#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
DMBX1	127343	broad.mit.edu	37	1	46976626	46976626	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:46976626G>A	ENST00000360032.3	+	3	367	c.353G>A	c.(352-354)cGg>cAg	p.R118Q	DMBX1_ENST00000371956.4_Missense_Mutation_p.R123Q	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1									p.R123Q(1)		endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					AAGAACCGCCGGGCCAAGTTC	0.627																																							uc001cpx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(367-369)CGG>CAG		diencephalon/mesencephalon homeobox 1 isoform b							23.0	28.0	27.0					1																	46976626		2203	4300	6503	SO:0001583	missense	127343				brain development|developmental growth|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:46976626G>A	AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.353G>A	1.37:g.46976626G>A	ENSP00000353132:p.Arg118Gln		Somatic				DMBX1_uc001cpw.2_Missense_Mutation_p.R118Q	p.R123Q	NM_147192	NP_671725	WXS	Illumina HiSeq	Unspecified	Q8NFW5	DMBX1_HUMAN			3	383	+	Acute lymphoblastic leukemia(166;0.155)		123			Homeobox.|Interacts with OXT2 and is required for repressor activity (By similarity).			Missense_Mutation	SNP	ENST00000360032.3	37	c.368G>A	CCDS536.1	.	.	.	.	.	.	.	.	.	.	G	35	5.440020	0.96168	.	.	ENSG00000197587	ENST00000371956;ENST00000360032	D;D	0.99143	-5.48;-5.48	5.01	5.01	0.66863	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99704	0.9887	H	0.99877	4.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96841	0.9618	10	0.87932	D	0	.	17.3035	0.87188	0.0:0.0:1.0:0.0	.	123;118	Q8NFW5;Q8NFW5-2	DMBX1_HUMAN;.	Q	123;118	ENSP00000361024:R123Q;ENSP00000353132:R118Q	ENSP00000353132:R118Q	R	+	2	0	DMBX1	46749213	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.337000	0.79520	0.591000	0.81541	CGG		0.627	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021895.1			7	12	0	0	0	0.001984	0	7	12				
ACADM	34	broad.mit.edu	37	1	76198356	76198356	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:76198356A>C	ENST00000370841.4	+	3	583	c.146A>C	c.(145-147)cAa>cCa	p.Q49P	ACADM_ENST00000370834.5_Missense_Mutation_p.Q49P|ACADM_ENST00000541113.1_Missense_Mutation_p.Q13P|ACADM_ENST00000543667.1_5'UTR|ACADM_ENST00000420607.2_Missense_Mutation_p.Q53P	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	49					cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)	p.Q49P(1)		breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	AAAGAATTTCAAGCTACTGCT	0.348																																							uc001dgw.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)|skin(1)	4						c.(145-147)CAA>CCA		medium-chain acyl-CoA dehydrogenase isoform a							97.0	110.0	106.0					1																	76198356		2202	4300	6502	SO:0001583	missense	34				carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity	g.chr1:76198356A>C	M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.146A>C	1.37:g.76198356A>C	ENSP00000359878:p.Gln49Pro		Somatic				ACADM_uc010orc.1_Missense_Mutation_p.Q49P|ACADM_uc010ord.1_5'UTR|ACADM_uc009wbp.2_Missense_Mutation_p.Q53P|ACADM_uc009wbr.2_Missense_Mutation_p.Q49P|ACADM_uc010ore.1_Missense_Mutation_p.Q13P|ACADM_uc010orf.1_5'UTR|ACADM_uc001dgx.3_5'UTR|ACADM_uc010org.1_5'UTR	p.Q49P	NM_000016	NP_000007	WXS	Illumina HiSeq	Unspecified	P11310	ACADM_HUMAN			3	576	+			49					Q5T4U4|Q9NYF1	Missense_Mutation	SNP	ENST00000370841.4	37	c.146A>C	CCDS668.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.705811	0.89018	.	.	ENSG00000117054	ENST00000370841;ENST00000370834;ENST00000541113;ENST00000420607	D;D;D;D	0.99722	-6.53;-6.53;-6.53;-6.53	5.77	5.77	0.91146	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.051426	0.85682	D	0.000000	D	0.99825	0.9922	H	0.96333	3.805	0.80722	D	1	D;D;P;D;D	0.71674	0.971;0.998;0.956;0.958;0.966	P;D;D;D;D	0.71184	0.881;0.972;0.936;0.936;0.962	D	0.96732	0.9540	10	0.87932	D	0	.	15.757	0.78043	1.0:0.0:0.0:0.0	.	13;49;49;53;49	B7Z9I1;E9PJM9;Q5T4U5;P11310-2;P11310	.;.;.;.;ACADM_HUMAN	P	49;49;13;53	ENSP00000359878:Q49P;ENSP00000359871:Q49P;ENSP00000442324:Q13P;ENSP00000409612:Q53P	ENSP00000359871:Q49P	Q	+	2	0	ACADM	75970944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.934000	0.75880	2.196000	0.70406	0.528000	0.53228	CAA		0.348	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026967.1			40	49	0	0	0	0.010771	0	40	49				
LPPR4	9890	broad.mit.edu	37	1	99764596	99764596	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:99764596C>T	ENST00000370185.3	+	4	1041	c.544C>T	c.(544-546)Cat>Tat	p.H182Y	LPPR4_ENST00000457765.1_Missense_Mutation_p.H182Y|LPPR4_ENST00000370184.1_Missense_Mutation_p.H24Y	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		182					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.H182Y(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TATAGGTGTTCATGTATTTGG	0.348																																							uc001dse.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(544-546)CAT>TAT		plasticity related gene 1							137.0	120.0	125.0					1																	99764596		2203	4300	6503	SO:0001583	missense	9890						phosphatidate phosphatase activity	g.chr1:99764596C>T																												ENST00000370185.3:c.544C>T	1.37:g.99764596C>T	ENSP00000359204:p.His182Tyr		Somatic				LPPR4_uc010oue.1_Missense_Mutation_p.H182Y	p.H182Y	NM_014839	NP_055654	WXS	Illumina HiSeq	Unspecified	Q7Z2D5	LPPR4_HUMAN		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)	4	650	+		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)	182			Helical; (Potential).		E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	c.544C>T	CCDS757.1	.	.	.	.	.	.	.	.	.	.	C	19.70	3.876298	0.72180	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.50548	0.74;0.74;0.74	5.41	5.41	0.78517	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.49457	0.1558	L	0.28740	0.885	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.995;0.999	T	0.31364	-0.9946	10	0.25751	T	0.34	-22.0235	19.5802	0.95464	0.0:1.0:0.0:0.0	.	182;182	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	Y	182;182;182;24	ENSP00000359204:H182Y;ENSP00000394913:H182Y;ENSP00000359203:H24Y	ENSP00000263178:H182Y	H	+	1	0	RP4-788L13.1	99537184	1.000000	0.71417	0.927000	0.36925	0.559000	0.35586	7.776000	0.85560	2.712000	0.92718	0.650000	0.86243	CAT		0.348	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			11	32	0	0	0	0.008291	0	11	32				
HSD3B1	3283	broad.mit.edu	37	1	120057020	120057020	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:120057020T>C	ENST00000369413.3	+	4	1019	c.874T>C	c.(874-876)Tat>Cat	p.Y292H	HSD3B1_ENST00000528909.1_Missense_Mutation_p.Y292H|HSD3B1_ENST00000235547.6_Missense_Mutation_p.Y294H			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	292					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)	p.Y292H(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	ATCCCTGATGTATTGGATTGG	0.473																																							uc001ehv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(874-876)TAT>CAT		3 beta-hydroxysteroid dehydrogenase 1	NADH(DB00157)|Trilostane(DB01108)						104.0	107.0	106.0					1																	120057020		2203	4300	6503	SO:0001583	missense	3283				androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity	g.chr1:120057020T>C	S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.874T>C	1.37:g.120057020T>C	ENSP00000358421:p.Tyr292His		Somatic				HSD3B1_uc001ehw.2_Missense_Mutation_p.Y294H	p.Y292H	NM_000862	NP_000853	WXS	Illumina HiSeq	Unspecified	P14060	3BHS1_HUMAN		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	4	1019	+	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)	292			Helical; (Potential).		A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	ENST00000369413.3	37	c.874T>C	CCDS903.1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.057281	0.36277	.	.	ENSG00000203857	ENST00000369413;ENST00000235547;ENST00000528909	D;D;D	0.84442	-1.85;-1.85;-1.85	3.26	3.26	0.37387	.	0.000000	0.85682	D	0.000000	D	0.89653	0.6777	M	0.84326	2.69	0.53688	D	0.999973	D;D	0.89917	0.999;1.0	D;D	0.91635	0.994;0.999	D	0.90478	0.4458	10	0.87932	D	0	-18.2281	9.8392	0.40989	0.0:0.0:0.0:1.0	.	294;292	Q5TDG2;P14060	.;3BHS1_HUMAN	H	292;294;292	ENSP00000358421:Y292H;ENSP00000235547:Y294H;ENSP00000432268:Y292H	ENSP00000235547:Y294H	Y	+	1	0	HSD3B1	119858543	1.000000	0.71417	0.720000	0.30636	0.012000	0.07955	7.159000	0.77483	1.467000	0.48044	0.260000	0.18958	TAT		0.473	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034993.3	NM_000862		18	57	0	0	0	0.006122	0	18	57				
ITGA10	8515	broad.mit.edu	37	1	145535838	145535838	+	Silent	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:145535838C>T	ENST00000369304.3	+	16	2201	c.2026C>T	c.(2026-2028)Ctg>Ttg	p.L676L	ITGA10_ENST00000538811.1_Silent_p.L545L|ITGA10_ENST00000539363.1_Silent_p.L533L	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	676					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)	p.L676L(1)		NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGCAGTCTGTCTGACTGCAGC	0.557																																							uc001eoa.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8						c.(2026-2028)CTG>TTG		integrin, alpha 10 precursor							99.0	91.0	94.0					1																	145535838		2203	4300	6503	SO:0001819	synonymous_variant	8515				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity	g.chr1:145535838C>T	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.2026C>T	1.37:g.145535838C>T			Somatic				NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Silent_p.L545L|ITGA10_uc009wiw.2_Silent_p.L533L|ITGA10_uc010oyw.1_Silent_p.L621L	p.L676L	NM_003637	NP_003628	WXS	Illumina HiSeq	Unspecified	O75578	ITA10_HUMAN			16	2102	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		676			Extracellular (Potential).		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Silent	SNP	ENST00000369304.3	37	c.2026C>T	CCDS918.1																																																																																				0.557	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637		44	66	0	0	0	0.009718	0	44	66				
HIST2H2AC	8338	broad.mit.edu	37	1	149858560	149858560	+	Silent	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:149858560C>T	ENST00000331380.2	+	1	36	c.36C>T	c.(34-36)cgC>cgT	p.R12R	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	12						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R12R(1)		NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GCAAGGCCCGCGCCAAGGCCA	0.587																																							uc001etd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(34-36)CGC>CGT		histone cluster 2, H2ac							77.0	85.0	82.0					1																	149858560		2203	4300	6503	SO:0001819	synonymous_variant	8338				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr1:149858560C>T	AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.36C>T	1.37:g.149858560C>T			Somatic				HIST2H2BE_uc001etc.2_5'Flank	p.R12R	NM_003517	NP_003508	WXS	Illumina HiSeq	Unspecified	Q16777	H2A2C_HUMAN	STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)		1	36	+	Breast(34;0.0124)|all_hematologic(923;0.127)		12					Q6DRA7|Q8IUE5	Silent	SNP	ENST00000331380.2	37	c.36C>T	CCDS937.1																																																																																				0.587	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087128.1	NM_003517		36	90	0	0	0	0.005524	0	36	90				
DENND4B	9909	broad.mit.edu	37	1	153907270	153907270	+	Silent	SNP	C	C	T	rs564847781	byFrequency	TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:153907270C>T	ENST00000361217.4	-	18	3157	c.2739G>A	c.(2737-2739)gtG>gtA	p.V913V	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	913	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.V913V(1)|p.V801V(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GATGTGCTGACACctgctcct	0.627																																							uc001fdd.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2737-2739)GTG>GTA		DENN/MADD domain containing 4B							26.0	32.0	30.0					1																	153907270		2194	4287	6481	SO:0001819	synonymous_variant	9909							g.chr1:153907270C>T	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2739G>A	1.37:g.153907270C>T			Somatic				uc001fdc.1_RNA	p.V913V	NM_014856	NP_055671	WXS	Illumina HiSeq	Unspecified	O75064	DEN4B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		18	3140	-	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		913			Gln-rich.		Q5T4K0	Silent	SNP	ENST00000361217.4	37	c.2739G>A	CCDS44228.1																																																																																				0.627	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806		13	24	0	0	0	0.013537	0	13	24				
F13B	2165	broad.mit.edu	37	1	197019966	197019966	+	Silent	SNP	T	T	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:197019966T>A	ENST00000367412.1	-	10	1642	c.1599A>T	c.(1597-1599)ggA>ggT	p.G533G	F13B_ENST00000490002.1_5'UTR	NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	533	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)		p.G533G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TAATAATGACTCCATGTTTAA	0.343																																							uc001gtt.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(1597-1599)GGA>GGT		coagulation factor XIII B subunit precursor							108.0	107.0	108.0					1																	197019966		2203	4300	6503	SO:0001819	synonymous_variant	2165				blood coagulation	extracellular region		g.chr1:197019966T>A	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1599A>T	1.37:g.197019966T>A			Somatic					p.G533G	NM_001994	NP_001985	WXS	Illumina HiSeq	Unspecified	P05160	F13B_HUMAN			10	1643	-			533			Sushi 9.		A8K3E5|Q5VYL5	Silent	SNP	ENST00000367412.1	37	c.1599A>T	CCDS1388.1																																																																																				0.343	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994		12	45	0	0	0	0.016723	0	12	45				
NR5A2	2494	broad.mit.edu	37	1	200014594	200014594	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:200014594A>T	ENST00000367362.3	+	4	591	c.345A>T	c.(343-345)caA>caT	p.Q115H	NR5A2_ENST00000544748.1_Missense_Mutation_p.Q43H|NR5A2_ENST00000236914.3_Missense_Mutation_p.Q69H	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	115					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q115H(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					GAACAGTCCAAAATAATAAAA	0.328																																					Melanoma(179;1138 2773 15678 26136)	Melanoma(179;1138 2773 15678 26136)	uc001gvb.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(343-345)CAA>CAT		nuclear receptor subfamily 5, group A, member 2							92.0	94.0	93.0					1																	200014594		2203	4300	6503	SO:0001583	missense	2494				embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr1:200014594A>T	U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.345A>T	1.37:g.200014594A>T	ENSP00000356331:p.Gln115His		Somatic				NR5A2_uc001gvc.2_Missense_Mutation_p.Q69H|NR5A2_uc009wzh.2_Missense_Mutation_p.Q75H|NR5A2_uc010pph.1_Missense_Mutation_p.Q43H	p.Q115H	NM_205860	NP_995582	WXS	Illumina HiSeq	Unspecified	O00482	NR5A2_HUMAN			4	551	+	Prostate(682;0.19)		115			Nuclear receptor.		B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	ENST00000367362.3	37	c.345A>T	CCDS1401.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.6|21.6	4.175184|4.175184	0.78564|0.78564	.|.	.|.	ENSG00000116833|ENSG00000116833	ENST00000367357|ENST00000367362;ENST00000236914;ENST00000544748;ENST00000235480	.|D;D;D	.|0.97505	.|-4.41;-4.41;-4.41	5.5|5.5	1.94|1.94	0.25998|0.25998	.|Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97711|0.97711	0.9249|0.9249	M|M	0.80332|0.80332	2.49|2.49	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|0.998;1.0	D|D	0.96213|0.96213	0.9154|0.9154	5|9	.|.	.|.	.|.	.|.	6.8332|6.8332	0.23921|0.23921	0.5319:0.0:0.4681:0.0|0.5319:0.0:0.4681:0.0	.|.	.|69;115	.|F1D8R9;O00482	.|.;NR5A2_HUMAN	I|H	36|115;69;43;35	.|ENSP00000356331:Q115H;ENSP00000236914:Q69H;ENSP00000439116:Q43H	.|.	K|Q	+|+	2|3	0|2	NR5A2|NR5A2	198281217|198281217	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.058000|3.058000	0.49939|0.49939	0.470000|0.470000	0.27294|0.27294	0.533000|0.533000	0.62120|0.62120	AAA|CAA		0.328	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086497.2			9	36	0	0	0	0.004482	0	9	36				
NAV1	89796	broad.mit.edu	37	1	201749556	201749556	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:201749556G>A	ENST00000367296.4	+	4	1654	c.1234G>A	c.(1234-1236)Gaa>Aaa	p.E412K	NAV1_ENST00000367302.1_Missense_Mutation_p.E425K|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000295624.6_Missense_Mutation_p.E412K|NAV1_ENST00000367297.4_Missense_Mutation_p.E412K|NAV1_ENST00000367295.1_Missense_Mutation_p.E21K|NAV1_ENST00000367300.3_Missense_Mutation_p.E412K	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	412					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.E412K(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						TAGCTGGGATGAAAGCAGCTC	0.468																																							uc001gwu.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|ovary(1)	4						c.(1234-1236)GAA>AAA		neuron navigator 1							114.0	104.0	107.0					1																	201749556		2203	4300	6503	SO:0001583	missense	89796				cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding	g.chr1:201749556G>A	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.1234G>A	1.37:g.201749556G>A	ENSP00000356265:p.Glu412Lys		Somatic				NAV1_uc001gwv.1_5'UTR|NAV1_uc001gww.1_Missense_Mutation_p.E21K|NAV1_uc001gwx.2_Missense_Mutation_p.E21K|NAV1_uc001gwy.1_5'Flank	p.E412K	NM_020443	NP_065176	WXS	Illumina HiSeq	Unspecified	Q8NEY1	NAV1_HUMAN			4	1581	+			412					A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	c.1234G>A	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	G	34	5.310991	0.95629	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295	T;T;T;T;T;T	0.09350	3.11;3.16;3.16;3.16;3.11;2.99	5.42	5.42	0.78866	.	0.165903	0.50627	D	0.000102	T	0.27313	0.0670	L	0.56769	1.78	0.54753	D	0.999989	D;D;D	0.63880	0.982;0.963;0.993	P;P;P	0.58520	0.78;0.723;0.84	T	0.00256	-1.1873	10	0.49607	T	0.09	-25.9456	18.8379	0.92169	0.0:0.0:1.0:0.0	.	21;412;412	Q8NEY1-5;Q8NEY1;Q8NEY1-3	.;NAV1_HUMAN;.	K	425;412;412;412;412;21	ENSP00000356271:E425K;ENSP00000356265:E412K;ENSP00000295624:E412K;ENSP00000356266:E412K;ENSP00000356269:E412K;ENSP00000356264:E21K	ENSP00000295624:E412K	E	+	1	0	NAV1	200016179	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.833000	0.99426	2.531000	0.85337	0.655000	0.94253	GAA		0.468	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443		16	49	0	0	0	0.003163	0	16	49				
