#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
USP48	84196	broad.mit.edu	37	1	22033296	22033296	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:22033296G>A	ENST00000308271.9	-	16	2677	c.2029C>T	c.(2029-2031)Cag>Tag	p.Q677*	USP48_ENST00000529637.1_Nonsense_Mutation_p.Q689*|USP48_ENST00000400301.1_Nonsense_Mutation_p.Q677*|USP48_ENST00000374732.3_Nonsense_Mutation_p.Q215*	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	677	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.Q677*(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		GGAAAGTACTGCTGCAGTTTG	0.398																																							uc001bfb.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|lung(1)	2						c.(2029-2031)CAG>TAG		ubiquitin specific protease 48 isoform a							127.0	120.0	122.0					1																	22033296		2203	4300	6503	SO:0001587	stop_gained	84196				ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr1:22033296G>A	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2029C>T	1.37:g.22033296G>A	ENSP00000309262:p.Gln677*		Somatic				USP48_uc001bfa.2_Nonsense_Mutation_p.Q215*|USP48_uc010odq.1_Nonsense_Mutation_p.Q689*|USP48_uc009vqc.2_Nonsense_Mutation_p.Q611*|USP48_uc001bfc.2_Nonsense_Mutation_p.Q677*|USP48_uc001bfd.1_5'Flank	p.Q677*	NM_032236	NP_115612	WXS	Illumina HiSeq	Unspecified	Q86UV5	UBP48_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)	16	2267	-		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	677			DUSP 2.		B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Nonsense_Mutation	SNP	ENST00000308271.9	37	c.2029C>T	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	G	38	7.025029	0.98010	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	.	.	.	5.07	4.14	0.48551	.	0.238690	0.44285	D	0.000474	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	9.9876	0.41852	0.0:0.1503:0.6939:0.1558	.	.	.	.	X	677;677;215;689	.	ENSP00000309262:Q677X	Q	-	1	0	USP48	21905883	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	4.509000	0.60448	1.234000	0.43709	0.563000	0.77884	CAG		0.398	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236		11	89	0	0	0	0.013537	0	11	89				
IQCC	55721	broad.mit.edu	37	1	32672631	32672631	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:32672631C>T	ENST00000291358.6	+	4	489	c.468C>T	c.(466-468)agC>agT	p.S156S	DCDC2B_ENST00000409358.1_5'Flank|RP4-622L5.7_ENST00000421616.1_RNA|RP4-622L5.7_ENST00000373604.4_RNA|IQCC_ENST00000537469.1_Silent_p.S236S	NM_018134.2	NP_060604.2	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	156								p.S156S(2)		endometrium(4)|large_intestine(1)|lung(3)|ovary(4)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TGCCCCACAGCCAACCTCAGC	0.527																																							uc001bum.2		NA																	2	Substitution - coding silent(2)	p.S156S(1)	ovary(1)|lung(1)	ovary(4)	4						c.(466-468)AGC>AGT		IQ motif containing C isoform 2							108.0	109.0	109.0					1																	32672631		2203	4300	6503	SO:0001819	synonymous_variant	55721							g.chr1:32672631C>T	AL049795	CCDS355.1, CCDS53293.1	1p36.11-p34.2	2008-02-05			ENSG00000160051	ENSG00000160051			25545	protein-coding gene	gene with protein product							Standard	NM_018134		Approved	FLJ10547	uc001bum.2	Q4KMZ1	OTTHUMG00000005739	ENST00000291358.6:c.468C>T	1.37:g.32672631C>T			Somatic				IQCC_uc009vua.2_Silent_p.S236S|IQCC_uc010ogz.1_Silent_p.S56S|DCDC2B_uc001bun.2_5'Flank	p.S156S	NM_018134	NP_060604	WXS	Illumina HiSeq	Unspecified	Q4KMZ1	IQCC_HUMAN			4	515	+		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)	156					F5H7T8|Q4KMS3|Q4KMZ5|Q53FL2|Q5TFJ8|Q9NVS3	Silent	SNP	ENST00000291358.6	37	c.468C>T	CCDS355.1																																																																																				0.527	IQCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015731.3	NM_018134		13	99	0	0	0	0.001855	0	13	99				
STK40	83931	broad.mit.edu	37	1	36826829	36826829	+	Silent	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:36826829G>A	ENST00000373129.3	-	3	511	c.105C>T	c.(103-105)ttC>ttT	p.F35F	STK40_ENST00000359297.2_Silent_p.F35F|STK40_ENST00000373132.3_Silent_p.F35F|STK40_ENST00000482458.1_5'UTR|STK40_ENST00000373130.3_Silent_p.F35F	NM_032017.1	NP_114406.1	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	35	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				glycogen metabolic process (GO:0005977)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|regulation of MAPK cascade (GO:0043408)|respiratory system process (GO:0003016)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.F35F(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)	13		Myeloproliferative disorder(586;0.0393)				TACCAAGGATGAATGGTCCAG	0.547																																							uc001cak.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(103-105)TTC>TTT		serine/threonine kinase 40							178.0	166.0	170.0					1																	36826829		2203	4300	6503	SO:0001819	synonymous_variant	83931					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	g.chr1:36826829G>A	BC008344	CCDS407.1, CCDS60089.1	1p34.3	2008-02-05			ENSG00000196182	ENSG00000196182			21373	protein-coding gene	gene with protein product		609437					Standard	NM_032017		Approved	MGC4796, SgK495	uc001cak.1	Q8N2I9	OTTHUMG00000008238	ENST00000373129.3:c.105C>T	1.37:g.36826829G>A			Somatic				STK40_uc001cal.1_Silent_p.F35F|STK40_uc001cam.1_Silent_p.F35F|STK40_uc009vva.1_Silent_p.F35F|STK40_uc001can.1_Silent_p.F35F	p.F35F	NM_032017	NP_114406	WXS	Illumina HiSeq	Unspecified	Q8N2I9	STK40_HUMAN			3	512	-		Myeloproliferative disorder(586;0.0393)	35			Protein kinase.		D3DPS8|Q5VTK8|Q5VTK9|Q6ZMN1|Q8N2J8|Q8N3I6|Q96HN6|Q96I44|Q9BSA3|Q9H7H6	Silent	SNP	ENST00000373129.3	37	c.105C>T	CCDS407.1																																																																																				0.547	STK40-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022592.1	NM_032017		11	81	0	0	0	0.008291	0	11	81				
SLC44A3	126969	broad.mit.edu	37	1	95357975	95357975	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:95357975G>C	ENST00000271227.6	+	14	1861	c.1759G>C	c.(1759-1761)Gaa>Caa	p.E587Q	SLC44A3_ENST00000446120.2_Missense_Mutation_p.E551Q|SLC44A3_ENST00000529450.1_Missense_Mutation_p.E554Q|SLC44A3_ENST00000467909.1_Missense_Mutation_p.E539Q|SLC44A3_ENST00000532427.1_Missense_Mutation_p.E507Q|SLC44A3_ENST00000527077.1_Missense_Mutation_p.E519Q	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	587					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E587Q(1)|p.E539Q(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	ATCTGTGTTTGAAACTGTGCT	0.413																																							uc001dqv.3		NA																	2	Substitution - Missense(2)		lung(2)	kidney(1)	1						c.(1759-1761)GAA>CAA		solute carrier family 44, member 3 isoform 1	Choline(DB00122)						241.0	236.0	238.0					1																	95357975		2203	4300	6503	SO:0001583	missense	126969					integral to membrane|plasma membrane	choline transmembrane transporter activity	g.chr1:95357975G>C	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1759G>C	1.37:g.95357975G>C	ENSP00000271227:p.Glu587Gln		Somatic				SLC44A3_uc001dqx.3_Missense_Mutation_p.E586Q|SLC44A3_uc010otq.1_Missense_Mutation_p.E519Q|SLC44A3_uc010otr.1_Missense_Mutation_p.E551Q|SLC44A3_uc001dqw.3_Missense_Mutation_p.E539Q|SLC44A3_uc010ots.1_Missense_Mutation_p.E507Q|SLC44A3_uc009wds.2_Missense_Mutation_p.E490Q|SLC44A3_uc010ott.1_Missense_Mutation_p.E506Q	p.E587Q	NM_001114106	NP_001107578	WXS	Illumina HiSeq	Unspecified	Q8N4M1	CTL3_HUMAN		all cancers(265;0.039)|Epithelial(280;0.124)	14	1866	+		all_lung(203;0.000712)|Lung NSC(277;0.00316)	587					B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	ENST00000271227.6	37	c.1759G>C	CCDS44176.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198559	0.58126	.	.	ENSG00000143036	ENST00000446120;ENST00000271227;ENST00000527077;ENST00000529450;ENST00000467909;ENST00000532427	T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9	5.28	5.28	0.74379	.	0.089006	0.48767	D	0.000167	T	0.42177	0.1191	M	0.85945	2.785	0.42246	D	0.991959	B;D;B;B;B	0.59767	0.126;0.986;0.294;0.126;0.126	B;P;B;B;B	0.58130	0.187;0.833;0.187;0.187;0.187	T	0.42224	-0.9464	10	0.49607	T	0.09	-8.3238	15.6238	0.76833	0.0:0.1376:0.8624:0.0	.	507;551;519;554;587	E9PIC5;Q8N4M1-3;E9PJY8;E9PJH2;Q8N4M1	.;.;.;.;CTL3_HUMAN	Q	551;587;519;554;539;507	ENSP00000389143:E551Q;ENSP00000271227:E587Q;ENSP00000433641:E519Q;ENSP00000431836:E554Q;ENSP00000432789:E539Q;ENSP00000436661:E507Q	ENSP00000271227:E587Q	E	+	1	0	SLC44A3	95130563	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.634000	0.74290	2.620000	0.88729	0.491000	0.48974	GAA		0.413	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369		16	123	0	0	0	0.003163	0	16	123				
GPR61	83873	broad.mit.edu	37	1	110086231	110086231	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:110086231C>T	ENST00000527748.1	+	2	1270	c.587C>T	c.(586-588)tCa>tTa	p.S196L	RP5-1160K1.8_ENST00000526411.1_RNA	NM_031936.4	NP_114142.3	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.S196L(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	23		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		CCAGGCTGTTCACTCCAGTGG	0.577																																							uc001dxy.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(586-588)TCA>TTA		G protein-coupled receptor 61							173.0	164.0	167.0					1																	110086231		2203	4300	6503	SO:0001583	missense	83873					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr1:110086231C>T	AF317652	CCDS801.1	1p13.3	2012-08-21			ENSG00000156097	ENSG00000156097		"""GPCR / Class A : Orphans"""	13300	protein-coding gene	gene with protein product		606916				11165367, 11690637	Standard	NM_031936		Approved	BALGR	uc001dxy.2	Q9BZJ8	OTTHUMG00000011633	ENST00000527748.1:c.587C>T	1.37:g.110086231C>T	ENSP00000432456:p.Ser196Leu		Somatic					p.S196L	NM_031936	NP_114142	WXS	Illumina HiSeq	Unspecified	Q9BZJ8	GPR61_HUMAN		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)	2	1270	+		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)	196			Extracellular (Potential).		A8K1W2|Q6NWS0|Q8TDV4|Q96PR4	Missense_Mutation	SNP	ENST00000527748.1	37	c.587C>T	CCDS801.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.651786	0.88056	.	.	ENSG00000156097	ENST00000527748;ENST00000286603	T	0.36520	1.25	5.68	5.68	0.88126	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.39064	0.1064	L	0.48174	1.505	0.58432	D	0.999996	D	0.71674	0.998	P	0.58620	0.842	T	0.02214	-1.1194	10	0.21540	T	0.41	-22.6039	19.3855	0.94554	0.0:1.0:0.0:0.0	.	196	Q9BZJ8	GPR61_HUMAN	L	196;324	ENSP00000432456:S196L	ENSP00000286603:S324L	S	+	2	0	GPR61	109887754	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.693000	0.68264	2.664000	0.90586	0.655000	0.94253	TCA		0.577	GPR61-005	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385575.1			5	61	0	0	0	0.000602	0	5	61				
TCHH	7062	broad.mit.edu	37	1	152082861	152082861	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:152082861C>T	ENST00000368804.1	-	2	2831	c.2832G>A	c.(2830-2832)ctG>ctA	p.L944L		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	944	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.L944L(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTCCTCTCTCAGCAGCTGCT	0.562																																							uc001ezp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(2830-2832)CTG>CTA		trichohyalin							179.0	184.0	182.0					1																	152082861		1958	4150	6108	SO:0001819	synonymous_variant	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152082861C>T	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2832G>A	1.37:g.152082861C>T			Somatic				TCHH_uc009wne.1_Silent_p.L944L	p.L944L	NM_007113	NP_009044	WXS	Illumina HiSeq	Unspecified	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	2832	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		944			4-2.|10 X 30 AA tandem repeats.		Q5VUI3	Silent	SNP	ENST00000368804.1	37	c.2832G>A	CCDS41396.1																																																																																				0.562	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		15	484	0	0	0	0.00499	0	15	484				
OR10J3	441911	broad.mit.edu	37	1	159284287	159284287	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:159284287G>A	ENST00000332217.5	-	1	162	c.163C>T	c.(163-165)Cat>Tat	p.H55Y		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H55Y(1)|p.H55D(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					GTGTGAAGATGATGGTCCAGG	0.468																																							uc010piu.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(163-165)CAT>TAT		olfactory receptor, family 10, subfamily J,							211.0	210.0	210.0					1																	159284287		2203	4300	6503	SO:0001583	missense	441911				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:159284287G>A		CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.163C>T	1.37:g.159284287G>A	ENSP00000331789:p.His55Tyr		Somatic					p.H55Y	NM_001004467	NP_001004467	WXS	Illumina HiSeq	Unspecified	Q5JRS4	O10J3_HUMAN			1	163	-	all_hematologic(112;0.0429)		55			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000332217.5	37	c.163C>T	CCDS30909.1	.	.	.	.	.	.	.	.	.	.	G	7.025	0.559457	0.13436	.	.	ENSG00000196266	ENST00000332217	T	0.00792	5.69	5.16	5.16	0.70880	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31949	U	0.006808	T	0.00695	0.0023	M	0.84511	2.7	0.31430	N	0.673216	B	0.32245	0.361	B	0.26094	0.066	T	0.51332	-0.8719	10	0.18276	T	0.48	.	16.1857	0.81950	0.0:0.0:1.0:0.0	.	55	Q5JRS4	O10J3_HUMAN	Y	55	ENSP00000331789:H55Y	ENSP00000331789:H55Y	H	-	1	0	OR10J3	157550911	0.028000	0.19301	0.938000	0.37757	0.346000	0.29079	2.063000	0.41423	2.687000	0.91594	0.561000	0.74099	CAT		0.468	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1			13	266	0	0	0	0.003163	0	13	266				
CDC73	79577	broad.mit.edu	37	1	193218933	193218933	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:193218933A>T	ENST00000367435.3	+	16	1675	c.1491A>T	c.(1489-1491)ttA>ttT	p.L497F	CDC73_ENST00000477868.1_3'UTR	NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	497	Interaction with POLR2A and PAF1.				cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)	p.L497F(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						TAACAGTATTAGAACTCAGCT	0.393																																							uc001gtb.2		NA																	1	Substitution - Missense(1)		lung(1)	parathyroid(46)|ovary(1)|breast(1)|pancreas(1)	49						c.(1489-1491)TTA>TTT		parafibromin							116.0	115.0	116.0					1																	193218933		2201	4300	6501	SO:0001583	missense	79577	Hyperparathyroidism_Familial_Isolated|Hyperparathyroidism-Jaw_Tumor_Syndrome			cell cycle|histone H2B ubiquitination|histone monoubiquitination|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding	g.chr1:193218933A>T	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.1491A>T	1.37:g.193218933A>T	ENSP00000356405:p.Leu497Phe		Somatic					p.L497F	NM_024529	NP_078805	WXS	Illumina HiSeq	Unspecified	Q6P1J9	CDC73_HUMAN			16	1734	+			497					A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	37	c.1491A>T	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.425705	0.83667	.	.	ENSG00000134371	ENST00000367435	T	0.68903	-0.36	5.53	4.41	0.53225	.	0.000000	0.64402	D	0.000002	T	0.79650	0.4482	M	0.81614	2.55	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	T	0.78986	-0.1987	10	0.51188	T	0.08	-8.0174	8.622	0.33866	0.8526:0.0:0.1474:0.0	.	497	Q6P1J9	CDC73_HUMAN	F	497	ENSP00000356405:L497F	ENSP00000356405:L497F	L	+	3	2	CDC73	191485556	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	4.358000	0.59442	0.926000	0.37118	0.482000	0.46254	TTA		0.393	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529		11	144	0	0	0	0.010729	0	11	144				
ASPM	259266	broad.mit.edu	37	1	197111590	197111590	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:197111590C>G	ENST00000367409.4	-	3	2048	c.1792G>C	c.(1792-1794)Gaa>Caa	p.E598Q	ASPM_ENST00000294732.7_Missense_Mutation_p.E598Q	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	598					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.E598Q(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						CTTTTGATTTCTCGCACTTCT	0.398																																							uc001gtu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(1792-1794)GAA>CAA		asp (abnormal spindle)-like, microcephaly							204.0	216.0	212.0					1																	197111590		2203	4300	6503	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197111590C>G	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.1792G>C	1.37:g.197111590C>G	ENSP00000356379:p.Glu598Gln		Somatic				ASPM_uc001gtv.2_Missense_Mutation_p.E598Q|ASPM_uc001gtw.3_Intron	p.E598Q	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			3	2049	-			598					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.1792G>C	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.599677	0.28534	.	.	ENSG00000066279	ENST00000367409;ENST00000294732	T;T	0.59364	0.27;1.55	5.65	3.77	0.43336	.	0.324668	0.29861	N	0.011002	T	0.47248	0.1435	L	0.55743	1.74	0.09310	N	1	B;B	0.27068	0.018;0.167	B;B	0.23275	0.012;0.045	T	0.35450	-0.9788	10	0.33141	T	0.24	.	7.2704	0.26254	0.0:0.597:0.2633:0.1398	.	598;598	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	Q	598	ENSP00000356379:E598Q;ENSP00000294732:E598Q	ENSP00000294732:E598Q	E	-	1	0	ASPM	195378213	0.059000	0.20769	0.007000	0.13788	0.017000	0.09413	0.237000	0.17985	0.839000	0.34971	0.643000	0.83706	GAA		0.398	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		19	385	0	0	0	0.00278	0	19	385				
FMOD	2331	broad.mit.edu	37	1	203317286	203317286	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:203317286T>A	ENST00000354955.4	-	2	576	c.113A>T	c.(112-114)tAc>tTc	p.Y38F	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	38					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.Y38F(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			GGGATCGTAGTAGGTGGACTG	0.592																																							uc001gzr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(112-114)TAC>TTC		fibromodulin precursor							65.0	62.0	63.0					1																	203317286		2203	4300	6503	SO:0001583	missense	2331				transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix		g.chr1:203317286T>A	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.113A>T	1.37:g.203317286T>A	ENSP00000347041:p.Tyr38Phe		Somatic				FMOD_uc010pqi.1_RNA	p.Y38F	NM_002023	NP_002014	WXS	Illumina HiSeq	Unspecified	Q06828	FMOD_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.171)		2	249	-			38					Q15331|Q8IV47	Missense_Mutation	SNP	ENST00000354955.4	37	c.113A>T	CCDS30976.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.71|14.71	2.617986|2.617986	0.46736|0.46736	.|.	.|.	ENSG00000122176|ENSG00000122176	ENST00000539467|ENST00000435105;ENST00000354955	.|T	.|0.54675	.|0.56	5.53|5.53	3.17|3.17	0.36434|0.36434	.|.	.|0.231960	.|0.29515	.|N	.|0.011928	T|T	0.29945|0.29945	0.0749|0.0749	N|N	0.19112|0.19112	0.55|0.55	0.22787|0.22787	N|N	0.998734|0.998734	.|P	.|0.37466	.|0.596	.|B	.|0.32211	.|0.142	T|T	0.09552|0.09552	-1.0669|-1.0669	6|10	0.21014|0.30078	T|T	0.42|0.28	-13.6448|-13.6448	6.7498|6.7498	0.23482|0.23482	0.0:0.0776:0.2896:0.6327|0.0:0.0776:0.2896:0.6327	.|.	.|38	.|Q06828	.|FMOD_HUMAN	S|F	19|38	.|ENSP00000347041:Y38F	ENSP00000438680:T19S|ENSP00000347041:Y38F	T|Y	-|-	1|2	0|0	FMOD|FMOD	201583909|201583909	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.879000|0.879000	0.50718|0.50718	2.737000|2.737000	0.47393|0.47393	0.375000|0.375000	0.24679|0.24679	0.460000|0.460000	0.39030|0.39030	ACT|TAC		0.592	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087472.1	NM_002023		9	96	0	0	0	0.006214	0	9	96				
NFASC	23114	broad.mit.edu	37	1	204923376	204923376	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:204923376G>A	ENST00000401399.1	+	5	475	c.276G>A	c.(274-276)atG>atA	p.M92I	NFASC_ENST00000403080.1_Missense_Mutation_p.M92I|NFASC_ENST00000404076.1_Missense_Mutation_p.M86I|NFASC_ENST00000404907.1_Missense_Mutation_p.M86I|NFASC_ENST00000539706.1_Missense_Mutation_p.M86I|NFASC_ENST00000367169.4_Missense_Mutation_p.M92I|NFASC_ENST00000367172.4_Missense_Mutation_p.M92I|NFASC_ENST00000360049.4_Missense_Mutation_p.M86I|NFASC_ENST00000339876.6_Missense_Mutation_p.M92I|NFASC_ENST00000338515.6_Missense_Mutation_p.M92I|NFASC_ENST00000367171.4_Missense_Mutation_p.M92I|NFASC_ENST00000338586.6_Missense_Mutation_p.M92I|NFASC_ENST00000513543.1_Missense_Mutation_p.M86I|NFASC_ENST00000367170.4_Missense_Mutation_p.M92I			O94856	NFASC_HUMAN	neurofascin	92	Ig-like C2-type 1.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.M92I(2)|p.M86I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GGGTGTCCATGAGGAGGAGGT	0.582																																							uc001hbj.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(274-276)ATG>ATA		neurofascin isoform 1 precursor							61.0	60.0	60.0					1																	204923376		2203	4300	6503	SO:0001583	missense	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204923376G>A	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.276G>A	1.37:g.204923376G>A	ENSP00000385637:p.Met92Ile		Somatic				NFASC_uc001hbh.2_Missense_Mutation_p.M92I|NFASC_uc010pqz.1_Missense_Mutation_p.M86I|NFASC_uc010pra.1_Missense_Mutation_p.M86I|NFASC_uc001hbi.2_Missense_Mutation_p.M86I|NFASC_uc009xbg.1_Missense_Mutation_p.M159I|NFASC_uc010prb.1_Missense_Mutation_p.M86I|NFASC_uc010prc.1_5'UTR	p.M92I	NM_001005388	NP_001005388	WXS	Illumina HiSeq	Unspecified	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		6	604	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		92			Ig-like C2-type 1.|Extracellular (Potential).		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	c.276G>A	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777266	0.70107	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000446412;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000505079;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.66460	1.29;-0.21;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;-0.21;1.29;1.29;1.29	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000003	T	0.66167	0.2762	L	0.38838	1.175	0.54753	D	0.999985	P;B;P;P;B;B	0.42357	0.613;0.111;0.487;0.777;0.34;0.185	B;B;P;B;B;B	0.48738	0.32;0.044;0.588;0.13;0.069;0.115	T	0.67484	-0.5659	10	0.51188	T	0.08	.	14.3309	0.66556	0.0:0.1484:0.8516:0.0	.	86;86;188;92;86;92	O94856-11;O94856-8;B4DRH7;O94856-9;O94856-3;O94856-2	.;.;.;.;.;.	I	92;92;92;92;92;92;86;86;86;92;92;92;86;92;92;86;86;62	ENSP00000356140:M92I;ENSP00000356139:M92I;ENSP00000356138:M92I;ENSP00000342128:M92I;ENSP00000344786:M92I;ENSP00000343509:M92I;ENSP00000438614:M86I;ENSP00000353154:M86I;ENSP00000356137:M92I;ENSP00000412161:M92I;ENSP00000384875:M92I;ENSP00000385676:M86I;ENSP00000385637:M92I;ENSP00000427586:M92I;ENSP00000384061:M86I;ENSP00000425908:M86I;ENSP00000415031:M62I	ENSP00000295776:M86I	M	+	3	0	NFASC	203189999	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.749000	0.85096	2.516000	0.84829	0.655000	0.94253	ATG		0.582	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		4	101	0	0	0	0.009096	0	4	101				
IKBKE	9641	broad.mit.edu	37	1	206649522	206649522	+	Splice_Site	SNP	A	A	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:206649522A>G	ENST00000367120.3	+	6	731		c.e6-1		IKBKE_ENST00000537984.1_Splice_Site	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon						immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)	p.?(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					GTCTGTCCCCAGTGGCCGGCA	0.617																																							uc001hdz.1		NA																	1	Unknown(1)		lung(1)	ovary(3)|lung(3)|central_nervous_system(1)|skin(1)	8						c.e6-2		IKK-related kinase epsilon							50.0	46.0	47.0					1																	206649522		2203	4300	6503	SO:0001630	splice_region_variant	9641				DNA damage response, signal transduction resulting in induction of apoptosis|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane|PML body	ATP binding|IkappaB kinase activity|NF-kappaB-inducing kinase activity|protein binding	g.chr1:206649522A>G	AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.359-1A>G	1.37:g.206649522A>G			Somatic				IKBKE_uc009xbu.1_Splice_Site_p.V120_splice|IKBKE_uc009xbv.1_Splice_Site_p.V120_splice|IKBKE_uc001hea.1_Splice_Site_p.V35_splice	p.V120_splice	NM_014002	NP_054721	WXS	Illumina HiSeq	Unspecified	Q14164	IKKE_HUMAN			6	727	+	Breast(84;0.137)							D3DT78|Q3B754|Q3KR43|Q5JTS6	Splice_Site	SNP	ENST00000367120.3	37	c.359_splice	CCDS30996.1	.	.	.	.	.	.	.	.	.	.	A	18.14	3.557034	0.65425	.	.	ENSG00000143466	ENST00000367120;ENST00000537984	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4601	0.75349	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IKBKE	204716145	1.000000	0.71417	0.994000	0.49952	0.649000	0.38597	9.019000	0.93662	2.110000	0.64415	0.402000	0.26972	.		0.617	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088484.1		Intron	20	18	0	0	0	0.010504	0	20	18				
LAMB3	3914	broad.mit.edu	37	1	209789861	209789861	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:209789861C>T	ENST00000356082.4	-	22	3471	c.3337G>A	c.(3337-3339)Gag>Aag	p.E1113K	LAMB3_ENST00000367030.3_Missense_Mutation_p.E1113K|LAMB3_ENST00000391911.1_Missense_Mutation_p.E1113K	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	1113	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.E1113K(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		AACAGCTCCTCTGCCTCTGTC	0.522																																							uc001hhg.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6						c.(3337-3339)GAG>AAG		laminin, beta 3 precursor							227.0	217.0	220.0					1																	209789861		2203	4300	6503	SO:0001583	missense	3914				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity	g.chr1:209789861C>T	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.3337G>A	1.37:g.209789861C>T	ENSP00000348384:p.Glu1113Lys		Somatic				LAMB3_uc009xco.2_Missense_Mutation_p.E1113K|LAMB3_uc001hhh.2_Missense_Mutation_p.E1113K	p.E1113K	NM_001017402	NP_001017402	WXS	Illumina HiSeq	Unspecified	Q13751	LAMB3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0519)	21	3727	-			1113			Domain I.|Potential.		D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	37	c.3337G>A	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524281	0.27299	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.35789	1.29;1.29;1.29	4.43	2.4	0.29515	.	0.612675	0.15119	U	0.279482	T	0.19167	0.0460	N	0.19112	0.55	0.23282	N	0.997983	B	0.06786	0.001	B	0.06405	0.002	T	0.23154	-1.0196	10	0.14252	T	0.57	.	6.6992	0.23215	0.0:0.7178:0.1803:0.1019	.	1113	Q13751	LAMB3_HUMAN	K	1113	ENSP00000375778:E1113K;ENSP00000348384:E1113K;ENSP00000355997:E1113K	ENSP00000348384:E1113K	E	-	1	0	LAMB3	207856484	0.049000	0.20398	0.987000	0.45799	0.916000	0.54674	0.518000	0.22847	0.865000	0.35603	0.449000	0.29647	GAG		0.522	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228		17	261	0	0	0	0.006122	0	17	261				
RPS6KC1	26750	broad.mit.edu	37	1	213415373	213415373	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:213415373G>A	ENST00000366960.3	+	11	2704	c.2554G>A	c.(2554-2556)Gat>Aat	p.D852N	RPS6KC1_ENST00000366959.3_Missense_Mutation_p.D840N|RPS6KC1_ENST00000543354.1_Missense_Mutation_p.D555N|RPS6KC1_ENST00000543470.1_Missense_Mutation_p.D640N|RPS6KC1_ENST00000490299.1_3'UTR	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	852	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)	p.D852N(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		TCAGACTGATGATTTGGCTAA	0.383																																							uc010ptr.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(3)|breast(1)	8						c.(2554-2556)GAT>AAT		ribosomal protein S6 kinase, 52kDa, polypeptide							113.0	117.0	116.0					1																	213415373		2203	4300	6503	SO:0001583	missense	26750				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity	g.chr1:213415373G>A	AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.2554G>A	1.37:g.213415373G>A	ENSP00000355927:p.Asp852Asn		Somatic				RPS6KC1_uc001hkd.2_Missense_Mutation_p.D840N|RPS6KC1_uc010pts.1_Missense_Mutation_p.D640N|RPS6KC1_uc010ptt.1_Missense_Mutation_p.D640N|RPS6KC1_uc010ptu.1_Missense_Mutation_p.D671N|RPS6KC1_uc010ptv.1_Missense_Mutation_p.D387N|RPS6KC1_uc001hke.2_Missense_Mutation_p.D671N	p.D852N	NM_012424	NP_036556	WXS	Illumina HiSeq	Unspecified	Q96S38	KS6C1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)	11	2713	+			852			Protein kinase 2.		B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Missense_Mutation	SNP	ENST00000366960.3	37	c.2554G>A	CCDS1513.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.736236	0.49045	.	.	ENSG00000136643	ENST00000543470;ENST00000366960;ENST00000366959;ENST00000543354	T;T;T;T	0.41758	1.47;1.49;1.5;0.99	5.42	5.42	0.78866	Protein kinase, catalytic domain (1);	0.143676	0.49305	D	0.000146	T	0.52158	0.1717	L	0.47716	1.5	0.45108	D	0.998122	D;P;P	0.55800	0.973;0.682;0.682	P;B;B	0.54270	0.747;0.227;0.227	T	0.42327	-0.9458	10	0.33940	T	0.23	-21.2083	19.2322	0.93845	0.0:0.0:1.0:0.0	.	640;852;840	F5H7T0;Q96S38;B1APS8	.;KS6C1_HUMAN;.	N	640;852;840;555	ENSP00000442306:D640N;ENSP00000355927:D852N;ENSP00000355926:D840N;ENSP00000439282:D555N	ENSP00000355926:D840N	D	+	1	0	RPS6KC1	211481996	1.000000	0.71417	0.722000	0.30670	0.884000	0.51177	3.905000	0.56333	2.525000	0.85131	0.655000	0.94253	GAT		0.383	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089690.3	NM_012424		12	299	0	0	0	0.003163	0	12	299				
SMYD2	56950	broad.mit.edu	37	1	214510074	214510074	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:214510074G>A	ENST00000366957.5	+	12	1271	c.1249G>A	c.(1249-1251)Ggc>Agc	p.G417S	SMYD2_ENST00000415093.2_3'UTR|SMYD2_ENST00000491455.1_3'UTR	NM_020197.2	NP_064582.2	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	417					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|RNA polymerase II core binding (GO:0000993)	p.G417S(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		AGTAGCTCACGGCAAAGATCA	0.403																																							uc010ptx.1		NA																	2	Substitution - Missense(2)		lung(1)|kidney(1)	ovary(1)	1						c.(1249-1251)GGC>AGC		SET and MYND domain containing 2							111.0	103.0	105.0					1																	214510074		2203	4300	6503	SO:0001583	missense	56950				negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	cytosol|nucleus	histone methyltransferase activity (H3-K36 specific)|p53 binding|RNA polymerase II core binding|zinc ion binding	g.chr1:214510074G>A	AF226053	CCDS31022.1	1q32.3	2011-07-01			ENSG00000143499	ENSG00000143499		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20982	protein-coding gene	gene with protein product		610663					Standard	NM_020197		Approved	HSKM-B, ZMYND14, KMT3C	uc021pix.1	Q9NRG4	OTTHUMG00000037066	ENST00000366957.5:c.1249G>A	1.37:g.214510074G>A	ENSP00000355924:p.Gly417Ser		Somatic				SMYD2_uc009xdl.1_RNA	p.G417S	NM_020197	NP_064582	WXS	Illumina HiSeq	Unspecified	Q9NRG4	SMYD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)	12	1282	+			417					B2R9P9|I6L9H7|Q4V765|Q5VSH9|Q96AI4	Missense_Mutation	SNP	ENST00000366957.5	37	c.1249G>A	CCDS31022.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716833	0.89205	.	.	ENSG00000143499	ENST00000366957	T	0.44482	0.92	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.67646	0.2915	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68428	-0.5411	10	0.66056	D	0.02	-21.8132	20.093	0.97828	0.0:0.0:1.0:0.0	.	417	Q9NRG4	SMYD2_HUMAN	S	417	ENSP00000355924:G417S	ENSP00000355924:G417S	G	+	1	0	SMYD2	212576697	1.000000	0.71417	0.997000	0.53966	0.363000	0.29612	9.621000	0.98376	2.756000	0.94617	0.561000	0.74099	GGC		0.403	SMYD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089998.1	NM_020197		13	145	0	0	0	0.003163	0	13	145				
CENPF	1063	broad.mit.edu	37	1	214813604	214813604	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:214813604G>C	ENST00000366955.3	+	12	2091	c.1923G>C	c.(1921-1923)caG>caC	p.Q641H		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.Q641H(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AAAACTTGCAGAGTAAAATTA	0.338																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(1921-1923)CAG>CAC		centromere protein F							35.0	38.0	37.0					1																	214813604		2202	4300	6502	SO:0001583	missense	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214813604G>C	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.1923G>C	1.37:g.214813604G>C	ENSP00000355922:p.Gln641His		Somatic					p.Q641H	NM_016343	NP_057427	WXS	Illumina HiSeq	Unspecified	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	12	2097	+			641			Potential.		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	c.1923G>C	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050592	0.55218	.	.	ENSG00000117724	ENST00000366955	T	0.03441	3.93	5.84	4.83	0.62350	.	0.495939	0.15118	N	0.279548	T	0.12050	0.0293	.	.	.	0.25872	N	0.983691	D	0.69078	0.997	P	0.62089	0.898	T	0.05550	-1.0878	9	0.39692	T	0.17	.	13.4266	0.61028	0.1021:0.0:0.8979:0.0	.	641	P49454	CENPF_HUMAN	H	641	ENSP00000355922:Q641H	ENSP00000355922:Q641H	Q	+	3	2	CENPF	212880227	0.989000	0.36119	0.998000	0.56505	0.992000	0.81027	1.499000	0.35671	2.758000	0.94735	0.609000	0.83330	CAG		0.338	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		5	91	0	0	0	0.000602	0	5	91				
