACAA	0.657																																					Pancreas(113;759 1672 13322 24104 50104)	Pancreas(113;759 1672 13322 24104 50104)	uc003lic.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1342-1344)GTG>ATG		protocadherin alpha 12 isoform 1 precursor							117.0	119.0	119.0					5																	140256399		2203	4300	6503	SO:0001583	missense	56137				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140256399G>A	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1342G>A	5.37:g.140256399G>A	ENSP00000381628:p.Val448Met		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Missense_Mutation_p.V448M	p.V448M	NM_018903	NP_061726	WXS	Illumina HiSeq	Unspecified	Q9UN75	PCDAC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1469	+			448			Cadherin 4.|Extracellular (Potential).		O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	c.1342G>A	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135468	0.77662	.	.	ENSG00000251664	ENST00000398631	T	0.02050	4.48	4.92	4.92	0.64577	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.17746	0.0426	M	0.92026	3.265	0.42943	D	0.99435	D;D	0.89917	1.0;1.0	D;D	0.69142	0.962;0.953	T	0.04090	-1.0978	9	0.72032	D	0.01	.	18.5395	0.91022	0.0:0.0:1.0:0.0	.	448;448	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	M	448	ENSP00000381628:V448M	ENSP00000381628:V448M	V	+	1	0	PCDHA12	140236583	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	3.193000	0.50997	2.452000	0.82932	0.650000	0.86243	GTG		0.657	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903		19	78	0	0	0	0.008871	0	19	78				
PCDHB2	56133	broad.mit.edu	37	5	140475631	140475631	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:140475631C>A	ENST00000194155.4	+	1	1405	c.1257C>A	c.(1255-1257)taC>taA	p.Y419*		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	419	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.Y419*(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GATCCGAATACAACATCACCA	0.522																																							uc003lil.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(1255-1257)TAC>TAA		protocadherin beta 2 precursor							139.0	128.0	132.0					5																	140475631		2203	4300	6503	SO:0001587	stop_gained	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140475631C>A	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1257C>A	5.37:g.140475631C>A	ENSP00000194155:p.Tyr419*		Somatic				PCDHB2_uc003lim.1_Nonsense_Mutation_p.Y80*	p.Y419*	NM_018936	NP_061759	WXS	Illumina HiSeq	Unspecified	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1395	+			419			Extracellular (Potential).|Cadherin 4.		Q4KMU1	Nonsense_Mutation	SNP	ENST00000194155.4	37	c.1257C>A	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.403708	0.42613	.	.	ENSG00000112852	ENST00000194155	.	.	.	5.11	0.349	0.16032	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3373	0.43858	0.0:0.5228:0.0:0.4772	.	.	.	.	X	419	.	ENSP00000194155:Y419X	Y	+	3	2	PCDHB2	140455815	0.000000	0.05858	0.881000	0.34555	0.025000	0.11179	-1.529000	0.02223	-0.089000	0.12484	-0.355000	0.07637	TAC		0.522	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		25	38	1	0	4.26978e-12	0.01892	5.47106e-12	25	38				
PCDHB3	56132	broad.mit.edu	37	5	140480379	140480379	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:140480379C>T	ENST00000231130.2	+	1	146	c.146C>T	c.(145-147)gCa>gTa	p.A49V	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	49	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A49V(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCAACCTAGCAAAGGATCTG	0.507																																							uc003lio.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(145-147)GCA>GTA		protocadherin beta 3 precursor							55.0	65.0	62.0					5																	140480379		2203	4300	6503	SO:0001583	missense	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140480379C>T	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.146C>T	5.37:g.140480379C>T	ENSP00000231130:p.Ala49Val		Somatic				uc003lin.2_Intron	p.A49V	NM_018937	NP_061760	WXS	Illumina HiSeq	Unspecified	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	146	+			49			Extracellular (Potential).|Cadherin 1.		B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	c.146C>T	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655502	0.67586	.	.	ENSG00000113205	ENST00000231130	T	0.53423	0.62	4.89	4.0	0.46444	Cadherin, N-terminal (1);Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.55593	0.1930	M	0.74546	2.27	0.45607	D	0.998549	P	0.36027	0.533	B	0.43018	0.405	T	0.59123	-0.7513	9	0.48119	T	0.1	.	14.3339	0.66576	0.1498:0.8502:0.0:0.0	.	49	Q9Y5E6	PCDB3_HUMAN	V	49	ENSP00000231130:A49V	ENSP00000231130:A49V	A	+	2	0	PCDHB3	140460563	0.877000	0.30153	0.978000	0.43139	0.983000	0.72400	1.842000	0.39250	1.140000	0.42260	0.655000	0.94253	GCA		0.507	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		25	23	0	0	0	0.01892	0	25	23				
PCDHB8	56128	broad.mit.edu	37	5	140559000	140559000	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:140559000G>C	ENST00000239444.2	+	1	1630	c.1385G>C	c.(1384-1386)cGc>cCc	p.R462P	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	462	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R462P(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTTCGTCCGCGAGAACAAC	0.627																																							uc011dai.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)	4						c.(1384-1386)CGC>CCC		protocadherin beta 8 precursor							101.0	145.0	130.0					5																	140559000		2203	4297	6500	SO:0001583	missense	56128				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140559000G>C	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1385G>C	5.37:g.140559000G>C	ENSP00000239444:p.Arg462Pro		Somatic				PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	p.R462P	NM_019120	NP_061993	WXS	Illumina HiSeq	Unspecified	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1571	+			462			Cadherin 5.|Extracellular (Potential).		B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	c.1385G>C	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	G	6.196	0.404386	0.11754	.	.	ENSG00000120322	ENST00000239444	T	0.01745	4.66	4.26	-0.0626	0.13780	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.00875	0.0029	N	0.03115	-0.41	0.09310	N	1	B	0.20780	0.048	B	0.28232	0.087	T	0.49570	-0.8926	9	0.18710	T	0.47	.	1.8958	0.03257	0.2297:0.25:0.3933:0.127	.	462	Q9UN66	PCDB8_HUMAN	P	462	ENSP00000239444:R462P	ENSP00000239444:R462P	R	+	2	0	PCDHB8	140539184	0.000000	0.05858	0.705000	0.30386	0.561000	0.35649	-4.039000	0.00308	0.246000	0.21394	0.305000	0.20034	CGC		0.627	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120		41	204	0	0	0	0.01441	0	41	204				
PCDHGA5	56110	broad.mit.edu	37	5	140744879	140744879	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:140744879G>T	ENST00000518069.1	+	1	982	c.982G>T	c.(982-984)Gtt>Ttt	p.V328F	PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	328	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V328F(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCGCTCTTGTTGCCAGCGC	0.502																																							uc003lju.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(982-984)GTT>TTT		protocadherin gamma subfamily A, 5 isoform 1							73.0	75.0	75.0					5																	140744879		2068	4222	6290	SO:0001583	missense	56110				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140744879G>T	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.982G>T	5.37:g.140744879G>T	ENSP00000429834:p.Val328Phe		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Missense_Mutation_p.V328F	p.V328F	NM_018918	NP_061741	WXS	Illumina HiSeq	Unspecified	Q9Y5G8	PCDG5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	982	+			328			Cadherin 3.|Extracellular (Potential).		Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	c.982G>T	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	2.168	-0.390579	0.04932	.	.	ENSG00000253485	ENST00000518069	T	0.01838	4.61	5.52	4.66	0.58398	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.02047	0.0064	N	0.20328	0.56	0.22412	N	0.999122	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.46693	-0.9173	9	0.26408	T	0.33	.	10.7392	0.46143	0.1364:0.5952:0.2684:0.0	.	328;328	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	F	328	ENSP00000429834:V328F	ENSP00000429834:V328F	V	+	1	0	PCDHGA5	140725063	0.000000	0.05858	1.000000	0.80357	0.979000	0.70002	0.015000	0.13355	1.476000	0.48215	-0.232000	0.12228	GTT		0.502	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918		18	30	1	0	2.94398e-08	0.007413	3.45526e-08	18	30				
LARS	51520	broad.mit.edu	37	5	145523006	145523006	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:145523006G>A	ENST00000394434.2	-	19	2012	c.1846C>T	c.(1846-1848)Cat>Tat	p.H616Y	LARS_ENST00000510191.1_Missense_Mutation_p.H562Y|LARS_ENST00000274562.9_Missense_Mutation_p.H589Y|LARS_ENST00000545646.1_Missense_Mutation_p.H570Y	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	616					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)	p.H616Y(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	GCCTGTCCATGCAAGTTACCC	0.433																																							uc003lnx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1846-1848)CAT>TAT		leucyl-tRNA synthetase	L-Leucine(DB00149)						197.0	194.0	195.0					5																	145523006		2203	4300	6503	SO:0001583	missense	51520				leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding	g.chr5:145523006G>A	AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.1846C>T	5.37:g.145523006G>A	ENSP00000377954:p.His616Tyr		Somatic				LARS_uc011dbq.1_Missense_Mutation_p.H570Y|LARS_uc011dbr.1_Missense_Mutation_p.H562Y|LARS_uc011dbs.1_Missense_Mutation_p.H589Y	p.H616Y	NM_020117	NP_064502	WXS	Illumina HiSeq	Unspecified	Q9P2J5	SYLC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		19	2084	-			616					A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	Missense_Mutation	SNP	ENST00000394434.2	37	c.1846C>T	CCDS34265.1	.	.	.	.	.	.	.	.	.	.	G	1.002	-0.690491	0.03303	.	.	ENSG00000133706	ENST00000394434;ENST00000545646;ENST00000510191;ENST00000274562	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.64	1.54	0.23209	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.662303	0.17173	N	0.184216	T	0.07908	0.0198	N	0.00191	-1.88	0.09310	N	0.999993	B;B;B	0.19583	0.0;0.037;0.01	B;B;B	0.25140	0.0;0.058;0.028	T	0.40515	-0.9559	10	0.02654	T	1	-8.2428	10.7114	0.45986	0.0674:0.0:0.4989:0.4337	.	589;570;616	B4DER1;F5H698;Q9P2J5	.;.;SYLC_HUMAN	Y	616;570;562;589	ENSP00000377954:H616Y;ENSP00000437791:H570Y;ENSP00000426005:H562Y;ENSP00000274562:H589Y	ENSP00000274562:H589Y	H	-	1	0	LARS	145503199	0.909000	0.30893	0.662000	0.29724	0.774000	0.43823	1.705000	0.37867	0.388000	0.25054	-0.142000	0.14014	CAT		0.433	LARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000373367.1	NM_020117		72	123	0	0	0	0.01441	0	72	123				
GEMIN5	25929	broad.mit.edu	37	5	154270801	154270801	+	Splice_Site	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:154270801C>A	ENST00000285873.7	-	26	4337	c.4262G>T	c.(4261-4263)tGt>tTt	p.C1421F		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	1421					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)	p.C1421F(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGTACTTACCACTGGCTCTG	0.483																																							uc003lvx.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(4261-4263)TGT>TTT		gemin 5							133.0	129.0	130.0					5																	154270801		2203	4300	6503	SO:0001630	splice_region_variant	25929				ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding	g.chr5:154270801C>A	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.4262+1G>T	5.37:g.154270801C>A			Somatic				GEMIN5_uc011ddk.1_Missense_Mutation_p.C1420F	p.C1421F	NM_015465	NP_056280	WXS	Illumina HiSeq	Unspecified	Q8TEQ6	GEMI5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		26	4345	-	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	1421					Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	37	c.4262G>T	CCDS4330.1	.	.	.	.	.	.	.	.	.	.	C	0.123	-1.122718	0.01785	.	.	ENSG00000082516	ENST00000285873	T	0.70869	-0.52	5.5	1.6	0.23607	.	1.876250	0.01645	N	0.024287	T	0.54498	0.1862	N	0.22421	0.69	0.19300	N	0.999973	B;B	0.24533	0.105;0.105	B;B	0.22601	0.04;0.04	T	0.33828	-0.9853	9	.	.	.	2.6483	1.9785	0.03421	0.2704:0.4357:0.1398:0.1541	.	1420;1421	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	F	1421	ENSP00000285873:C1421F	.	C	-	2	0	GEMIN5	154250994	0.613000	0.27009	0.378000	0.26068	0.252000	0.25951	0.870000	0.28010	0.342000	0.23796	0.655000	0.94253	TGT		0.483	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		Missense_Mutation	44	60	1	0	6.07928e-31	0.009718	9.61214e-31	44	60				
HK3	3101	broad.mit.edu	37	5	176314548	176314549	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:176314548_176314549CC>AA	ENST00000292432.5	-	11	1594_1595	c.1503_1504GG>TT	c.(1501-1506)caGGca>caTTca	p.501_502QA>HS		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	501	Catalytic.|Hexokinase type-1 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)	p.Q501_A502>HS(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCATCTGTGCCTGAACCGCAG	0.673																																							uc003mfa.2		NA																	2	Complex - compound substitution(2)		lung(2)	ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7						c.(1501-1506)CAGGCA>CATTCA		hexokinase 3																																				SO:0001583	missense	3101				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity	g.chr5:176314548_176314549CC>AA		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.1503_1504delinsAA	5.37:g.176314548_176314549delinsAA	ENSP00000292432:p.Q501_A502delinsHS		Somatic				HK3_uc003mez.2_Missense_Mutation_p.57_58QA>HS	p.501_502QA>HS	NM_002115	NP_002106	WXS	Illumina HiSeq	Unspecified	P52790	HXK3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		11	1595_1596	-	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	501_502			Catalytic.		Q8N1E7	Missense_Mutation	DNP	ENST00000292432.5	37	c.1503_1504GG>TT	CCDS4407.1																																																																																				0.673	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1			20	28	0	0	0	0.004672	0	20	28				
FLT4	2324	broad.mit.edu	37	5	180047710	180047710	+	Nonsense_Mutation	SNP	C	C	A	rs144822344		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:180047710C>A	ENST00000261937.6	-	16	2383	c.2305G>T	c.(2305-2307)Gag>Tag	p.E769*	FLT4_ENST00000424276.2_5'Flank|FLT4_ENST00000393347.3_Nonsense_Mutation_p.E769*|FLT4_ENST00000502649.1_Nonsense_Mutation_p.E769*	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	769					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.E769*(2)|p.E579*(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCCTTATCCTCGGAGCCTGCG	0.597																																					Colon(97;1075 1466 27033 27547 35871)	Colon(97;1075 1466 27033 27547 35871)	uc003mma.3		NA																	3	Substitution - Nonsense(3)		lung(3)	lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15						c.(2305-2307)GAG>TAG		fms-related tyrosine kinase 4 isoform 2	Sorafenib(DB00398)|Sunitinib(DB01268)						99.0	102.0	101.0					5																	180047710		2200	4300	6500	SO:0001587	stop_gained	2324	Congenital_Hereditary_Lymphedema			positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity	g.chr5:180047710C>A	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2305G>T	5.37:g.180047710C>A	ENSP00000261937:p.Glu769*		Somatic				FLT4_uc003mlz.3_Nonsense_Mutation_p.E769*|FLT4_uc003mmb.1_Nonsense_Mutation_p.E302*	p.E769*	NM_002020	NP_002011	WXS	Illumina HiSeq	Unspecified	P35916	VGFR3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	16	2384	-	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	769			Extracellular (Potential).		A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Nonsense_Mutation	SNP	ENST00000261937.6	37	c.2305G>T	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.731098	0.89390	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	.	.	.	4.27	4.27	0.50696	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	17.2678	0.87092	0.0:1.0:0.0:0.0	.	.	.	.	X	769;769;769;579	.	ENSP00000261937:E769X	E	-	1	0	FLT4	179980316	1.000000	0.71417	0.082000	0.20525	0.002000	0.02628	4.262000	0.58847	2.392000	0.81423	0.455000	0.32223	GAG		0.597	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4			18	10	1	0	3.32936e-07	0.006122	3.77027e-07	18	10				
OR2V2	285659	broad.mit.edu	37	5	180581967	180581967	+	Missense_Mutation	SNP	T	T	A	rs201962305		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr5:180581967T>A	ENST00000328275.1	+	1	25	c.25T>A	c.(25-27)Tac>Aac	p.Y9N		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y9N(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAACCAGTCCTACACAGATGG	0.507																																							uc011dhj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(25-27)TAC>AAC		olfactory receptor, family 2, subfamily V,							231.0	185.0	201.0					5																	180581967		2203	4300	6503	SO:0001583	missense	285659				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr5:180581967T>A	AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.25T>A	5.37:g.180581967T>A	ENSP00000332185:p.Tyr9Asn		Somatic					p.Y9N	NM_206880	NP_996763	WXS	Illumina HiSeq	Unspecified	Q96R30	OR2V2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		1	25	+	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	9			Extracellular (Potential).		Q6IFL6|Q8NGV1	Missense_Mutation	SNP	ENST00000328275.1	37	c.25T>A	CCDS4461.1	.	.	.	.	.	.	.	.	.	.	.	0.024	-1.389038	0.01185	.	.	ENSG00000182613	ENST00000328275	T	0.00565	6.56	3.38	3.38	0.38709	.	0.532223	0.14257	N	0.331063	T	0.00271	0.0008	N	0.02685	-0.53	0.09310	N	1	B	0.18610	0.029	B	0.14023	0.01	T	0.42899	-0.9424	10	0.27785	T	0.31	.	5.3273	0.15913	0.0:0.1321:0.0:0.8679	.	9	Q96R30	OR2V2_HUMAN	N	9	ENSP00000332185:Y9N	ENSP00000332185:Y9N	Y	+	1	0	OR2V2	180514573	0.001000	0.12720	0.027000	0.17364	0.004000	0.04260	0.840000	0.27600	1.534000	0.49203	0.254000	0.18369	TAC		0.507	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253529.1			46	58	0	0	0	0.01441	0	46	58				
GPLD1	2822	broad.mit.edu	37	6	24447133	24447133	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:24447133G>A	ENST00000230036.1	-	18	1863	c.1753C>T	c.(1753-1755)Cac>Tac	p.H585Y		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	585					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)	p.H585Y(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						GTGACACCGTGAAGGGAATAT	0.522																																							uc003ned.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)	3						c.(1753-1755)CAC>TAC		glycosylphosphatidylinositol specific							119.0	103.0	108.0					6																	24447133		2203	4300	6503	SO:0001583	missense	2822					extracellular region	glycosylphosphatidylinositol phospholipase D activity	g.chr6:24447133G>A	L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.1753C>T	6.37:g.24447133G>A	ENSP00000230036:p.His585Tyr		Somatic					p.H585Y	NM_001503	NP_001494	WXS	Illumina HiSeq	Unspecified	P80108	PHLD_HUMAN			18	1864	-			585			FG-GAP 4.		Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	ENST00000230036.1	37	c.1753C>T	CCDS4553.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072622	0.36566	.	.	ENSG00000112293	ENST00000230036	T	0.71222	-0.55	5.42	5.42	0.78866	.	0.176180	0.41712	D	0.000840	T	0.63616	0.2526	M	0.77820	2.39	0.80722	D	1	P	0.46064	0.872	P	0.45474	0.482	T	0.64499	-0.6393	10	0.13853	T	0.58	-29.4295	14.5571	0.68109	0.0:0.0:0.8531:0.1469	.	585	P80108	PHLD_HUMAN	Y	585	ENSP00000230036:H585Y	ENSP00000230036:H585Y	H	-	1	0	GPLD1	24555112	0.060000	0.20803	0.098000	0.21074	0.299000	0.27559	1.939000	0.40213	2.536000	0.85505	0.655000	0.94253	CAC		0.522	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043315.1	NM_001503		31	32	0	0	0	0.010818	0	31	32				
ALDH5A1	7915	broad.mit.edu	37	6	24533937	24533937	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:24533937G>T	ENST00000357578.3	+	10	1750	c.1605G>T	c.(1603-1605)ttG>ttT	p.L535F	ALDH5A1_ENST00000546278.1_Missense_Mutation_p.L447F|ALDH5A1_ENST00000348925.2_Missense_Mutation_p.L548F|ALDH5A1_ENST00000491546.1_Missense_Mutation_p.L507F	NM_001080.3	NP_001071.1	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5 family, member A1	535					acetate metabolic process (GO:0006083)|central nervous system development (GO:0007417)|galactosylceramide metabolic process (GO:0006681)|gamma-aminobutyric acid catabolic process (GO:0009450)|glucose metabolic process (GO:0006006)|glucosylceramide metabolic process (GO:0006678)|glutamate metabolic process (GO:0006536)|glutamine metabolic process (GO:0006541)|glutathione metabolic process (GO:0006749)|glycerophospholipid metabolic process (GO:0006650)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|respiratory electron transport chain (GO:0022904)|short-chain fatty acid metabolic process (GO:0046459)|succinate metabolic process (GO:0006105)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	protein homodimerization activity (GO:0042803)|succinate-semialdehyde dehydrogenase (NAD+) activity (GO:0004777)|succinate-semialdehyde dehydrogenase [NAD(P)+] activity (GO:0009013)	p.L548F(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|skin(2)|urinary_tract(1)	20					Chlormerodrin(DB00534)|Succinic acid(DB00139)|Valproic Acid(DB00313)	ACGGGGGCTTGTAGGATTCTT	0.398																																							uc003neg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1603-1605)TTG>TTT		aldehyde dehydrogenase 5A1 isoform 2 precursor	Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)						84.0	85.0	84.0					6																	24533937		2203	4300	6503	SO:0001583	missense	7915				acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity	g.chr6:24533937G>T	L34820	CCDS4555.1, CCDS4556.1	6p22	2013-06-03	2008-07-31		ENSG00000112294	ENSG00000112294	1.2.1.24	"""Aldehyde dehydrogenases"""	408	protein-coding gene	gene with protein product	"""succinate-semialdehyde dehydrogenase"""	610045				7814412, 9059628	Standard	NM_001080		Approved	SSADH, SSDH	uc003nef.3	P51649	OTTHUMG00000014356	ENST00000357578.3:c.1605G>T	6.37:g.24533937G>T	ENSP00000350191:p.Leu535Phe		Somatic				ALDH5A1_uc003nef.2_Missense_Mutation_p.L548F	p.L535F	NM_001080	NP_001071	WXS	Illumina HiSeq	Unspecified	P51649	SSDH_HUMAN			10	1633	+			535					B2RD26|G5E949|Q546H9|Q8N3W6	Missense_Mutation	SNP	ENST00000357578.3	37	c.1605G>T	CCDS4555.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100467	0.56183	.	.	ENSG00000112294	ENST00000357578;ENST00000546278;ENST00000491546;ENST00000348925	T;T;T;T	0.81415	-1.21;-1.35;-1.49;-1.2	5.32	-0.671	0.11381	.	0.360150	0.25708	N	0.028835	T	0.76695	0.4023	L	0.40543	1.245	0.54753	D	0.999986	D;D	0.76494	0.999;0.999	P;D	0.68039	0.903;0.955	T	0.77938	-0.2400	10	0.87932	D	0	-8.4013	11.7992	0.52118	0.5104:0.0:0.4896:0.0	.	535;548	P51649;G5E949	SSDH_HUMAN;.	F	535;447;507;548	ENSP00000350191:L535F;ENSP00000438193:L447F;ENSP00000417687:L507F;ENSP00000314649:L548F	ENSP00000314649:L548F	L	+	3	2	ALDH5A1	24641916	0.853000	0.29707	0.996000	0.52242	0.717000	0.41224	-0.052000	0.11865	-0.053000	0.13289	-0.345000	0.07892	TTG		0.398	ALDH5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040007.2			22	45	1	0	6.44725e-10	0.014323	7.92199e-10	22	45				
BTN1A1	696	broad.mit.edu	37	6	26509112	26509112	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:26509112G>T	ENST00000244513.6	+	7	1357	c.1291G>T	c.(1291-1293)Gga>Tga	p.G431*		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	431	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.G431*(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						CTATGAATCAGGAGACATCTC	0.522																																							uc003nif.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1291-1293)GGA>TGA		butyrophilin, subfamily 1, member A1 precursor							70.0	65.0	67.0					6																	26509112		2203	4300	6503	SO:0001587	stop_gained	696					extracellular region|integral to plasma membrane	receptor activity	g.chr6:26509112G>T	U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.1291G>T	6.37:g.26509112G>T	ENSP00000244513:p.Gly431*		Somatic					p.G431*	NM_001732	NP_001723	WXS	Illumina HiSeq	Unspecified	Q13410	BT1A1_HUMAN			7	1311	+			431			B30.2/SPRY.|Cytoplasmic (Potential).		Q4VAN3|Q4VAN4|Q9H458	Nonsense_Mutation	SNP	ENST00000244513.6	37	c.1291G>T	CCDS4614.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983678	0.74474	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	.	.	.	5.98	5.11	0.69529	.	0.105641	0.42821	D	0.000647	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	13.0264	0.58817	0.0778:0.0:0.9222:0.0	.	.	.	.	X	431	.	ENSP00000244513:G431X	G	+	1	0	BTN1A1	26617091	1.000000	0.71417	0.610000	0.28997	0.076000	0.17211	6.660000	0.74417	1.538000	0.49270	-0.140000	0.14226	GGA		0.522	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043776.1	NM_001732		18	25	1	0	9.16793e-09	0.00499	1.09753e-08	18	25				
GPX5	2880	broad.mit.edu	37	6	28501899	28501899	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:28501899C>T	ENST00000412168.2	+	5	710	c.621C>T	c.(619-621)gtC>gtT	p.V207V	GPX5_ENST00000442674.2_3'UTR	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	207					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)	p.V207V(1)		endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	TCAGCTCAGTCAAGACAGACA	0.507																																							uc003nll.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(619-621)GTC>GTT		glutathione peroxidase 5 isoform 1 precursor	Glutathione(DB00143)						79.0	77.0	77.0					6																	28501899		2203	4300	6503	SO:0001819	synonymous_variant	2880				lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity	g.chr6:28501899C>T	AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.621C>T	6.37:g.28501899C>T			Somatic				GPX5_uc003nlm.2_3'UTR|GPX5_uc003nln.2_RNA	p.V207V	NM_001509	NP_001500	WXS	Illumina HiSeq	Unspecified	O75715	GPX5_HUMAN			5	623	+			207					A1A4Y0	Silent	SNP	ENST00000412168.2	37	c.621C>T	CCDS4652.1																																																																																				0.507	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043672.2			25	16	0	0	0	0.021523	0	25	16				
OR12D2	26529	broad.mit.edu	37	6	29364862	29364862	+	Missense_Mutation	SNP	G	G	T	rs552058342		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:29364862G>T	ENST00000383555.2	+	1	447	c.386G>T	c.(385-387)cGc>cTc	p.R129L	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R129L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						AAGCCACTTCGCTACACTGTC	0.512																																							uc003nmf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(385-387)CGC>CTC		olfactory receptor, family 12, subfamily D,							117.0	115.0	116.0					6																	29364862		1510	2709	4219	SO:0001583	missense	26529				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29364862G>T		CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.386G>T	6.37:g.29364862G>T	ENSP00000373047:p.Arg129Leu		Somatic					p.R129L	NM_013936	NP_039224	WXS	Illumina HiSeq	Unspecified	P58182	O12D2_HUMAN			1	447	+			129			Cytoplasmic (Potential).		B0S862|Q5SUN9|Q6IET9	Missense_Mutation	SNP	ENST00000383555.2	37	c.386G>T	CCDS4659.1	.	.	.	.	.	.	.	.	.	.	G	6.810	0.518541	0.13005	.	.	ENSG00000168787	ENST00000383555	T	0.00411	7.53	3.94	-2.24	0.06909	GPCR, rhodopsin-like superfamily (1);	0.649919	0.14885	N	0.292751	T	0.00073	0.0002	L	0.39245	1.2	0.09310	N	0.999992	B	0.16166	0.016	B	0.18561	0.022	T	0.27365	-1.0076	10	0.08837	T	0.75	.	10.3656	0.44021	0.4854:0.0:0.5146:0.0	.	129	P58182	O12D2_HUMAN	L	129	ENSP00000373047:R129L	ENSP00000373047:R129L	R	+	2	0	OR12D2	29472841	0.000000	0.05858	0.025000	0.17156	0.154000	0.21943	-2.042000	0.01414	-0.329000	0.08527	0.205000	0.17691	CGC		0.512	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076054.2			15	35	1	0	4.3181e-19	0.013726	6.09186e-19	15	35				