NAV1	89796	broad.mit.edu	37	1	201777216	201777216	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:201777216G>A	ENST00000367296.4	+	18	4204	c.3784G>A	c.(3784-3786)Gag>Aag	p.E1262K	NAV1_ENST00000367302.1_Missense_Mutation_p.E1215K|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000295624.6_Missense_Mutation_p.E1259K|NAV1_ENST00000367297.4_Missense_Mutation_p.E1254K|NAV1_ENST00000367295.1_Missense_Mutation_p.E868K|NAV1_ENST00000367300.3_Missense_Mutation_p.E1202K|MIR1231_ENST00000408101.1_RNA	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1262					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.E1259K(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						TGGTTCTACAGAGACTGCTTC	0.557																																							uc001gwu.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|ovary(1)	4						c.(3775-3777)GAG>AAG		neuron navigator 1							142.0	136.0	138.0					1																	201777216		2203	4300	6503	SO:0001583	missense	89796				cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding	g.chr1:201777216G>A	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.3784G>A	1.37:g.201777216G>A	ENSP00000356265:p.Glu1262Lys		Somatic				NAV1_uc001gwx.2_Missense_Mutation_p.E868K|MIR1231_hsa-mir-1231|MI0006321_5'Flank	p.E1259K	NM_020443	NP_065176	WXS	Illumina HiSeq	Unspecified	Q8NEY1	NAV1_HUMAN			17	4122	+			1262					A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	c.3775G>A	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	g	12.54	1.969759	0.34754	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295	D;D;D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19;-3.19;-3.19	5.42	5.42	0.78866	.	0.499074	0.21184	N	0.078779	D	0.90501	0.7024	L	0.29908	0.895	0.35276	D	0.780918	P;B	0.47910	0.902;0.264	B;B	0.43301	0.415;0.033	D	0.93080	0.6490	10	0.46703	T	0.11	-25.5439	18.8431	0.92192	0.0:0.0:1.0:0.0	.	868;1259	Q8NEY1-5;Q8NEY1-3	.;.	K	1215;1262;1259;1254;1202;868	ENSP00000356271:E1215K;ENSP00000356265:E1262K;ENSP00000295624:E1259K;ENSP00000356266:E1254K;ENSP00000356269:E1202K;ENSP00000356264:E868K	ENSP00000295624:E1259K	E	+	1	0	NAV1	200043839	1.000000	0.71417	0.916000	0.36221	0.250000	0.25880	4.474000	0.60203	2.538000	0.85594	0.552000	0.68991	GAG		0.557	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443		27	48	0	0	0	0.004656	0	27	48				
USH2A	7399	broad.mit.edu	37	1	216405452	216405452	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:216405452T>C	ENST00000307340.3	-	14	3222	c.2836A>G	c.(2836-2838)Act>Gct	p.T946A	USH2A_ENST00000366942.3_Missense_Mutation_p.T946A|USH2A_ENST00000366943.2_Missense_Mutation_p.T946A	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	946	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.T946A(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGCAGCCAGTGGCATTGCCT	0.358										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(2836-2838)ACT>GCT		usherin isoform B							92.0	84.0	87.0					1																	216405452		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216405452T>C	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2836A>G	1.37:g.216405452T>C	ENSP00000305941:p.Thr946Ala	HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Missense_Mutation_p.T946A	p.T946A	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	14	3223	-			946			Laminin EGF-like 8.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.2836A>G	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	2.031	-0.422400	0.04734	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.60672	0.17;0.17;0.17	5.91	0.771	0.18504	EGF-like, laminin (4);	0.145069	0.31312	N	0.007880	T	0.39627	0.1085	L	0.40543	1.245	0.09310	N	1	B;B	0.31655	0.05;0.334	B;B	0.37888	0.037;0.26	T	0.22034	-1.0228	10	0.09084	T	0.74	.	1.8735	0.03214	0.1237:0.1346:0.258:0.4837	.	946;946	O75445-2;O75445	.;USH2A_HUMAN	A	946	ENSP00000305941:T946A;ENSP00000355910:T946A;ENSP00000355909:T946A	ENSP00000305941:T946A	T	-	1	0	USH2A	214472075	0.003000	0.15002	0.034000	0.17996	0.542000	0.35054	-0.317000	0.08060	-0.108000	0.12066	-1.422000	0.01108	ACT		0.358	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		29	50	0	0	0	0.007291	0	29	50				
EPRS	2058	broad.mit.edu	37	1	220160560	220160560	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:220160560C>A	ENST00000366923.3	-	20	3231	c.2962G>T	c.(2962-2964)Gac>Tac	p.D988Y	snoU13_ENST00000459217.1_RNA	NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	988	Charged.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)	p.D988Y(1)		breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TTAGAAGGGTCTTTCCTTTGG	0.433																																							uc001hly.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2962-2964)GAC>TAC		glutamyl-prolyl tRNA synthetase	L-Glutamic Acid(DB00142)|L-Proline(DB00172)						113.0	107.0	109.0					1																	220160560		2203	4300	6503	SO:0001583	missense	2058				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding	g.chr1:220160560C>A	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2962G>T	1.37:g.220160560C>A	ENSP00000355890:p.Asp988Tyr		Somatic				EPRS_uc010puf.1_Missense_Mutation_p.D739Y|EPRS_uc001hlz.1_Missense_Mutation_p.D995Y	p.D988Y	NM_004446	NP_004437	WXS	Illumina HiSeq	Unspecified	P07814	SYEP_HUMAN		GBM - Glioblastoma multiforme(131;0.0735)	20	3232	-			988			Charged.		A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	c.2962G>T	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.425764	0.83667	.	.	ENSG00000136628	ENST00000366923	T	0.07114	3.22	5.79	5.79	0.91817	.	0.517889	0.23091	N	0.052032	T	0.12902	0.0313	L	0.36672	1.1	0.51482	D	0.999925	P	0.38767	0.646	B	0.42087	0.375	T	0.01496	-1.1340	10	0.62326	D	0.03	-12.7968	20.0368	0.97565	0.0:1.0:0.0:0.0	.	988	P07814	SYEP_HUMAN	Y	988	ENSP00000355890:D988Y	ENSP00000355890:D988Y	D	-	1	0	EPRS	218227183	1.000000	0.71417	0.987000	0.45799	0.990000	0.78478	7.284000	0.78650	2.735000	0.93741	0.563000	0.77884	GAC		0.433	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446		24	65	1	0	4.59853e-10	0.005443	5.42309e-10	24	65				
URB2	9816	broad.mit.edu	37	1	229771675	229771675	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:229771675G>A	ENST00000258243.2	+	4	1451	c.1315G>A	c.(1315-1317)Gag>Aag	p.E439K		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	439						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.E439K(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GATCGATGCCGAGGTAACAGA	0.498																																							uc001hts.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(1315-1317)GAG>AAG		URB2 ribosome biogenesis 2 homolog							73.0	83.0	80.0					1																	229771675		2203	4300	6503	SO:0001583	missense	9816					nucleolus		g.chr1:229771675G>A	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.1315G>A	1.37:g.229771675G>A	ENSP00000258243:p.Glu439Lys		Somatic				URB2_uc009xfd.1_Missense_Mutation_p.E439K	p.E439K	NM_014777	NP_055592	WXS	Illumina HiSeq	Unspecified	Q14146	URB2_HUMAN			4	1451	+			439					Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	c.1315G>A	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.819115	0.71028	.	.	ENSG00000135763	ENST00000258243	T	0.34072	1.38	5.35	4.43	0.53597	.	0.332043	0.34628	N	0.003814	T	0.26991	0.0661	L	0.50333	1.59	0.48696	D	0.999698	P	0.39250	0.665	B	0.27380	0.079	T	0.06180	-1.0841	9	.	.	.	-10.8405	11.6246	0.51138	0.0691:0.1251:0.8058:0.0	.	439	Q14146	URB2_HUMAN	K	439	ENSP00000258243:E439K	.	E	+	1	0	URB2	227838298	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	3.466000	0.53071	1.384000	0.46424	0.650000	0.86243	GAG		0.498	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777		30	71	0	0	0	0.009535	0	30	71				
GALNT2	2590	broad.mit.edu	37	1	230415081	230415081	+	Silent	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:230415081G>C	ENST00000366672.4	+	16	1665	c.1593G>C	c.(1591-1593)ctG>ctC	p.L531L	GALNT2_ENST00000485438.1_3'UTR|GALNT2_ENST00000543760.1_Silent_p.L493L|RP5-956O18.3_ENST00000414640.1_RNA	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	531	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L531L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				ACTCCAAGCTGAGGCACGTGG	0.582																																							uc010pwa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1591-1593)CTG>CTC		polypeptide N-acetylgalactosaminyltransferase 2							69.0	63.0	65.0					1																	230415081		2203	4300	6503	SO:0001819	synonymous_variant	2590				immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr1:230415081G>C	BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.1593G>C	1.37:g.230415081G>C			Somatic				GALNT2_uc010pvy.1_Silent_p.L493L|GALNT2_uc001htu.2_Silent_p.L143L	p.L531L	NM_004481	NP_004472	WXS	Illumina HiSeq	Unspecified	Q10471	GALT2_HUMAN			16	1665	+	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)	531			Lumenal (Potential).|Ricin B-type lectin.		A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Silent	SNP	ENST00000366672.4	37	c.1593G>C	CCDS1582.1																																																																																				0.582	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1	NM_004481		12	20	0	0	0	0.010729	0	12	20				
ZP4	57829	broad.mit.edu	37	1	238048576	238048576	+	Silent	SNP	G	G	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:238048576G>T	ENST00000366570.4	-	9	1358	c.1200C>A	c.(1198-1200)atC>atA	p.I400I	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	400	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.I400I(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TCTGGACAGGGATCAGCTGGG	0.517																																					NSCLC(166;160 2029 11600 18754 19936)	NSCLC(166;160 2029 11600 18754 19936)	uc001hym.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1198-1200)ATC>ATA		zona pellucida glycoprotein 4 preproprotein							74.0	73.0	74.0					1																	238048576		2203	4300	6503	SO:0001819	synonymous_variant	57829				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity	g.chr1:238048576G>T	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1200C>A	1.37:g.238048576G>T			Somatic				LOC100130331_uc010pyc.1_Intron	p.I400I	NM_021186	NP_067009	WXS	Illumina HiSeq	Unspecified	Q12836	ZP4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		9	1200	-	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	400			ZP.|Extracellular (Potential).		B2RAE1	Silent	SNP	ENST00000366570.4	37	c.1200C>A	CCDS1615.1																																																																																				0.517	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1			8	21	1	0	5.18039e-06	0.00308	5.71514e-06	8	21				
NLRP3	114548	broad.mit.edu	37	1	247587274	247587274	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:247587274C>A	ENST00000336119.3	+	3	1275	c.529C>A	c.(529-531)Cac>Aac	p.H177N	NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391827.2_Missense_Mutation_p.H177N|NLRP3_ENST00000366497.2_Missense_Mutation_p.H177N|NLRP3_ENST00000391828.3_Missense_Mutation_p.H177N|NLRP3_ENST00000348069.2_Missense_Mutation_p.H177N|NLRP3_ENST00000366496.2_Missense_Mutation_p.H177N	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	177					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.H177N(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CATCAAGGAGCACCGGAGCCA	0.557																																							uc001icr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(529-531)CAC>AAC		NLR family, pyrin domain containing 3 isoform a							73.0	61.0	65.0					1																	247587274		2203	4300	6503	SO:0001583	missense	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247587274C>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.529C>A	1.37:g.247587274C>A	ENSP00000337383:p.His177Asn		Somatic				NLRP3_uc001ics.2_Missense_Mutation_p.H177N|NLRP3_uc001icu.2_Missense_Mutation_p.H177N|NLRP3_uc001icw.2_Missense_Mutation_p.H177N|NLRP3_uc001icv.2_Missense_Mutation_p.H177N|NLRP3_uc010pyw.1_Missense_Mutation_p.H175N|NLRP3_uc001ict.1_Missense_Mutation_p.H175N	p.H177N	NM_001079821	NP_001073289	WXS	Illumina HiSeq	Unspecified	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	667	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	177					B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	c.529C>A	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132494	0.37630	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4;-2.4	4.27	3.36	0.38483	.	0.119190	0.38436	N	0.001689	D	0.92264	0.7546	M	0.71206	2.165	0.32571	N	0.529785	D;D;D;D;D	0.89917	0.979;0.958;1.0;0.997;0.979	P;P;D;D;P	0.83275	0.824;0.759;0.996;0.946;0.69	D	0.91854	0.5494	10	0.48119	T	0.1	.	8.1754	0.31278	0.0:0.8931:0.0:0.1069	.	177;177;177;177;177	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	N	177	ENSP00000375704:H177N;ENSP00000355453:H177N;ENSP00000337383:H177N;ENSP00000294752:H177N;ENSP00000355452:H177N;ENSP00000375703:H177N	ENSP00000337383:H177N	H	+	1	0	NLRP3	245653897	0.107000	0.21998	0.933000	0.37362	0.201000	0.24016	1.300000	0.33436	1.402000	0.46780	0.655000	0.94253	CAC		0.557	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		14	11	1	0	4.3838e-07	0.016723	4.89954e-07	14	11				
OR2L13	284521	broad.mit.edu	37	1	248263401	248263401	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr1:248263401A>G	ENST00000358120.2	+	2	869	c.724A>G	c.(724-726)Aca>Gca	p.T242A	OR2L13_ENST00000366478.2_Missense_Mutation_p.T242A			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T242A(2)|p.T242S(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CACCATTTCAACACATTTAAC	0.463																																							uc001ids.2		NA																	4	Substitution - Missense(4)		lung(4)	central_nervous_system(2)|ovary(1)|skin(1)	4						c.(724-726)ACA>GCA		olfactory receptor, family 2, subfamily L,							146.0	140.0	142.0					1																	248263401		2203	4300	6503	SO:0001583	missense	284521				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding	g.chr1:248263401A>G	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.724A>G	1.37:g.248263401A>G	ENSP00000350836:p.Thr242Ala		Somatic					p.T242A	NM_175911	NP_787107	WXS	Illumina HiSeq	Unspecified	Q8N349	OR2LD_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0132)		3	1061	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		242			Helical; Name=6; (Potential).		Q5VUR5	Missense_Mutation	SNP	ENST00000358120.2	37	c.724A>G	CCDS1637.1	.	.	.	.	.	.	.	.	.	.	A	2.918	-0.223927	0.06061	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.36699	1.24;1.24	4.21	0.201	0.15186	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000202	T	0.13372	0.0324	N	0.04320	-0.23	0.09310	N	1	B	0.18968	0.032	B	0.22152	0.038	T	0.13818	-1.0495	10	0.87932	D	0	.	1.1427	0.01769	0.358:0.2828:0.0912:0.2679	.	242	Q8N349	OR2LD_HUMAN	A	242	ENSP00000355434:T242A;ENSP00000350836:T242A	ENSP00000350836:T242A	T	+	1	0	OR2L13	246330024	0.000000	0.05858	0.652000	0.29579	0.013000	0.08279	-0.095000	0.11077	0.170000	0.19704	-0.321000	0.08615	ACA		0.463	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911		5	101	0	0	0	0.014758	0	5	101				
PITRM1	10531	broad.mit.edu	37	10	3202411	3202411	+	Silent	SNP	T	T	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr10:3202411T>G	ENST00000224949.4	-	8	937	c.903A>C	c.(901-903)acA>acC	p.T301T	PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Silent_p.T301T|PITRM1_ENST00000380994.1_5'Flank|PITRM1_ENST00000451104.2_Silent_p.T269T|PITRM1-AS1_ENST00000601046.1_RNA			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	301					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.T301T(1)		breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						TGTCCCAGGGTGTCTGAGCTG	0.468																																							uc010qah.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(805-807)ACA>ACC		SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;							68.0	69.0	69.0					10																	3202411		1932	4148	6080	SO:0001819	synonymous_variant	10531				proteolysis		metalloendopeptidase activity|zinc ion binding	g.chr10:3202411T>G	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.903A>C	10.37:g.3202411T>G			Somatic				PITRM1_uc001igr.1_Silent_p.T301T|PITRM1_uc001igt.1_Silent_p.T301T|PITRM1_uc009xhv.1_5'Flank|PITRM1_uc001igu.1_Silent_p.T293T|PITRM1_uc010qai.1_Silent_p.T272T|PITRM1_uc001igw.1_Silent_p.T301T	p.T269T			WXS	Illumina HiSeq	Unspecified	E7ES23	E7ES23_HUMAN			7	839	-			269					B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Silent	SNP	ENST00000224949.4	37	c.807A>C	CCDS59208.1																																																																																				0.468	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2			3	16	0	0	0	0.001984	0	3	16				