RRP15	51018	broad.mit.edu	37	1	218504419	218504419	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:218504419G>A	ENST00000366932.3	+	5	865	c.835G>A	c.(835-837)Gac>Aac	p.D279N		NM_016052.3	NP_057136.2	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog (S. cerevisiae)	279						mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.D279N(1)	ACBD6/RRP15(2)	NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		ATCTGCAAGTGACTCTGATAC	0.393																																							uc001hlj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(835-837)GAC>AAC		ribosomal RNA processing 15 homolog							70.0	66.0	67.0					1																	218504419		2203	4300	6503	SO:0001583	missense	51018					mitochondrion|nucleolus	protein binding	g.chr1:218504419G>A		CCDS1520.2	1q41	2008-02-05			ENSG00000067533	ENSG00000067533			24255	protein-coding gene	gene with protein product		611193	"""KIAA0507"""	KIAA0507		15769876	Standard	NM_016052		Approved	CGI-115	uc001hlj.3	Q9Y3B9	OTTHUMG00000039494	ENST00000366932.3:c.835G>A	1.37:g.218504419G>A	ENSP00000355899:p.Asp279Asn		Somatic				RRP15_uc001hlk.2_RNA	p.D279N	NM_016052	NP_057136	WXS	Illumina HiSeq	Unspecified	Q9Y3B9	RRP15_HUMAN		all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)	5	865	+			279						Missense_Mutation	SNP	ENST00000366932.3	37	c.835G>A	CCDS1520.2	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755873	0.69648	.	.	ENSG00000067533	ENST00000366932	T	0.29142	1.58	5.52	3.57	0.40892	.	0.620454	0.17441	N	0.174116	T	0.29126	0.0724	L	0.36672	1.1	0.27825	N	0.941679	D	0.53619	0.961	P	0.44597	0.454	T	0.06881	-1.0802	10	0.49607	T	0.09	.	14.3721	0.66846	0.0:0.2809:0.7191:0.0	.	279	Q9Y3B9	RRP15_HUMAN	N	279	ENSP00000355899:D279N	ENSP00000355899:D279N	D	+	1	0	RRP15	216571042	1.000000	0.71417	0.004000	0.12327	0.996000	0.88848	2.012000	0.40932	0.635000	0.30488	0.655000	0.94253	GAC		0.393	RRP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095284.1	NM_016052		5	91	0	0	0	0.001168	0	5	91				
ZNF678	339500	broad.mit.edu	37	1	227843344	227843344	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:227843344G>A	ENST00000343776.5	+	4	1738	c.1393G>A	c.(1393-1395)Gaa>Aaa	p.E465K	ZNF678_ENST00000397097.3_Missense_Mutation_p.E520K|ZNF678_ENST00000608949.1_Intron	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E465K(1)|p.E520K(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				CAAATGTGAAGAATGTGGCAA	0.363																																							uc001hqw.1		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1393-1395)GAA>AAA		zinc finger protein 678							38.0	42.0	41.0					1																	227843344		2202	4294	6496	SO:0001583	missense	339500				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr1:227843344G>A	BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.1393G>A	1.37:g.227843344G>A	ENSP00000344828:p.Glu465Lys		Somatic				ZNF678_uc009xet.1_Intron|ZNF678_uc009xeu.1_Intron	p.E465K	NM_178549	NP_848644	WXS	Illumina HiSeq	Unspecified	F5GXA7	F5GXA7_HUMAN			4	1738	+		Prostate(94;0.0885)	520					Q8IVQ9	Missense_Mutation	SNP	ENST00000343776.5	37	c.1393G>A		.	.	.	.	.	.	.	.	.	.	G	10.03	1.239801	0.22711	.	.	ENSG00000181450	ENST00000343776;ENST00000397097	T;T	0.37058	1.22;1.22	1.63	0.621	0.17643	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31575	0.0801	L	0.41710	1.295	0.09310	N	1	P	0.51933	0.949	P	0.48114	0.567	T	0.14531	-1.0469	9	0.51188	T	0.08	.	5.2133	0.15329	0.2253:0.0:0.7747:0.0	.	465	Q5SXM1	ZN678_HUMAN	K	465;520	ENSP00000344828:E465K;ENSP00000440403:E520K	ENSP00000344828:E465K	E	+	1	0	ZNF678	225909967	0.000000	0.05858	0.015000	0.15790	0.009000	0.06853	-2.017000	0.01445	0.792000	0.33850	0.609000	0.83330	GAA		0.363	ZNF678-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000091976.2	NM_178549		6	66	0	0	0	0.001984	0	6	66				
OR2W5	441932	broad.mit.edu	37	1	247655031	247655031	+	RNA	SNP	G	G	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:247655031G>T	ENST00000522351.1	+	0	662							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C201F(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			ATTCACCTTTGCCCTGGGGGT	0.592																																							uc001icz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(601-603)TGC>TTC		olfactory receptor, family 2, subfamily W,							126.0	130.0	129.0					1																	247655031		2203	4300	6503			441932				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247655031G>T			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247655031G>T			Somatic					p.C201F	NM_001004698	NP_001004698	WXS	Illumina HiSeq	Unspecified	A6NFC9	OR2W5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	602	+	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	201					B9EH85	Missense_Mutation	SNP	ENST00000522351.1	37	c.602G>T																																																																																					0.592	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698		9	259	1	0	4.68919e-08	0.008291	5.44871e-08	9	259				
OR2T34	127068	broad.mit.edu	37	1	248737470	248737470	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:248737470C>T	ENST00000328782.2	-	1	610	c.589G>A	c.(589-591)Gtc>Atc	p.V197I		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V197I(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TAGAGGGAGACGTCAGAGCAG	0.517																																							uc001iep.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(589-591)GTC>ATC		olfactory receptor, family 2, subfamily T,							153.0	171.0	165.0					1																	248737470		2144	4300	6444	SO:0001583	missense	127068				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248737470C>T	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.589G>A	1.37:g.248737470C>T	ENSP00000330904:p.Val197Ile		Somatic					p.V197I	NM_001001821	NP_001001821	WXS	Illumina HiSeq	Unspecified	Q8NGX1	O2T34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	589	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		197			Extracellular (Potential).		B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	37	c.589G>A	CCDS31120.1	.	.	.	.	.	.	.	.	.	.	.	8.800	0.932770	0.18131	.	.	ENSG00000183310	ENST00000328782	T	0.00069	8.77	2.37	-0.338	0.12651	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.02345	-0.59	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.13818	-1.0495	9	0.56958	D	0.05	.	2.8491	0.05552	0.3815:0.1291:0.0:0.4895	.	197	Q8NGX1	O2T34_HUMAN	I	197	ENSP00000330904:V197I	ENSP00000330904:V197I	V	-	1	0	OR2T34	246804093	0.000000	0.05858	0.006000	0.13384	0.159000	0.22180	-1.043000	0.03535	-0.342000	0.08363	0.123000	0.15791	GTC		0.517	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821		7	246	0	0	0	0.004482	0	7	246				
PGBD2	267002	broad.mit.edu	37	1	249211155	249211155	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr1:249211155G>C	ENST00000329291.5	+	3	519	c.372G>C	c.(370-372)tgG>tgC	p.W124C	PGBD2_ENST00000539153.1_Missense_Mutation_p.W121C|PGBD2_ENST00000355360.4_Intron|PGBD2_ENST00000462488.1_Intron	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	124								p.W124C(1)		NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TTGGCAGTTGGACTGCATCAG	0.458																																							uc001ifh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(370-372)TGG>TGC		hypothetical protein LOC267002 isoform a							54.0	60.0	58.0					1																	249211155		2203	4300	6503	SO:0001583	missense	267002							g.chr1:249211155G>C	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.372G>C	1.37:g.249211155G>C	ENSP00000331643:p.Trp124Cys		Somatic				PGBD2_uc001ifg.2_Intron|PGBD2_uc009xhd.2_Missense_Mutation_p.W121C	p.W124C	NM_170725	NP_733843	WXS	Illumina HiSeq	Unspecified	Q6P3X8	PGBD2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		3	519	+	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	124					B3KVR8|Q6MZF8	Missense_Mutation	SNP	ENST00000329291.5	37	c.372G>C	CCDS31128.1	.	.	.	.	.	.	.	.	.	.	G	4.585	0.108713	0.08780	.	.	ENSG00000185220	ENST00000329291;ENST00000539153	T;T	0.13196	2.61;2.61	4.18	3.23	0.37069	.	0.000000	0.31507	U	0.007527	T	0.29028	0.0721	L	0.59436	1.845	0.20196	N	0.999929	D;D	0.89917	1.0;1.0	D;D	0.85130	0.976;0.997	T	0.02574	-1.1139	10	0.39692	T	0.17	-21.8159	9.7773	0.40628	0.0:0.2105:0.7895:0.0	.	121;124	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	C	124;121	ENSP00000331643:W124C;ENSP00000439950:W121C	ENSP00000331643:W124C	W	+	3	0	PGBD2	247177778	0.965000	0.33210	0.044000	0.18714	0.009000	0.06853	2.064000	0.41432	1.059000	0.40554	0.655000	0.94253	TGG		0.458	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1			6	123	0	0	0	0.001168	0	6	123				
ACBD5	91452	broad.mit.edu	37	10	27506908	27506908	+	Splice_Site	SNP	C	C	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr10:27506908C>A	ENST00000375888.1	-	7	921		c.e7+1		ACBD5_ENST00000375905.4_Splice_Site|ACBD5_ENST00000375901.1_Splice_Site|ACBD5_ENST00000396271.3_Splice_Site|ACBD5_ENST00000476758.1_Splice_Site|ACBD5_ENST00000375897.3_Intron			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5						peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)	p.?(2)		breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						GGGGACAATACCTTGGTGAAT	0.373																																							uc010qdp.1		NA																	2	Unknown(2)		lung(2)		0						c.e7+1		acyl-Coenzyme A binding domain containing 5							114.0	105.0	108.0					10																	27506908		2203	4300	6503	SO:0001630	splice_region_variant	91452				transport	integral to membrane|peroxisomal membrane	fatty-acyl-CoA binding	g.chr10:27506908C>A	AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.856+1G>T	10.37:g.27506908C>A			Somatic				ACBD5_uc010qdm.1_Splice_Site_p.D275_splice|ACBD5_uc010qdn.1_Splice_Site_p.D168_splice|ACBD5_uc010qdo.1_Intron|ACBD5_uc001ito.2_Splice_Site_p.D242_splice|ACBD5_uc001itp.2_Splice_Site_p.D168_splice|ACBD5_uc001itq.2_Splice_Site_p.D168_splice|ACBD5_uc001itr.1_Splice_Site_p.D66_splice	p.D277_splice	NM_145698	NP_663736	WXS	Illumina HiSeq	Unspecified	Q5T8D3	ACBD5_HUMAN			7	1020	-								B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Splice_Site	SNP	ENST00000375888.1	37	c.829_splice		.	.	.	.	.	.	.	.	.	.	C	12.23	1.875509	0.33162	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375888	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9772	0.86316	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACBD5	27546914	1.000000	0.71417	0.998000	0.56505	0.170000	0.22686	4.913000	0.63341	2.434000	0.82447	0.585000	0.79938	.		0.373	ACBD5-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000047314.1	NM_145698	Intron	4	90	1	0	0.00909568	0.009096	0.00955915	4	90				
EPC1	80314	broad.mit.edu	37	10	32561036	32561036	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr10:32561036C>T	ENST00000263062.8	-	13	2261	c.1992G>A	c.(1990-1992)gtG>gtA	p.V664V	RP11-166N17.1_ENST00000415731.2_RNA|EPC1_ENST00000319778.6_Silent_p.V641V|EPC1_ENST00000375110.2_Silent_p.V591V	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	664					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)		p.V664V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				GTTCTGATGTCACCAAAGCAG	0.398																																							uc001iwg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1990-1992)GTG>GTA		enhancer of polycomb 1							75.0	66.0	69.0					10																	32561036		2203	4300	6503	SO:0001819	synonymous_variant	80314				histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex		g.chr10:32561036C>T	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.1992G>A	10.37:g.32561036C>T			Somatic				EPC1_uc001iwi.3_Silent_p.V591V|EPC1_uc001iwh.1_Silent_p.V641V	p.V664V	NM_025209	NP_079485	WXS	Illumina HiSeq	Unspecified	Q9H2F5	EPC1_HUMAN			13	2262	-		Prostate(175;0.0199)	664					B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Silent	SNP	ENST00000263062.8	37	c.1992G>A	CCDS7172.1																																																																																				0.398	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1			10	64	0	0	0	0.008291	0	10	64				
NRG3	10718	broad.mit.edu	37	10	84744853	84744853	+	Splice_Site	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr10:84744853G>C	ENST00000404547.1	+	10	1655		c.e10-1		NRG3_ENST00000372141.2_Splice_Site|NRG3_ENST00000545131.1_Splice_Site|NRG3_ENST00000556918.1_Splice_Site|NRG3_ENST00000404576.2_Splice_Site|NRG3_ENST00000537893.1_Splice_Site|NRG3_ENST00000372142.2_Splice_Site			P56975	NRG3_HUMAN	neuregulin 3						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.?(2)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TTCTTTTTCAGGTATTCATCC	0.383																																							uc001kco.2		NA																	2	Unknown(2)		lung(2)	lung(5)|breast(1)	6						c.e9-1		neuregulin 3 isoform 1							132.0	145.0	140.0					10																	84744853		2203	4300	6503	SO:0001630	splice_region_variant	10718				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity	g.chr10:84744853G>C	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1656-1G>C	10.37:g.84744853G>C			Somatic				NRG3_uc010qlz.1_Splice_Site_p.G527_splice|NRG3_uc001kcp.2_Splice_Site_p.K331_splice|NRG3_uc001kcq.2_Splice_Site_p.G178_splice|NRG3_uc001kcr.2_Splice_Site_p.K202_splice	p.G528_splice	NM_001010848	NP_001010848	WXS	Illumina HiSeq	Unspecified	P56975	NRG3_HUMAN		GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)	9	1611	+								A4D7U1|Q0PEH2|Q5VYH3	Splice_Site	SNP	ENST00000404547.1	37	c.1584_splice	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087851	0.55968	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8962	0.88888	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NRG3	84734833	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.895000	0.63214	2.827000	0.97445	0.650000	0.86243	.		0.383	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086	Intron	47	220	0	0	0	0.01441	0	47	220				
COL17A1	1308	broad.mit.edu	37	10	105798252	105798252	+	Silent	SNP	C	C	T	rs372181801		TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr10:105798252C>T	ENST00000353479.5	-	45	3272	c.2982G>A	c.(2980-2982)ccG>ccA	p.P994P	COL17A1_ENST00000369733.3_Silent_p.P949P	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	994	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.P994P(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GGGGCCCTGGCGGGCCTGACA	0.602																																							uc001kxr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(2980-2982)CCG>CCA		alpha 1 type XVII collagen		C		0,4394		0,0,2197	63.0	72.0	69.0		2982	-9.6	0.1	10		69	1,8585		0,1,4292	no	coding-synonymous	COL17A1	NM_000494.3		0,1,6489	TT,TC,CC		0.0116,0.0,0.0077		994/1498	105798252	1,12979	2197	4293	6490	SO:0001819	synonymous_variant	1308				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding	g.chr10:105798252C>T	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.2982G>A	10.37:g.105798252C>T			Somatic					p.P994P	NM_000494	NP_000485	WXS	Illumina HiSeq	Unspecified	Q9UMD9	COHA1_HUMAN		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	45	3151	-		Colorectal(252;0.103)|Breast(234;0.122)	994			Extracellular (Potential).|Triple-helical region.		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	ENST00000353479.5	37	c.2982G>A	CCDS7554.1																																																																																				0.602	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		4	153	0	0	0	0.009096	0	4	153				
ATHL1	80162	broad.mit.edu	37	11	293450	293450	+	Silent	SNP	A	A	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr11:293450A>G	ENST00000409548.2	+	9	1543	c.1428A>G	c.(1426-1428)gtA>gtG	p.V476V	ATHL1_ENST00000409479.1_Silent_p.V503V|ATHL1_ENST00000409655.1_Intron	NM_025092.4	NP_079368.3	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1 (yeast)	476					carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.V476V(1)|p.V299V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|skin(3)	17		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		AGATCAAGGTACCCTTTGACG	0.632																																							uc010qvu.1		NA																	2	Substitution - coding silent(2)		lung(2)	liver(1)|central_nervous_system(1)|skin(1)	3						c.(1426-1428)GTA>GTG		ATH1, acid trehalase-like 1							52.0	51.0	52.0					11																	293450		2203	4299	6502	SO:0001819	synonymous_variant	80162				carbohydrate metabolic process		hydrolase activity, acting on glycosyl bonds	g.chr11:293450A>G	AK090428	CCDS31322.2	11p15.5	2005-10-27			ENSG00000142102	ENSG00000142102			26210	protein-coding gene	gene with protein product							Standard	NM_025092		Approved	FLJ22635	uc010qvu.2	Q32M88	OTTHUMG00000153218	ENST00000409548.2:c.1428A>G	11.37:g.293450A>G			Somatic				ATHL1_uc001lor.3_Intron|ATHL1_uc001los.1_Silent_p.V503V|ATHL1_uc001lou.3_Silent_p.V51V|ATHL1_uc001lov.3_5'Flank	p.V476V	NM_025092	NP_079368	WXS	Illumina HiSeq	Unspecified	Q32M88	ATHL1_HUMAN		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)	9	1543	+		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	476					Q658X8|Q8TEG9|Q9H635	Silent	SNP	ENST00000409548.2	37	c.1428A>G	CCDS31322.2																																																																																				0.632	ATHL1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330164.3	NM_025092		3	35	0	0	0	0.004672	0	3	35				
NUP98	4928	broad.mit.edu	37	11	3714470	3714470	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr11:3714470C>T	ENST00000324932.7	-	27	4723	c.4303G>A	c.(4303-4305)Gca>Aca	p.A1435T	NUP98_ENST00000359171.4_Missense_Mutation_p.A1435T|snoU13_ENST00000458786.1_RNA|NUP98_ENST00000488828.1_5'Flank|NUP98_ENST00000355260.3_Missense_Mutation_p.A1435T	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1452					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.A1435T(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		ACCTGAAATGCTTCTTCATAC	0.458			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																		uc001lyh.2		NA		Dom	yes		11	11p15	4928	T	nucleoporin 98kDa			L	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11		AML		1	Substitution - Missense(1)		lung(1)	breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12						c.(4303-4305)GCA>ACA		nucleoporin 98kD isoform 1							151.0	156.0	154.0					11																	3714470		2201	4298	6499	SO:0001583	missense	4928				carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity	g.chr11:3714470C>T	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.4303G>A	11.37:g.3714470C>T	ENSP00000316032:p.Ala1435Thr		Somatic				NUP98_uc001lyi.2_Missense_Mutation_p.A1435T|NUP98_uc001lyg.2_Missense_Mutation_p.A400T	p.A1435T	NM_016320	NP_057404	WXS	Illumina HiSeq	Unspecified	P52948	NUP98_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)	27	4594	-		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)	1452					Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	37	c.4303G>A	CCDS7746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.392853|5.392853	0.96009|0.96009	.|.	.|.	ENSG00000110713|ENSG00000110713	ENST00000324932;ENST00000359171;ENST00000355260|ENST00000429801	.|.	.|.	.|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78842|0.78842	0.4347|0.4347	M|M	0.79805|0.79805	2.47|2.47	0.58432|0.58432	D|D	0.99999|0.99999	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.999;0.998|.	T|T	0.78833|0.78833	-0.2048|-0.2048	9|5	0.14252|.	T|.	0.57|.	-17.342|-17.342	18.7621|18.7621	0.91856|0.91856	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1435;1435;1349|.	P52948-2;P52948-5;P52948-6|.	.;.;.|.	T|N	1435|387	.|.	ENSP00000316032:A1435T|.	A|S	-|-	1|2	0|0	NUP98|NUP98	3671046|3671046	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	5.580000|5.580000	0.67464|0.67464	2.673000|2.673000	0.90976|0.90976	0.558000|0.558000	0.71614|0.71614	GCA|AGC		0.458	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320		17	175	0	0	0	0.008871	0	17	175				
OR56A3	390083	broad.mit.edu	37	11	5969263	5969263	+	Silent	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr11:5969263G>C	ENST00000329564.6	+	1	694	c.687G>C	c.(685-687)gtG>gtC	p.V229V		NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V229V(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCGAGCTGTGCTGAGACTCA	0.512																																							uc010qzt.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(685-687)GTG>GTC		olfactory receptor, family 56, subfamily A,							202.0	197.0	198.0					11																	5969263		2186	4286	6472	SO:0001819	synonymous_variant	390083				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5969263G>C		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.687G>C	11.37:g.5969263G>C			Somatic					p.V229V	NM_001003443	NP_001003443	WXS	Illumina HiSeq	Unspecified	Q8NH54	O56A3_HUMAN		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	687	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	229			Cytoplasmic (Potential).		A6NN77|Q6IFF7	Silent	SNP	ENST00000329564.6	37	c.687G>C	CCDS41614.1																																																																																				0.512	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443		3	162	0	0	0	0.009096	0	3	162				
PDE3B	5140	broad.mit.edu	37	11	14880641	14880641	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr11:14880641C>T	ENST00000282096.4	+	13	2926	c.2573C>T	c.(2572-2574)gCt>gTt	p.A858V	PDE3B_ENST00000455098.2_Missense_Mutation_p.A807V	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	858	Catalytic. {ECO:0000250}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)	p.A858V(1)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	GCTGCGTCAGCTTGGAATCTA	0.358																																							uc001mln.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2572-2574)GCT>GTT		phosphodiesterase 3B							174.0	160.0	165.0					11																	14880641		2199	4294	6493	SO:0001583	missense	5140				cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding	g.chr11:14880641C>T	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.2573C>T	11.37:g.14880641C>T	ENSP00000282096:p.Ala858Val		Somatic				PDE3B_uc010rcr.1_Missense_Mutation_p.A807V	p.A858V	NM_000922	NP_000913	WXS	Illumina HiSeq	Unspecified	Q13370	PDE3B_HUMAN			13	2926	+			858			Catalytic (By similarity).		B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	ENST00000282096.4	37	c.2573C>T	CCDS7817.1	.	.	.	.	.	.	.	.	.	.	C	32	5.139943	0.94560	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.78364	-1.17;-1.17	5.54	5.54	0.83059	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.88514	0.6457	M	0.74546	2.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89268	0.3602	10	0.87932	D	0	.	19.4868	0.95032	0.0:1.0:0.0:0.0	.	807;858	B7ZM37;Q13370	.;PDE3B_HUMAN	V	858;807	ENSP00000282096:A858V;ENSP00000388644:A807V	ENSP00000282096:A858V	A	+	2	0	PDE3B	14837217	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.487000	0.81328	2.598000	0.87819	0.563000	0.77884	GCT		0.358	PDE3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386974.1	NM_000922		15	113	0	0	0	0.008871	0	15	113				
OR5J2	282775	broad.mit.edu	37	11	55944458	55944458	+	Missense_Mutation	SNP	G	G	A	rs151315491	byFrequency	TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr11:55944458G>A	ENST00000312298.1	+	1	365	c.365G>A	c.(364-366)cGc>cAc	p.R122H		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					GCCTATGACCGCTATGTGGCC	0.453													.|||	2	0.000399361	0.0008	0.0	5008	,	,		23085	0.001		0.0	False		,,,				2504	0.0						uc010rjb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4						c.(364-366)CGC>CAC		olfactory receptor, family 5, subfamily J,							154.0	139.0	144.0					11																	55944458		2201	4296	6497	SO:0001583	missense	282775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55944458G>A	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.365G>A	11.37:g.55944458G>A	ENSP00000310788:p.Arg122His		Somatic					p.R122H	NM_001005492	NP_001005492	WXS	Illumina HiSeq	Unspecified	Q8NH18	OR5J2_HUMAN			1	365	+	Esophageal squamous(21;0.00693)		122			Cytoplasmic (Potential).		Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	37	c.365G>A	CCDS31522.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	G	10.78	1.447291	0.25987	.	.	ENSG00000174957	ENST00000312298	T	0.77489	-1.1	4.67	0.433	0.16534	GPCR, rhodopsin-like superfamily (1);	0.107595	0.41823	D	0.000808	T	0.75796	0.3898	M	0.82056	2.57	0.38442	D	0.946739	B	0.20887	0.049	B	0.18263	0.021	T	0.71991	-0.4425	10	0.72032	D	0.01	.	11.2842	0.49212	0.1056:0.0:0.8944:0.0	.	122	Q8NH18	OR5J2_HUMAN	H	122	ENSP00000310788:R122H	ENSP00000310788:R122H	R	+	2	0	OR5J2	55701034	0.452000	0.25713	0.001000	0.08648	0.015000	0.08874	3.597000	0.54031	-0.090000	0.12462	0.584000	0.79450	CGC		0.453	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492		17	76	0	0	0	0.00499	0	17	76				
SCGB1D1	10648	broad.mit.edu	37	11	61957768	61957768	+	Silent	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr11:61957768G>A	ENST00000306238.3	+	1	81	c.12G>A	c.(10-12)tcG>tcA	p.S4S		NM_006552.1	NP_006543.1	O95968	SG1D1_HUMAN	secretoglobin, family 1D, member 1	4						extracellular space (GO:0005615)	protein heterodimerization activity (GO:0046982)	p.S4S(1)		endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	9						TGAGGCTGTCGGTGTGTCTCC	0.587																																							uc001nsz.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(10-12)TCG>TCA		lipophilin A precursor							153.0	110.0	125.0					11																	61957768		2202	4299	6501	SO:0001819	synonymous_variant	10648					extracellular space	binding	g.chr11:61957768G>A	AJ224171	CCDS8015.1	11q13	2011-12-14			ENSG00000168515	ENSG00000168515		"""Secretoglobins"""	18395	protein-coding gene	gene with protein product	"""prostatein-like lipophilin A"", ""lipophilin A (uteroglobin family member)"""	615060				9720917, 10066439, 22155607	Standard	NM_006552		Approved	LPHA, LIPA, MGC71958	uc001nsz.1	O95968	OTTHUMG00000167505	ENST00000306238.3:c.12G>A	11.37:g.61957768G>A			Somatic					p.S4S	NM_006552	NP_006543	WXS	Illumina HiSeq	Unspecified	O95968	SG1D1_HUMAN			1	59	+			4						Silent	SNP	ENST00000306238.3	37	c.12G>A	CCDS8015.1																																																																																				0.587	SCGB1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394856.1	NM_006552		3	34	0	0	0	0.004672	0	3	34				
AHNAK	79026	broad.mit.edu	37	11	62284242	62284242	+	Silent	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr11:62284242G>A	ENST00000378024.4	-	5	17921	c.17647C>T	c.(17647-17649)Ctg>Ttg	p.L5883L	AHNAK_ENST00000525875.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5883					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.L5883L(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GAAACTGACAGCTCCACCTCG	0.468																																							uc001ntl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(17647-17649)CTG>TTG		AHNAK nucleoprotein isoform 1							117.0	119.0	118.0					11																	62284242		2202	4299	6501	SO:0001819	synonymous_variant	79026				nervous system development	nucleus	protein binding	g.chr11:62284242G>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17647C>T	11.37:g.62284242G>A			Somatic				AHNAK_uc001ntk.1_Intron	p.L5883L	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	17947	-		Melanoma(852;0.155)	5883					A1A586	Silent	SNP	ENST00000378024.4	37	c.17647C>T	CCDS31584.1																																																																																				0.468	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		45	180	0	0	0	0.01441	0	45	180				
SIK2	23235	broad.mit.edu	37	11	111590634	111590634	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr11:111590634C>T	ENST00000304987.3	+	10	1575	c.1402C>T	c.(1402-1404)Cat>Tat	p.H468Y	SIK2_ENST00000533868.1_3'UTR	NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	468					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.H468Y(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						AGACCCCGCTCATGCCTTTGA	0.592																																							uc001plt.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(1)	3						c.(1402-1404)CAT>TAT		SNF1-like kinase 2							87.0	66.0	73.0					11																	111590634		2201	4297	6498	SO:0001583	missense	23235				intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:111590634C>T	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.1402C>T	11.37:g.111590634C>T	ENSP00000305976:p.His468Tyr		Somatic					p.H468Y	NM_015191	NP_056006	WXS	Illumina HiSeq	Unspecified	Q9H0K1	SIK2_HUMAN			10	1520	+			468					A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	ENST00000304987.3	37	c.1402C>T	CCDS8347.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069231	0.55539	.	.	ENSG00000170145	ENST00000304987	T	0.73152	-0.72	6.17	5.21	0.72293	.	0.253454	0.46442	D	0.000281	T	0.64800	0.2631	L	0.36672	1.1	0.28979	N	0.888758	B	0.19200	0.034	B	0.24701	0.055	T	0.62224	-0.6899	10	0.59425	D	0.04	.	16.757	0.85502	0.0:0.8711:0.1289:0.0	.	468	Q9H0K1	SIK2_HUMAN	Y	468	ENSP00000305976:H468Y	ENSP00000305976:H468Y	H	+	1	0	SIK2	111095844	0.995000	0.38212	0.373000	0.26003	0.647000	0.38526	4.466000	0.60148	2.941000	0.99782	0.655000	0.94253	CAT		0.592	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191		7	45	0	0	0	0.001984	0	7	45				
RBM7	10179	broad.mit.edu	37	11	114272522	114272522	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr11:114272522A>G	ENST00000540163.1	+	2	841	c.199A>G	c.(199-201)Atg>Gtg	p.M67V	C11orf71_ENST00000325636.4_5'Flank|RBM7_ENST00000545678.1_Intron|RBM7_ENST00000544582.1_Missense_Mutation_p.M67V|RBM7_ENST00000375490.5_Missense_Mutation_p.M67V|RBM7_ENST00000541475.1_Missense_Mutation_p.M67V|RP11-212D19.4_ENST00000544347.1_Silent_p.Q63Q			Q9Y580	RBM7_HUMAN	RNA binding motif protein 7	67	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				meiotic nuclear division (GO:0007126)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.M67V(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)		TCCTTATGCAATGAATCTACT	0.383																																							uc001pov.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(199-201)ATG>GTG		RNA binding motif protein 7							86.0	86.0	86.0					11																	114272522		2201	4295	6496	SO:0001583	missense	10179				meiosis		nucleotide binding|protein binding|RNA binding	g.chr11:114272522A>G	AF156098	CCDS8370.1, CCDS66233.1, CCDS73395.1	11q23.1-q23.2	2013-02-12			ENSG00000076053	ENSG00000076053		"""RNA binding motif (RRM) containing"""	9904	protein-coding gene	gene with protein product		612413				12477932	Standard	NM_001286045		Approved		uc001pov.3	Q9Y580		ENST00000540163.1:c.199A>G	11.37:g.114272522A>G	ENSP00000439918:p.Met67Val		Somatic				C11orf71_uc001pot.1_5'Flank|C11orf71_uc001pou.3_5'Flank|RBM7_uc001pow.2_Missense_Mutation_p.M67V|RBM7_uc001pox.2_5'UTR	p.M67V	NM_016090	NP_057174	WXS	Illumina HiSeq	Unspecified	Q9Y580	RBM7_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)	2	209	+		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)	67			RRM.		B2R6K8|Q9NUT4	Missense_Mutation	SNP	ENST00000540163.1	37	c.199A>G	CCDS8370.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.319782	0.41096	.	.	ENSG00000076053	ENST00000540163;ENST00000375490;ENST00000541475;ENST00000544582	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	5.76	5.76	0.90799	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.035807	0.85682	D	0.000000	T	0.09291	0.0229	N	0.01668	-0.77	0.80722	D	1	B;B	0.29508	0.246;0.213	B;B	0.41174	0.349;0.262	T	0.47420	-0.9119	10	0.62326	D	0.03	-19.8444	14.9156	0.70795	1.0:0.0:0.0:0.0	.	67;67	Q6IRX3;Q9Y580	.;RBM7_HUMAN	V	67	ENSP00000439918:M67V;ENSP00000364639:M67V;ENSP00000440949:M67V;ENSP00000440923:M67V	ENSP00000364639:M67V	M	+	1	0	RBM7	113777732	0.999000	0.42202	0.992000	0.48379	0.996000	0.88848	3.741000	0.55090	2.186000	0.69663	0.533000	0.62120	ATG		0.383	RBM7-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399010.1	NM_016090		8	80	0	0	0	0.00308	0	8	80				
OAF	220323	broad.mit.edu	37	11	120096462	120096462	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr11:120096462C>A	ENST00000328965.4	+	2	837	c.324C>A	c.(322-324)caC>caA	p.H108Q	OAF_ENST00000531220.1_5'UTR	NM_178507.2	NP_848602.1	Q86UD1	OAF_HUMAN	OAF homolog (Drosophila)	108						extracellular vesicular exosome (GO:0070062)		p.H108Q(1)		kidney(1)|lung(5)	6		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)		AGCTGCAGCACAATGAGATCA	0.637																																							uc001pxb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(322-324)CAC>CAA		OAF homolog precursor							130.0	124.0	126.0					11																	120096462		2203	4300	6503	SO:0001583	missense	220323							g.chr11:120096462C>A	BC047726	CCDS8430.1	11q23.3	2010-11-23			ENSG00000184232	ENSG00000184232			28752	protein-coding gene	gene with protein product						12477932	Standard	NM_178507		Approved	MGC52117	uc001pxb.3	Q86UD1	OTTHUMG00000166139	ENST00000328965.4:c.324C>A	11.37:g.120096462C>A	ENSP00000332613:p.His108Gln		Somatic					p.H108Q	NM_178507	NP_848602	WXS	Illumina HiSeq	Unspecified	Q86UD1	OAF_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)	2	565	+		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)	108						Missense_Mutation	SNP	ENST00000328965.4	37	c.324C>A	CCDS8430.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.758419	0.49468	.	.	ENSG00000184232	ENST00000328965	T	0.29397	1.57	5.16	5.16	0.70880	.	0.303979	0.36374	N	0.002638	T	0.30008	0.0751	L	0.57536	1.79	0.80722	D	1	B	0.34015	0.435	B	0.31101	0.124	T	0.08330	-1.0727	10	0.44086	T	0.13	-22.6338	13.0186	0.58773	0.0:0.9222:0.0:0.0778	.	108	Q86UD1	OAF_HUMAN	Q	108	ENSP00000332613:H108Q	ENSP00000332613:H108Q	H	+	3	2	OAF	119601672	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.786000	0.47790	2.392000	0.81423	0.561000	0.74099	CAC		0.637	OAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388036.2	NM_178507		8	130	1	0	0.00307968	0.00308	0.00334307	8	130				