GABBR1	2550	broad.mit.edu	37	6	29595311	29595311	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:29595311C>A	ENST00000377034.4	-	6	944	c.609G>T	c.(607-609)agG>agT	p.R203S	GABBR1_ENST00000377016.4_Missense_Mutation_p.R141S|GABBR1_ENST00000377012.4_Missense_Mutation_p.R86S|GABBR1_ENST00000355973.3_Missense_Mutation_p.R86S|GABBR1_ENST00000376977.3_Missense_Mutation_p.R203S	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	203					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.R203S(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	GCAGGATGTCCCTGCGGCTAT	0.677																																							uc003nmt.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|liver(1)|skin(1)	7						c.(607-609)AGG>AGT		gamma-aminobutyric acid (GABA) B receptor 1	Baclofen(DB00181)|Progabide(DB00837)						19.0	12.0	14.0					6																	29595311		2029	4012	6041	SO:0001583	missense	2550				gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity	g.chr6:29595311C>A	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.609G>T	6.37:g.29595311C>A	ENSP00000366233:p.Arg203Ser		Somatic				GABBR1_uc003nmp.3_Missense_Mutation_p.R86S|GABBR1_uc003nms.3_Missense_Mutation_p.R86S|GABBR1_uc003nmu.3_Missense_Mutation_p.R141S|GABBR1_uc011dlr.1_Missense_Mutation_p.R26S|GABBR1_uc011dls.1_Missense_Mutation_p.R203S	p.R203S	NM_001470	NP_001461	WXS	Illumina HiSeq	Unspecified	Q9UBS5	GABR1_HUMAN			6	945	-			203			Extracellular (Potential).		B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	37	c.609G>T	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	C	6.768	0.510586	0.12883	.	.	ENSG00000204681	ENST00000355973;ENST00000376977;ENST00000377016;ENST00000377012;ENST00000377034	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71	3.97	2.11	0.27256	Extracellular ligand-binding receptor (1);	0.061460	0.64402	U	0.000012	T	0.09291	0.0229	N	0.00128	-2.045	0.38707	D	0.953127	B;B;B;B	0.10296	0.001;0.002;0.0;0.003	B;B;B;B	0.12837	0.002;0.003;0.002;0.008	T	0.23868	-1.0176	10	0.08599	T	0.76	-30.9919	6.679	0.23110	0.0:0.7507:0.0:0.2493	.	203;141;203;86	Q9UBS5-5;Q9UBS5-3;Q9UBS5;Q5SUJ9	.;.;GABR1_HUMAN;.	S	86;203;141;86;203	ENSP00000348248:R86S;ENSP00000366176:R203S;ENSP00000366215:R141S;ENSP00000366211:R86S;ENSP00000366233:R203S	ENSP00000348248:R86S	R	-	3	2	GABBR1	29703290	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.450000	0.21762	0.618000	0.30179	0.455000	0.32223	AGG		0.677	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3			3	7	1	0	0.00909568	0.009096	0.00934091	3	7				
GRM4	2914	broad.mit.edu	37	6	34003675	34003675	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:34003675G>A	ENST00000538487.2	-	9	2655	c.2212C>T	c.(2212-2214)Cgc>Tgc	p.R738C	GRM4_ENST00000544773.2_Missense_Mutation_p.R569C|GRM4_ENST00000609222.1_Missense_Mutation_p.R605C|GRM4_ENST00000535756.1_Missense_Mutation_p.R605C|GRM4_ENST00000455714.2_Missense_Mutation_p.R598C|GRM4_ENST00000374181.4_Missense_Mutation_p.R738C|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000374177.3_Missense_Mutation_p.R622C	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	738					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.R738C(2)|p.R622C(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CTGGCGAAGCGGGGGTCGAGT	0.622																																							uc003oir.3		NA																	3	Substitution - Missense(3)		lung(3)	lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6						c.(2212-2214)CGC>TGC		glutamate receptor, metabotropic 4 precursor	L-Glutamic Acid(DB00142)						85.0	79.0	81.0					6																	34003675		2203	4300	6503	SO:0001583	missense	2914				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:34003675G>A	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.2212C>T	6.37:g.34003675G>A	ENSP00000440556:p.Arg738Cys		Somatic				GRM4_uc011dsn.1_Missense_Mutation_p.R691C|GRM4_uc010jvh.2_Missense_Mutation_p.R738C|GRM4_uc010jvi.2_Missense_Mutation_p.R430C|GRM4_uc003oio.2_Missense_Mutation_p.R430C|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.R598C|GRM4_uc003oiq.2_Missense_Mutation_p.R605C|GRM4_uc011dsm.1_Missense_Mutation_p.R569C	p.R738C	NM_000841	NP_000832	WXS	Illumina HiSeq	Unspecified	Q14833	GRM4_HUMAN			8	2382	-			738			Extracellular (Potential).		B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	c.2212C>T	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.807320	0.31961	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	4.35	3.47	0.39725	GPCR, family 3, C-terminal (2);	0.444726	0.26220	N	0.025636	T	0.78648	0.4316	N	0.08118	0	0.36925	D	0.891586	P;P;D;D;D	0.56746	0.89;0.943;0.971;0.977;0.969	B;P;P;P;B	0.53954	0.231;0.738;0.533;0.498;0.401	D	0.83357	0.0000	10	0.62326	D	0.03	.	13.0425	0.58908	0.0:0.309:0.691:0.0	.	691;569;598;738;605	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	C	738;622;430;605;569;738;598	ENSP00000363296:R738C;ENSP00000363292:R622C;ENSP00000445533:R430C;ENSP00000437925:R605C;ENSP00000437730:R569C;ENSP00000440556:R738C;ENSP00000398456:R598C	ENSP00000363292:R622C	R	-	1	0	GRM4	34111653	0.902000	0.30710	1.000000	0.80357	0.868000	0.49771	1.540000	0.36115	1.025000	0.39708	0.455000	0.32223	CGC		0.622	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2			18	29	0	0	0	0.007413	0	18	29				
ARMC12	221481	broad.mit.edu	37	6	35715159	35715160	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:35715159_35715160GG>TT	ENST00000373866.3	+	4	588_589	c.566_567GG>TT	c.(565-567)cGG>cTT	p.R189L	ARMC12_ENST00000373869.3_Missense_Mutation_p.R189L|ARMC12_ENST00000288065.2_Missense_Mutation_p.R216L			Q5T9G4	ARM12_HUMAN	armadillo repeat containing 12	189						nucleus (GO:0005634)		p.R216L(1)									CAGCTGCGACGGGTGATGCCTG	0.589																																							uc003ola.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(646-648)CGG>CTT		hypothetical protein LOC221481																																				SO:0001583	missense	221481						binding	g.chr6:35715159_35715160GG>TT	AK058119	CCDS4809.1, CCDS69093.1, CCDS69094.1	6p21.31	2013-02-14	2011-12-14	2011-12-14	ENSG00000157343	ENSG00000157343		"""Armadillo repeat containing"""	21099	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 81"""	C6orf81			Standard	XM_005248920		Approved	FLJ25390	uc003ola.3	Q5T9G4	OTTHUMG00000014577	Exception_encountered	6.37:g.35715159_35715160delinsTT	ENSP00000362973:p.Arg189Leu		Somatic				C6orf81_uc003olb.1_Missense_Mutation_p.R189L	p.R216L	NM_145028	NP_659465	WXS	Illumina HiSeq	Unspecified	Q5T9G4	CF081_HUMAN			4	674_675	+			189			ARM 2.		Q8NEB2|Q96LL8	Missense_Mutation	DNP	ENST00000373866.3	37	c.647_648GG>TT																																																																																					0.589	ARMC12-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040311.2	NM_145028		12	31	0	0	0	0.004672	0	12	31				
GUCA1B	2979	broad.mit.edu	37	6	42162358	42162358	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:42162358C>A	ENST00000230361.3	-	1	296	c.201G>T	c.(199-201)aaG>aaT	p.K67N		NM_002098.5	NP_002089.4	Q9UMX6	GUC1B_HUMAN	guanylate cyclase activator 1B (retina)	67	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				body fluid secretion (GO:0007589)|cell-cell signaling (GO:0007267)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)	p.K67N(1)		large_intestine(3)|lung(3)|skin(2)	8	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)			TTACCCCATTCTTGTCGAAGG	0.572																																							uc003orz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(199-201)AAG>AAT		guanylate cyclase activator 1B (retina)							104.0	86.0	92.0					6																	42162358		2203	4300	6503	SO:0001583	missense	2979				body fluid secretion|cell-cell signaling|receptor guanylyl cyclase signaling pathway|visual perception	plasma membrane	calcium ion binding|calcium sensitive guanylate cyclase activator activity	g.chr6:42162358C>A	AF173227	CCDS4865.1	6p21.1	2013-02-14			ENSG00000112599	ENSG00000112599		"""EF-hand domain containing"""	4679	protein-coding gene	gene with protein product		602275				9119368	Standard	NM_002098		Approved	GCAP2, RP48	uc003orz.3	Q9UMX6	OTTHUMG00000014697	ENST00000230361.3:c.201G>T	6.37:g.42162358C>A	ENSP00000230361:p.Lys67Asn		Somatic					p.K67N	NM_002098	NP_002089	WXS	Illumina HiSeq	Unspecified	Q9UMX6	GUC1B_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)		1	337	-	Colorectal(47;0.196)		67			1 (Potential).|EF-hand 2.		Q9NU15	Missense_Mutation	SNP	ENST00000230361.3	37	c.201G>T	CCDS4865.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957373	0.53400	.	.	ENSG00000112599	ENST00000230361;ENST00000372949	T	0.41758	0.99	4.6	2.78	0.32641	EF-hand-like domain (1);	0.045975	0.85682	D	0.000000	T	0.33731	0.0873	M	0.72479	2.2	0.58432	D	0.999999	P	0.50369	0.934	P	0.49387	0.609	T	0.18935	-1.0321	10	0.51188	T	0.08	.	7.3112	0.26475	0.0:0.7129:0.0:0.2871	.	67	Q9UMX6	GUC1B_HUMAN	N	67	ENSP00000230361:K67N	ENSP00000230361:K67N	K	-	3	2	GUCA1B	42270336	0.989000	0.36119	1.000000	0.80357	0.948000	0.59901	0.322000	0.19576	1.068000	0.40764	-0.264000	0.10439	AAG		0.572	GUCA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040550.1	NM_002098		25	22	1	0	1.75199e-13	0.007291	2.30843e-13	25	22				
GFRAL	389400	broad.mit.edu	37	6	55216094	55216094	+	Silent	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:55216094T>C	ENST00000340465.2	+	5	500	c.414T>C	c.(412-414)tgT>tgC	p.C138C		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	138					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.C138C(1)		NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CAGAGGCATGTGTAGGGGATG	0.468																																							uc003pcm.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(412-414)TGT>TGC		GDNF family receptor alpha like precursor							280.0	242.0	254.0					6																	55216094		2203	4300	6503	SO:0001819	synonymous_variant	389400					integral to membrane	receptor activity	g.chr6:55216094T>C	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.414T>C	6.37:g.55216094T>C			Somatic					p.C138C	NM_207410	NP_997293	WXS	Illumina HiSeq	Unspecified	Q6UXV0	GFRAL_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		5	500	+	Lung NSC(77;0.0875)|Renal(3;0.122)		138			Extracellular (Potential).		Q5VTF6	Silent	SNP	ENST00000340465.2	37	c.414T>C	CCDS4957.1																																																																																				0.468	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410		75	108	0	0	0	0.01441	0	75	108				
COL21A1	81578	broad.mit.edu	37	6	55924964	55924964	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:55924964G>T	ENST00000244728.5	-	28	2857	c.2460C>A	c.(2458-2460)tgC>tgA	p.C820*	COL21A1_ENST00000370808.2_Intron|COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000370819.1_Nonsense_Mutation_p.C817*|COL21A1_ENST00000535941.1_Nonsense_Mutation_p.C820*	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	820					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.C820*(2)		breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			GTTGGGACAGGCAATGATCAC	0.493																																							uc003pcs.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)	2						c.(2458-2460)TGC>TGA		collagen, type XXI, alpha 1 precursor							47.0	46.0	47.0					6																	55924964		1847	4089	5936	SO:0001587	stop_gained	81578				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr6:55924964G>T	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.2460C>A	6.37:g.55924964G>T	ENSP00000244728:p.Cys820*		Somatic				COL21A1_uc010jzz.2_Nonsense_Mutation_p.C205*|COL21A1_uc011dxg.1_Nonsense_Mutation_p.C193*|COL21A1_uc011dxh.1_Intron|COL21A1_uc003pcr.2_Nonsense_Mutation_p.C177*	p.C820*	NM_030820	NP_110447	WXS	Illumina HiSeq	Unspecified	Q96P44	COLA1_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.181)		28	2692	-	Lung NSC(77;0.0483)		820					A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Nonsense_Mutation	SNP	ENST00000244728.5	37	c.2460C>A	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	G	41	8.553761	0.98861	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811	.	.	.	5.33	1.94	0.25998	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.839	0.29387	0.5537:0.0:0.4463:0.0	.	.	.	.	X	820;817;820;817	.	.	C	-	3	2	COL21A1	56032923	1.000000	0.71417	0.550000	0.28217	0.988000	0.76386	1.541000	0.36126	0.191000	0.20236	0.655000	0.94253	TGC		0.493	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2			13	18	1	0	1.5842e-08	0.016723	1.8804e-08	13	18				
BAI3	577	broad.mit.edu	37	6	70092758	70092758	+	Silent	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:70092758A>G	ENST00000370598.1	+	31	5132	c.4311A>G	c.(4309-4311)ctA>ctG	p.L1437L	BAI3_ENST00000546190.1_Silent_p.L401L|BAI3_ENST00000238918.8_Silent_p.L643L	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1437					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L1437L(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ATATGGAACTATTTCAAGAAC	0.363																																							uc003pev.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(4309-4311)CTA>CTG		brain-specific angiogenesis inhibitor 3							105.0	104.0	105.0					6																	70092758		2203	4300	6503	SO:0001819	synonymous_variant	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:70092758A>G	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.4311A>G	6.37:g.70092758A>G			Somatic				BAI3_uc010kak.2_Silent_p.L1437L|BAI3_uc011dxx.1_Silent_p.L643L	p.L1437L	NM_001704	NP_001695	WXS	Illumina HiSeq	Unspecified	O60242	BAI3_HUMAN			31	4759	+		all_lung(197;0.212)	1437			Cytoplasmic (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	ENST00000370598.1	37	c.4311A>G	CCDS4968.1																																																																																				0.363	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			16	21	0	0	0	0.006122	0	16	21				
COL19A1	1310	broad.mit.edu	37	6	70916968	70916968	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:70916968G>A	ENST00000322773.4	+	51	3521	c.3419G>A	c.(3418-3420)gGt>gAt	p.G1140D	COL19A1_ENST00000393344.1_Missense_Mutation_p.G762D	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	1140				G -> C (in Ref. 2; BAA23309). {ECO:0000305}.	cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.G1140D(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CAGCGCACAGGTGGGAATTGA	0.542																																							uc003pfc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)	4						c.(3418-3420)GGT>GAT		alpha 1 type XIX collagen precursor							120.0	133.0	128.0					6																	70916968		2203	4300	6503	SO:0001583	missense	1310				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging	g.chr6:70916968G>A		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.3419G>A	6.37:g.70916968G>A	ENSP00000316030:p.Gly1140Asp		Somatic					p.G1140D	NM_001858	NP_001849	WXS	Illumina HiSeq	Unspecified	Q14993	COJA1_HUMAN			51	3536	+			1140	G -> C (in Ref. 2; BAA23309).				Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	37	c.3419G>A	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	G	6.184	0.402182	0.11696	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.91237	-2.81;-2.77	5.9	4.11	0.48088	.	0.292311	0.29451	N	0.012110	T	0.66839	0.2830	N	0.08118	0	0.32067	N	0.594972	B	0.10296	0.003	B	0.08055	0.003	T	0.61797	-0.6989	10	0.54805	T	0.06	.	7.8346	0.29363	0.143:0.1312:0.7258:0.0	.	1140	Q14993	COJA1_HUMAN	D	1140;762	ENSP00000316030:G1140D;ENSP00000377013:G762D	ENSP00000316030:G1140D	G	+	2	0	COL19A1	70973689	0.997000	0.39634	0.995000	0.50966	0.294000	0.27393	1.386000	0.34419	1.505000	0.48720	0.563000	0.77884	GGT		0.542	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1			84	101	0	0	0	0.01441	0	84	101				
COL9A1	1297	broad.mit.edu	37	6	71004158	71004158	+	Silent	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:71004158G>C	ENST00000357250.6	-	5	566	c.408C>G	c.(406-408)tcC>tcG	p.S136S	COL9A1_ENST00000370496.3_Silent_p.S136S	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	136	Laminin G-like.|Nonhelical region (NC4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.S136S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CCTTCCCAGAGGAATCCTGAA	0.438																																							uc003pfg.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(406-408)TCC>TCG		alpha 1 type IX collagen isoform 1 precursor							145.0	147.0	146.0					6																	71004158		2203	4300	6503	SO:0001819	synonymous_variant	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:71004158G>C		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.408C>G	6.37:g.71004158G>C			Somatic					p.S136S	NM_001851	NP_001842	WXS	Illumina HiSeq	Unspecified	P20849	CO9A1_HUMAN			5	567	-			136			Nonhelical region (NC4).|TSP N-terminal.		Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Silent	SNP	ENST00000357250.6	37	c.408C>G	CCDS4971.1																																																																																				0.438	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			108	126	0	0	0	0.01441	0	108	126				
RIMS1	22999	broad.mit.edu	37	6	73102459	73102459	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:73102459G>T	ENST00000521978.1	+	31	4565	c.4565G>T	c.(4564-4566)gGa>gTa	p.G1522V	RIMS1_ENST00000491071.2_Missense_Mutation_p.G1345V|RIMS1_ENST00000520567.1_Missense_Mutation_p.G1172V|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000517827.1_Missense_Mutation_p.G656V|RIMS1_ENST00000401910.3_Missense_Mutation_p.G842V|RIMS1_ENST00000425662.2_Missense_Mutation_p.G590V|RIMS1_ENST00000518273.1_Missense_Mutation_p.G1201V|RIMS1_ENST00000538414.1_Missense_Mutation_p.G328V|RIMS1_ENST00000348717.5_Missense_Mutation_p.G1305V|RIMS1_ENST00000517960.1_Missense_Mutation_p.G1305V|RIMS1_ENST00000523963.1_Missense_Mutation_p.G647V|RIMS1_ENST00000414192.2_Missense_Mutation_p.G49V|RIMS1_ENST00000264839.7_Missense_Mutation_p.G1371V|RIMS1_ENST00000522291.1_Missense_Mutation_p.G1121V	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1522					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.G1522V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TTTCTTGATGGATTGGGACCA	0.408																																							uc003pga.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)	10						c.(4564-4566)GGA>GTA		regulating synaptic membrane exocytosis 1							99.0	93.0	95.0					6																	73102459		1845	4104	5949	SO:0001583	missense	22999				calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr6:73102459G>T	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4565G>T	6.37:g.73102459G>T	ENSP00000428417:p.Gly1522Val		Somatic				RIMS1_uc011dyb.1_Missense_Mutation_p.G919V|RIMS1_uc003pgc.2_Missense_Mutation_p.G971V|RIMS1_uc010kaq.2_Missense_Mutation_p.G842V|RIMS1_uc011dyc.1_Missense_Mutation_p.G647V|RIMS1_uc010kar.2_Missense_Mutation_p.G590V|RIMS1_uc011dyd.1_Missense_Mutation_p.G656V|RIMS1_uc003pgf.2_Missense_Mutation_p.G522V|RIMS1_uc003pgg.2_Missense_Mutation_p.G418V|RIMS1_uc003pgi.2_Missense_Mutation_p.G338V|RIMS1_uc003pgh.2_Missense_Mutation_p.G389V|RIMS1_uc003pgd.2_Missense_Mutation_p.G588V|RIMS1_uc003pge.2_Missense_Mutation_p.G562V|RIMS1_uc011dye.1_Missense_Mutation_p.G328V|RIMS1_uc011dyf.1_Missense_Mutation_p.G146V|RIMS1_uc011dyg.1_Missense_Mutation_p.G49V	p.G1522V	NM_014989	NP_055804	WXS	Illumina HiSeq	Unspecified	Q86UR5	RIMS1_HUMAN			31	4642	+		all_epithelial(107;0.179)|all_hematologic(105;0.212)	1522					A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	c.4565G>T	CCDS47449.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	29.2|29.2|29.2	4.982775|4.982775|4.982775	0.93044|0.93044|0.93044	.|.|.	.|.|.	ENSG00000079841|ENSG00000079841|ENSG00000079841	ENST00000522211|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420;ENST00000538414;ENST00000414192|ENST00000517433	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	.|0.29142|.	.|1.58;2.25;2.15;2.26;2.42;2.42;2.43;2.1;2.2;2.41;2.36;1.95;2.35;1.74;1.82;2.07|.	5.5|5.5|5.5	5.5|5.5|5.5	0.81552|0.81552|0.81552	.|.|.	.|0.000000|.	.|0.64402|.	.|D|.	.|0.000008|.	T|T|T	0.78432|0.78432|0.78432	0.4282|0.4282|0.4282	M|M|M	0.81497|0.81497|0.81497	2.545|2.545|2.545	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D;D;D;D;D;D;D;D;D;D;D;D|.	.|0.89917|.	.|0.999;0.999;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0|.	.|D;D;D;D;D;D;D;D;D;D;D;D;D|.	.|0.97110|.	.|0.991;0.978;0.999;1.0;1.0;1.0;0.999;0.986;0.999;1.0;0.997;1.0;0.997|.	T|T|T	0.78620|0.78620|0.78620	-0.2133|-0.2133|-0.2133	5|10|5	.|0.87932|.	.|D|.	.|0|.	-19.8577|-19.8577|-19.8577	19.3783|19.3783|19.3783	0.94521|0.94521|0.94521	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|146;328;656;647;1371;842;1121;425;1201;1305;598;1345;1522|.	.|B7Z6K9;B7Z7W2;B7Z3S3;E9PHF5;E9PHR1;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5|.	.|.;.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN|.	Y|V|C	440|1345;1371;1345;1305;1201;1121;1371;1305;1201;1172;1121;1522;842;647;590;687;656;570;328;49|867	.|ENSP00000430101:G1345V;ENSP00000275037:G1305V;ENSP00000264839:G1371V;ENSP00000429959:G1305V;ENSP00000430408:G1201V;ENSP00000430502:G1172V;ENSP00000430932:G1121V;ENSP00000428417:G1522V;ENSP00000385649:G842V;ENSP00000428328:G647V;ENSP00000411235:G590V;ENSP00000389503:G687V;ENSP00000428367:G656V;ENSP00000359448:G570V;ENSP00000439730:G328V;ENSP00000402273:G49V|.	.|ENSP00000264839:G1371V|.	D|G|W	+|+|+	1|2|3	0|0|0	RIMS1|RIMS1|RIMS1	73159180|73159180|73159180	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.994000|0.994000|0.994000	0.84299|0.84299|0.84299	9.869000|9.869000|9.869000	0.99810|0.99810|0.99810	2.582000|2.582000|2.582000	0.87167|0.87167|0.87167	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GAT|GGA|TGG		0.408	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			30	52	1	0	4.65686e-17	0.017118	6.46101e-17	30	52				
CD109	135228	broad.mit.edu	37	6	74528210	74528210	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:74528210G>T	ENST00000287097.5	+	31	4123	c.4011G>T	c.(4009-4011)gtG>gtT	p.V1337V	CD109_ENST00000437994.2_Silent_p.V1320V|CD109_ENST00000422508.2_Silent_p.V1260V			Q6YHK3	CD109_HUMAN	CD109 molecule	1337					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.V1337V(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCGAGACAGTGAAGAAAGTGG	0.403																																							uc003php.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(2)	4						c.(4009-4011)GTG>GTT		CD109 antigen isoform 1 precursor							102.0	104.0	103.0					6																	74528210		2203	4300	6503	SO:0001819	synonymous_variant	135228					anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr6:74528210G>T	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.4011G>T	6.37:g.74528210G>T			Somatic				CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Silent_p.V1320V|CD109_uc010kba.2_Silent_p.V1260V	p.V1337V	NM_133493	NP_598000	WXS	Illumina HiSeq	Unspecified	Q6YHK3	CD109_HUMAN			31	4436	+			1337					A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Silent	SNP	ENST00000287097.5	37	c.4011G>T	CCDS4982.1																																																																																				0.403	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493		17	23	1	0	1.02788e-11	0.00499	1.30116e-11	17	23				
SIM1	6492	broad.mit.edu	37	6	100838768	100838768	+	Missense_Mutation	SNP	G	G	C	rs375025782		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:100838768G>C	ENST00000369208.3	-	12	2552	c.1770C>G	c.(1768-1770)gaC>gaG	p.D590E	SIM1_ENST00000262901.4_Missense_Mutation_p.D590E			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	590	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.D590E(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		AAGCCAGTTGGTCTGAGGGGG	0.473																																							uc003pqj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1768-1770)GAC>GAG		single-minded homolog 1		G	GLU/ASP	0,4406		0,0,2203	76.0	76.0	76.0		1770	1.7	1.0	6		76	1,8599	1.2+/-3.3	0,1,4299	no	missense	SIM1	NM_005068.2	45	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	benign	590/767	100838768	1,13005	2203	4300	6503	SO:0001583	missense	6492				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr6:100838768G>C	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1770C>G	6.37:g.100838768G>C	ENSP00000358210:p.Asp590Glu		Somatic				SIM1_uc010kcu.2_Missense_Mutation_p.D590E	p.D590E	NM_005068	NP_005059	WXS	Illumina HiSeq	Unspecified	P81133	SIM1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0774)	11	1977	-		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)	590			Single-minded C-terminal.		Q5TDP7	Missense_Mutation	SNP	ENST00000369208.3	37	c.1770C>G	CCDS5045.1	.	.	.	.	.	.	.	.	.	.	G	5.550	0.286335	0.10513	0.0	1.16E-4	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.27402	1.67;1.67	5.82	1.69	0.24217	Single-minded, C-terminal (2);	0.231128	0.50627	D	0.000117	T	0.05044	0.0135	N	0.12182	0.205	0.37090	D	0.899417	B	0.06786	0.001	B	0.08055	0.003	T	0.29761	-1.0001	10	0.11794	T	0.64	.	9.6165	0.39694	0.4567:0.0:0.5433:0.0	.	590	P81133	SIM1_HUMAN	E	590	ENSP00000358210:D590E;ENSP00000262901:D590E	ENSP00000262901:D590E	D	-	3	2	SIM1	100945489	0.164000	0.22935	0.996000	0.52242	0.954000	0.61252	0.336000	0.19823	0.253000	0.21552	-0.262000	0.10625	GAC		0.473	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068		39	25	0	0	0	0.021022	0	39	25				
BVES	11149	broad.mit.edu	37	6	105549026	105549026	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:105549026C>G	ENST00000314641.5	-	8	1237	c.1021G>C	c.(1021-1023)Gat>Cat	p.D341H	BVES_ENST00000446408.2_Missense_Mutation_p.D341H|BVES_ENST00000336775.5_Missense_Mutation_p.D341H	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	341					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)	p.D341H(1)		NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				TCATCATCATCTTCTGCTCCT	0.473																																							uc003pqw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1021-1023)GAT>CAT		blood vessel epicardial substance isoform 5							219.0	185.0	197.0					6																	105549026		2203	4300	6503	SO:0001583	missense	11149				epithelial cell-cell adhesion|muscle organ development|positive regulation of locomotion|positive regulation of receptor recycling|regulation of Cdc42 GTPase activity|regulation of cell shape|regulation of Rac GTPase activity|substrate adhesion-dependent cell spreading|vesicle-mediated transport	integral to membrane|lateral plasma membrane|tight junction	structural molecule activity	g.chr6:105549026C>G	AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.1021G>C	6.37:g.105549026C>G	ENSP00000313172:p.Asp341His		Somatic				BVES_uc003pqx.2_Missense_Mutation_p.D341H|BVES_uc003pqy.2_Missense_Mutation_p.D341H	p.D341H	NM_147147	NP_671488	WXS	Illumina HiSeq	Unspecified	Q8NE79	POPD1_HUMAN			8	1178	-		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)	341			Cytoplasmic (Potential).		A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Missense_Mutation	SNP	ENST00000314641.5	37	c.1021G>C	CCDS5051.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255918	0.39896	.	.	ENSG00000112276	ENST00000314641;ENST00000336775;ENST00000446408	T;T;T	0.28454	1.61;1.61;1.61	5.3	4.43	0.53597	.	0.303914	0.34067	N	0.004295	T	0.30230	0.0758	L	0.41824	1.3	0.34725	D	0.729149	D	0.89917	1.0	D	0.87578	0.998	T	0.12372	-1.0550	10	0.36615	T	0.2	-19.5974	10.489	0.44739	0.0:0.9094:0.0:0.0906	.	341	Q8NE79	POPD1_HUMAN	H	341	ENSP00000313172:D341H;ENSP00000337259:D341H;ENSP00000397310:D341H	ENSP00000313172:D341H	D	-	1	0	BVES	105655719	1.000000	0.71417	0.990000	0.47175	0.110000	0.19582	2.262000	0.43285	1.362000	0.46000	0.650000	0.86243	GAT		0.473	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406075.1	NM_147147		31	38	0	0	0	0.008361	0	31	38				
FIG4	9896	broad.mit.edu	37	6	110086283	110086283	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:110086283G>A	ENST00000230124.3	+	14	1626	c.1502G>A	c.(1501-1503)gGa>gAa	p.G501E	FIG4_ENST00000441478.2_Missense_Mutation_p.G224E	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	501	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)	p.G501E(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		TTTATGGTGGGAAAATGTGCT	0.398																																							uc003ptt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1501-1503)GGA>GAA		Sac domain-containing inositol phosphatase 3							159.0	142.0	148.0					6																	110086283		2203	4300	6503	SO:0001583	missense	9896				cell death	endosome membrane	protein binding	g.chr6:110086283G>A	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.1502G>A	6.37:g.110086283G>A	ENSP00000230124:p.Gly501Glu		Somatic				FIG4_uc011eau.1_Missense_Mutation_p.G224E	p.G501E	NM_014845	NP_055660	WXS	Illumina HiSeq	Unspecified	Q92562	FIG4_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)	14	1717	+		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)	501			SAC.		Q53H49|Q5TCS6	Missense_Mutation	SNP	ENST00000230124.3	37	c.1502G>A	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818458	0.90790	.	.	ENSG00000112367	ENST00000441478;ENST00000230124	T;T	0.57907	1.56;0.37	5.22	5.22	0.72569	Synaptojanin, N-terminal (1);	0.189755	0.46145	D	0.000307	T	0.80428	0.4621	H	0.97465	4.01	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.967;0.998	D	0.87573	0.2479	10	0.87932	D	0	-20.3989	16.98	0.86324	0.0:0.0:1.0:0.0	.	224;501	F5H8L9;Q92562	.;FIG4_HUMAN	E	224;501	ENSP00000399443:G224E;ENSP00000230124:G501E	ENSP00000230124:G501E	G	+	2	0	FIG4	110192976	1.000000	0.71417	0.969000	0.41365	0.890000	0.51754	9.190000	0.94934	2.431000	0.82371	0.650000	0.86243	GGA		0.398	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845		42	81	0	0	0	0.007835	0	42	81				