KIAA1462	57608	broad.mit.edu	37	10	30316110	30316110	+	Silent	SNP	G	G	C	rs372613979		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr10:30316110G>C	ENST00000375377.1	-	3	3068	c.2967C>G	c.(2965-2967)ccC>ccG	p.P989P		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	989					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)		p.P989P(1)		breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GATAGGACGCGGGCAGTGGTT	0.532																																							uc001iux.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(2965-2967)CCC>CCG		hypothetical protein LOC57608							107.0	104.0	105.0					10																	30316110		1970	4147	6117	SO:0001819	synonymous_variant	57608							g.chr10:30316110G>C	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.2967C>G	10.37:g.30316110G>C			Somatic				KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Silent_p.P851P|KIAA1462_uc009xle.1_Silent_p.P989P	p.P989P	NM_020848	NP_065899	WXS	Illumina HiSeq	Unspecified	Q9P266	K1462_HUMAN			2	3026	-			989					Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Silent	SNP	ENST00000375377.1	37	c.2967C>G	CCDS41500.1																																																																																				0.532	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848		37	94	0	0	0	0.019004	0	37	94				
SLC18A3	6572	broad.mit.edu	37	10	50818879	50818879	+	Silent	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr10:50818879G>A	ENST00000374115.3	+	1	533	c.93G>A	c.(91-93)caG>caA	p.Q31Q	CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000339797.1_Intron	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	31					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)	p.Q31Q(1)		endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						CCCGGCGGCAGAGGCGCCTGG	0.677																																							uc001jhw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(91-93)CAG>CAA		vesicular acetylcholine transporter							31.0	25.0	27.0					10																	50818879		2198	4300	6498	SO:0001819	synonymous_variant	6572				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity	g.chr10:50818879G>A	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.93G>A	10.37:g.50818879G>A			Somatic				CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank	p.Q31Q	NM_003055	NP_003046	WXS	Illumina HiSeq	Unspecified	Q16572	VACHT_HUMAN			1	533	+			31			Cytoplasmic (Potential).		B2R7S1	Silent	SNP	ENST00000374115.3	37	c.93G>A	CCDS7231.1																																																																																				0.677	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055		3	13	0	0	0	0.004672	0	3	13				
PRKG1	5592	broad.mit.edu	37	10	54048708	54048708	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr10:54048708G>A	ENST00000401604.2	+	16	1999	c.1805G>A	c.(1804-1806)aGa>aAa	p.R602K	PRKG1-AS1_ENST00000426785.2_RNA|PRKG1-AS1_ENST00000452247.2_RNA|PRKG1_ENST00000373985.1_Missense_Mutation_p.R590K|PRKG1_ENST00000373980.4_Missense_Mutation_p.R617K|PRKG1_ENST00000373975.2_Missense_Mutation_p.R320K			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	602	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)	p.R602K(1)|p.R617K(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CCATCAGAAAGATTAGGGAAT	0.308																																							uc001jjm.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6						c.(1804-1806)AGA>AAA		protein kinase, cGMP-dependent, type I isoform							82.0	91.0	88.0					10																	54048708		2199	4290	6489	SO:0001583	missense	5592				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity	g.chr10:54048708G>A		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.1805G>A	10.37:g.54048708G>A	ENSP00000384200:p.Arg602Lys		Somatic				PRKG1_uc001jjo.2_Missense_Mutation_p.R617K|PRKG1_uc009xow.1_Missense_Mutation_p.R320K|uc001jjq.1_Intron	p.R602K	NM_001098512	NP_001091982	WXS	Illumina HiSeq	Unspecified	Q13976	KGP1_HUMAN		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)	16	1999	+		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)	602			Protein kinase.		A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	37	c.1805G>A	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	G	34	5.307179	0.95629	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000332193;ENST00000373975	T;T;T	0.47177	0.85;0.85;0.85	5.59	5.59	0.84812	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80237	0.4586	H	0.96833	3.89	0.80722	D	1	D;D;D	0.65815	0.994;0.982;0.995	D;D;D	0.71414	0.973;0.911;0.969	D	0.86716	0.1939	10	0.87932	D	0	-8.1384	19.2374	0.93866	0.0:0.0:1.0:0.0	.	320;617;602	B3KSF3;Q13976-2;Q13976	.;.;KGP1_HUMAN	K	602;590;617;320;214	ENSP00000384200:R602K;ENSP00000363097:R590K;ENSP00000363092:R617K	ENSP00000327642:R320K	R	+	2	0	PRKG1	53718714	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.865000	0.99609	2.639000	0.89480	0.644000	0.83932	AGA		0.308	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				22	82	0	0	0	0.01892	0	22	82				
ANK3	288	broad.mit.edu	37	10	62038898	62038898	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr10:62038898C>G	ENST00000280772.2	-	3	416	c.225G>C	c.(223-225)ttG>ttC	p.L75F	ANK3_ENST00000503366.1_Missense_Mutation_p.L58F|ANK3_ENST00000373827.2_Missense_Mutation_p.L69F	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	75					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.L75F(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GGAGAGCGTTCAACCCATTCT	0.438																																							uc001jky.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						c.(223-225)TTG>TTC		ankyrin 3 isoform 1							89.0	90.0	90.0					10																	62038898		2203	4300	6503	SO:0001583	missense	288				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding	g.chr10:62038898C>G	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.225G>C	10.37:g.62038898C>G	ENSP00000280772:p.Leu75Phe		Somatic				ANK3_uc010qih.1_Missense_Mutation_p.L58F|ANK3_uc001jkz.3_Missense_Mutation_p.L69F|ANK3_uc001jlb.1_5'UTR	p.L75F	NM_020987	NP_066267	WXS	Illumina HiSeq	Unspecified	Q12955	ANK3_HUMAN			3	417	-			75			ANK 1.		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	c.225G>C	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.968970	0.74131	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000503925	T;T;T;T	0.65732	0.58;0.58;-0.17;2.36	5.37	5.37	0.77165	Ankyrin repeat-containing domain (4);	0.000000	0.34507	N	0.003908	T	0.66086	0.2754	N	0.10809	0.05	0.80722	D	1	P;D;D	0.89917	0.637;1.0;1.0	P;D;D	0.97110	0.676;1.0;0.999	T	0.73519	-0.3957	10	0.87932	D	0	.	19.2966	0.94124	0.0:1.0:0.0:0.0	.	58;69;75	E9PE32;Q5CZH9;Q12955	.;.;ANK3_HUMAN	F	75;69;58;37;49	ENSP00000280772:L75F;ENSP00000362933:L69F;ENSP00000425236:L58F;ENSP00000426011:L49F	ENSP00000280772:L75F	L	-	3	2	ANK3	61708904	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.122000	0.31295	2.793000	0.96121	0.655000	0.94253	TTG		0.438	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987		19	50	0	0	0	0.010504	0	19	50				
PPA1	5464	broad.mit.edu	37	10	71973273	71973273	+	Missense_Mutation	SNP	C	C	T	rs11538284		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr10:71973273C>T	ENST00000373232.3	-	6	556	c.457G>A	c.(457-459)Gac>Aac	p.D153N	PPA1_ENST00000608321.1_Missense_Mutation_p.D153N	NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	153					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)	p.D153N(2)		breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						ACTTTCCAGTCGGTTTCCCCT	0.383																																							uc001jqv.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	breast(1)	1						c.(457-459)GAC>AAC		pyrophosphatase 1		C	ASN/ASP	0,4406		0,0,2203	95.0	86.0	89.0		457	5.8	1.0	10	dbSNP_120	89	1,8599	1.2+/-3.3	0,1,4299	no	missense	PPA1	NM_021129.3	23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	153/290	71973273	1,13005	2203	4300	6503	SO:0001583	missense	5464				diphosphate metabolic process|tRNA aminoacylation for protein translation	cytosol	inorganic diphosphatase activity|magnesium ion binding	g.chr10:71973273C>T	AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.457G>A	10.37:g.71973273C>T	ENSP00000362329:p.Asp153Asn		Somatic					p.D153N	NM_021129	NP_066952	WXS	Illumina HiSeq	Unspecified	Q15181	IPYR_HUMAN			6	564	-			153				Magnesium 1 (By similarity).	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Missense_Mutation	SNP	ENST00000373232.3	37	c.457G>A	CCDS7299.1	.	.	.	.	.	.	.	.	.	.	C	36	5.777773	0.96929	0.0	1.16E-4	ENSG00000180817	ENST00000373232;ENST00000373230	T;T	0.70869	-0.52;-0.52	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.90957	0.7157	H	0.99357	4.53	0.80722	D	1	D	0.59767	0.986	D	0.65233	0.933	D	0.94356	0.7583	10	0.87932	D	0	-4.0609	18.604	0.91259	0.0:1.0:0.0:0.0	rs11538284	153	Q15181	IPYR_HUMAN	N	153	ENSP00000362329:D153N;ENSP00000362327:D153N	ENSP00000362327:D153N	D	-	1	0	PPA1	71643279	1.000000	0.71417	0.983000	0.44433	0.970000	0.65996	7.652000	0.83633	2.737000	0.93849	0.585000	0.79938	GAC		0.383	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048490.2	NM_021129		3	71	0	0	0	0.004672	0	3	71				
GOT1	2805	broad.mit.edu	37	10	101163595	101163595	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr10:101163595G>C	ENST00000370508.5	-	6	706	c.679C>G	c.(679-681)Cag>Gag	p.Q227E	GOT1_ENST00000543866.1_Missense_Mutation_p.Q206E	NM_002079.2	NP_002070.1	P17174	AATC_HUMAN	glutamic-oxaloacetic transaminase 1, soluble	227					2-oxoglutarate metabolic process (GO:0006103)|aspartate biosynthetic process (GO:0006532)|aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|carbohydrate metabolic process (GO:0005975)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to insulin stimulus (GO:0032869)|fatty acid homeostasis (GO:0055089)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glutamate catabolic process to 2-oxoglutarate (GO:0019551)|glutamate catabolic process to aspartate (GO:0019550)|glutamate metabolic process (GO:0006536)|glycerol biosynthetic process (GO:0006114)|L-methionine biosynthetic process from methylthioadenosine (GO:0019509)|oxaloacetate metabolic process (GO:0006107)|polyamine metabolic process (GO:0006595)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	carboxylic acid binding (GO:0031406)|L-aspartate:2-oxoglutarate aminotransferase activity (GO:0004069)|L-cysteine:2-oxoglutarate aminotransferase activity (GO:0047801)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|phosphatidylserine decarboxylase activity (GO:0004609)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.Q227E(1)|p.Q227*(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)	16		Ovarian(717;0.028)|Colorectal(252;0.234)		Epithelial(162;4.76e-10)|all cancers(201;3.84e-08)	L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)	GCGAAGCCCTGATAGGCTGAG	0.542																																					Melanoma(173;770 3544 21601)	Melanoma(173;770 3544 21601)	uc001kpr.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(1)|kidney(1)		0						c.(679-681)CAG>GAG		aspartate aminotransferase 1	L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)						63.0	67.0	66.0					10																	101163595		2203	4300	6503	SO:0001583	missense	2805				aspartate catabolic process|cellular response to insulin stimulus|gluconeogenesis|response to glucocorticoid stimulus	cytosol	L-aspartate:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding	g.chr10:101163595G>C	M37400	CCDS7479.1	10q24.1-q25.1	2013-05-29	2013-05-29		ENSG00000120053	ENSG00000120053	2.6.1.1		4432	protein-coding gene	gene with protein product	"""aspartate aminotransferase 1"", ""aspartate transaminase 1"""	138180	"""glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)"""			1974457	Standard	NM_002079		Approved		uc001kpr.3	P17174	OTTHUMG00000018882	ENST00000370508.5:c.679C>G	10.37:g.101163595G>C	ENSP00000359539:p.Gln227Glu		Somatic				GOT1_uc009xwh.2_RNA|GOT1_uc001kpq.1_Intron	p.Q227E	NM_002079	NP_002070	WXS	Illumina HiSeq	Unspecified	P17174	AATC_HUMAN		Epithelial(162;4.76e-10)|all cancers(201;3.84e-08)	6	887	-		Ovarian(717;0.028)|Colorectal(252;0.234)	227					B2R6R7|B7Z7E9|Q5VW80	Missense_Mutation	SNP	ENST00000370508.5	37	c.679C>G	CCDS7479.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909846	0.92107	.	.	ENSG00000120053	ENST00000370508;ENST00000535447;ENST00000543866	D;D	0.90900	-2.75;-2.75	5.6	5.6	0.85130	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.117523	0.64402	D	0.000007	D	0.97025	0.9028	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97791	1.0238	10	0.87932	D	0	-6.5058	19.6558	0.95837	0.0:0.0:1.0:0.0	.	227	P17174	AATC_HUMAN	E	227;180;206	ENSP00000359539:Q227E;ENSP00000445578:Q206E	ENSP00000359539:Q227E	Q	-	1	0	GOT1	101153585	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.869000	0.99810	2.647000	0.89833	0.558000	0.71614	CAG		0.542	GOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049794.1	NM_002079		12	31	0	0	0	0.016723	0	12	31				
PCGF6	84108	broad.mit.edu	37	10	105108755	105108755	+	Splice_Site	SNP	C	C	A	rs370275744		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr10:105108755C>A	ENST00000369847.3	-	2	429	c.362G>T	c.(361-363)cGc>cTc	p.R121L	PCGF6_ENST00000490296.1_5'UTR|PCGF6_ENST00000337211.4_Splice_Site_p.R121L	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	121					negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R121L(2)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		ATTAATCAGGCGCTGCAAATA	0.378																																							uc001kwt.2		NA																	2	Substitution - Missense(2)		lung(2)	kidney(1)	1						c.(361-363)CGC>CTC		polycomb group ring finger 6 isoform a							87.0	84.0	85.0					10																	105108755		2203	4300	6503	SO:0001630	splice_region_variant	84108				negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:105108755C>A	AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.361-1G>T	10.37:g.105108755C>A			Somatic				PCGF6_uc001kwu.2_Missense_Mutation_p.R121L|PCGF6_uc009xxk.2_RNA|PCGF6_uc009xxl.2_RNA|PCGF6_uc009xxm.2_RNA	p.R121L	NM_001011663	NP_001011663	WXS	Illumina HiSeq	Unspecified	Q9BYE7	PCGF6_HUMAN		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)	2	430	-		Colorectal(252;0.0747)|Breast(234;0.128)	121					A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	Missense_Mutation	SNP	ENST00000369847.3	37	c.362G>T	CCDS31275.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491123	0.44249	.	.	ENSG00000156374	ENST00000369847;ENST00000337211	T;T	0.34275	1.4;1.37	4.29	4.29	0.51040	Zinc finger, RING/FYVE/PHD-type (1);	0.325400	0.32901	N	0.005503	T	0.25005	0.0607	N	0.24115	0.695	0.42134	D	0.991488	P;B	0.36633	0.562;0.072	B;B	0.36464	0.225;0.057	T	0.09422	-1.0675	10	0.56958	D	0.05	.	10.5626	0.45154	0.0:0.9094:0.0:0.0906	.	121;121	Q9BYE7-3;Q9BYE7	.;PCGF6_HUMAN	L	121	ENSP00000358862:R121L;ENSP00000338845:R121L	ENSP00000338845:R121L	R	-	2	0	PCGF6	105098745	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.865000	0.48412	2.370000	0.80446	0.561000	0.74099	CGC		0.378	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050132.1	NM_032154	Missense_Mutation	12	37	1	0	1.08611e-07	0.010729	1.24647e-07	12	37				
MAP3K11	4296	broad.mit.edu	37	11	65375408	65375408	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr11:65375408C>A	ENST00000530153.1	-	3	804	c.283G>T	c.(283-285)Gca>Tca	p.A95S	MAP3K11_ENST00000534432.1_5'Flank|MAP3K11_ENST00000309100.3_Missense_Mutation_p.A352S|MAP3K11_ENST00000532507.1_5'Flank					mitogen-activated protein kinase kinase kinase 11									p.A352S(1)		breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(14)|skin(1)	24						ATAAGCTGTGCGAAGGGCTCG	0.612																																							uc001oew.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|lung(1)|central_nervous_system(1)|skin(1)	6						c.(1054-1056)GCA>TCA		mitogen-activated protein kinase kinase kinase							49.0	38.0	42.0					11																	65375408		2201	4297	6498	SO:0001583	missense	4296				activation of JUN kinase activity|cell proliferation|G1 phase of mitotic cell cycle|microtubule-based process|positive regulation of JNK cascade|protein autophosphorylation	centrosome|microtubule	ATP binding|JUN kinase kinase kinase activity|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity	g.chr11:65375408C>A		CCDS8107.1	11q13.1-q13.3	2011-06-09			ENSG00000173327	ENSG00000173327	2.7.10.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6850	protein-coding gene	gene with protein product		600050		MLK3, PTK1		9267807, 8183572	Standard	NM_002419		Approved	SPRK, MEKK11	uc001oew.3	Q16584	OTTHUMG00000166529	ENST00000530153.1:c.283G>T	11.37:g.65375408C>A	ENSP00000433886:p.Ala95Ser		Somatic				MAP3K11_uc001oev.2_5'Flank|MAP3K11_uc010rol.1_Missense_Mutation_p.A95S|MAP3K11_uc001oex.1_5'UTR	p.A352S	NM_002419	NP_002410	WXS	Illumina HiSeq	Unspecified	Q16584	M3K11_HUMAN			3	1547	-			352			Protein kinase.			Missense_Mutation	SNP	ENST00000530153.1	37	c.1054G>T		.	.	.	.	.	.	.	.	.	.	C	13.91	2.378986	0.42207	.	.	ENSG00000173327	ENST00000309100;ENST00000530153;ENST00000526293;ENST00000529839	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	4.8	4.8	0.61643	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.065992	0.64402	D	0.000017	T	0.77260	0.4104	L	0.28115	0.83	0.42258	D	0.992005	P	0.38582	0.638	B	0.41946	0.371	T	0.78912	-0.2017	10	0.45353	T	0.12	.	15.3885	0.74723	0.0:1.0:0.0:0.0	.	352	Q16584	M3K11_HUMAN	S	352;95;102;95	ENSP00000309597:A352S;ENSP00000433886:A95S;ENSP00000435970:A102S;ENSP00000435237:A95S	ENSP00000309597:A352S	A	-	1	0	MAP3K11	65131984	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.718000	0.68455	2.490000	0.84030	0.491000	0.48974	GCA		0.612	MAP3K11-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000390233.2			13	8	1	0	1.49906e-05	0.020292	1.6432e-05	13	8				