WNK1	65125	broad.mit.edu	37	12	970206	970206	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr12:970206G>C	ENST00000315939.6	+	7	2291	c.1648G>C	c.(1648-1650)Gat>Cat	p.D550H	WNK1_ENST00000540360.1_3'UTR|WNK1_ENST00000530271.2_Missense_Mutation_p.D550H|WNK1_ENST00000340908.4_Missense_Mutation_p.D143H|WNK1_ENST00000537687.1_Missense_Mutation_p.D550H|WNK1_ENST00000535572.1_Missense_Mutation_p.D550H	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	550					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.D550H(2)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CTGTGAAGGTGATCACAAGAC	0.438																																					Colon(19;451 567 6672 12618 28860)	Colon(19;451 567 6672 12618 28860)	uc001qio.3		NA																	2	Substitution - Missense(2)		lung(2)	stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23						c.(1648-1650)GAT>CAT		WNK lysine deficient protein kinase 1							155.0	171.0	166.0					12																	970206		2203	4300	6503	SO:0001583	missense	65125				intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity	g.chr12:970206G>C	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1648G>C	12.37:g.970206G>C	ENSP00000313059:p.Asp550His		Somatic				WNK1_uc001qip.3_Missense_Mutation_p.D550H|WNK1_uc001qir.3_5'UTR	p.D550H	NM_018979	NP_061852	WXS	Illumina HiSeq	Unspecified	Q9H4A3	WNK1_HUMAN	Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)		7	2155	+	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		550					A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	c.1648G>C	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722360	0.89298	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000530271;ENST00000340908	T;T;T;T;T	0.81415	-0.86;-1.04;-0.81;-0.86;-1.49	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000002	D	0.91205	0.7229	M	0.85197	2.74	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.92088	0.5678	10	0.87932	D	0	-14.8379	19.5385	0.95264	0.0:0.0:1.0:0.0	.	550;550	F5GWT4;Q9H4A3	.;WNK1_HUMAN	H	550;550;550;550;143	ENSP00000441972:D550H;ENSP00000313059:D550H;ENSP00000444465:D550H;ENSP00000433548:D550H;ENSP00000341292:D143H	ENSP00000313059:D550H	D	+	1	0	WNK1	840467	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.622000	0.88805	0.591000	0.81541	GAT		0.438	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979		21	293	0	0	0	0.00333	0	21	293				
CLSTN3	9746	broad.mit.edu	37	12	7295905	7295905	+	Silent	SNP	C	C	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr12:7295905C>A	ENST00000266546.6	+	12	2295	c.1845C>A	c.(1843-1845)gtC>gtA	p.V615V	CLSTN3_ENST00000537408.1_Silent_p.V627V	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	615					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.V615V(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CCACTGCTGTCAAGTGAGTGT	0.582																																							uc001qsr.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(1843-1845)GTC>GTA		calsyntenin 3 precursor							58.0	53.0	55.0					12																	7295905		2203	4300	6503	SO:0001819	synonymous_variant	9746				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding	g.chr12:7295905C>A	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.1845C>A	12.37:g.7295905C>A			Somatic				CLSTN3_uc001qss.2_Silent_p.V627V	p.V615V	NM_014718	NP_055533	WXS	Illumina HiSeq	Unspecified	Q9BQT9	CSTN3_HUMAN			12	2123	+			615			Extracellular (Potential).		D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	ENST00000266546.6	37	c.1845C>A	CCDS8575.1																																																																																				0.582	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718		5	24	1	0	0.000602214	0.000602	0.000666882	5	24				
PRB4	5545	broad.mit.edu	37	12	11461564	11461564	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr12:11461564C>T	ENST00000535904.1	-	3	386	c.353G>A	c.(352-354)gGa>gAa	p.G118E	PRB4_ENST00000279575.1_Missense_Mutation_p.G118E|PRB4_ENST00000445719.2_Intron			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	139	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).			extracellular region (GO:0005576)		p.G118E(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						TTCTGGCTTTCCTGGAGGAGG	0.607										HNSCC(22;0.051)																													uc001qzf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(352-354)GGA>GAA		proline-rich protein BstNI subfamily 4							146.0	162.0	157.0					12																	11461564		2203	4300	6503	SO:0001583	missense	5545					extracellular region		g.chr12:11461564C>T		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.353G>A	12.37:g.11461564C>T	ENSP00000442834:p.Gly118Glu	HNSCC(22;0.051)	Somatic				PRB4_uc001qzt.2_Missense_Mutation_p.G118E	p.G118E	NM_002723	NP_002714	WXS	Illumina HiSeq	Unspecified	P10163	PRB4_HUMAN			3	387	-			181		Missing (in allele S).	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.|7.		A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	c.353G>A	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	0.992	-0.693586	0.03303	.	.	ENSG00000230657	ENST00000279575;ENST00000535904	T;T	0.06218	3.33;3.33	0.796	-0.565	0.11771	.	.	.	.	.	T	0.08670	0.0215	M	0.81802	2.56	0.09310	N	1	B	0.19817	0.039	B	0.14023	0.01	T	0.34551	-0.9824	9	0.62326	D	0.03	.	2.8431	0.05535	0.0:0.3825:0.0:0.6175	.	118	E9PAL0	.	E	118	ENSP00000279575:G118E;ENSP00000442834:G118E	ENSP00000279575:G118E	G	-	2	0	PRB4	11352831	0.000000	0.05858	0.003000	0.11579	0.057000	0.15508	-2.681000	0.00837	-0.212000	0.10109	0.197000	0.17608	GGA		0.607	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723		29	253	0	0	0	0.01441	0	29	253				
PRB4	5545	broad.mit.edu	37	12	11461628	11461628	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr12:11461628C>T	ENST00000535904.1	-	3	322	c.289G>A	c.(289-291)Gga>Aga	p.G97R	PRB4_ENST00000279575.1_Missense_Mutation_p.G97R|PRB4_ENST00000445719.2_Missense_Mutation_p.G97R			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	118	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)		p.G97R(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						TCTGGCTTTCCTGGATGAGGT	0.602										HNSCC(22;0.051)																													uc001qzf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(289-291)GGA>AGA		proline-rich protein BstNI subfamily 4							297.0	314.0	308.0					12																	11461628		2203	4300	6503	SO:0001583	missense	5545					extracellular region		g.chr12:11461628C>T		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.289G>A	12.37:g.11461628C>T	ENSP00000442834:p.Gly97Arg	HNSCC(22;0.051)	Somatic				PRB4_uc001qzt.2_Missense_Mutation_p.G97R	p.G97R	NM_002723	NP_002714	WXS	Illumina HiSeq	Unspecified	P10163	PRB4_HUMAN			3	323	-			118		Missing (in allele M and allele S).	4.|9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	c.289G>A	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	5.628	0.300638	0.10678	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.04809	3.55;3.55;3.55	0.805	-1.61	0.08399	.	.	.	.	.	T	0.06005	0.0156	M	0.75777	2.31	0.09310	N	1	B	0.23540	0.087	B	0.14023	0.01	T	0.36163	-0.9759	9	0.72032	D	0.01	.	2.1618	0.03827	0.0:0.302:0.3302:0.3678	.	97	E9PAL0	.	R	97	ENSP00000279575:G97R;ENSP00000442834:G97R;ENSP00000412740:G97R	ENSP00000279575:G97R	G	-	1	0	PRB4	11352895	0.004000	0.15560	0.001000	0.08648	0.021000	0.10359	0.259000	0.18405	-1.017000	0.03367	0.205000	0.17691	GGA		0.602	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723		85	378	0	0	0	0.01441	0	85	378				
PRB4	5545	broad.mit.edu	37	12	11461690	11461690	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr12:11461690C>T	ENST00000535904.1	-	3	260	c.227G>A	c.(226-228)gGa>gAa	p.G76E	PRB4_ENST00000279575.1_Missense_Mutation_p.G76E|PRB4_ENST00000445719.2_Missense_Mutation_p.G76E			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	97	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.			Missing (in Ref. 7; CAA30542). {ECO:0000305}.		extracellular region (GO:0005576)		p.G76E(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						TTCTGGCTTTCCTGGAGGAGG	0.617										HNSCC(22;0.051)																													uc001qzf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(226-228)GGA>GAA		proline-rich protein BstNI subfamily 4							292.0	321.0	311.0					12																	11461690		2203	4300	6503	SO:0001583	missense	5545					extracellular region		g.chr12:11461690C>T		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.227G>A	12.37:g.11461690C>T	ENSP00000442834:p.Gly76Glu	HNSCC(22;0.051)	Somatic				PRB4_uc001qzt.2_Missense_Mutation_p.G76E	p.G76E	NM_002723	NP_002714	WXS	Illumina HiSeq	Unspecified	P10163	PRB4_HUMAN			3	261	-			76	Missing (in Ref. 7; CAA30542).		9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.|2.		A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	c.227G>A	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	2.214	-0.380100	0.05000	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.06068	3.35;3.35;3.35	0.956	-0.00857	0.14005	.	.	.	.	.	T	0.07999	0.0200	M	0.77313	2.365	0.09310	N	1	P	0.44659	0.84	B	0.38194	0.267	T	0.23261	-1.0193	9	0.72032	D	0.01	.	3.2434	0.06788	0.0:0.6845:0.0:0.3155	.	76	E9PAL0	.	E	76	ENSP00000279575:G76E;ENSP00000442834:G76E;ENSP00000412740:G76E	ENSP00000279575:G76E	G	-	2	0	PRB4	11352957	0.000000	0.05858	0.001000	0.08648	0.023000	0.10783	-0.638000	0.05452	-0.018000	0.14079	0.196000	0.17591	GGA		0.617	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723		36	342	0	0	0	0.010771	0	36	342				
IGF1	3479	broad.mit.edu	37	12	102811743	102811743	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr12:102811743C>G	ENST00000307046.8	-	4	622	c.441G>C	c.(439-441)caG>caC	p.Q147H	IGF1_ENST00000456098.1_Missense_Mutation_p.Q147H|IGF1_ENST00000424202.2_Intron|IGF1_ENST00000392904.1_Missense_Mutation_p.Q147H|IGF1_ENST00000481539.1_5'Flank|IGF1_ENST00000337514.6_Intron	NM_001111285.1	NP_001104755.1	P05019	IGF1_HUMAN	insulin-like growth factor 1 (somatomedin C)	147					blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|bone mineralization involved in bone maturation (GO:0035630)|branching morphogenesis of an epithelial tube (GO:0048754)|cell activation (GO:0001775)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|DNA replication (GO:0006260)|exocrine pancreas development (GO:0031017)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|glial cell differentiation (GO:0010001)|glycolate metabolic process (GO:0009441)|inner ear development (GO:0048839)|insulin-like growth factor receptor signaling pathway (GO:0048009)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mammary gland development (GO:0030879)|multicellular organism growth (GO:0035264)|muscle hypertrophy (GO:0014896)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|myoblast proliferation (GO:0051450)|myotube cell development (GO:0014904)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate gland growth (GO:0060736)|prostate gland stromal morphogenesis (GO:0060741)|proteoglycan biosynthetic process (GO:0030166)|Ras protein signal transduction (GO:0007265)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of multicellular organism growth (GO:0040014)|signal transduction (GO:0007165)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|skeletal system development (GO:0001501)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)|water homeostasis (GO:0030104)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|insulin-like growth factor binding protein complex (GO:0016942)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	hormone activity (GO:0005179)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|integrin binding (GO:0005178)	p.Q147H(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)	11						CTTTCCTTCTCTGAGACTTCG	0.468																																							uc001tjp.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(439-441)CAG>CAC		insulin-like growth factor 1 isoform 3							234.0	212.0	219.0					12																	102811743		1568	3582	5150	SO:0001583	missense	3479				anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding	g.chr12:102811743C>G	X00173	CCDS9091.1, CCDS44960.1, CCDS44961.1, CCDS44962.1	12q23.2	2014-09-16			ENSG00000017427	ENSG00000017427		"""Endogenous ligands"""	5464	protein-coding gene	gene with protein product		147440				2982726, 6358902	Standard	NM_001111283		Approved	IGF1A, IGFI, IGF-I	uc001tjp.4	P05019	OTTHUMG00000149910	ENST00000307046.8:c.441G>C	12.37:g.102811743C>G	ENSP00000302665:p.Gln147His		Somatic				IGF1_uc001tjn.2_Intron|IGF1_uc001tjm.2_Missense_Mutation_p.Q147H|IGF1_uc001tjo.2_Intron	p.Q147H	NM_001111285	NP_001104755	WXS	Illumina HiSeq	Unspecified	P05019	IGF1_HUMAN			4	660	-			147					B2RWM7|E9PD02|P01343|Q14620	Missense_Mutation	SNP	ENST00000307046.8	37	c.441G>C	CCDS44962.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.282045	0.40394	.	.	ENSG00000017427	ENST00000456098;ENST00000392904;ENST00000392905;ENST00000307046	D;D;D;D	0.96967	-4.19;-4.19;-4.18;-3.17	5.54	5.54	0.83059	.	0.459840	0.23656	N	0.045864	D	0.91157	0.7215	N	0.19112	0.55	0.28363	N	0.920368	P;B	0.37864	0.61;0.38	B;B	0.34873	0.191;0.135	D	0.87896	0.2687	10	0.66056	D	0.02	-27.9178	10.4322	0.44413	0.0:0.9121:0.0:0.0879	.	147;147	P05019;E9PD02	IGF1_HUMAN;.	H	147;147;128;147	ENSP00000394999:Q147H;ENSP00000376637:Q147H;ENSP00000376638:Q128H;ENSP00000302665:Q147H	ENSP00000302665:Q147H	Q	-	3	2	IGF1	101335873	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.757000	0.38400	2.610000	0.88304	0.655000	0.94253	CAG		0.468	IGF1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313855.1	NM_000618		20	229	0	0	0	0.007413	0	20	229				
NOS1	4842	broad.mit.edu	37	12	117723102	117723102	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr12:117723102C>T	ENST00000338101.4	-	6	1330	c.1326G>A	c.(1324-1326)ggG>ggA	p.G442G	NOS1_ENST00000317775.6_Silent_p.G442G|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.G442G(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		AGTTGAACATCCCGTGGGCCG	0.572																																					Esophageal Squamous(162;1748 2599 51982 52956)	Esophageal Squamous(162;1748 2599 51982 52956)	uc001twm.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(3)|pancreas(1)	7						c.(1324-1326)GGG>GGA		nitric oxide synthase 1, neuronal	L-Citrulline(DB00155)						92.0	97.0	95.0					12																	117723102		2079	4229	6308	SO:0001819	synonymous_variant	4842				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	g.chr12:117723102C>T		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1326G>A	12.37:g.117723102C>T			Somatic					p.G442G	NM_000620	NP_000611	WXS	Illumina HiSeq	Unspecified	P29475	NOS1_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0561)	7	2012	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		442						Silent	SNP	ENST00000338101.4	37	c.1326G>A	CCDS55890.1																																																																																				0.572	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1			3	33	0	0	0	0.004672	0	3	33				
MYO16	23026	broad.mit.edu	37	13	109610094	109610094	+	Missense_Mutation	SNP	G	G	A	rs552055055		TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr13:109610094G>A	ENST00000357550.2	+	16	1959	c.1918G>A	c.(1918-1920)Gag>Aag	p.E640K	MYO16_ENST00000457511.2_Missense_Mutation_p.E152K|MYO16_ENST00000356711.2_Missense_Mutation_p.E640K|MYO16_ENST00000251041.5_Missense_Mutation_p.E640K	NM_001198950.1	NP_001185879.1			myosin XVI									p.E640K(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TCTGAACAGGGAGAAATTGGC	0.458																																							uc001vqt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(1918-1920)GAG>AAG		myosin heavy chain Myr 8							129.0	109.0	116.0					13																	109610094		2203	4300	6503	SO:0001583	missense	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109610094G>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1918G>A	13.37:g.109610094G>A	ENSP00000350160:p.Glu640Lys		Somatic				MYO16_uc010agk.1_Missense_Mutation_p.E662K|MYO16_uc001vqu.1_Missense_Mutation_p.E440K|MYO16_uc010tjh.1_Missense_Mutation_p.E152K	p.E640K	NM_015011	NP_055826	WXS	Illumina HiSeq	Unspecified	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		17	2044	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		640			Myosin head-like 1.			Missense_Mutation	SNP	ENST00000357550.2	37	c.1918G>A	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194323	0.78902	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857;ENST00000457511	D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26	5.22	5.22	0.72569	Myosin head, motor domain (2);	0.000000	0.40908	U	0.000998	D	0.89336	0.6686	L	0.35341	1.055	0.54753	D	0.999985	D;P;D	0.67145	0.996;0.9;0.996	P;P;D	0.65443	0.894;0.571;0.935	D	0.88234	0.2905	9	.	.	.	.	17.7921	0.88555	0.0:0.0:1.0:0.0	.	152;640;640	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	K	640;640;640;640;428;152	ENSP00000349145:E640K;ENSP00000350160:E640K;ENSP00000251041:E640K;ENSP00000401633:E152K	.	E	+	1	0	MYO16	108408095	1.000000	0.71417	0.998000	0.56505	0.782000	0.44232	6.609000	0.74173	2.442000	0.82660	0.655000	0.94253	GAG		0.458	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		6	23	0	0	0	0.00308	0	6	23				
MYH6	4624	broad.mit.edu	37	14	23861783	23861783	+	Silent	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr14:23861783C>G	ENST00000356287.3	-	24	3359	c.3330G>C	c.(3328-3330)ctG>ctC	p.L1110L	MYH6_ENST00000405093.3_Silent_p.L1110L			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1110					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.L1110L(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GGTTTTCCTTCAGTTTCTTCT	0.488																																							uc001wjv.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(3328-3330)CTG>CTC		myosin heavy chain 6							194.0	186.0	188.0					14																	23861783		2203	4300	6503	SO:0001819	synonymous_variant	4624				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle	g.chr14:23861783C>G	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.3330G>C	14.37:g.23861783C>G			Somatic					p.L1110L	NM_002471	NP_002462	WXS	Illumina HiSeq	Unspecified	P13533	MYH6_HUMAN		GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)	25	3397	-	all_cancers(95;2.54e-05)		1110			Potential.		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	ENST00000356287.3	37	c.3330G>C	CCDS9600.1																																																																																				0.488	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3			19	202	0	0	0	0.010504	0	19	202				
BAZ1A	11177	broad.mit.edu	37	14	35227951	35227951	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr14:35227951C>T	ENST00000382422.2	-	24	4672	c.4345G>A	c.(4345-4347)Gat>Aat	p.D1449N	BAZ1A_ENST00000358716.4_Missense_Mutation_p.D1417N|BAZ1A_ENST00000360310.1_Missense_Mutation_p.D1449N			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1449	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)	p.D1449N(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		CAGCTGTCATCATGTCGTACC	0.408																																							uc001wsk.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7						c.(4345-4347)GAT>AAT		bromodomain adjacent to zinc finger domain, 1A							95.0	87.0	90.0					14																	35227951		2203	4300	6503	SO:0001583	missense	11177				chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding	g.chr14:35227951C>T	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.4345G>A	14.37:g.35227951C>T	ENSP00000371859:p.Asp1449Asn		Somatic				BAZ1A_uc001wsl.2_Missense_Mutation_p.D1417N	p.D1449N	NM_013448	NP_038476	WXS	Illumina HiSeq	Unspecified	Q9NRL2	BAZ1A_HUMAN	LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)	25	4913	-	Breast(36;0.0388)|Hepatocellular(127;0.158)		1449			Bromo.		Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	37	c.4345G>A	CCDS9651.1	.	.	.	.	.	.	.	.	.	.	.	28.3	4.910741	0.92107	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	T;T;T	0.20069	2.1;2.1;2.1	5.46	5.46	0.80206	Bromodomain (6);	0.176479	0.48767	D	0.000178	T	0.34687	0.0906	L	0.36672	1.1	0.51233	D	0.999919	D;D	0.57257	0.974;0.979	P;P	0.60236	0.796;0.871	T	0.01169	-1.1430	10	0.32370	T	0.25	.	19.3193	0.94231	0.0:1.0:0.0:0.0	.	1417;1449	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	N	1417;1449;1449;1101	ENSP00000351555:D1417N;ENSP00000371859:D1449N;ENSP00000353458:D1449N	ENSP00000351555:D1417N	D	-	1	0	BAZ1A	34297702	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.602000	0.67612	2.559000	0.86315	0.655000	0.94253	GAT		0.408	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1			7	122	0	0	0	0.00308	0	7	122				
LRFN5	145581	broad.mit.edu	37	14	42360699	42360699	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr14:42360699C>G	ENST00000298119.4	+	4	2821	c.1632C>G	c.(1630-1632)ttC>ttG	p.F544L	LRFN5_ENST00000554171.1_Intron|LRFN5_ENST00000554120.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	544				F -> L (in Ref. 1; BAG53340). {ECO:0000305}.		integral component of membrane (GO:0016021)		p.F544L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGCTGGTATTCATCATTATTC	0.403										HNSCC(30;0.082)																													uc001wvm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(1630-1632)TTC>TTG		leucine rich repeat and fibronectin type III							153.0	148.0	149.0					14																	42360699		2203	4300	6503	SO:0001583	missense	145581					integral to membrane		g.chr14:42360699C>G	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1632C>G	14.37:g.42360699C>G	ENSP00000298119:p.Phe544Leu	HNSCC(30;0.082)	Somatic				LRFN5_uc010ana.2_Intron	p.F544L	NM_152447	NP_689660	WXS	Illumina HiSeq	Unspecified	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	4	2830	+			544	F -> L (in Ref. 1; BAG53340).		Helical; (Potential).		B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	c.1632C>G	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432651	0.62844	.	.	ENSG00000165379	ENST00000298119	T	0.72725	-0.68	5.87	4.8	0.61643	.	0.000000	0.64402	D	0.000013	D	0.83096	0.5180	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84644	0.0697	10	0.87932	D	0	.	13.1328	0.59393	0.0:0.9102:0.0:0.0898	.	544	Q96NI6	LRFN5_HUMAN	L	544	ENSP00000298119:F544L	ENSP00000298119:F544L	F	+	3	2	LRFN5	41430449	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.130000	0.42064	2.775000	0.95449	0.650000	0.86243	TTC		0.403	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		11	275	0	0	0	0.010729	0	11	275				
ZFP36L1	677	broad.mit.edu	37	14	69259641	69259641	+	Silent	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr14:69259641G>C	ENST00000439696.2	-	1	316	c.15C>G	c.(13-15)ctC>ctG	p.L5L	ZFP36L1_ENST00000336440.3_Silent_p.L5L|ZFP36L1_ENST00000555997.1_5'Flank	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	5					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L5L(1)		breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGGCAGACACGAGGGTGGTGG	0.557																																							uc001xkh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(13-15)CTC>CTG		butyrate response factor 1							133.0	132.0	133.0					14																	69259641		2203	4300	6503	SO:0001819	synonymous_variant	677				regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr14:69259641G>C	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.15C>G	14.37:g.69259641G>C			Somatic				ZFP36L1_uc001xki.1_Silent_p.L5L	p.L5L	NM_004926	NP_004917	WXS	Illumina HiSeq	Unspecified	Q07352	TISB_HUMAN		all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)	1	145	-			5					Q13851	Silent	SNP	ENST00000439696.2	37	c.15C>G	CCDS9791.1																																																																																				0.557	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1			5	125	0	0	0	0.000602	0	5	125				
SLC39A9	55334	broad.mit.edu	37	14	69908920	69908920	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr14:69908920C>G	ENST00000336643.5	+	3	1018	c.340C>G	c.(340-342)Ctg>Gtg	p.L114V	SLC39A9_ENST00000031146.4_Intron|SLC39A9_ENST00000555245.1_3'UTR|SLC39A9_ENST00000556605.1_Missense_Mutation_p.L114V|SLC39A9_ENST00000557046.1_Missense_Mutation_p.L114V	NM_018375.4	NP_060845.2	Q9NUM3	S39A9_HUMAN	solute carrier family 39, member 9	114					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.L114V(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|skin(1)|stomach(1)	14				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)		TTCCCTCGTTCTGGGCTTCGT	0.493																																							uc001xle.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(340-342)CTG>GTG		solute carrier family 39 (zinc transporter),							389.0	324.0	346.0					14																	69908920		2203	4300	6503	SO:0001583	missense	55334				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr14:69908920C>G		CCDS9795.1, CCDS58327.1, CCDS58328.1	14q24.1	2013-07-17	2013-07-17			ENSG00000029364		"""Solute carriers"""	20182	protein-coding gene	gene with protein product							Standard	NM_018375		Approved	FLJ11274	uc001xle.3	Q9NUM3		ENST00000336643.5:c.340C>G	14.37:g.69908920C>G	ENSP00000336887:p.Leu114Val		Somatic				SLC39A9_uc010aqx.2_Missense_Mutation_p.L114V|SLC39A9_uc001xlf.3_Missense_Mutation_p.L114V|SLC39A9_uc001xlg.3_RNA	p.L114V	NM_018375	NP_060845	WXS	Illumina HiSeq	Unspecified	Q9NUM3	S39A9_HUMAN		all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)	3	1020	+			114			Helical; (Potential).		G3V5J8|Q53HN3|Q5MJQ0|Q6P2Q1|Q86WY2	Missense_Mutation	SNP	ENST00000336643.5	37	c.340C>G	CCDS9795.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452300	0.63290	.	.	ENSG00000029364	ENST00000556605;ENST00000336643;ENST00000557046	T;T;T	0.66460	1.33;-0.21;0.61	5.41	2.52	0.30459	.	0.000000	0.85682	D	0.000000	T	0.73087	0.3542	M	0.79011	2.435	0.80722	D	1	P;P;P	0.51537	0.937;0.946;0.835	P;P;B	0.55303	0.773;0.462;0.394	T	0.70880	-0.4752	10	0.14656	T	0.56	-7.355	11.9307	0.52845	0.0:0.7964:0.0:0.2036	.	114;114;114	Q9NUM3-2;G3V5J8;Q9NUM3	.;.;S39A9_HUMAN	V	114	ENSP00000452385:L114V;ENSP00000336887:L114V;ENSP00000451833:L114V	ENSP00000031146:L114V	L	+	1	2	SLC39A9	68978673	0.992000	0.36948	0.659000	0.29680	0.886000	0.51366	2.991000	0.49409	0.743000	0.32719	0.655000	0.94253	CTG		0.493	SLC39A9-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412446.1	NM_018375		9	152	0	0	0	0.008291	0	9	152				
ASB2	51676	broad.mit.edu	37	14	94413798	94413798	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr14:94413798C>G	ENST00000315988.4	-	5	1293	c.805G>C	c.(805-807)Gag>Cag	p.E269Q	MIR4506_ENST00000584693.1_RNA|ASB2_ENST00000556337.1_Intron|ASB2_ENST00000555019.1_Missense_Mutation_p.E317Q	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	269					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)	p.E269Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		ACCACCTCCTCATGCTCATTC	0.587																																							uc001ycc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(805-807)GAG>CAG		ankyrin repeat and SOCS box-containing protein							195.0	150.0	165.0					14																	94413798		2203	4300	6503	SO:0001583	missense	51676				intracellular signal transduction			g.chr14:94413798C>G	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.805G>C	14.37:g.94413798C>G	ENSP00000320675:p.Glu269Gln		Somatic				ASB2_uc001ycd.2_Missense_Mutation_p.E317Q|ASB2_uc001yce.1_Missense_Mutation_p.E215Q	p.E269Q	NM_016150	NP_057234	WXS	Illumina HiSeq	Unspecified	Q96Q27	ASB2_HUMAN		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)	5	1294	-		all_cancers(154;0.13)	269			ANK 7.		B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	c.805G>C	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.302405	0.40694	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.65364	2.42;2.42;-0.15	5.19	4.29	0.51040	Ankyrin repeat-containing domain (3);	0.371203	0.30356	N	0.009815	T	0.52338	0.1728	L	0.39326	1.205	0.34863	D	0.742785	B;B;B	0.16166	0.011;0.016;0.011	B;B;B	0.19666	0.016;0.019;0.026	T	0.55592	-0.8117	10	0.13108	T	0.6	-0.0499	15.6944	0.77484	0.0:0.8626:0.1374:0.0	.	285;317;269	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	Q	317;285;269;215;215	ENSP00000451575:E317Q;ENSP00000320675:E269Q;ENSP00000450940:E215Q	ENSP00000320675:E269Q	E	-	1	0	ASB2	93483551	0.062000	0.20869	0.991000	0.47740	0.865000	0.49528	1.426000	0.34870	1.153000	0.42468	0.462000	0.41574	GAG		0.587	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1			6	64	0	0	0	0.001984	0	6	64				
TCF12	6938	broad.mit.edu	37	15	57383997	57383997	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr15:57383997A>G	ENST00000267811.5	+	5	537	c.233A>G	c.(232-234)gAc>gGc	p.D78G	TCF12_ENST00000438423.2_Missense_Mutation_p.D78G|TCF12_ENST00000333725.5_Missense_Mutation_p.D78G|TCF12_ENST00000452095.2_Missense_Mutation_p.D74G|TCF12_ENST00000557843.1_Missense_Mutation_p.D78G	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	78					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.D78G(2)|p.D74G(1)	TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		GGTTTTACAGACAGCCCTCAT	0.413			T	TEC	extraskeletal myxoid chondrosarcoma																																		uc002aec.2		NA		Dom	yes		15	15q21	6938	T	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""			M	TEC		extraskeletal myxoid chondrosarcoma		3	Substitution - Missense(3)		lung(3)	central_nervous_system(5)|ovary(2)|lung(1)	8						c.(232-234)GAC>GGC		transcription factor 12 isoform b							107.0	104.0	105.0					15																	57383997		2192	4292	6484	SO:0001583	missense	6938				immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr15:57383997A>G	BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.233A>G	15.37:g.57383997A>G	ENSP00000267811:p.Asp78Gly		Somatic				TCF12_uc010ugm.1_Missense_Mutation_p.D130G|TCF12_uc010ugn.1_Missense_Mutation_p.D74G|TCF12_uc002aea.2_Missense_Mutation_p.D78G|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Missense_Mutation_p.D78G|TCF12_uc002aed.2_Missense_Mutation_p.D78G	p.D78G	NM_207038	NP_996921	WXS	Illumina HiSeq	Unspecified	Q99081	HTF4_HUMAN		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)	5	517	+		Colorectal(260;0.0907)	78					Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	ENST00000267811.5	37	c.233A>G	CCDS10159.1	.	.	.	.	.	.	.	.	.	.	A	31	5.076195	0.94000	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725	T;T;T;T	0.43688	1.48;1.48;0.94;1.48	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.61937	0.2387	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.71674	0.997;0.998;0.993;0.996	D;D;D;D	0.81914	0.98;0.995;0.984;0.993	T	0.59915	-0.7364	10	0.38643	T	0.18	-2.2466	16.2365	0.82377	1.0:0.0:0.0:0.0	.	74;130;78;78	E9PGY0;F5H6Z6;Q99081;Q99081-3	.;.;HTF4_HUMAN;.	G	130;78;78;74;78	ENSP00000267811:D78G;ENSP00000388940:D78G;ENSP00000396881:D74G;ENSP00000331057:D78G	ENSP00000267811:D78G	D	+	2	0	TCF12	55171289	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.447000	0.90332	2.238000	0.73509	0.477000	0.44152	GAC		0.413	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255069.3	NM_003205		6	67	0	0	0	0.001984	0	6	67				
SV2B	9899	broad.mit.edu	37	15	91810797	91810797	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr15:91810797G>T	ENST00000394232.1	+	8	1602	c.1132G>T	c.(1132-1134)Gcc>Tcc	p.A378S	SV2B_ENST00000545111.2_Missense_Mutation_p.A227S|SV2B_ENST00000330276.4_Missense_Mutation_p.A378S	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	378					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.A378S(1)		NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			CTGGGATAATGCCCTGTACTG	0.423																																							uc002bqv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(1132-1134)GCC>TCC		synaptic vesicle protein 2B homolog							245.0	204.0	217.0					15																	91810797		2198	4298	6496	SO:0001583	missense	9899				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr15:91810797G>T	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.1132G>T	15.37:g.91810797G>T	ENSP00000377779:p.Ala378Ser		Somatic				SV2B_uc002bqt.2_Missense_Mutation_p.A378S|SV2B_uc010uqv.1_Missense_Mutation_p.A227S|SV2B_uc002bqu.3_RNA	p.A378S	NM_014848	NP_055663	WXS	Illumina HiSeq	Unspecified	Q7L1I2	SV2B_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0895)		7	1523	+	Lung NSC(78;0.0987)|all_lung(78;0.172)		378			Cytoplasmic (Potential).		B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	ENST00000394232.1	37	c.1132G>T	CCDS10370.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057349	0.36277	.	.	ENSG00000185518	ENST00000545111;ENST00000394232;ENST00000330276	T;T;T	0.61392	0.11;0.12;0.12	5.4	5.4	0.78164	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.382752	0.29799	N	0.011174	T	0.28599	0.0708	N	0.00771	-1.2	0.32962	D	0.521134	B	0.19935	0.04	B	0.29440	0.102	T	0.38735	-0.9647	10	0.21014	T	0.42	-17.3402	12.7984	0.57571	0.0:0.0:0.8364:0.1636	.	378	Q7L1I2	SV2B_HUMAN	S	227;378;378	ENSP00000443243:A227S;ENSP00000377779:A378S;ENSP00000332818:A378S	ENSP00000332818:A378S	A	+	1	0	SV2B	89611801	0.990000	0.36364	0.975000	0.42487	0.286000	0.27126	2.494000	0.45329	2.521000	0.84997	0.563000	0.77884	GCC		0.423	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848		3	21	1	0	0.00024832	0.009096	0.000276843	3	21				