LAMA4	3910	broad.mit.edu	37	6	112513053	112513053	+	Splice_Site	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:112513053C>A	ENST00000230538.7	-	6	901		c.e6-1		LAMA4_ENST00000389463.4_Splice_Site|LAMA4_ENST00000524032.1_Splice_Site|LAMA4_ENST00000522006.1_Splice_Site|LAMA4_ENST00000424408.2_Splice_Site	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4						blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.?(2)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GGGAGCACATCTGAAGAGGAA	0.363																																							uc003pvu.2		NA																	2	Unknown(2)		lung(1)|kidney(1)	ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9						c.e6-1		laminin, alpha 4 isoform 1 precursor							49.0	47.0	47.0					6																	112513053		2203	4300	6503	SO:0001630	splice_region_variant	3910				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	g.chr6:112513053C>A		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.504-1G>T	6.37:g.112513053C>A			Somatic				LAMA4_uc003pvv.2_Splice_Site_p.R168_splice|LAMA4_uc003pvt.2_Splice_Site_p.R168_splice	p.R168_splice	NM_001105206	NP_001098676	WXS	Illumina HiSeq	Unspecified	Q16363	LAMA4_HUMAN		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	6	813	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)						Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Splice_Site	SNP	ENST00000230538.7	37	c.504_splice	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	C	19.47	3.834309	0.71373	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408;ENST00000454881;ENST00000521398;ENST00000542588	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6753	0.95930	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LAMA4	112619746	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.452000	0.80683	2.648000	0.89879	0.563000	0.77884	.		0.363	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	Intron	12	21	1	0	0.000151284	0.016723	0.000162118	12	21				
RSPO3	84870	broad.mit.edu	37	6	127440428	127440428	+	Silent	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:127440428C>A	ENST00000356698.4	+	1	680	c.91C>A	c.(91-93)Cga>Aga	p.R31R	RSPO3_ENST00000368317.3_Silent_p.R31R	NM_032784.3	NP_116173.2	Q9BXY4	RSPO3_HUMAN	R-spondin 3	31					branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)	extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.R31R(1)	PTPRK/RSPO3(10)	breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17				GBM - Glioblastoma multiforme(226;0.0555)		AAGGCGCCAGCGAAGAAGTAA	0.552																																							uc003qar.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(91-93)CGA>AGA		R-spondin 3 precursor							145.0	160.0	155.0					6																	127440428		2203	4300	6503	SO:0001819	synonymous_variant	84870					extracellular region	heparin binding	g.chr6:127440428C>A	BC022367	CCDS5135.1	6q22.33	2013-02-28	2011-06-29	2005-08-08	ENSG00000146374	ENSG00000146374		"""Endogenous ligands"""	20866	protein-coding gene	gene with protein product		610574	"""thrombospondin, type I, domain containing 2"", ""R-spondin 3 homolog (Xenopus laevis)"""	THSD2		10842357, 15469841	Standard	NM_032784		Approved	FLJ14440	uc003qar.3	Q9BXY4	OTTHUMG00000015521	ENST00000356698.4:c.91C>A	6.37:g.127440428C>A			Somatic				uc003qaq.1_Intron|RSPO3_uc003qas.1_Silent_p.R31R	p.R31R	NM_032784	NP_116173	WXS	Illumina HiSeq	Unspecified	Q9BXY4	RSPO3_HUMAN		GBM - Glioblastoma multiforme(226;0.0555)	1	381	+			31					B2RC27|Q5VTV4|Q96K87	Silent	SNP	ENST00000356698.4	37	c.91C>A	CCDS5135.1																																																																																				0.552	RSPO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042111.1	NM_032784		27	35	1	0	1.17739e-12	0.005443	1.53207e-12	27	35				
EYA4	2070	broad.mit.edu	37	6	133849905	133849905	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:133849905C>A	ENST00000367895.5	+	20	2346	c.1882C>A	c.(1882-1884)Ctg>Atg	p.L628M	EYA4_ENST00000452339.2_Missense_Mutation_p.L574M|EYA4_ENST00000525849.1_Missense_Mutation_p.L605M|EYA4_ENST00000355167.3_Missense_Mutation_p.L628M|EYA4_ENST00000355286.6_Missense_Mutation_p.L605M|RP3-323P13.2_ENST00000607033.1_RNA|EYA4_ENST00000531901.1_Missense_Mutation_p.L634M|EYA4_ENST00000431403.2_Missense_Mutation_p.L628M|EYA4_ENST00000430974.2_Intron	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	628					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)	p.L628M(2)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CTCAGACCTCCTGGCTCTCCA	0.453																																					Melanoma(57;398 1237 3528 4702 7415)	Melanoma(57;398 1237 3528 4702 7415)	uc003qec.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)	2						c.(1882-1884)CTG>ATG		eyes absent 4 isoform a							278.0	256.0	263.0					6																	133849905		2203	4300	6503	SO:0001583	missense	2070				anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr6:133849905C>A	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1882C>A	6.37:g.133849905C>A	ENSP00000356870:p.Leu628Met		Somatic				EYA4_uc011ecq.1_Missense_Mutation_p.L574M|EYA4_uc011ecr.1_Intron|EYA4_uc003qed.3_Missense_Mutation_p.L628M|EYA4_uc003qee.3_Missense_Mutation_p.L605M|EYA4_uc011ecs.1_Missense_Mutation_p.L634M|uc003qeg.1_Intron	p.L628M	NM_004100	NP_004091	WXS	Illumina HiSeq	Unspecified	O95677	EYA4_HUMAN		GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)	20	2340	+	Colorectal(23;0.221)		628					B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	37	c.1882C>A	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	C	4.662	0.123091	0.08931	.	.	ENSG00000112319	ENST00000452339;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37;-2.37;-2.37	6.07	4.85	0.62838	EYA (1);	0.000000	0.85682	D	0.000000	D	0.83413	0.5249	N	0.20986	0.625	0.53688	D	0.999978	B;D;D;B;B	0.76494	0.018;0.998;0.999;0.041;0.018	B;D;D;B;B	0.68943	0.022;0.952;0.961;0.022;0.036	T	0.82255	-0.0548	10	0.25751	T	0.34	-8.0266	9.0666	0.36467	0.0:0.1624:0.0:0.8376	.	634;574;605;628;628	F2Z2Y1;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;EYA4_HUMAN	M	574;628;628;605;634;605;628	ENSP00000395916:L574M;ENSP00000356870:L628M;ENSP00000347294:L628M;ENSP00000347434:L605M;ENSP00000432770:L634M;ENSP00000433219:L605M;ENSP00000404558:L628M	ENSP00000347294:L628M	L	+	1	2	EYA4	133891598	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.248000	0.51430	1.021000	0.39600	-0.345000	0.07892	CTG		0.453	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100		109	97	1	0	1.38406e-41	0.01441	2.23907e-41	109	97				
MTHFD1L	25902	broad.mit.edu	37	6	151247409	151247409	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:151247409G>T	ENST00000367321.3	+	11	1508	c.1234G>T	c.(1234-1236)Gga>Tga	p.G412*		NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	412	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)	p.G412*(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TCAAGCAGATGGAAAATACGT	0.393																																							uc003qob.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(1234-1236)GGA>TGA		methylenetetrahydrofolate dehydrogenase (NADP+							130.0	123.0	125.0					6																	151247409		2203	4300	6503	SO:0001587	stop_gained	25902				folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity	g.chr6:151247409G>T	BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.1234G>T	6.37:g.151247409G>T	ENSP00000356290:p.Gly412*		Somatic				MTHFD1L_uc011een.1_RNA|MTHFD1L_uc011eeo.1_Nonsense_Mutation_p.G413*|MTHFD1L_uc003qoc.2_Nonsense_Mutation_p.G360*	p.G412*	NM_015440	NP_056255	WXS	Illumina HiSeq	Unspecified	Q6UB35	C1TM_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)	11	1502	+		Ovarian(120;0.128)	412			Formyltetrahydrofolate synthetase.		Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Nonsense_Mutation	SNP	ENST00000367321.3	37	c.1234G>T	CCDS5228.1	.	.	.	.	.	.	.	.	.	.	G	40	8.038062	0.98621	.	.	ENSG00000120254	ENST00000367321;ENST00000441122	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.1162	0.97934	0.0:0.0:1.0:0.0	.	.	.	.	X	412;83	.	ENSP00000356290:G412X	G	+	1	0	MTHFD1L	151289102	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	9.476000	0.97823	2.756000	0.94617	0.655000	0.94253	GGA		0.393	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042699.1	NM_015440		47	47	1	0	4.18559e-23	0.01441	6.28588e-23	47	47				
PLG	5340	broad.mit.edu	37	6	161134032	161134032	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:161134032C>A	ENST00000308192.9	+	5	485	c.422C>A	c.(421-423)aCa>aAa	p.T141K	PLG_ENST00000462918.1_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	141	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.T141K(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TCACCTGCTACACACCCCTCA	0.483																																							uc003qtm.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(421-423)ACA>AAA		plasminogen	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)						101.0	103.0	102.0					6																	161134032		2203	4300	6503	SO:0001583	missense	5340				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity	g.chr6:161134032C>A	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.422C>A	6.37:g.161134032C>A	ENSP00000308938:p.Thr141Lys		Somatic					p.T141K	NM_000301	NP_000292	WXS	Illumina HiSeq	Unspecified	P00747	PLMN_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	5	485	+			141			Kringle 1.		Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	c.422C>A	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	C	0.216	-1.032708	0.02029	.	.	ENSG00000122194	ENST00000308192;ENST00000418964	T;T	0.64803	-0.12;-0.12	5.22	-3.04	0.05412	Kringle (4);Kringle-like fold (1);	0.832329	0.09693	N	0.768051	T	0.08403	0.0209	N	0.02708	-0.52	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32851	-0.9891	10	0.02654	T	1	.	4.7374	0.12995	0.2988:0.4876:0.0792:0.1344	.	141	P00747	PLMN_HUMAN	K	141;158	ENSP00000308938:T141K;ENSP00000389424:T158K	ENSP00000308938:T141K	T	+	2	0	PLG	161054022	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.577000	0.05847	-0.163000	0.10946	0.650000	0.86243	ACA		0.483	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301		56	52	1	0	2.30037e-20	0.01441	3.2896e-20	56	52				
ETV1	2115	broad.mit.edu	37	7	13971234	13971234	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:13971234T>A	ENST00000430479.1	-	9	1362	c.695A>T	c.(694-696)cAc>cTc	p.H232L	ETV1_ENST00000405358.4_Missense_Mutation_p.H246L|ETV1_ENST00000399357.3_Missense_Mutation_p.H129L|ETV1_ENST00000405218.2_Missense_Mutation_p.H232L|ETV1_ENST00000343495.5_Missense_Mutation_p.H214L|ETV1_ENST00000403527.1_Missense_Mutation_p.H192L|ETV1_ENST00000242066.5_Missense_Mutation_p.H214L|ETV1_ENST00000403685.1_Missense_Mutation_p.H214L|ETV1_ENST00000405192.2_Missense_Mutation_p.H232L|ETV1_ENST00000420159.2_Missense_Mutation_p.H174L|ETV1_ENST00000476720.2_5'UTR	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	232					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H192L(1)|p.H232L(1)	TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						CACTGGGTCGTGGTACTCCTG	0.522			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																		uc011jxq.1		NA		Dom	yes		7	7p22	2115	T	ets variant gene 1			"""M, E"""	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3		Ewing sarcoma|prostate	TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	2	Substitution - Missense(2)		lung(2)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35						c.(694-696)CAC>CTC		ets variant gene 1 isoform a							132.0	129.0	130.0					7																	13971234		2018	4182	6200	SO:0001583	missense	2115				transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:13971234T>A		CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.695A>T	7.37:g.13971234T>A	ENSP00000405327:p.His232Leu		Somatic				ETV1_uc011jxn.1_Missense_Mutation_p.H192L|ETV1_uc011jxo.1_Missense_Mutation_p.H129L|ETV1_uc011jxp.1_Missense_Mutation_p.H174L|ETV1_uc003ssw.3_Missense_Mutation_p.H232L|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Missense_Mutation_p.H214L|ETV1_uc011jxs.1_Missense_Mutation_p.H214L|ETV1_uc010ktv.2_Missense_Mutation_p.H101L	p.H232L	NM_004956	NP_004947	WXS	Illumina HiSeq	Unspecified	P50549	ETV1_HUMAN			9	1434	-			232					A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	ENST00000430479.1	37	c.695A>T	CCDS55088.1	.	.	.	.	.	.	.	.	.	.	T	7.948	0.744269	0.15710	.	.	ENSG00000006468	ENST00000430479;ENST00000242066;ENST00000343495;ENST00000420159;ENST00000399357;ENST00000405192;ENST00000405358;ENST00000403527;ENST00000405218;ENST00000403685;ENST00000438956;ENST00000443608	T;T;T;T;T;T;T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.07	6.13	6.13	0.99165	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.046444	0.85682	D	0.000000	T	0.33206	0.0855	L	0.33189	0.99	0.48135	D	0.999593	B;B;B;B;B;D;B;B	0.60160	0.27;0.001;0.27;0.4;0.24;0.987;0.001;0.002	B;B;B;B;B;D;B;B	0.72982	0.085;0.003;0.085;0.075;0.209;0.979;0.004;0.004	T	0.04320	-1.0960	10	0.09843	T	0.71	.	16.7898	0.85586	0.0:0.0:0.0:1.0	.	243;214;246;174;129;192;174;232	Q59GA7;P50549-2;B5MCT2;F5GXR2;B7Z9P2;E9PHB1;B7Z618;P50549	.;.;.;.;.;.;.;ETV1_HUMAN	L	232;214;214;174;129;232;246;192;232;214;174;129	ENSP00000405327:H232L;ENSP00000242066:H214L;ENSP00000340853:H214L;ENSP00000411626:H174L;ENSP00000382293:H129L;ENSP00000385381:H232L;ENSP00000384085:H246L;ENSP00000384138:H192L;ENSP00000385551:H232L;ENSP00000385686:H214L;ENSP00000393078:H174L;ENSP00000394710:H129L	ENSP00000242066:H214L	H	-	2	0	ETV1	13937759	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.859000	0.62954	2.364000	0.80123	0.524000	0.50904	CAC		0.522	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326111.1	NM_004956		16	12	0	0	0	0.006122	0	16	12				
C7orf69	80099	broad.mit.edu	37	7	47859104	47859104	+	Splice_Site	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:47859104G>A	ENST00000258776.4	+	3	323		c.e3-1		PKD1L1_ENST00000289672.2_Intron|C7orf69_ENST00000418326.2_Splice_Site	NM_025031.2	NP_079307.2	Q9H7B7	CG069_HUMAN	chromosome 7 open reading frame 69							extracellular region (GO:0005576)		p.?(1)		lung(2)	2						TTTGCACACAGCACCACCTAC	0.418																																							uc003tnz.3		NA																	1	Unknown(1)		lung(1)		0						c.e3-1		hypothetical protein LOC80099 precursor							78.0	73.0	75.0					7																	47859104		1911	4133	6044	SO:0001630	splice_region_variant	80099					extracellular region		g.chr7:47859104G>A	BC113681	CCDS43581.1	7p12	2011-12-09			ENSG00000136275	ENSG00000136275			21911	protein-coding gene	gene with protein product							Standard	NM_025031		Approved	FLJ21075	uc003tnz.4	Q9H7B7	OTTHUMG00000155648	ENST00000258776.4:c.279-1G>A	7.37:g.47859104G>A			Somatic				PKD1L1_uc003tny.1_Intron|C7orf69_uc003toa.1_Intron|PKD1L1_uc003tob.2_Intron	p.S93_splice	NM_025031	NP_079307	WXS	Illumina HiSeq	Unspecified	Q9H7B7	CG069_HUMAN			3	324	+								A4D2F1|Q14CN7|Q75MJ5	Splice_Site	SNP	ENST00000258776.4	37	c.279_splice	CCDS43581.1	.	.	.	.	.	.	.	.	.	.	G	8.417	0.845540	0.16963	.	.	ENSG00000136275	ENST00000258776;ENST00000418326	.	.	.	4.57	3.68	0.42216	.	.	.	.	.	.	.	.	.	.	.	0.31661	N	0.645626	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7541	0.40494	0.0:0.0:0.7938:0.2062	.	.	.	.	.	-1	.	.	.	+	.	.	C7orf69	47825629	0.001000	0.12720	0.013000	0.15412	0.439000	0.31926	0.663000	0.25053	1.112000	0.41740	0.655000	0.94253	.		0.418	C7orf69-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340973.1	NM_025031	Intron	10	6	0	0	0	0.006214	0	10	6				
ABCA13	154664	broad.mit.edu	37	7	48312879	48312879	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:48312879G>T	ENST00000435803.1	+	17	3640	c.3616G>T	c.(3616-3618)Gct>Tct	p.A1206S		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1206					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A1151S(1)|p.A1206S(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CCATAATGTTGCTAGACTCAT	0.388																																							uc003toq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|central_nervous_system(4)|skin(1)	10						c.(3616-3618)GCT>TCT		ATP binding cassette, sub-family A (ABC1),							48.0	47.0	47.0					7																	48312879		1826	4081	5907	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48312879G>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.3616G>T	7.37:g.48312879G>T	ENSP00000411096:p.Ala1206Ser		Somatic				ABCA13_uc010kyr.2_Missense_Mutation_p.A709S	p.A1206S	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			17	3641	+			1206					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.3616G>T	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.726879	0.30593	.	.	ENSG00000179869	ENST00000435803	D	0.86865	-2.18	5.46	0.909	0.19332	.	0.343609	0.20862	N	0.084331	T	0.80099	0.4561	M	0.62723	1.935	0.09310	N	1	B	0.17038	0.02	B	0.15052	0.012	T	0.64407	-0.6415	9	.	.	.	.	2.7366	0.05242	0.3915:0.0:0.406:0.2025	.	1206	Q86UQ4	ABCAD_HUMAN	S	1206	ENSP00000411096:A1206S	.	A	+	1	0	ABCA13	48283425	0.009000	0.17119	0.008000	0.14137	0.802000	0.45316	0.520000	0.22878	0.335000	0.23614	0.563000	0.77884	GCT		0.388	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		16	9	1	0	1.45105e-14	0.006122	1.96126e-14	16	9				
ABCA13	154664	broad.mit.edu	37	7	48337984	48337984	+	Missense_Mutation	SNP	T	T	C	rs117649711	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:48337984T>C	ENST00000435803.1	+	23	9245	c.9221T>C	c.(9220-9222)aTg>aCg	p.M3074T		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3074					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.M3019T(1)|p.M3074T(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AAAGATTTGATGAAGAATATC	0.328																																							uc003toq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|central_nervous_system(4)|skin(1)	10						c.(9220-9222)ATG>ACG		ATP binding cassette, sub-family A (ABC1),							71.0	66.0	68.0					7																	48337984		1806	4070	5876	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48337984T>C	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.9221T>C	7.37:g.48337984T>C	ENSP00000411096:p.Met3074Thr		Somatic				ABCA13_uc010kys.1_Missense_Mutation_p.M148T	p.M3074T	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			23	9246	+			3074					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.9221T>C	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	T	11.06	1.526596	0.27299	.	.	ENSG00000179869	ENST00000435803	D	0.86956	-2.19	5.47	5.47	0.80525	.	0.208574	0.33144	N	0.005239	T	0.80380	0.4612	L	0.29908	0.895	0.80722	D	1	B;B	0.23442	0.053;0.085	B;B	0.18561	0.022;0.015	T	0.78178	-0.2305	10	0.87932	D	0	.	11.9538	0.52970	0.0:0.0:0.0:1.0	.	776;3074	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	T	3074	ENSP00000411096:M3074T	ENSP00000411096:M3074T	M	+	2	0	ABCA13	48308530	0.996000	0.38824	0.976000	0.42696	0.423000	0.31445	4.111000	0.57838	2.076000	0.62316	0.533000	0.62120	ATG		0.328	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		10	14	0	0	0	0.006214	0	10	14				
PCLO	27445	broad.mit.edu	37	7	82387927	82387927	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:82387927C>G	ENST00000333891.9	-	25	15730	c.15393G>C	c.(15391-15393)tgG>tgC	p.W5131C		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.W5131C(2)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AAAGTTTGTGCCAGTTGACTA	0.393																																							uc003uhx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)	7						c.(15391-15393)TGG>TGC		piccolo isoform 1							262.0	250.0	254.0					7																	82387927		1850	4090	5940	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82387927C>G	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15393G>C	7.37:g.82387927C>G	ENSP00000334319:p.Trp5131Cys		Somatic					p.W5131C	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			25	15682	-			5054						Missense_Mutation	SNP	ENST00000333891.9	37	c.15393G>C	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494228	0.44352	.	.	ENSG00000186472	ENST00000333891	T	0.12984	2.63	5.51	5.51	0.81932	.	0.000000	0.47093	U	0.000256	T	0.27454	0.0674	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04650	-1.0936	10	0.87932	D	0	.	19.4158	0.94697	0.0:1.0:0.0:0.0	.	5131	Q9Y6V0-5	.	C	5131	ENSP00000334319:W5131C	ENSP00000334319:W5131C	W	-	3	0	PCLO	82225863	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.818000	0.86416	2.598000	0.87819	0.585000	0.79938	TGG		0.393	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		71	77	0	0	0	0.01441	0	71	77				
PCLO	27445	broad.mit.edu	37	7	82579280	82579280	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:82579280G>T	ENST00000333891.9	-	6	10961	c.10624C>A	c.(10624-10626)Cga>Aga	p.R3542R	PCLO_ENST00000423517.2_Silent_p.R3542R|PCLO_ENST00000437081.1_Silent_p.R262R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.R3542R(2)|p.R3473R(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCATCCACTCGTGCCCGTATG	0.448																																							uc003uhx.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(7)	7						c.(10624-10626)CGA>AGA		piccolo isoform 1							142.0	126.0	131.0					7																	82579280		1926	4135	6061	SO:0001819	synonymous_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82579280G>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10624C>A	7.37:g.82579280G>T			Somatic				PCLO_uc003uhv.2_Silent_p.R3542R|PCLO_uc010lec.2_Silent_p.R507R	p.R3542R	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			6	10913	-			3473						Silent	SNP	ENST00000333891.9	37	c.10624C>A	CCDS47630.1																																																																																				0.448	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		19	26	1	0	6.49762e-13	0.006122	8.48132e-13	19	26				
COL1A2	1278	broad.mit.edu	37	7	94058669	94058669	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:94058669G>C	ENST00000297268.6	+	51	4352	c.3881G>C	c.(3880-3882)gGc>gCc	p.G1294A		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	1294	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.G1294A(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	ATTCTACAGGGCTCTAATGAT	0.448										HNSCC(75;0.22)																													uc003ung.1		NA																COL1A2/PLAG1(3)	1	Substitution - Missense(1)		lung(1)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9						c.(3880-3882)GGC>GCC		alpha 2 type I collagen precursor	Collagenase(DB00048)						125.0	101.0	109.0					7																	94058669		2203	4300	6503	SO:0001583	missense	1278				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging	g.chr7:94058669G>C	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.3881G>C	7.37:g.94058669G>C	ENSP00000297268:p.Gly1294Ala	HNSCC(75;0.22)	Somatic				COL1A2_uc011kib.1_Missense_Mutation_p.G146A	p.G1294A	NM_000089	NP_000080	WXS	Illumina HiSeq	Unspecified	P08123	CO1A2_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		51	4352	+	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		1294			Fibrillar collagen NC1.		P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	c.3881G>C	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.796822	0.50208	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	T	0.75938	-0.98	5.09	5.09	0.68999	Fibrillar collagen, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.85375	0.5682	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.84384	0.0551	10	0.44086	T	0.13	.	19.3783	0.94521	0.0:0.0:1.0:0.0	.	146;1294	B4DTF5;P08123	.;CO1A2_HUMAN	A	1294;1295	ENSP00000297268:G1294A	ENSP00000297268:G1294A	G	+	2	0	COL1A2	93896605	1.000000	0.71417	0.997000	0.53966	0.363000	0.29612	9.864000	0.99589	2.751000	0.94390	0.650000	0.86243	GGC		0.448	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089		21	23	0	0	0	0.010504	0	21	23				
CYP3A43	64816	broad.mit.edu	37	7	99445825	99445825	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:99445825G>T	ENST00000354829.2	+	6	572	c.469G>T	c.(469-471)Gtg>Ttg	p.V157L	CYP3A43_ENST00000477658.1_3'UTR|CYP3A43_ENST00000342499.4_Missense_Mutation_p.G19V|CYP3A43_ENST00000312017.5_Missense_Mutation_p.V157L|CYP3A43_ENST00000417625.1_Intron|CYP3A43_ENST00000222382.5_Missense_Mutation_p.V157L|CYP3A43_ENST00000415413.1_Intron|CYP3A43_ENST00000444905.1_Intron	NM_022820.3|NM_057095.1	NP_073731.1|NP_476436.1	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 43	157			Missing (in allele CYP3A43*2).		small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)	p.V157L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Dexamethasone(DB01234)|Dolutegravir(DB08930)|Ethosuximide(DB00593)|Oxazepam(DB00842)|Phenelzine(DB00780)|Praziquantel(DB01058)|Rifampicin(DB01045)|Rifapentine(DB01201)|Testosterone(DB00624)|Troleandomycin(DB01361)|Zalcitabine(DB00943)	AGATATGTTGGTGAGAAGCCT	0.488																																							uc003urx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(469-471)GTG>TTG		cytochrome P450, family 3, subfamily A,	Cetirizine(DB00341)|Doxycycline(DB00254)						178.0	140.0	153.0					7																	99445825		2203	4300	6503	SO:0001583	missense	64816				xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding	g.chr7:99445825G>T	AF319634	CCDS5675.1, CCDS5676.1, CCDS5677.1, CCDS64723.1	7q21.1	2007-12-14	2003-01-14		ENSG00000021461	ENSG00000021461		"""Cytochrome P450s"""	17450	protein-coding gene	gene with protein product		606534	"""cytochrome P450, subfamily IIIA, polypeptide 43"""			11160876, 11266076	Standard	NM_022820		Approved		uc003ury.1	Q9HB55	OTTHUMG00000156498	ENST00000354829.2:c.469G>T	7.37:g.99445825G>T	ENSP00000346887:p.Val157Leu		Somatic				CYP3A43_uc003ury.1_Missense_Mutation_p.V157L|CYP3A43_uc003urz.1_Missense_Mutation_p.V157L|CYP3A43_uc003usa.1_RNA|CYP3A43_uc010lgi.1_Intron|CYP3A43_uc003usb.1_Missense_Mutation_p.G19V	p.V157L	NM_057095	NP_476436	WXS	Illumina HiSeq	Unspecified	Q9HB55	CP343_HUMAN			6	572	+	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)		157		Missing (in allele CYP3A43*2).			Q495Y1|Q75MK2|Q75MK3|Q9HB52|Q9HB53|Q9HB54|Q9HB57	Missense_Mutation	SNP	ENST00000354829.2	37	c.469G>T	CCDS5676.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.05|12.05	1.822718|1.822718	0.32237|0.32237	.|.	.|.	ENSG00000021461|ENSG00000021461	ENST00000342499|ENST00000354829;ENST00000312017;ENST00000222382	T|T;T;T	0.79554|0.66280	-1.28|-0.2;-0.2;-0.2	2.91|2.91	0.859|0.859	0.19036|0.19036	.|.	.|0.286251	.|0.32736	.|N	.|0.005701	T|T	0.52853|0.52853	0.1760|0.1760	M|M	0.68593|0.68593	2.085|2.085	0.28490|0.28490	N|N	0.914514|0.914514	B|B;B;B	0.28850|0.21606	0.225|0.058;0.046;0.022	B|B;B;B	0.36418|0.22880	0.224|0.031;0.042;0.02	T|T	0.50684|0.50684	-0.8799|-0.8799	9|10	0.87932|0.59425	D|D	0|0.04	.|.	3.8077|3.8077	0.08783|0.08783	0.146:0.0:0.6179:0.2361|0.146:0.0:0.6179:0.2361	.|.	19|157;157;157	F8W6L8|Q9HB55-3;Q75MK2;Q9HB55	.|.;.;CP343_HUMAN	V|L	19|157	ENSP00000345351:G19V|ENSP00000346887:V157L;ENSP00000312110:V157L;ENSP00000222382:V157L	ENSP00000345351:G19V|ENSP00000222382:V157L	G|V	+|+	2|1	0|0	CYP3A43|CYP3A43	99283761|99283761	1.000000|1.000000	0.71417|0.71417	0.103000|0.103000	0.21229|0.21229	0.384000|0.384000	0.30261|0.30261	0.547000|0.547000	0.23299|0.23299	0.036000|0.036000	0.15547|0.15547	0.205000|0.205000	0.17691|0.17691	GGT|GTG		0.488	CYP3A43-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000344379.1			7	14	1	0	1.06961e-07	0.00308	1.23803e-07	7	14				
MUC17	140453	broad.mit.edu	37	7	100675733	100675733	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:100675733G>T	ENST00000306151.4	+	3	1100	c.1036G>T	c.(1036-1038)Gtt>Ttt	p.V346F		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	346	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.V346F(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACCATGCCGGTTGCCACTTC	0.483																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(1036-1038)GTT>TTT		mucin 17 precursor							183.0	191.0	188.0					7																	100675733		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100675733G>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.1036G>T	7.37:g.100675733G>T	ENSP00000302716:p.Val346Phe		Somatic				MUC17_uc010lho.1_RNA	p.V346F	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	1089	+	Lung NSC(181;0.136)|all_lung(186;0.182)		346			Extracellular (Potential).|Ser-rich.|3.|59 X approximate tandem repeats.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.1036G>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	2.218	-0.379008	0.05000	.	.	ENSG00000169876	ENST00000306151	T	0.02763	4.17	1.21	-0.941	0.10402	.	.	.	.	.	T	0.01254	0.0041	N	0.08118	0	0.09310	N	1	P	0.50156	0.932	B	0.34824	0.19	T	0.51012	-0.8759	9	0.37606	T	0.19	.	5.5246	0.16951	0.3415:0.0:0.6585:0.0	.	346	Q685J3	MUC17_HUMAN	F	346	ENSP00000302716:V346F	ENSP00000302716:V346F	V	+	1	0	MUC17	100462453	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-2.311000	0.01128	-0.189000	0.10482	0.383000	0.25322	GTT		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		30	98	1	0	6.04164e-23	0.010818	9.04089e-23	30	98				