BBS1	582	broad.mit.edu	37	11	66282099	66282099	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr11:66282099C>T	ENST00000318312.7	+	4	433	c.382C>T	c.(382-384)Caa>Taa	p.Q128*	BBS1_ENST00000393994.2_Nonsense_Mutation_p.Q128*|CTD-3074O7.11_ENST00000419755.3_Nonsense_Mutation_p.Q165*|BBS1_ENST00000529766.1_3'UTR|BBS1_ENST00000537537.1_Silent_p.P31P|BBS1_ENST00000455748.2_Nonsense_Mutation_p.Q128*	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	128					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)	p.Q128*(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						CAGCCTGCCCCAATTGCCTCC	0.507									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)	GBM(152;173 2612 9770 10137)	uc001oij.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1	GRCh37	CM031130	BBS1	M		c.(382-384)CAA>TAA		Bardet-Biedl syndrome 1							101.0	97.0	99.0					11																	66282099		2200	4295	6495	SO:0001587	stop_gained	582	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	BBSome|cilium membrane|cytoplasm	protein binding	g.chr11:66282099C>T	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.382C>T	11.37:g.66282099C>T	ENSP00000317469:p.Gln128*		Somatic				BBS1_uc001oii.1_Nonsense_Mutation_p.Q165*|BBS1_uc010rpf.1_RNA|BBS1_uc010rpg.1_Nonsense_Mutation_p.Q128*|BBS1_uc001oik.1_Nonsense_Mutation_p.Q52*|BBS1_uc001oil.1_Nonsense_Mutation_p.Q128*	p.Q128*	NM_024649	NP_078925	WXS	Illumina HiSeq	Unspecified	Q8NFJ9	BBS1_HUMAN			4	394	+			128					Q32MM9|Q32MN0|Q96SN4	Nonsense_Mutation	SNP	ENST00000318312.7	37	c.382C>T	CCDS8142.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020214	0.75275	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000455748;ENST00000393994;ENST00000524705	.	.	.	5.09	4.18	0.49190	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	7.6282	0.28224	0.0:0.7455:0.1653:0.0892	.	.	.	.	X	165;128;128;128;35	.	ENSP00000317469:Q128X	Q	+	1	0	BBS1;CTD-3074O7.11	66038675	0.000000	0.05858	0.565000	0.28409	0.908000	0.53690	0.957000	0.29215	1.292000	0.44672	0.558000	0.71614	CAA		0.507	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393235.2			6	79	0	0	0	0.001984	0	6	79				
ME3	10873	broad.mit.edu	37	11	86267677	86267677	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr11:86267677C>A	ENST00000393324.3	-	3	638	c.385G>T	c.(385-387)Gtg>Ttg	p.V129L	ME3_ENST00000323418.6_Missense_Mutation_p.V67L|RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000543262.1_Missense_Mutation_p.V129L|ME3_ENST00000359636.2_Missense_Mutation_p.V129L	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	129					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.V129L(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				AACTTCTCCACGTCCGAAGTC	0.552																																							uc001pbz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(385-387)GTG>TTG		mitochondrial malic enzyme 3 precursor	NADH(DB00157)						116.0	93.0	100.0					11																	86267677		2202	4299	6501	SO:0001583	missense	10873				aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding	g.chr11:86267677C>A	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.385G>T	11.37:g.86267677C>A	ENSP00000376998:p.Val129Leu		Somatic				ME3_uc001pca.2_Missense_Mutation_p.V129L|ME3_uc009yvk.2_Missense_Mutation_p.V129L|ME3_uc010rtr.1_RNA	p.V129L	NM_001014811	NP_001014811	WXS	Illumina HiSeq	Unspecified	Q16798	MAON_HUMAN			3	639	-		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)	129					B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	c.385G>T	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754698	0.49362	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826;ENST00000545395;ENST00000323418;ENST00000530335	T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04	5.96	5.03	0.67393	Malic enzyme, N-terminal (2);	0.052237	0.64402	D	0.000001	T	0.21881	0.0527	N	0.11201	0.11	0.44595	D	0.997563	B	0.20988	0.05	B	0.29716	0.106	T	0.10660	-1.0620	9	.	.	.	-9.6555	4.6648	0.12660	0.1899:0.6388:0.0:0.1714	.	129	Q16798	MAON_HUMAN	L	129;129;129;129;67;67;129	ENSP00000352657:V129L;ENSP00000440246:V129L;ENSP00000376998:V129L;ENSP00000431182:V129L;ENSP00000315255:V67L;ENSP00000434690:V129L	.	V	-	1	0	ME3	85945325	1.000000	0.71417	0.961000	0.40146	0.702000	0.40608	3.253000	0.51469	1.468000	0.48064	0.655000	0.94253	GTG		0.552	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2			14	25	1	0	0.000151284	0.016723	0.000162702	14	25				
OR4D5	219875	broad.mit.edu	37	11	123810836	123810836	+	Silent	SNP	T	T	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr11:123810836T>C	ENST00000307033.2	+	1	587	c.513T>C	c.(511-513)ccT>ccC	p.P171P		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P171P(1)		autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCTGTGGGCCTGACAAGCTGG	0.488																																							uc001pzk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(511-513)CCT>CCC		olfactory receptor, family 4, subfamily D,							143.0	133.0	136.0					11																	123810836		2202	4299	6501	SO:0001819	synonymous_variant	219875				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123810836T>C	BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.513T>C	11.37:g.123810836T>C			Somatic					p.P171P	NM_001001965	NP_001001965	WXS	Illumina HiSeq	Unspecified	Q8NGN0	OR4D5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	513	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	171			Extracellular (Potential).		B9EGZ4|Q6IFE6	Silent	SNP	ENST00000307033.2	37	c.513T>C	CCDS31699.1																																																																																				0.488	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387263.1	NM_001001965		4	86	0	0	0	0.009096	0	4	86				
OR8B8	26493	broad.mit.edu	37	11	124310358	124310358	+	Silent	SNP	A	A	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr11:124310358A>C	ENST00000328064.2	-	1	696	c.624T>G	c.(622-624)ggT>ggG	p.G208G		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	208					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G208G(2)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CTGTGGGCACACCAATATCAA	0.488																																							uc010sal.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(622-624)GGT>GGG		olfactory receptor, family 8, subfamily B,							189.0	157.0	168.0					11																	124310358		2201	4299	6500	SO:0001819	synonymous_variant	26493				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124310358A>C	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.624T>G	11.37:g.124310358A>C			Somatic					p.G208G	NM_012378	NP_036510	WXS	Illumina HiSeq	Unspecified	Q15620	OR8B8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)	1	624	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	208			Helical; Name=5; (Potential).		A1L446|Q96RC8	Silent	SNP	ENST00000328064.2	37	c.624T>G	CCDS8446.1																																																																																				0.488	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378		16	25	0	0	0	0.006122	0	16	25				
MSANTD2	79684	broad.mit.edu	37	11	124637469	124637469	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr11:124637469T>C	ENST00000374979.3	-	4	1291	c.1283A>G	c.(1282-1284)gAa>gGa	p.E428G	MSANTD2_ENST00000526629.1_Missense_Mutation_p.E198G|MSANTD2_ENST00000524950.1_3'UTR|RP11-677M14.3_ENST00000532579.1_RNA|RP11-677M14.3_ENST00000504932.2_RNA|MSANTD2_ENST00000239614.4_Missense_Mutation_p.E376G			Q6P1R3	MSD2_HUMAN	Myb/SANT-like DNA-binding domain containing 2	428								p.E376G(1)									AATACATTCTTCATAGCCAAT	0.502																																							uc001qba.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1282-1284)GAA>GGA		hypothetical protein LOC79684							83.0	90.0	88.0					11																	124637469		2201	4299	6500	SO:0001583	missense	79684							g.chr11:124637469T>C	AK026995	CCDS8454.1, CCDS73408.1	11q24.2	2012-03-02	2012-03-02	2012-03-02	ENSG00000120458	ENSG00000120458			26266	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 61"""	C11orf61			Standard	NM_024631		Approved	FLJ23342	uc001qaz.1	Q6P1R3	OTTHUMG00000165931	ENST00000374979.3:c.1283A>G	11.37:g.124637469T>C	ENSP00000364118:p.Glu428Gly		Somatic				C11orf61_uc001qaz.1_Missense_Mutation_p.E376G|C11orf61_uc010sap.1_Missense_Mutation_p.E148G|C11orf61_uc001qay.1_Missense_Mutation_p.E198G	p.E428G	NM_024631	NP_078907	WXS	Illumina HiSeq	Unspecified	Q6P1R3	CK061_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0079)	4	1306	-	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	428					B3KRY6|Q9H042|Q9H5K8	Missense_Mutation	SNP	ENST00000374979.3	37	c.1283A>G		.	.	.	.	.	.	.	.	.	.	T	21.7	4.184924	0.78677	.	.	ENSG00000120458	ENST00000239614;ENST00000374979;ENST00000526629	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.67998	0.2953	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.991	T	0.70974	-0.4726	9	0.87932	D	0	-13.8578	16.6512	0.85203	0.0:0.0:0.0:1.0	.	428;376	Q6P1R3;Q6P1R3-3	CK061_HUMAN;.	G	376;428;198	.	ENSP00000239614:E376G	E	-	2	0	C11orf61	124142679	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.583000	0.82559	2.333000	0.79357	0.482000	0.46254	GAA		0.502	MSANTD2-002	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000387084.1	NM_024631		16	97	0	0	0	0.003163	0	16	97				
ETS1	2113	broad.mit.edu	37	11	128354828	128354828	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr11:128354828G>A	ENST00000319397.6	-	5	929	c.620C>T	c.(619-621)tCg>tTg	p.S207L	ETS1_ENST00000535549.1_Intron|ETS1_ENST00000392668.4_Missense_Mutation_p.S251L|ETS1_ENST00000345075.4_Missense_Mutation_p.S207L|ETS1_ENST00000526145.2_Missense_Mutation_p.S207L|ETS1_ENST00000531611.1_Missense_Mutation_p.S207L	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	207	Activation domain; required for transcription activation.				angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S207L(1)|p.S251L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		GAGAATGACCGAGGGGTAGTC	0.522																																							uc010sbs.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(4)|central_nervous_system(1)|pleura(1)	6						c.(619-621)TCG>TTG		v-ets erythroblastosis virus E26 oncogene							144.0	129.0	134.0					11																	128354828		2201	4297	6498	SO:0001583	missense	2113				cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr11:128354828G>A		CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.620C>T	11.37:g.128354828G>A	ENSP00000324578:p.Ser207Leu		Somatic				ETS1_uc001qej.2_Missense_Mutation_p.S251L|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Missense_Mutation_p.S207L	p.S207L	NM_005238	NP_005229	WXS	Illumina HiSeq	Unspecified	P14921	ETS1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)	5	936	-	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)	207					A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	ENST00000319397.6	37	c.620C>T	CCDS8475.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.765361	0.31228	.	.	ENSG00000134954	ENST00000345075;ENST00000392668;ENST00000531611;ENST00000319397;ENST00000526145	T;T;T;T;T	0.47177	3.07;2.69;0.85;2.72;3.07	5.67	5.67	0.87782	.	0.505280	0.19302	N	0.117612	T	0.31167	0.0788	N	0.12182	0.205	0.80722	D	1	B;B;B	0.10296	0.0;0.003;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.08086	-1.0739	10	0.39692	T	0.17	.	13.0358	0.58870	0.0736:0.0:0.9264:0.0	.	207;207;251	P14921;Q96AC5;Q6N087	ETS1_HUMAN;.;.	L	207;251;207;207;207	ENSP00000340485:S207L;ENSP00000376436:S251L;ENSP00000435666:S207L;ENSP00000324578:S207L;ENSP00000433500:S207L	ENSP00000324578:S207L	S	-	2	0	ETS1	127860038	0.998000	0.40836	0.943000	0.38184	0.742000	0.42306	3.738000	0.55067	2.673000	0.90976	0.561000	0.74099	TCG		0.522	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386269.2	NM_005238		29	24	0	0	0	0.007291	0	29	24				
PRMT8	56341	broad.mit.edu	37	12	3677968	3677968	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr12:3677968A>G	ENST00000382622.3	+	5	968	c.578A>G	c.(577-579)tAt>tGt	p.Y193C	PRMT8_ENST00000261252.4_3'UTR|PRMT8_ENST00000452611.2_Missense_Mutation_p.Y184C	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	193	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.Y193C(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			TGTCTGTTCTATGAGTCCATG	0.547																																							uc001qmf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(577-579)TAT>TGT		HMT1 hnRNP methyltransferase-like 4							301.0	219.0	247.0					12																	3677968		2203	4300	6503	SO:0001583	missense	56341				regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity	g.chr12:3677968A>G	AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.578A>G	12.37:g.3677968A>G	ENSP00000372067:p.Tyr193Cys		Somatic				PRMT8_uc009zed.2_Missense_Mutation_p.Y184C|PRMT8_uc009zee.1_RNA|PRMT8_uc001qmg.2_Missense_Mutation_p.Y7C	p.Y193C	NM_019854	NP_062828	WXS	Illumina HiSeq	Unspecified	Q9NR22	ANM8_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)		5	945	+			193					B2RDP0|Q8TBJ8	Missense_Mutation	SNP	ENST00000382622.3	37	c.578A>G	CCDS8521.2	.	.	.	.	.	.	.	.	.	.	A	23.7	4.451270	0.84209	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	T;T	0.23147	1.92;1.92	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.62901	0.2466	H	0.94734	3.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.73861	-0.3849	10	0.87932	D	0	.	14.4967	0.67694	1.0:0.0:0.0:0.0	.	184;193	Q9NR22-2;Q9NR22	.;ANM8_HUMAN	C	184;193	ENSP00000414507:Y184C;ENSP00000372067:Y193C	ENSP00000372067:Y193C	Y	+	2	0	PRMT8	3548229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.311000	0.77944	0.533000	0.62120	TAT		0.547	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854		24	65	0	0	0	0.01892	0	24	65				
GALNT8	26290	broad.mit.edu	37	12	4872541	4872541	+	Silent	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr12:4872541C>T	ENST00000252318.2	+	8	1819	c.1482C>T	c.(1480-1482)atC>atT	p.I494I		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	494					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.I494I(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						TCCACACCATCGTGGGCTATG	0.413																																					Colon(108;631 1558 7270 20097 39846)	Colon(108;631 1558 7270 20097 39846)	uc001qne.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(1480-1482)ATC>ATT		polypeptide N-acetylgalactosaminyltransferase 8							116.0	113.0	114.0					12																	4872541		2203	4300	6503	SO:0001819	synonymous_variant	26290					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:4872541C>T	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1482C>T	12.37:g.4872541C>T			Somatic					p.I494I	NM_017417	NP_059113	WXS	Illumina HiSeq	Unspecified	Q9NY28	GALT8_HUMAN			8	1574	+			494			Lumenal (Potential).		B2RU02	Silent	SNP	ENST00000252318.2	37	c.1482C>T	CCDS8533.1	.	.	.	.	.	.	.	.	.	.	C	0.552	-0.849148	0.02651	.	.	ENSG00000130035	ENST00000542998	.	.	.	4.17	0.175	0.15045	.	.	.	.	.	T	0.31949	0.0813	.	.	.	0.23765	N	0.996906	.	.	.	.	.	.	T	0.28522	-1.0041	4	.	.	.	.	7.5619	0.27855	0.0:0.2275:0.0:0.7725	.	.	.	.	L	11	.	.	S	+	2	0	GALNT8	4742802	0.000000	0.05858	0.172000	0.22920	0.286000	0.27126	-1.849000	0.01672	-0.090000	0.12462	0.655000	0.94253	TCG		0.413	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417		29	64	0	0	0	0.012213	0	29	64				
GAPDH	2597	broad.mit.edu	37	12	6647123	6647123	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr12:6647123G>A	ENST00000229239.5	+	8	1565	c.899G>A	c.(898-900)gGc>gAc	p.G300D	GAPDH_ENST00000396859.1_Missense_Mutation_p.G300D|RP5-940J5.9_ENST00000602946.1_RNA|GAPDH_ENST00000396861.1_Missense_Mutation_p.G300D|GAPDH_ENST00000396858.1_Missense_Mutation_p.G258D|GAPDH_ENST00000396856.1_Missense_Mutation_p.G225D	NM_002046.4	NP_002037.2	P04406	G3P_HUMAN	glyceraldehyde-3-phosphate dehydrogenase	300					carbohydrate metabolic process (GO:0005975)|cellular response to interferon-gamma (GO:0071346)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of translation (GO:0017148)|neuron apoptotic process (GO:0051402)|peptidyl-cysteine S-trans-nitrosylation (GO:0035606)|protein stabilization (GO:0050821)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GAIT complex (GO:0097452)|lipid particle (GO:0005811)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)|vesicle (GO:0031982)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|identical protein binding (GO:0042802)|microtubule binding (GO:0008017)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|peptidyl-cysteine S-nitrosylase activity (GO:0035605)	p.G300D(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|lung(4)	7						GCTGGGGCTGGCATTGCCCTC	0.597											OREG0021628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001qop.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(898-900)GGC>GAC		glyceraldehyde-3-phosphate dehydrogenase	NADH(DB00157)						49.0	55.0	53.0					12																	6647123		2202	4299	6501	SO:0001583	missense	2597				gluconeogenesis|glycolysis|neuron apoptosis|peptidyl-cysteine S-trans-nitrosylation|protein stabilization	cytosol|membrane|nucleus|perinuclear region of cytoplasm	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|peptidyl-cysteine S-nitrosylase activity|protein binding	g.chr12:6647123G>A	AF261085	CCDS8549.1, CCDS58201.1	12p13.31	2012-10-02		2005-05-06	ENSG00000111640	ENSG00000111640	1.2.1.12		4141	protein-coding gene	gene with protein product		138400		GAPD		3170585	Standard	NM_002046		Approved		uc001qop.2	P04406	OTTHUMG00000137379	ENST00000229239.5:c.899G>A	12.37:g.6647123G>A	ENSP00000229239:p.Gly300Asp		Somatic	OREG0021628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	635	GAPDH_uc009zep.1_Missense_Mutation_p.G258D|GAPDH_uc001qoq.1_Missense_Mutation_p.G225D|GAPDH_uc001qor.1_Missense_Mutation_p.G259D|GAPDH_uc001qos.1_Missense_Mutation_p.G300D|GAPDH_uc001qot.1_Missense_Mutation_p.G300D|GAPDH_uc001qou.1_Missense_Mutation_p.G259D|GAPDH_uc001qov.1_Missense_Mutation_p.G258D|GAPDH_uc001qow.1_Missense_Mutation_p.G253D|GAPDH_uc001qox.1_Missense_Mutation_p.G126D	p.G300D	NM_002046	NP_002037	WXS	Illumina HiSeq	Unspecified	P04406	G3P_HUMAN			8	1001	+			300					E7EUT4|P00354|Q53X65	Missense_Mutation	SNP	ENST00000229239.5	37	c.899G>A	CCDS8549.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.967047	0.92855	.	.	ENSG00000111640	ENST00000229239;ENST00000396856;ENST00000396861;ENST00000396859;ENST00000396858	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	4.84	4.84	0.62591	Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76744	0.4030	M	0.92833	3.35	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;0.999;0.998	D;D;D;D	0.97110	1.0;1.0;0.975;0.966	D	0.83866	0.0271	10	0.87932	D	0	.	18.0367	0.89305	0.0:0.0:1.0:0.0	.	258;300;225;300	E7EUT4;Q2TSD0;E7EUT5;P04406	.;.;.;G3P_HUMAN	D	300;225;300;300;258	ENSP00000229239:G300D;ENSP00000380065:G225D;ENSP00000380070:G300D;ENSP00000380068:G300D;ENSP00000380067:G258D	ENSP00000229239:G300D	G	+	2	0	GAPDH	6517384	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.831000	0.99420	2.247000	0.74100	0.556000	0.70494	GGC		0.597	GAPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268059.1	NM_002046		3	49	0	0	0	0.004672	0	3	49				