TMC7	79905	broad.mit.edu	37	16	19056263	19056263	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr16:19056263G>C	ENST00000304381.5	+	10	1525	c.1395G>C	c.(1393-1395)aaG>aaC	p.K465N	TMC7_ENST00000569532.1_Missense_Mutation_p.K465N|TMC7_ENST00000421369.3_Missense_Mutation_p.K355N	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	465					ion transport (GO:0006811)	integral component of membrane (GO:0016021)		p.K465N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						TGGGCTCCAAGATCACATCCT	0.577																																							uc002dfq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1393-1395)AAG>AAC		transmembrane channel-like 7 isoform a							118.0	103.0	108.0					16																	19056263		2197	4300	6497	SO:0001583	missense	79905					integral to membrane		g.chr16:19056263G>C	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1395G>C	16.37:g.19056263G>C	ENSP00000304710:p.Lys465Asn		Somatic				TMC7_uc010vao.1_3'UTR|TMC7_uc002dfp.2_Missense_Mutation_p.K465N|TMC7_uc010vap.1_Missense_Mutation_p.K355N	p.K465N	NM_024847	NP_079123	WXS	Illumina HiSeq	Unspecified	Q7Z402	TMC7_HUMAN			10	1525	+			465			Cytoplasmic (Potential).		E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	ENST00000304381.5	37	c.1395G>C	CCDS10573.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594603	0.28445	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	T;T	0.53423	0.62;0.62	5.21	3.23	0.37069	.	0.325305	0.28436	N	0.015351	T	0.34687	0.0906	L	0.38175	1.15	0.38288	D	0.942629	B;B	0.16603	0.004;0.018	B;B	0.17722	0.007;0.019	T	0.20940	-1.0260	10	0.30854	T	0.27	.	9.0765	0.36525	0.2268:0.0:0.7732:0.0	.	465;465	Q7Z402;B3KSZ3	TMC7_HUMAN;.	N	465;355	ENSP00000304710:K465N;ENSP00000397081:K355N	ENSP00000304710:K465N	K	+	3	2	TMC7	18963764	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	1.642000	0.37207	1.188000	0.43014	0.555000	0.69702	AAG		0.577	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847		9	132	0	0	0	0.006214	0	9	132				
RRN3P1	730092	broad.mit.edu	37	16	21817457	21817457	+	RNA	SNP	G	G	A	rs202140854	byFrequency	TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr16:21817457G>A	ENST00000546471.1	-	0	1601							Q2M238	RN3P1_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 1																		CTTACATCCAGCTTGAGTAGT	0.259																																							uc010vbl.1		NA																	0					0						c.(106-108)CTG>TTG		SubName: Full=Putative uncharacterized protein ENSP00000219758;																																						730092							g.chr16:21817457G>A			16p12.2	2012-10-16			ENSG00000248124	ENSG00000248124			30548	pseudogene	pseudogene						12477932	Standard	NR_003370		Approved		uc010vbl.1	Q2M238	OTTHUMG00000170417		16.37:g.21817457G>A			Somatic				uc002diq.3_Intron	p.L36L	NR_003370		WXS	Illumina HiSeq	Unspecified					7	603	-								A8K6T4|B3KWX9|O75704	Silent	SNP	ENST00000546471.1	37	c.106C>T																																																																																					0.259	RRN3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000409035.1	NR_003370		3	25	0	0	0	0.000602	0	3	25				
CD2BP2	10421	broad.mit.edu	37	16	30364598	30364598	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr16:30364598C>T	ENST00000305596.3	-	6	994	c.819G>A	c.(817-819)tcG>tcA	p.S273S	CD2BP2_ENST00000569466.1_Silent_p.S273S|RP11-347C12.10_ENST00000563252.1_lincRNA	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	273					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)	p.S273S(1)		breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						CATCTCCCCGCGACTCTGCTT	0.567																																							uc002dxr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(817-819)TCG>TCA		CD2 antigen (cytoplasmic tail) binding protein							119.0	109.0	112.0					16																	30364598		2197	4300	6497	SO:0001819	synonymous_variant	10421				assembly of spliceosomal tri-snRNP	cytoplasm|nucleoplasm|U5 snRNP	protein binding|ribonucleoprotein binding	g.chr16:30364598C>T	AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.819G>A	16.37:g.30364598C>T			Somatic				CD2BP2_uc002dxs.2_Silent_p.S273S	p.S273S	NM_006110	NP_006101	WXS	Illumina HiSeq	Unspecified	O95400	CD2B2_HUMAN			5	1072	-			273					B2RDX2|Q9ULP2	Silent	SNP	ENST00000305596.3	37	c.819G>A	CCDS10675.1																																																																																				0.567	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255528.1	NM_006110		11	70	0	0	0	0.008291	0	11	70				
FBRS	64319	broad.mit.edu	37	16	30676242	30676242	+	Splice_Site	SNP	G	G	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr16:30676242G>T	ENST00000287468.5	+	2	266		c.e2+1		FBRS_ENST00000395073.2_Splice_Site|FBRS_ENST00000356166.6_Splice_Site|FBRS_ENST00000568722.1_Intron	NM_001105079.1	NP_001098549.1	Q9HAH7	FBRS_HUMAN	fibrosin									p.?(1)		ovary(1)	1			Colorectal(24;0.103)			CCCCCACATGGTGAGCTCCTC	0.677																																							uc002dzd.3		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e2+1		fibrosin							52.0	66.0	61.0					16																	30676242		2195	4297	6492	SO:0001630	splice_region_variant	64319							g.chr16:30676242G>T	AK021680		16p11.2	2008-02-05	2007-04-18	2007-04-18	ENSG00000156860	ENSG00000156860			20442	protein-coding gene	gene with protein product		608601	"""fibrosin 1"""	FBS1		7892239, 9809749	Standard	NM_001105079		Approved	FBS, FLJ11618	uc002dzd.4	Q9HAH7	OTTHUMG00000132390	ENST00000287468.5:c.3+1G>T	16.37:g.30676242G>T			Somatic				FBRS_uc002dzc.3_Intron	p.M1_splice	NM_001105079	NP_001098549	WXS	Illumina HiSeq	Unspecified	Q9HAH7	FBRS_HUMAN	Colorectal(24;0.103)		2	266	+								B4DP86|Q96CI9|Q9H9X4	Splice_Site	SNP	ENST00000287468.5	37	c.3_splice		.	.	.	.	.	.	.	.	.	.	G	16.75	3.209337	0.58343	.	.	ENSG00000156860	ENST00000356166;ENST00000287468	.	.	.	4.19	4.19	0.49359	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.89	0.63733	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FBRS	30583743	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.359000	0.79477	2.329000	0.79093	0.591000	0.81541	.		0.677	FBRS-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_022452	Intron	4	11	1	0	0.00909568	0.009096	0.00955915	4	11				
CNOT1	23019	broad.mit.edu	37	16	58555102	58555102	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr16:58555102G>A	ENST00000317147.5	-	48	7369	c.7037C>T	c.(7036-7038)gCc>gTc	p.A2346V	CNOT1_ENST00000245138.4_Missense_Mutation_p.A1197V|CNOT1_ENST00000569240.1_Missense_Mutation_p.A2341V	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	2346					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)	p.A2346V(1)		breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GATTTCTGGGGCACAGTGTAC	0.398																																							uc002env.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(7036-7038)GCC>GTC		CCR4-NOT transcription complex, subunit 1							93.0	94.0	93.0					16																	58555102		2198	4300	6498	SO:0001583	missense	23019				nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol		g.chr16:58555102G>A	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.7037C>T	16.37:g.58555102G>A	ENSP00000320949:p.Ala2346Val		Somatic				CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Missense_Mutation_p.A2341V|CNOT1_uc002ent.2_Missense_Mutation_p.A284V|CNOT1_uc010vik.1_Missense_Mutation_p.A1303V	p.A2346V	NM_016284	NP_057368	WXS	Illumina HiSeq	Unspecified	A5YKK6	CNOT1_HUMAN		Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)	48	7330	-			2346					Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	c.7037C>T	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	G	32	5.157347	0.94686	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000245138	T	0.54479	0.57	5.91	5.91	0.95273	CCR4-Not complex component, Not1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.74779	0.3761	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.981	D;D;D	0.85130	0.997;0.972;0.976	T	0.74179	-0.3749	10	0.49607	T	0.09	-3.3293	19.2867	0.94077	0.0:0.0:1.0:0.0	.	1197;2346;2341	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	V	2346;1040;1197	ENSP00000320949:A2346V	ENSP00000245138:A1197V	A	-	2	0	CNOT1	57112603	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.631000	0.98424	2.793000	0.96121	0.655000	0.94253	GCC		0.398	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284		4	143	0	0	0	0.009096	0	4	143				
ADAD2	161931	broad.mit.edu	37	16	84229882	84229882	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr16:84229882A>C	ENST00000315906.5	+	8	1484	c.1432A>C	c.(1432-1434)Acc>Ccc	p.T478P	RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.T560P|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	478	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						TTCCGAACCCACCCCTGACAC	0.687																																							uc002fhr.2		NA																	0					0						c.(1432-1434)ACC>CCC		adenosine deaminase domain containing 2 isoform							38.0	46.0	43.0					16																	84229882		2197	4297	6494	SO:0001583	missense	161931				RNA processing	intracellular	adenosine deaminase activity|double-stranded RNA binding	g.chr16:84229882A>C	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1432A>C	16.37:g.84229882A>C	ENSP00000325153:p.Thr478Pro		Somatic				ADAD2_uc002fhq.2_Missense_Mutation_p.T560P|uc002fhs.1_Intron	p.T478P	NM_001145400	NP_001138872	WXS	Illumina HiSeq	Unspecified	Q8NCV1	ADAD2_HUMAN			8	1546	+			478			A to I editase.		B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	c.1432A>C	CCDS45536.1	.	.	.	.	.	.	.	.	.	.	A	2.882	-0.231633	0.05983	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	D;D	0.93426	-3.22;-3.22	5.15	-3.91	0.04168	Adenosine deaminase/editase (2);	1.375220	0.04854	N	0.442885	T	0.81113	0.4755	N	0.11560	0.145	0.09310	N	1	P;B	0.36048	0.534;0.053	B;B	0.33392	0.163;0.053	T	0.74538	-0.3632	10	0.30854	T	0.27	-4.2062	1.291	0.02060	0.272:0.2788:0.3125:0.1368	.	478;560	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	P	478;560	ENSP00000325153:T478P;ENSP00000268624:T560P	ENSP00000268624:T560P	T	+	1	0	ADAD2	82787383	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.361000	0.07612	-0.282000	0.09128	0.533000	0.62120	ACC		0.687	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174		6	86	0	0	0	0.004007	0	6	86				
MC1R	4157	broad.mit.edu	37	16	89986023	89986023	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr16:89986023C>T	ENST00000555147.1	+	1	1737	c.357C>T	c.(355-357)gtC>gtT	p.V119V	RP11-566K11.4_ENST00000554623.1_RNA|TUBB3_ENST00000554444.1_5'Flank|RP11-566K11.7_ENST00000570217.1_RNA|TUBB3_ENST00000556922.1_Silent_p.V119V|MC1R_ENST00000555427.1_Silent_p.V119V	NM_002386.3	NP_002377.4	Q01726	MSHR_HUMAN	melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)	119					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intracellular signal transduction (GO:0035556)|melanin biosynthetic process (GO:0042438)|multicellular organismal development (GO:0007275)|negative regulation of tumor necrosis factor production (GO:0032720)|pigmentation (GO:0043473)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sensory perception of pain (GO:0019233)|UV protection (GO:0009650)|UV-damage excision repair (GO:0070914)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|ubiquitin protein ligase binding (GO:0031625)	p.V119V(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		TGGACAATGTCATTGACGTGA	0.642									Melanoma, Familial Clustering of																														uc002fpf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(355-357)GTC>GTT		tubulin, beta, 4							63.0	70.0	68.0					16																	89986023		2196	4298	6494	SO:0001819	synonymous_variant	10381		Familial Cancer Database		'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr16:89986023C>T		CCDS56011.1	16q24.3	2012-10-05			ENSG00000258839	ENSG00000258839		"""GPCR / Class A : Melanocortin receptors"""	6929	protein-coding gene	gene with protein product		155555				8458079	Standard	NM_002386		Approved	MSH-R		Q01726		ENST00000555147.1:c.357C>T	16.37:g.89986023C>T			Somatic				MC1R_uc002fpe.3_Silent_p.V119V|TUBB3_uc010ciz.1_5'Flank	p.V119V	NM_006086	NP_006077	WXS	Illumina HiSeq	Unspecified	Q13509	TBB3_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0273)	1	765	+		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)	116					Q66K38|Q6UR93|Q8WWX6|Q8WWX7|Q96I33|Q96RU4|Q9UBF7|Q9UN58|Q9UN59|Q9UN60|Q9UN61|Q9UN62	Silent	SNP	ENST00000555147.1	37	c.357C>T	CCDS56011.1																																																																																				0.642	MC1R-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412014.1	NM_002386		5	51	0	0	0	0.001168	0	5	51				
P2RX5	5026	broad.mit.edu	37	17	3593383	3593383	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:3593383G>C	ENST00000225328.5	-	6	993	c.595C>G	c.(595-597)Ccc>Gcc	p.P199A	P2RX5_ENST00000550772.1_5'UTR|P2RX5_ENST00000551178.1_Missense_Mutation_p.P175A|P2RX5_ENST00000552276.1_Missense_Mutation_p.P199A|P2RX5_ENST00000435558.1_Missense_Mutation_p.P199A|P2RX5_ENST00000552050.1_Missense_Mutation_p.P139A|P2RX5_ENST00000547178.1_Missense_Mutation_p.P199A|P2RX5_ENST00000345901.3_Missense_Mutation_p.P175A|P2RX5-TAX1BP3_ENST00000550383.1_Missense_Mutation_p.P199A	NM_001204519.1|NM_002561.3	NP_001191448.1|NP_002552.2	Q93086	P2RX5_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 5	199					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transport (GO:0006810)	integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|ion channel activity (GO:0005216)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)	p.P199A(1)		endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						TTGAATTTGGGGAAACGGATG	0.582																																							uc002fwi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(595-597)CCC>GCC		purinergic receptor P2X5 isoform A							236.0	255.0	249.0					17																	3593383		2203	4300	6503	SO:0001583	missense	5026				nervous system development|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity	g.chr17:3593383G>C	AF016709	CCDS11034.1, CCDS11035.1, CCDS56014.1, CCDS56015.1	17p13.3	2012-01-17			ENSG00000083454	ENSG00000083454		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8536	protein-coding gene	gene with protein product		602836				9414125	Standard	NM_002561		Approved	P2X5	uc002fwi.3	Q93086	OTTHUMG00000090700	ENST00000225328.5:c.595C>G	17.37:g.3593383G>C	ENSP00000225328:p.Pro199Ala		Somatic				P2RX5_uc002fwd.2_RNA|P2RX5_uc002fwh.1_Missense_Mutation_p.P199A|P2RX5_uc010vrx.1_Missense_Mutation_p.P139A|P2RX5_uc002fwj.2_Missense_Mutation_p.P175A|P2RX5_uc002fwk.2_Missense_Mutation_p.P199A|P2RX5_uc002fwl.2_Missense_Mutation_p.P175A	p.P199A	NM_002561	NP_002552	WXS	Illumina HiSeq	Unspecified	Q93086	P2RX5_HUMAN			6	879	-			199			Extracellular (Potential).		G5E981|O43450|O75540|Q308M5|Q59F38|Q8IXW4|Q93087|Q9NZV0	Missense_Mutation	SNP	ENST00000225328.5	37	c.595C>G	CCDS11034.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.0|22.0	4.227863|4.227863	0.79576|0.79576	.|.	.|.	ENSG00000083454|ENSG00000083454	ENST00000435558;ENST00000551178;ENST00000547178;ENST00000225328;ENST00000345901;ENST00000552050|ENST00000552723	T;T;T;T;T;T|.	0.05319|.	3.46;3.46;3.46;3.46;3.46;3.46|.	5.34|5.34	4.36|4.36	0.52297|0.52297	.|.	0.110120|0.110120	0.64402|0.64402	D|D	0.000006|0.000006	T|T	0.78947|0.78947	0.4364|0.4364	M|M	0.87547|0.87547	2.89|2.89	0.53005|0.53005	D|D	0.999967|0.999967	D;D;D;D;D;D|.	0.64830|.	0.994;0.988;0.966;0.988;0.972;0.966|.	D;D;P;D;P;P|.	0.66847|.	0.94;0.928;0.777;0.947;0.858;0.777|.	T|T	0.82271|0.82271	-0.0540|-0.0540	10|6	0.66056|.	D|.	0.02|.	-6.5344|-6.5344	14.7289|14.7289	0.69365|0.69365	0.0:0.0:0.854:0.146|0.0:0.0:0.854:0.146	.|.	139;175;199;175;199;199|.	B4DEG2;G5E981;Q93086-1;Q93086-2;Q93086;Q93086-4|.	.;.;.;.;P2RX5_HUMAN;.|.	A|R	199;175;199;199;175;139|146	ENSP00000415370:P199A;ENSP00000447545:P175A;ENSP00000448355:P199A;ENSP00000225328:P199A;ENSP00000342161:P175A;ENSP00000450006:P139A|.	ENSP00000225328:P199A|.	P|P	-|-	1|2	0|0	P2RX5|P2RX5	3540132|3540132	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	7.863000|7.863000	0.87023|0.87023	1.364000|1.364000	0.46038|0.46038	0.655000|0.655000	0.94253|0.94253	CCC|CCC		0.582	P2RX5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207388.3	NM_002561, NM_175080, NM_175081		94	212	0	0	0	0.01441	0	94	212				
SLFN13	146857	broad.mit.edu	37	17	33770904	33770904	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:33770904G>A	ENST00000285013.6	-	4	1377	c.1102C>T	c.(1102-1104)Cag>Tag	p.Q368*	SLFN13_ENST00000526861.1_Nonsense_Mutation_p.Q368*|SLFN13_ENST00000534689.1_Nonsense_Mutation_p.Q50*|SLFN13_ENST00000360502.2_Nonsense_Mutation_p.Q50*|SLFN13_ENST00000533791.1_Nonsense_Mutation_p.Q368*|SLFN13_ENST00000542635.1_Nonsense_Mutation_p.Q368*	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	368						intracellular (GO:0005622)	ATP binding (GO:0005524)	p.Q368*(2)		NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AGACTCAACTGAGACTCAAAG	0.388																																							uc002hjk.1		NA																	2	Substitution - Nonsense(2)	p.Q368*(1)	ovary(1)|lung(1)	ovary(1)|breast(1)	2						c.(1102-1104)CAG>TAG		schlafen family member 13							85.0	81.0	82.0					17																	33770904		2203	4300	6503	SO:0001587	stop_gained	146857					intracellular	ATP binding	g.chr17:33770904G>A	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1102C>T	17.37:g.33770904G>A	ENSP00000285013:p.Gln368*		Somatic				SLFN13_uc010wch.1_Nonsense_Mutation_p.Q368*|SLFN13_uc002hjl.2_Nonsense_Mutation_p.Q368*|SLFN13_uc010ctt.2_Nonsense_Mutation_p.Q50*|SLFN13_uc002hjm.2_Nonsense_Mutation_p.Q37*	p.Q368*	NM_144682	NP_653283	WXS	Illumina HiSeq	Unspecified	Q68D06	SLN13_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)	2	1432	-			368					E1P645|Q658M1|Q6ZS51|Q96A81	Nonsense_Mutation	SNP	ENST00000285013.6	37	c.1102C>T	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	g	38	6.735089	0.97801	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689;ENST00000532210	.	.	.	3.4	3.4	0.38934	.	0.000000	0.43260	D	0.000589	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	10.4397	0.44457	0.0:0.0:1.0:0.0	.	.	.	.	X	368;50;368;368;50;37	.	ENSP00000285013:Q368X	Q	-	1	0	SLFN13	30795017	0.040000	0.19996	0.987000	0.45799	0.106000	0.19336	2.747000	0.47475	1.878000	0.54408	0.514000	0.50259	CAG		0.388	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682		8	62	0	0	0	0.004482	0	8	62				
KRT27	342574	broad.mit.edu	37	17	38935859	38935859	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:38935859C>T	ENST00000301656.3	-	5	907	c.867G>A	c.(865-867)caG>caA	p.Q289Q	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27									p.Q289Q(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				CGTCAGAGATCTGCTGCTGCA	0.607																																							uc002hvg.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(865-867)CAG>CAA		keratin 27							47.0	45.0	45.0					17																	38935859		2203	4300	6503	SO:0001819	synonymous_variant	342574					cytoplasm|intermediate filament	structural molecule activity	g.chr17:38935859C>T	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.867G>A	17.37:g.38935859C>T			Somatic					p.Q289Q	NM_181537	NP_853515	WXS	Illumina HiSeq	Unspecified	Q7Z3Y8	K1C27_HUMAN			5	908	-		Breast(137;0.000812)	289			Rod.|Coil 2.			Silent	SNP	ENST00000301656.3	37	c.867G>A	CCDS11375.1																																																																																				0.607	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537		4	33	0	0	0	0.009096	0	4	33				
KRT36	8689	broad.mit.edu	37	17	39645783	39645783	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:39645783G>T	ENST00000328119.6	-	1	333	c.334C>A	c.(334-336)Cgt>Agt	p.R112S	KRT36_ENST00000393986.2_Missense_Mutation_p.R62S	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	112	Coil 1A.|Rod.				regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)	p.R112S(1)		breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				TCCAGCTGACGCACCTTCTCC	0.602																																							uc002hwt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(334-336)CGT>AGT		keratin 36							116.0	109.0	112.0					17																	39645783		2203	4300	6503	SO:0001583	missense	8689					intermediate filament	protein binding|structural constituent of epidermis	g.chr17:39645783G>T	Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.334C>A	17.37:g.39645783G>T	ENSP00000329165:p.Arg112Ser		Somatic					p.R112S	NM_003771	NP_003762	WXS	Illumina HiSeq	Unspecified	O76013	KRT36_HUMAN			1	334	-		Breast(137;0.000286)	112			Rod.|Coil 1A.		Q86XG4	Missense_Mutation	SNP	ENST00000328119.6	37	c.334C>A	CCDS11395.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.794715	0.90453	.	.	ENSG00000126337	ENST00000393986;ENST00000328119	D;D	0.92397	-3.03;-3.03	5.57	5.57	0.84162	Filament (1);	0.000000	0.50627	D	0.000102	D	0.97511	0.9185	H	0.97491	4.015	0.49130	D	0.999758	D	0.57571	0.98	D	0.74023	0.982	D	0.98543	1.0633	10	0.87932	D	0	.	15.1978	0.73108	0.0:0.0:0.8586:0.1414	.	112	O76013	KRT36_HUMAN	S	62;112	ENSP00000377555:R62S;ENSP00000329165:R112S	ENSP00000329165:R112S	R	-	1	0	KRT36	36899309	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.481000	0.73608	2.620000	0.88729	0.563000	0.77884	CGT		0.602	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259508.1	NM_003771		5	119	1	0	0.00307968	0.00308	0.00334307	5	119				
FZD2	2535	broad.mit.edu	37	17	42635739	42635739	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:42635739C>T	ENST00000315323.3	+	1	815	c.683C>T	c.(682-684)gCg>gTg	p.A228V		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	228					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.A228V(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TGCGAACCTGCGCGGCCCGAT	0.622																																							uc002igx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(682-684)GCG>GTG		frizzled 2 precursor							51.0	50.0	50.0					17																	42635739		2203	4300	6503	SO:0001583	missense	2535				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr17:42635739C>T	L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.683C>T	17.37:g.42635739C>T	ENSP00000323901:p.Ala228Val		Somatic					p.A228V	NM_001466	NP_001457	WXS	Illumina HiSeq	Unspecified	Q14332	FZD2_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.189)	1	815	+		Prostate(33;0.0181)	228			Extracellular (Potential).		Q0VG82	Missense_Mutation	SNP	ENST00000315323.3	37	c.683C>T	CCDS11484.1	.	.	.	.	.	.	.	.	.	.	c	11.34	1.610295	0.28712	.	.	ENSG00000180340	ENST00000541149;ENST00000315323	T	0.73575	-0.76	4.34	4.34	0.51931	.	0.190050	0.45867	D	0.000332	T	0.57784	0.2077	N	0.14661	0.345	0.09310	N	1	B	0.31290	0.318	B	0.20577	0.03	T	0.57568	-0.7789	10	0.56958	D	0.05	.	16.4665	0.84080	0.0:1.0:0.0:0.0	.	228	Q14332	FZD2_HUMAN	V	304;228	ENSP00000323901:A228V	ENSP00000323901:A228V	A	+	2	0	FZD2	39991265	0.008000	0.16893	0.646000	0.29493	0.638000	0.38207	2.058000	0.41374	1.935000	0.56089	0.561000	0.74099	GCG		0.622	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457806.1	NM_001466		10	32	0	0	0	0.008291	0	10	32				
ZNF652	22834	broad.mit.edu	37	17	47388720	47388720	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:47388720A>C	ENST00000362063.2	-	5	1581	c.1263T>G	c.(1261-1263)gaT>gaG	p.D421E	ZNF652_ENST00000430262.2_Missense_Mutation_p.D421E	NM_014897.2	NP_055712.1	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D421E(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			TCATGTTGAAATCCTTGCCAC	0.433																																							uc002iov.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1261-1263)GAT>GAG		zinc finger protein 652							275.0	230.0	245.0					17																	47388720		2203	4300	6503	SO:0001583	missense	22834				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr17:47388720A>C	AB023141	CCDS32677.1	17q21.32	2013-01-08				ENSG00000198740		"""Zinc fingers, C2H2-type"""	29147	protein-coding gene	gene with protein product		613907				10231032	Standard	NM_014897		Approved	KIAA0924	uc002iow.3	Q9Y2D9		ENST00000362063.2:c.1263T>G	17.37:g.47388720A>C	ENSP00000354686:p.Asp421Glu		Somatic				ZNF652_uc002iow.2_Missense_Mutation_p.D421E|ZNF652_uc002iou.3_RNA	p.D421E	NM_001145365	NP_001138837	WXS	Illumina HiSeq	Unspecified	Q9Y2D9	ZN652_HUMAN	BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)		5	1727	-	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		421			C2H2-type 7.		A4QPD9|Q5H9Q0	Missense_Mutation	SNP	ENST00000362063.2	37	c.1263T>G	CCDS32677.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.278389	0.80692	.	.	ENSG00000198740	ENST00000362063;ENST00000430262	T;T	0.07327	3.2;3.2	5.61	-2.46	0.06461	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.045886	0.85682	D	0.000000	T	0.08447	0.0210	N	0.05199	-0.095	0.47905	D	0.999549	D	0.76494	0.999	D	0.76071	0.987	T	0.07635	-1.0762	10	0.14656	T	0.56	-25.6547	12.5538	0.56242	0.5748:0.0:0.4252:0.0	.	421	Q9Y2D9	ZN652_HUMAN	E	421	ENSP00000354686:D421E;ENSP00000416305:D421E	ENSP00000354686:D421E	D	-	3	2	ZNF652	44743719	0.998000	0.40836	0.938000	0.37757	0.994000	0.84299	0.503000	0.22610	-0.730000	0.04869	-0.248000	0.11899	GAT		0.433	ZNF652-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364524.1	NM_014897		47	142	0	0	0	0.01441	0	47	142				
MED13	9969	broad.mit.edu	37	17	60024297	60024297	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:60024297G>A	ENST00000397786.2	-	29	6449	c.6373C>T	c.(6373-6375)Cag>Tag	p.Q2125*		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2125					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.Q2125*(1)		breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TCTGAAGTCTGATTTGAGTCA	0.393																																							uc002izo.2		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(6373-6375)CAG>TAG		mediator complex subunit 13							179.0	181.0	180.0					17																	60024297		1960	4163	6123	SO:0001587	stop_gained	9969				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:60024297G>A	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.6373C>T	17.37:g.60024297G>A	ENSP00000380888:p.Gln2125*		Somatic					p.Q2125*	NM_005121	NP_005112	WXS	Illumina HiSeq	Unspecified	Q9UHV7	MED13_HUMAN			29	6450	-			2125					B2RU05|O60334	Nonsense_Mutation	SNP	ENST00000397786.2	37	c.6373C>T	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	G	47	13.181330	0.99725	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-4.7171	18.9301	0.92561	0.0:0.0:1.0:0.0	.	.	.	.	X	2125;2124	.	ENSP00000262436:Q2124X	Q	-	1	0	MED13	57379079	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.400000	0.97290	2.464000	0.83262	0.467000	0.42956	CAG		0.393	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121		9	164	0	0	0	0.008291	0	9	164				
OTOP3	347741	broad.mit.edu	37	17	72942967	72942967	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:72942967C>T	ENST00000328801.4	+	6	1017	c.1017C>T	c.(1015-1017)ttC>ttT	p.F339F		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	339						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.F339F(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					GGGCCATCTTCGGGCCGCTGC	0.637																																							uc010wrr.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1015-1017)TTC>TTT		otopetrin 3							59.0	62.0	61.0					17																	72942967		2203	4296	6499	SO:0001819	synonymous_variant	347741					integral to membrane|intracellular	zinc ion binding	g.chr17:72942967C>T	BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.1017C>T	17.37:g.72942967C>T			Somatic				OTOP3_uc010wrq.1_Silent_p.F321F	p.F339F	NM_178233	NP_839947	WXS	Illumina HiSeq	Unspecified	Q7RTS5	OTOP3_HUMAN			6	1017	+	all_lung(278;0.151)|Lung NSC(278;0.185)		339			Helical; (Potential).			Silent	SNP	ENST00000328801.4	37	c.1017C>T	CCDS11709.1																																																																																				0.637	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445308.1	NM_178233		18	138	0	0	0	0.007413	0	18	138				
OTOP3	347741	broad.mit.edu	37	17	72943371	72943371	+	Missense_Mutation	SNP	G	G	A	rs149666474	byFrequency	TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:72943371G>A	ENST00000328801.4	+	6	1421	c.1421G>A	c.(1420-1422)cGg>cAg	p.R474Q		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	474						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.R474Q(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					GGCCTGCACCGGCGCCCACTC	0.662																																							uc010wrr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1420-1422)CGG>CAG		otopetrin 3		G	GLN/ARG	0,4406		0,0,2203	32.0	32.0	32.0		1421	3.6	1.0	17	dbSNP_134	32	2,8598	2.2+/-6.3	0,2,4298	no	missense	OTOP3	NM_178233.1	43	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	474/597	72943371	2,13004	2203	4300	6503	SO:0001583	missense	347741					integral to membrane|intracellular	zinc ion binding	g.chr17:72943371G>A	BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.1421G>A	17.37:g.72943371G>A	ENSP00000328090:p.Arg474Gln		Somatic				OTOP3_uc010wrq.1_Missense_Mutation_p.R456Q	p.R474Q	NM_178233	NP_839947	WXS	Illumina HiSeq	Unspecified	Q7RTS5	OTOP3_HUMAN			6	1421	+	all_lung(278;0.151)|Lung NSC(278;0.185)		474						Missense_Mutation	SNP	ENST00000328801.4	37	c.1421G>A	CCDS11709.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306811	0.81247	0.0	2.33E-4	ENSG00000182938	ENST00000328801	T	0.26067	1.76	4.54	3.57	0.40892	.	0.000000	0.64402	D	0.000011	T	0.50633	0.1627	M	0.85777	2.775	0.40337	D	0.978993	D	0.89917	1.0	D	0.74674	0.984	T	0.55547	-0.8124	10	0.87932	D	0	-11.0622	9.0187	0.36186	0.1718:0.0:0.8282:0.0	.	474	Q7RTS5	OTOP3_HUMAN	Q	474	ENSP00000328090:R474Q	ENSP00000328090:R474Q	R	+	2	0	OTOP3	70454966	1.000000	0.71417	0.997000	0.53966	0.960000	0.62799	7.989000	0.88205	0.896000	0.36366	0.462000	0.41574	CGG		0.662	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445308.1	NM_178233		5	31	0	0	0	0.000602	0	5	31				
EVPL	2125	broad.mit.edu	37	17	74004735	74004735	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:74004735C>G	ENST00000301607.3	-	22	4804	c.4551G>C	c.(4549-4551)aaG>aaC	p.K1517N	EVPL_ENST00000586740.1_Missense_Mutation_p.K1539N|TEN1-CDK3_ENST00000567351.1_RNA	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1517	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.K1517N(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						TGTAGATGGTCTTCTCCTGCG	0.602																																							uc002jqi.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|central_nervous_system(1)|skin(1)	4						c.(4549-4551)AAG>AAC		envoplakin							170.0	132.0	145.0					17																	74004735		2203	4300	6503	SO:0001583	missense	2125				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity	g.chr17:74004735C>G	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.4551G>C	17.37:g.74004735C>G	ENSP00000301607:p.Lys1517Asn		Somatic				EVPL_uc010wss.1_Missense_Mutation_p.K1539N|EVPL_uc010wst.1_Missense_Mutation_p.K987N	p.K1517N	NM_001988	NP_001979	WXS	Illumina HiSeq	Unspecified	Q92817	EVPL_HUMAN			22	4779	-			1517			Central fibrous rod domain.		A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	c.4551G>C	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.573086	0.45902	.	.	ENSG00000167880	ENST00000301607	T	0.54071	0.59	4.88	2.89	0.33648	.	0.056025	0.64402	D	0.000002	T	0.68439	0.3001	M	0.81341	2.54	0.40020	D	0.975398	D;D	0.89917	0.999;1.0	D;D	0.71656	0.974;0.963	T	0.68842	-0.5302	10	0.72032	D	0.01	-52.4243	7.6994	0.28613	0.0:0.6728:0.0:0.3272	.	1539;1517	B7ZLH8;Q92817	.;EVPL_HUMAN	N	1517	ENSP00000301607:K1517N	ENSP00000301607:K1517N	K	-	3	2	EVPL	71516330	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.118000	0.41949	0.482000	0.27582	0.561000	0.74099	AAG		0.602	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988		6	111	0	0	0	0.001984	0	6	111				
C17orf70	80233	broad.mit.edu	37	17	79517327	79517327	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr17:79517327C>A	ENST00000327787.8	-	3	1239	c.1193G>T	c.(1192-1194)aGc>aTc	p.S398I	C17orf70_ENST00000425898.2_5'Flank|C17orf70_ENST00000537152.1_Missense_Mutation_p.S247I			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	398					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S247I(1)|p.S398I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GATGTTCAGGCTGGCTGGGCA	0.632																																							uc002kaq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1192-1194)AGC>ATC		Fanconi anemia core complex 100 kDa subunit							63.0	73.0	70.0					17																	79517327		2198	4289	6487	SO:0001583	missense	80233				DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding	g.chr17:79517327C>A	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.1193G>T	17.37:g.79517327C>A	ENSP00000333283:p.Ser398Ile		Somatic				C17orf70_uc002kao.1_5'Flank|C17orf70_uc010wuq.1_RNA|C17orf70_uc002kap.2_Missense_Mutation_p.S247I	p.S398I	NM_001109760	NP_001103230	WXS	Illumina HiSeq	Unspecified	Q0VG06	FP100_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)		3	1248	-	all_neural(118;0.0878)|Melanoma(429;0.242)		398					A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Missense_Mutation	SNP	ENST00000327787.8	37	c.1193G>T	CCDS32765.2	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940035	0.52972	.	.	ENSG00000185504	ENST00000327787;ENST00000537152;ENST00000541246;ENST00000544302	T;T	0.40756	1.02;1.03	4.86	1.72	0.24424	.	0.158655	0.53938	D	0.000055	T	0.47673	0.1458	M	0.65498	2.005	0.42735	D	0.993729	P	0.52061	0.95	P	0.53809	0.735	T	0.43130	-0.9410	10	0.87932	D	0	.	5.2754	0.15647	0.1621:0.6621:0.0:0.1758	.	398	Q0VG06	FP100_HUMAN	I	398;247;247;247	ENSP00000333283:S398I;ENSP00000440151:S247I	ENSP00000333283:S398I	S	-	2	0	C17orf70	77127769	0.974000	0.33945	0.033000	0.17914	0.316000	0.28119	1.766000	0.38491	0.109000	0.17891	-0.136000	0.14681	AGC		0.632	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161		10	155	1	0	0.00136819	0.013537	0.00150501	10	155				