C7orf60	154743	broad.mit.edu	37	7	112462041	112462041	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:112462041T>C	ENST00000297145.4	-	5	1141	c.976A>G	c.(976-978)Aca>Gca	p.T326A	C7orf60_ENST00000485446.1_5'Flank	NM_152556.2	NP_689769.2	Q1RMZ1	BMT2_HUMAN	chromosome 7 open reading frame 60	326							rRNA (adenine) methyltransferase activity (GO:0016433)	p.T326A(1)		breast(1)|endometrium(2)|lung(7)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	17						AAGTCACTTGTGGTTTTTAGA	0.373																																							uc003vgo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(976-978)ACA>GCA		hypothetical protein LOC154743							61.0	55.0	57.0					7																	112462041		1815	4078	5893	SO:0001583	missense	154743							g.chr7:112462041T>C		CCDS43634.1	7q31.1	2011-01-11	2008-06-19		ENSG00000164603	ENSG00000164603			26475	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31818"""						Standard	NM_152556		Approved	DKFZp762M126, FLJ31818	uc003vgo.1	Q1RMZ1	OTTHUMG00000155233	ENST00000297145.4:c.976A>G	7.37:g.112462041T>C	ENSP00000297145:p.Thr326Ala		Somatic				C7orf60_uc011kms.1_Missense_Mutation_p.T352A	p.T326A	NM_152556	NP_689769	WXS	Illumina HiSeq	Unspecified	Q1RMZ1	CG060_HUMAN			5	1103	-			326					Q8N3D0|Q96MV7	Missense_Mutation	SNP	ENST00000297145.4	37	c.976A>G	CCDS43634.1	.	.	.	.	.	.	.	.	.	.	T	12.55	1.970982	0.34754	.	.	ENSG00000164603	ENST00000297145;ENST00000432572;ENST00000358032	.	.	.	5.92	5.92	0.95590	.	0.095006	0.64402	D	0.000001	T	0.63379	0.2506	L	0.44542	1.39	0.58432	D	0.999997	P;B	0.51791	0.948;0.136	P;B	0.54499	0.754;0.033	T	0.60571	-0.7237	9	0.33940	T	0.23	-3.335	16.3678	0.83341	0.0:0.0:0.0:1.0	.	273;326	B4DST1;Q1RMZ1	.;CG060_HUMAN	A	326;308;273	.	ENSP00000297145:T326A	T	-	1	0	C7orf60	112249277	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.254000	0.74563	0.528000	0.53228	ACA		0.373	C7orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338923.1	NM_152556		10	21	0	0	0	0.006214	0	10	21				
PTPRZ1	5803	broad.mit.edu	37	7	121653414	121653414	+	Silent	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:121653414C>A	ENST00000393386.2	+	12	4725	c.4314C>A	c.(4312-4314)tcC>tcA	p.S1438S	PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1438					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.S1438S(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ATGGCTTATCCATTCATAAGT	0.418																																							uc003vjy.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						c.(4312-4314)TCC>TCA		protein tyrosine phosphatase, receptor-type,							80.0	73.0	75.0					7																	121653414		2203	4300	6503	SO:0001819	synonymous_variant	5803				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:121653414C>A	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.4314C>A	7.37:g.121653414C>A			Somatic				PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	p.S1438S	NM_002851	NP_002842	WXS	Illumina HiSeq	Unspecified	P23471	PTPRZ_HUMAN			12	4709	+			1438			Extracellular (Potential).		A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	c.4314C>A	CCDS34740.1																																																																																				0.418	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		11	31	1	0	0.000673444	0.008291	0.000708978	11	31				
GRM8	2918	broad.mit.edu	37	7	126410120	126410120	+	Splice_Site	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:126410120C>A	ENST00000339582.2	-	7	1965		c.e7-1		GRM8_ENST00000358373.3_Splice_Site|GRM8_ENST00000444921.2_Splice_Site|GRM8_ENST00000405249.1_Splice_Site|GRM8_ENST00000480995.1_Splice_Site			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.?(2)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				CGCTCCAGCCCTGCAAAATAA	0.378										HNSCC(24;0.065)																													uc003vlr.2		NA																	2	Unknown(2)		lung(2)	lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23						c.e6-1		glutamate receptor, metabotropic 8 isoform a	L-Glutamic Acid(DB00142)						44.0	40.0	41.0					7																	126410120		2203	4300	6503	SO:0001630	splice_region_variant	2918				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		g.chr7:126410120C>A		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1157-1G>T	7.37:g.126410120C>A		HNSCC(24;0.065)	Somatic				GRM8_uc003vls.2_Splice_Site|GRM8_uc011kof.1_Splice_Site|GRM8_uc003vlt.2_Splice_Site_p.G386_splice|GRM8_uc010lkz.1_Splice_Site|GRM8_uc003vlu.1_Splice_Site_p.G107_splice	p.G386_splice	NM_000845	NP_000836	WXS	Illumina HiSeq	Unspecified	O00222	GRM8_HUMAN			6	1468	-		Prostate(267;0.186)						A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Splice_Site	SNP	ENST00000339582.2	37	c.1157_splice	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474613	0.43942	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2147	0.93772	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GRM8	126197356	1.000000	0.71417	0.977000	0.42913	0.221000	0.24807	7.814000	0.86154	2.769000	0.95229	0.655000	0.94253	.		0.378	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4		Intron	16	12	1	0	1.52009e-12	0.003163	1.97188e-12	16	12				
TRIM24	8805	broad.mit.edu	37	7	138189108	138189108	+	Silent	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:138189108G>A	ENST00000343526.4	+	2	653	c.438G>A	c.(436-438)aaG>aaA	p.K146K	TRIM24_ENST00000497516.1_3'UTR|TRIM24_ENST00000415680.2_Silent_p.K146K			O15164	TIF1A_HUMAN	tripartite motif containing 24	146					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K146N(2)|p.K146K(2)|p.K104N(1)|p.K104K(1)		breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						TTTTTGTGAAGGACACTACTG	0.373																																					Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)	Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)	uc003vuc.2		NA																	6	Substitution - Missense(3)|Substitution - coding silent(3)		lung(6)	central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						c.(436-438)AAG>AAA		transcriptional intermediary factor 1 alpha							110.0	109.0	109.0					7																	138189108		2203	4300	6503	SO:0001819	synonymous_variant	8805				cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr7:138189108G>A	AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.438G>A	7.37:g.138189108G>A			Somatic				TRIM24_uc003vub.2_Silent_p.K146K	p.K146K	NM_015905	NP_056989	WXS	Illumina HiSeq	Unspecified	O15164	TIF1A_HUMAN			2	653	+			146					A4D1R7|A4D1R8|O95854	Silent	SNP	ENST00000343526.4	37	c.438G>A	CCDS5847.1																																																																																				0.373	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341814.1	NM_015905		42	50	0	0	0	0.011902	0	42	50				
KMT2C	58508	broad.mit.edu	37	7	151962287	151962287	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:151962287T>A	ENST00000262189.6	-	8	1238	c.1020A>T	c.(1018-1020)gaA>gaT	p.E340D	KMT2C_ENST00000355193.2_Missense_Mutation_p.E340D	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	340					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E340D(2)									AGTTTGCATCTTCCTTCGCTA	0.368																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(1018-1020)GAA>GAT		myeloid/lymphoid or mixed-lineage leukemia 3							83.0	77.0	79.0					7																	151962287		2203	4299	6502	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151962287T>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1020A>T	7.37:g.151962287T>A	ENSP00000262189:p.Glu340Asp		Somatic					p.E340D	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	8	1239	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	340					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.1020A>T	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	T	6.160	0.397690	0.11696	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98876	-5.2;-5.2	4.65	3.5	0.40072	Zinc finger, RING/FYVE/PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.42821	U	0.000650	D	0.93514	0.7930	N	0.04335	-0.225	0.80722	D	1	B	0.27765	0.188	B	0.24974	0.057	D	0.89819	0.3987	10	0.31617	T	0.26	.	10.2628	0.43436	0.0:0.0789:0.0:0.9211	.	340	Q8NEZ4	MLL3_HUMAN	D	340	ENSP00000262189:E340D;ENSP00000347325:E340D	ENSP00000262189:E340D	E	-	3	2	MLL3	151593220	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	2.565000	0.45939	0.734000	0.32515	-0.385000	0.06624	GAA		0.368	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			5	94	0	0	0	0.00308	0	5	94				
CSMD1	64478	broad.mit.edu	37	8	2944645	2944645	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:2944645C>A	ENST00000520002.1	-	50	8006	c.7451G>T	c.(7450-7452)tGg>tTg	p.W2484L	CSMD1_ENST00000542608.1_Missense_Mutation_p.W2483L|CSMD1_ENST00000537824.1_Missense_Mutation_p.W2483L|CSMD1_ENST00000602723.1_Missense_Mutation_p.W2484L|CSMD1_ENST00000400186.3_Missense_Mutation_p.W2484L|CSMD1_ENST00000602557.1_Missense_Mutation_p.W2484L			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2484	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.W2483L(1)|p.W2212L(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GAGGGAGTCCCACTGGTACAT	0.478																																							uc011kwk.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(7450-7452)TGG>TTG		CUB and Sushi multiple domains 1 precursor							96.0	97.0	96.0					8																	2944645		2034	4186	6220	SO:0001583	missense	64478					integral to membrane		g.chr8:2944645C>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7451G>T	8.37:g.2944645C>A	ENSP00000430733:p.Trp2484Leu		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.W1813L|CSMD1_uc010lrg.2_Missense_Mutation_p.W552L	p.W2484L	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	49	7841	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2484			Sushi 14.|Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.7451G>T		.	.	.	.	.	.	.	.	.	.	C	19.08	3.758505	0.69763	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29	5.81	5.81	0.92471	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	D	0.92867	0.7731	M	0.94021	3.485	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.87578	0.998;0.997;0.998	D	0.93727	0.7038	10	0.66056	D	0.02	.	20.0543	0.97645	0.0:1.0:0.0:0.0	.	2484;2484;2483	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	L	2484;2484;2345;2483;2483	ENSP00000383047:W2484L;ENSP00000430733:W2484L;ENSP00000441462:W2483L;ENSP00000446243:W2483L	ENSP00000320445:W2345L	W	-	2	0	CSMD1	2932052	1.000000	0.71417	0.998000	0.56505	0.052000	0.14988	7.567000	0.82357	2.749000	0.94314	0.561000	0.74099	TGG		0.478	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		31	7	1	0	5.6714e-07	0.010818	6.40517e-07	31	7				
NEFM	4741	broad.mit.edu	37	8	24775339	24775339	+	Silent	SNP	G	G	T	rs371898352	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:24775339G>T	ENST00000221166.5	+	3	2753	c.1971G>T	c.(1969-1971)ccG>ccT	p.P657P	NEFM_ENST00000521540.1_Intron|NEFM_ENST00000437366.2_Intron|NEFM_ENST00000433454.2_Silent_p.P281P|NEFM_ENST00000518131.1_Intron			P07197	NFM_HUMAN	neurofilament, medium polypeptide	657	6 X 13 AA approximate tandem repeats of K-S-P-V-[PS]-K-S-P-V-E-E-[KA]-[GAK].|Tail.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)	p.P657P(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		CTCCTGTGCCGAAATCACCAG	0.502																																							uc003xed.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1969-1971)CCG>CCT		neurofilament, medium polypeptide 150kDa isoform							101.0	102.0	101.0					8																	24775339		2203	4300	6503	SO:0001819	synonymous_variant	4741					neurofilament	protein binding|structural constituent of cytoskeleton	g.chr8:24775339G>T	BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.1971G>T	8.37:g.24775339G>T			Somatic				NEFM_uc011lac.1_Intron|NEFM_uc010lue.2_Silent_p.P281P	p.P657P	NM_005382	NP_005373	WXS	Illumina HiSeq	Unspecified	P07197	NFM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)	3	2004	+		Prostate(55;0.157)	657			4.|6 X 13 AA approximate tandem repeats of K-S-P-V-[PS]-K-S-P-V-E-E-[KA]-[GAK].|Tail.		B4DGN2|E9PBF7|Q4QRK6	Silent	SNP	ENST00000221166.5	37	c.1971G>T	CCDS6046.1																																																																																				0.502	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254954.2	NM_005382		33	4	1	0	1.56442e-22	0.012213	2.30807e-22	33	4				
ADAM18	8749	broad.mit.edu	37	8	39587426	39587426	+	Silent	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:39587426C>A	ENST00000265707.5	+	20	2232	c.2187C>A	c.(2185-2187)tcC>tcA	p.S729S	ADAM18_ENST00000379866.1_Silent_p.S705S|ADAM18_ENST00000523755.1_3'UTR|ADAM18_ENST00000541111.1_Silent_p.S143S	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	729					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S729S(1)		NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			GTAATTCATCCGTTGTATCAG	0.308																																							uc003xni.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6						c.(2185-2187)TCC>TCA		a disintegrin and metalloprotease domain 18							129.0	123.0	125.0					8																	39587426		2203	4300	6503	SO:0001819	synonymous_variant	8749				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding	g.chr8:39587426C>A	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.2187C>A	8.37:g.39587426C>A			Somatic				ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Silent_p.S705S	p.S729S	NM_014237	NP_055052	WXS	Illumina HiSeq	Unspecified	Q9Y3Q7	ADA18_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.000199)		20	2187	+		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	729			Cytoplasmic (Potential).		B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Silent	SNP	ENST00000265707.5	37	c.2187C>A	CCDS6113.1																																																																																				0.308	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237		418	55	1	0	4.14718e-181	0.01441	6.86826e-181	418	55				
HOOK3	84376	broad.mit.edu	37	8	42865485	42865485	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:42865485G>C	ENST00000307602.4	+	19	1976	c.1776G>C	c.(1774-1776)aaG>aaC	p.K592N	HOOK3_ENST00000524839.1_3'UTR	NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	592	Required for association with Golgi.|Required for interaction with MSR1.				cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)	p.K592N(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			CTTTACGAAAGAAAGAGGAAG	0.279			T	RET	papillary thyroid																																		uc003xpr.2		NA		Dom	yes		8	8p11.21	84376	T	hook homolog 3			E	RET		papillary thyroid		1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1774-1776)AAG>AAC		golgi-associated microtubule-binding protein							51.0	47.0	48.0					8																	42865485		2203	4300	6503	SO:0001583	missense	84376				cytoplasmic microtubule organization|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|Golgi localization|interkinetic nuclear migration|lysosome organization|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome|protein transport	cis-Golgi network|FHF complex|microtubule|pericentriolar material	identical protein binding|microtubule binding	g.chr8:42865485G>C	AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.1776G>C	8.37:g.42865485G>C	ENSP00000305699:p.Lys592Asn		Somatic					p.K592N	NM_032410	NP_115786	WXS	Illumina HiSeq	Unspecified	Q86VS8	HOOK3_HUMAN	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)		19	2018	+	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	592			Potential.|Required for interaction with MSR1.|Required for association with Golgi.		D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	ENST00000307602.4	37	c.1776G>C	CCDS6139.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.748405	0.49257	.	.	ENSG00000168172	ENST00000307602;ENST00000533539	T;T	0.78246	2.1;-1.16	5.58	3.79	0.43588	.	0.000000	0.85682	D	0.000000	D	0.82770	0.5109	L	0.59436	1.845	0.58432	D	0.999999	D	0.76494	0.999	D	0.79784	0.993	T	0.79222	-0.1892	10	0.30854	T	0.27	-23.4165	8.8836	0.35389	0.3461:0.0:0.6539:0.0	.	592	Q86VS8	HOOK3_HUMAN	N	592;70	ENSP00000305699:K592N;ENSP00000433953:K70N	ENSP00000305699:K592N	K	+	3	2	HOOK3	42984642	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.652000	0.37313	0.827000	0.34685	0.585000	0.79938	AAG		0.279	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383172.2	NM_032410		5	44	0	0	0	0.001168	0	5	44				
ZFHX4	79776	broad.mit.edu	37	8	77763422	77763422	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:77763422G>T	ENST00000521891.2	+	10	4713	c.4265G>T	c.(4264-4266)cGg>cTg	p.R1422L	ZFHX4_ENST00000455469.2_Missense_Mutation_p.R1377L|ZFHX4_ENST00000518282.1_Missense_Mutation_p.R1396L|ZFHX4_ENST00000050961.6_Missense_Mutation_p.R1377L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.R1422L(1)|p.R1422Q(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CATGCAATTCGGGCTGCGACA	0.458										HNSCC(33;0.089)																													uc003yav.2		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(4129-4131)CGG>CTG		zinc finger homeodomain 4							53.0	49.0	50.0					8																	77763422		1917	4132	6049	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77763422G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4265G>T	8.37:g.77763422G>T	ENSP00000430497:p.Arg1422Leu	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.R1422L|ZFHX4_uc003yaw.1_Missense_Mutation_p.R1377L	p.R1377L	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	4517	+			1377					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.4130G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	17.17	3.319997	0.60634	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	4.94	4.94	0.65067	.	0.000000	0.40640	U	0.001059	T	0.60958	0.2309	M	0.82716	2.605	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.993;0.997;0.997	T	0.67130	-0.5748	10	0.87932	D	0	.	18.4109	0.90550	0.0:0.0:1.0:0.0	.	1377;1377;1422	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	L	1422;1422;1377;1377;1396	ENSP00000430497:R1422L;ENSP00000399605:R1377L;ENSP00000050961:R1377L;ENSP00000430848:R1396L	ENSP00000050961:R1377L	R	+	2	0	ZFHX4	77925977	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.657000	0.98554	2.589000	0.87451	0.549000	0.68633	CGG		0.458	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		11	10	1	0	3.86212e-05	0.008291	4.1923e-05	11	10				
ZFHX4	79776	broad.mit.edu	37	8	77764395	77764395	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:77764395G>T	ENST00000521891.2	+	10	5686	c.5238G>T	c.(5236-5238)acG>acT	p.T1746T	ZFHX4_ENST00000455469.2_Silent_p.T1701T|ZFHX4_ENST00000518282.1_Silent_p.T1720T|ZFHX4_ENST00000050961.6_Silent_p.T1701T	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1701	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.T1746T(2)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TACCTGGGACGGAGTTCAGCT	0.507										HNSCC(33;0.089)																													uc003yav.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(5101-5103)ACG>ACT		zinc finger homeodomain 4							54.0	52.0	52.0					8																	77764395		2049	4230	6279	SO:0001819	synonymous_variant	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77764395G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.5238G>T	8.37:g.77764395G>T		HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Silent_p.T1746T|ZFHX4_uc003yaw.1_Silent_p.T1701T	p.T1701T	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	5490	+			1701			Gln-rich.		G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	c.5103G>T	CCDS47878.2																																																																																				0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		14	29	1	0	5.01169e-05	0.00499	5.4261e-05	14	29				
MMP16	4325	broad.mit.edu	37	8	89209482	89209482	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:89209482C>T	ENST00000286614.6	-	2	467	c.186G>A	c.(184-186)gtG>gtA	p.V62V	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	62					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V62V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	CAGAGCGCAGCACTGACATTC	0.438																																							uc003yeb.3		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						c.(184-186)GTG>GTA		matrix metalloproteinase 16 isoform 1							102.0	85.0	91.0					8																	89209482		2203	4300	6503	SO:0001819	synonymous_variant	4325				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding	g.chr8:89209482C>T	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.186G>A	8.37:g.89209482C>T			Somatic				MMP16_uc003yec.2_Silent_p.V62V	p.V62V	NM_005941	NP_005932	WXS	Illumina HiSeq	Unspecified	P51512	MMP16_HUMAN			2	468	-			62					B2RAN7|Q14824|Q52H48	Silent	SNP	ENST00000286614.6	37	c.186G>A	CCDS6246.1																																																																																				0.438	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941		13	32	0	0	0	0.013537	0	13	32				
OXR1	55074	broad.mit.edu	37	8	107752609	107752609	+	Silent	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:107752609A>G	ENST00000442977.2	+	13	2304	c.2205A>G	c.(2203-2205)ccA>ccG	p.P735P	OXR1_ENST00000521592.1_5'UTR|OXR1_ENST00000531443.1_Silent_p.P707P|OXR1_ENST00000445937.1_Silent_p.P707P|OXR1_ENST00000517566.2_Silent_p.P734P|OXR1_ENST00000312046.6_Silent_p.P700P|OXR1_ENST00000449762.2_Silent_p.P77P|OXR1_ENST00000452423.2_Silent_p.P155P|OXR1_ENST00000297447.6_Silent_p.P104P	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	735	TLD.				adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)	p.P735P(1)|p.P619P(1)|p.P104P(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			TTGGCTATCCATGGACTCTTG	0.368																																							uc011lht.1		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(2203-2205)CCA>CCG		oxidation resistance 1 isoform 1							121.0	113.0	116.0					8																	107752609		2203	4299	6502	SO:0001819	synonymous_variant	55074				cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion		g.chr8:107752609A>G	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.2205A>G	8.37:g.107752609A>G			Somatic				OXR1_uc003ymf.2_Silent_p.P707P|OXR1_uc011lhu.1_Silent_p.P700P|OXR1_uc010mcg.2_RNA|OXR1_uc010mch.2_Silent_p.P363P|OXR1_uc003ymk.2_Silent_p.P104P|OXR1_uc003yml.2_Silent_p.P77P	p.P735P	NM_018002	NP_060472	WXS	Illumina HiSeq	Unspecified	Q8N573	OXR1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)		13	2304	+			735			TLD.		A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Silent	SNP	ENST00000442977.2	37	c.2205A>G	CCDS56548.1	.	.	.	.	.	.	.	.	.	.	A	9.861	1.196320	0.22037	.	.	ENSG00000164830	ENST00000519415	.	.	.	5.48	2.8	0.32819	.	.	.	.	.	T	0.57844	0.2081	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53121	-0.8483	4	.	.	.	-14.562	8.5309	0.33333	0.8048:0.0:0.0702:0.125	.	.	.	.	R	379	.	.	H	+	2	0	OXR1	107821785	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.220000	0.32491	0.909000	0.36697	0.533000	0.62120	CAT		0.368	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354		47	75	0	0	0	0.01441	0	47	75				
COL14A1	7373	broad.mit.edu	37	8	121262859	121262859	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:121262859C>G	ENST00000297848.3	+	22	2876	c.2606C>G	c.(2605-2607)cCt>cGt	p.P869R	COL14A1_ENST00000247781.3_Missense_Mutation_p.P774R|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.P869R	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.P869R(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TCTTTAGTTCCTGGTCCAACA	0.383																																							uc003yox.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(2605-2607)CCT>CGT		collagen, type XIV, alpha 1 precursor							99.0	92.0	94.0					8																	121262859		2203	4300	6503	SO:0001583	missense	7373				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	g.chr8:121262859C>G		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2606C>G	8.37:g.121262859C>G	ENSP00000297848:p.Pro869Arg		Somatic				COL14A1_uc003yoy.2_Missense_Mutation_p.P547R	p.P869R	NM_021110	NP_066933	WXS	Illumina HiSeq	Unspecified	Q05707	COEA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		22	2871	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		869			Fibronectin type-III 7.			Missense_Mutation	SNP	ENST00000297848.3	37	c.2606C>G	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.753907	0.49362	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.73	4.86	0.63082	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.290083	0.38663	N	0.001614	T	0.51736	0.1692	M	0.61703	1.905	0.80722	D	1	P;B	0.35527	0.507;0.317	B;B	0.38106	0.265;0.13	T	0.48151	-0.9060	10	0.17832	T	0.49	.	15.2456	0.73504	0.0:0.9324:0.0:0.0676	.	869;869	Q05707-2;Q05707	.;COEA1_HUMAN	R	869;869;774;682	ENSP00000311809:P869R;ENSP00000297848:P869R;ENSP00000247781:P774R;ENSP00000409461:P682R	ENSP00000247781:P774R	P	+	2	0	COL14A1	121332040	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	7.244000	0.78228	1.575000	0.49775	0.655000	0.94253	CCT		0.383	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		34	55	0	0	0	0.013726	0	34	55				
ZC3H3	23144	broad.mit.edu	37	8	144621365	144621365	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:144621365T>A	ENST00000262577.5	-	2	203	c.172A>T	c.(172-174)Agc>Tgc	p.S58C	7SK_ENST00000517300.1_RNA|RP11-661A12.5_ENST00000530600.1_RNA	NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	58					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.S58C(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CCCCTCCGGCTTGGACGAGGG	0.657																																							uc003yyd.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(172-174)AGC>TGC		zinc finger CCCH-type containing 3							64.0	61.0	62.0					8																	144621365		2201	4291	6492	SO:0001583	missense	23144				mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding	g.chr8:144621365T>A	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.172A>T	8.37:g.144621365T>A	ENSP00000262577:p.Ser58Cys		Somatic					p.S58C	NM_015117	NP_055932	WXS	Illumina HiSeq	Unspecified	Q8IXZ2	ZC3H3_HUMAN	Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)		2	201	-	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		58					Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	37	c.172A>T	CCDS6402.1	.	.	.	.	.	.	.	.	.	.	T	15.14	2.745321	0.49151	.	.	ENSG00000014164	ENST00000262577	T	0.03094	4.05	4.7	-2.53	0.06326	.	0.566251	0.17878	N	0.158952	T	0.03520	0.0101	L	0.57536	1.79	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.35549	-0.9784	10	0.39692	T	0.17	.	3.3604	0.07185	0.1182:0.4383:0.1339:0.3095	.	58	Q8IXZ2	ZC3H3_HUMAN	C	58	ENSP00000262577:S58C	ENSP00000262577:S58C	S	-	1	0	ZC3H3	144692508	0.000000	0.05858	0.051000	0.19133	0.766000	0.43426	-0.936000	0.03946	-0.404000	0.07610	0.533000	0.62120	AGC		0.657	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117		25	37	0	0	0	0.007291	0	25	37				
KLHL9	55958	broad.mit.edu	37	9	21333334	21333334	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr9:21333334A>G	ENST00000359039.4	-	1	2045	c.1525T>C	c.(1525-1527)Tat>Cat	p.Y509H	KLHL9_ENST00000537938.1_Missense_Mutation_p.Y441H			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	509					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)		p.Y509H(1)		endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		ACATCATCATAATCACTTGTT	0.453																																							uc003zoy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1525-1527)TAT>CAT		kelch-like 9							232.0	233.0	233.0					9																	21333334		2203	4300	6503	SO:0001583	missense	55958				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|midbody		g.chr9:21333334A>G	AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.1525T>C	9.37:g.21333334A>G	ENSP00000351933:p.Tyr509His		Somatic				KLHL9_uc003zow.2_Intron|KLHL9_uc003zox.2_RNA	p.Y509H	NM_018847	NP_061335	WXS	Illumina HiSeq	Unspecified	Q9P2J3	KLHL9_HUMAN		Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)	1	2096	-			509			Kelch 5.		Q8TCQ2	Missense_Mutation	SNP	ENST00000359039.4	37	c.1525T>C	CCDS6503.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.988108	0.53934	.	.	ENSG00000198642	ENST00000359039;ENST00000537938	T;T	0.77620	-1.11;-1.11	5.19	5.19	0.71726	Galactose oxidase, beta-propeller (1);	0.000000	0.64402	U	0.000001	T	0.80701	0.4673	L	0.37507	1.11	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.76187	-0.3051	10	0.16420	T	0.52	.	13.3152	0.60403	1.0:0.0:0.0:0.0	.	509	Q9P2J3	KLHL9_HUMAN	H	509;441	ENSP00000351933:Y509H;ENSP00000437733:Y441H	ENSP00000351933:Y509H	Y	-	1	0	KLHL9	21323334	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.241000	0.95402	2.094000	0.63399	0.533000	0.62120	TAT		0.453	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847		167	32	0	0	0	0.01441	0	167	32				
FRMPD1	22844	broad.mit.edu	37	9	37745436	37745436	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr9:37745436C>T	ENST00000539465.1	+	16	4000	c.3407C>T	c.(3406-3408)tCc>tTc	p.S1136F	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.S1136F			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1136						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.S1136F(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		TCAGGTGACTCCCCGGGTGAT	0.438																																							uc004aag.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(3406-3408)TCC>TTC		FERM and PDZ domain containing 1							60.0	62.0	61.0					9																	37745436		2203	4300	6503	SO:0001583	missense	22844					cytoskeleton|cytosol|plasma membrane		g.chr9:37745436C>T	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3407C>T	9.37:g.37745436C>T	ENSP00000444411:p.Ser1136Phe		Somatic				FRMPD1_uc004aah.1_Missense_Mutation_p.S1136F	p.S1136F	NM_014907	NP_055722	WXS	Illumina HiSeq	Unspecified	Q5SYB0	FRPD1_HUMAN		GBM - Glioblastoma multiforme(29;0.00655)	16	3451	+			1136					B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	c.3407C>T	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	C	9.626	1.135179	0.21123	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.07327	3.2;3.2	5.12	0.972	0.19704	.	2.988070	0.00567	N	0.000292	T	0.07007	0.0178	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35748	-0.9776	10	0.62326	D	0.03	0.9636	5.0971	0.14739	0.0:0.589:0.1488:0.2622	.	1136	Q5SYB0	FRPD1_HUMAN	F	1136	ENSP00000366995:S1136F;ENSP00000444411:S1136F	ENSP00000366995:S1136F	S	+	2	0	FRMPD1	37735436	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.013000	0.12678	0.182000	0.20032	-0.379000	0.06801	TCC		0.438	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		25	5	0	0	0	0.01892	0	25	5				