GUCY2C	2984	broad.mit.edu	37	12	14778702	14778702	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr12:14778702C>T	ENST00000261170.3	-	21	2533	c.2397G>A	c.(2395-2397)atG>atA	p.M799I		NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	799					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)	p.M799I(1)		breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	TTGGAAGCAACATAAAGTTAA	0.428																																							uc001rcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)	6						c.(2395-2397)ATG>ATA		guanylate cyclase 2C precursor							220.0	190.0	200.0					12																	14778702		2203	4300	6503	SO:0001583	missense	2984				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity	g.chr12:14778702C>T		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.2397G>A	12.37:g.14778702C>T	ENSP00000261170:p.Met799Ile		Somatic					p.M799I	NM_004963	NP_004954	WXS	Illumina HiSeq	Unspecified	P25092	GUC2C_HUMAN			21	2534	-			799			Cytoplasmic (Potential).		B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	c.2397G>A	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.855353	0.71719	.	.	ENSG00000070019	ENST00000261170	T	0.80909	-1.43	5.35	5.35	0.76521	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.036481	0.85682	D	0.000000	D	0.82981	0.5155	M	0.78223	2.4	0.80722	D	1	B	0.26845	0.161	B	0.32677	0.15	T	0.79271	-0.1872	10	0.27082	T	0.32	.	19.4318	0.94772	0.0:1.0:0.0:0.0	.	799	P25092	GUC2C_HUMAN	I	799	ENSP00000261170:M799I	ENSP00000261170:M799I	M	-	3	0	GUCY2C	14669969	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.724000	0.84798	2.668000	0.90789	0.591000	0.81541	ATG		0.428	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1			26	82	0	0	0	0.005443	0	26	82				
ASUN	55726	broad.mit.edu	37	12	27066581	27066581	+	Silent	SNP	G	G	A	rs377055805		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr12:27066581G>A	ENST00000261191.7	-	14	2150	c.1614C>T	c.(1612-1614)acC>acT	p.T538T	ASUN_ENST00000539625.1_Silent_p.T437T	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	538					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T538T(1)									CTCTGACAAGGGTTTCTAATT	0.393																																							uc001rhk.3		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(1612-1614)ACC>ACT		hypothetical protein LOC55726							266.0	266.0	266.0					12																	27066581		2203	4300	6503	SO:0001819	synonymous_variant	55726				cell division|mitosis|regulation of mitotic cell cycle		protein binding	g.chr12:27066581G>A	AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.1614C>T	12.37:g.27066581G>A			Somatic				C12orf11_uc001rhj.3_Silent_p.T106T|C12orf11_uc010sjk.1_Silent_p.T437T	p.T538T	NM_018164	NP_060634	WXS	Illumina HiSeq	Unspecified	Q9NVM9	M89BB_HUMAN			14	2151	-	Colorectal(261;0.0847)		538					B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Silent	SNP	ENST00000261191.7	37	c.1614C>T	CCDS8708.1																																																																																				0.393	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402819.1	NM_018164		66	206	0	0	0	0.01441	0	66	206				
ZFC3H1	196441	broad.mit.edu	37	12	72022764	72022764	+	Silent	SNP	T	T	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr12:72022764T>G	ENST00000378743.3	-	20	4238	c.3880A>C	c.(3880-3882)Aga>Cga	p.R1294R		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1294					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R1294R(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ATAGGTTTTCTCCAAAACTTT	0.313																																							uc001swo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(3880-3882)AGA>CGA		proline/serine-rich coiled-coil 2							137.0	126.0	129.0					12																	72022764		1823	4081	5904	SO:0001819	synonymous_variant	196441				RNA processing	intracellular	metal ion binding	g.chr12:72022764T>G	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.3880A>C	12.37:g.72022764T>G			Somatic					p.R1294R	NM_144982	NP_659419	WXS	Illumina HiSeq	Unspecified	O60293	ZC3H1_HUMAN			20	4239	-			1294					Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Silent	SNP	ENST00000378743.3	37	c.3880A>C	CCDS41813.1																																																																																				0.313	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982		4	27	0	0	0	0.009096	0	4	27				
MYO1H	283446	broad.mit.edu	37	12	109872885	109872885	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr12:109872885G>A	ENST00000431443.2	+	20	2089	c.2089G>A	c.(2089-2091)Gaa>Aaa	p.E697K	MYO1H_ENST00000310903.5_Missense_Mutation_p.E687K	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	697	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E687K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						GTTTGCTACCGAAGATGCCTT	0.348																																							uc010sxn.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2059-2061)GAA>AAA		myosin 1H							99.0	91.0	93.0					12																	109872885		1825	4081	5906	SO:0001583	missense	283446					myosin complex	motor activity	g.chr12:109872885G>A		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.2089G>A	12.37:g.109872885G>A	ENSP00000444076:p.Glu697Lys		Somatic					p.E687K	NM_001101421	NP_001094891	WXS	Illumina HiSeq	Unspecified	Q8N1T3	MYO1H_HUMAN			20	2059	+			Error:Variant_position_missing_in_B4DNW6_after_alignment					F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	37	c.2059G>A		.	.	.	.	.	.	.	.	.	.	G	29.0	4.967064	0.92855	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	T;T	0.74737	-0.87;-0.87	4.63	4.63	0.57726	.	.	.	.	.	D	0.85031	0.5604	M	0.85630	2.765	0.46849	D	0.999228	D	0.69078	0.997	P	0.58266	0.836	D	0.88155	0.2853	9	0.87932	D	0	.	15.3452	0.74330	0.0:0.0:1.0:0.0	.	687	F5H3C6	.	K	687;697	ENSP00000439182:E687K;ENSP00000444076:E697K	ENSP00000439182:E687K	E	+	1	0	MYO1H	108357268	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	9.111000	0.94308	2.285000	0.76669	0.655000	0.94253	GAA		0.348	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597		11	21	0	0	0	0.013537	0	11	21				
NOS1	4842	broad.mit.edu	37	12	117672562	117672562	+	Splice_Site	SNP	G	G	A	rs565699307		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr12:117672562G>A	ENST00000338101.4	-	21	3149	c.3145C>T	c.(3145-3147)Cgg>Tgg	p.R1049W	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Splice_Site_p.R1015W			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.R1015W(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		ATAGTTGACCGACTGCAGGAA	0.552																																					Esophageal Squamous(162;1748 2599 51982 52956)	Esophageal Squamous(162;1748 2599 51982 52956)	uc001twm.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(3)|skin(3)|pancreas(1)	7						c.(3043-3045)CGG>TGG		nitric oxide synthase 1, neuronal	L-Citrulline(DB00155)						31.0	33.0	32.0					12																	117672562		2021	4188	6209	SO:0001630	splice_region_variant	4842				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	g.chr12:117672562G>A		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3144-1C>T	12.37:g.117672562G>A			Somatic					p.R1015W	NM_000620	NP_000611	WXS	Illumina HiSeq	Unspecified	P29475	NOS1_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0561)	21	3729	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		1015			FAD-binding FR-type.			Missense_Mutation	SNP	ENST00000338101.4	37	c.3043C>T	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377548	0.61735	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.78364	-1.17;-1.17	4.65	4.65	0.58169	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.91469	0.7307	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93812	0.7111	10	0.87932	D	0	-14.5882	18.067	0.89394	0.0:0.0:1.0:0.0	.	1015	P29475	NOS1_HUMAN	W	910;1015;1015;1049	ENSP00000320758:R1015W;ENSP00000337459:R1049W	ENSP00000320758:R1015W	R	-	1	2	NOS1	116156945	1.000000	0.71417	0.989000	0.46669	0.022000	0.10575	7.511000	0.81718	2.568000	0.86640	0.561000	0.74099	CGG		0.552	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		Missense_Mutation	4	24	0	0	0	0.001168	0	4	24				
KNTC1	9735	broad.mit.edu	37	12	123087269	123087269	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr12:123087269A>C	ENST00000333479.7	+	46	4984	c.4807A>C	c.(4807-4809)Aac>Cac	p.N1603H	KNTC1_ENST00000450485.2_Intron|KNTC1_ENST00000436959.3_5'UTR|KNTC1_ENST00000537348.1_Missense_Mutation_p.N28H	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1603					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.N1603H(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		CACAGCACAGAACTTCTGGAA	0.353																																							uc001ucv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10						c.(4807-4809)AAC>CAC		Rough Deal homolog, centromere/kinetochore							106.0	96.0	99.0					12																	123087269		1859	4093	5952	SO:0001583	missense	9735				cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding	g.chr12:123087269A>C		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.4807A>C	12.37:g.123087269A>C	ENSP00000328236:p.Asn1603His		Somatic				KNTC1_uc010taf.1_Intron	p.N1603H	NM_014708	NP_055523	WXS	Illumina HiSeq	Unspecified	P50748	KNTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)	46	4970	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		1603					A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	c.4807A>C	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	A	12.14	1.848433	0.32699	.	.	ENSG00000184445	ENST00000333479;ENST00000537348	T;T	0.29397	1.57;1.57	5.77	5.77	0.91146	RZZ complex, subunit KNTC1/ROD, C-terminal (1);	0.240948	0.49305	D	0.000154	T	0.28466	0.0704	L	0.34521	1.04	0.31320	N	0.686169	P	0.37612	0.602	P	0.45377	0.478	T	0.19516	-1.0303	10	0.13108	T	0.6	-20.1386	10.9927	0.47559	0.8273:0.0:0.0:0.1727	.	1603	P50748	KNTC1_HUMAN	H	1603;28	ENSP00000328236:N1603H;ENSP00000443622:N28H	ENSP00000328236:N1603H	N	+	1	0	KNTC1	121653222	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.855000	0.48333	2.203000	0.70933	0.533000	0.62120	AAC		0.353	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2			7	36	0	0	0	0.00308	0	7	36				
SHISA2	387914	broad.mit.edu	37	13	26620830	26620830	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr13:26620830G>A	ENST00000319420.3	-	2	764	c.709C>T	c.(709-711)Cca>Tca	p.P237S		NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	237					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.P237S(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						CCTTGATGTGGCACAATCTGG	0.557																																							uc001uqm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(709-711)CCA>TCA		shisa homolog 2 precursor							146.0	120.0	128.0					13																	26620830		2203	4300	6503	SO:0001583	missense	387914				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane		g.chr13:26620830G>A		CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.709C>T	13.37:g.26620830G>A	ENSP00000313079:p.Pro237Ser		Somatic					p.P237S	NM_001007538	NP_001007539	WXS	Illumina HiSeq	Unspecified	Q6UWI4	SHSA2_HUMAN			2	794	-			237			Cytoplasmic (Potential).		B9EH70|Q5W0G8	Missense_Mutation	SNP	ENST00000319420.3	37	c.709C>T	CCDS31951.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.903676	0.52333	.	.	ENSG00000180730	ENST00000319420	T	0.47528	0.84	5.55	5.55	0.83447	.	0.063753	0.64402	D	0.000005	T	0.34483	0.0899	L	0.27053	0.805	0.80722	D	1	P	0.48503	0.911	B	0.35073	0.195	T	0.13872	-1.0493	10	0.30078	T	0.28	-24.4753	19.5067	0.95121	0.0:0.0:1.0:0.0	.	237	Q6UWI4	SHSA2_HUMAN	S	237	ENSP00000313079:P237S	ENSP00000313079:P237S	P	-	1	0	SHISA2	25518830	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.268000	0.78473	2.609000	0.88269	0.650000	0.86243	CCA		0.557	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044239.2	NM_001007538		3	56	0	0	0	0.004672	0	3	56				
ZC3H13	23091	broad.mit.edu	37	13	46559563	46559563	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr13:46559563C>T	ENST00000242848.4	-	10	1937	c.1589G>A	c.(1588-1590)gGc>gAc	p.G530D	ZC3H13_ENST00000282007.3_Missense_Mutation_p.G530D			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	530	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.G530D(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		ATGGTTTCGGCCATAACTCCG	0.463																																					Esophageal Squamous(187;747 2077 11056 31291 44172)	Esophageal Squamous(187;747 2077 11056 31291 44172)	uc010tfw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(1588-1590)GGC>GAC		zinc finger CCCH-type containing 13							106.0	103.0	104.0					13																	46559563		2203	4300	6503	SO:0001583	missense	23091						nucleic acid binding|zinc ion binding	g.chr13:46559563C>T	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1589G>A	13.37:g.46559563C>T	ENSP00000242848:p.Gly530Asp		Somatic				ZC3H13_uc001vas.1_Missense_Mutation_p.G530D|ZC3H13_uc001vat.1_Missense_Mutation_p.G530D	p.G530D	NM_015070	NP_055885	WXS	Illumina HiSeq	Unspecified	Q5T200	ZC3HD_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)	9	1595	-		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	530			Arg/Ser-rich.		A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	ENST00000242848.4	37	c.1589G>A		.	.	.	.	.	.	.	.	.	.	C	13.93	2.383687	0.42308	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	T;T	0.34072	2.38;1.38	5.73	5.73	0.89815	.	0.187693	0.37715	N	0.001965	T	0.36303	0.0962	L	0.34521	1.04	0.80722	D	1	D;D	0.53619	0.961;0.959	B;P	0.48030	0.36;0.564	T	0.01781	-1.1275	10	0.19590	T	0.45	.	18.4403	0.90664	0.0:1.0:0.0:0.0	.	530;530	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	D	530;530;346	ENSP00000242848:G530D;ENSP00000282007:G530D	ENSP00000242848:G530D	G	-	2	0	ZC3H13	45457564	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.915000	0.56409	2.861000	0.98227	0.655000	0.94253	GGC		0.463	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070		13	59	0	0	0	0.016723	0	13	59				
WDR25	79446	broad.mit.edu	37	14	100847837	100847837	+	Silent	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr14:100847837C>T	ENST00000335290.6	+	2	802	c.576C>T	c.(574-576)ggC>ggT	p.G192G	WDR25_ENST00000554998.1_Silent_p.G192G|WDR25_ENST00000402312.3_Silent_p.G192G|WDR25_ENST00000542471.2_5'Flank|WDR25_ENST00000554175.1_Silent_p.G192G	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	192								p.G192G(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				CGGAGACAGGCAAGGGTAAAG	0.542																																							uc010avx.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(574-576)GGC>GGT		WD repeat domain 25							70.0	78.0	75.0					14																	100847837		2203	4300	6503	SO:0001819	synonymous_variant	79446							g.chr14:100847837C>T	BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.576C>T	14.37:g.100847837C>T			Somatic				WDR25_uc001yhm.2_Silent_p.G184G|WDR25_uc001yhn.2_Silent_p.G192G|WDR25_uc010avy.2_RNA|WDR25_uc001yho.2_5'Flank	p.G192G	NM_001161476	NP_001154948	WXS	Illumina HiSeq	Unspecified	Q64LD2	WDR25_HUMAN			2	669	+		Melanoma(154;0.212)	192					A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Silent	SNP	ENST00000335290.6	37	c.576C>T	CCDS32157.1																																																																																				0.542	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1	NM_024515		5	87	0	0	0	0.001168	0	5	87				