ANKRD30B	374860	broad.mit.edu	37	18	14803745	14803745	+	Missense_Mutation	SNP	A	A	G	rs45533337		TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr18:14803745A>G	ENST00000358984.4	+	24	2386	c.2206A>G	c.(2206-2208)Act>Gct	p.T736A	ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	736										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TTTCCTTGAGACTCTCTTACA	0.289																																							uc010dlo.2		NA																	0				ovary(1)|skin(1)	2						c.(2206-2208)ACT>GCT		ankyrin repeat domain 30B							25.0	22.0	23.0					18																	14803745		688	1579	2267	SO:0001583	missense	374860							g.chr18:14803745A>G	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2206A>G	18.37:g.14803745A>G	ENSP00000351875:p.Thr736Ala		Somatic				ANKRD30B_uc010xak.1_RNA	p.T736A	NM_001145029	NP_001138501	WXS	Illumina HiSeq	Unspecified	Q9BXX2	AN30B_HUMAN			24	2386	+			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.2206A>G	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	5.153	0.213833	0.09810	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.06371	3.31	1.16	1.16	0.20824	.	.	.	.	.	T	0.04861	0.0131	L	0.29908	0.895	0.09310	N	1	B	0.16396	0.017	B	0.08055	0.003	T	0.36817	-0.9732	9	0.87932	D	0	.	4.5782	0.12245	1.0:0.0:0.0:0.0	.	736	F8WAG3	.	A	736;11;4	ENSP00000351875:T736A	ENSP00000277669:T4A	T	+	1	0	ANKRD30B	14793745	0.037000	0.19845	0.001000	0.08648	0.001000	0.01503	1.570000	0.36439	0.807000	0.34208	0.440000	0.28878	ACT		0.289	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		3	16	0	0	0	0.001168	0	3	16				
C18orf8	29919	broad.mit.edu	37	18	21086937	21086937	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr18:21086937G>A	ENST00000269221.3	+	3	293	c.183G>A	c.(181-183)atG>atA	p.M61I	C18orf8_ENST00000590868.1_Missense_Mutation_p.M61I	NM_013326.3	NP_037458.3	Q96DM3	MIC1_HUMAN	chromosome 18 open reading frame 8	61						lysosomal membrane (GO:0005765)		p.M61I(2)		endometrium(9)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	21	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CTTAAAGAATGGATGACAAAG	0.333																																							uc010xax.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(181-183)ATG>ATA		colon cancer-associated protein Mic1							144.0	154.0	151.0					18																	21086937		2203	4300	6503	SO:0001583	missense	29919							g.chr18:21086937G>A	AK057192	CCDS32803.1, CCDS74199.1	18q11.2	2013-12-13			ENSG00000141452	ENSG00000141452			24326	protein-coding gene	gene with protein product	"""colon cancer associated protein Mic1"", ""macrophage inhibitory cytokine 1"""					12477932	Standard	NM_013326		Approved	MIC1, MIC-1, HsT2591	uc021uie.2	Q96DM3		ENST00000269221.3:c.183G>A	18.37:g.21086937G>A	ENSP00000269221:p.Met61Ile		Somatic				C18orf8_uc010xau.1_Intron|C18orf8_uc010xav.1_Missense_Mutation_p.M61I|C18orf8_uc010xaw.1_Intron|C18orf8_uc002kul.2_RNA	p.M61I	NM_013326	NP_037458	WXS	Illumina HiSeq	Unspecified	Q96DM3	MIC1_HUMAN			3	304	+	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)		61					Q9BU17|Q9Y5M0	Missense_Mutation	SNP	ENST00000269221.3	37	c.183G>A	CCDS32803.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744331	0.69418	.	.	ENSG00000141452	ENST00000269221;ENST00000540942	T	0.10573	2.86	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.10809	0.0264	L	0.31207	0.915	0.80722	D	1	B;B	0.31931	0.236;0.347	B;B	0.30782	0.056;0.12	T	0.22521	-1.0214	10	0.22706	T	0.39	-13.811	20.2985	0.98592	0.0:0.0:1.0:0.0	.	61;61	Q96DM3;F5H2W0	MIC1_HUMAN;.	I	61	ENSP00000269221:M61I	ENSP00000269221:M61I	M	+	3	0	C18orf8	19340935	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.119000	0.94362	2.793000	0.96121	0.655000	0.94253	ATG		0.333	C18orf8-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445386.1	NM_013326		37	106	0	0	0	0.005524	0	37	106				
SETBP1	26040	broad.mit.edu	37	18	42643129	42643129	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr18:42643129G>C	ENST00000282030.5	+	6	4553	c.4257G>C	c.(4255-4257)aaG>aaC	p.K1419N		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1419						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K1419N(1)|p.K1365N(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		ACTACACCAAGATCCTGTCCA	0.542									Schinzel-Giedion syndrome																														uc010dni.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(4255-4257)AAG>AAC		SET binding protein 1 isoform a							58.0	54.0	56.0					18																	42643129		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42643129G>C	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4257G>C	18.37:g.42643129G>C	ENSP00000282030:p.Lys1419Asn		Somatic					p.K1419N	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	6	4553	+			1419					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.4257G>C	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686777	0.68157	.	.	ENSG00000152217	ENST00000282030	T	0.76186	-1.0	5.27	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.77322	0.4113	L	0.29908	0.895	0.33485	D	0.587905	D	0.76494	0.999	D	0.83275	0.996	T	0.82259	-0.0546	10	0.87932	D	0	.	10.9248	0.47185	0.1514:0.0:0.8486:0.0	.	1419	Q9Y6X0	SETBP_HUMAN	N	1419	ENSP00000282030:K1419N	ENSP00000282030:K1419N	K	+	3	2	SETBP1	40897127	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.340000	0.52143	2.615000	0.88500	0.563000	0.77884	AAG		0.542	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		3	20	0	0	0	0.004672	0	3	20				
TNFRSF11A	8792	broad.mit.edu	37	18	60036591	60036591	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr18:60036591G>A	ENST00000586569.1	+	9	1479	c.1441G>A	c.(1441-1443)Gaa>Aaa	p.E481K	TNFRSF11A_ENST00000269485.7_Intron	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	481					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)	p.E481K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				CCTTCCCCCTGAAGAAGAAGC	0.662																																							uc002lin.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|lung(1)	3						c.(1441-1443)GAA>AAA		tumor necrosis factor receptor superfamily,							36.0	39.0	38.0					18																	60036591		2095	4124	6219	SO:0001583	missense	8792	Paget_Disease_of_Bone			adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity	g.chr18:60036591G>A	AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.1441G>A	18.37:g.60036591G>A	ENSP00000465500:p.Glu481Lys		Somatic				TNFRSF11A_uc010dpv.2_Intron	p.E481K	NM_003839	NP_003830	WXS	Illumina HiSeq	Unspecified	Q9Y6Q6	TNR11_HUMAN			9	1479	+		Colorectal(73;0.188)	481			Cytoplasmic (Potential).		I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Missense_Mutation	SNP	ENST00000586569.1	37	c.1441G>A	CCDS11980.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812234	0.70797	.	.	ENSG00000141655	ENST00000269485	.	.	.	4.91	4.91	0.64330	.	2.513390	0.00963	N	0.003123	T	0.46190	0.1380	L	0.60455	1.87	0.09310	N	1	P	0.43094	0.799	B	0.38378	0.272	T	0.46062	-0.9218	8	.	.	.	-16.2616	11.9422	0.52907	0.0:0.0:0.8266:0.1734	.	481	Q9Y6Q6	TNR11_HUMAN	K	481	.	.	E	+	1	0	TNFRSF11A	58187571	0.471000	0.25862	0.039000	0.18376	0.166000	0.22503	1.965000	0.40471	2.273000	0.75805	0.563000	0.77884	GAA		0.662	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256186.2			9	69	0	0	0	0.008291	0	9	69				
CD226	10666	broad.mit.edu	37	18	67531647	67531647	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr18:67531647G>C	ENST00000280200.4	-	7	1182	c.914C>G	c.(913-915)tCt>tGt	p.S305C	CD226_ENST00000577287.1_Missense_Mutation_p.S150C|CD226_ENST00000582621.1_Missense_Mutation_p.S305C|CD226_ENST00000581982.1_Missense_Mutation_p.S150C	NM_006566.2	NP_006557.2	Q15762	CD226_HUMAN	CD226 molecule	305					cell adhesion (GO:0007155)|cell recognition (GO:0008037)|cytokine production (GO:0001816)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)	p.S305C(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	24		Esophageal squamous(42;0.129)				TTGACTGGTAGAGATGGGACT	0.383																																					NSCLC(184;838 2130 8673 21498 50749)	NSCLC(184;838 2130 8673 21498 50749)	uc010dqo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(913-915)TCT>TGT		CD226 molecule precursor							224.0	199.0	208.0					18																	67531647		2203	4300	6503	SO:0001583	missense	10666				cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity	g.chr18:67531647G>C	U56102	CCDS11997.1	18q22.3	2013-01-11	2006-03-28		ENSG00000150637	ENSG00000150637		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	16961	protein-coding gene	gene with protein product		605397	"""CD226 antigen"""			8673704	Standard	NM_006566		Approved	DNAM-1, DNAM1, PTA1, TLiSA1	uc002lkm.4	Q15762	OTTHUMG00000132809	ENST00000280200.4:c.914C>G	18.37:g.67531647G>C	ENSP00000280200:p.Ser305Cys		Somatic				CD226_uc002lkm.3_Missense_Mutation_p.S305C	p.S305C	NM_006566	NP_006557	WXS	Illumina HiSeq	Unspecified	Q15762	CD226_HUMAN			6	1361	-		Esophageal squamous(42;0.129)	305			Cytoplasmic (Potential).		B2R818	Missense_Mutation	SNP	ENST00000280200.4	37	c.914C>G	CCDS11997.1	.	.	.	.	.	.	.	.	.	.	G	14.27	2.486804	0.44249	.	.	ENSG00000150637	ENST00000280200	T	0.25085	1.82	5.15	3.36	0.38483	.	1.064320	0.07245	N	0.864895	T	0.27697	0.0681	N	0.14661	0.345	0.09310	N	1	D	0.67145	0.996	P	0.57371	0.819	T	0.23833	-1.0177	10	0.66056	D	0.02	.	7.239	0.26086	0.193:0.0:0.807:0.0	.	305	Q15762	CD226_HUMAN	C	305	ENSP00000280200:S305C	ENSP00000280200:S305C	S	-	2	0	CD226	65682627	0.012000	0.17670	0.007000	0.13788	0.025000	0.11179	1.791000	0.38744	1.552000	0.49463	0.585000	0.79938	TCT		0.383	CD226-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256226.3	NM_006566		4	113	0	0	0	0.009096	0	4	113				
ZNF699	374879	broad.mit.edu	37	19	9407326	9407326	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr19:9407326C>T	ENST00000591998.1	-	6	982	c.754G>A	c.(754-756)Gaa>Aaa	p.E252K	ZNF699_ENST00000308650.3_Missense_Mutation_p.E252K|CTC-325H20.4_ENST00000591336.1_RNA			Q32M78	ZN699_HUMAN	zinc finger protein 699	252					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E252K(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCCTTACATTCATAGGGCTTC	0.418																																							uc002mlc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(754-756)GAA>AAA		zinc finger protein 699							129.0	123.0	125.0					19																	9407326		2029	4197	6226	SO:0001583	missense	374879				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9407326C>T	BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.754G>A	19.37:g.9407326C>T	ENSP00000467723:p.Glu252Lys		Somatic					p.E252K	NM_198535	NP_940937	WXS	Illumina HiSeq	Unspecified	Q32M78	ZN699_HUMAN			5	754	-			252			C2H2-type 3.		Q8N9A1	Missense_Mutation	SNP	ENST00000591998.1	37	c.754G>A	CCDS42495.1	.	.	.	.	.	.	.	.	.	.	c	9.273	1.046265	0.19748	.	.	ENSG00000196110	ENST00000308650	T	0.14266	2.52	3.28	0.686	0.18015	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.791384	0.10424	N	0.676361	T	0.04952	0.0133	N	0.04043	-0.29	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.45702	-0.9243	10	0.12103	T	0.63	.	4.9387	0.13954	0.0:0.6268:0.2025:0.1706	.	252	Q32M78	ZN699_HUMAN	K	252	ENSP00000311596:E252K	ENSP00000311596:E252K	E	-	1	0	ZNF699	9268326	0.000000	0.05858	0.004000	0.12327	0.025000	0.11179	-0.787000	0.04618	0.232000	0.21100	0.550000	0.68814	GAA		0.418	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449010.1	NM_198535		4	159	0	0	0	0.001984	0	4	159				
OR10H3	26532	broad.mit.edu	37	19	15852411	15852411	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr19:15852411C>G	ENST00000305892.1	+	1	209	c.209C>G	c.(208-210)tCt>tGt	p.S70C		NM_013938.1	NP_039226.1	O60404	O10H3_HUMAN	olfactory receptor, family 10, subfamily H, member 3	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S70C(1)		cervix(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						CTCTCCATCTCTGAGATTCTG	0.502																																							uc010xoq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(208-210)TCT>TGT		olfactory receptor, family 10, subfamily H,							474.0	414.0	434.0					19																	15852411		2203	4300	6503	SO:0001583	missense	26532				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:15852411C>G		CCDS12334.1	19p13.1	2012-08-09				ENSG00000171936		"""GPCR / Class A : Olfactory receptors"""	8174	protein-coding gene	gene with protein product							Standard	NM_013938		Approved		uc010xoq.2	O60404		ENST00000305892.1:c.209C>G	19.37:g.15852411C>G	ENSP00000307130:p.Ser70Cys		Somatic					p.S70C	NM_013938	NP_039226	WXS	Illumina HiSeq	Unspecified	O60404	O10H3_HUMAN			1	209	+			70			Helical; Name=2; (Potential).		Q2HIZ3|Q6IFQ0	Missense_Mutation	SNP	ENST00000305892.1	37	c.209C>G	CCDS12334.1	.	.	.	.	.	.	.	.	.	.	.	11.88	1.770817	0.31320	.	.	ENSG00000171936	ENST00000305892	T	0.03004	4.08	2.35	1.29	0.21616	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39834	U	0.001256	T	0.09686	0.0238	L	0.58354	1.805	0.09310	N	1	D	0.89917	1.0	D	0.72338	0.977	T	0.05370	-1.0889	10	0.62326	D	0.03	.	3.7208	0.08456	0.0:0.6422:0.0:0.3578	.	70	O60404	O10H3_HUMAN	C	70	ENSP00000307130:S70C	ENSP00000307130:S70C	S	+	2	0	OR10H3	15713411	0.000000	0.05858	0.954000	0.39281	0.610000	0.37248	0.430000	0.21428	1.320000	0.45209	0.185000	0.17295	TCT		0.502	OR10H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460918.1			20	230	0	0	0	0.008871	0	20	230				
MYO9B	4650	broad.mit.edu	37	19	17264843	17264843	+	Silent	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr19:17264843C>G	ENST00000594824.1	+	5	1212	c.1065C>G	c.(1063-1065)ctC>ctG	p.L355L	CTD-3032J10.2_ENST00000599360.1_RNA|CTD-3032J10.2_ENST00000597216.1_RNA|MYO9B_ENST00000397274.2_Silent_p.L355L|MYO9B_ENST00000595618.1_Silent_p.L355L			Q13459	MYO9B_HUMAN	myosin IXB	355	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.L355L(2)		breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						AATTTCAGCTCAAGCAGCCTG	0.453																																							uc010eak.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(1)	1						c.(1063-1065)CTC>CTG		myosin IXB isoform 1							115.0	116.0	116.0					19																	17264843		1935	4133	6068	SO:0001819	synonymous_variant	4650				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity	g.chr19:17264843C>G		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.1065C>G	19.37:g.17264843C>G			Somatic				MYO9B_uc002nfi.2_Silent_p.L355L|MYO9B_uc002nfj.1_Silent_p.L355L	p.L355L	NM_004145	NP_004136	WXS	Illumina HiSeq	Unspecified	Q13459	MYO9B_HUMAN			5	1217	+			355			Myosin head-like.		O75314|Q9NUJ2|Q9UHN0	Silent	SNP	ENST00000594824.1	37	c.1065C>G																																																																																					0.453	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1			4	69	0	0	0	0.000602	0	4	69				
RYR1	6261	broad.mit.edu	37	19	39018359	39018359	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr19:39018359G>A	ENST00000359596.3	+	73	10759	c.10759G>A	c.(10759-10761)Gat>Aat	p.D3587N	RYR1_ENST00000360985.3_Missense_Mutation_p.D3587N|AC067969.1_ENST00000597015.1_RNA|RYR1_ENST00000355481.4_Missense_Mutation_p.D3582N			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3587					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.D3587N(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGAGGACGCCGATGACCCCGA	0.652																																							uc002oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(10759-10761)GAT>AAT		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						45.0	47.0	47.0					19																	39018359		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:39018359G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10759G>A	19.37:g.39018359G>A	ENSP00000352608:p.Asp3587Asn		Somatic				RYR1_uc002oiu.2_Missense_Mutation_p.D3582N|RYR1_uc002oiv.1_Missense_Mutation_p.D502N|RYR1_uc010xuf.1_Missense_Mutation_p.D507N	p.D3587N	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		73	10889	+	all_cancers(60;7.91e-06)		3587					Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.10759G>A	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461131	0.26248	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.96716	-4.1;-4.1;-4.1	4.55	4.55	0.56014	.	0.246291	0.31177	U	0.008107	D	0.91290	0.7254	L	0.32530	0.975	0.31209	N	0.698815	B;B;B	0.18013	0.025;0.025;0.014	B;B;B	0.12156	0.007;0.007;0.003	D	0.85713	0.1320	10	0.28530	T	0.3	.	6.7734	0.23607	0.1932:0.0:0.8068:0.0	.	3587;3582;3587	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	N	3587;3582;3587;507	ENSP00000352608:D3587N;ENSP00000347667:D3582N;ENSP00000354254:D3587N	ENSP00000347667:D3582N	D	+	1	0	RYR1	43710199	0.973000	0.33851	1.000000	0.80357	0.292000	0.27327	2.943000	0.49026	2.355000	0.79922	0.313000	0.20887	GAT		0.652	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			5	59	0	0	0	0.000602	0	5	59				
EIF3K	27335	broad.mit.edu	37	19	39123104	39123104	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr19:39123104G>C	ENST00000538434.1	+	4	363	c.128G>C	c.(127-129)gGt>gCt	p.G43A	EIF3K_ENST00000593149.1_Missense_Mutation_p.G43A|EIF3K_ENST00000545173.2_Missense_Mutation_p.G130A|EIF3K_ENST00000588934.1_Intron|EIF3K_ENST00000248342.4_Missense_Mutation_p.G130A|EIF3K_ENST00000592558.1_Missense_Mutation_p.G130A					eukaryotic translation initiation factor 3, subunit K									p.G130A(1)	EIF3K/CYP39A1(2)	central_nervous_system(1)|endometrium(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CTCTTGGAAGGTATAACTGGC	0.458																																							uc002oiz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(388-390)GGT>GCT		eukaryotic translation initiation factor 3,							123.0	126.0	125.0					19																	39123104		2203	4300	6503	SO:0001583	missense	27335				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex|nucleus	protein binding|ribosome binding|translation initiation factor activity	g.chr19:39123104G>C	AB019392	CCDS12517.1, CCDS74360.1	19q13.2	2012-05-28	2007-07-27	2007-07-27	ENSG00000178982	ENSG00000178982			24656	protein-coding gene	gene with protein product		609596	"""eukaryotic translation initiation factor 3, subunit 12"""	EIF3S12		11042152, 14519125	Standard	XM_006723147		Approved	eIF3k, PRO1474, HSPC029, PTD001, PLAC-24, M9, ARG134	uc002oiz.1	Q9UBQ5		ENST00000538434.1:c.128G>C	19.37:g.39123104G>C	ENSP00000440999:p.Gly43Ala		Somatic				EIF3K_uc010xuh.1_Missense_Mutation_p.G130A|EIF3K_uc010xui.1_Missense_Mutation_p.G43A	p.G130A	NM_013234	NP_037366	WXS	Illumina HiSeq	Unspecified	Q9UBQ5	EIF3K_HUMAN	Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)		5	576	+	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		130						Missense_Mutation	SNP	ENST00000538434.1	37	c.389G>C		.	.	.	.	.	.	.	.	.	.	G	25.3	4.621417	0.87460	.	.	ENSG00000178982	ENST00000248342;ENST00000538434;ENST00000545173	.	.	.	5.39	5.39	0.77823	Winged helix-turn-helix transcription repressor DNA-binding (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65196	0.2668	N	0.17723	0.515	0.80722	D	1	D;B;B	0.76494	0.999;0.11;0.11	D;B;B	0.85130	0.997;0.021;0.021	T	0.69932	-0.5011	9	0.87932	D	0	-17.1781	18.2945	0.90140	0.0:0.0:1.0:0.0	.	43;130;130	B4DQ48;B7ZAM9;Q9UBQ5	.;.;EIF3K_HUMAN	A	130;43;130	.	ENSP00000248342:G130A	G	+	2	0	EIF3K	43814944	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.803000	0.91915	2.688000	0.91661	0.563000	0.77884	GGT		0.458	EIF3K-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000453409.1	NM_013234		12	162	0	0	0	0.00245	0	12	162				
ZC3H4	23211	broad.mit.edu	37	19	47597768	47597768	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr19:47597768C>T	ENST00000253048.5	-	3	296	c.259G>A	c.(259-261)Ggg>Agg	p.G87R	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	87							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.G87R(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		TGCTTCTCCCCCTTTTCTTTC	0.522																																							uc002pga.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(2)	6						c.(259-261)GGG>AGG		zinc finger CCCH-type containing 4							296.0	301.0	300.0					19																	47597768		1945	4122	6067	SO:0001583	missense	23211						nucleic acid binding|zinc ion binding	g.chr19:47597768C>T	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.259G>A	19.37:g.47597768C>T	ENSP00000253048:p.Gly87Arg		Somatic				ZC3H4_uc002pgb.1_RNA	p.G87R	NM_015168	NP_055983	WXS	Illumina HiSeq	Unspecified	Q9UPT8	ZC3H4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)	3	297	-		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)	87					Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	c.259G>A	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155846	0.57259	.	.	ENSG00000130749	ENST00000253048	T	0.17854	2.25	6.05	5.02	0.67125	.	0.547849	0.18052	N	0.153227	T	0.19127	0.0459	N	0.19112	0.55	0.36558	D	0.872247	D	0.63880	0.993	P	0.56343	0.796	T	0.13575	-1.0504	10	0.44086	T	0.13	.	8.2034	0.31438	0.0:0.7693:0.0:0.2307	.	87	Q9UPT8	ZC3H4_HUMAN	R	87	ENSP00000253048:G87R	ENSP00000253048:G87R	G	-	1	0	ZC3H4	52289608	0.751000	0.28327	0.998000	0.56505	0.764000	0.43329	1.511000	0.35801	1.551000	0.49450	0.650000	0.86243	GGG		0.522	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1			23	246	0	0	0	0.012319	0	23	246				
KLK1	3816	broad.mit.edu	37	19	51323577	51323577	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr19:51323577G>A	ENST00000301420.2	-	3	364	c.329C>T	c.(328-330)aCc>aTc	p.T110I	KLK1_ENST00000448701.2_Missense_Mutation_p.T8I|CTD-2568A17.5_ENST00000326989.5_lincRNA	NM_002257.2	NP_002248.1	P06870	KLK1_HUMAN	kallikrein 1	110	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)	p.T110I(1)		breast(1)|large_intestine(4)|lung(7)|urinary_tract(1)	13		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Aprotinin(DB06692)	TGCTTGGCGGGTGTGGTTCTC	0.562																																							uc002ptk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(328-330)ACC>ATC		kallikrein 1 preproprotein	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						191.0	163.0	172.0					19																	51323577		2203	4300	6503	SO:0001583	missense	3816				proteolysis	nucleus	serine-type endopeptidase activity	g.chr19:51323577G>A	L10038	CCDS12804.1	19q13.3	2008-02-05	2006-10-27			ENSG00000167748	3.4.21.35	"""Kallikreins"""	6357	protein-coding gene	gene with protein product		147910	"""kallikrein 1, renal/pancreas/salivary"""			1684954, 16800724, 16800723	Standard	NM_002257		Approved	Klk6	uc002ptk.1	P06870		ENST00000301420.2:c.329C>T	19.37:g.51323577G>A	ENSP00000301420:p.Thr110Ile		Somatic				KLK1_uc010ycg.1_RNA	p.T110I	NM_002257	NP_002248	WXS	Illumina HiSeq	Unspecified	P06870	KLK1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	3	368	-		all_neural(266;0.0199)	110			Peptidase S1.		Q66US9|Q86U61|Q8TCV8|Q9BS53|Q9NQU4|Q9UD19|Q9UMJ1	Missense_Mutation	SNP	ENST00000301420.2	37	c.329C>T	CCDS12804.1	.	.	.	.	.	.	.	.	.	.	g	9.252	1.040883	0.19669	.	.	ENSG00000167748	ENST00000301420;ENST00000448701	T;D	0.88896	3.32;-2.44	2.63	1.56	0.23342	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.71986	0.3405	N	0.03608	-0.345	0.09310	N	1	B	0.19200	0.034	B	0.15870	0.014	T	0.59963	-0.7355	9	0.25106	T	0.35	.	6.7098	0.23270	0.0:0.0:0.7186:0.2814	.	110	P06870	KLK1_HUMAN	I	110;8	ENSP00000301420:T110I;ENSP00000400994:T8I	ENSP00000301420:T110I	T	-	2	0	KLK1	56015389	0.020000	0.18652	0.007000	0.13788	0.286000	0.27126	-0.566000	0.05922	0.657000	0.30906	0.306000	0.20318	ACC		0.562	KLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464135.2	NM_002257		15	91	0	0	0	0.003163	0	15	91				
ZNF582	147948	broad.mit.edu	37	19	56895542	56895542	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr19:56895542C>G	ENST00000301310.4	-	5	1402	c.1244G>C	c.(1243-1245)aGa>aCa	p.R415T	ZNF582_ENST00000586929.1_Missense_Mutation_p.R415T	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	415					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R415T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TGTATGAATTCTGTAATGTAC	0.403																																					Ovarian(183;1887 2032 4349 30507 51343)	Ovarian(183;1887 2032 4349 30507 51343)	uc002qmz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(1243-1245)AGA>ACA		zinc finger protein 582							106.0	103.0	104.0					19																	56895542		2203	4300	6503	SO:0001583	missense	147948				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:56895542C>G	AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.1244G>C	19.37:g.56895542C>G	ENSP00000301310:p.Arg415Thr		Somatic				ZNF582_uc002qmy.2_Missense_Mutation_p.R446T	p.R415T	NM_144690	NP_653291	WXS	Illumina HiSeq	Unspecified	Q96NG8	ZN582_HUMAN		GBM - Glioblastoma multiforme(193;0.0547)	5	1403	-		Colorectal(82;0.000256)|Ovarian(87;0.243)	415			C2H2-type 9.		B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	ENST00000301310.4	37	c.1244G>C	CCDS33121.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.505307	0.64410	.	.	ENSG00000018869	ENST00000301310	T	0.25414	1.8	4.37	4.37	0.52481	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38778	N	0.001563	T	0.41971	0.1182	M	0.62088	1.915	0.25634	N	0.986277	D;D	0.71674	0.998;0.994	D;P	0.62955	0.909;0.888	T	0.19484	-1.0304	10	0.62326	D	0.03	.	9.9155	0.41432	0.0:0.9046:0.0:0.0954	.	415;446	Q96NG8;B4DQZ9	ZN582_HUMAN;.	T	415	ENSP00000301310:R415T	ENSP00000301310:R415T	R	-	2	0	ZNF582	61587354	0.000000	0.05858	0.041000	0.18516	0.019000	0.09904	0.618000	0.24373	2.432000	0.82394	0.655000	0.94253	AGA		0.403	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690		8	84	0	0	0	0.004482	0	8	84				
NBAS	51594	broad.mit.edu	37	2	15629148	15629148	+	Splice_Site	SNP	T	T	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr2:15629148T>A	ENST00000281513.5	-	12	980		c.e12-2		NBAS_ENST00000441750.1_Splice_Site	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence						negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.?(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						AATTCCATCCTAAATAAGAAT	0.408																																							uc002rcc.1		NA																	1	Unknown(1)		lung(1)	ovary(2)|liver(1)|skin(1)	4						c.e12-1		neuroblastoma-amplified protein							67.0	63.0	64.0					2																	15629148		2203	4300	6503	SO:0001630	splice_region_variant	51594							g.chr2:15629148T>A	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.955-2A>T	2.37:g.15629148T>A			Somatic				NBAS_uc002rcd.1_Splice_Site	p.D319_splice	NM_015909	NP_056993	WXS	Illumina HiSeq	Unspecified	A2RRP1	NBAS_HUMAN			12	981	-								O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Splice_Site	SNP	ENST00000281513.5	37	c.955_splice	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	T	12.81	2.050040	0.36181	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2378	0.82389	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NBAS	15546599	1.000000	0.71417	0.944000	0.38274	0.077000	0.17291	6.326000	0.72905	2.317000	0.78254	0.459000	0.35465	.		0.408	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	Intron	7	57	0	0	0	0.004482	0	7	57				
C2orf16	84226	broad.mit.edu	37	2	27802858	27802858	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr2:27802858C>T	ENST00000408964.2	+	1	3470	c.3419C>T	c.(3418-3420)tCg>tTg	p.S1140L	AC074091.1_ENST00000408604.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1140						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.S1140L(2)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					CAGACCACTTCGGGGCCTTAT	0.488																																							uc002rkz.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)	1						c.(3418-3420)TCG>TTG		hypothetical protein LOC84226							110.0	111.0	110.0					2																	27802858		1974	4166	6140	SO:0001583	missense	84226							g.chr2:27802858C>T	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.3419C>T	2.37:g.27802858C>T	ENSP00000386190:p.Ser1140Leu		Somatic					p.S1140L	NM_032266	NP_115642	WXS	Illumina HiSeq	Unspecified	Q68DN1	CB016_HUMAN			1	3470	+	Acute lymphoblastic leukemia(172;0.155)		1140					B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	37	c.3419C>T	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	C	10.99	1.507191	0.27036	.	.	ENSG00000221843	ENST00000408964	T	0.04454	3.62	5.36	-2.81	0.05805	.	.	.	.	.	T	0.02047	0.0064	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45702	-0.9243	9	0.52906	T	0.07	.	0.3042	0.00278	0.2843:0.1715:0.1466:0.3976	.	1140	Q68DN1	CB016_HUMAN	L	1140	ENSP00000386190:S1140L	ENSP00000386190:S1140L	S	+	2	0	C2orf16	27656362	0.003000	0.15002	0.013000	0.15412	0.614000	0.37383	0.143000	0.16115	-0.250000	0.09555	-0.691000	0.03719	TCG		0.488	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266		9	146	0	0	0	0.006214	0	9	146				
LRP1B	53353	broad.mit.edu	37	2	141092095	141092095	+	Silent	SNP	G	G	A	rs145423213	byFrequency	TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr2:141092095G>A	ENST00000389484.3	-	79	13121	c.12150C>T	c.(12148-12150)tcC>tcT	p.S4050S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4050					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.S4050S(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTTCTATATGGGAATGATCCC	0.458										TSP Lung(27;0.18)			g|||	2	0.000399361	0.0	0.0	5008	,	,		16903	0.002		0.0	False		,,,				2504	0.0				Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(12148-12150)TCC>TCT		low density lipoprotein-related protein 1B							169.0	152.0	158.0					2																	141092095		2203	4300	6503	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141092095G>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12150C>T	2.37:g.141092095G>A		TSP Lung(27;0.18)	Somatic					p.S4050S	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	79	13122	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4050			Extracellular (Potential).|LDL-receptor class B 35.		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.12150C>T	CCDS2182.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	g	3.659	-0.069875	0.07228	.	.	ENSG00000168702	ENST00000437977	.	.	.	6.08	-0.539	0.11865	.	.	.	.	.	T	0.52273	0.1724	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42565	-0.9444	4	.	.	.	.	7.0763	0.25207	0.4401:0.0:0.4492:0.1107	.	.	.	.	L	282	.	.	P	-	2	0	LRP1B	140808565	0.760000	0.28428	0.997000	0.53966	0.255000	0.26057	-0.022000	0.12480	-0.038000	0.13624	-0.941000	0.02677	CCC		0.458	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		17	121	0	0	0	0.007413	0	17	121				
TTN	7273	broad.mit.edu	37	2	179418768	179418768	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr2:179418768G>T	ENST00000591111.1	-	283	84371	c.84147C>A	c.(84145-84147)gaC>gaA	p.D28049E	TTN_ENST00000589042.1_Missense_Mutation_p.D29690E|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D20817E|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D27122E|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D20750E|TTN_ENST00000460472.2_Missense_Mutation_p.D20625E|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28049	Fibronectin type-III 104. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.D20817E(1)|p.D20750E(1)|p.D27120E(1)|p.D20625E(1)|p.D27122E(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGTCTGGTGTCACGGATAG	0.418																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(81364-81366)GAC>GAA		titin isoform N2-A							182.0	179.0	180.0					2																	179418768		1890	4121	6011	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179418768G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.84147C>A	2.37:g.179418768G>T	ENSP00000465570:p.Asp28049Glu		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D20817E|TTN_uc010zfi.1_Missense_Mutation_p.D20750E|TTN_uc010zfj.1_Missense_Mutation_p.D20625E	p.D27122E	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		282	81590	-			28049					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.81366C>A		.	.	.	.	.	.	.	.	.	.	G	17.29	3.352054	0.61183	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.61	4.73	0.59995	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54319	0.1851	N	0.25380	0.74	0.44295	D	0.997168	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.58645	-0.7600	9	0.87932	D	0	.	11.5566	0.50752	0.1425:0.0:0.8575:0.0	.	20625;20750;20817;28049	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	27122;20625;20817;20750;20622	ENSP00000343764:D27122E;ENSP00000434586:D20625E;ENSP00000340554:D20817E;ENSP00000352154:D20750E	ENSP00000340554:D20817E	D	-	3	2	TTN	179127014	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.909000	0.48758	1.502000	0.48669	0.655000	0.94253	GAC		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		43	107	1	0	5.2432e-18	0.01441	6.17949e-18	43	107				
TTN	7273	broad.mit.edu	37	2	179429186	179429186	+	Missense_Mutation	SNP	C	C	T	rs375211424		TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr2:179429186C>T	ENST00000591111.1	-	276	76974	c.76750G>A	c.(76750-76752)Gta>Ata	p.V25584I	TTN_ENST00000589042.1_Missense_Mutation_p.V27225I|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V18352I|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V24657I|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V18285I|TTN_ENST00000460472.2_Missense_Mutation_p.V18160I|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25584	Fibronectin type-III 86. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V18160I(1)|p.V24657I(1)|p.V18352I(1)|p.V18285I(1)|p.V24655I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTCTAATACGTTGGTAAAG	0.383													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22092	0.0		0.0	False		,,,				2504	0.0						uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(73969-73971)GTA>ATA		titin isoform N2-A		C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,3702		0,0,1851	67.0	62.0	63.0		54478,73969,54853,55054	6.2	1.0	2		63	1,8193		0,1,4096	no	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	29,29,29,29	0,1,5947	TT,TC,CC		0.0122,0.0,0.0084	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	18160/26927,24657/33424,18285/27052,18352/27119	179429186	1,11895	1851	4097	5948	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179429186C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76750G>A	2.37:g.179429186C>T	ENSP00000465570:p.Val25584Ile		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V18352I|TTN_uc010zfi.1_Missense_Mutation_p.V18285I|TTN_uc010zfj.1_Missense_Mutation_p.V18160I	p.V24657I	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	74193	-			25584					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.73969G>A		.	.	.	.	.	.	.	.	.	.	C	13.11	2.139278	0.37728	0.0	1.22E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	6.16	6.16	0.99307	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.42449	0.1203	N	0.21142	0.635	0.49687	D	0.999815	P;P;P;P	0.37083	0.581;0.581;0.581;0.581	B;B;B;B	0.30782	0.12;0.12;0.12;0.12	T	0.44251	-0.9340	9	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	18160;18285;18352;25584	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	24657;18160;18352;18285;18158	ENSP00000343764:V24657I;ENSP00000434586:V18160I;ENSP00000340554:V18352I;ENSP00000352154:V18285I	ENSP00000340554:V18352I	V	-	1	0	TTN	179137432	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	4.850000	0.62889	2.937000	0.99478	0.650000	0.86243	GTA		0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	15	0	0	0	0.009096	0	4	15				