Unknown	0	broad.mit.edu	37	9	66499716	66499716	+	IGR	SNP	A	A	G	rs374942568		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr9:66499716A>G								RP11-262H14.1 (30406 upstream) : RP11-262H14.7 (17489 downstream)																							CCTGGAGCCCAATCTGCTGGA	0.607																																							uc004aee.1		NA																	0					0						c.(526-528)AAT>GAT		Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).																																				SO:0001628	intergenic_variant	442421							g.chr9:66499716A>G																													9.37:g.66499716A>G			Somatic				LOC442421_uc004aed.1_RNA	p.N176D			WXS	Illumina HiSeq	Unspecified					1	526	+									Missense_Mutation	SNP		37	c.526A>G																																																																																				0	0.607									8	55	0	0	0	0.006214	0	8	55				
ZNF883	169834	broad.mit.edu	37	9	115759674	115759674	+	lincRNA	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr9:115759674C>T	ENST00000427548.1	-	0	2139							P0CG24	ZN883_HUMAN	zinc finger protein 883						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GGGTTTCACACAAGAATGAAT	0.388																																							uc011lwy.1		NA																	0					0						c.(865-867)TGT>TAT		hypothetical protein LOC169834							190.0	206.0	201.0					9																	115759674		2104	4246	6350			169834				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:115759674C>T	AK095843		9q32	2010-07-23			ENSG00000228623	ENSG00000228623		"""Zinc fingers, C2H2-type"""	27271	protein-coding gene	gene with protein product							Standard	NM_001101338		Approved		uc011lwy.2	P0CG24	OTTHUMG00000020514		9.37:g.115759674C>T			Somatic					p.C289Y	NM_001101338	NP_001094808	WXS	Illumina HiSeq	Unspecified	P0CG24	ZN883_HUMAN			5	2105	-			289						Missense_Mutation	SNP	ENST00000427548.1	37	c.866G>A																																																																																					0.388	ZNF883-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000053704.1	NM_001101338		6	136	0	0	0	0.004482	0	6	136				
OR1J4	26219	broad.mit.edu	37	9	125281945	125281945	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr9:125281945C>A	ENST00000340750.1	+	1	526	c.526C>A	c.(526-528)Cat>Aat	p.H176N		NM_001004452.1	NP_001004452.1	Q8NGS1	OR1J4_HUMAN	olfactory receptor, family 1, subfamily J, member 4	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H176N(1)		large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	20						CACCATCCCCCATTTCTTCTG	0.507																																							uc011lyw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(526-528)CAT>AAT		olfactory receptor, family 1, subfamily J,							147.0	126.0	134.0					9																	125281945		2203	4300	6503	SO:0001583	missense	26219				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125281945C>A	X64979	CCDS35122.1	9q33.2	2013-09-20			ENSG00000239590	ENSG00000239590		"""GPCR / Class A : Olfactory receptors"""	8211	protein-coding gene	gene with protein product						1370859	Standard	NM_001004452		Approved	HTPCRX01, HSHTPCRX01	uc011lyw.2	Q8NGS1	OTTHUMG00000020606	ENST00000340750.1:c.526C>A	9.37:g.125281945C>A	ENSP00000343521:p.His176Asn		Somatic					p.H176N	NM_001004452	NP_001004452	WXS	Illumina HiSeq	Unspecified	Q8NGS1	OR1J4_HUMAN			1	526	+			176			Extracellular (Potential).		A3KFM0|Q6IEZ3|Q96R89	Missense_Mutation	SNP	ENST00000340750.1	37	c.526C>A	CCDS35122.1	.	.	.	.	.	.	.	.	.	.	C	7.112	0.576251	0.13686	.	.	ENSG00000239590	ENST00000340750	T	0.00164	8.64	5.54	4.64	0.57946	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36034	U	0.002837	T	0.00241	0.0007	M	0.76002	2.32	0.21950	N	0.999459	B	0.23490	0.086	B	0.33799	0.17	T	0.19095	-1.0316	10	0.62326	D	0.03	.	8.9167	0.35585	0.1515:0.7717:0.0:0.0768	.	176	Q8NGS1	OR1J4_HUMAN	N	176	ENSP00000343521:H176N	ENSP00000343521:H176N	H	+	1	0	OR1J4	124321766	0.002000	0.14202	0.601000	0.28877	0.033000	0.12548	0.622000	0.24433	1.572000	0.49736	-0.188000	0.12872	CAT		0.507	OR1J4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053936.1			35	13	1	0	4.34311e-12	0.015359	5.54805e-12	35	13				
OR1N2	138882	broad.mit.edu	37	9	125316138	125316138	+	Silent	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr9:125316138G>A	ENST00000373688.2	+	1	748	c.690G>A	c.(688-690)ctG>ctA	p.L230L		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L230L(1)		breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						CCCTCCTGCTGATCGTCTTCT	0.517																																							uc011lyx.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)	4						c.(688-690)CTG>CTA		olfactory receptor, family 1, subfamily N,							267.0	248.0	255.0					9																	125316138		2203	4300	6503	SO:0001819	synonymous_variant	138882				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125316138G>A		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.690G>A	9.37:g.125316138G>A			Somatic					p.L230L	NM_001004457	NP_001004457	WXS	Illumina HiSeq	Unspecified	Q8NGR9	OR1N2_HUMAN			1	690	+			230			Helical; Name=5; (Potential).		A3KFM2|B2RNY4|Q6IF17|Q96RA3	Silent	SNP	ENST00000373688.2	37	c.690G>A	CCDS35123.1																																																																																				0.517	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2			102	22	0	0	0	0.01441	0	102	22				
NUP188	23511	broad.mit.edu	37	9	131749115	131749115	+	Missense_Mutation	SNP	C	C	T	rs148207291		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr9:131749115C>T	ENST00000372577.2	+	22	2246	c.2225C>T	c.(2224-2226)gCg>gTg	p.A742V		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	742					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.A742V(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CTGATTCATGCGATACTGAAC	0.493																																							uc004bws.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						c.(2224-2226)GCG>GTG		nucleoporin 188kDa		C	VAL/ALA	0,4406		0,0,2203	117.0	103.0	108.0		2225	5.5	1.0	9	dbSNP_134	108	2,8598	2.2+/-6.3	0,2,4298	no	missense	NUP188	NM_015354.1	64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	742/1750	131749115	2,13004	2203	4300	6503	SO:0001583	missense	23511				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr9:131749115C>T	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.2225C>T	9.37:g.131749115C>T	ENSP00000361658:p.Ala742Val		Somatic				NUP188_uc004bwu.2_Missense_Mutation_p.A85V	p.A742V	NM_015354	NP_056169	WXS	Illumina HiSeq	Unspecified	Q5SRE5	NU188_HUMAN			22	2247	+			742					Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	c.2225C>T	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	C	33	5.224096	0.95139	0.0	2.33E-4	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.65178	-0.14	5.5	5.5	0.81552	.	0.047152	0.85682	D	0.000000	T	0.68054	0.2959	L	0.29908	0.895	0.80722	D	1	B;D	0.76494	0.056;0.999	B;D	0.81914	0.041;0.995	T	0.59413	-0.7459	10	0.10636	T	0.68	-26.7082	18.7416	0.91775	0.0:1.0:0.0:0.0	.	75;742	E9PET9;Q5SRE5	.;NU188_HUMAN	V	631;742	ENSP00000361658:A742V	ENSP00000349125:A631V	A	+	2	0	NUP188	130788936	1.000000	0.71417	0.978000	0.43139	0.957000	0.61999	7.256000	0.78350	2.739000	0.93911	0.561000	0.74099	GCG		0.493	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			4	50	0	0	0	0.014758	0	4	50				
PRRC2B	84726	broad.mit.edu	37	9	134351524	134351524	+	Silent	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr9:134351524A>G	ENST00000357304.4	+	15	4063	c.4008A>G	c.(4006-4008)gcA>gcG	p.A1336A	PRRC2B_ENST00000405995.1_Intron|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1336							poly(A) RNA binding (GO:0044822)	p.A1336A(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						ACCTGCTGGCAGGTCAGTGGC	0.677											OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004can.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(4006-4008)GCA>GCG		HLA-B associated transcript 2-like							25.0	31.0	29.0					9																	134351524		1894	4109	6003	SO:0001819	synonymous_variant	84726						protein binding	g.chr9:134351524A>G	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.4008A>G	9.37:g.134351524A>G			Somatic	OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1610	BAT2L1_uc010mzj.1_Silent_p.A919A|BAT2L1_uc004cao.3_Silent_p.A694A	p.A1336A	NM_013318	NP_037450	WXS	Illumina HiSeq	Unspecified	Q5JSZ5	PRC2B_HUMAN			15	4063	+			1336					O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Silent	SNP	ENST00000357304.4	37	c.4008A>G	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	A	0.195	-1.049872	0.01981	.	.	ENSG00000130723	ENST00000451855	.	.	.	5.66	-11.3	0.00108	.	.	.	.	.	T	0.42787	0.1218	.	.	.	0.51482	D	0.999924	.	.	.	.	.	.	T	0.64041	-0.6500	4	.	.	.	.	6.3867	0.21563	0.4856:0.3451:0.0641:0.1052	.	.	.	.	G	70	.	.	R	+	1	2	PRRC2B	133341345	0.000000	0.05858	0.000000	0.03702	0.173000	0.22820	-4.095000	0.00296	-5.159000	0.00020	-0.242000	0.12053	AGG		0.677	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				17	9	0	0	0	0.007413	0	17	9				
NOTCH1	4851	broad.mit.edu	37	9	139413252	139413252	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr9:139413252T>C	ENST00000277541.6	-	6	965	c.890A>G	c.(889-891)gAc>gGc	p.D297G	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	297	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D297G(2)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CTGGCACTCGTCCACATCCTC	0.637			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																													uc004chz.2		NA		Dom	yes		9	9q34.3	4851	T|Mis|O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""			L	TRB@		T-ALL		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856						c.(889-891)GAC>GGC		notch1 preproprotein							63.0	69.0	67.0					9																	139413252		2194	4295	6489	SO:0001583	missense	4851				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr9:139413252T>C	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.890A>G	9.37:g.139413252T>C	ENSP00000277541:p.Asp297Gly	HNSCC(8;0.001)	Somatic					p.D297G	NM_017617	NP_060087	WXS	Illumina HiSeq	Unspecified	P46531	NOTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)	6	890	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	297			Extracellular (Potential).|EGF-like 8; calcium-binding (Potential).		Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	c.890A>G	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.982814	0.93044	.	.	ENSG00000148400	ENST00000277541	D	0.95588	-3.75	5.3	5.3	0.74995	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.049906	0.85682	D	0.000000	D	0.97536	0.9193	M	0.89030	3	0.80722	D	1	D	0.55800	0.973	P	0.60068	0.868	D	0.98008	1.0364	10	0.59425	D	0.04	.	14.055	0.64761	0.0:0.0:0.0:1.0	.	297	P46531	NOTC1_HUMAN	G	297	ENSP00000277541:D297G	ENSP00000277541:D297G	D	-	2	0	NOTCH1	138533073	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.866000	0.87056	2.004000	0.58718	0.459000	0.35465	GAC		0.637	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		18	1	0	0	0	0.007413	0	18	1				
TUBBP5	643224	broad.mit.edu	37	9	141071154	141071154	+	RNA	SNP	T	T	C	rs202207360		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr9:141071154T>C	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5									p.V258A(1)									GTGAACATGGTCCCGTTTCCC	0.632																																							uc004com.2		NA																	1	Substitution - Missense(1)		endometrium(1)		0						c.(556-558)GTC>GCC		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141071154T>C	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071154T>C			Somatic				TUBBP5_uc010ncq.2_3'UTR	p.V186A			WXS	Illumina HiSeq	Unspecified					4	818	+									Missense_Mutation	SNP	ENST00000503395.1	37	c.557T>C																																																																																					0.632	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		8	17	0	0	0	0.00308	0	8	17				
FANCB	2187	broad.mit.edu	37	X	14863236	14863236	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:14863236C>G	ENST00000324138.3	-	7	1822	c.1669G>C	c.(1669-1671)Gat>Cat	p.D557H	FANCB_ENST00000398334.1_Missense_Mutation_p.D557H	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	557					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)		p.D557H(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					TTCTTGCTATCAGGGGTCAAC	0.388								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc004cwg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(1669-1671)GAT>CAT	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia complementation group B							102.0	90.0	94.0					X																	14863236		2203	4300	6503	SO:0001583	missense	2187	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	nucleoplasm		g.chrX:14863236C>G	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1669G>C	X.37:g.14863236C>G	ENSP00000326819:p.Asp557His		Somatic				FANCB_uc004cwh.1_Missense_Mutation_p.D557H	p.D557H	NM_001018113	NP_001018123	WXS	Illumina HiSeq	Unspecified	Q8NB91	FANCB_HUMAN			8	1937	-	Hepatocellular(33;0.183)		557					B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	ENST00000324138.3	37	c.1669G>C	CCDS14161.1	.	.	.	.	.	.	.	.	.	.	C	0.076	-1.193051	0.01607	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	5.15	-0.106	0.13596	.	1.028200	0.07714	N	0.942577	T	0.28962	0.0719	L	0.41236	1.265	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.23119	-1.0197	9	0.27082	T	0.32	-0.0908	2.8594	0.05582	0.1728:0.4497:0.204:0.1735	.	557	Q8NB91	FANCB_HUMAN	H	557	.	ENSP00000326819:D557H	D	-	1	0	FANCB	14773157	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	0.096000	0.15147	-0.601000	0.05783	0.523000	0.50628	GAT		0.388	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633		81	99	0	0	0	0.01441	0	81	99				
RAI2	10742	broad.mit.edu	37	X	17819005	17819005	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:17819005C>T	ENST00000545871.1	-	3	1586	c.1126G>A	c.(1126-1128)Gag>Aag	p.E376K	RAI2_ENST00000415486.3_Missense_Mutation_p.E326K|RAI2_ENST00000451717.1_Missense_Mutation_p.E376K|RAI2_ENST00000331511.1_Missense_Mutation_p.E376K|RAI2_ENST00000360011.1_Missense_Mutation_p.E376K	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	376					embryo development (GO:0009790)			p.E376K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					GGAAGTTTCTCCATCACTGTG	0.557																																							uc004cyf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1126-1128)GAG>AAG		retinoic acid induced 2							62.0	56.0	58.0					X																	17819005		2203	4300	6503	SO:0001583	missense	10742				embryo development			g.chrX:17819005C>T	Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.1126G>A	X.37:g.17819005C>T	ENSP00000444210:p.Glu376Lys		Somatic				RAI2_uc004cyg.2_Missense_Mutation_p.E376K|RAI2_uc010nfa.2_Missense_Mutation_p.E376K|RAI2_uc004cyh.3_Missense_Mutation_p.E376K|RAI2_uc011miy.1_Missense_Mutation_p.E326K	p.E376K	NM_021785	NP_068557	WXS	Illumina HiSeq	Unspecified	Q9Y5P3	RAI2_HUMAN			3	1696	-	Hepatocellular(33;0.183)		376					B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	ENST00000545871.1	37	c.1126G>A	CCDS14183.1	.	.	.	.	.	.	.	.	.	.	c	8.276	0.814476	0.16607	.	.	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717;ENST00000415486	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	4.93	4.06	0.47325	.	0.574842	0.16349	N	0.218286	T	0.21674	0.0522	L	0.34521	1.04	0.26841	N	0.968368	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.13926	-1.0491	10	0.35671	T	0.21	-18.3131	7.3942	0.26927	0.0:0.7321:0.0:0.2679	.	326;376	E7EMN4;Q9Y5P3	.;RAI2_HUMAN	K	376;376;376;376;326	ENSP00000333456:E376K;ENSP00000353106:E376K;ENSP00000444210:E376K;ENSP00000401323:E376K;ENSP00000392578:E326K	ENSP00000333456:E376K	E	-	1	0	RAI2	17728926	0.945000	0.32115	0.865000	0.33974	0.060000	0.15804	1.977000	0.40589	1.053000	0.40415	0.597000	0.82753	GAG		0.557	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055937.1	NM_021785		24	43	0	0	0	0.016522	0	24	43				
BEND2	139105	broad.mit.edu	37	X	18221854	18221854	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:18221854C>G	ENST00000380033.4	-	5	806	c.674G>C	c.(673-675)gGc>gCc	p.G225A	BEND2_ENST00000380030.3_Missense_Mutation_p.G225A	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	225								p.G225A(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						AGGAAATGAGCCACCTTGTGC	0.453																																							uc004cyj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(673-675)GGC>GCC		BEN domain containing 2							175.0	140.0	152.0					X																	18221854		2203	4300	6503	SO:0001583	missense	139105							g.chrX:18221854C>G	AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.674G>C	X.37:g.18221854C>G	ENSP00000369372:p.Gly225Ala		Somatic				BEND2_uc010nfb.2_Missense_Mutation_p.G225A	p.G225A	NM_153346	NP_699177	WXS	Illumina HiSeq	Unspecified	Q8NDZ0	BEND2_HUMAN			5	828	-			225					E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	ENST00000380033.4	37	c.674G>C	CCDS14184.1	.	.	.	.	.	.	.	.	.	.	C	8.503	0.864684	0.17250	.	.	ENSG00000177324	ENST00000380033;ENST00000380030	T;T	0.24151	1.92;1.87	3.59	-0.153	0.13403	.	0.526148	0.15571	N	0.255437	T	0.10723	0.0262	N	0.14661	0.345	0.09310	N	1	B;P	0.34977	0.3;0.478	B;B	0.28553	0.067;0.091	T	0.19484	-1.0304	10	0.34782	T	0.22	-0.6296	5.8547	0.18712	0.0:0.3748:0.0:0.6252	.	225;225	E9PFY2;Q8NDZ0	.;BEND2_HUMAN	A	225	ENSP00000369372:G225A;ENSP00000369369:G225A	ENSP00000369369:G225A	G	-	2	0	BEND2	18131775	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.126000	0.03254	-0.004000	0.14419	0.436000	0.28706	GGC		0.453	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346		21	122	0	0	0	0.014323	0	21	122				
PPEF1	5475	broad.mit.edu	37	X	18836203	18836203	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:18836203G>A	ENST00000361511.4	+	16	1935	c.1441G>A	c.(1441-1443)Gtg>Atg	p.V481M	PPEF1_ENST00000544635.1_Missense_Mutation_p.V416M|PPEF1_ENST00000543630.1_Missense_Mutation_p.S371N|PPEF1_ENST00000349874.5_Missense_Mutation_p.V419M|PPEF1_ENST00000359763.6_Missense_Mutation_p.V428M	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	481					detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)	p.V481M(1)		breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					AAGAGAGAGAGTGATTTCACG	0.348																																							uc004cyq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1441-1443)GTG>ATG		protein phosphatase with EF hand calcium-binding							128.0	113.0	118.0					X																	18836203		2203	4300	6503	SO:0001583	missense	5475				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity	g.chrX:18836203G>A	BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1441G>A	X.37:g.18836203G>A	ENSP00000354871:p.Val481Met		Somatic				PPEF1_uc004cyp.2_Missense_Mutation_p.V453M|PPEF1_uc004cyr.2_Missense_Mutation_p.V419M|PPEF1_uc004cys.2_Missense_Mutation_p.V481M|PPEF1_uc011mja.1_Missense_Mutation_p.V416M|PPEF1_uc011mjb.1_Missense_Mutation_p.V425M	p.V481M	NM_006240	NP_006231	WXS	Illumina HiSeq	Unspecified	O14829	PPE1_HUMAN			16	1922	+	Hepatocellular(33;0.183)		481					A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	ENST00000361511.4	37	c.1441G>A	CCDS14188.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.634|1.634	-0.518115|-0.518115	0.04171|0.04171	.|.	.|.	ENSG00000086717|ENSG00000086717	ENST00000543630|ENST00000361511;ENST00000359763;ENST00000349874;ENST00000544635	T|T;T;T;T	0.24350|0.06687	1.86|3.27;3.27;3.27;3.27	5.23|5.23	-0.8|-0.8	0.10897|0.10897	.|.	.|1.250810	.|0.05390	.|N	.|0.538901	T|T	0.02767|0.02767	0.0083|0.0083	N|N	0.01188|0.01188	-0.97|-0.97	0.25727|0.25727	N|N	0.985318|0.985318	.|B;B;B	.|0.09022	.|0.002;0.002;0.001	.|B;B;B	.|0.09377	.|0.003;0.002;0.004	T|T	0.42832|0.42832	-0.9428|-0.9428	6|10	.|0.25106	.|T	.|0.35	-0.9249|-0.9249	5.1385|5.1385	0.14947|0.14947	0.5547:0.28:0.1653:0.0|0.5547:0.28:0.1653:0.0	.|.	.|419;481;453	.|O14829-5;O14829;O14829-3	.|.;PPE1_HUMAN;.	N|M	371|481;428;419;416	ENSP00000437785:S371N|ENSP00000354871:V481M;ENSP00000352806:V428M;ENSP00000341892:V419M;ENSP00000441289:V416M	.|ENSP00000341892:V419M	S|V	+|+	2|1	0|0	PPEF1|PPEF1	18746124|18746124	0.993000|0.993000	0.37304|0.37304	0.525000|0.525000	0.27900|0.27900	0.025000|0.025000	0.11179|0.11179	0.488000|0.488000	0.22371|0.22371	-0.041000|-0.041000	0.13558|0.13558	-0.735000|-0.735000	0.03563|0.03563	AGT|GTG		0.348	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3	NM_006240		52	75	0	0	0	0.01441	0	52	75				
SUPT20HL1	100130302	broad.mit.edu	37	X	24382893	24382893	+	IGR	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:24382893G>T								AC004552.1 (15870 upstream) : PDK3 (100444 downstream)														p.Q677H(1)									CACCCCTTCAGTTTTTCCTAA	0.602																																							uc011mjx.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(2014-2016)CAG>CAT		hypothetical protein LOC100130302							45.0	43.0	43.0					X																	24382893		1568	3580	5148	SO:0001628	intergenic_variant	100130302							g.chrX:24382893G>T																													X.37:g.24382893G>T			Somatic					p.Q672H	NM_001136234	NP_001129706	WXS	Illumina HiSeq	Unspecified					1	2016	+									Missense_Mutation	SNP		37	c.2016G>T																																																																																				0	0.602									28	34	1	0	1.08312e-15	0.009535	1.49285e-15	28	34				
IL1RAPL1	11141	broad.mit.edu	37	X	29973708	29973708	+	Missense_Mutation	SNP	A	A	G	rs371810135		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:29973708A>G	ENST00000378993.1	+	11	2535	c.1862A>G	c.(1861-1863)cAg>cGg	p.Q621R	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.Q621R	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	621	Interaction with NCS1.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.Q621R(2)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						CAAATGCGTCAGAAACACTAC	0.527																																							uc004dby.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(1)|pancreas(1)	5						c.(1861-1863)CAG>CGG		interleukin 1 receptor accessory protein-like 1		A	ARG/GLN	0,3833		0,0,1631,571	92.0	42.0	59.0		1862	5.1	1.0	X		59	1,6726		0,1,2427,1871	no	missense	IL1RAPL1	NM_014271.3	43	0,1,4058,2442	GG,GA,AA,A		0.0149,0.0,0.0095	possibly-damaging	621/697	29973708	1,10559	2202	4299	6501	SO:0001583	missense	11141				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity	g.chrX:29973708A>G	AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1862A>G	X.37:g.29973708A>G	ENSP00000368278:p.Gln621Arg		Somatic					p.Q621R	NM_014271	NP_055086	WXS	Illumina HiSeq	Unspecified	Q9NZN1	IRPL1_HUMAN			11	2370	+			621			Cytoplasmic (Potential).|Interaction with NCS1.		A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	c.1862A>G	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.320635	0.23994	0.0	1.49E-4	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.04049	3.72;3.72	5.12	5.12	0.69794	.	0.115379	0.64402	D	0.000008	T	0.05410	0.0143	L	0.41236	1.265	0.51767	D	0.999935	B	0.14805	0.011	B	0.12156	0.007	T	0.38714	-0.9648	9	.	.	.	.	12.6539	0.56776	1.0:0.0:0.0:0.0	.	621	Q9NZN1	IRPL1_HUMAN	R	621	ENSP00000368278:Q621R;ENSP00000305200:Q621R	.	Q	+	2	0	IL1RAPL1	29883629	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.962000	0.93254	1.700000	0.51204	0.430000	0.28490	CAG		0.527	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271		7	12	0	0	0	0.001984	0	7	12				
MAGEB16	139604	broad.mit.edu	37	X	35821060	35821060	+	Silent	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:35821060C>A	ENST00000399989.1	+	2	1026	c.747C>A	c.(745-747)ctC>ctA	p.L249L	MAGEB16_ENST00000399987.1_Silent_p.L249L|MAGEB16_ENST00000399985.1_Silent_p.L249L|MAGEB16_ENST00000399992.1_Silent_p.L281L|MAGEB16_ENST00000399988.1_Silent_p.L249L	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	249	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.L416L(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						CCAGAATGCTCATCACCAAAG	0.502																																							uc010ngt.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|ovary(2)|breast(1)|skin(1)	7						c.(745-747)CTC>CTA		melanoma antigen family B, 16							43.0	42.0	42.0					X																	35821060		2166	4286	6452	SO:0001819	synonymous_variant	139604							g.chrX:35821060C>A		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.747C>A	X.37:g.35821060C>A			Somatic					p.L249L	NM_001099921	NP_001093391	WXS	Illumina HiSeq	Unspecified	A2A368	MAGBG_HUMAN			2	1026	+			249			MAGE.		A8MU30	Silent	SNP	ENST00000399989.1	37	c.747C>A	CCDS43927.1																																																																																				0.502	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1			4	16	1	0	3.32936e-07	0.006122	3.77027e-07	4	16				
CXorf38	159013	broad.mit.edu	37	X	40496313	40496313	+	Silent	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:40496313C>G	ENST00000327877.5	-	4	593	c.567G>C	c.(565-567)ctG>ctC	p.L189L	CXorf38_ENST00000440784.2_Silent_p.L104L|CXorf38_ENST00000378426.1_Silent_p.L70L|CXorf38_ENST00000378421.1_Silent_p.L70L	NM_144970.2	NP_659407.1	Q8TB03	CX038_HUMAN	chromosome X open reading frame 38	189								p.L189L(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	12						TGAATTCATTCAGAAAATTTT	0.363																																							uc004dew.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(565-567)CTG>CTC		hypothetical protein LOC159013							72.0	67.0	69.0					X																	40496313		2202	4300	6502	SO:0001819	synonymous_variant	159013							g.chrX:40496313C>G	AL832829	CCDS14253.1	Xp11	2008-02-05			ENSG00000185753	ENSG00000185753			28589	protein-coding gene	gene with protein product							Standard	NM_144970		Approved	MGC39350	uc004dew.3	Q8TB03	OTTHUMG00000024104	ENST00000327877.5:c.567G>C	X.37:g.40496313C>G			Somatic				CXorf38_uc011mko.1_Silent_p.L104L|CXorf38_uc004dev.1_Silent_p.L70L|CXorf38_uc010nhd.2_RNA	p.L189L	NM_144970	NP_659407	WXS	Illumina HiSeq	Unspecified	Q8TB03	CX038_HUMAN			4	572	-			189					B3KW28|D3DWB5|Q5JPF5|Q8N941	Silent	SNP	ENST00000327877.5	37	c.567G>C	CCDS14253.1																																																																																				0.363	CXorf38-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060685.3	NM_144970		52	57	0	0	0	0.01441	0	52	57				
WAS	7454	broad.mit.edu	37	X	48547174	48547174	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:48547174C>A	ENST00000376701.4	+	10	1132	c.1057C>A	c.(1057-1059)Cca>Aca	p.P353T		NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	353	Poly-Pro.				actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)	p.P353T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				TGCCCCACCCCCACCAACACC	0.692			"""Mis, N, F, S"""			lymphoma																																	uc004dkm.3		NA		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Mis|N|F|S	Wiskott-Aldrich syndrome			L		lymphoma			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1057-1059)CCA>ACA		Wiskott-Aldrich syndrome protein							5.0	5.0	5.0					X																	48547174		2105	4020	6125	SO:0001583	missense	7454	Wiskott-Aldrich_syndrome			blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity	g.chrX:48547174C>A	AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.1057C>A	X.37:g.48547174C>A	ENSP00000365891:p.Pro353Thr		Somatic					p.P353T	NM_000377	NP_000368	WXS	Illumina HiSeq	Unspecified	P42768	WASP_HUMAN			10	1114	+		all_lung(315;1.27e-10)	353			Poly-Pro.		Q9BU11|Q9UNJ9	Missense_Mutation	SNP	ENST00000376701.4	37	c.1057C>A	CCDS14303.1	.	.	.	.	.	.	.	.	.	.	C	9.510	1.105613	0.20632	.	.	ENSG00000015285	ENST00000376701	D	0.97352	-4.35	4.3	4.3	0.51218	Wiscott-Aldrich syndrome, C-terminal (1);	0.060286	0.64402	D	0.000003	D	0.96349	0.8809	M	0.68952	2.095	0.44652	D	0.99763	P	0.48162	0.906	P	0.46585	0.521	D	0.96047	0.9028	10	0.51188	T	0.08	-7.2668	13.5832	0.61915	0.0:1.0:0.0:0.0	.	353	P42768	WASP_HUMAN	T	353	ENSP00000365891:P353T	ENSP00000365891:P353T	P	+	1	0	WAS	48432118	0.906000	0.30813	0.447000	0.26932	0.381000	0.30169	3.290000	0.51755	1.858000	0.53909	0.464000	0.42555	CCA		0.692	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083379.1	NM_000377		3	2	1	0	6.4e-05	0.004672	6.89509e-05	3	2				