BRF1	2972	broad.mit.edu	37	14	105692426	105692426	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr14:105692426A>C	ENST00000546474.1	-	10	15987	c.1028T>G	c.(1027-1029)cTg>cGg	p.L343R	BRF1_ENST00000446501.2_Missense_Mutation_p.L105R|BRF1_ENST00000551787.1_Intron|BRF1_ENST00000440513.3_Missense_Mutation_p.L228R|BRF1_ENST00000327359.3_Missense_Mutation_p.L228R|BRF1_ENST00000379937.2_Missense_Mutation_p.L316R|BRF1_ENST00000392557.4_Missense_Mutation_p.L139R|BRF1_ENST00000379932.4_Intron	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	343					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)	p.L228R(1)|p.L343R(1)		NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		CAGGCTGGCCAGGCCCCCCTT	0.468																																							uc001yqp.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(1027-1029)CTG>CGG		transcription initiation factor IIIB isoform 1							69.0	75.0	73.0					14																	105692426		2203	4300	6503	SO:0001583	missense	2972				positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding	g.chr14:105692426A>C	U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.1028T>G	14.37:g.105692426A>C	ENSP00000448323:p.Leu343Arg		Somatic				BRF1_uc010tyo.1_Missense_Mutation_p.L228R|BRF1_uc010typ.1_Missense_Mutation_p.L228R|BRF1_uc001yql.2_Missense_Mutation_p.L139R|BRF1_uc001yqo.2_Missense_Mutation_p.L105R|BRF1_uc010axg.1_Missense_Mutation_p.L316R|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron	p.L343R	NM_001519	NP_001510	WXS	Illumina HiSeq	Unspecified	Q92994	TF3B_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)	10	1391	-		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	343					B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Missense_Mutation	SNP	ENST00000546474.1	37	c.1028T>G	CCDS10001.1	.	.	.	.	.	.	.	.	.	.	A	12.69	2.013773	0.35511	.	.	ENSG00000185024	ENST00000392557;ENST00000379937;ENST00000546474;ENST00000446501;ENST00000327359;ENST00000440513;ENST00000547562;ENST00000549655;ENST00000552127	.	.	.	5.35	4.17	0.49024	.	0.198709	0.43579	N	0.000549	T	0.39759	0.1090	L	0.56769	1.78	0.26455	N	0.975536	B;B;B	0.24186	0.08;0.099;0.027	B;B;B	0.26416	0.045;0.069;0.012	T	0.29150	-1.0021	9	0.24483	T	0.36	.	6.0683	0.19875	0.6662:0.1703:0.0:0.1634	.	228;316;343	F5H5Z7;Q92994-5;Q92994	.;.;TF3B_HUMAN	R	139;316;343;105;228;228;63;139;139	.	ENSP00000329029:L228R	L	-	2	0	BRF1	104763471	0.998000	0.40836	0.001000	0.08648	0.955000	0.61496	4.470000	0.60175	0.836000	0.34901	0.454000	0.30748	CTG		0.468	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074548.4	NM_001519		15	65	0	0	0	0.003163	0	15	65				
USP8	9101	broad.mit.edu	37	15	50769639	50769639	+	Silent	SNP	T	T	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr15:50769639T>G	ENST00000396444.3	+	10	1499	c.1161T>G	c.(1159-1161)tcT>tcG	p.S387S	USP8_ENST00000425032.3_Silent_p.S310S|USP8_ENST00000307179.4_Silent_p.S387S|USP8_ENST00000433963.1_Silent_p.S387S	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	387					cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)	p.S387S(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TTGCTGCTTCTAAATCTGATG	0.338																																							uc001zym.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(1159-1161)TCT>TCG		ubiquitin specific peptidase 8							97.0	101.0	100.0					15																	50769639		2196	4294	6490	SO:0001819	synonymous_variant	9101				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr15:50769639T>G	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.1161T>G	15.37:g.50769639T>G			Somatic				USP8_uc001zyk.1_Silent_p.S88S|USP8_uc001zyl.3_Silent_p.S387S|USP8_uc001zyn.3_Silent_p.S387S|USP8_uc010ufh.1_Silent_p.S310S|USP8_uc010bev.1_Silent_p.S16S	p.S387S	NM_001128611	NP_001122083	WXS	Illumina HiSeq	Unspecified	P40818	UBP8_HUMAN		all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)	11	1661	+			387					B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Silent	SNP	ENST00000396444.3	37	c.1161T>G	CCDS10137.1																																																																																				0.338	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154		17	53	0	0	0	0.008871	0	17	53				
ADAMTS7	11173	broad.mit.edu	37	15	79058500	79058500	+	Silent	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr15:79058500G>A	ENST00000388820.4	-	19	3963	c.3753C>T	c.(3751-3753)tcC>tcT	p.S1251S	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1251					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S1251S(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GACTAGGAGAGGAGTGGGTGC	0.662																																							uc002bej.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(3751-3753)TCC>TCT		ADAM metallopeptidase with thrombospondin type 1							19.0	21.0	20.0					15																	79058500		2193	4286	6479	SO:0001819	synonymous_variant	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79058500G>A	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3753C>T	15.37:g.79058500G>A			Somatic				ADAMTS7_uc010und.1_3'UTR	p.S1251S	NM_014272	NP_055087	WXS	Illumina HiSeq	Unspecified	Q9UKP4	ATS7_HUMAN			19	3964	-			1251					Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	c.3753C>T	CCDS32303.1																																																																																				0.662	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		15	33	0	0	0	0.004007	0	15	33				
ARNT2	9915	broad.mit.edu	37	15	80869214	80869214	+	Silent	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr15:80869214G>A	ENST00000303329.4	+	15	1686	c.1521G>A	c.(1519-1521)aaG>aaA	p.K507K	ARNT2_ENST00000533983.1_Silent_p.K496K|ARNT2_ENST00000527771.1_Silent_p.K496K	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	507					central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.K507K(1)		NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			TAGCGGAGAAGAAGATGATGA	0.582																																							uc002bfr.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(3)|ovary(1)|pancreas(1)	5						c.(1519-1521)AAG>AAA		aryl hydrocarbon receptor nuclear translocator							120.0	115.0	117.0					15																	80869214		2203	4300	6503	SO:0001819	synonymous_variant	9915				central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr15:80869214G>A	AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.1521G>A	15.37:g.80869214G>A			Somatic				ARNT2_uc010unm.1_Silent_p.K496K|ARNT2_uc002bfs.2_Silent_p.K496K	p.K507K	NM_014862	NP_055677	WXS	Illumina HiSeq	Unspecified	Q9HBZ2	ARNT2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.134)		15	1687	+			507					B4DIS7|O15024|Q8IYC2	Silent	SNP	ENST00000303329.4	37	c.1521G>A	CCDS32307.1																																																																																				0.582	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384389.2			27	65	0	0	0	0.009535	0	27	65				
ARNT2	9915	broad.mit.edu	37	15	80869217	80869217	+	Silent	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr15:80869217G>A	ENST00000303329.4	+	15	1689	c.1524G>A	c.(1522-1524)aaG>aaA	p.K508K	ARNT2_ENST00000533983.1_Silent_p.K497K|ARNT2_ENST00000527771.1_Silent_p.K497K	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	508					central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.K508K(1)		NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			CGGAGAAGAAGATGATGAGCT	0.582																																							uc002bfr.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(3)|ovary(1)|pancreas(1)	5						c.(1522-1524)AAG>AAA		aryl hydrocarbon receptor nuclear translocator							123.0	118.0	120.0					15																	80869217		2203	4300	6503	SO:0001819	synonymous_variant	9915				central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr15:80869217G>A	AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.1524G>A	15.37:g.80869217G>A			Somatic				ARNT2_uc010unm.1_Silent_p.K497K|ARNT2_uc002bfs.2_Silent_p.K497K	p.K508K	NM_014862	NP_055677	WXS	Illumina HiSeq	Unspecified	Q9HBZ2	ARNT2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.134)		15	1690	+			508					B4DIS7|O15024|Q8IYC2	Silent	SNP	ENST00000303329.4	37	c.1524G>A	CCDS32307.1																																																																																				0.582	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384389.2			27	68	0	0	0	0.00632	0	27	68				
IDH2	3418	broad.mit.edu	37	15	90634804	90634804	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr15:90634804C>T	ENST00000330062.3	-	2	301	c.188G>A	c.(187-189)tGg>tAg	p.W63*	IDH2_ENST00000540499.2_Nonsense_Mutation_p.W11*|IDH2_ENST00000539790.1_Intron|IDH2_ENST00000559482.1_Nonsense_Mutation_p.W63*	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	63					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.W63*(1)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			GATGAACTGCCAGATAATACG	0.562			M		GBM																																		uc002box.2		NA		Dom	yes		15	15q26.1	3418	M	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """			M			GBM		1	Substitution - Nonsense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(621)|central_nervous_system(80)|bone(7)|skin(3)	711						c.(187-189)TGG>TAG		isocitrate dehydrogenase 2 (NADP+),							209.0	169.0	182.0					15																	90634804		2200	4298	6498	SO:0001587	stop_gained	3418				2-oxoglutarate metabolic process|glyoxylate cycle|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding	g.chr15:90634804C>T		CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.188G>A	15.37:g.90634804C>T	ENSP00000331897:p.Trp63*		Somatic				IDH2_uc010uqb.1_Nonsense_Mutation_p.W11*|IDH2_uc010uqc.1_Intron|IDH2_uc010bnu.2_Nonsense_Mutation_p.W63*	p.W63*	NM_002168	NP_002159	WXS	Illumina HiSeq	Unspecified	P48735	IDHP_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)		2	274	-	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		63					B2R6L6|B4DFL2|Q96GT3	Nonsense_Mutation	SNP	ENST00000330062.3	37	c.188G>A	CCDS10359.1	.	.	.	.	.	.	.	.	.	.	C	37	6.333923	0.97480	.	.	ENSG00000182054	ENST00000330062;ENST00000540499	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.6873	0.85312	0.0:1.0:0.0:0.0	.	.	.	.	X	63;11	.	ENSP00000331897:W63X	W	-	2	0	IDH2	88435808	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	7.797000	0.85911	2.536000	0.85505	0.561000	0.74099	TGG		0.562	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1			3	105	0	0	0	0.004672	0	3	105				
SRRM2	23524	broad.mit.edu	37	16	2813050	2813050	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr16:2813050C>T	ENST00000301740.8	+	11	3070	c.2521C>T	c.(2521-2523)Cat>Tat	p.H841Y		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	841	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.H841Y(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TTCATCTCCTCATCCTAAAGT	0.493																																							uc002crk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(2521-2523)CAT>TAT		splicing coactivator subunit SRm300							181.0	178.0	179.0					16																	2813050		2198	4300	6498	SO:0001583	missense	23524					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding	g.chr16:2813050C>T	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2521C>T	16.37:g.2813050C>T	ENSP00000301740:p.His841Tyr		Somatic				SRRM2_uc002crj.1_Missense_Mutation_p.H745Y|SRRM2_uc002crl.1_Missense_Mutation_p.H841Y|SRRM2_uc010bsu.1_Missense_Mutation_p.H745Y	p.H841Y	NM_016333	NP_057417	WXS	Illumina HiSeq	Unspecified	Q9UQ35	SRRM2_HUMAN			11	3070	+			841			Ser-rich.		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	c.2521C>T	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	2.717	-0.267506	0.05754	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933;ENST00000426305	T	0.23147	1.92	5.49	2.25	0.28309	.	0.815187	0.10997	N	0.610902	T	0.09905	0.0243	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34601	-0.9822	10	0.14252	T	0.57	0.1144	2.1923	0.03902	0.1563:0.5184:0.1516:0.1737	.	841	Q9UQ35	SRRM2_HUMAN	Y	841;841;93;806	ENSP00000301740:H841Y	ENSP00000301740:H841Y	H	+	1	0	SRRM2	2753051	0.381000	0.25140	0.981000	0.43875	0.629000	0.37895	0.450000	0.21762	1.333000	0.45449	0.655000	0.94253	CAT		0.493	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			43	102	0	0	0	0.00874	0	43	102				
GTF3C1	2975	broad.mit.edu	37	16	27481580	27481580	+	Missense_Mutation	SNP	C	C	T	rs369166362		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr16:27481580C>T	ENST00000356183.4	-	31	4678	c.4663G>A	c.(4663-4665)Gac>Aac	p.D1555N	GTF3C1_ENST00000561623.1_Missense_Mutation_p.D1555N	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1555					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.D1555N(1)		breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCCACCATGTCGTTTGTGGGC	0.537																																							uc002dov.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(4663-4665)GAC>AAC		general transcription factor IIIC, polypeptide							126.0	125.0	126.0					16																	27481580		2197	4300	6497	SO:0001583	missense	2975					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr16:27481580C>T	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4663G>A	16.37:g.27481580C>T	ENSP00000348510:p.Asp1555Asn		Somatic				GTF3C1_uc002dou.2_Missense_Mutation_p.D1555N	p.D1555N	NM_001520	NP_001511	WXS	Illumina HiSeq	Unspecified	Q12789	TF3C1_HUMAN			31	4703	-			1555					B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	c.4663G>A	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	C	16.32	3.090361	0.55968	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.24908	1.83	5.57	3.59	0.41128	.	0.105092	0.64402	N	0.000005	T	0.28928	0.0718	M	0.67953	2.075	0.30340	N	0.785851	D;P	0.54047	0.964;0.854	P;B	0.44623	0.455;0.308	T	0.22138	-1.0225	10	0.30078	T	0.28	-20.7252	10.8198	0.46597	0.0:0.7969:0.1315:0.0715	.	1555;1555	Q12789;Q12789-3	TF3C1_HUMAN;.	N	1555;1551	ENSP00000348510:D1555N	ENSP00000348510:D1555N	D	-	1	0	GTF3C1	27389081	0.997000	0.39634	0.613000	0.29037	0.554000	0.35429	4.282000	0.58971	0.690000	0.31570	0.591000	0.81541	GAC		0.537	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520		28	102	0	0	0	0.013726	0	28	102				
ZNF48	197407	broad.mit.edu	37	16	30408675	30408675	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr16:30408675C>T	ENST00000320159.2	+	2	480	c.104C>T	c.(103-105)tCt>tTt	p.S35F	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	35					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S35F(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						AACGTGATTTCTCAGCCGAAT	0.468																																							uc002dya.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(103-105)TCT>TTT		zinc finger protein 48							93.0	94.0	94.0					16																	30408675		2197	4300	6497	SO:0001583	missense	197407				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:30408675C>T	M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.104C>T	16.37:g.30408675C>T	ENSP00000324056:p.Ser35Phe		Somatic				ZNF48_uc002dxz.1_5'UTR	p.S35F	NM_152652	NP_689865	WXS	Illumina HiSeq	Unspecified	Q96MX3	ZNF48_HUMAN			2	163	+			35					Q15920|Q4G0R3|Q69YP3|Q96IL9	Missense_Mutation	SNP	ENST00000320159.2	37	c.104C>T	CCDS10679.1	.	.	.	.	.	.	.	.	.	.	C	3.490	-0.104004	0.06967	.	.	ENSG00000180035	ENST00000495929;ENST00000528032;ENST00000524644;ENST00000320159	T;T;T	0.07567	3.38;3.32;3.18	4.61	3.63	0.41609	.	0.402479	0.18487	N	0.139765	T	0.06142	0.0159	N	0.14661	0.345	0.09310	N	1	B	0.32693	0.38	B	0.34991	0.193	T	0.36962	-0.9726	10	0.33141	T	0.24	0.2317	12.558	0.56265	0.0:0.8308:0.1692:0.0	.	35	Q96MX3	ZNF48_HUMAN	F	160;35;35;35	ENSP00000435674:S35F;ENSP00000432548:S35F;ENSP00000324056:S35F	ENSP00000324056:S35F	S	+	2	0	ZNF48	30316176	0.000000	0.05858	0.012000	0.15200	0.112000	0.19704	0.961000	0.29267	1.240000	0.43803	0.563000	0.77884	TCT		0.468	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255549.2	NM_152652		15	54	0	0	0	0.006122	0	15	54				
ZNF48	197407	broad.mit.edu	37	16	30409150	30409150	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr16:30409150C>G	ENST00000320159.2	+	2	955	c.579C>G	c.(577-579)atC>atG	p.I193M	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I193M(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						GCCCCACTATCTGTGGTGAAT	0.592																																							uc002dya.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(577-579)ATC>ATG		zinc finger protein 48							36.0	41.0	39.0					16																	30409150		2197	4300	6497	SO:0001583	missense	197407				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:30409150C>G	M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.579C>G	16.37:g.30409150C>G	ENSP00000324056:p.Ile193Met		Somatic				ZNF48_uc002dxz.1_Missense_Mutation_p.I70M	p.I193M	NM_152652	NP_689865	WXS	Illumina HiSeq	Unspecified	Q96MX3	ZNF48_HUMAN			2	638	+			193			C2H2-type 3.		Q15920|Q4G0R3|Q69YP3|Q96IL9	Missense_Mutation	SNP	ENST00000320159.2	37	c.579C>G	CCDS10679.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.391763	0.42410	.	.	ENSG00000180035	ENST00000495929;ENST00000320159	T	0.28895	1.59	5.01	-0.321	0.12717	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40818	N	0.001005	T	0.22820	0.0551	N	0.16307	0.4	0.26092	N	0.980933	B	0.31503	0.326	B	0.42653	0.394	T	0.31081	-0.9956	10	0.66056	D	0.02	-9.4899	9.1036	0.36685	0.0:0.6008:0.0:0.3992	.	193	Q96MX3	ZNF48_HUMAN	M	318;193	ENSP00000324056:I193M	ENSP00000324056:I193M	I	+	3	3	ZNF48	30316651	0.000000	0.05858	0.996000	0.52242	0.992000	0.81027	-0.502000	0.06390	0.052000	0.16007	-0.214000	0.12660	ATC		0.592	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255549.2	NM_152652		10	29	0	0	0	0.008291	0	10	29				
SRCAP	10847	broad.mit.edu	37	16	30732059	30732059	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr16:30732059G>C	ENST00000262518.4	+	20	3398	c.3013G>C	c.(3013-3015)Gaa>Caa	p.E1005Q	SRCAP_ENST00000344771.4_Missense_Mutation_p.E1005Q|SRCAP_ENST00000395059.2_Missense_Mutation_p.E1005Q	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1005	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.E1005Q(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ACCTAAGCAAGAAGGCCGGAC	0.552																																							uc002dze.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(3013-3015)GAA>CAA		Snf2-related CBP activator protein							70.0	78.0	75.0					16																	30732059		2197	4300	6497	SO:0001583	missense	10847				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity	g.chr16:30732059G>C	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3013G>C	16.37:g.30732059G>C	ENSP00000262518:p.Glu1005Gln		Somatic				SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.E862Q|SRCAP_uc010bzz.1_Missense_Mutation_p.E575Q	p.E1005Q	NM_006662	NP_006653	WXS	Illumina HiSeq	Unspecified	Q6ZRS2	SRCAP_HUMAN	Colorectal(24;0.198)		20	3398	+			1005			Pro-rich.		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	c.3013G>C	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	G	16.75	3.209763	0.58343	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91686	-2.87;-2.81;-2.89	5.25	5.25	0.73442	.	0.000000	0.52532	D	0.000068	D	0.92996	0.7771	L	0.39245	1.2	0.32731	N	0.509017	D;D;D	0.76494	0.996;0.999;0.999	P;D;D	0.68943	0.889;0.961;0.915	D	0.93569	0.6902	10	0.62326	D	0.03	-9.5719	11.2202	0.48851	0.0844:0.0:0.9156:0.0	.	1005;1005;1005	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	Q	1005	ENSP00000262518:E1005Q;ENSP00000378499:E1005Q;ENSP00000343042:E1005Q	ENSP00000262518:E1005Q	E	+	1	0	SRCAP	30639560	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.894000	0.87336	2.729000	0.93468	0.557000	0.71058	GAA		0.552	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662		42	97	0	0	0	0.007835	0	42	97				