TNS1	7145	broad.mit.edu	37	2	218712545	218712545	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr2:218712545C>T	ENST00000171887.4	-	17	2772	c.2320G>A	c.(2320-2322)Gga>Aga	p.G774R	TNS1_ENST00000419504.1_Missense_Mutation_p.G774R|TNS1_ENST00000480665.1_5'Flank|TNS1_ENST00000430930.1_Missense_Mutation_p.G774R	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	774					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.G774R(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TCAGGGGTTCCCAACGAATGC	0.597																																							uc002vgt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(2320-2322)GGA>AGA		tensin							28.0	30.0	29.0					2																	218712545		2201	4300	6501	SO:0001583	missense	7145					cytoplasm|cytoskeleton|focal adhesion	actin binding	g.chr2:218712545C>T	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.2320G>A	2.37:g.218712545C>T	ENSP00000171887:p.Gly774Arg		Somatic				TNS1_uc002vgr.2_Missense_Mutation_p.G774R|TNS1_uc002vgs.2_Missense_Mutation_p.G774R|TNS1_uc010zjv.1_Missense_Mutation_p.G774R|TNS1_uc010fvj.1_Missense_Mutation_p.G842R|TNS1_uc010fvk.1_Missense_Mutation_p.G899R|TNS1_uc010fvi.1_Missense_Mutation_p.G461R	p.G774R	NM_022648	NP_072174	WXS	Illumina HiSeq	Unspecified	Q9HBL0	TENS1_HUMAN		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)	17	2718	-		Renal(207;0.0483)|Lung NSC(271;0.213)	774					Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	c.2320G>A	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	C	10.35	1.325672	0.24080	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930	D;D;D	0.91843	-2.87;-2.92;-2.89	4.0	4.0	0.46444	.	12.146400	0.00166	N	0.000000	D	0.93959	0.8066	L	0.29908	0.895	0.19300	N	0.999979	D;P;D;D;D	0.71674	0.998;0.949;0.993;0.986;0.993	P;B;P;P;P	0.62649	0.905;0.416;0.855;0.708;0.855	D	0.85549	0.1220	10	0.44086	T	0.13	.	15.0424	0.71803	0.0:1.0:0.0:0.0	.	774;828;774;774;774	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	R	774	ENSP00000171887:G774R;ENSP00000408724:G774R;ENSP00000406016:G774R	ENSP00000171887:G774R	G	-	1	0	TNS1	218420790	0.688000	0.27680	0.315000	0.25238	0.210000	0.24377	3.287000	0.51732	2.054000	0.61138	0.462000	0.41574	GGA		0.597	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648		7	36	0	0	0	0.001984	0	7	36				
DNPEP	23549	broad.mit.edu	37	2	220239731	220239731	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr2:220239731C>T	ENST00000273075.4	-	14	1473	c.1253G>A	c.(1252-1254)cGg>cAg	p.R418Q	DNPEP_ENST00000523282.1_Missense_Mutation_p.R426Q|DNPEP_ENST00000490371.1_5'UTR|DNPEP_ENST00000373972.1_Missense_Mutation_p.R343Q	NM_012100.2	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	408					peptide metabolic process (GO:0006518)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R418Q(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGTGTCATTCCGGACCATGAG	0.572																																							uc010zlg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1276-1278)CGG>CAG		aspartyl aminopeptidase	L-Glutamic Acid(DB00142)						58.0	61.0	60.0					2																	220239731		1988	4186	6174	SO:0001583	missense	23549				peptide metabolic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding	g.chr2:220239731C>T		CCDS42823.1	2q36.1	2008-05-22			ENSG00000123992	ENSG00000123992			2981	protein-coding gene	gene with protein product		611367				9632644	Standard	NM_012100		Approved	DAP, ASPEP	uc002vle.2	Q9ULA0	OTTHUMG00000058919	ENST00000273075.4:c.1253G>A	2.37:g.220239731C>T	ENSP00000273075:p.Arg418Gln		Somatic				DNPEP_uc010zlf.1_RNA|DNPEP_uc002vle.2_Missense_Mutation_p.R418Q|DNPEP_uc002vlf.1_Missense_Mutation_p.R404Q|DNPEP_uc002vlh.2_Missense_Mutation_p.R365Q|DNPEP_uc002vli.1_Missense_Mutation_p.R365Q	p.R426Q	NM_012100	NP_036232	WXS	Illumina HiSeq	Unspecified	Q9ULA0	DNPEP_HUMAN		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	14	1359	-		Renal(207;0.0474)	408					Q9BW44|Q9NUV5	Missense_Mutation	SNP	ENST00000273075.4	37	c.1277G>A	CCDS42823.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.173652|5.173652	0.94807|0.94807	.|.	.|.	ENSG00000123992|ENSG00000123992	ENST00000337010|ENST00000273075;ENST00000373972;ENST00000523282;ENST00000535056	.|.	.|.	.|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.87176|0.87176	0.6112|0.6112	H|H	0.95504|0.95504	3.68|3.68	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;0.999;1.0;0.999	.|D;D;P;D	.|0.66196	.|0.942;0.942;0.893;0.942	D|D	0.90538|0.90538	0.4500|0.4500	6|9	0.02654|0.87932	T|D	1|0	-23.7686|-23.7686	19.3333|19.3333	0.94303|0.94303	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|426;426;408;418	.|E7ETB3;B7Z7F0;Q9ULA0;Q53SB6	.|.;.;DNPEP_HUMAN;.	R|Q	418|418;343;426;311	.|.	ENSP00000337776:G418R|ENSP00000273075:R418Q	G|R	-|-	1|2	0|0	DNPEP|DNPEP	219947975|219947975	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	5.683000|5.683000	0.68189|0.68189	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GGA|CGG		0.572	DNPEP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000130212.1	NM_012100		3	43	0	0	0	0.004672	0	3	43				
PAX1	5075	broad.mit.edu	37	20	21689309	21689309	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr20:21689309G>T	ENST00000398485.2	+	3	1084	c.1030G>T	c.(1030-1032)Gcc>Tcc	p.A344S	PAX1_ENST00000460221.1_3'UTR|PAX1_ENST00000444366.2_Missense_Mutation_p.A320S	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	344					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A250S(1)|p.A344S(1)		autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						AGAGAAACCTGCCTTAGAGGC	0.572																																							uc002wsj.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|kidney(1)	2						c.(1030-1032)GCC>TCC		paired box 1							33.0	37.0	36.0					20																	21689309		2202	4300	6502	SO:0001583	missense	5075				regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding	g.chr20:21689309G>T		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.1030G>T	20.37:g.21689309G>T	ENSP00000381499:p.Ala344Ser		Somatic				PAX1_uc010zsl.1_Missense_Mutation_p.A344S|PAX1_uc010zsm.1_Missense_Mutation_p.A320S	p.A344S	NM_006192	NP_006183	WXS	Illumina HiSeq	Unspecified	P15863	PAX1_HUMAN			3	1084	+			344					B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	c.1030G>T	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	G	10.66	1.412050	0.25465	.	.	ENSG00000125813	ENST00000398485;ENST00000444366	D;D	0.98207	-4.31;-4.79	5.42	3.44	0.39384	.	0.178126	0.48286	D	0.000195	D	0.93552	0.7942	N	0.19112	0.55	0.27235	N	0.959298	B;B;B	0.25772	0.02;0.038;0.134	B;B;B	0.21708	0.036;0.006;0.03	D	0.86256	0.1652	10	0.22109	T	0.4	.	7.8236	0.29303	0.1488:0.1357:0.7156:0.0	.	320;250;344	P15863-2;C9J775;P15863	.;.;PAX1_HUMAN	S	344;320	ENSP00000381499:A344S;ENSP00000410355:A320S	ENSP00000381499:A344S	A	+	1	0	PAX1	21637309	0.697000	0.27767	0.990000	0.47175	0.372000	0.29890	1.907000	0.39897	0.639000	0.30564	0.462000	0.41574	GCC		0.572	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3			11	38	1	0	3.07112e-06	0.010729	3.51899e-06	11	38				
CST5	1473	broad.mit.edu	37	20	23858166	23858166	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr20:23858166G>T	ENST00000304710.4	-	2	394	c.321C>A	c.(319-321)ttC>ttA	p.F107L		NM_001900.4	NP_001891.2	P28325	CYTD_HUMAN	cystatin D	107					negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.F107L(1)		breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11						GCTGGTCATTGAAGGGACAGT	0.517																																							uc002wtr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(319-321)TTC>TTA		cystatin D precursor							240.0	182.0	202.0					20																	23858166		2203	4300	6503	SO:0001583	missense	1473					extracellular region	cysteine-type endopeptidase inhibitor activity|protein binding	g.chr20:23858166G>T		CCDS13162.1	20p11.21	2008-04-15			ENSG00000170367	ENSG00000170367			2477	protein-coding gene	gene with protein product		123858				1939105	Standard	NM_001900		Approved		uc002wtr.1	P28325	OTTHUMG00000032089	ENST00000304710.4:c.321C>A	20.37:g.23858166G>T	ENSP00000307132:p.Phe107Leu		Somatic					p.F107L	NM_001900	NP_001891	WXS	Illumina HiSeq	Unspecified	P28325	CYTD_HUMAN			2	388	-			107					Q5JRF5|Q9UCA0	Missense_Mutation	SNP	ENST00000304710.4	37	c.321C>A	CCDS13162.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507865	0.27036	.	.	ENSG00000170367	ENST00000304710	T	0.23950	1.88	2.56	-0.77	0.11005	Proteinase inhibitor I25, cystatin (2);	0.278605	0.33916	U	0.004425	T	0.12561	0.0305	L	0.41079	1.255	0.09310	N	0.999992	P	0.35527	0.507	B	0.33254	0.16	T	0.21075	-1.0256	10	0.11182	T	0.66	.	2.822	0.05474	0.3169:0.2486:0.4345:0.0	.	107	P28325	CYTD_HUMAN	L	107	ENSP00000307132:F107L	ENSP00000307132:F107L	F	-	3	2	CST5	23806166	0.113000	0.22115	0.036000	0.18154	0.199000	0.23934	0.209000	0.17435	-0.004000	0.14419	0.462000	0.41574	TTC		0.517	CST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078355.2	NM_001900		10	84	1	0	1.5842e-08	0.001855	1.85385e-08	10	84				
ZGPAT	84619	broad.mit.edu	37	20	62365055	62365055	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr20:62365055G>C	ENST00000328969.5	+	4	962	c.835G>C	c.(835-837)Gac>Cac	p.D279H	ZGPAT_ENST00000448100.2_Missense_Mutation_p.D279H|ZGPAT_ENST00000355969.6_Missense_Mutation_p.D279H|RP4-583P15.15_ENST00000490623.2_Missense_Mutation_p.Q184H|ZGPAT_ENST00000478385.1_3'UTR|ZGPAT_ENST00000357119.4_Missense_Mutation_p.D279H|ZGPAT_ENST00000369967.3_Missense_Mutation_p.D279H|LIME1_ENST00000309546.3_5'Flank	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	279					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D279H(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GTCCGACTCAGACAGCGACGG	0.652																																							uc002ygk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(835-837)GAC>CAC		zinc finger, CCCH-type with G patch domain							87.0	85.0	85.0					20																	62365055		2203	4300	6503	SO:0001583	missense	84619				negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:62365055G>C	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.835G>C	20.37:g.62365055G>C	ENSP00000332013:p.Asp279His		Somatic				ZGPAT_uc002ygi.2_Missense_Mutation_p.D279H|ZGPAT_uc002ygj.2_Missense_Mutation_p.D279H|ZGPAT_uc010gkk.1_Intron|ZGPAT_uc010gkl.1_Missense_Mutation_p.D279H|ZGPAT_uc002ygm.2_Missense_Mutation_p.D279H|ZGPAT_uc002ygn.3_RNA|LIME1_uc011abi.1_5'Flank|LIME1_uc002ygp.3_5'Flank	p.D279H	NM_032527	NP_115916	WXS	Illumina HiSeq	Unspecified	Q8N5A5	ZGPAT_HUMAN			4	1013	+	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)		279					E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Missense_Mutation	SNP	ENST00000328969.5	37	c.835G>C	CCDS13534.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.836729	0.91117	.	.	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000369967;ENST00000328969	T;T;T;T;T	0.35048	1.33;1.33;1.6;1.33;1.76	5.65	5.65	0.86999	.	0.219434	0.45867	D	0.000334	T	0.58409	0.2120	M	0.64997	1.995	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.69142	0.959;0.955;0.962	T	0.59268	-0.7486	10	0.72032	D	0.01	-12.7977	17.9012	0.88904	0.0:0.0:1.0:0.0	.	279;279;279	Q8N5A5-3;Q8N5A5;Q8N5A5-2	.;ZGPAT_HUMAN;.	H	279	ENSP00000391176:D279H;ENSP00000348242:D279H;ENSP00000349634:D279H;ENSP00000358984:D279H;ENSP00000332013:D279H	ENSP00000332013:D279H	D	+	1	0	ZGPAT	61835499	1.000000	0.71417	0.257000	0.24404	0.241000	0.25554	8.372000	0.90127	2.668000	0.90789	0.591000	0.81541	GAC		0.652	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484		7	123	0	0	0	0.00308	0	7	123				
PCMTD2	55251	broad.mit.edu	37	20	62891579	62891579	+	Silent	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr20:62891579G>A	ENST00000308824.6	+	2	388	c.261G>A	c.(259-261)ctG>ctA	p.L87L	PCMTD2_ENST00000299468.7_Silent_p.L87L|PCMTD2_ENST00000609372.1_Intron|PCMTD2_ENST00000369758.4_Silent_p.L87L	NM_018257.2	NP_060727.2	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2	87						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.L87L(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|upper_aerodigestive_tract(1)	17	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TTCTGAACCTGGGCAGTGGCA	0.537																																							uc002yil.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(259-261)CTG>CTA		protein-L-isoaspartate (D-aspartate)							119.0	124.0	122.0					20																	62891579		2203	4300	6503	SO:0001819	synonymous_variant	55251					cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity	g.chr20:62891579G>A	AK001745	CCDS13559.1, CCDS46631.1	20q13.33	2012-10-02	2005-10-06	2005-10-06	ENSG00000203880	ENSG00000203880			15882	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 36"""	C20orf36			Standard	NM_018257		Approved	FLJ10883	uc002yil.4	Q9NV79	OTTHUMG00000033029	ENST00000308824.6:c.261G>A	20.37:g.62891579G>A			Somatic				PCMTD2_uc002yim.3_Silent_p.L87L	p.L87L	NM_018257	NP_060727	WXS	Illumina HiSeq	Unspecified	Q9NV79	PCMD2_HUMAN			2	461	+	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)		87					E1P5H3|Q8IW60|Q9H4K2	Silent	SNP	ENST00000308824.6	37	c.261G>A	CCDS13559.1																																																																																				0.537	PCMTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080301.1	NM_018257		12	134	0	0	0	0.001855	0	12	134				
CYYR1	116159	broad.mit.edu	37	21	27945234	27945234	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr21:27945234C>T	ENST00000299340.4	-	1	369	c.26G>A	c.(25-27)cGt>cAt	p.R9H	CYYR1_ENST00000400043.3_Missense_Mutation_p.R9H|CYYR1_ENST00000435845.2_Missense_Mutation_p.R117H	NM_052954.2	NP_443186.1	Q96J86	CYYR1_HUMAN	cysteine/tyrosine-rich 1	9						integral component of membrane (GO:0016021)		p.R9H(1)		large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	15						GACCCCTGGACGCACGGGTAG	0.662																																							uc002ymd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(25-27)CGT>CAT		cysteine and tyrosine-rich 1 protein precursor							63.0	61.0	61.0					21																	27945234		2203	4300	6503	SO:0001583	missense	116159					integral to membrane		g.chr21:27945234C>T	AY061853	CCDS13578.1	21q21.2	2014-07-04	2005-07-24		ENSG00000166265	ENSG00000166265			16274	protein-coding gene	gene with protein product			"""cysteine and tyrosine-rich 1"""	C21orf95		12036297, 12062809, 24981926	Standard	NM_052954		Approved		uc002ymd.3	Q96J86	OTTHUMG00000078689	ENST00000299340.4:c.26G>A	21.37:g.27945234C>T	ENSP00000299340:p.Arg9His		Somatic				CYYR1_uc011ack.1_RNA|CYYR1_uc002yme.2_Missense_Mutation_p.R9H	p.R9H	NM_052954	NP_443186	WXS	Illumina HiSeq	Unspecified	Q96J86	CYYR1_HUMAN			1	348	-			9					A0A059TD09|A8MTU9|B2R845|Q53ER3|Q5JPD0|Q96NV7|R9QAJ4|W8CQB3	Missense_Mutation	SNP	ENST00000299340.4	37	c.26G>A	CCDS13578.1	.	.	.	.	.	.	.	.	.	.	C	13.21	2.167931	0.38315	.	.	ENSG00000166265	ENST00000299340;ENST00000435845;ENST00000400043	T;T;T	0.33865	1.39;1.39;1.39	5.16	-0.961	0.10337	.	0.863580	0.10561	N	0.660288	T	0.18002	0.0432	N	0.16478	0.41	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.0;0.001	T	0.21314	-1.0249	10	0.30078	T	0.28	-0.8647	4.1564	0.10263	0.1573:0.4082:0.0:0.4345	.	9;9	Q96J86-2;Q96J86	.;CYYR1_HUMAN	H	9;117;9	ENSP00000299340:R9H;ENSP00000401313:R117H;ENSP00000382918:R9H	ENSP00000299340:R9H	R	-	2	0	CYYR1	26867105	0.015000	0.18098	0.316000	0.25252	0.754000	0.42855	0.749000	0.26320	-0.086000	0.12550	-0.157000	0.13467	CGT		0.662	CYYR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171654.2	NM_052954		4	36	0	0	0	0.000602	0	4	36				
DLEC1	9940	broad.mit.edu	37	3	38136442	38136442	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr3:38136442C>T	ENST00000308059.6	+	13	2013	c.1992C>T	c.(1990-1992)ttC>ttT	p.F664F	DLEC1_ENST00000452631.2_Silent_p.F664F|DLEC1_ENST00000346219.3_Silent_p.F664F					deleted in lung and esophageal cancer 1									p.F664F(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		GAGAAACCTTCAGCATGGACA	0.582																																							uc003cho.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(1990-1992)TTC>TTT		deleted in lung and esophageal cancer 1 isoform							72.0	78.0	76.0					3																	38136442		2102	4219	6321	SO:0001819	synonymous_variant	9940				negative regulation of cell proliferation	cytoplasm		g.chr3:38136442C>T	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.1992C>T	3.37:g.38136442C>T			Somatic				DLEC1_uc003chp.1_Silent_p.F664F|DLEC1_uc010hgv.1_Silent_p.F664F|DLEC1_uc003chr.1_5'UTR|DLEC1_uc010hgx.1_5'Flank|DLEC1_uc003chq.1_Intron	p.F664F	NM_007335	NP_031361	WXS	Illumina HiSeq	Unspecified	Q9Y238	DLEC1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)	13	2013	+			664						Silent	SNP	ENST00000308059.6	37	c.1992C>T	CCDS2672.2																																																																																				0.582	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337		6	36	0	0	0	0.001168	0	6	36				
SCN10A	6336	broad.mit.edu	37	3	38760174	38760174	+	Silent	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr3:38760174G>A	ENST00000449082.2	-	20	3650	c.3651C>T	c.(3649-3651)gcC>gcT	p.A1217A		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1217					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.A1217A(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GCCAGCACCAGGCATTGGTGA	0.522																																							uc003ciq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10						c.(3649-3651)GCC>GCT		sodium channel, voltage-gated, type X, alpha	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)						117.0	106.0	110.0					3																	38760174		2203	4300	6503	SO:0001819	synonymous_variant	6336				sensory perception	voltage-gated sodium channel complex		g.chr3:38760174G>A	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3651C>T	3.37:g.38760174G>A			Somatic					p.A1217A	NM_006514	NP_006505	WXS	Illumina HiSeq	Unspecified	Q9Y5Y9	SCNAA_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	20	3651	-			1217			III.|Helical; Name=S3 of repeat III; (Potential).		A6NDQ1	Silent	SNP	ENST00000449082.2	37	c.3651C>T	CCDS33736.1																																																																																				0.522	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		9	61	0	0	0	0.006214	0	9	61				
DVL3	1857	broad.mit.edu	37	3	183883995	183883995	+	Missense_Mutation	SNP	T	T	C	rs371458501		TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr3:183883995T>C	ENST00000313143.3	+	8	1093	c.845T>C	c.(844-846)aTg>aCg	p.M282T	EIF2B5_ENST00000444495.1_Intron|DVL3_ENST00000431765.1_Missense_Mutation_p.M282T	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	282	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)	p.M282T(1)		breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			GGCTCTATCATGAAGGGTGGG	0.512																																							uc003fms.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(844-846)ATG>ACG		dishevelled 3		T	THR/MET	0,4406		0,0,2203	85.0	79.0	81.0		845	5.8	1.0	3		81	1,8599	1.2+/-3.3	0,1,4299	no	missense	DVL3	NM_004423.3	81	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	282/717	183883995	1,13005	2203	4300	6503	SO:0001583	missense	1857				canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity	g.chr3:183883995T>C	D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.845T>C	3.37:g.183883995T>C	ENSP00000316054:p.Met282Thr		Somatic				DVL3_uc011bqw.1_Missense_Mutation_p.M282T|DVL3_uc003fmt.2_5'UTR|DVL3_uc003fmu.2_Missense_Mutation_p.M114T	p.M282T	NM_004423	NP_004414	WXS	Illumina HiSeq	Unspecified	Q92997	DVL3_HUMAN	Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)		8	985	+	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		282			PDZ.		B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Missense_Mutation	SNP	ENST00000313143.3	37	c.845T>C	CCDS3253.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.295490	0.81025	0.0	1.16E-4	ENSG00000161202	ENST00000313143;ENST00000415612;ENST00000431765;ENST00000423300	T;T;T	0.28666	1.6;1.6;1.6	5.8	5.8	0.92144	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.47395	0.1443	L	0.39633	1.23	0.80722	D	1	B;D;D	0.62365	0.278;0.991;0.961	P;D;P	0.69654	0.564;0.965;0.841	T	0.45891	-0.9230	10	0.87932	D	0	-20.9186	16.1549	0.81657	0.0:0.0:0.0:1.0	.	282;114;282	B4E3E5;Q9UG07;Q92997	.;.;DVL3_HUMAN	T	282;282;282;180	ENSP00000316054:M282T;ENSP00000405885:M282T;ENSP00000393849:M180T	ENSP00000316054:M282T	M	+	2	0	DVL3	185366689	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.209000	0.71365	0.533000	0.62120	ATG		0.512	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346184.1	NM_004423		6	57	0	0	0	0.001168	0	6	57				
SENP5	205564	broad.mit.edu	37	3	196612594	196612594	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr3:196612594G>C	ENST00000323460.5	+	2	791	c.542G>C	c.(541-543)gGc>gCc	p.G181A	SENP5_ENST00000419026.1_Intron|SENP5_ENST00000445299.2_Missense_Mutation_p.G181A	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	181					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.G181A(1)		NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		GGTGAGAGTGGCACGATTGTG	0.532																																					Ovarian(47;891 1095 11174 13858 51271)	Ovarian(47;891 1095 11174 13858 51271)	uc003fwz.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|lung(1)	3						c.(541-543)GGC>GCC		SUMO1/sentrin specific peptidase 5							44.0	40.0	42.0					3																	196612594		2203	4300	6503	SO:0001583	missense	205564				cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity	g.chr3:196612594G>C	BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.542G>C	3.37:g.196612594G>C	ENSP00000327197:p.Gly181Ala		Somatic				SENP5_uc011bty.1_Missense_Mutation_p.G181A	p.G181A	NM_152699	NP_689912	WXS	Illumina HiSeq	Unspecified	Q96HI0	SENP5_HUMAN	Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)	2	791	+	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		181					B4DY82|Q96SA5	Missense_Mutation	SNP	ENST00000323460.5	37	c.542G>C	CCDS3322.1	.	.	.	.	.	.	.	.	.	.	G	9.769	1.172211	0.21704	.	.	ENSG00000119231	ENST00000323460;ENST00000445299	T;T	0.32272	1.46;1.46	5.58	4.71	0.59529	.	2.039250	0.02049	N	0.049893	T	0.28001	0.0690	L	0.27053	0.805	0.24527	N	0.994137	B;B	0.23650	0.084;0.089	B;B	0.20577	0.02;0.03	T	0.21759	-1.0236	10	0.72032	D	0.01	-0.5274	8.8952	0.35460	0.168:0.0:0.832:0.0	.	181;181	B4DY82;Q96HI0	.;SENP5_HUMAN	A	181	ENSP00000327197:G181A;ENSP00000390231:G181A	ENSP00000327197:G181A	G	+	2	0	SENP5	198096991	0.302000	0.24454	0.317000	0.25265	0.773000	0.43773	2.147000	0.42226	1.507000	0.48752	0.655000	0.94253	GGC		0.532	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1	NM_152699		4	26	0	0	0	0.009096	0	4	26				
LDB2	9079	broad.mit.edu	37	4	16597424	16597424	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr4:16597424G>T	ENST00000304523.5	-	3	633	c.310C>A	c.(310-312)Ctc>Atc	p.L104I	LDB2_ENST00000441778.2_Missense_Mutation_p.L104I|LDB2_ENST00000515064.1_Missense_Mutation_p.L104I|LDB2_ENST00000502640.1_Missense_Mutation_p.L104I|LDB2_ENST00000503829.1_5'UTR|LDB2_ENST00000503178.2_5'UTR	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	104					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)	p.L104I(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						GAGTGTTTGAGAATGTAATAC	0.507																																							uc003goz.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(310-312)CTC>ATC		LIM domain binding 2 isoform a							158.0	127.0	138.0					4																	16597424		2203	4300	6503	SO:0001583	missense	9079						LIM domain binding|transcription cofactor activity	g.chr4:16597424G>T	AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.310C>A	4.37:g.16597424G>T	ENSP00000306772:p.Leu104Ile		Somatic				LDB2_uc003gpa.2_Missense_Mutation_p.L104I|LDB2_uc003gpb.2_Missense_Mutation_p.L104I|LDB2_uc011bxh.1_Missense_Mutation_p.L104I|LDB2_uc010iee.2_Missense_Mutation_p.L104I|LDB2_uc003goy.2_5'UTR|LDB2_uc011bxi.1_5'UTR	p.L104I	NM_001290	NP_001281	WXS	Illumina HiSeq	Unspecified	O43679	LDB2_HUMAN			3	626	-			104					O60619|O75480	Missense_Mutation	SNP	ENST00000304523.5	37	c.310C>A	CCDS3420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.937800|4.937800	0.92458|0.92458	.|.	.|.	ENSG00000169744|ENSG00000169744	ENST00000507464|ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000506732	.|.	.|.	.|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.000000	.|0.64402	.|D	.|0.000003	T|T	0.79429|0.79429	0.4444|0.4444	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	.|D;D;D;P;D	.|0.76494	.|0.979;0.972;0.984;0.94;0.999	.|D;P;P;P;D	.|0.87578	.|0.973;0.877;0.853;0.688;0.998	T|T	0.76340|0.76340	-0.2995|-0.2995	5|9	.|0.34782	.|T	.|0.22	-13.3897|-13.3897	18.9634|18.9634	0.92685|0.92685	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|70;104;104;104;104	.|B7Z6D0;E9PFI4;G5E9Y7;O43679-2;O43679	.|.;.;.;.;LDB2_HUMAN	L|I	25|104;104;104;104;80	.|.	.|ENSP00000306772:L104I	F|L	-|-	3|1	2|0	LDB2|LDB2	16206522|16206522	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.997000|0.997000	0.91878|0.91878	9.420000|9.420000	0.97426|0.97426	2.793000|2.793000	0.96121|0.96121	0.563000|0.563000	0.77884|0.77884	TTC|CTC		0.507	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250321.2			4	56	1	0	0.00909568	0.009096	0.00955915	4	56				
GRSF1	2926	broad.mit.edu	37	4	71698055	71698055	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr4:71698055G>C	ENST00000254799.6	-	4	900	c.783C>G	c.(781-783)tgC>tgG	p.C261W	GRSF1_ENST00000502323.1_Missense_Mutation_p.C99W|GRSF1_ENST00000439371.1_Missense_Mutation_p.C99W|GRSF1_ENST00000508091.1_Intron|GRSF1_ENST00000545193.1_Missense_Mutation_p.C143W	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	261	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.C261W(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			CTTTCTCATTGCAACTATAAG	0.398																																							uc010iia.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(781-783)TGC>TGG		G-rich RNA sequence binding factor 1 isoform 1							138.0	136.0	137.0					4																	71698055		1908	4119	6027	SO:0001583	missense	2926				mRNA polyadenylation		mRNA binding|nucleotide binding	g.chr4:71698055G>C	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.783C>G	4.37:g.71698055G>C	ENSP00000254799:p.Cys261Trp		Somatic				GRSF1_uc011caz.1_Missense_Mutation_p.C143W|GRSF1_uc003hfs.2_Missense_Mutation_p.C99W	p.C261W	NM_002092	NP_002083	WXS	Illumina HiSeq	Unspecified	Q12849	GRSF1_HUMAN	Lung(101;0.235)		4	866	-		all_hematologic(202;0.21)	261			RRM 2.		B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	ENST00000254799.6	37	c.783C>G	CCDS47069.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.323731|4.323731	0.81580|0.81580	.|.	.|.	ENSG00000132463|ENSG00000132463	ENST00000514161|ENST00000254799;ENST00000439371;ENST00000540657;ENST00000499044;ENST00000502323;ENST00000545193	.|T;T;T;T;T	.|0.07567	.|3.18;3.18;3.18;3.18;3.18	5.93|5.93	5.08|5.08	0.68730|0.68730	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.226336	.|0.53938	.|D	.|0.000052	T|T	0.29256|0.29256	0.0728|0.0728	M|M	0.70903|0.70903	2.155|2.155	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.81914	.|0.995;0.995	T|T	0.03249|0.03249	-1.1056|-1.1056	5|10	.|0.87932	.|D	.|0	.|.	16.3719|16.3719	0.83365|0.83365	0.0:0.0:0.8671:0.1329|0.0:0.0:0.8671:0.1329	.|.	.|174;261	.|B7Z5F9;Q12849	.|.;GRSF1_HUMAN	G|W	198|261;99;193;234;99;143	.|ENSP00000254799:C261W;ENSP00000389219:C99W;ENSP00000427354:C234W;ENSP00000425430:C99W;ENSP00000443380:C143W	.|ENSP00000254799:C261W	A|C	-|-	2|3	0|2	GRSF1|GRSF1	71916919|71916919	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	5.910000|5.910000	0.69931|0.69931	1.460000|1.460000	0.47911|0.47911	0.655000|0.655000	0.94253|0.94253	GCA|TGC		0.398	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1	NM_002092		3	71	0	0	0	0.004672	0	3	71				
KIAA1109	84162	broad.mit.edu	37	4	123268929	123268929	+	Missense_Mutation	SNP	G	G	A	rs377061438		TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr4:123268929G>A	ENST00000264501.4	+	76	13497	c.13124G>A	c.(13123-13125)cGa>cAa	p.R4375Q	KIAA1109_ENST00000388738.3_Missense_Mutation_p.R4375Q			Q2LD37	K1109_HUMAN	KIAA1109	4375					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R4375Q(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TCAGTTCCTCGAAGAGGTAAC	0.413																																							uc003ieh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(13123-13125)CGA>CAA		fragile site-associated protein		G	GLN/ARG	1,3841		0,1,1920	118.0	110.0	112.0		13124	1.9	1.0	4		112	0,8268		0,0,4134	no	missense	KIAA1109	NM_015312.3	43	0,1,6054	AA,AG,GG		0.0,0.026,0.0083	benign	4375/5006	123268929	1,12109	1921	4134	6055	SO:0001583	missense	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123268929G>A	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.13124G>A	4.37:g.123268929G>A	ENSP00000264501:p.Arg4375Gln		Somatic				KIAA1109_uc003iem.2_Missense_Mutation_p.R731Q	p.R4375Q	NM_015312	NP_056127	WXS	Illumina HiSeq	Unspecified	Q2LD37	K1109_HUMAN			74	13169	+			4375					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	c.13124G>A	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.53|13.53	2.264540|2.264540	0.39995|0.39995	2.6E-4|2.6E-4	0.0|0.0	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000264501;ENST00000388738;ENST00000438707	.|T;T;T	.|0.30714	.|2.46;2.46;1.52	6.01|6.01	1.91|1.91	0.25777|0.25777	.|.	.|0.196873	.|0.42294	.|N	.|0.000727	T|T	0.18257|0.18257	0.0438|0.0438	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.06409|0.06409	-1.0828|-1.0828	5|10	.|0.25751	.|T	.|0.34	.|.	10.053|10.053	0.42228|0.42228	0.3883:0.0:0.6117:0.0|0.3883:0.0:0.6117:0.0	.|.	.|4374;4375	.|Q2LD37-4;Q2LD37	.|.;K1109_HUMAN	K|Q	751|4375;4375;1044	.|ENSP00000264501:R4375Q;ENSP00000373390:R4375Q;ENSP00000410874:R1044Q	.|ENSP00000264501:R4375Q	E|R	+|+	1|2	0|0	KIAA1109|KIAA1109	123488379|123488379	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	3.134000|3.134000	0.50538|0.50538	0.449000|0.449000	0.26747|0.26747	-0.157000|-0.157000	0.13467|0.13467	GAA|CGA		0.413	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		5	83	0	0	0	0.000602	0	5	83				
ELMOD2	255520	broad.mit.edu	37	4	141458637	141458637	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr4:141458637G>A	ENST00000323570.3	+	5	473	c.341G>A	c.(340-342)aGt>aAt	p.S114N		NM_153702.3	NP_714913.1	Q8IZ81	ELMD2_HUMAN	ELMO/CED-12 domain containing 2	114					defense response to virus (GO:0051607)|phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)|regulation of defense response to virus (GO:0050688)	cytoskeleton (GO:0005856)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.S114N(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	7	all_hematologic(180;0.162)					GATGTAGAAAGTGTGAGGAAA	0.318																																							uc003iik.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(340-342)AGT>AAT		ELMO/CED-12 domain containing 2							116.0	118.0	117.0					4																	141458637		2203	4300	6503	SO:0001583	missense	255520				phagocytosis|regulation of defense response to virus|response to virus	cytoskeleton	GTPase activator activity	g.chr4:141458637G>A	BX648349	CCDS3752.1	4q31.1	2006-10-24	2006-01-20		ENSG00000179387	ENSG00000179387			28111	protein-coding gene	gene with protein product		610196	"""ELMO domain containing 2"""			16773575	Standard	NM_153702		Approved	MGC10084	uc003iik.3	Q8IZ81	OTTHUMG00000133417	ENST00000323570.3:c.341G>A	4.37:g.141458637G>A	ENSP00000326342:p.Ser114Asn		Somatic					p.S114N	NM_153702	NP_714913	WXS	Illumina HiSeq	Unspecified	Q8IZ81	ELMD2_HUMAN			5	433	+	all_hematologic(180;0.162)		114					B2R712|D3DNZ0	Missense_Mutation	SNP	ENST00000323570.3	37	c.341G>A	CCDS3752.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.459674	0.26248	.	.	ENSG00000179387	ENST00000323570;ENST00000502397;ENST00000513606	T;T;T	0.27402	1.67;1.67;1.67	5.76	-5.23	0.02798	Engulfment/cell motility, ELMO (1);	0.500789	0.26126	N	0.026188	T	0.09730	0.0239	N	0.01482	-0.84	0.21697	N	0.999582	B	0.02656	0.0	B	0.01281	0.0	T	0.18618	-1.0331	10	0.16896	T	0.51	-0.1427	16.5965	0.84797	0.8629:0.0:0.1371:0.0	.	114	Q8IZ81	ELMD2_HUMAN	N	114;114;37	ENSP00000326342:S114N;ENSP00000422582:S114N;ENSP00000427592:S37N	ENSP00000326342:S114N	S	+	2	0	ELMOD2	141678087	1.000000	0.71417	0.602000	0.28890	0.997000	0.91878	2.884000	0.48562	-1.004000	0.03421	0.555000	0.69702	AGT		0.318	ELMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257277.2	NM_153702		8	69	0	0	0	0.004482	0	8	69				