OTUD5	55593	broad.mit.edu	37	X	48780529	48780529	+	Silent	SNP	C	C	A	rs138137225		TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:48780529C>A	ENST00000156084.4	-	9	1698	c.1638G>T	c.(1636-1638)ctG>ctT	p.L546L	OTUD5_ENST00000376488.3_Silent_p.L541L|OTUD5_ENST00000396743.3_Silent_p.L541L|OTUD5_ENST00000428668.2_Silent_p.L324L|OTUD5_ENST00000484499.1_5'Flank	NM_017602.3	NP_060072.1	Q96G74	OTUD5_HUMAN	OTU deubiquitinase 5	546					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)	ubiquitin-specific protease activity (GO:0004843)	p.L517L(1)|p.L546L(1)		endometrium(2)|large_intestine(3)|lung(6)|pancreas(2)	13						GGGACACTGCCAGCACCGAAG	0.532																																							uc004dlu.2		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)	1						c.(1636-1638)CTG>CTT		OTU domain containing 5 isoform a		C	,,,	0,3835		0,0,1632,571	139.0	107.0	118.0		1623,1623,972,1638	5.0	1.0	X	dbSNP_134	118	1,6727		0,1,2427,1872	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	OTUD5	NM_001136157.1,NM_001136158.1,NM_001136159.1,NM_017602.3	,,,	0,1,4059,2443	AA,AC,CC,C		0.0149,0.0,0.0095	,,,	541/567,541/567,324/350,546/572	48780529	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	55593				negative regulation of type I interferon production		cysteine-type peptidase activity	g.chrX:48780529C>A		CCDS14313.1, CCDS48104.1, CCDS48105.1	Xp11.23	2014-06-09	2014-02-24		ENSG00000068308	ENSG00000068308		"""OTU domain containing"""	25402	protein-coding gene	gene with protein product		300713	"""OTU domain containing 5"""			24143256	Standard	NM_001136157		Approved	DKFZp761A052, DUBA	uc004dlu.3	Q96G74	OTTHUMG00000024130	ENST00000156084.4:c.1638G>T	X.37:g.48780529C>A			Somatic				OTUD5_uc004dlt.3_Silent_p.L541L|OTUD5_uc004dlv.2_Silent_p.L541L|OTUD5_uc011mmp.1_Silent_p.L324L	p.L546L	NM_017602	NP_060072	WXS	Illumina HiSeq	Unspecified	Q96G74	OTUD5_HUMAN			9	1699	-			546					B4DGG7|G5E9D7|Q4KMN9|Q8N6T5|Q9H650|Q9H9U0|Q9NT65	Silent	SNP	ENST00000156084.4	37	c.1638G>T	CCDS14313.1																																																																																				0.532	OTUD5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000060799.1	NM_017602		23	39	1	0	0.00047179	0.01892	0.000499192	23	39				
GPKOW	27238	broad.mit.edu	37	X	48972658	48972658	+	Silent	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:48972658G>C	ENST00000156109.5	-	7	1011	c.933C>G	c.(931-933)gcC>gcG	p.A311A		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	311						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.A311A(1)		breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						TCCGTGATGAGGCAGTTCCGT	0.537																																							uc004dmr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(931-933)GCC>GCG		G patch domain and KOW motifs							273.0	205.0	228.0					X																	48972658		2203	4300	6503	SO:0001819	synonymous_variant	27238					nucleus	nucleic acid binding	g.chrX:48972658G>C	U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.933C>G	X.37:g.48972658G>C			Somatic					p.A311A	NM_015698	NP_056513	WXS	Illumina HiSeq	Unspecified	Q92917	GPKOW_HUMAN			7	940	-			311					Q59EK5|Q9BQA8	Silent	SNP	ENST00000156109.5	37	c.933C>G	CCDS35251.1																																																																																				0.537	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056535.2	NM_015698		23	40	0	0	0	0.021523	0	23	40				
PRICKLE3	4007	broad.mit.edu	37	X	49034397	49034397	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:49034397G>T	ENST00000376317.3	-	7	994	c.900C>A	c.(898-900)tgC>tgA	p.C300*	PRICKLE3_ENST00000536904.1_Nonsense_Mutation_p.C219*|PRICKLE3_ENST00000540849.1_Nonsense_Mutation_p.C232*|PRICKLE3_ENST00000538114.1_Intron	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	300	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)	p.C300*(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						CGTAGCAGGCGCAGCAGTGGG	0.617																																							uc004dmy.1		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(1)	1						c.(898-900)TGC>TGA		LIM domain only 6							47.0	45.0	46.0					X																	49034397		2203	4299	6502	SO:0001587	stop_gained	4007						protein binding|zinc ion binding	g.chrX:49034397G>T	BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.900C>A	X.37:g.49034397G>T	ENSP00000365494:p.Cys300*		Somatic				PRICKLE3_uc011mmv.1_Nonsense_Mutation_p.C232*|PRICKLE3_uc011mmw.1_Nonsense_Mutation_p.C219*|PRICKLE3_uc011mmx.1_Nonsense_Mutation_p.C262*|PRICKLE3_uc011mmy.1_Nonsense_Mutation_p.C287*	p.C300*	NM_006150	NP_006141	WXS	Illumina HiSeq	Unspecified	O43900	PRIC3_HUMAN			7	926	-			300			LIM zinc-binding 2.		B7Z8F2|O76007|Q53XR5	Nonsense_Mutation	SNP	ENST00000376317.3	37	c.900C>A	CCDS14320.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.02|16.02	3.004857|3.004857	0.54254|0.54254	.|.	.|.	ENSG00000012211|ENSG00000012211	ENST00000376317;ENST00000536904;ENST00000540849|ENST00000453382;ENST00000432913	.|.	.|.	.|.	4.99|4.99	-3.5|-3.5	0.04710|0.04710	.|.	0.000000|.	0.41396|.	D|.	0.000895|.	.|T	.|0.36717	.|0.0977	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.45862	.|-0.9232	.|3	0.02654|.	T|.	1|.	-14.0787|-14.0787	8.1453|8.1453	0.31108|0.31108	0.5827:0.1132:0.3041:0.0|0.5827:0.1132:0.3041:0.0	.|.	.|.	.|.	.|.	X|S	300;219;232|313;311	.|.	ENSP00000365494:C300X|.	C|R	-|-	3|1	2|0	PRICKLE3|PRICKLE3	48921341|48921341	0.003000|0.003000	0.15002|0.15002	0.129000|0.129000	0.21949|0.21949	0.823000|0.823000	0.46562|0.46562	0.033000|0.033000	0.13754|0.13754	-0.839000|-0.839000	0.04212|0.04212	0.416000|0.416000	0.27883|0.27883	TGC|CGC		0.617	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060811.1	NM_006150		14	25	1	0	0.00244969	0.020292	0.00254065	14	25				
GSPT2	23708	broad.mit.edu	37	X	51486783	51486783	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:51486783G>T	ENST00000340438.4	+	1	303	c.61G>T	c.(61-63)Gaa>Taa	p.E21*		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	21					cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.E21*(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					GGTGGACATGGAATCCCCGGG	0.677																																							uc004dpl.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(61-63)GAA>TAA		peptide chain release factor 3							23.0	27.0	26.0					X																	51486783		2202	4293	6495	SO:0001587	stop_gained	23708				cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|translational termination	cytoplasm	GTP binding|GTPase activity|protein binding	g.chrX:51486783G>T	AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.61G>T	X.37:g.51486783G>T	ENSP00000341247:p.Glu21*		Somatic					p.E21*	NM_018094	NP_060564	WXS	Illumina HiSeq	Unspecified	Q8IYD1	ERF3B_HUMAN			1	287	+	Ovarian(276;0.236)		21					Q9H909|Q9NVY0|Q9NY44	Nonsense_Mutation	SNP	ENST00000340438.4	37	c.61G>T	CCDS14336.1	.	.	.	.	.	.	.	.	.	.	G	37	6.239845	0.97403	.	.	ENSG00000189369	ENST00000340438	.	.	.	3.83	3.83	0.44106	.	0.456457	0.19720	N	0.107608	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-1.1824	12.7794	0.57469	0.0:0.0:1.0:0.0	.	.	.	.	X	21	.	ENSP00000341247:E21X	E	+	1	0	GSPT2	51503523	1.000000	0.71417	0.976000	0.42696	0.653000	0.38743	4.844000	0.62846	2.171000	0.68590	0.519000	0.50382	GAA		0.677	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056587.1			10	23	1	0	0.000978159	0.010729	0.00102462	10	23				
TRO	7216	broad.mit.edu	37	X	54949157	54949157	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:54949157C>A	ENST00000173898.7	+	3	304	c.192C>A	c.(190-192)aaC>aaA	p.N64K	TRO_ENST00000319167.8_Missense_Mutation_p.N64K|TRO_ENST00000375041.2_Intron|TRO_ENST00000420798.2_Intron|TRO_ENST00000484031.1_Intron|TRO_ENST00000375022.4_Missense_Mutation_p.N64K|TRO_ENST00000399736.1_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	64					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.N64K(2)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CAGTTGTCAACCGGCCTAAGA	0.537																																							uc004dtq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(190-192)AAC>AAA		trophinin isoform 5							40.0	41.0	41.0					X																	54949157		1940	4140	6080	SO:0001583	missense	7216				embryo implantation|homophilic cell adhesion	integral to plasma membrane		g.chrX:54949157C>A	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.192C>A	X.37:g.54949157C>A	ENSP00000173898:p.Asn64Lys		Somatic				TRO_uc011moj.1_Missense_Mutation_p.N7K|TRO_uc004dts.2_Missense_Mutation_p.N64K|TRO_uc004dtr.2_Missense_Mutation_p.N64K|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Intron|TRO_uc004dtw.2_Intron|TRO_uc004dtx.2_5'Flank	p.N64K	NM_001039705	NP_001034794	WXS	Illumina HiSeq	Unspecified	Q12816	TROP_HUMAN			3	299	+			64					B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	c.192C>A	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	C	3.755	-0.050700	0.07407	.	.	ENSG00000067445	ENST00000411534;ENST00000452830;ENST00000430420;ENST00000442098;ENST00000173898;ENST00000319167;ENST00000453081;ENST00000375022;ENST00000440759;ENST00000449980;ENST00000416704;ENST00000427099	T;T;T;T;T;T;T;T;T;T;T;T	0.53423	0.7;0.66;0.69;0.72;3.73;3.52;0.62;3.52;0.72;0.71;0.72;0.7	3.15	1.28	0.21552	.	.	.	.	.	T	0.27731	0.0682	N	0.19112	0.55	0.09310	N	1	B;B	0.24651	0.108;0.084	B;B	0.18871	0.023;0.021	T	0.22521	-1.0214	9	0.72032	D	0.01	.	3.094	0.06303	0.2637:0.5838:0.0:0.1526	.	64;64	Q96SX2;Q12816	.;TROP_HUMAN	K	20;20;20;64;64;64;20;64;64;20;64;20	ENSP00000388947:N20K;ENSP00000387676:N20K;ENSP00000411717:N20K;ENSP00000404645:N64K;ENSP00000173898:N64K;ENSP00000318278:N64K;ENSP00000412588:N20K;ENSP00000364162:N64K;ENSP00000406574:N64K;ENSP00000392841:N20K;ENSP00000404767:N64K;ENSP00000405311:N20K	ENSP00000173898:N64K	N	+	3	2	TRO	54965882	0.703000	0.27826	0.077000	0.20336	0.182000	0.23217	1.037000	0.30241	0.189000	0.20188	0.506000	0.49869	AAC		0.537	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157		7	12	1	0	0.000157383	0.00308	0.000167795	7	12				
MTMR8	55613	broad.mit.edu	37	X	63488738	63488738	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:63488738C>T	ENST00000374852.3	-	14	1861	c.1794G>A	c.(1792-1794)atG>atA	p.M598I	MTMR8_ENST00000453546.1_Intron	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	598						nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(2)|p.M598I(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						TTACTTGATCCATCTGAGCTC	0.507																																							uc004dvs.2		NA																	3	Whole gene deletion(2)|Substitution - Missense(1)		ovary(1)|lung(1)|large_intestine(1)	ovary(2)|breast(2)	4						c.(1792-1794)ATG>ATA		myotubularin related protein 8							80.0	61.0	68.0					X																	63488738		2203	4300	6503	SO:0001583	missense	55613					nuclear envelope	protein tyrosine phosphatase activity	g.chrX:63488738C>T	AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.1794G>A	X.37:g.63488738C>T	ENSP00000363985:p.Met598Ile		Somatic				MTMR8_uc011mou.1_Intron	p.M598I	NM_017677	NP_060147	WXS	Illumina HiSeq	Unspecified	Q96EF0	MTMR8_HUMAN			14	1862	-			598					Q5JT99|Q9NXP6	Missense_Mutation	SNP	ENST00000374852.3	37	c.1794G>A	CCDS14379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.50|11.50	1.658362|1.658362	0.29425|0.29425	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000442913|ENST00000374852;ENST00000247400	.|D	.|0.93953	.|-3.32	2.69|2.69	0.815|0.815	0.18763|0.18763	.|.	.|0.506273	.|0.15240	.|U	.|0.272902	T|T	0.81123|0.81123	0.4757|0.4757	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.65825|0.65825	-0.6074|-0.6074	5|10	.|0.22706	.|T	.|0.39	.|.	4.2338|4.2338	0.10616|0.10616	0.0:0.6201:0.0:0.3799|0.0:0.6201:0.0:0.3799	.|.	.|598	.|Q96EF0	.|MTMR8_HUMAN	R|I	402|598;484	.|ENSP00000363985:M598I	.|ENSP00000247400:M484I	G|M	-|-	1|3	0|0	MTMR8|MTMR8	63405463|63405463	0.998000|0.998000	0.40836|0.40836	0.986000|0.986000	0.45419|0.45419	0.988000|0.988000	0.76386|0.76386	0.608000|0.608000	0.24223|0.24223	0.097000|0.097000	0.17492|0.17492	0.529000|0.529000	0.55759|0.55759	GGA|ATG		0.507	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056949.2	NM_017677		21	27	0	0	0	0.008871	0	21	27				
VSIG4	11326	broad.mit.edu	37	X	65259825	65259825	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:65259825C>A	ENST00000374737.4	-	1	124	c.16G>T	c.(16-18)Ggc>Tgc	p.G6C	VSIG4_ENST00000455586.2_Missense_Mutation_p.G6C|VSIG4_ENST00000412866.2_Missense_Mutation_p.G6C	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	6					complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.G6C(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGTAGCAGGCCCAGTAAGATC	0.567																																							uc004dwh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(16-18)GGC>TGC		V-set and immunoglobulin domain containing 4							157.0	98.0	118.0					X																	65259825		2203	4300	6503	SO:0001583	missense	11326				complement activation, alternative pathway	integral to membrane	protein binding	g.chrX:65259825C>A	AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.16G>T	X.37:g.65259825C>A	ENSP00000363869:p.Gly6Cys		Somatic				VSIG4_uc004dwi.2_Missense_Mutation_p.G6C|VSIG4_uc010nkq.1_Missense_Mutation_p.G6C|VSIG4_uc004dwj.2_Missense_Mutation_p.G6C|VSIG4_uc011moy.1_Missense_Mutation_p.G6C|VSIG4_uc004dwk.2_Missense_Mutation_p.G6C	p.G6C	NM_007268	NP_009199	WXS	Illumina HiSeq	Unspecified	Q9Y279	VSIG4_HUMAN			1	143	-			6					Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	37	c.16G>T	CCDS14383.1	.	.	.	.	.	.	.	.	.	.	C	11.81	1.750557	0.31046	.	.	ENSG00000155659	ENST00000374737;ENST00000455586;ENST00000412866;ENST00000423830	T;T;T;T	0.49432	1.74;1.52;2.13;0.78	5.15	2.29	0.28610	.	1.190960	0.05968	N	0.641791	T	0.59197	0.2176	L	0.53249	1.67	0.09310	N	1	D;D;D;D	0.71674	0.995;0.992;0.998;0.997	P;P;D;P	0.63877	0.831;0.875;0.919;0.831	T	0.35051	-0.9804	10	0.38643	T	0.18	-0.3509	6.0665	0.19866	0.0:0.6504:0.0:0.3496	.	6;6;6;6	C9J1L3;Q9Y279-2;Q9Y279-3;Q9Y279	.;.;.;VSIG4_HUMAN	C	6	ENSP00000363869:G6C;ENSP00000411581:G6C;ENSP00000394143:G6C;ENSP00000414594:G6C	ENSP00000363869:G6C	G	-	1	0	VSIG4	65176550	0.170000	0.23016	0.017000	0.16124	0.911000	0.54048	0.462000	0.21956	0.339000	0.23719	0.506000	0.49869	GGC		0.567	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1	NM_007268		9	24	1	0	2.80697e-09	0.010729	3.3992e-09	9	24				
HEPH	9843	broad.mit.edu	37	X	65415023	65415023	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:65415023C>A	ENST00000343002.2	+	8	2117	c.1453C>A	c.(1453-1455)Cat>Aat	p.H485N	HEPH_ENST00000441993.2_Missense_Mutation_p.H488N|HEPH_ENST00000419594.1_Missense_Mutation_p.H488N|HEPH_ENST00000374727.3_Missense_Mutation_p.H488N|HEPH_ENST00000519389.1_Missense_Mutation_p.H539N|HEPH_ENST00000336279.5_Missense_Mutation_p.H218N			Q9BQS7	HEPH_HUMAN	hephaestin	485	Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)	p.H485N(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CATGCAGCCCCATGGGGTCTT	0.522																																							uc011moz.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|ovary(4)	9						c.(1462-1464)CAT>AAT		hephaestin isoform a							51.0	44.0	46.0					X																	65415023		2203	4300	6503	SO:0001583	missense	9843				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity	g.chrX:65415023C>A	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1453C>A	X.37:g.65415023C>A	ENSP00000343939:p.His485Asn		Somatic				HEPH_uc004dwn.2_Missense_Mutation_p.H488N|HEPH_uc004dwo.2_Missense_Mutation_p.H218N|HEPH_uc010nkr.2_Missense_Mutation_p.H488N|HEPH_uc011mpa.1_Missense_Mutation_p.H488N	p.H488N	NM_138737	NP_620074	WXS	Illumina HiSeq	Unspecified	Q9BQS7	HEPH_HUMAN			9	1522	+			485			Extracellular (Potential).|Plastocyanin-like 3.		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37	c.1462C>A		.	.	.	.	.	.	.	.	.	.	C	23.3	4.405416	0.83230	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.99541	-6.12;-6.12;-6.12;-6.12;-6.12;-6.12;-6.12	5.46	5.46	0.80206	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99619	0.9861	M	0.85859	2.78	0.39288	D	0.964689	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.992;0.941;0.997	D	0.98552	1.0637	10	0.52906	T	0.07	.	16.8287	0.85938	0.0:1.0:0.0:0.0	.	539;488;485	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	N	539;488;218;488;488;485;485	ENSP00000430620:H539N;ENSP00000363859:H488N;ENSP00000337418:H218N;ENSP00000411687:H488N;ENSP00000413211:H488N;ENSP00000343939:H485N;ENSP00000398078:H485N	ENSP00000337418:H218N	H	+	1	0	HEPH	65331748	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.295000	0.59049	2.291000	0.77112	0.529000	0.55759	CAT		0.522	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737		22	25	1	0	6.44725e-10	0.014323	7.92199e-10	22	25				
KIF4A	24137	broad.mit.edu	37	X	69622419	69622419	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:69622419T>A	ENST00000374403.3	+	23	2575	c.2493T>A	c.(2491-2493)agT>agA	p.S831R	KIF4A_ENST00000374388.3_Missense_Mutation_p.S831R	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	831	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.S831R(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						CCTGAAGGAGTGCTCAGATTG	0.453																																							uc004dyg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(2491-2493)AGT>AGA		kinesin family member 4							62.0	55.0	57.0					X																	69622419		2203	4300	6503	SO:0001583	missense	24137				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding	g.chrX:69622419T>A	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2493T>A	X.37:g.69622419T>A	ENSP00000363524:p.Ser831Arg		Somatic				KIF4A_uc010nkw.2_Missense_Mutation_p.S831R	p.S831R	NM_012310	NP_036442	WXS	Illumina HiSeq	Unspecified	O95239	KIF4A_HUMAN			23	2620	+			831			Potential.|Interaction with PRC1.		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	37	c.2493T>A	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	T	18.79	3.698819	0.68501	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.69806	-0.43;-0.39	5.01	1.32	0.21799	.	0.000000	0.64402	D	0.000001	T	0.70116	0.3187	M	0.75615	2.305	0.54753	D	0.999987	D	0.61080	0.989	P	0.52856	0.711	T	0.66905	-0.5805	9	.	.	.	.	7.843	0.29410	0.0:0.2495:0.0:0.7505	.	831	O95239	KIF4A_HUMAN	R	831;831;133	ENSP00000363509:S831R;ENSP00000363524:S831R	.	S	+	3	2	KIF4A	69539144	0.998000	0.40836	0.999000	0.59377	0.940000	0.58332	0.389000	0.20751	0.029000	0.15352	0.486000	0.48141	AGT		0.453	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310		11	19	0	0	0	0.010729	0	11	19				
FOXO4	4303	broad.mit.edu	37	X	70321152	70321152	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:70321152G>T	ENST00000374259.3	+	2	1404	c.1072G>T	c.(1072-1074)Ggg>Tgg	p.G358W	FOXO4_ENST00000341558.3_Missense_Mutation_p.G303W	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	358					cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.G358W(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					AGCAGGAGAAGGGTGCTTCTC	0.612											OREG0019856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004dys.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|prostate(1)	3						c.(1072-1074)GGG>TGG		forkhead box O4							24.0	25.0	25.0					X																	70321152		1957	4130	6087	SO:0001583	missense	4303				cell cycle arrest|cell differentiation|embryo development|G1 phase of mitotic cell cycle|insulin receptor signaling pathway|mitotic cell cycle G2/M transition DNA damage checkpoint|muscle organ development|negative regulation of angiogenesis|negative regulation of cell proliferation|negative regulation of smooth muscle cell differentiation|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chrX:70321152G>T		CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.1072G>T	X.37:g.70321152G>T	ENSP00000363377:p.Gly358Trp		Somatic	OREG0019856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1121	FOXO4_uc010nkz.2_Intron|FOXO4_uc004dyt.1_Missense_Mutation_p.G303W	p.G358W	NM_005938	NP_005929	WXS	Illumina HiSeq	Unspecified	P98177	FOXO4_HUMAN			2	1425	+	Renal(35;0.156)		358					B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Missense_Mutation	SNP	ENST00000374259.3	37	c.1072G>T	CCDS43969.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.383359	0.42207	.	.	ENSG00000184481	ENST00000374259;ENST00000341558	D;D	0.95980	-3.69;-3.87	4.89	4.03	0.46877	.	0.385659	0.26149	N	0.026047	D	0.96071	0.8720	L	0.47716	1.5	0.34722	D	0.728897	D;P	0.89917	1.0;0.938	D;B	0.91635	0.999;0.371	D	0.97574	1.0106	10	0.72032	D	0.01	-6.643	10.1887	0.43013	0.0994:0.0:0.9006:0.0	.	303;358	P98177-2;P98177	.;FOXO4_HUMAN	W	358;303	ENSP00000363377:G358W;ENSP00000342209:G303W	ENSP00000342209:G303W	G	+	1	0	FOXO4	70237877	0.995000	0.38212	1.000000	0.80357	0.872000	0.50106	1.324000	0.33712	1.058000	0.40530	-0.295000	0.09555	GGG		0.612	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057115.1	NM_005938		16	10	1	0	4.7546e-09	0.004007	5.74115e-09	16	10				
P2RY10	27334	broad.mit.edu	37	X	78216792	78216792	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:78216792T>C	ENST00000171757.2	+	4	1055	c.775T>C	c.(775-777)Tat>Cat	p.Y259H	P2RY10_ENST00000544091.1_Missense_Mutation_p.Y259H	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.Y259H(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						CTTCACTCCCTATCATATTAA	0.458																																							uc004ede.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|breast(1)	5						c.(775-777)TAT>CAT		G-protein coupled purinergic receptor P2Y10							141.0	129.0	133.0					X																	78216792		2203	4300	6503	SO:0001583	missense	27334					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78216792T>C	AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.775T>C	X.37:g.78216792T>C	ENSP00000171757:p.Tyr259His		Somatic				P2RY10_uc004edf.2_Missense_Mutation_p.Y259H	p.Y259H	NM_014499	NP_055314	WXS	Illumina HiSeq	Unspecified	O00398	P2Y10_HUMAN			4	1144	+			259			Helical; Name=6; (Potential).		D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	ENST00000171757.2	37	c.775T>C	CCDS14442.1	.	.	.	.	.	.	.	.	.	.	T	16.58	3.162047	0.57368	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.74526	-0.85;-0.85	4.8	4.8	0.61643	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83408	0.5248	M	0.72576	2.205	0.50813	D	0.999893	D	0.89917	1.0	D	0.91635	0.999	T	0.82020	-0.0664	10	0.30078	T	0.28	.	12.303	0.54884	0.0:0.0:0.0:1.0	.	259	O00398	P2Y10_HUMAN	H	259	ENSP00000443138:Y259H;ENSP00000171757:Y259H	ENSP00000171757:Y259H	Y	+	1	0	P2RY10	78103448	1.000000	0.71417	0.967000	0.41034	0.857000	0.48899	7.627000	0.83176	1.786000	0.52430	0.483000	0.47432	TAT		0.458	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1			56	52	0	0	0	0.01441	0	56	52				
GPR174	84636	broad.mit.edu	37	X	78426678	78426678	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:78426678G>C	ENST00000276077.1	+	1	210	c.174G>C	c.(172-174)atG>atC	p.M58I		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.M58I(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						TGATATTTATGATAAACTTAG	0.408										HNSCC(63;0.18)																													uc004edg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(172-174)ATG>ATC		putative purinergic receptor FKSG79							112.0	85.0	94.0					X																	78426678		2202	4300	6502	SO:0001583	missense	84636					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78426678G>C	AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.174G>C	X.37:g.78426678G>C	ENSP00000276077:p.Met58Ile	HNSCC(63;0.18)	Somatic					p.M58I	NM_032553	NP_115942	WXS	Illumina HiSeq	Unspecified	Q9BXC1	GP174_HUMAN			1	210	+			58			Helical; Name=2; (Potential).		Q2M3F7	Missense_Mutation	SNP	ENST00000276077.1	37	c.174G>C	CCDS14443.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953132	0.73902	.	.	ENSG00000147138	ENST00000276077	T	0.34667	1.35	5.2	5.2	0.72013	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.51873	0.1700	L	0.41492	1.28	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.50783	-0.8787	10	0.48119	T	0.1	.	16.3133	0.82905	0.0:0.0:1.0:0.0	.	58	Q9BXC1	GP174_HUMAN	I	58	ENSP00000276077:M58I	ENSP00000276077:M58I	M	+	3	0	GPR174	78313334	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.488000	0.97947	2.161000	0.67846	0.538000	0.68166	ATG		0.408	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553		10	17	0	0	0	0.008291	0	10	17				
CHM	1121	broad.mit.edu	37	X	85213879	85213879	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:85213879C>A	ENST00000357749.2	-	6	835	c.806G>T	c.(805-807)gGa>gTa	p.G269V	CHM_ENST00000537751.1_Missense_Mutation_p.G121V|CHM_ENST00000467744.2_Intron	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	269					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)	p.G269V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TTCCACTCGTCCTTCTCGAAA	0.338																																							uc004eet.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(805-807)GGA>GTA		choroideremia isoform a							97.0	85.0	89.0					X																	85213879		2203	4300	6503	SO:0001583	missense	1121				intracellular protein transport|protein geranylgeranylation|response to stimulus|visual perception	Rab-protein geranylgeranyltransferase complex	GTPase activator activity|Rab geranylgeranyltransferase activity	g.chrX:85213879C>A	X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.806G>T	X.37:g.85213879C>A	ENSP00000350386:p.Gly269Val		Somatic				CHM_uc011mqz.1_Missense_Mutation_p.G121V	p.G269V	NM_000390	NP_000381	WXS	Illumina HiSeq	Unspecified	P24386	RAE1_HUMAN			6	836	-		all_lung(315;5.41e-06)	269					A1L4D2|O43732	Missense_Mutation	SNP	ENST00000357749.2	37	c.806G>T	CCDS14454.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.543374	0.65198	.	.	ENSG00000188419	ENST00000357749;ENST00000537751	T;T	0.65549	-0.16;-0.16	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.83403	0.5247	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.88044	0.2783	10	0.87932	D	0	-0.1451	17.1736	0.86835	0.0:1.0:0.0:0.0	.	269	P24386	RAE1_HUMAN	V	269;121	ENSP00000350386:G269V;ENSP00000441728:G121V	ENSP00000350386:G269V	G	-	2	0	CHM	85100535	1.000000	0.71417	1.000000	0.80357	0.558000	0.35554	7.064000	0.76721	1.976000	0.57569	0.422000	0.28245	GGA		0.338	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057396.3	NM_000390		37	87	1	0	3.78316e-11	0.00623	4.73177e-11	37	87				
NRK	203447	broad.mit.edu	37	X	105167150	105167150	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:105167150T>A	ENST00000243300.9	+	18	2954	c.2651T>A	c.(2650-2652)gTa>gAa	p.V884E	NRK_ENST00000428173.2_Missense_Mutation_p.V885E	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	884					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.V885E(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TCACCCCCTGTATACTTGACA	0.418										HNSCC(51;0.14)																													uc004emd.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						c.(2650-2652)GTA>GAA		Nik related kinase							131.0	120.0	124.0					X																	105167150		1876	4103	5979	SO:0001583	missense	203447						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chrX:105167150T>A	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.2651T>A	X.37:g.105167150T>A	ENSP00000434830:p.Val884Glu	HNSCC(51;0.14)	Somatic				NRK_uc010npc.1_Missense_Mutation_p.V552E	p.V884E	NM_198465	NP_940867	WXS	Illumina HiSeq	Unspecified	Q7Z2Y5	NRK_HUMAN			18	2954	+			884					Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37	c.2651T>A		.	.	.	.	.	.	.	.	.	.	T	16.98	3.271415	0.59649	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	D;D	0.81996	-1.55;-1.56	3.38	3.38	0.38709	.	0.000000	0.35378	N	0.003242	D	0.82944	0.5147	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.981	T	0.83099	-0.0129	10	0.87932	D	0	.	7.4476	0.27219	0.0:0.0:0.0:1.0	.	552;884	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	E	884;885	ENSP00000434830:V884E;ENSP00000438378:V885E	ENSP00000434830:V884E	V	+	2	0	NRK	105053806	0.268000	0.24133	0.957000	0.39632	0.984000	0.73092	1.661000	0.37408	1.569000	0.49696	0.486000	0.48141	GTA		0.418	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465		77	98	0	0	0	0.01441	0	77	98				