PHKB	5257	broad.mit.edu	37	16	47533691	47533691	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr16:47533691A>G	ENST00000323584.5	+	3	215	c.191A>G	c.(190-192)cAa>cGa	p.Q64R	PHKB_ENST00000455779.1_Missense_Mutation_p.Q57R|PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000566044.1_Missense_Mutation_p.Q57R|PHKB_ENST00000299167.8_Missense_Mutation_p.Q64R	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	64					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.Q64R(2)|p.Q57R(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				CTGCTGTATCAAAGTCCAACT	0.473																																							uc002eev.3		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|large_intestine(1)|breast(1)	3						c.(190-192)CAA>CGA		phosphorylase kinase, beta isoform a							163.0	158.0	159.0					16																	47533691		2201	4300	6501	SO:0001583	missense	5257				glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity	g.chr16:47533691A>G		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.191A>G	16.37:g.47533691A>G	ENSP00000313504:p.Gln64Arg		Somatic				PHKB_uc010vgi.1_Missense_Mutation_p.Q57R|PHKB_uc002eeu.3_Missense_Mutation_p.Q57R	p.Q64R	NM_000293	NP_000284	WXS	Illumina HiSeq	Unspecified	Q93100	KPBB_HUMAN			3	243	+		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)	64					Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	c.191A>G	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	A	34	5.396413	0.96009	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.92545	-3.06;-3.06	5.81	5.81	0.92471	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.052713	0.85682	D	0.000000	D	0.97126	0.9061	M	0.93638	3.44	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.997	D;D;D	0.97110	0.992;1.0;0.991	D	0.98115	1.0422	10	0.87932	D	0	-18.7238	16.1617	0.81721	1.0:0.0:0.0:0.0	.	57;64;57	B4DQ16;Q93100;Q93100-4	.;KPBB_HUMAN;.	R	57;57;64	ENSP00000414345:Q57R;ENSP00000313504:Q64R	ENSP00000299167:Q57R	Q	+	2	0	PHKB	46091192	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.272000	0.95707	2.209000	0.71365	0.533000	0.62120	CAA		0.473	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1			33	82	0	0	0	0.013726	0	33	82				
TSR1	55720	broad.mit.edu	37	17	2234267	2234267	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr17:2234267C>T	ENST00000301364.5	-	9	2712	c.1633G>A	c.(1633-1635)Gaa>Aaa	p.E545K	SNORD91A_ENST00000390861.1_RNA|SNORD91B_ENST00000391250.1_RNA	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	545					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.E545K(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						TCTTTTTCTTCAACCTCTTTA	0.378																																							uc002fuj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1633-1635)GAA>AAA		TSR1, 20S rRNA accumulation							147.0	135.0	139.0					17																	2234267		2203	4300	6503	SO:0001583	missense	55720				ribosome assembly	nucleolus	protein binding	g.chr17:2234267C>T	AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.1633G>A	17.37:g.2234267C>T	ENSP00000301364:p.Glu545Lys		Somatic				SNORD91B_uc002fuk.1_5'Flank|SNORD91A_uc002ful.1_5'Flank	p.E545K	NM_018128	NP_060598	WXS	Illumina HiSeq	Unspecified	Q2NL82	TSR1_HUMAN			9	2590	-			545					Q8WUY5|Q9NVT0|Q9P2E6	Missense_Mutation	SNP	ENST00000301364.5	37	c.1633G>A	CCDS32525.1	.	.	.	.	.	.	.	.	.	.	c	16.93	3.258186	0.59321	.	.	ENSG00000167721	ENST00000301364	T	0.18174	2.23	4.96	2.94	0.34122	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.206931	0.49305	N	0.000157	T	0.11410	0.0278	L	0.31845	0.965	0.44006	D	0.99671	B	0.02656	0.0	B	0.12837	0.008	T	0.09122	-1.0689	10	0.10377	T	0.69	-8.0723	10.7347	0.46117	0.0:0.8411:0.0:0.1589	.	545	Q2NL82	TSR1_HUMAN	K	545	ENSP00000301364:E545K	ENSP00000301364:E545K	E	-	1	0	TSR1	2181017	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	3.861000	0.56002	1.080000	0.41073	0.556000	0.70494	GAA		0.378	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438180.2	NM_018128		7	22	0	0	0	0.00308	0	7	22				
DNAH9	1770	broad.mit.edu	37	17	11631220	11631220	+	Nonsense_Mutation	SNP	T	T	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr17:11631220T>A	ENST00000262442.4	+	28	5863	c.5795T>A	c.(5794-5796)tTg>tAg	p.L1932*	DNAH9_ENST00000454412.2_Nonsense_Mutation_p.L1932*	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1932	AAA 1. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.L1932*(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GTGGAGGTCTTGTCAGTGGTG	0.493																																							uc002gne.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(5794-5796)TTG>TAG		dynein, axonemal, heavy chain 9 isoform 2							120.0	108.0	112.0					17																	11631220		2203	4300	6503	SO:0001587	stop_gained	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11631220T>A	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.5795T>A	17.37:g.11631220T>A	ENSP00000262442:p.Leu1932*		Somatic				DNAH9_uc010coo.2_Nonsense_Mutation_p.L1226*	p.L1932*	NM_001372	NP_001363	WXS	Illumina HiSeq	Unspecified	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	28	5863	+		Breast(5;0.0122)|all_epithelial(5;0.131)	1932			AAA 1 (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Nonsense_Mutation	SNP	ENST00000262442.4	37	c.5795T>A	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	T	46	12.707397	0.99690	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	.	.	.	4.77	4.77	0.60923	.	0.095946	0.40302	N	0.001138	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5611	0.68136	0.0:0.0:0.0:1.0	.	.	.	.	X	1932;1932;514	.	ENSP00000262442:L1932X	L	+	2	0	DNAH9	11571945	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.974000	0.88039	1.915000	0.55452	0.477000	0.44152	TTG		0.493	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		12	15	0	0	0	0.013537	0	12	15				
NUFIP2	57532	broad.mit.edu	37	17	27613317	27613317	+	Silent	SNP	G	G	A	rs150088850		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr17:27613317G>A	ENST00000225388.4	-	2	1753	c.1695C>T	c.(1693-1695)taC>taT	p.Y565Y	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	565						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.Y565Y(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			TCTCCAGCTCGTAAGCCTTGG	0.463																																							uc002hdy.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.(1693-1695)TAC>TAT		nuclear fragile X mental retardation protein		G		0,4406		0,0,2203	85.0	84.0	84.0		1695	4.9	1.0	17	dbSNP_134	84	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	NUFIP2	NM_020772.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		565/696	27613317	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	57532					nucleus|polysomal ribosome	protein binding|RNA binding	g.chr17:27613317G>A	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.1695C>T	17.37:g.27613317G>A			Somatic				NUFIP2_uc002hdx.3_Intron	p.Y565Y	NM_020772	NP_065823	WXS	Illumina HiSeq	Unspecified	Q7Z417	NUFP2_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)		2	1784	-			565					A1L3A6|Q9P2M5	Silent	SNP	ENST00000225388.4	37	c.1695C>T	CCDS32600.1																																																																																				0.463	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2	NM_020772		7	53	0	0	0	0.00308	0	7	53				
KPNA2	3838	broad.mit.edu	37	17	66042019	66042019	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr17:66042019G>C	ENST00000537025.2	+	10	2099	c.1479G>C	c.(1477-1479)gaG>gaC	p.E493D	KPNA2_ENST00000330459.3_Missense_Mutation_p.E493D|KPNA2_ENST00000582898.1_3'UTR			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	493					cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.E493D(1)		breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GCTTAATTGAGAAGTATTTCT	0.318																																							uc002jgk.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(1477-1479)GAG>GAC		karyopherin alpha 2							101.0	106.0	104.0					17																	66042019		2203	4295	6498	SO:0001583	missense	3838				DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity	g.chr17:66042019G>C	U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.1479G>C	17.37:g.66042019G>C	ENSP00000438483:p.Glu493Asp		Somatic				KPNA2_uc002jgl.2_Missense_Mutation_p.E493D	p.E493D	NM_002266	NP_002257	WXS	Illumina HiSeq	Unspecified	P52292	IMA2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)		10	1611	+	all_cancers(12;1.18e-09)		493			ARM 10; atypical.		B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	ENST00000537025.2	37	c.1479G>C	CCDS32713.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.352324	0.24512	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	T;T	0.60920	0.15;0.15	5.17	3.98	0.46160	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.54581	0.1867	M	0.65498	2.005	0.54753	D	0.999986	B	0.02656	0.0	B	0.04013	0.001	T	0.54801	-0.8239	10	0.35671	T	0.21	.	13.6753	0.62449	0.1343:0.0:0.8657:0.0	.	493	P52292	IMA2_HUMAN	D	493	ENSP00000332455:E493D;ENSP00000438483:E493D	ENSP00000332455:E493D	E	+	3	2	KPNA2	63472481	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.127000	0.31357	2.414000	0.81942	0.461000	0.40582	GAG		0.318	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448111.1	NM_002266		17	74	0	0	0	0.007413	0	17	74				
METTL4	64863	broad.mit.edu	37	18	2567170	2567170	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr18:2567170G>C	ENST00000574538.1	-	2	821	c.46C>G	c.(46-48)Ctt>Gtt	p.L16V	METTL4_ENST00000319888.6_Missense_Mutation_p.L16V	NM_022840.3	NP_073751.3	Q8N3J2	METL4_HUMAN	methyltransferase like 4	16					nucleobase-containing compound metabolic process (GO:0006139)		methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)	p.L16V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						ATAAAAGAAAGATGATCCAGT	0.393																																							uc002klh.3		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)|skin(1)	2						c.(46-48)CTT>GTT		methyltransferase like 4							89.0	89.0	89.0					18																	2567170		2203	4300	6503	SO:0001583	missense	64863				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		methyltransferase activity|nucleic acid binding	g.chr18:2567170G>C		CCDS11826.1	18p11.31	2008-02-05			ENSG00000101574	ENSG00000101574			24726	protein-coding gene	gene with protein product						12477932	Standard	NM_022840		Approved	FLJ23017, HsT661	uc002klh.4	Q8N3J2	OTTHUMG00000131482	ENST00000574538.1:c.46C>G	18.37:g.2567170G>C	ENSP00000458290:p.Leu16Val		Somatic					p.L16V	NM_022840	NP_073751	WXS	Illumina HiSeq	Unspecified	Q8N3J2	METL4_HUMAN			2	826	-			16					B2RNA1|Q2TAA7|Q9H5U9	Missense_Mutation	SNP	ENST00000574538.1	37	c.46C>G	CCDS11826.1	.	.	.	.	.	.	.	.	.	.	G	15.60	2.882321	0.51908	.	.	ENSG00000101574	ENST00000319888	T	0.39406	1.08	5.86	5.0	0.66597	.	0.074923	0.52532	D	0.000063	T	0.45915	0.1366	M	0.69823	2.125	0.33951	D	0.644484	P	0.52316	0.952	B	0.44224	0.444	T	0.66496	-0.5909	10	0.72032	D	0.01	-2.9558	11.8439	0.52371	0.0808:0.0:0.9192:0.0	.	16	Q8N3J2	METL4_HUMAN	V	16	ENSP00000320349:L16V	ENSP00000320349:L16V	L	-	1	0	METTL4	2557170	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.527000	0.53517	1.487000	0.48415	0.655000	0.94253	CTT		0.393	METTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254326.3	NM_022840		23	33	0	0	0	0.014323	0	23	33				
POTEC	388468	broad.mit.edu	37	18	14542654	14542654	+	Silent	SNP	C	C	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr18:14542654C>A	ENST00000358970.5	-	1	491	c.492G>T	c.(490-492)acG>acT	p.T164T	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	164								p.T164T(2)		NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						TGTTCATGTCCGTGTCCCTGA	0.592																																							uc010dln.2		NA																	2	Substitution - coding silent(2)		lung(1)|kidney(1)	skin(3)	3						c.(490-492)ACG>ACT		ANKRD26-like family B, member 2							260.0	241.0	247.0					18																	14542654		692	1591	2283	SO:0001819	synonymous_variant	388468							g.chr18:14542654C>A	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.492G>T	18.37:g.14542654C>A			Somatic				POTEC_uc010xaj.1_RNA	p.T164T	NM_001137671	NP_001131143	WXS	Illumina HiSeq	Unspecified	B2RU33	POTEC_HUMAN			1	946	-			164			ANK 1.			Silent	SNP	ENST00000358970.5	37	c.492G>T	CCDS45835.1																																																																																				0.592	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269		4	100	1	0	0.00909568	0.009096	0.00954209	4	100				
DSG3	1830	broad.mit.edu	37	18	29039000	29039000	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr18:29039000C>A	ENST00000257189.4	+	5	460	c.377C>A	c.(376-378)aCa>aAa	p.T126K		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	126	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T126K(1)		breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TCCTAGATCACATGTCGGGCT	0.363																																							uc002kws.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9						c.(376-378)ACA>AAA		desmoglein 3 preproprotein							65.0	64.0	64.0					18																	29039000		2203	4300	6503	SO:0001583	missense	1830				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding	g.chr18:29039000C>A	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.377C>A	18.37:g.29039000C>A	ENSP00000257189:p.Thr126Lys		Somatic					p.T126K	NM_001944	NP_001935	WXS	Illumina HiSeq	Unspecified	P32926	DSG3_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		5	486	+			126			Extracellular (Potential).|Cadherin 1.		A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	37	c.377C>A	CCDS11898.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.922334	0.33908	.	.	ENSG00000134757	ENST00000257189	T	0.55588	0.51	5.39	3.48	0.39840	Cadherin (4);Cadherin-like (1);	0.347875	0.21464	N	0.074113	T	0.46249	0.1383	L	0.38175	1.15	0.33935	D	0.642534	B	0.32968	0.392	P	0.45276	0.475	T	0.54043	-0.8352	10	0.24483	T	0.36	.	5.3696	0.16132	0.2127:0.5913:0.1191:0.0769	.	126	P32926	DSG3_HUMAN	K	126	ENSP00000257189:T126K	ENSP00000257189:T126K	T	+	2	0	DSG3	27292998	0.016000	0.18221	0.922000	0.36590	0.631000	0.37964	0.229000	0.17833	1.395000	0.46643	0.655000	0.94253	ACA		0.363	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944		14	22	1	0	2.31682e-05	0.003163	2.52342e-05	14	22				
ALPK2	115701	broad.mit.edu	37	18	56246449	56246449	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr18:56246449A>C	ENST00000361673.3	-	4	1772	c.1559T>G	c.(1558-1560)gTg>gGg	p.V520G	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	520						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CTTTCCCCCCACTCTCTTGTC	0.522											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(1558-1560)GTG>GGG		heart alpha-kinase							218.0	218.0	218.0					18																	56246449		2203	4300	6503	SO:0001583	missense	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56246449A>C	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.1559T>G	18.37:g.56246449A>C	ENSP00000354991:p.Val520Gly		Somatic	OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1014		p.V520G	NM_052947	NP_443179	WXS	Illumina HiSeq	Unspecified	Q86TB3	ALPK2_HUMAN			4	1773	-			520					Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	c.1559T>G	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	A	9.848	1.192809	0.21954	.	.	ENSG00000198796	ENST00000361673	T	0.44482	0.92	5.14	-9.36	0.00629	.	2.716050	0.01631	N	0.023537	T	0.18964	0.0455	N	0.17082	0.46	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.10941	-1.0608	10	0.18710	T	0.47	0.3576	1.9092	0.03284	0.1547:0.1707:0.3387:0.3359	.	520	Q86TB3	ALPK2_HUMAN	G	520	ENSP00000354991:V520G	ENSP00000354991:V520G	V	-	2	0	ALPK2	54397429	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.723000	0.00810	-1.698000	0.01418	-1.410000	0.01125	GTG		0.522	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		6	109	0	0	0	0.001168	0	6	109				
THOP1	7064	broad.mit.edu	37	19	2813149	2813150	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr19:2813149_2813150GG>TT	ENST00000307741.6	+	13	2148_2149	c.1945_1946GG>TT	c.(1945-1947)GGc>TTc	p.G649F	THOP1_ENST00000586677.1_Missense_Mutation_p.G528F|THOP1_ENST00000395212.4_Missense_Mutation_p.G218F	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	649					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)	p.G649F(1)		NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGAGACCCGGCGGTTCCGAG	0.678																																							uc002lwj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1945-1947)GGC>TTC		thimet oligopeptidase 1																																				SO:0001583	missense	7064				proteolysis	cytoplasm	metal ion binding|metalloendopeptidase activity|protein binding	g.chr19:2813149_2813150GG>TT		CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		Exception_encountered	19.37:g.2813149_2813150delinsTT	ENSP00000304467:p.Gly649Phe		Somatic				THOP1_uc010xgz.1_Missense_Mutation_p.G528F|THOP1_uc002lwk.2_Missense_Mutation_p.G218F	p.G649F	NM_003249	NP_003240	WXS	Illumina HiSeq	Unspecified	P52888	THOP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	13	2100_2101	+			649					B3KSE2|Q9UCB3	Missense_Mutation	DNP	ENST00000307741.6	37	c.1945_1946GG>TT	CCDS12095.1																																																																																				0.678	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451587.2			9	11	0	0	0	0.004672	0	9	11				