FBN2	2201	broad.mit.edu	37	5	127648361	127648361	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr5:127648361C>T	ENST00000508053.1	-	43	5818	c.4844G>A	c.(4843-4845)gGa>gAa	p.G1615E	FBN2_ENST00000262464.4_Missense_Mutation_p.G1615E			P35556	FBN2_HUMAN	fibrillin 2	1615	TB 6.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.G1615E(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACAGGGGTTTCCCCAGGCCTT	0.502																																							uc003kuu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(4843-4845)GGA>GAA		fibrillin 2 precursor							213.0	227.0	222.0					5																	127648361		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127648361C>T	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4844G>A	5.37:g.127648361C>T	ENSP00000424571:p.Gly1615Glu		Somatic					p.G1615E	NM_001999	NP_001990	WXS	Illumina HiSeq	Unspecified	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	37	5283	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	1615			TB 6.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.4844G>A	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	33	5.200460	0.94997	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.97752	-4.52;-4.52	5.3	5.3	0.74995	Matrix fibril-associated (3);TGF-beta binding (1);	0.095097	0.46442	D	0.000290	D	0.99058	0.9677	M	0.93462	3.42	0.58432	D	0.999999	D	0.71674	0.998	D	0.73708	0.981	D	0.99044	1.0825	10	0.49607	T	0.09	.	19.1532	0.93499	0.0:1.0:0.0:0.0	.	1615	P35556	FBN2_HUMAN	E	1615	ENSP00000262464:G1615E;ENSP00000424571:G1615E	ENSP00000262464:G1615E	G	-	2	0	FBN2	127676260	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	7.585000	0.82584	2.769000	0.95229	0.655000	0.94253	GGA		0.502	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		26	347	0	0	0	0.005443	0	26	347				
SH3TC2	79628	broad.mit.edu	37	5	148427473	148427473	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr5:148427473C>T	ENST00000515425.1	-	3	332	c.231G>A	c.(229-231)cgG>cgA	p.R77R	SH3TC2_ENST00000394358.2_5'UTR|SH3TC2_ENST00000512049.1_Silent_p.R77R	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	77					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)		p.R77R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCCAGAGCCGCCTCCGAG	0.527																																							uc003lpu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(229-231)CGG>CGA		SH3 domain and tetratricopeptide repeats 2							111.0	109.0	110.0					5																	148427473		2203	4300	6503	SO:0001819	synonymous_variant	79628						binding	g.chr5:148427473C>T	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.231G>A	5.37:g.148427473C>T			Somatic				SH3TC2_uc003lpp.1_RNA|SH3TC2_uc003lpt.2_5'UTR|SH3TC2_uc010jgx.2_Silent_p.R77R|SH3TC2_uc003lpv.1_5'UTR|SH3TC2_uc011dbz.1_5'UTR|SH3TC2_uc003lpw.1_Silent_p.R77R	p.R77R	NM_024577	NP_078853	WXS	Illumina HiSeq	Unspecified	Q8TF17	S3TC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		3	383	-			77					B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Silent	SNP	ENST00000515425.1	37	c.231G>A	CCDS4293.1																																																																																				0.527	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577		4	172	0	0	0	0.009096	0	4	172				
OR12D2	26529	broad.mit.edu	37	6	29364564	29364564	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr6:29364564C>T	ENST00000383555.2	+	1	149	c.88C>T	c.(88-90)Ctc>Ttc	p.L30F	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L30F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						CGTGGTTTTCCTCACCATCTA	0.448																																							uc003nmf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(88-90)CTC>TTC		olfactory receptor, family 12, subfamily D,							155.0	174.0	167.0					6																	29364564		1511	2708	4219	SO:0001583	missense	26529				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29364564C>T		CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.88C>T	6.37:g.29364564C>T	ENSP00000373047:p.Leu30Phe		Somatic					p.L30F	NM_013936	NP_039224	WXS	Illumina HiSeq	Unspecified	P58182	O12D2_HUMAN			1	149	+			30			Helical; Name=1; (Potential).		B0S862|Q5SUN9|Q6IET9	Missense_Mutation	SNP	ENST00000383555.2	37	c.88C>T	CCDS4659.1	.	.	.	.	.	.	.	.	.	.	C	3.299	-0.143245	0.06669	.	.	ENSG00000168787	ENST00000383555	T	0.01804	4.63	4.07	2.22	0.28083	.	0.126250	0.33438	N	0.004911	T	0.00666	0.0022	L	0.47190	1.495	0.09310	N	0.999992	P	0.37101	0.582	B	0.37144	0.242	T	0.50381	-0.8835	10	0.44086	T	0.13	.	3.4677	0.07555	0.1831:0.5253:0.0:0.2916	.	30	P58182	O12D2_HUMAN	F	30	ENSP00000373047:L30F	ENSP00000373047:L30F	L	+	1	0	OR12D2	29472543	0.000000	0.05858	0.076000	0.20297	0.008000	0.06430	0.011000	0.13264	0.338000	0.23692	-0.718000	0.03613	CTC		0.448	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076054.2			19	190	0	0	0	0.007413	0	19	190				
PHF3	23469	broad.mit.edu	37	6	64422504	64422504	+	Missense_Mutation	SNP	C	C	T	rs147627550		TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr6:64422504C>T	ENST00000262043.3	+	16	5360	c.5020C>T	c.(5020-5022)Cgg>Tgg	p.R1674W	PHF3_ENST00000393387.1_Missense_Mutation_p.R1674W			Q92576	PHF3_HUMAN	PHD finger protein 3	1674					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R1674W(1)		breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AGATAGTTGCCGGAATGGAGA	0.448																																					GBM(135;136 1820 29512 34071 46235)	GBM(135;136 1820 29512 34071 46235)	uc003pep.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|skin(1)	5						c.(5020-5022)CGG>TGG		PHD finger protein 3		C	TRP/ARG	0,4406		0,0,2203	47.0	47.0	47.0		5020	-0.8	0.0	6	dbSNP_134	47	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PHF3	NM_015153.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1674/2040	64422504	1,13005	2203	4300	6503	SO:0001583	missense	23469				multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr6:64422504C>T	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.5020C>T	6.37:g.64422504C>T	ENSP00000262043:p.Arg1674Trp		Somatic				PHF3_uc003pen.2_Missense_Mutation_p.R1586W|PHF3_uc011dxs.1_Missense_Mutation_p.R943W	p.R1674W	NM_015153	NP_055968	WXS	Illumina HiSeq	Unspecified	Q92576	PHF3_HUMAN	LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)		15	5046	+	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		1674					A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	37	c.5020C>T	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	C	5.746	0.322020	0.10900	0.0	1.16E-4	ENSG00000118482	ENST00000262043;ENST00000393387	T;T	0.22336	1.96;1.96	5.76	-0.777	0.10981	.	0.447307	0.16364	N	0.217659	T	0.03053	0.0090	L	0.27053	0.805	0.09310	N	1	B	0.16603	0.018	B	0.08055	0.003	T	0.43814	-0.9368	9	.	.	.	1.3795	3.966	0.09431	0.2844:0.4352:0.165:0.1155	.	1674	Q92576	PHF3_HUMAN	W	1674	ENSP00000262043:R1674W;ENSP00000377048:R1674W	.	R	+	1	2	PHF3	64480463	0.708000	0.27876	0.018000	0.16275	0.672000	0.39443	0.233000	0.17911	-0.407000	0.07576	-0.808000	0.03180	CGG		0.448	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2			3	48	0	0	0	0.004672	0	3	48				
MLLT4	4301	broad.mit.edu	37	6	168344625	168344625	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr6:168344625G>A	ENST00000447894.2	+	25	3223	c.3223G>A	c.(3223-3225)Gca>Aca	p.A1075T	MLLT4_ENST00000351017.4_Missense_Mutation_p.A1082T|MLLT4_ENST00000400822.3_Missense_Mutation_p.A1074T|MLLT4_ENST00000344191.4_Missense_Mutation_p.A1075T|MLLT4_ENST00000507679.1_3'UTR|MLLT4_ENST00000366806.2_Missense_Mutation_p.A1075T|MLLT4_ENST00000392112.1_Missense_Mutation_p.A1058T|MLLT4_ENST00000392108.3_Missense_Mutation_p.A1075T			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1075	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)	p.A1075T(1)|p.A1059T(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TCCTAGGGCGGCAGAACTCAT	0.478			T	MLL	AL																																		uc003qwd.2		NA		Dom	yes		6	6q27	4301	T	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""			L	MLL		AL		2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5						c.(3220-3222)GCA>ACA		myeloid/lymphoid or mixed-lineage leukemia							104.0	92.0	96.0					6																	168344625		2203	4300	6503	SO:0001583	missense	4301				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding	g.chr6:168344625G>A	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.3223G>A	6.37:g.168344625G>A	ENSP00000404595:p.Ala1075Thr		Somatic				MLLT4_uc003qwb.1_Missense_Mutation_p.A1059T|MLLT4_uc003qwc.1_Missense_Mutation_p.A1075T|MLLT4_uc003qwg.1_Missense_Mutation_p.A384T	p.A1074T	NM_001040001	NP_001035090	WXS	Illumina HiSeq	Unspecified	P55196	AFAD_HUMAN		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)	25	3362	+		Breast(66;1.07e-05)|Ovarian(120;0.024)	1075			PDZ.		O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37	c.3220G>A		.	.	.	.	.	.	.	.	.	.	G	33	5.266076	0.95399	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63;1.63;1.63	4.92	4.92	0.64577	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.50497	0.1619	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.999	T	0.57087	-0.7871	10	0.72032	D	0.01	-5.2792	18.1404	0.89637	0.0:0.0:1.0:0.0	.	1075;1074;1075;1059	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	T	1075;1082;1075;1075;1058;1075;1074;1075	ENSP00000341118:A1075T;ENSP00000252692:A1082T;ENSP00000375956:A1075T;ENSP00000355771:A1075T;ENSP00000375960:A1058T;ENSP00000383623:A1074T;ENSP00000404595:A1075T	ENSP00000345834:A1075T	A	+	1	0	MLLT4	168087474	1.000000	0.71417	0.993000	0.49108	0.923000	0.55619	9.268000	0.95675	2.257000	0.74773	0.650000	0.86243	GCA		0.478	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936		3	65	0	0	0	0.001168	0	3	65				
NXPH1	30010	broad.mit.edu	37	7	8790640	8790640	+	Silent	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr7:8790640C>G	ENST00000405863.1	+	3	968	c.57C>G	c.(55-57)gtC>gtG	p.V19V	NXPH1_ENST00000497400.1_3'UTR|NXPH1_ENST00000602349.1_5'UTR	NM_152745.2	NP_689958.1	P58417	NXPH1_HUMAN	neurexophilin 1	19						extracellular region (GO:0005576)		p.V19V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|ovary(1)	17		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		GTTTTCAGGTCACATGTGCCA	0.398																																							uc003srv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(55-57)GTC>GTG		neurexophilin 1 precursor							103.0	96.0	98.0					7																	8790640		1923	4136	6059	SO:0001819	synonymous_variant	30010					extracellular region		g.chr7:8790640C>G	AB047362	CCDS47540.1	7p22	2003-03-20			ENSG00000122584	ENSG00000122584			20693	protein-coding gene	gene with protein product		604639				9570794	Standard	NM_152745		Approved		uc003srv.3	P58417	OTTHUMG00000151941	ENST00000405863.1:c.57C>G	7.37:g.8790640C>G			Somatic				NXPH1_uc011jxh.1_5'UTR	p.V19V	NM_152745	NP_689958	WXS	Illumina HiSeq	Unspecified	P58417	NXPH1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)	3	968	+		Ovarian(82;0.0628)	19					Q8NB31	Silent	SNP	ENST00000405863.1	37	c.57C>G	CCDS47540.1																																																																																				0.398	NXPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324591.1	NM_152745		14	101	0	0	0	0.003163	0	14	101				
AGMO	392636	broad.mit.edu	37	7	15601385	15601385	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr7:15601385G>A	ENST00000342526.3	-	1	255	c.86C>T	c.(85-87)tCa>tTa	p.S29L		NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	29					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)	p.S29L(1)		breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						TGTTTGGAATGAAGTTTCACT	0.408																																							uc003stb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(85-87)TCA>TTA		transmembrane protein 195							126.0	125.0	125.0					7																	15601385		2203	4300	6503	SO:0001583	missense	392636				ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding	g.chr7:15601385G>A		CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.86C>T	7.37:g.15601385G>A	ENSP00000341662:p.Ser29Leu		Somatic					p.S29L	NM_001004320	NP_001004320	WXS	Illumina HiSeq	Unspecified	Q6ZNB7	ALKMO_HUMAN			1	256	-			29					A4D114|A6NCH5	Missense_Mutation	SNP	ENST00000342526.3	37	c.86C>T	CCDS34604.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994360	0.54041	.	.	ENSG00000187546	ENST00000342526	T	0.31247	1.5	5.93	5.93	0.95920	.	0.177667	0.50627	D	0.000101	T	0.34803	0.0910	L	0.60957	1.885	0.37630	D	0.921658	B	0.18310	0.027	B	0.17722	0.019	T	0.12734	-1.0536	10	0.35671	T	0.21	-7.7548	18.5214	0.90954	0.0:0.0:1.0:0.0	.	29	Q6ZNB7	ALKMO_HUMAN	L	29	ENSP00000341662:S29L	ENSP00000341662:S29L	S	-	2	0	AGMO	15567910	1.000000	0.71417	0.969000	0.41365	0.765000	0.43378	4.382000	0.59594	2.814000	0.96858	0.655000	0.94253	TCA		0.408	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326049.2	NM_001004320		9	109	0	0	0	0.006214	0	9	109				
MUC17	140453	broad.mit.edu	37	7	100684569	100684569	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr7:100684569C>T	ENST00000306151.4	+	3	9936	c.9872C>T	c.(9871-9873)aCa>aTa	p.T3291I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3291	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T3291I(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTCAGCACCACAACGGTGGCC	0.507																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(9871-9873)ACA>ATA		mucin 17 precursor							337.0	334.0	335.0					7																	100684569		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100684569C>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9872C>T	7.37:g.100684569C>T	ENSP00000302716:p.Thr3291Ile		Somatic				MUC17_uc010lho.1_RNA	p.T3291I	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	9925	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3291			Extracellular (Potential).|Ser-rich.|53.|59 X approximate tandem repeats.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.9872C>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	7.091	0.572150	0.13623	.	.	ENSG00000169876	ENST00000306151	T	0.02446	4.29	1.28	0.336	0.15958	.	.	.	.	.	T	0.05364	0.0142	N	0.24115	0.695	0.09310	N	1	D	0.58970	0.984	D	0.70487	0.969	T	0.44221	-0.9342	9	0.40728	T	0.16	.	5.4791	0.16713	0.0:0.7863:0.0:0.2137	.	3291	Q685J3	MUC17_HUMAN	I	3291	ENSP00000302716:T3291I	ENSP00000302716:T3291I	T	+	2	0	MUC17	100471289	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.777000	0.26718	0.110000	0.17919	0.196000	0.17591	ACA		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		36	361	0	0	0	0.003755	0	36	361				
TBXAS1	6916	broad.mit.edu	37	7	139575437	139575437	+	Splice_Site	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr7:139575437G>A	ENST00000455353.1	+	3	373		c.e3+1		TBXAS1_ENST00000336425.5_Splice_Site|TBXAS1_ENST00000263552.6_Splice_Site|TBXAS1_ENST00000436047.2_Splice_Site|TBXAS1_ENST00000448866.1_Splice_Site|TBXAS1_ENST00000416849.2_Splice_Site|TBXAS1_ENST00000425687.1_Splice_Site|TBXAS1_ENST00000411653.1_Splice_Site|TBXAS1_ENST00000462275.1_Intron|TBXAS1_ENST00000458722.1_Splice_Site|TBXAS1_ENST00000414508.2_Splice_Site|TBXAS1_ENST00000539806.1_Splice_Site			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)						arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)	p.?(2)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	CTCTGTGTGGGTAAGAAGGAA	0.353																																							uc011kqv.1		NA																	2	Unknown(2)		lung(2)	ovary(2)|breast(1)	3						c.e3+1		thromboxane A synthase 1, platelet isoform							154.0	154.0	154.0					7																	139575437		2203	4300	6503	SO:0001630	splice_region_variant	6916				hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity	g.chr7:139575437G>A	L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000455353.1:c.236+1G>A	7.37:g.139575437G>A			Somatic				TBXAS1_uc003vvh.2_Splice_Site_p.G80_splice|TBXAS1_uc010lne.2_Splice_Site_p.G12_splice|TBXAS1_uc011kqu.1_Intron|TBXAS1_uc003vvi.2_Splice_Site_p.G80_splice|TBXAS1_uc003vvj.2_Splice_Site_p.G80_splice|TBXAS1_uc011kqw.1_Missense_Mutation_p.V51I|TBXAS1_uc011kqx.1_Splice_Site_p.G80_splice	p.G80_splice	NM_001130966	NP_001124438	WXS	Illumina HiSeq	Unspecified	P24557	THAS_HUMAN			3	403	+	Melanoma(164;0.0142)							B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Splice_Site	SNP	ENST00000455353.1	37	c.239_splice		.	.	.	.	.	.	.	.	.	.	G	16.02	3.003235	0.54254	.	.	ENSG00000059377	ENST00000425687;ENST00000263552;ENST00000438104;ENST00000336425;ENST00000416849;ENST00000436047;ENST00000414508;ENST00000448866;ENST00000455353;ENST00000458722;ENST00000411653;ENST00000539806	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5335	0.67942	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TBXAS1	139221906	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	5.187000	0.65087	2.494000	0.84150	0.650000	0.86243	.		0.353	TBXAS1-008	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000348380.1		Intron	12	80	0	0	0	0.013537	0	12	80				
PRSS3P2	154754	broad.mit.edu	37	7	142480063	142480063	+	RNA	SNP	C	C	A	rs202169021	byFrequency	TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr7:142480063C>A	ENST00000603901.1	+	0	195					NR_001296.3		Q8NHM4	TRY6_HUMAN	protease, serine, 3 pseudogene 2						endothelial cell migration (GO:0043542)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)										GTCACTGCTACAAGCCGTAAG	0.567																																							uc011ksq.1		NA																	0					0						c.(193-195)TAC>TAA		SubName: Full=Protease, serine, 3; Flags: Fragment;							28.0	25.0	26.0					7																	142480063		692	1591	2283			154754							g.chr7:142480063C>A			7q34	2012-03-06			ENSG00000250606	ENSG00000275896			43788	pseudogene	pseudogene	"""trypsinogen C"""						Standard	NR_001296		Approved	TRY6	uc011ksq.2	Q8NHM4	OTTHUMG00000158904		7.37:g.142480063C>A			Somatic				uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_RNA|uc003wan.1_Intron|TRY6_uc011kso.1_RNA|TRY6_uc011ksr.1_RNA	p.Y65*	NR_001296		WXS	Illumina HiSeq	Unspecified					2	278	+									Nonsense_Mutation	SNP	ENST00000603901.1	37	c.195C>A																																																																																					0.567	PRSS3P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000470000.1	NR_001296		5	72	1	0	3.10358e-05	0.014323	3.50747e-05	5	72				
KRBA1	84626	broad.mit.edu	37	7	149419892	149419892	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr7:149419892G>A	ENST00000485033.2	+	6	617	c.617G>A	c.(616-618)aGc>aAc	p.S206N	KRBA1_ENST00000255992.10_Missense_Mutation_p.S206N|KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000319551.8_Missense_Mutation_p.S206N			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	206								p.S206N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCTGGGAACAGCCCCTTGCAA	0.622																																							uc003wfz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(616-618)AGC>AAC		KRAB A domain containing 1							55.0	60.0	58.0					7																	149419892		1972	4152	6124	SO:0001583	missense	84626							g.chr7:149419892G>A	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.617G>A	7.37:g.149419892G>A	ENSP00000420112:p.Ser206Asn		Somatic				KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_5'Flank	p.S206N	NM_032534	NP_115923	WXS	Illumina HiSeq	Unspecified	A5PL33	KRBA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		7	1016	+	Melanoma(164;0.165)|Ovarian(565;0.177)		206					A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37	c.617G>A		.	.	.	.	.	.	.	.	.	.	G	18.86	3.712409	0.68730	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.38240	1.17;1.15;1.15	4.92	4.02	0.46733	.	0.000000	0.52532	D	0.000071	T	0.31009	0.0783	L	0.34521	1.04	0.28701	N	0.904042	P	0.46142	0.873	P	0.45681	0.49	T	0.17837	-1.0356	10	0.59425	D	0.04	-19.5077	9.5526	0.39319	0.1005:0.0:0.8995:0.0	.	206	A5PL33	KRBA1_HUMAN	N	206	ENSP00000255992:S206N;ENSP00000317165:S206N;ENSP00000420112:S206N	ENSP00000255992:S206N	S	+	2	0	KRBA1	149050825	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	2.448000	0.44926	2.284000	0.76573	0.561000	0.74099	AGC		0.622	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000349841.3	NM_032534		3	74	0	0	0	0.004672	0	3	74				
SSPO	23145	broad.mit.edu	37	7	149523250	149523250	+	RNA	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr7:149523250C>T	ENST00000378016.2	+	0	14336							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)	p.P167S(1)				Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGCTCGGCCCCCTGTGGTGGG	0.642																																							uc010lpk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(14332-14334)CCC>CTC		SCO-spondin precursor							39.0	47.0	45.0					7																	149523250		1956	4131	6087			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149523250C>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149523250C>T			Somatic				SSPO_uc010lpm.1_RNA|SSPO_uc003wgg.2_Intron|SSPO_uc003wgh.2_RNA|SSPO_uc003wgi.1_RNA	p.P4778L	NM_198455	NP_940857	WXS	Illumina HiSeq	Unspecified	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		103	14333	+	Melanoma(164;0.165)|Ovarian(565;0.177)		4778			TSP type-1 24.		Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37	c.14333C>T																																																																																					0.642	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				12	58	0	0	0	0.010729	0	12	58				
PCM1	5108	broad.mit.edu	37	8	17804748	17804748	+	Silent	SNP	A	A	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr8:17804748A>G	ENST00000519253.1	+	7	1088	c.837A>G	c.(835-837)caA>caG	p.Q279Q	PCM1_ENST00000325083.8_Silent_p.Q279Q|PCM1_ENST00000524226.1_Silent_p.Q279Q|PCM1_ENST00000518537.1_Silent_p.Q318Q			Q15154	PCM1_HUMAN	pericentriolar material 1	279					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)	p.Q279Q(1)	PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		TGAAGAAACAACATGATTTAT	0.403			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																		uc003wyi.3		NA		Dom	yes		8	8p22-p21.3	5108	T	pericentriolar material 1  (PTC4)			"""E, L"""	RET|JAK2		papillary thyroid|CML|MPD	PCM1/JAK2(30)	1	Substitution - coding silent(1)		lung(1)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36						c.(835-837)CAA>CAG		pericentriolar material 1							88.0	87.0	88.0					8																	17804748		1855	4093	5948	SO:0001819	synonymous_variant	5108				centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding	g.chr8:17804748A>G		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.837A>G	8.37:g.17804748A>G			Somatic				PCM1_uc011kyh.1_Silent_p.Q279Q|PCM1_uc003wyj.3_Silent_p.Q279Q|PCM1_uc003wyg.2_Silent_p.Q279Q|PCM1_uc003wyh.2_Silent_p.Q318Q|PCM1_uc010lta.1_Silent_p.Q318Q	p.Q279Q	NM_006197	NP_006188	WXS	Illumina HiSeq	Unspecified	Q15154	PCM1_HUMAN		Colorectal(111;0.0789)	7	1259	+			279			Potential.		Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Silent	SNP	ENST00000519253.1	37	c.837A>G																																																																																					0.403	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197		11	61	0	0	0	0.008291	0	11	61				
ARFGEF1	10565	broad.mit.edu	37	8	68111195	68111195	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr8:68111195G>C	ENST00000262215.3	-	39	5913	c.5524C>G	c.(5524-5526)Cag>Gag	p.Q1842E	ARFGEF1_ENST00000520381.1_Intron|ARFGEF1_ENST00000517955.1_5'UTR	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1842					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.Q1842E(1)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CCAAGTTCCTGTTCAGGTGGT	0.383																																							uc003xxo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8						c.(5524-5526)CAG>GAG		brefeldin A-inhibited guanine							155.0	142.0	147.0					8																	68111195		2203	4300	6503	SO:0001583	missense	10565				exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding	g.chr8:68111195G>C	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.5524C>G	8.37:g.68111195G>C	ENSP00000262215:p.Gln1842Glu		Somatic				ARFGEF1_uc003xxl.1_Intron|ARFGEF1_uc003xxm.1_Missense_Mutation_p.Q245E|ARFGEF1_uc003xxn.1_Missense_Mutation_p.Q787E|ARFGEF1_uc003xxp.1_3'UTR	p.Q1842E	NM_006421	NP_006412	WXS	Illumina HiSeq	Unspecified	Q9Y6D6	BIG1_HUMAN	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)		39	5914	-	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	1842					Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	c.5524C>G	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571849	0.28003	.	.	ENSG00000066777	ENST00000262215	T	0.18502	2.21	5.38	5.38	0.77491	.	0.147871	0.47093	D	0.000255	T	0.15089	0.0364	L	0.29908	0.895	0.80722	D	1	B;B	0.17038	0.005;0.02	B;B	0.11329	0.004;0.006	T	0.04579	-1.0941	10	0.30854	T	0.27	.	17.273	0.87107	0.0:0.0:1.0:0.0	.	1842;666	Q9Y6D6;B3KMS9	BIG1_HUMAN;.	E	1842	ENSP00000262215:Q1842E	ENSP00000262215:Q1842E	Q	-	1	0	ARFGEF1	68273749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.201000	0.77847	2.672000	0.90937	0.650000	0.86243	CAG		0.383	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421		10	66	0	0	0	0.008291	0	10	66				
PREX2	80243	broad.mit.edu	37	8	68995474	68995474	+	Splice_Site	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr8:68995474G>C	ENST00000288368.4	+	18	2155		c.e18-1		PREX2_ENST00000529398.1_Splice_Site|RP11-403D15.2_ENST00000526901.1_RNA	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2						adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.?(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TTCTCTCTTAGATGGCTGGCA	0.303																																							uc003xxv.1		NA																	2	Unknown(2)		lung(2)	skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						c.e18-1		DEP domain containing 2 isoform a							67.0	68.0	68.0					8																	68995474		2203	4300	6503	SO:0001630	splice_region_variant	80243				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	g.chr8:68995474G>C	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1879-1G>C	8.37:g.68995474G>C			Somatic				PREX2_uc003xxu.1_Splice_Site_p.M627_splice|PREX2_uc011lez.1_Splice_Site_p.M562_splice	p.M627_splice	NM_024870	NP_079146	WXS	Illumina HiSeq	Unspecified	Q70Z35	PREX2_HUMAN			18	1906	+								B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Splice_Site	SNP	ENST00000288368.4	37	c.1879_splice	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.237515	0.79800	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0401	0.97581	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PREX2	69158028	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.429000	0.97481	2.805000	0.96524	0.655000	0.94253	.		0.303	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	Intron	3	94	0	0	0	0.004672	0	3	94				
VPS13B	157680	broad.mit.edu	37	8	100866417	100866417	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr8:100866417C>T	ENST00000358544.2	+	56	10986	c.10875C>T	c.(10873-10875)ttC>ttT	p.F3625F	VPS13B_ENST00000357162.2_Silent_p.F3600F|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3625					protein transport (GO:0015031)			p.F3625F(1)|p.F3600F(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GACCCATCTTCACCACTGCGA	0.537																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(10873-10875)TTC>TTT		vacuolar protein sorting 13B isoform 5							111.0	88.0	96.0					8																	100866417		2203	4300	6503	SO:0001819	synonymous_variant	157680				protein transport			g.chr8:100866417C>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10875C>T	8.37:g.100866417C>T			Somatic				VPS13B_uc003yiw.2_Silent_p.F3600F	p.F3625F	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		56	10986	+	Breast(36;3.73e-07)		3625					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	c.10875C>T	CCDS6280.1																																																																																				0.537	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		8	36	0	0	0	0.010729	0	8	36				
GPAA1	8733	broad.mit.edu	37	8	145140569	145140569	+	Silent	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr8:145140569C>T	ENST00000355091.4	+	11	1666	c.1545C>T	c.(1543-1545)ctC>ctT	p.L515L	GPAA1_ENST00000361036.6_Silent_p.L455L	NM_003801.3	NP_003792.1	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment 1	515					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein complex assembly (GO:0006461)|protein retention in ER lumen (GO:0006621)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	tubulin binding (GO:0015631)	p.L515L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(2)	19	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCATCGCCCTCACCAACTTCT	0.612																																							uc003zax.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1543-1545)CTC>CTT		glycosylphosphatidylinositol anchor attachment							75.0	82.0	79.0					8																	145140569		2101	4225	6326	SO:0001819	synonymous_variant	8733				attachment of GPI anchor to protein|C-terminal protein lipidation|protein complex assembly|protein retention in ER lumen	GPI-anchor transamidase complex	tubulin binding	g.chr8:145140569C>T	AB006969	CCDS43776.1	8q24.3	2012-12-10	2012-12-10		ENSG00000197858	ENSG00000197858			4446	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	603048	"""anchor attachment protein 1 (Gaa1p, yeast) homolog"", ""GPAA1P anchor attachment protein 1 homolog (yeast)"", ""glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)"""			9828142	Standard	NM_003801		Approved	GAA1, hGAA1	uc003zax.3	O43292	OTTHUMG00000165438	ENST00000355091.4:c.1545C>T	8.37:g.145140569C>T			Somatic					p.L515L	NM_003801	NP_003792	WXS	Illumina HiSeq	Unspecified	O43292	GPAA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		11	1655	+	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		515			Helical; (Potential).		Q9NSS0|Q9UQ31	Silent	SNP	ENST00000355091.4	37	c.1545C>T	CCDS43776.1																																																																																				0.612	GPAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384070.1	NM_003801		6	65	0	0	0	0.001168	0	6	65				
SHARPIN	81858	broad.mit.edu	37	8	145158011	145158011	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr8:145158011G>C	ENST00000398712.2	-	2	755	c.319C>G	c.(319-321)Cag>Gag	p.Q107E	SHARPIN_ENST00000533948.1_5'UTR|MAF1_ENST00000532522.1_5'Flank|MAF1_ENST00000534585.1_5'Flank|MAF1_ENST00000322428.5_5'Flank	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	107	Self-association. {ECO:0000250}.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)	p.Q107E(1)		breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGAGCTTCCTGAGGGTTGAGG	0.577																																							uc003zba.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(319-321)CAG>GAG		shank-interacting protein-like 1							75.0	82.0	80.0					8																	145158011		2036	4183	6219	SO:0001583	missense	81858				negative regulation of inflammatory response|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein linear polyubiquitination|regulation of CD40 signaling pathway|regulation of tumor necrosis factor-mediated signaling pathway	cytosol|LUBAC complex	polyubiquitin binding|zinc ion binding	g.chr8:145158011G>C	AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.319C>G	8.37:g.145158011G>C	ENSP00000381698:p.Gln107Glu		Somatic				SHARPIN_uc003zbb.2_RNA|MAF1_uc003zbc.1_5'Flank	p.Q107E	NM_030974	NP_112236	WXS	Illumina HiSeq	Unspecified	Q9H0F6	SHRPN_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		2	803	-	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		107			Self-association (By similarity).		A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Missense_Mutation	SNP	ENST00000398712.2	37	c.319C>G	CCDS43777.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.131496	0.37630	.	.	ENSG00000179526	ENST00000398712;ENST00000359551	D;D	0.85013	-1.93;-1.93	4.31	1.33	0.21861	.	0.380726	0.25127	N	0.032926	T	0.75019	0.3793	L	0.31120	0.905	0.20703	N	0.999864	B	0.02656	0.0	B	0.04013	0.001	T	0.59958	-0.7356	10	0.32370	T	0.25	.	11.8049	0.52150	0.0:0.5211:0.4789:0.0	.	107	Q9H0F6	SHRPN_HUMAN	E	107	ENSP00000381698:Q107E;ENSP00000352551:Q107E	ENSP00000352551:Q107E	Q	-	1	0	SHARPIN	145229999	0.976000	0.34144	0.123000	0.21794	0.978000	0.69477	1.788000	0.38714	0.078000	0.16900	0.561000	0.74099	CAG		0.577	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382901.1	NM_030974		5	98	0	0	0	0.000602	0	5	98				
KANK1	23189	broad.mit.edu	37	9	713067	713067	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr9:713067C>A	ENST00000382303.1	+	7	2953	c.2301C>A	c.(2299-2301)aaC>aaA	p.N767K	KANK1_ENST00000382293.3_Missense_Mutation_p.N609K|KANK1_ENST00000382297.2_Missense_Mutation_p.N767K|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	767					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)	p.N767K(1)|p.N609K(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TAAATATTAACGACAACTATC	0.522																																							uc003zgl.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(2299-2301)AAC>AAA		KN motif and ankyrin repeat domains 1 isoform a							90.0	92.0	91.0					9																	713067		2203	4300	6503	SO:0001583	missense	23189				negative regulation of actin filament polymerization	cytoplasm		g.chr9:713067C>A	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2301C>A	9.37:g.713067C>A	ENSP00000371740:p.Asn767Lys		Somatic				KANK1_uc003zgm.2_Missense_Mutation_p.N767K|KANK1_uc003zgn.1_Missense_Mutation_p.N767K|KANK1_uc003zgo.1_Missense_Mutation_p.N767K|KANK1_uc003zgp.1_Missense_Mutation_p.N767K|KANK1_uc003zgq.2_Missense_Mutation_p.N609K|KANK1_uc003zgr.1_Missense_Mutation_p.N609K|KANK1_uc003zgs.1_Missense_Mutation_p.N609K	p.N767K	NM_015158	NP_055973	WXS	Illumina HiSeq	Unspecified	Q14678	KANK1_HUMAN		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)	7	2950	+		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)	767					A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	37	c.2301C>A	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	C	0.044	-1.272703	0.01421	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.22945	1.93;1.93;1.93	5.97	-11.9	0.00025	.	0.578798	0.16171	N	0.226301	T	0.21674	0.0522	M	0.61703	1.905	0.80722	D	1	P;P	0.35944	0.471;0.529	B;B	0.35240	0.198;0.131	T	0.61903	-0.6967	10	0.54805	T	0.06	-10.5395	17.5771	0.87953	0.0:0.6743:0.1687:0.157	.	767;767	Q5W0W1;Q14678	.;KANK1_HUMAN	K	767;767;767;609	ENSP00000371740:N767K;ENSP00000371734:N767K;ENSP00000371730:N609K	ENSP00000346479:N767K	N	+	3	2	KANK1	703067	0.000000	0.05858	0.009000	0.14445	0.668000	0.39293	-2.221000	0.01216	-3.042000	0.00263	-1.731000	0.00696	AAC		0.522	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158		3	57	1	0	0.004672	0.004672	0.00500571	3	57				