CHRDL1	91851	broad.mit.edu	37	X	109924711	109924711	+	Splice_Site	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:109924711C>A	ENST00000372045.1	-	10	1262	c.1131G>T	c.(1129-1131)aaG>aaT	p.K377N	CHRDL1_ENST00000482160.1_Splice_Site_p.K305N|CHRDL1_ENST00000434224.1_Splice_Site_p.K304N|CHRDL1_ENST00000394797.4_Splice_Site_p.K383N|CHRDL1_ENST00000444321.2_Splice_Site_p.K384N|CHRDL1_ENST00000372042.1_Splice_Site_p.K385N|CHRDL1_ENST00000218054.4_Splice_Site_p.K383N			Q9BU40	CRDL1_HUMAN	chordin-like 1	377					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.K383N(1)		endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						CTTGCTCACCCTTTCGAATAG	0.443																																							uc004eou.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1153-1155)AAG>AAT		chordin-like 1 isoform 1 precursor							164.0	129.0	141.0					X																	109924711		2203	4300	6503	SO:0001630	splice_region_variant	91851				BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region		g.chrX:109924711C>A	AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.1132+1G>T	X.37:g.109924711C>A			Somatic				CHRDL1_uc004eov.2_Missense_Mutation_p.K374N|CHRDL1_uc004eow.2_Missense_Mutation_p.K383N|CHRDL1_uc010nps.2_Missense_Mutation_p.K384N|CHRDL1_uc004eot.2_Missense_Mutation_p.K304N|CHRDL1_uc011mss.1_Missense_Mutation_p.K299N	p.K385N	NM_001143981	NP_001137453	WXS	Illumina HiSeq	Unspecified	Q9BU40	CRDL1_HUMAN			10	1504	-			377					B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	ENST00000372045.1	37	c.1155G>T		.	.	.	.	.	.	.	.	.	.	C	17.22	3.335201	0.60853	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	T;T;T;T;T;T;T	0.37058	1.98;1.22;1.98;1.98;2.23;1.22;1.97	4.97	-0.107	0.13592	.	0.049073	0.85682	D	0.000000	T	0.41627	0.1167	L	0.32530	0.975	0.44595	D	0.997567	D;D;D;D;D;D	0.71674	0.994;0.998;0.998;0.998;0.998;0.998	D;D;D;D;D;D	0.76071	0.983;0.987;0.987;0.987;0.987;0.981	T	0.08126	-1.0737	9	.	.	.	-10.9429	9.7889	0.40692	0.0:0.2244:0.0:0.7756	.	305;384;364;377;385;304	B4DMP3;E9PGS5;Q59FB2;Q9BU40;D3DUY6;D3YTA8	.;.;.;CRDL1_HUMAN;.;.	N	377;304;383;383;385;305;384	ENSP00000361115:K377N;ENSP00000389627:K304N;ENSP00000218054:K383N;ENSP00000378276:K383N;ENSP00000361112:K385N;ENSP00000418443:K305N;ENSP00000399739:K384N	.	K	-	3	2	CHRDL1	109811367	0.995000	0.38212	0.997000	0.53966	0.924000	0.55760	0.132000	0.15891	-0.060000	0.13132	0.538000	0.68166	AAG		0.443	CHRDL1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057912.1	NM_145234	Missense_Mutation	51	73	1	0	7.77372e-23	0.01441	1.15914e-22	51	73				
WDR44	54521	broad.mit.edu	37	X	117570726	117570726	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:117570726G>C	ENST00000254029.3	+	14	2308	c.1913G>C	c.(1912-1914)aGa>aCa	p.R638T	WDR44_ENST00000371822.5_Missense_Mutation_p.R613T|WDR44_ENST00000371825.3_Missense_Mutation_p.R638T	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	638						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.R638T(2)		breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						ATTTCTCGAAGAGAATGCCTT	0.328																																							uc004eqn.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						c.(1912-1914)AGA>ACA		WD repeat domain 44 protein							123.0	107.0	112.0					X																	117570726		2202	4299	6501	SO:0001583	missense	54521					cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm		g.chrX:117570726G>C	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.1913G>C	X.37:g.117570726G>C	ENSP00000254029:p.Arg638Thr		Somatic				WDR44_uc004eqo.2_Missense_Mutation_p.R638T|WDR44_uc011mtr.1_Missense_Mutation_p.R613T|WDR44_uc010nqi.2_Missense_Mutation_p.R348T	p.R638T	NM_019045	NP_061918	WXS	Illumina HiSeq	Unspecified	Q5JSH3	WDR44_HUMAN			14	2338	+			638			WD 2.		B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	37	c.1913G>C	CCDS14572.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.545226|4.545226	0.86022|0.86022	.|.	.|.	ENSG00000131725|ENSG00000131725	ENST00000371848|ENST00000371822;ENST00000254029;ENST00000371825;ENST00000318919	.|T;T;T	.|0.81330	.|-1.48;-1.46;-1.46	5.58|5.58	5.58|5.58	0.84498|0.84498	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85146|0.85146	0.5630|0.5630	L|L	0.43757|0.43757	1.38|1.38	0.50313|0.50313	D|D	0.999861|0.999861	.|P;D;D;D	.|0.62365	.|0.575;0.987;0.991;0.971	.|B;P;P;P	.|0.60286	.|0.293;0.872;0.798;0.796	D|D	0.85212|0.85212	0.1021|0.1021	5|10	.|0.49607	.|T	.|0.09	-8.2066|-8.2066	18.8529|18.8529	0.92240|0.92240	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|613;638;638;638	.|F8W913;E9PCI7;Q5JSH3-2;Q5JSH3	.|.;.;.;WDR44_HUMAN	N|T	537|613;638;638;24	.|ENSP00000360887:R613T;ENSP00000254029:R638T;ENSP00000360890:R638T	.|ENSP00000254029:R638T	K|R	+|+	3|2	2|0	WDR44|WDR44	117454754|117454754	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.950000|7.950000	0.87804|0.87804	2.485000|2.485000	0.83878|0.83878	0.591000|0.591000	0.81541|0.81541	AAG|AGA		0.328	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045		39	53	0	0	0	0.00623	0	39	53				
UPF3B	65109	broad.mit.edu	37	X	118972013	118972013	+	Splice_Site	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:118972013G>T	ENST00000276201.2	-	10	1078	c.1009C>A	c.(1009-1011)Cct>Act	p.P337T	UPF3B_ENST00000478840.1_5'Flank|UPF3B_ENST00000345865.2_Splice_Site_p.P324T	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	337	Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P337T(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						TCATCTTCAGGTCTGCATGAA	0.473																																							uc004erz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)	3						c.(1009-1011)CCT>ACT		UPF3 regulator of nonsense transcripts homolog B							100.0	90.0	93.0					X																	118972013		2203	4299	6502	SO:0001630	splice_region_variant	65109				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding	g.chrX:118972013G>T	AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.1008-1C>A	X.37:g.118972013G>T			Somatic				UPF3B_uc004esa.1_Missense_Mutation_p.P324T	p.P337T	NM_080632	NP_542199	WXS	Illumina HiSeq	Unspecified	Q9BZI7	REN3B_HUMAN			10	1086	-			337			Sufficient for association with EJC core.		D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Missense_Mutation	SNP	ENST00000276201.2	37	c.1009C>A	CCDS14588.1	.	.	.	.	.	.	.	.	.	.	G	6.817	0.519768	0.13005	.	.	ENSG00000125351	ENST00000276201;ENST00000345865	T;T	0.76316	-0.99;-1.01	5.68	-1.22	0.09494	.	1.350910	0.04170	N	0.324587	T	0.66317	0.2777	L	0.43152	1.355	0.20703	N	0.999862	B;B	0.13594	0.008;0.001	B;B	0.13407	0.009;0.004	T	0.36792	-0.9733	10	0.26408	T	0.33	.	2.4566	0.04531	0.5381:0.1378:0.1819:0.1422	.	324;337	Q9BZI7-2;Q9BZI7	.;REN3B_HUMAN	T	337;324	ENSP00000276201:P337T;ENSP00000245418:P324T	ENSP00000276201:P337T	P	-	1	0	UPF3B	118856041	0.021000	0.18746	0.008000	0.14137	0.047000	0.14425	0.195000	0.17155	-0.279000	0.09167	-0.230000	0.12252	CCT		0.473	UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1		Missense_Mutation	64	79	1	0	5.10508e-28	0.01441	7.8931e-28	64	79				
GLUD2	2747	broad.mit.edu	37	X	120182428	120182428	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:120182428C>A	ENST00000328078.1	+	1	967	c.890C>A	c.(889-891)cCa>cAa	p.P297Q		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	297					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.P297Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						GGAATGACACCAGGGTTTAGA	0.408																																							uc004eto.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(889-891)CCA>CAA		glutamate dehydrogenase 2 precursor	L-Glutamic Acid(DB00142)|NADH(DB00157)						173.0	155.0	161.0					X																	120182428		2203	4300	6503	SO:0001583	missense	2747				glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding	g.chrX:120182428C>A	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.890C>A	X.37:g.120182428C>A	ENSP00000327589:p.Pro297Gln		Somatic					p.P297Q	NM_012084	NP_036216	WXS	Illumina HiSeq	Unspecified	P49448	DHE4_HUMAN			1	967	+			297					B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	c.890C>A	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	C	12.93	2.085810	0.36758	.	.	ENSG00000182890	ENST00000328078	D	0.96587	-4.06	2.4	1.49	0.22878	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.051757	0.85682	D	0.000000	D	0.94272	0.8160	M	0.69248	2.105	0.50313	D	0.999864	B	0.27013	0.166	B	0.32342	0.144	D	0.90392	0.4396	10	0.87932	D	0	0.8396	7.8403	0.29395	0.2488:0.7512:0.0:0.0	.	297	P49448	DHE4_HUMAN	Q	297	ENSP00000327589:P297Q	ENSP00000327589:P297Q	P	+	2	0	GLUD2	120010109	0.999000	0.42202	0.786000	0.31890	0.937000	0.57800	5.325000	0.65869	0.282000	0.22254	0.472000	0.43445	CCA		0.408	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084		76	106	1	0	1.76847e-28	0.01441	2.75461e-28	76	106				
DCAF12L2	340578	broad.mit.edu	37	X	125299865	125299865	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:125299865C>A	ENST00000360028.2	-	1	69	c.43G>T	c.(43-45)Gcg>Tcg	p.A15S	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.A15S			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	15								p.A15S(2)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GCCTCGACCGCGGGCGCTTTC	0.751																																							uc004euk.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						c.(43-45)GCG>TCG		DDB1 and CUL4 associated factor 12-like 2							10.0	12.0	12.0					X																	125299865		1950	3887	5837	SO:0001583	missense	340578							g.chrX:125299865C>A	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.43G>T	X.37:g.125299865C>A	ENSP00000353128:p.Ala15Ser		Somatic					p.A15S	NM_001013628	NP_001013650	WXS	Illumina HiSeq	Unspecified	Q5VW00	DC122_HUMAN			1	70	-			15					B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	c.43G>T	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	c	13.26	2.184386	0.38609	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.18502	2.21;2.21	2.75	2.75	0.32379	.	.	.	.	.	T	0.12689	0.0308	L	0.41236	1.265	0.09310	N	1	B	0.30709	0.291	B	0.21151	0.033	T	0.13176	-1.0519	9	0.45353	T	0.12	.	8.1746	0.31275	0.0:1.0:0.0:0.0	.	15	Q5VW00	DC122_HUMAN	S	15	ENSP00000441489:A15S;ENSP00000353128:A15S	ENSP00000353128:A15S	A	-	1	0	DCAF12L2	125127546	0.000000	0.05858	0.005000	0.12908	0.312000	0.27988	0.027000	0.13621	1.646000	0.50622	0.287000	0.19450	GCG		0.751	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		7	6	1	0	2.0095e-06	0.001984	2.25732e-06	7	6				
BCORL1	63035	broad.mit.edu	37	X	129148566	129148566	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:129148566G>C	ENST00000218147.7	+	4	2015	c.1818G>C	c.(1816-1818)caG>caC	p.Q606H	BCORL1_ENST00000303743.5_Missense_Mutation_p.Q606H|BCORL1_ENST00000540052.1_Missense_Mutation_p.Q606H|BCORL1_ENST00000359304.2_Missense_Mutation_p.Q606H			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	606	Pro-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Q606H(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CACCGCCACAGCTGGAACGAG	0.602																																							uc004evb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|lung(1)	7						c.(1816-1818)CAG>CAC		BCL6 co-repressor-like 1							77.0	63.0	68.0					X																	129148566		2203	4300	6503	SO:0001583	missense	63035				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chrX:129148566G>C	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.1818G>C	X.37:g.129148566G>C	ENSP00000218147:p.Gln606His		Somatic				BCORL1_uc010nrd.1_Missense_Mutation_p.Q508H	p.Q606H	NM_021946	NP_068765	WXS	Illumina HiSeq	Unspecified	Q5H9F3	BCORL_HUMAN			4	1932	+			606			Pro-rich.		B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	c.1818G>C	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.89|11.89	1.772979|1.772979	0.31411|0.31411	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000441294|ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822	.|T;T;T;T;T	.|0.56103	.|0.51;0.92;0.48;0.51;0.99	5.37|5.37	2.59|2.59	0.31030|0.31030	.|.	.|0.000000	.|0.34676	.|N	.|0.003773	T|T	0.55577|0.55577	0.1929|0.1929	L|L	0.27053|0.27053	0.805|0.805	0.35061|0.35061	D|D	0.761564|0.761564	.|D;D	.|0.71674	.|0.998;0.998	.|D;D	.|0.80764	.|0.994;0.993	T|T	0.62964|0.62964	-0.6742|-0.6742	5|10	.|0.48119	.|T	.|0.1	-13.1202|-13.1202	9.8186|9.8186	0.40869|0.40869	0.2311:0.0:0.7689:0.0|0.2311:0.0:0.7689:0.0	.|.	.|606;606	.|Q5H9F3-2;Q5H9F3	.|.;BCORL_HUMAN	P|H	42|606;606;606;606;206	.|ENSP00000218147:Q606H;ENSP00000307541:Q606H;ENSP00000352253:Q606H;ENSP00000437775:Q606H;ENSP00000399483:Q206H	.|ENSP00000218147:Q606H	A|Q	+|+	1|3	0|2	BCORL1|BCORL1	128976247|128976247	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.649000|0.649000	0.38597|0.38597	1.479000|1.479000	0.35453|0.35453	0.461000|0.461000	0.27071|0.27071	0.431000|0.431000	0.28591|0.28591	GCT|CAG		0.602	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		17	33	0	0	0	0.007413	0	17	33				
RAB33A	9363	broad.mit.edu	37	X	129306210	129306210	+	Silent	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:129306210G>T	ENST00000257017.4	+	1	588	c.174G>T	c.(172-174)ggG>ggT	p.G58G		NM_004794.2	NP_004785.1	Q14088	RB33A_HUMAN	RAB33A, member RAS oncogene family	58					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.G58G(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(5)	11						GCTTCTGCGGGGGTACCTTCC	0.562																																							uc004evl.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(172-174)GGG>GGT		Ras-related protein Rab-33A							89.0	71.0	77.0					X																	129306210		2203	4300	6503	SO:0001819	synonymous_variant	9363				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chrX:129306210G>T	D14889	CCDS14621.1	Xq26	2008-02-05			ENSG00000134594	ENSG00000134594		"""RAB, member RAS oncogene"""	9773	protein-coding gene	gene with protein product		300333				7688322, 9512502	Standard	NM_004794		Approved	RabS10	uc004evl.3	Q14088	OTTHUMG00000022391	ENST00000257017.4:c.174G>T	X.37:g.129306210G>T			Somatic				RAB33A_uc010nre.2_RNA	p.G58G	NM_004794	NP_004785	WXS	Illumina HiSeq	Unspecified	Q14088	RB33A_HUMAN			1	438	+			58					Q5JUZ6|Q92465	Silent	SNP	ENST00000257017.4	37	c.174G>T	CCDS14621.1																																																																																				0.562	RAB33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058246.1	NM_004794		21	42	1	0	3.8784e-16	0.012319	5.36321e-16	21	42				
ZNF75D	7626	broad.mit.edu	37	X	134427710	134427710	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:134427710C>A	ENST00000370766.3	-	3	3066	c.357G>T	c.(355-357)caG>caT	p.Q119H	ZNF75D_ENST00000494295.1_Intron|ZNF75D_ENST00000370764.1_Missense_Mutation_p.Q119H	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	119	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.Q119H(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GGACCAGAGCCTGTTTGACAT	0.463																																							uc004eyp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(355-357)CAG>CAT		zinc finger protein 75							92.0	87.0	89.0					X																	134427710		2203	4300	6503	SO:0001583	missense	7626				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:134427710C>A	S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.357G>T	X.37:g.134427710C>A	ENSP00000359802:p.Gln119His		Somatic				ZNF75D_uc004eym.2_Intron|ZNF75D_uc004eyn.2_5'Flank|ZNF75D_uc004eyo.2_Missense_Mutation_p.Q119H	p.Q119H	NM_007131	NP_009062	WXS	Illumina HiSeq	Unspecified	P51815	ZN75D_HUMAN			3	3012	-			119			SCAN box.		A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Missense_Mutation	SNP	ENST00000370766.3	37	c.357G>T	CCDS14648.1	.	.	.	.	.	.	.	.	.	.	C	9.752	1.167692	0.21621	.	.	ENSG00000186376	ENST00000370766;ENST00000370764	T;T	0.05855	3.38;3.38	2.98	1.19	0.21007	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.09818	0.0241	L	0.56199	1.76	0.09310	N	0.999999	P;P	0.48998	0.857;0.918	P;P	0.49140	0.505;0.601	T	0.21042	-1.0257	9	0.87932	D	0	.	4.7031	0.12837	0.0:0.6815:0.0:0.3185	.	119;119	P51815;A6NK62	ZN75D_HUMAN;.	H	119	ENSP00000359802:Q119H;ENSP00000359800:Q119H	ENSP00000359800:Q119H	Q	-	3	2	ZNF75D	134255376	1.000000	0.71417	0.304000	0.25085	0.235000	0.25334	1.799000	0.38824	0.193000	0.20303	0.509000	0.49947	CAG		0.463	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058415.1	NM_007131		62	55	1	0	1.41401e-22	0.01441	2.10095e-22	62	55				
SLC9A6	10479	broad.mit.edu	37	X	135067822	135067822	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:135067822A>T	ENST00000370698.3	+	1	196	c.161A>T	c.(160-162)gAc>gTc	p.D54V	SLC9A6_ENST00000370701.1_Missense_Mutation_p.D2V|SLC9A6_ENST00000370695.4_Missense_Mutation_p.D54V	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	54					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)	p.D54V(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					AGAGCCATGGACGAGGAGATC	0.647																																							uc004ezj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(160-162)GAC>GTC		solute carrier family 9 (sodium/hydrogen							78.0	73.0	75.0					X																	135067822		2203	4300	6503	SO:0001583	missense	10479				regulation of pH	early endosome membrane|endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane|recycling endosome membrane	sodium:hydrogen antiporter activity	g.chrX:135067822A>T	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.161A>T	X.37:g.135067822A>T	ENSP00000359732:p.Asp54Val		Somatic				SLC9A6_uc004ezk.2_Missense_Mutation_p.D54V|SLC9A6_uc011mvx.1_Missense_Mutation_p.D2V	p.D54V	NM_006359	NP_006350	WXS	Illumina HiSeq	Unspecified	Q92581	SL9A6_HUMAN			1	237	+	Acute lymphoblastic leukemia(192;0.000127)		54					A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	c.161A>T	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	a	14.22	2.470661	0.43942	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.57907	0.37;0.49;0.43	4.71	4.71	0.59529	.	0.204000	0.50627	D	0.000103	T	0.31231	0.0790	N	0.08118	0	0.54753	D	0.999981	B;B;B	0.15719	0.008;0.014;0.003	B;B;B	0.20184	0.01;0.028;0.017	T	0.13045	-1.0524	10	0.56958	D	0.05	.	7.9759	0.30155	0.6867:0.0:0.0:0.3133	.	2;54;54	B4DU30;Q92581-2;Q92581	.;.;SL9A6_HUMAN	V	2;54;54	ENSP00000359735:D2V;ENSP00000359732:D54V;ENSP00000359729:D54V	ENSP00000359729:D54V	D	+	2	0	SLC9A6	134895488	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.932000	0.48940	1.537000	0.49254	0.305000	0.20034	GAC		0.647	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359		22	43	0	0	0	0.01892	0	22	43				
VGLL1	51442	broad.mit.edu	37	X	135631064	135631064	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:135631064C>T	ENST00000370634.3	+	3	701	c.531C>T	c.(529-531)tgC>tgT	p.C177C	MIR934_ENST00000401241.1_RNA	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	177					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.C177C(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					AAGACAGATGCCTAGCCCGTC	0.607																																							uc004ezy.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(529-531)TGC>TGT		vestigial like 1							90.0	89.0	89.0					X																	135631064		2203	4300	6503	SO:0001819	synonymous_variant	51442				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	transcription coactivator activity	g.chrX:135631064C>T	AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.531C>T	X.37:g.135631064C>T			Somatic				MIR934_hsa-mir-934|MI0005756_5'Flank	p.C177C	NM_016267	NP_057351	WXS	Illumina HiSeq	Unspecified	Q99990	VGLL1_HUMAN			3	701	+	Acute lymphoblastic leukemia(192;0.000127)		177					Q5H915	Silent	SNP	ENST00000370634.3	37	c.531C>T	CCDS14658.1																																																																																				0.607	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1	NM_016267		6	133	0	0	0	0.001984	0	6	133				
F9	2158	broad.mit.edu	37	X	138642899	138642899	+	Splice_Site	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:138642899G>T	ENST00000218099.2	+	7	730		c.e7-1		F9_ENST00000394090.2_Splice_Site	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX						blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)	p.?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	TGTTTTCACAGGTTGTTTTGA	0.338																																							uc004fas.1		NA																	1	Unknown(1)		lung(1)	lung(2)|ovary(1)	3	GRCh37	CS083921|CS910433|CS941482	F9	S		c.e7-1		coagulation factor IX preproprotein	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)						223.0	195.0	204.0					X																	138642899		2203	4300	6503	SO:0001630	splice_region_variant	2158				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity	g.chrX:138642899G>T	M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.724-1G>T	X.37:g.138642899G>T			Somatic				F9_uc004fat.1_Splice_Site_p.V204_splice	p.V242_splice	NM_000133	NP_000124	WXS	Illumina HiSeq	Unspecified	P00740	FA9_HUMAN			7	753	+	Acute lymphoblastic leukemia(192;0.000127)							A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Splice_Site	SNP	ENST00000218099.2	37	c.724_splice	CCDS14666.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.551682	0.45487	.	.	ENSG00000101981	ENST00000218099;ENST00000394090	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3112	0.82872	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	F9	138470565	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	8.499000	0.90494	2.457000	0.83068	0.544000	0.68410	.		0.338	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058557.1		Intron	57	66	1	0	7.47603e-22	0.01441	1.09526e-21	57	66				
MCF2	4168	broad.mit.edu	37	X	138689898	138689898	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:138689898C>A	ENST00000370576.4	-	12	1651	c.1442G>T	c.(1441-1443)gGt>gTt	p.G481V	MCF2_ENST00000519895.1_Missense_Mutation_p.G557V|MCF2_ENST00000370573.4_Missense_Mutation_p.G481V|MCF2_ENST00000370578.4_Missense_Mutation_p.G626V|MCF2_ENST00000414978.1_Missense_Mutation_p.G541V|MCF2_ENST00000536274.1_Missense_Mutation_p.G442V|MCF2_ENST00000338585.6_Missense_Mutation_p.G497V|MCF2_ENST00000520602.1_Missense_Mutation_p.G541V|MCF2_ENST00000483690.1_5'UTR	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	481					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G481V(3)|p.G557V(2)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					GGAGGATGGACCAGAACTTCT	0.353																																							uc004fau.2		NA																	5	Substitution - Missense(5)		lung(5)	lung(1)|pleura(1)	2						c.(1441-1443)GGT>GTT		MCF.2 cell line derived transforming sequence							63.0	57.0	59.0					X																	138689898		2203	4300	6503	SO:0001583	missense	4168				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chrX:138689898C>A		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.1442G>T	X.37:g.138689898C>A	ENSP00000359608:p.Gly481Val		Somatic				MCF2_uc004fav.2_Missense_Mutation_p.G497V|MCF2_uc011mwl.1_Missense_Mutation_p.G458V|MCF2_uc010nsh.1_Missense_Mutation_p.G481V|MCF2_uc011mwm.1_Missense_Mutation_p.G442V|MCF2_uc011mwn.1_Missense_Mutation_p.G626V|MCF2_uc004faw.2_Missense_Mutation_p.G541V|MCF2_uc011mwo.1_Missense_Mutation_p.G557V	p.G481V	NM_005369	NP_005360	WXS	Illumina HiSeq	Unspecified	P10911	MCF2_HUMAN			12	1736	-	Acute lymphoblastic leukemia(192;0.000127)		481					B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000370576.4	37	c.1442G>T	CCDS14667.1	.	.	.	.	.	.	.	.	.	.	C	6.107	0.387930	0.11581	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000446225;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T;T	0.48836	1.33;1.23;1.12;1.33;1.33;0.8;1.37;1.23;1.27	5.05	-9.66	0.00534	.	1.441670	0.03981	N	0.293322	T	0.28665	0.0710	L	0.34521	1.04	0.09310	N	1	B;B;B;B;B;B;B;B	0.19817	0.032;0.001;0.039;0.023;0.001;0.007;0.001;0.023	B;B;B;B;B;B;B;B	0.29077	0.021;0.002;0.098;0.045;0.009;0.005;0.003;0.045	T	0.17258	-1.0375	10	0.27785	T	0.31	.	1.4055	0.02279	0.1865:0.1384:0.3242:0.3509	.	557;626;442;481;481;626;497;481	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	V	541;481;442;626;541;84;557;481;497	ENSP00000427745:G541V;ENSP00000359608:G481V;ENSP00000438155:G442V;ENSP00000359610:G626V;ENSP00000397055:G541V;ENSP00000405848:G84V;ENSP00000430276:G557V;ENSP00000359605:G481V;ENSP00000342204:G497V	ENSP00000342204:G497V	G	-	2	0	MCF2	138517564	0.000000	0.05858	0.000000	0.03702	0.422000	0.31414	0.026000	0.13599	-1.743000	0.01340	0.538000	0.68166	GGT		0.353	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369		27	44	1	0	3.90053e-15	0.012213	5.30624e-15	27	44				
ATP11C	286410	broad.mit.edu	37	X	138880430	138880430	+	Splice_Site	SNP	A	A	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:138880430A>G	ENST00000327569.3	-	10	965		c.e10+1		ATP11C_ENST00000361648.2_Splice_Site|ATP11C_ENST00000370543.1_Splice_Site|ATP11C_ENST00000370557.1_Splice_Site|ATP11C_ENST00000460773.1_5'Flank|ATP11C_ENST00000359686.2_Splice_Site	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C						ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.?(2)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					GCGCATACTAACTTTTCAACA	0.313																																							uc004faz.2		NA																	2	Unknown(2)		lung(2)	ovary(5)|large_intestine(3)	8						c.e10+1		ATPase, class VI, type 11C isoform a							107.0	92.0	97.0					X																	138880430		2203	4299	6502	SO:0001630	splice_region_variant	286410				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chrX:138880430A>G	AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.866+1T>C	X.37:g.138880430A>G			Somatic				ATP11C_uc004fay.2_5'Flank|ATP11C_uc004fba.2_Splice_Site_p.K289_splice	p.K289_splice	NM_173694	NP_775965	WXS	Illumina HiSeq	Unspecified	Q8NB49	AT11C_HUMAN			10	965	-	Acute lymphoblastic leukemia(192;0.000127)							Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Splice_Site	SNP	ENST00000327569.3	37	c.866_splice	CCDS14668.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.112717	0.77210	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9985	0.64419	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP11C	138708096	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.339000	0.96797	1.903000	0.55091	0.425000	0.28330	.		0.313	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	Intron	23	70	0	0	0	0.01892	0	23	70				
TMEM185A	84548	broad.mit.edu	37	X	148693003	148693003	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:148693003C>A	ENST00000316916.8	-	2	486	c.182G>T	c.(181-183)gGa>gTa	p.G61V	TMEM185A_ENST00000507237.1_Missense_Mutation_p.G61V|TMEM185A_ENST00000536359.1_Intron	NM_032508.2	NP_115897.1	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	61						dendrite (GO:0030425)|integral component of membrane (GO:0016021)		p.G61V(1)		kidney(1)|large_intestine(3)|lung(10)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GACTCCAGTTCCAACTGAGGC	0.458																																							uc011mxq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(181-183)GGA>GTA		transmembrane protein 185A							234.0	223.0	227.0					X																	148693003		2203	4299	6502	SO:0001583	missense	84548					integral to membrane		g.chrX:148693003C>A	AF353675	CCDS14689.1, CCDS55523.1, CCDS76041.1	Xq28	2014-01-28	2007-02-05	2007-02-05	ENSG00000155984	ENSG00000269556			17125	protein-coding gene	gene with protein product		300031	"""chromosome X open reading frame 13"", ""family with sequence similarity 11, member A"""	CXorf13, FAM11A		12404111	Standard	NM_032508		Approved		uc022cgl.1	Q8NFB2	OTTHUMG00000022625	ENST00000316916.8:c.182G>T	X.37:g.148693003C>A	ENSP00000359449:p.Gly61Val		Somatic				HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|TMEM185A_uc011mxp.1_Intron|TMEM185A_uc004fdo.2_Intron|TMEM185A_uc004fdp.3_5'Flank	p.G61V	NM_032508	NP_115897	WXS	Illumina HiSeq	Unspecified	Q8NFB2	T185A_HUMAN			3	493	-	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)		61			Helical; (Potential).		B3KTZ3|Q3SYH1|Q96CW3|Q96KE8	Missense_Mutation	SNP	ENST00000316916.8	37	c.182G>T	CCDS14689.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691228	0.88735	.	.	ENSG00000155984	ENST00000316916;ENST00000507237	T;T	0.22336	1.96;1.96	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.47507	0.1449	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.44967	-0.9293	10	0.35671	T	0.21	.	16.2802	0.82672	0.0:1.0:0.0:0.0	.	61	Q8NFB2	T185A_HUMAN	V	61	ENSP00000359449:G61V;ENSP00000427766:G61V	ENSP00000359449:G61V	G	-	2	0	TMEM185A	148500804	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.298000	0.78815	2.040000	0.60383	0.594000	0.82650	GGA		0.458	TMEM185A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058710.4	NM_032508		126	215	1	0	2.87069e-51	0.01441	4.69851e-51	126	215				
ATP2B3	492	broad.mit.edu	37	X	152825273	152825273	+	Silent	SNP	C	C	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:152825273C>A	ENST00000349466.2	+	17	3038	c.2712C>A	c.(2710-2712)ccC>ccA	p.P904P	ATP2B3_ENST00000393842.1_Silent_p.P890P|ATP2B3_ENST00000359149.3_Silent_p.P904P|ATP2B3_ENST00000263519.4_Silent_p.P904P|ATP2B3_ENST00000370186.1_Silent_p.P890P|ATP2B3_ENST00000370181.2_Silent_p.P890P|ATP2B3_ENST00000460549.1_3'UTR			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	904					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.P904P(3)|p.P890P(1)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGGAGCCACCCACAGAGTCGC	0.602																																							uc004fht.1		NA																	4	Substitution - coding silent(4)		lung(4)	pancreas(1)	1						c.(2710-2712)CCC>CCA		plasma membrane calcium ATPase 3 isoform 3b							79.0	67.0	71.0					X																	152825273		2203	4300	6503	SO:0001819	synonymous_variant	492				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding	g.chrX:152825273C>A	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.2712C>A	X.37:g.152825273C>A			Somatic				ATP2B3_uc004fhs.1_Silent_p.P904P|ATP2B3_uc010nuf.1_5'Flank|ATP2B3_uc004fhu.1_5'Flank	p.P904P	NM_001001344	NP_001001344	WXS	Illumina HiSeq	Unspecified	Q16720	AT2B3_HUMAN			16	2838	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		904			Cytoplasmic (Potential).		B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	ENST00000349466.2	37	c.2712C>A	CCDS35440.1																																																																																				0.602	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949		24	22	1	0	1.22574e-08	0.014323	1.4632e-08	24	22				
SLC6A8	6535	broad.mit.edu	37	X	152958790	152958790	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:152958790A>T	ENST00000253122.5	+	6	1461	c.985A>T	c.(985-987)Agc>Tgc	p.S329C	SLC6A8_ENST00000485324.1_3'UTR|SLC6A8_ENST00000430077.2_Missense_Mutation_p.S214C	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	329					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)	p.S329C(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	AGCCCTGGGCAGCTACAACCG	0.627																																							uc004fib.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(985-987)AGC>TGC		solute carrier family 6 member 8 isoform 1	Creatine(DB00148)						45.0	48.0	47.0					X																	152958790		2203	4300	6503	SO:0001583	missense	6535				creatine metabolic process|muscle contraction	integral to plasma membrane	creatine:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chrX:152958790A>T		CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.985A>T	X.37:g.152958790A>T	ENSP00000253122:p.Ser329Cys		Somatic				SLC6A8_uc004fic.3_Missense_Mutation_p.S329C|SLC6A8_uc011myx.1_Missense_Mutation_p.S214C|SLC6A8_uc010nuj.2_RNA	p.S329C	NM_005629	NP_005620	WXS	Illumina HiSeq	Unspecified	P48029	SC6A8_HUMAN			6	1263	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		329			Cytoplasmic (Potential).		B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Missense_Mutation	SNP	ENST00000253122.5	37	c.985A>T	CCDS14726.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	26.8|26.8	4.771382|4.771382	0.90108|0.90108	.|.	.|.	ENSG00000130821|ENSG00000130821	ENST00000413787|ENST00000253122;ENST00000430077;ENST00000328897	T|D;D	0.72615|0.86497	-0.67|-2.13;-2.13	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	.|0.000000	.|0.85682	.|U	.|0.000000	D|D	0.96423|0.96423	0.8833|0.8833	H|H	0.99404|0.99404	4.55|4.55	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.97629|0.97629	1.0141|1.0141	7|10	0.30854|0.87932	T|D	0.27|0	.|.	12.9947|12.9947	0.58640|0.58640	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|348;329	.|Q59EV7;P48029	.|.;SC6A8_HUMAN	L|C	44|329;214;335	ENSP00000400463:Q44L|ENSP00000253122:S329C;ENSP00000403041:S214C	ENSP00000400463:Q44L|ENSP00000253122:S329C	Q|S	+|+	2|1	0|0	SLC6A8|SLC6A8	152611984|152611984	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.002000|9.002000	0.93572|0.93572	1.914000|1.914000	0.55421|0.55421	0.430000|0.430000	0.28490|0.28490	CAG|AGC		0.627	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061003.1			24	36	0	0	0	0.01892	0	24	36				
ABCD1	215	broad.mit.edu	37	X	152991456	152991456	+	Silent	SNP	C	C	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:152991456C>T	ENST00000218104.3	+	1	1134	c.735C>T	c.(733-735)gcC>gcT	p.A245A	BCAP31_ENST00000345046.6_5'Flank|BCAP31_ENST00000458587.2_5'Flank|BCAP31_ENST00000441714.1_5'Flank|ABCD1_ENST00000370129.4_Silent_p.A60A	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	245	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)	p.A245A(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGCCCTCGGCCATCGCCGGCC	0.701																																							uc004fif.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(733-735)GCC>GCT		ATP-binding cassette, sub-family D (ALD), member							24.0	25.0	25.0					X																	152991456		2198	4294	6492	SO:0001819	synonymous_variant	215				fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity	g.chrX:152991456C>T	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.735C>T	X.37:g.152991456C>T			Somatic				BCAP31_uc004fid.2_5'Flank|BCAP31_uc011myz.1_5'Flank|BCAP31_uc011mza.1_5'Flank|BCAP31_uc004fie.2_5'Flank	p.A245A	NM_000033	NP_000024	WXS	Illumina HiSeq	Unspecified	P33897	ABCD1_HUMAN			1	1134	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		245			ABC transmembrane type-1.|Helical; (Potential).		Q6GTZ2	Silent	SNP	ENST00000218104.3	37	c.735C>T	CCDS14728.1																																																																																				0.701	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033		16	11	0	0	0	0.003163	0	16	11				
FLNA	2316	broad.mit.edu	37	X	153582821	153582821	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:153582821C>G	ENST00000369850.3	-	33	5580	c.5344G>C	c.(5344-5346)Ggg>Cgg	p.G1782R	FLNA_ENST00000369856.3_5'UTR|FLNA_ENST00000422373.1_Missense_Mutation_p.G1774R|FLNA_ENST00000360319.4_Missense_Mutation_p.G1774R|FLNA_ENST00000344736.4_Missense_Mutation_p.G1742R	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1782					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)	p.G1782R(1)		breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACATCCAGCCCATTGACACCC	0.612																																							uc004fkk.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(6)	6						c.(5344-5346)GGG>CGG		filamin A, alpha isoform 2							38.0	38.0	38.0					X																	153582821		1990	4153	6143	SO:0001583	missense	2316				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding	g.chrX:153582821C>G	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.5344G>C	X.37:g.153582821C>G	ENSP00000358866:p.Gly1782Arg		Somatic				FLNA_uc004fki.2_5'Flank|FLNA_uc011mzn.1_5'UTR|FLNA_uc010nuu.1_Missense_Mutation_p.G1774R	p.G1782R	NM_001110556	NP_001104026	WXS	Illumina HiSeq	Unspecified	P21333	FLNA_HUMAN			33	5593	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		1782			Filamin 16.		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	c.5344G>C	CCDS48194.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.66|18.66	3.670778|3.670778	0.67814|0.67814	.|.	.|.	ENSG00000196924|ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736|ENST00000438732	D;D;D;D|.	0.85629|.	-2.01;-2.01;-2.01;-2.0|.	5.67|5.67	5.67|5.67	0.87782|0.87782	Immunoglobulin E-set (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60405|0.60405	0.2266|0.2266	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	P;B|.	0.47350|.	0.894;0.004|.	P;B|.	0.55545|.	0.778;0.026|.	T|T	0.57027|0.57027	-0.7881|-0.7881	10|5	0.33141|.	T|.	0.24|.	.|.	14.2921|14.2921	0.66286|0.66286	0.1491:0.8509:0.0:0.0|0.1491:0.8509:0.0:0.0	.|.	1774;1782|.	P21333-2;P21333|.	.;FLNA_HUMAN|.	R|I	1774;1755;1774;1782;1742|64	ENSP00000353467:G1774R;ENSP00000416926:G1774R;ENSP00000358866:G1782R;ENSP00000358863:G1742R|.	ENSP00000358863:G1742R|.	G|M	-|-	1|3	0|0	FLNA|FLNA	153236015|153236015	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.872000|0.872000	0.50106|0.50106	7.357000|7.357000	0.79456|0.79456	2.385000|2.385000	0.81259|0.81259	0.529000|0.529000	0.55759|0.55759	GGG|ATG		0.612	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			12	20	0	0	0	0.020292	0	12	20				
FLNA	2316	broad.mit.edu	37	X	153596271	153596271	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:153596271G>T	ENST00000369850.3	-	3	797	c.561C>A	c.(559-561)aaC>aaA	p.N187K	FLNA_ENST00000422373.1_Missense_Mutation_p.N187K|FLNA_ENST00000360319.4_Missense_Mutation_p.N187K|FLNA_ENST00000344736.4_Missense_Mutation_p.N187K	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	187	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)	p.N187K(1)		breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCGGCTGAAGTTGGTGATGG	0.687																																							uc004fkk.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(6)	6						c.(559-561)AAC>AAA		filamin A, alpha isoform 2							42.0	47.0	45.0					X																	153596271		2026	4189	6215	SO:0001583	missense	2316				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding	g.chrX:153596271G>T	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.561C>A	X.37:g.153596271G>T	ENSP00000358866:p.Asn187Lys		Somatic				FLNA_uc010nuu.1_Missense_Mutation_p.N187K	p.N187K	NM_001110556	NP_001104026	WXS	Illumina HiSeq	Unspecified	P21333	FLNA_HUMAN			3	810	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		187			CH 2.|Actin-binding.		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	c.561C>A	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.096604	0.36952	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.96745	-4.11;-4.11;-4.11;-4.11	5.13	2.43	0.29744	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.98391	0.9465	H	0.95780	3.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97664	1.0162	10	0.87932	D	0	.	10.2019	0.43089	0.2148:0.0:0.7852:0.0	.	187;187	P21333-2;P21333	.;FLNA_HUMAN	K	187;160;187;187;187	ENSP00000353467:N187K;ENSP00000416926:N187K;ENSP00000358866:N187K;ENSP00000358863:N187K	ENSP00000358863:N187K	N	-	3	2	FLNA	153249465	1.000000	0.71417	0.999000	0.59377	0.954000	0.61252	4.212000	0.58514	0.083000	0.17047	-0.513000	0.04457	AAC		0.687	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			24	36	1	0	1.10923e-09	0.016522	1.35501e-09	24	36				
F8	2157	broad.mit.edu	37	X	154157090	154157090	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chrX:154157090G>T	ENST00000360256.4	-	14	5175	c.4975C>A	c.(4975-4977)Cca>Aca	p.P1659T		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1659	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.P1659T(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	AAGACTGGTGGGTTTTGAGAG	0.418																																							uc004fmt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(4975-4977)CCA>ACA		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						148.0	124.0	132.0					X																	154157090		2203	4300	6503	SO:0001583	missense	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154157090G>T	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.4975C>A	X.37:g.154157090G>T	ENSP00000353393:p.Pro1659Thr		Somatic					p.P1659T	NM_000132	NP_000123	WXS	Illumina HiSeq	Unspecified	P00451	FA8_HUMAN			14	5146	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		1659			B.		Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	c.4975C>A	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	g	10.72	1.430111	0.25726	.	.	ENSG00000185010	ENST00000360256	D	0.99677	-6.37	4.89	3.96	0.45880	.	0.509628	0.19617	N	0.109990	D	0.98757	0.9582	M	0.71581	2.175	0.09310	N	1	P	0.46706	0.883	B	0.39419	0.299	D	0.97546	1.0089	10	0.38643	T	0.18	-1.2786	8.9596	0.35838	0.0:0.0:0.7793:0.2207	.	1659	P00451	FA8_HUMAN	T	1659	ENSP00000353393:P1659T	ENSP00000353393:P1659T	P	-	1	0	F8	153810284	0.003000	0.15002	0.005000	0.12908	0.186000	0.23388	0.963000	0.29293	2.170000	0.68504	0.540000	0.68198	CCA		0.418	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			61	84	1	0	4.09106e-26	0.01441	6.25604e-26	61	84				
MTF2	22823	broad.mit.edu	37	1	93602318	93602327	+	Frame_Shift_Del	DEL	AGAGCACTCC	AGAGCACTCC	-			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	AGAGCACTCC	AGAGCACTCC	-	-	AGAGCACTCC	AGAGCACTCC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:93602318_93602327delAGAGCACTCC	ENST00000370298.4	+	15	1805_1814	c.1516_1525delAGAGCACTCC	c.(1516-1527)agagcactccagfs	p.RALQ506fs	MTF2_ENST00000471953.1_3'UTR|MTF2_ENST00000370303.4_Frame_Shift_Del_p.RALQ449fs|MTF2_ENST00000545708.1_Frame_Shift_Del_p.RALQ404fs|MTF2_ENST00000540243.1_Frame_Shift_Del_p.RALQ404fs	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	506					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		TCTTCCAAGAAGAGCACTCCAGACTCAGAA	0.41																																							uc009wdj.2		NA																	0				ovary(2)	2						c.(1516-1527)AGAGCACTCCAGfs		metal response element binding transcription																																				SO:0001589	frameshift_variant	22823					nucleus	DNA binding|zinc ion binding	g.chr1:93602318_93602327delAGAGCACTCC	AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.1516_1525delAGAGCACTCC	1.37:g.93602318_93602327delAGAGCACTCC	ENSP00000359321:p.Arg506fs		Somatic				MTF2_uc010oth.1_Frame_Shift_Del_p.R404fs|MTF2_uc009wdk.2_Frame_Shift_Del_p.R449fs|MTF2_uc001dpi.3_Frame_Shift_Del_p.R233fs|MTF2_uc010oti.1_Frame_Shift_Del_p.R404fs|MTF2_uc001dpj.3_Frame_Shift_Del_p.R404fs|MTF2_uc001dpl.3_Frame_Shift_Del_p.R404fs|MTF2_uc001dpm.3_Frame_Shift_Del_p.R175fs	p.R506fs	NM_007358	NP_031384	WXS	Illumina HiSeq	Unspecified	Q9Y483	MTF2_HUMAN		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)	15	1808_1817	+		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)	506_509					A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Frame_Shift_Del	DEL	ENST00000370298.4	37	c.1516_1525delAGAGCACTCC	CCDS742.1																																																																																				0.410	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028075.3	NM_007358		8	117	NA	NA	NA	NA	NA	8	117	---	---	---	---
STRIP1	85369	broad.mit.edu	37	1	110590442	110590442	+	Frame_Shift_Del	DEL	A	A	-			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr1:110590442delA	ENST00000369795.3	+	15	1634	c.1612delA	c.(1612-1614)aaafs	p.K538fs	STRIP1_ENST00000461054.1_3'UTR|STRIP1_ENST00000369796.1_Frame_Shift_Del_p.K443fs	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	538					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											CTCAAAAGCCAAAACAGACTC	0.502																																							uc001dza.1		NA																	0				ovary(3)|large_intestine(1)	4						c.(1612-1614)AAAfs		hypothetical protein LOC85369							96.0	78.0	84.0					1																	110590442		2201	4296	6497	SO:0001589	frameshift_variant	85369					nucleus	protein binding	g.chr1:110590442delA	AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.1612delA	1.37:g.110590442delA	ENSP00000358810:p.Lys538fs		Somatic				FAM40A_uc001dyz.1_Frame_Shift_Del_p.K443fs|FAM40A_uc009wfp.1_Frame_Shift_Del_p.K362fs	p.K538fs	NM_033088	NP_149079	WXS	Illumina HiSeq	Unspecified	Q5VSL9	FA40A_HUMAN		Lung(183;0.0154)|all cancers(265;0.0732)|Epithelial(280;0.0781)|Colorectal(144;0.115)|LUSC - Lung squamous cell carcinoma(189;0.137)	15	1631	+		all_cancers(81;8.51e-05)|all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)	538					Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Frame_Shift_Del	DEL	ENST00000369795.3	37	c.1612delA	CCDS30798.1																																																																																				0.502	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032213.1	NM_033088		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
COX8A	1351	broad.mit.edu	37	11	63743756	63743764	+	In_Frame_Del	DEL	CCTGTCACA	CCTGTCACA	-	rs11550240	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	CCTGTCACA	CCTGTCACA	-	-	CCTGTCACA	CCTGTCACA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr11:63743756_63743764delCCTGTCACA	ENST00000314133.3	+	2	248_256	c.174_182delCCTGTCACA	c.(172-183)atcctgtcacac>atc	p.LSH59del	AP000721.4_ENST00000535431.1_Intron	NM_004074.2	NP_004065.1	P10176	COX8A_HUMAN	cytochrome c oxidase subunit VIIIA (ubiquitous)	59					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)										CGGGCTGGATCCTGTCACACCTGGAGACC	0.579																																							uc001nye.2		NA																	0					0						c.(172-183)ATCCTGTCACAC>ATC		cytochrome c oxidase subunit VIIIa precursor																																				SO:0001651	inframe_deletion	1351				respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	cytochrome-c oxidase activity	g.chr11:63743756_63743764delCCTGTCACA	J04823	CCDS8054.1	11q12-q13	2011-07-04	2010-04-27	2004-03-24	ENSG00000176340	ENSG00000176340	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2294	protein-coding gene	gene with protein product		123870	"""cytochrome c oxidase subunit VIII"", ""cytochrome c oxidase subunit 8A (ubiquitous)"""	COX8		2543673, 2847943	Standard	NM_004074		Approved	COX8-2, COX8L, VIII-L, COX, VIII	uc001nye.3	P10176	OTTHUMG00000167785	ENST00000314133.3:c.174_182delCCTGTCACA	11.37:g.63743756_63743764delCCTGTCACA	ENSP00000321260:p.Leu59_His61del		Somatic					p.LSH59del	NM_004074	NP_004065	WXS	Illumina HiSeq	Unspecified	P10176	COX8A_HUMAN			2	248_256	+			59_61			Mitochondrial intermembrane (By similarity).		P15955	In_Frame_Del	DEL	ENST00000314133.3	37	c.174_182delCCTGTCACA	CCDS8054.1																																																																																				0.579	COX8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396273.1	NM_004074		48	87	NA	NA	NA	NA	NA	48	87	---	---	---	---
NT5M	56953	broad.mit.edu	37	17	17207098	17207098	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:17207098delG	ENST00000389022.4	+	1	450	c.234delG	c.(232-234)tcgfs	p.S78fs		NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial	78					dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						TCTGGGTGTCGGAGCAGTACG	0.736																																							uc002grf.2		NA																	0					0						c.(232-234)TCGfs		5',3'-nucleotidase, mitochondrial precursor							7.0	8.0	8.0					17																	17207098		2062	4119	6181	SO:0001589	frameshift_variant	56953				DNA replication|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	5'-nucleotidase activity|metal ion binding|nucleotide binding	g.chr17:17207098delG	AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.234delG	17.37:g.17207098delG	ENSP00000373674:p.Ser78fs		Somatic				NT5M_uc002gre.2_Frame_Shift_Del_p.S78fs|NT5M_uc002grg.2_Frame_Shift_Del_p.S78fs	p.S78fs	NM_020201	NP_064586	WXS	Illumina HiSeq	Unspecified	Q9NPB1	NT5M_HUMAN			1	419	+			78						Frame_Shift_Del	DEL	ENST00000389022.4	37	c.234delG	CCDS32581.1																																																																																				0.736	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446045.1			2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
SUPT6H	6830	broad.mit.edu	37	17	27015143	27015143	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr17:27015143delG	ENST00000314616.6	+	24	3324	c.3041delG	c.(3040-3042)cggfs	p.R1014fs	SUPT6H_ENST00000347486.4_Frame_Shift_Del_p.R1014fs	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1014	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CTCGAGAGCCGGACCCAGCTG	0.607																																							uc002hby.2		NA																	0				ovary(2)|skin(1)	3						c.(3040-3042)CGGfs		suppressor of Ty 6 homolog							77.0	73.0	74.0					17																	27015143		2203	4300	6503	SO:0001589	frameshift_variant	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27015143delG	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3041delG	17.37:g.27015143delG	ENSP00000319104:p.Arg1014fs		Somatic				SUPT6H_uc010crt.2_Frame_Shift_Del_p.R1014fs|SUPT6H_uc002hbz.1_5'Flank	p.R1014fs	NM_003170	NP_003161	WXS	Illumina HiSeq	Unspecified	Q7KZ85	SPT6H_HUMAN			24	3131	+	Lung NSC(42;0.00431)		1014					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Frame_Shift_Del	DEL	ENST00000314616.6	37	c.3041delG	CCDS32596.1																																																																																				0.607	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		40	50	NA	NA	NA	NA	NA	40	50	---	---	---	---
COL6A5	256076	broad.mit.edu	37	3	130095082	130095082	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:130095082delC	ENST00000432398.2	+	3	564	c.70delC	c.(70-72)ccafs	p.P24fs	COL6A5_ENST00000265379.6_Frame_Shift_Del_p.P24fs	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	24	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TTTGATAGGGCCAGGCCCTGT	0.388																																							uc010htj.1		NA																	0					0						c.(70-72)CCAfs		collagen, type XXIX, alpha 1							73.0	59.0	63.0					3																	130095082		692	1591	2283	SO:0001589	frameshift_variant	256076				axon guidance|cell adhesion	collagen		g.chr3:130095082delC	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.70delC	3.37:g.130095082delC	ENSP00000390895:p.Pro24fs		Somatic				COL29A1_uc010hti.1_RNA	p.P24fs	NM_153264	NP_694996	WXS	Illumina HiSeq	Unspecified	A8TX70	CO6A5_HUMAN			3	564	+			24			Nonhelical region.		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Frame_Shift_Del	DEL	ENST00000432398.2	37	c.70delC																																																																																					0.388	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264		28	53	NA	NA	NA	NA	NA	28	53	---	---	---	---
BCHE	590	broad.mit.edu	37	3	165491179	165491180	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:165491179_165491180delCA	ENST00000264381.3	-	4	1965_1966	c.1799_1800delTG	c.(1798-1800)gtgfs	p.V600fs	BCHE_ENST00000540653.1_Frame_Shift_Del_p.V62fs	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	600					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	ATTAGAGACCCACACAACTTTC	0.342																																							uc003fem.3		NA																	0				ovary(3)|pancreas(1)	4						c.(1798-1800)GTGfs		butyrylcholinesterase precursor	Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)																																			SO:0001589	frameshift_variant	590				choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding	g.chr3:165491179_165491180delCA	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1799_1800delTG	3.37:g.165491183_165491184delCA	ENSP00000264381:p.Val600fs		Somatic				BCHE_uc003fen.3_RNA	p.V600fs	NM_000055	NP_000046	WXS	Illumina HiSeq	Unspecified	P06276	CHLE_HUMAN			4	1959_1960	-			600					A8K7P8	Frame_Shift_Del	DEL	ENST00000264381.3	37	c.1799_1800delTG	CCDS3198.1																																																																																				0.342	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1			15	39	NA	NA	NA	NA	NA	15	39	---	---	---	---
NDUFB5	4711	broad.mit.edu	37	3	179322663	179322663	+	Frame_Shift_Del	DEL	C	C	-	rs2271840	byFrequency	TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr3:179322663delC	ENST00000259037.3	+	1	174	c.60delC	c.(58-60)ggcfs	p.G20fs	MRPL47_ENST00000259038.2_5'Flank|MRPL47_ENST00000476781.1_5'Flank|NDUFB5_ENST00000472629.1_Frame_Shift_Del_p.G20fs|MRPL47_ENST00000392659.2_5'Flank|NDUFB5_ENST00000493866.1_Frame_Shift_Del_p.G20fs	NM_002492.3	NP_002483.1	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa	20					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|lung(6)|skin(1)	8	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			CTCTGTCTGGCCGGCCCCTTG	0.652																																							uc003fkc.2		NA																	0				skin(1)	1						c.(58-60)GGCfs		NADH dehydrogenase (ubiquinone) 1 beta	NADH(DB00157)						30.0	31.0	31.0					3																	179322663		2203	4300	6503	SO:0001589	frameshift_variant	4711				mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity	g.chr3:179322663delC	AF047181	CCDS3234.1, CCDS56297.1, CCDS75054.1	3q27.1	2011-07-04	2002-08-29		ENSG00000136521	ENSG00000136521		"""Mitochondrial respiratory chain complex / Complex I"""	7700	protein-coding gene	gene with protein product	"""complex I SGDH subunit"""	603841	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5 (16kD, SGDH)"""			9425316	Standard	NM_002492		Approved	SGDH, CI-SGDH, MGC12314	uc003fkc.3	O43674	OTTHUMG00000157480	ENST00000259037.3:c.60delC	3.37:g.179322663delC	ENSP00000259037:p.Gly20fs		Somatic				MRPL47_uc003fjz.2_5'Flank|MRPL47_uc003fka.2_5'Flank|MRPL47_uc003fkb.2_5'Flank|NDUFB5_uc003fkd.2_RNA|NDUFB5_uc003fke.2_Frame_Shift_Del_p.G20fs	p.G20fs	NM_002492	NP_002483	WXS	Illumina HiSeq	Unspecified	O43674	NDUB5_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)		1	89	+	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		20					Q561V6	Frame_Shift_Del	DEL	ENST00000259037.3	37	c.60delC	CCDS3234.1																																																																																				0.652	NDUFB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348937.2	NM_002492		15	31	NA	NA	NA	NA	NA	15	31	---	---	---	---
GBA3	57733	broad.mit.edu	37	4	22749429	22749429	+	RNA	DEL	A	A	-			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr4:22749429delA	ENST00000503442.1	+	0	377				GBA3_ENST00000511446.2_RNA|GBA3_ENST00000508166.1_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)			breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GATTATCCTGAAGTTGTCAAG	0.428																																							uc003gqp.3		NA																	0					0						c.(796-798)GAAfs		cytosolic beta-glucosidase isoform a							70.0	68.0	69.0					4																	22749429		1886	4119	6005			57733				glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity	g.chr4:22749429delA	AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		4.37:g.22749429delA			Somatic				GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Frame_Shift_Del_p.E267fs	p.E266fs	NM_020973	NP_066024	WXS	Illumina HiSeq	Unspecified	Q9H227	GBA3_HUMAN			3	888	+			266					Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	Frame_Shift_Del	DEL	ENST00000503442.1	37	c.797delA																																																																																					0.428	GBA3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000360620.2			13	30	NA	NA	NA	NA	NA	13	30	---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38743667	38743667	+	Frame_Shift_Del	DEL	A	A	-			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr6:38743667delA	ENST00000359357.3	+	11	1505	c.1251delA	c.(1249-1251)ccafs	p.P417fs	DNAH8_ENST00000449981.2_Frame_Shift_Del_p.P634fs|DNAH8_ENST00000441566.1_Frame_Shift_Del_p.P417fs			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	417					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TTCTGGATCCAAGAAGGACAG	0.303																																							uc003ooe.1		NA																	0				skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(1249-1251)CCAfs		dynein, axonemal, heavy polypeptide 8							88.0	103.0	98.0					6																	38743667		2202	4283	6485	SO:0001589	frameshift_variant	1769							g.chr6:38743667delA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1251delA	6.37:g.38743667delA	ENSP00000352312:p.Pro417fs		Somatic					p.P417fs	NM_001371	NP_001362	WXS	Illumina HiSeq	Unspecified					11	1851	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Frame_Shift_Del	DEL	ENST00000359357.3	37	c.1251delA																																																																																					0.303	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		63	105	NA	NA	NA	NA	NA	63	105	---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14216483	14216484	+	Frame_Shift_Ins	INS	-	-	A			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr7:14216483_14216484insA	ENST00000403951.2	-	25	2706_2707	c.2287_2288insT	c.(2287-2289)tggfs	p.W763fs	DGKB_ENST00000444700.2_Frame_Shift_Ins_p.W744fs|DGKB_ENST00000399322.3_Frame_Shift_Ins_p.W763fs|DGKB_ENST00000258767.5_Frame_Shift_Ins_p.W763fs|DGKB_ENST00000407950.1_Frame_Shift_Ins_p.W755fs|DGKB_ENST00000406247.3_Frame_Shift_Ins_p.W763fs|DGKB_ENST00000402815.1_Frame_Shift_Ins_p.W762fs			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	763					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						GGTCTGCATCCATGGCTCCCCA	0.381																																							uc003ssz.2		NA																	0				lung(5)|ovary(4)|breast(2)|skin(1)	12						c.(2287-2289)TGGfs		diacylglycerol kinase, beta isoform 1	Phosphatidylserine(DB00144)																																			SO:0001589	frameshift_variant	1607				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding	g.chr7:14216483_14216484insA	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2288dupT	7.37:g.14216484_14216484dupA	ENSP00000385780:p.Trp763fs		Somatic				DGKB_uc011jxt.1_Frame_Shift_Ins_p.W744fs|DGKB_uc003sta.2_Frame_Shift_Ins_p.W763fs|DGKB_uc011jxu.1_Frame_Shift_Ins_p.W762fs	p.W763fs	NM_004080	NP_004071	WXS	Illumina HiSeq	Unspecified	Q9Y6T7	DGKB_HUMAN			24	2474_2475	-			763					A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Frame_Shift_Ins	INS	ENST00000403951.2	37	c.2287_2288insT	CCDS47547.1																																																																																				0.381	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080		80	90	NA	NA	NA	NA	NA	80	90	---	---	---	---
CNBD1	168975	broad.mit.edu	37	8	88296927	88296927	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5931-01A-11D-1753-08	TCGA-50-5931-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	290847c6-c9d4-4a16-a70f-0488e3718f35	d65ae314-41bc-4273-aafb-507f31c1fa0a	g.chr8:88296927delG	ENST00000518476.1	+	7	844	c.793delG	c.(793-795)gggfs	p.G265fs	CNBD1_ENST00000522427.1_3'UTR	NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	265										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						GAGTACCTTTGGGACTCTGGA	0.393																																							uc003ydy.2		NA																	0				ovary(3)	3						c.(793-795)GGGfs		cyclic nucleotide binding domain containing 1							79.0	75.0	77.0					8																	88296927		1840	4080	5920	SO:0001589	frameshift_variant	168975							g.chr8:88296927delG	AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.793delG	8.37:g.88296927delG	ENSP00000430073:p.Gly265fs		Somatic					p.G265fs	NM_173538	NP_775809	WXS	Illumina HiSeq	Unspecified	Q8NA66	CNBD1_HUMAN			7	841	+			265						Frame_Shift_Del	DEL	ENST00000518476.1	37	c.793delG	CCDS55259.1																																																																																				0.393	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538		7	9	NA	NA	NA	NA	NA	7	9	---	---	---	---