SMARCA2	6595	broad.mit.edu	37	9	2182201	2182201	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr9:2182201C>G	ENST00000382203.1	+	31	4629	c.4420C>G	c.(4420-4422)Ctc>Gtc	p.L1474V	SMARCA2_ENST00000382185.1_Missense_Mutation_p.L120V|SMARCA2_ENST00000349721.2_Missense_Mutation_p.L1474V|SMARCA2_ENST00000302401.3_Missense_Mutation_p.L162V|SMARCA2_ENST00000382194.1_Missense_Mutation_p.L1456V|SMARCA2_ENST00000357248.2_Missense_Mutation_p.L1456V|SMARCA2_ENST00000324954.5_Missense_Mutation_p.L120V|SMARCA2_ENST00000382186.1_Missense_Mutation_p.L138V			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1474	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.L1474V(1)|p.L1470V(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		TGTCATGCTTCTCTGTCACAA	0.433																																							uc003zhc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(4420-4422)CTC>GTC		SWI/SNF-related matrix-associated							147.0	137.0	141.0					9																	2182201		2203	4300	6503	SO:0001583	missense	6595				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding	g.chr9:2182201C>G	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.4420C>G	9.37:g.2182201C>G	ENSP00000371638:p.Leu1474Val		Somatic				SMARCA2_uc003zhd.2_Missense_Mutation_p.L1456V|SMARCA2_uc010mha.2_Missense_Mutation_p.L1389V|SMARCA2_uc011llw.1_Missense_Mutation_p.L160V|SMARCA2_uc003zhf.2_Missense_Mutation_p.L138V|SMARCA2_uc011llx.1_Missense_Mutation_p.L120V|SMARCA2_uc003zhe.2_Missense_Mutation_p.L162V|SMARCA2_uc003zhg.2_Missense_Mutation_p.L120V|SMARCA2_uc010mhb.2_Missense_Mutation_p.L144V	p.L1474V	NM_003070	NP_003061	WXS	Illumina HiSeq	Unspecified	P51531	SMCA2_HUMAN		GBM - Glioblastoma multiforme(50;0.0475)	31	4519	+		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)	1474			Bromo.		B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	c.4420C>G	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207488	0.58343	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194;ENST00000452193;ENST00000302401;ENST00000324954;ENST00000382186;ENST00000417599;ENST00000382185;ENST00000382183;ENST00000416751;ENST00000382182	T;T;T;T;T;T;T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16	5.84	4.95	0.65309	Bromodomain (6);Bromodomain, conserved site (1);	0.072669	0.56097	N	0.000023	T	0.38268	0.1034	L	0.46614	1.455	0.80722	D	1	P;P;P;D	0.53745	0.85;0.919;0.953;0.962	P;P;D;D	0.77004	0.866;0.866;0.981;0.989	T	0.14868	-1.0457	10	0.87932	D	0	-26.6354	11.4208	0.49980	0.0:0.8054:0.1274:0.0672	.	160;162;1456;1474	B4DNT1;B1ALF6;P51531-2;P51531	.;.;.;SMCA2_HUMAN	V	1474;1456;1474;1456;138;162;120;138;160;120;120;120;3	ENSP00000265773:L1474V;ENSP00000349788:L1456V;ENSP00000371638:L1474V;ENSP00000371629:L1456V;ENSP00000401096:L138V;ENSP00000305411:L162V;ENSP00000324770:L120V;ENSP00000371621:L138V;ENSP00000387486:L160V;ENSP00000371620:L120V;ENSP00000371618:L120V;ENSP00000412242:L120V	ENSP00000305411:L162V	L	+	1	0	SMARCA2	2172201	1.000000	0.71417	0.966000	0.40874	0.858000	0.48976	4.962000	0.63687	1.489000	0.48450	-0.233000	0.12211	CTC		0.433	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070		13	133	0	0	0	0.00245	0	13	133				
KIAA2026	158358	broad.mit.edu	37	9	5920916	5920916	+	Missense_Mutation	SNP	T	T	C	rs568246890		TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr9:5920916T>C	ENST00000399933.3	-	8	5079	c.5080A>G	c.(5080-5082)Att>Gtt	p.I1694V	KIAA2026_ENST00000381461.2_Missense_Mutation_p.I1664V	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1694								p.I1694V(1)|p.I869V(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TTTGACAAAATAGGCATAATT	0.428													T|||	1	0.000199681	0.0008	0.0	5008	,	,		22113	0.0		0.0	False		,,,				2504	0.0						uc003zjq.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(5080-5082)ATT>GTT		hypothetical protein LOC158358							96.0	94.0	95.0					9																	5920916		1908	4128	6036	SO:0001583	missense	158358							g.chr9:5920916T>C	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.5080A>G	9.37:g.5920916T>C	ENSP00000382815:p.Ile1694Val		Somatic				KIAA2026_uc010mht.2_Missense_Mutation_p.I869V	p.I1694V	NM_001017969	NP_001017969	WXS	Illumina HiSeq	Unspecified	Q5HYC2	K2026_HUMAN		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)	8	5296	-		Acute lymphoblastic leukemia(23;0.158)	1694					A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37	c.5080A>G		.	.	.	.	.	.	.	.	.	.	T	0.020	-1.437129	0.01098	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.48	-4.43	0.03568	.	0.921143	0.09253	N	0.827590	T	0.11281	0.0275	N	0.02916	-0.46	0.19575	N	0.999966	B	0.02656	0.0	B	0.04013	0.001	T	0.39057	-0.9632	9	0.02654	T	1	-0.4462	9.1145	0.36748	0.0:0.5465:0.2137:0.2397	.	1694	Q5HYC2	K2026_HUMAN	V	1694;1664	.	ENSP00000370870:I1664V	I	-	1	0	KIAA2026	5910916	0.026000	0.19158	0.893000	0.35052	0.962000	0.63368	-1.369000	0.02578	-0.655000	0.05387	0.477000	0.44152	ATT		0.428	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969		11	88	0	0	0	0.010729	0	11	88				
Unknown	0	broad.mit.edu	37	9	66499680	66499680	+	IGR	SNP	C	C	A	rs370931238		TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr9:66499680C>A								RP11-262H14.1 (30370 upstream) : RP11-262H14.7 (17525 downstream)																							TCATGTTAACCCCTTCCCAGG	0.582																																							uc004aee.1		NA																	0					0						c.(490-492)CCC>ACC		Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).																																				SO:0001628	intergenic_variant	442421							g.chr9:66499680C>A																													9.37:g.66499680C>A			Somatic				LOC442421_uc004aed.1_RNA	p.P164T			WXS	Illumina HiSeq	Unspecified					1	490	+									Missense_Mutation	SNP		37	c.490C>A																																																																																				0	0.582									7	31	1	0	2.0095e-06	0.001984	2.31865e-06	7	31				
FAM166A	401565	broad.mit.edu	37	9	140138730	140138730	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr9:140138730C>T	ENST00000344774.4	-	6	812	c.758G>A	c.(757-759)aGa>aAa	p.R253K		NM_001001710.1	NP_001001710.1	Q6J272	F166A_HUMAN	family with sequence similarity 166, member A	253						nucleus (GO:0005634)		p.R253K(1)		kidney(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(2)	15						GTGGGGGTTTCTAAACAGGAA	0.602																																							uc004cmi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(757-759)AGA>AAA		hypothetical protein LOC401565							89.0	77.0	81.0					9																	140138730		2202	4300	6502	SO:0001583	missense	401565							g.chr9:140138730C>T	BC132916	CCDS35186.1	9q34.3	2008-08-08			ENSG00000188163	ENSG00000188163			33818	protein-coding gene	gene with protein product							Standard	XR_245332		Approved		uc004cmi.1	Q6J272	OTTHUMG00000159545	ENST00000344774.4:c.758G>A	9.37:g.140138730C>T	ENSP00000344729:p.Arg253Lys		Somatic					p.R253K	NM_001001710	NP_001001710	WXS	Illumina HiSeq	Unspecified	Q6J272	F166A_HUMAN			6	813	-			253					A6NND9|Q8N830	Missense_Mutation	SNP	ENST00000344774.4	37	c.758G>A	CCDS35186.1	.	.	.	.	.	.	.	.	.	.	C	6.981	0.551111	0.13374	.	.	ENSG00000188163	ENST00000344774	.	.	.	4.99	-0.205	0.13196	.	0.368953	0.25708	N	0.028832	T	0.26557	0.0649	L	0.38175	1.15	0.21064	N	0.999795	B	0.12013	0.005	B	0.08055	0.003	T	0.18999	-1.0319	9	0.20519	T	0.43	-5.0529	8.3719	0.32421	0.0:0.5798:0.0:0.4202	.	253	Q6J272	F166A_HUMAN	K	253	.	ENSP00000344729:R253K	R	-	2	0	FAM166A	139258551	0.001000	0.12720	0.007000	0.13788	0.068000	0.16541	0.375000	0.20518	-0.237000	0.09739	-0.235000	0.12190	AGA		0.602	FAM166A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356125.1	NM_001001710		5	34	0	0	0	0.000602	0	5	34				
TLR7	51284	broad.mit.edu	37	X	12905921	12905921	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:12905921C>T	ENST00000380659.3	+	3	2433	c.2294C>T	c.(2293-2295)aCc>aTc	p.T765I		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	765					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.T765I(1)		NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	ATCCAAAAGACCAGCTTCCCA	0.413																																							uc004cvc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|breast(1)	5						c.(2293-2295)ACC>ATC		toll-like receptor 7 precursor	Imiquimod(DB00724)						78.0	75.0	76.0					X																	12905921		2203	4300	6503	SO:0001583	missense	51284				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity	g.chrX:12905921C>T	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.2294C>T	X.37:g.12905921C>T	ENSP00000370034:p.Thr765Ile		Somatic					p.T765I	NM_016562	NP_057646	WXS	Illumina HiSeq	Unspecified	Q9NYK1	TLR7_HUMAN			3	2433	+			765			Extracellular (Potential).|LRR 26.		D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	37	c.2294C>T	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	C	13.91	2.378067	0.42105	.	.	ENSG00000196664	ENST00000380659	T	0.79845	-1.31	5.66	3.84	0.44239	.	0.217249	0.40064	N	0.001199	D	0.84115	0.5401	L	0.57536	1.79	0.32497	N	0.539331	P	0.41366	0.747	P	0.50896	0.653	D	0.87423	0.2383	10	0.87932	D	0	.	15.3293	0.74193	0.0:0.7424:0.2576:0.0	.	765	Q9NYK1	TLR7_HUMAN	I	765	ENSP00000370034:T765I	ENSP00000370034:T765I	T	+	2	0	TLR7	12815842	0.998000	0.40836	0.991000	0.47740	0.918000	0.54935	3.904000	0.56325	0.528000	0.28580	-0.343000	0.07986	ACC		0.413	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562		9	164	0	0	0	0.006214	0	9	164				
RS1	6247	broad.mit.edu	37	X	18660249	18660249	+	Missense_Mutation	SNP	A	A	T	rs61753172		TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:18660249A>T	ENST00000379984.3	-	6	590	c.550T>A	c.(550-552)Tcc>Acc	p.S184T	CDKL5_ENST00000379996.3_Intron|RS1_ENST00000476595.1_5'UTR|CDKL5_ENST00000379989.3_Intron	NM_000330.3	NP_000321.1	O15537	XLRS1_HUMAN	retinoschisin 1	184	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adaptation of rhodopsin mediated signaling (GO:0016062)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|retina layer formation (GO:0010842)|visual perception (GO:0007601)	extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)	p.S184T(1)		cervix(1)|endometrium(4)|large_intestine(5)|lung(2)|ovary(2)|skin(1)	15	Hepatocellular(33;0.183)					TGAACCGTGGAGGTGCGGTCC	0.587																																							uc004cyo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2	GRCh37	CI992798	RS1	I		c.(550-552)TCC>ACC		X-linked juvenile retinoschisis protein							82.0	72.0	75.0					X																	18660249		2203	4300	6503	SO:0001583	missense	6247				cell adhesion|multicellular organismal development|response to stimulus|visual perception	extracellular space		g.chrX:18660249A>T	AF014459	CCDS14187.1	Xp22.2-p22.1	2014-09-17	2008-07-29		ENSG00000102104	ENSG00000102104			10457	protein-coding gene	gene with protein product		300839	"""retinoschisis (X-linked, juvenile) 1"""	RS		9326935, 17804407	Standard	NM_000330		Approved	XLRS1	uc004cyo.3	O15537	OTTHUMG00000021216	ENST00000379984.3:c.550T>A	X.37:g.18660249A>T	ENSP00000369320:p.Ser184Thr		Somatic				CDKL5_uc004cym.2_Intron|CDKL5_uc004cyn.2_Intron	p.S184T	NM_000330	NP_000321	WXS	Illumina HiSeq	Unspecified	O15537	XLRS1_HUMAN			6	585	-	Hepatocellular(33;0.183)		184			F5/8 type C.		Q0QD39	Missense_Mutation	SNP	ENST00000379984.3	37	c.550T>A	CCDS14187.1	.	.	.	.	.	.	.	.	.	.	A	17.39	3.376768	0.61735	.	.	ENSG00000102104	ENST00000379984	D	0.98060	-4.69	5.64	5.64	0.86602	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.049702	0.85682	D	0.000000	D	0.96103	0.8730	N	0.11789	0.175	0.58432	D	0.999991	D	0.76494	0.999	D	0.83275	0.996	D	0.93232	0.6618	10	0.02654	T	1	.	14.8403	0.70217	1.0:0.0:0.0:0.0	.	184	O15537	XLRS1_HUMAN	T	184	ENSP00000369320:S184T	ENSP00000369320:S184T	S	-	1	0	RS1	18570170	1.000000	0.71417	0.989000	0.46669	0.899000	0.52679	5.832000	0.69337	1.886000	0.54624	0.486000	0.48141	TCC		0.587	RS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055949.1			5	106	0	0	0	0.001168	0	5	106				
FAM47A	158724	broad.mit.edu	37	X	34149208	34149208	+	Silent	SNP	C	C	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:34149208C>A	ENST00000346193.3	-	1	1239	c.1188G>T	c.(1186-1188)gtG>gtT	p.V396V		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	396								p.V396V(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GGAGATGAGACACTTCAGTCT	0.592																																							uc004ddg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(1186-1188)GTG>GTT		hypothetical protein LOC158724							48.0	47.0	48.0					X																	34149208		2201	4299	6500	SO:0001819	synonymous_variant	158724							g.chrX:34149208C>A	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1188G>T	X.37:g.34149208C>A			Somatic					p.V396V	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	1221	-			396					A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	c.1188G>T	CCDS43926.1																																																																																				0.592	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		4	54	1	0	0.00024832	0.009096	0.000276843	4	54				
USP9X	8239	broad.mit.edu	37	X	41007726	41007726	+	Silent	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:41007726G>A	ENST00000324545.8	+	12	2157	c.1524G>A	c.(1522-1524)ttG>ttA	p.L508L	USP9X_ENST00000378308.2_Silent_p.L508L	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	508					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.L501L(1)|p.L508L(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						ACAAAGTGTTGAACCTTCTGT	0.443																																					Ovarian(172;1807 2695 35459 49286)	Ovarian(172;1807 2695 35459 49286)	uc004dfb.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(3)|breast(2)|ovary(1)	6						c.(1522-1524)TTG>TTA		ubiquitin specific protease 9, X-linked isoform							226.0	196.0	206.0					X																	41007726		2203	4300	6503	SO:0001819	synonymous_variant	8239				BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity	g.chrX:41007726G>A	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.1524G>A	X.37:g.41007726G>A			Somatic				USP9X_uc004dfc.2_Silent_p.L508L	p.L508L	NM_001039590	NP_001034679	WXS	Illumina HiSeq	Unspecified	Q93008	USP9X_HUMAN			12	2157	+			508					O75550|Q8WWT3|Q8WX12	Silent	SNP	ENST00000324545.8	37	c.1524G>A	CCDS43930.1																																																																																				0.443	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652		4	140	0	0	0	0.009096	0	4	140				
ARAF	369	broad.mit.edu	37	X	47430737	47430737	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:47430737G>C	ENST00000377045.4	+	16	1896	c.1702G>C	c.(1702-1704)Gag>Cag	p.E568Q	ARAF_ENST00000470206.1_3'UTR	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	568	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.E568Q(1)|p.E568*(1)		biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	GGCCACAATTGAGCTGCTGCA	0.632																																							uc011mlq.1		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		large_intestine(1)|lung(1)	large_intestine(3)|lung(2)|ovary(1)|skin(1)	7						c.(1702-1704)GAG>CAG		v-raf murine sarcoma 3611 viral oncogene	Adenosine triphosphate(DB00171)						69.0	49.0	56.0					X																	47430737		2203	4300	6503	SO:0001583	missense	369				intracellular signal transduction|negative regulation of apoptosis|positive regulation of peptidyl-serine phosphorylation		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity	g.chrX:47430737G>C	X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.1702G>C	X.37:g.47430737G>C	ENSP00000366244:p.Glu568Gln		Somatic					p.E568Q	NM_001654	NP_001645	WXS	Illumina HiSeq	Unspecified	P10398	ARAF_HUMAN			16	1835	+			568			Protein kinase.		P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	ENST00000377045.4	37	c.1702G>C	CCDS35232.1	.	.	.	.	.	.	.	.	.	.	g	19.79	3.892408	0.72524	.	.	ENSG00000078061	ENST00000377045	T	0.63096	-0.02	5.24	5.24	0.73138	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69088	0.3072	L	0.33339	1.005	0.80722	D	1	D	0.89917	1.0	D	0.65987	0.94	T	0.71712	-0.4510	10	0.59425	D	0.04	.	15.5116	0.75786	0.0:0.0:1.0:0.0	.	568	P10398	ARAF_HUMAN	Q	568	ENSP00000366244:E568Q	ENSP00000366244:E568Q	E	+	1	0	ARAF	47315681	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.422000	0.97458	2.345000	0.79718	0.519000	0.50382	GAG		0.632	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1			3	42	0	0	0	0.009096	0	3	42				
HUWE1	10075	broad.mit.edu	37	X	53610529	53610529	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:53610529T>C	ENST00000342160.3	-	41	5966	c.5509A>G	c.(5509-5511)Acc>Gcc	p.T1837A	HUWE1_ENST00000262854.6_Missense_Mutation_p.T1837A			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1837					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.T1700A(1)|p.T1837A(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TTTTCCATGGTATGACGAAGG	0.438																																							uc004dsp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(5509-5511)ACC>GCC		HECT, UBA and WWE domain containing 1							120.0	104.0	109.0					X																	53610529		2203	4300	6503	SO:0001583	missense	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53610529T>C	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.5509A>G	X.37:g.53610529T>C	ENSP00000340648:p.Thr1837Ala		Somatic				HUWE1_uc004dsn.2_Missense_Mutation_p.T662A	p.T1837A	NM_031407	NP_113584	WXS	Illumina HiSeq	Unspecified	Q7Z6Z7	HUWE1_HUMAN			42	5911	-			1837					O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	c.5509A>G	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.84|13.84	2.357391|2.357391	0.41801|0.41801	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052	T;T|.	0.32515|.	1.45;1.45|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.39253|0.39253	0.1071|0.1071	N|N	0.10837|0.10837	0.055|0.055	0.58432|0.58432	D|D	0.999995|0.999995	B;B|.	0.23854|.	0.055;0.092|.	B;B|.	0.26202|.	0.031;0.067|.	T|T	0.32613|0.32613	-0.9900|-0.9900	10|5	0.02654|.	T|.	1|.	.|.	13.6324|13.6324	0.62202|0.62202	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1837;1837|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	A|C	1837|870	ENSP00000340648:T1837A;ENSP00000262854:T1837A|.	ENSP00000262854:T1837A|.	T|Y	-|-	1|2	0|0	HUWE1|HUWE1	53627254|53627254	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.641000|7.641000	0.83368|0.83368	1.862000|1.862000	0.54008|0.54008	0.486000|0.486000	0.48141|0.48141	ACC|TAC		0.438	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		10	154	0	0	0	0.010729	0	10	154				
ITIH6	347365	broad.mit.edu	37	X	54823428	54823428	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:54823428T>G	ENST00000218436.6	-	2	233	c.204A>C	c.(202-204)gaA>gaC	p.E68D		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	68	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.E68D(1)									CAAAGATGGCTTCATGGGCTT	0.448																																							uc004dtj.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(2)|ovary(1)|breast(1)	6						c.(202-204)GAA>GAC		inter-alpha (globulin) inhibitor H5-like							174.0	130.0	144.0					X																	54823428		2203	4300	6503	SO:0001583	missense	347365				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chrX:54823428T>G	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.204A>C	X.37:g.54823428T>G	ENSP00000218436:p.Glu68Asp		Somatic					p.E68D	NM_198510	NP_940912	WXS	Illumina HiSeq	Unspecified	Q6UXX5	ITH5L_HUMAN			2	234	-			68			VIT.		A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	c.204A>C	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	T	16.96	3.265749	0.59540	.	.	ENSG00000102313	ENST00000218436	T	0.30448	1.53	4.82	1.09	0.20402	Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);	0.000000	0.64402	U	0.000008	T	0.39118	0.1066	M	0.67517	2.055	0.27857	N	0.940536	P	0.48911	0.917	P	0.55545	0.778	T	0.16897	-1.0387	10	0.56958	D	0.05	.	4.6179	0.12435	0.1555:0.1563:0.0:0.6883	.	68	Q6UXX5	ITH5L_HUMAN	D	68	ENSP00000218436:E68D	ENSP00000218436:E68D	E	-	3	2	ITIH5L	54840153	1.000000	0.71417	0.225000	0.23894	0.874000	0.50279	0.580000	0.23803	0.499000	0.27970	0.412000	0.27726	GAA		0.448	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		4	159	0	0	0	0.009096	0	4	159				
VDAC1	7416	broad.mit.edu	37	X	80185205	80185205	+	IGR	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:80185205C>T								RNU6-493P (28842 upstream) : RNU6-995P (6727 downstream)																							TACGGCCTCACGTTTACAGAG	0.473																																							uc004eec.1		NA																	0					NA						c.(103-105)ACG>ATG		SubName: Full=cDNA FLJ16670 fis, clone THYMU3001133, highly similar to Voltage-dependent anion-selective channel protein 1; SubName: Full=Voltage-dependent anion channel 1, isoform CRA_a;																																				SO:0001628	intergenic_variant	0							g.chrX:80185205C>T																													X.37:g.80185205C>T			Somatic					p.T35M			WXS	Illumina HiSeq	Unspecified					1	278	+									Missense_Mutation	SNP		37	c.104C>T																																																																																				0	0.473									6	57	0	0	0	0.001168	0	6	57				
CXorf56	63932	broad.mit.edu	37	X	118678319	118678319	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:118678319C>G	ENST00000371594.4	-	4	498	c.420G>C	c.(418-420)aaG>aaC	p.K140N	CXorf56_ENST00000320339.4_Missense_Mutation_p.K91N|CXorf56_ENST00000536133.1_Missense_Mutation_p.K126N|CXorf56_ENST00000469448.1_5'Flank	NM_022101.3	NP_071384.1	Q9H5V9	CX056_HUMAN	chromosome X open reading frame 56	140								p.K140N(1)		cervix(1)|endometrium(2)|lung(7)	10						TAATTACCTTCTTAGGAGGCT	0.383																																							uc004erk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(418-420)AAG>AAC		hypothetical protein LOC63932							117.0	106.0	109.0					X																	118678319		2203	4300	6503	SO:0001583	missense	63932						protein binding	g.chrX:118678319C>G	AK026618	CCDS55484.1, CCDS55485.1	Xq24	2008-02-05			ENSG00000018610	ENSG00000018610			26239	protein-coding gene	gene with protein product						12477932	Standard	NM_022101		Approved	FLJ22965	uc004erk.2	Q9H5V9	OTTHUMG00000022276	ENST00000371594.4:c.420G>C	X.37:g.118678319C>G	ENSP00000360652:p.Lys140Asn		Somatic				CXorf56_uc004erj.1_Missense_Mutation_p.K91N|CXorf56_uc011mtu.1_Missense_Mutation_p.K126N	p.K140N	NM_022101	NP_071384	WXS	Illumina HiSeq	Unspecified	Q9H5V9	CX056_HUMAN			4	466	-			140					A8MPX7|B4DQN2|D3DWH9|F5GWL7|O43351	Missense_Mutation	SNP	ENST00000371594.4	37	c.420G>C	CCDS14579.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671447	0.67814	.	.	ENSG00000018610	ENST00000486230;ENST00000320339;ENST00000371594;ENST00000536133;ENST00000476164	T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.38214	0.1032	M	0.72353	2.195	0.80722	D	1	P;P	0.52463	0.953;0.953	P;P	0.52646	0.705;0.705	T	0.21655	-1.0239	10	0.51188	T	0.08	-23.2229	9.6779	0.40052	0.0:0.8894:0.0:0.1106	.	126;140	F5GWL7;Q9H5V9	.;CX056_HUMAN	N	140;91;140;126;140	ENSP00000420787:K140N;ENSP00000320345:K91N;ENSP00000360652:K140N;ENSP00000441786:K126N;ENSP00000420635:K140N	ENSP00000320345:K91N	K	-	3	2	CXorf56	118562347	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.695000	0.37763	1.987000	0.57996	0.544000	0.68410	AAG		0.383	CXorf56-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022101		18	236	0	0	0	0.008871	0	18	236				
HTATSF1	27336	broad.mit.edu	37	X	135586542	135586542	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:135586542G>A	ENST00000218364.4	+	6	928	c.754G>A	c.(754-756)Gag>Aag	p.E252K	HTATSF1_ENST00000535601.1_Missense_Mutation_p.E252K	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	252					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E252K(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					TTGGAGACCTGAGAGGCGAGC	0.453																																							uc004ezw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(754-756)GAG>AAG		HIV-1 Tat specific factor 1							108.0	90.0	96.0					X																	135586542		2203	4300	6503	SO:0001583	missense	27336				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding	g.chrX:135586542G>A	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.754G>A	X.37:g.135586542G>A	ENSP00000218364:p.Glu252Lys		Somatic				HTATSF1_uc004ezx.2_Missense_Mutation_p.E252K	p.E252K	NM_001163280	NP_001156752	WXS	Illumina HiSeq	Unspecified	O43719	HTSF1_HUMAN			7	1176	+	Acute lymphoblastic leukemia(192;0.000127)		252					D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	c.754G>A	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	G	35	5.584694	0.96578	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.26957	1.7;1.7	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.49012	0.1532	M	0.81802	2.56	0.80722	D	1	D	0.55605	0.972	P	0.53954	0.738	T	0.54323	-0.8311	10	0.72032	D	0.01	-13.4435	18.946	0.92622	0.0:0.0:1.0:0.0	.	252	O43719	HTSF1_HUMAN	K	252	ENSP00000442699:E252K;ENSP00000218364:E252K	ENSP00000218364:E252K	E	+	1	0	HTATSF1	135414208	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.185000	0.94900	2.422000	0.82143	0.538000	0.68166	GAG		0.453	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500		4	63	0	0	0	0.000602	0	4	63				
SLITRK4	139065	broad.mit.edu	37	X	142716664	142716664	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:142716664T>C	ENST00000381779.4	-	2	2486	c.2261A>G	c.(2260-2262)gAt>gGt	p.D754G	SLITRK4_ENST00000338017.4_Missense_Mutation_p.D754G|SLITRK4_ENST00000356928.1_Missense_Mutation_p.D754G	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	754						integral component of membrane (GO:0016021)		p.D754G(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					CACATTGGAATCCCTGCTAGG	0.393																																							uc004fbx.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(2260-2262)GAT>GGT		slit and trk like 4 protein precursor							101.0	100.0	101.0					X																	142716664		2203	4300	6503	SO:0001583	missense	139065					integral to membrane		g.chrX:142716664T>C	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.2261A>G	X.37:g.142716664T>C	ENSP00000371198:p.Asp754Gly		Somatic				SLITRK4_uc004fby.2_Missense_Mutation_p.D754G	p.D754G	NM_173078	NP_775101	WXS	Illumina HiSeq	Unspecified	Q8IW52	SLIK4_HUMAN			2	2637	-	Acute lymphoblastic leukemia(192;6.56e-05)		754			Cytoplasmic (Potential).		Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	c.2261A>G	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	t	14.81	2.646358	0.47258	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.59502	0.26;0.26;0.26	5.48	5.48	0.80851	.	0.072089	0.56097	U	0.000036	T	0.50429	0.1615	L	0.43152	1.355	0.80722	D	1	B	0.13145	0.007	B	0.14023	0.01	T	0.46034	-0.9220	10	0.44086	T	0.13	-10.251	13.324	0.60449	0.0:0.0:0.0:1.0	.	754	Q8IW52	SLIK4_HUMAN	G	754	ENSP00000371198:D754G;ENSP00000349400:D754G;ENSP00000336627:D754G	ENSP00000336627:D754G	D	-	2	0	SLITRK4	142544330	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.695000	0.84257	1.829000	0.53265	0.483000	0.47432	GAT		0.393	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078		74	201	0	0	0	0.01441	0	74	201				
MAGEA8	4107	broad.mit.edu	37	X	149013830	149013830	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:149013830C>T	ENST00000542674.1	+	3	1305	c.784C>T	c.(784-786)Cgc>Tgc	p.R262C	MAGEA8_ENST00000286482.1_Missense_Mutation_p.R262C|MAGEA8_ENST00000535454.1_Missense_Mutation_p.R262C	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	262	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.R262C(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					CCTGGAGTACCGCCAGGCGCC	0.582																																							uc004fdw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(784-786)CGC>TGC		melanoma antigen family A, 8							109.0	102.0	104.0					X																	149013830		2203	4298	6501	SO:0001583	missense	4107							g.chrX:149013830C>T		CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.784C>T	X.37:g.149013830C>T	ENSP00000443776:p.Arg262Cys		Somatic					p.R262C	NM_005364	NP_005355	WXS	Illumina HiSeq	Unspecified	P43361	MAGA8_HUMAN			3	999	+	Acute lymphoblastic leukemia(192;6.56e-05)		262			MAGE.		Q9BUN9	Missense_Mutation	SNP	ENST00000542674.1	37	c.784C>T	CCDS14692.1	.	.	.	.	.	.	.	.	.	.	.	13.37	2.216897	0.39201	.	.	ENSG00000156009	ENST00000535454;ENST00000542674;ENST00000286482	T;T;T	0.06449	3.3;3.3;3.3	1.0	-0.0909	0.13663	.	1.066030	0.07318	N	0.877049	T	0.23330	0.0564	M	0.87682	2.9	0.18873	N	0.999984	D	0.89917	1.0	D	0.68483	0.958	T	0.09640	-1.0665	10	0.66056	D	0.02	.	3.8134	0.08806	0.421:0.579:0.0:0.0	.	262	P43361	MAGA8_HUMAN	C	262	ENSP00000438293:R262C;ENSP00000443776:R262C;ENSP00000286482:R262C	ENSP00000286482:R262C	R	+	1	0	MAGEA8	148774488	0.002000	0.14202	0.154000	0.22540	0.312000	0.27988	0.246000	0.18160	-0.095000	0.12351	0.190000	0.17370	CGC		0.582	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058728.1	NM_005364		15	181	0	0	0	0.003163	0	15	181				
ARHGAP4	393	broad.mit.edu	37	X	153186252	153186252	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chrX:153186252G>A	ENST00000350060.5	-	5	550	c.509C>T	c.(508-510)aCg>aTg	p.T170M	ARHGAP4_ENST00000370028.3_Missense_Mutation_p.T170M|ARHGAP4_ENST00000370016.1_Missense_Mutation_p.T149M|ARHGAP4_ENST00000393721.1_Intron|ARHGAP4_ENST00000537206.1_Missense_Mutation_p.T147M	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	170					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)	p.T170M(2)		central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGCCTGGTACGTCTTCTTGGC	0.662																																							uc004fjk.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(508-510)ACG>ATG		Rho GTPase activating protein 4 isoform 2							58.0	53.0	54.0					X																	153186252		2203	4300	6503	SO:0001583	missense	393				apoptosis|cytoskeleton organization|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|Rho protein signal transduction	cytosol|focal adhesion|nucleus	Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity	g.chrX:153186252G>A	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.509C>T	X.37:g.153186252G>A	ENSP00000203786:p.Thr170Met		Somatic				ARHGAP4_uc011mzf.1_Missense_Mutation_p.T147M|ARHGAP4_uc004fjl.1_Missense_Mutation_p.T170M|ARHGAP4_uc010nup.1_RNA	p.T170M	NM_001666	NP_001657	WXS	Illumina HiSeq	Unspecified	P98171	RHG04_HUMAN			5	551	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		170			Potential.		Q14144|Q86UY3	Missense_Mutation	SNP	ENST00000350060.5	37	c.509C>T	CCDS14736.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.161863	0.38217	.	.	ENSG00000089820	ENST00000370028;ENST00000350060;ENST00000370016;ENST00000537206;ENST00000442262;ENST00000422091	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	4.89	4.01	0.46588	.	0.152498	0.31113	N	0.008223	T	0.47002	0.1422	M	0.78285	2.405	0.46678	D	0.999155	D;P	0.61080	0.989;0.944	B;B	0.44108	0.441;0.179	T	0.55386	-0.8149	10	0.59425	D	0.04	.	12.3464	0.55124	0.0896:0.0:0.9104:0.0	.	170;170	Q86UY3;P98171	.;RHG04_HUMAN	M	170;170;149;147;147;147	ENSP00000359045:T170M;ENSP00000203786:T170M;ENSP00000359033:T149M;ENSP00000444169:T147M;ENSP00000398259:T147M;ENSP00000413782:T147M	ENSP00000203786:T170M	T	-	2	0	ARHGAP4	152839446	1.000000	0.71417	0.800000	0.32199	0.307000	0.27823	7.536000	0.82023	1.108000	0.41662	0.529000	0.55759	ACG		0.662	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666		6	116	0	0	0	0.001168	0	6	116				
RBM12B	389677	broad.mit.edu	37	8	94746054	94746054	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5935-01A-11D-1753-08	TCGA-50-5935-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	9570cd02-3339-4805-855a-74ebe429df96	cdef3797-3c5d-461f-92c8-1392cdd1781d	g.chr8:94746054delG	ENST00000399300.2	-	3	2798	c.2585delC	c.(2584-2586)cctfs	p.P862fs	RBM12B_ENST00000520961.1_Intron|RBM12B_ENST00000517700.1_Frame_Shift_Del_p.P742fs|RP11-10N23.4_ENST00000517998.1_RNA	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	862							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			AAAATTGTCAGGAAGTCTAGG	0.522																																							uc003yfz.2		NA																	0					0						c.(2584-2586)CCTfs		RNA binding motif protein 12B							84.0	86.0	86.0					8																	94746054		1817	4077	5894	SO:0001589	frameshift_variant	389677						nucleotide binding|RNA binding	g.chr8:94746054delG		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2585delC	8.37:g.94746054delG	ENSP00000382239:p.Pro862fs		Somatic					p.P862fs	NM_203390	NP_976324	WXS	Illumina HiSeq	Unspecified	Q8IXT5	RB12B_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.0168)		3	2778	-	Breast(36;4.14e-07)		862					A8MYB5	Frame_Shift_Del	DEL	ENST00000399300.2	37	c.2585delC	CCDS43755.1																																																																																				0.522	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		19	158	NA	NA	NA	NA	NA	19	158	---	---	---	---