KEAP1	9817	broad.mit.edu	37	19	10610574	10610574	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr19:10610574G>A	ENST00000171111.5	-	2	683	c.136C>T	c.(136-138)Cag>Tag	p.Q46*	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Nonsense_Mutation_p.Q46*	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	46					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.Q46*(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TTGCCATGCTGGGAGGGCGTC	0.632																																							uc002moq.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(136-138)CAG>TAG		kelch-like ECH-associated protein 1							133.0	106.0	115.0					19																	10610574		2203	4300	6503	SO:0001587	stop_gained	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10610574G>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.136C>T	19.37:g.10610574G>A	ENSP00000171111:p.Gln46*		Somatic				KEAP1_uc002mor.1_Nonsense_Mutation_p.Q46*	p.Q46*	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		2	292	-			46					B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Nonsense_Mutation	SNP	ENST00000171111.5	37	c.136C>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	37	6.079161	0.97262	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	.	.	.	4.99	4.99	0.66335	.	0.294357	0.37577	N	0.002029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	15.778	0.78240	0.0:0.0:1.0:0.0	.	.	.	.	X	46	.	ENSP00000171111:Q46X	Q	-	1	0	KEAP1	10471574	1.000000	0.71417	0.965000	0.40720	0.992000	0.81027	3.815000	0.55651	2.335000	0.79485	0.462000	0.41574	CAG		0.632	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		22	50	0	0	0	0.004656	0	22	50				
SMARCA4	6597	broad.mit.edu	37	19	11100021	11100021	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr19:11100021C>T	ENST00000429416.3	+	8	1428	c.1147C>T	c.(1147-1149)Cag>Tag	p.Q383*	SMARCA4_ENST00000358026.2_Nonsense_Mutation_p.Q383*|SMARCA4_ENST00000589677.1_Nonsense_Mutation_p.Q383*|SMARCA4_ENST00000444061.3_Nonsense_Mutation_p.Q383*|SMARCA4_ENST00000450717.3_Nonsense_Mutation_p.Q383*|SMARCA4_ENST00000541122.2_Nonsense_Mutation_p.Q383*|SMARCA4_ENST00000413806.3_Nonsense_Mutation_p.Q383*|SMARCA4_ENST00000344626.4_Nonsense_Mutation_p.Q383*|SMARCA4_ENST00000590574.1_Nonsense_Mutation_p.Q383*	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	383					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.Q383*(2)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				ACACCGAATTCAGGAACTTGA	0.602			"""F, N, Mis"""		NSCLC																																		uc002mqf.3		NA		Rec	yes		19	19p13.2	6597	F|N|Mis	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""			E			NSCLC		3	Substitution - Nonsense(2)|Unknown(1)	p.?(1)	lung(3)	lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67						c.(1147-1149)CAG>TAG		SWI/SNF-related matrix-associated							88.0	90.0	90.0					19																	11100021		2203	4300	6503	SO:0001587	stop_gained	6597	Rhabdoid_Predisposition_syndrome			chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	g.chr19:11100021C>T	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1147C>T	19.37:g.11100021C>T	ENSP00000395654:p.Gln383*		Somatic				SMARCA4_uc010dxp.2_Nonsense_Mutation_p.Q383*|SMARCA4_uc010dxo.2_Nonsense_Mutation_p.Q383*|SMARCA4_uc002mqg.1_Nonsense_Mutation_p.Q383*|SMARCA4_uc010dxq.2_Nonsense_Mutation_p.Q383*|SMARCA4_uc010dxr.2_Nonsense_Mutation_p.Q383*|SMARCA4_uc002mqj.3_Nonsense_Mutation_p.Q383*|SMARCA4_uc010dxs.2_Nonsense_Mutation_p.Q383*|SMARCA4_uc002mqe.2_Nonsense_Mutation_p.Q383*	p.Q383*	NM_003072	NP_003063	WXS	Illumina HiSeq	Unspecified	P51532	SMCA4_HUMAN			7	1431	+		all_lung(6;0.0512)|Lung NSC(9;0.0568)	383					B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Nonsense_Mutation	SNP	ENST00000429416.3	37	c.1147C>T	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	C	37	6.005494	0.97195	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	.	.	.	4.18	3.12	0.35913	.	0.152246	0.44483	D	0.000442	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-29.4406	12.3228	0.54993	0.1701:0.8299:0.0:0.0	.	.	.	.	X	383	.	ENSP00000343896:Q383X	Q	+	1	0	SMARCA4	10961021	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.099000	0.50267	0.962000	0.38057	0.462000	0.41574	CAG		0.602	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		11	40	0	0	0	0.010729	0	11	40				
TSHZ3	57616	broad.mit.edu	37	19	31768163	31768163	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr19:31768163C>G	ENST00000240587.4	-	2	2863	c.2536G>C	c.(2536-2538)Gat>Cat	p.D846H		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	846					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D663H(1)|p.D846H(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TCGGATATATCTGACAAGGCA	0.527																																							uc002nsy.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(2536-2538)GAT>CAT		zinc finger protein 537							151.0	145.0	147.0					19																	31768163		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31768163C>G	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2536G>C	19.37:g.31768163C>G	ENSP00000240587:p.Asp846His		Somatic					p.D846H	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	2601	-	Esophageal squamous(110;0.226)		846					Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.2536G>C	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120920	0.77436	.	.	ENSG00000121297	ENST00000240587	T	0.28666	1.6	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.54447	0.1859	L	0.58810	1.83	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.56257	-0.8009	10	0.87932	D	0	-22.471	19.1085	0.93307	0.0:1.0:0.0:0.0	.	846	Q63HK5	TSH3_HUMAN	H	846	ENSP00000240587:D846H	ENSP00000240587:D846H	D	-	1	0	TSHZ3	36460003	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	7.366000	0.79548	2.501000	0.84356	0.655000	0.94253	GAT		0.527	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		58	47	0	0	0	0.01441	0	58	47				
SUPT5H	6829	broad.mit.edu	37	19	39962250	39962250	+	Silent	SNP	A	A	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr19:39962250A>G	ENST00000599117.1	+	21	2197	c.1830A>G	c.(1828-1830)cgA>cgG	p.R610R	SUPT5H_ENST00000432763.2_Silent_p.R610R|SUPT5H_ENST00000598725.1_Silent_p.R610R|SUPT5H_ENST00000402194.2_Silent_p.R606R|SUPT5H_ENST00000359191.6_Silent_p.R606R			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	610	KOW 4.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.R610R(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCTAGGGCCGAGAAGGGGAGA	0.552																																							uc002olo.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(1828-1830)CGA>CGG		suppressor of Ty 5 homolog isoform a							52.0	54.0	54.0					19																	39962250		2203	4300	6503	SO:0001819	synonymous_variant	6829				cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity	g.chr19:39962250A>G	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1830A>G	19.37:g.39962250A>G			Somatic				SUPT5H_uc002olp.3_Silent_p.R610R|SUPT5H_uc002olq.3_Silent_p.R606R|SUPT5H_uc002oln.3_Silent_p.R610R|SUPT5H_uc002olr.3_Silent_p.R610R|SUPT5H_uc002ols.1_Silent_p.R233R|SUPT5H_uc010egp.1_5'UTR	p.R610R	NM_001111020	NP_001104490	WXS	Illumina HiSeq	Unspecified	O00267	SPT5H_HUMAN	Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)		20	2009	+	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		610			KOW 4.		O43279|Q59G52|Q99639	Silent	SNP	ENST00000599117.1	37	c.1830A>G	CCDS12536.1																																																																																				0.552	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169		30	20	0	0	0	0.009535	0	30	20				
FLT3LG	2323	broad.mit.edu	37	19	49982278	49982278	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr19:49982278G>T	ENST00000594009.1	+	5	534	c.455G>T	c.(454-456)cGg>cTg	p.R152L	FLT3LG_ENST00000596435.1_Missense_Mutation_p.R134L|FLT3LG_ENST00000204637.2_Missense_Mutation_p.R70L|CTD-3148I10.15_ENST00000595815.1_RNA|CTD-3148I10.9_ENST00000599536.1_Intron|FLT3LG_ENST00000344019.3_Missense_Mutation_p.R152L|FLT3LG_ENST00000597551.1_Missense_Mutation_p.R152L|FLT3LG_ENST00000595510.1_Missense_Mutation_p.R70L|FLT3LG_ENST00000600429.1_Missense_Mutation_p.R152L	NM_001204503.1	NP_001191432.1	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand	152					embryonic hemopoiesis (GO:0035162)|lymphocyte differentiation (GO:0030098)|positive regulation of cell proliferation (GO:0008284)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|membrane (GO:0016020)	receptor binding (GO:0005102)	p.R152L(1)		large_intestine(2)|lung(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	10		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		AACTTCTCCCGGTGCCTGGAG	0.637																																							uc010yau.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(454-456)CGG>CTG		fms-related tyrosine kinase 3 ligand precursor							22.0	21.0	21.0					19																	49982278		2203	4300	6503	SO:0001583	missense	2323				positive regulation of cell proliferation|signal transduction	extracellular space|integral to membrane|plasma membrane|soluble fraction	cytokine activity	g.chr19:49982278G>T	U04806	CCDS12767.1, CCDS62753.1	19q13.3	2014-01-30				ENSG00000090554		"""Endogenous ligands"""	3766	protein-coding gene	gene with protein product		600007				8145851, 7824267	Standard	NM_001204502		Approved		uc010yau.2	P49771		ENST00000594009.1:c.455G>T	19.37:g.49982278G>T	ENSP00000469613:p.Arg152Leu		Somatic				FLT3LG_uc002pnv.2_Missense_Mutation_p.R70L|FLT3LG_uc002pnw.2_Missense_Mutation_p.R70L|FLT3LG_uc002pnu.2_Missense_Mutation_p.R152L|FLT3LG_uc002pnx.2_Missense_Mutation_p.R152L|FLT3LG_uc010yav.1_Missense_Mutation_p.R70L	p.R152L	NM_001459	NP_001450	WXS	Illumina HiSeq	Unspecified	P49771	FLT3L_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)	6	545	+		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)	152			Extracellular (Potential).		A0AVC2|B9EGH2|Q05C96	Missense_Mutation	SNP	ENST00000594009.1	37	c.455G>T	CCDS12767.1	.	.	.	.	.	.	.	.	.	.	G	10.16	1.272767	0.23221	.	.	ENSG00000090554	ENST00000204637;ENST00000344019	.	.	.	4.5	-0.939	0.10408	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.316092	0.32161	U	0.006483	T	0.18467	0.0443	N	0.24115	0.695	0.24148	N	0.995705	B	0.30193	0.272	B	0.28465	0.09	T	0.10989	-1.0606	9	0.62326	D	0.03	-16.3266	4.3548	0.11172	0.3662:0.1689:0.4649:0.0	.	152	P49771	FLT3L_HUMAN	L	152	.	ENSP00000204637:R152L	R	+	2	0	FLT3LG	54674090	0.092000	0.21681	0.777000	0.31699	0.240000	0.25518	0.195000	0.17155	0.036000	0.15547	0.174000	0.16983	CGG		0.637	FLT3LG-007	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465305.1			7	7	1	0	0.000157383	0.00308	0.000168203	7	7				
ZNF473	25888	broad.mit.edu	37	19	50548183	50548183	+	Silent	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr19:50548183C>T	ENST00000595661.1	+	6	978	c.483C>T	c.(481-483)acC>acT	p.T161T	ZNF473_ENST00000270617.3_Silent_p.T161T|ZNF473_ENST00000601364.1_Intron|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000445728.3_Silent_p.T149T|CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000391821.2_Silent_p.T161T			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	161					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T161T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		CTGTGTCCACCGTTTCCACGG	0.468																																							uc002prn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(481-483)ACC>ACT		zinc finger protein 473							61.0	59.0	60.0					19																	50548183		2203	4300	6503	SO:0001819	synonymous_variant	25888				histone mRNA 3'-end processing|regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription	Cajal body	DNA binding|protein binding|zinc ion binding	g.chr19:50548183C>T	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.483C>T	19.37:g.50548183C>T			Somatic				ZNF473_uc002prm.2_Silent_p.T161T|ZNF473_uc010ybo.1_Silent_p.T149T	p.T161T	NM_001006656	NP_001006657	WXS	Illumina HiSeq	Unspecified	Q8WTR7	ZN473_HUMAN		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)	5	720	+		all_neural(266;0.0459)|Ovarian(192;0.0728)	161					A8K8T7|Q9ULS9|Q9Y4Q7	Silent	SNP	ENST00000595661.1	37	c.483C>T	CCDS33077.1																																																																																				0.468	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390		3	63	0	0	0	0.004672	0	3	63				
APOB	338	broad.mit.edu	37	2	21234442	21234442	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr2:21234442G>C	ENST00000233242.1	-	26	5425	c.5298C>G	c.(5296-5298)ttC>ttG	p.F1766L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1766					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.F1766L(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTTTGAAGAGAAGTCCAGTG	0.373																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(5296-5298)TTC>TTG		apolipoprotein B precursor	Atorvastatin(DB01076)						118.0	115.0	116.0					2																	21234442		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21234442G>C	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.5298C>G	2.37:g.21234442G>C	ENSP00000233242:p.Phe1766Leu		Somatic					p.F1766L	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			26	5426	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1766					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.5298C>G	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181312	0.38511	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01126	5.3	5.95	4.11	0.48088	.	0.207210	0.33732	N	0.004613	T	0.01730	0.0055	M	0.66939	2.045	0.80722	D	1	B	0.21606	0.058	B	0.17098	0.017	T	0.51395	-0.8711	10	0.56958	D	0.05	.	5.5975	0.17334	0.2191:0.0:0.6275:0.1534	.	1766	P04114	APOB_HUMAN	L	1766	ENSP00000233242:F1766L	ENSP00000233242:F1766L	F	-	3	2	APOB	21087947	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.223000	0.42936	0.796000	0.33947	0.650000	0.86243	TTC		0.373	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			38	112	0	0	0	0.017118	0	38	112				
DHX57	90957	broad.mit.edu	37	2	39089319	39089319	+	Silent	SNP	T	T	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr2:39089319T>A	ENST00000295373.6	-	4	666	c.540A>T	c.(538-540)acA>acT	p.T180T	AC018693.6_ENST00000442829.1_RNA|DHX57_ENST00000479345.2_5'UTR	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	180	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.T180T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				ATGGGGAGACTGTAAATTCTG	0.458																																					Melanoma(191;1090 2095 4375 23729 47341)	Melanoma(191;1090 2095 4375 23729 47341)	uc002rrf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(538-540)ACA>ACT		DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57							73.0	69.0	70.0					2																	39089319		2203	4300	6503	SO:0001819	synonymous_variant	90957						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding	g.chr2:39089319T>A	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.540A>T	2.37:g.39089319T>A			Somatic				DHX57_uc002rre.2_5'UTR|DHX57_uc002rrg.2_Silent_p.T180T	p.T180T	NM_198963	NP_945314	WXS	Illumina HiSeq	Unspecified	Q6P158	DHX57_HUMAN			4	639	-		all_hematologic(82;0.248)	180			UBA.		A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Silent	SNP	ENST00000295373.6	37	c.540A>T	CCDS1800.1																																																																																				0.458	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646		8	35	0	0	0	0.00308	0	8	35				
DYSF	8291	broad.mit.edu	37	2	71795381	71795381	+	Missense_Mutation	SNP	C	C	T	rs571178452		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr2:71795381C>T	ENST00000258104.3	+	26	3000	c.2723C>T	c.(2722-2724)aCg>aTg	p.T908M	DYSF_ENST00000409762.1_Missense_Mutation_p.T925M|DYSF_ENST00000410020.3_Missense_Mutation_p.T926M|DYSF_ENST00000409582.3_Missense_Mutation_p.T925M|DYSF_ENST00000409366.1_Missense_Mutation_p.T909M|DYSF_ENST00000409744.1_Missense_Mutation_p.T895M|DYSF_ENST00000394120.2_Missense_Mutation_p.T909M|DYSF_ENST00000413539.2_Missense_Mutation_p.T939M|DYSF_ENST00000429174.2_Missense_Mutation_p.T908M|DYSF_ENST00000409651.1_Missense_Mutation_p.T940M|DYSF_ENST00000410041.1_Missense_Mutation_p.T926M	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	908					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.T908M(1)|p.T926M(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						TCTGACGTCACGGGCAAGATC	0.592													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18836	0.0		0.0	False		,,,				2504	0.0						uc002sie.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(2)|pancreas(1)|skin(1)	7						c.(2722-2724)ACG>ATG		dysferlin isoform 8							201.0	206.0	205.0					2																	71795381		2203	4300	6503	SO:0001583	missense	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71795381C>T	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2723C>T	2.37:g.71795381C>T	ENSP00000258104:p.Thr908Met		Somatic				DYSF_uc010feg.2_Missense_Mutation_p.T939M|DYSF_uc010feh.2_Missense_Mutation_p.T894M|DYSF_uc002sig.3_Missense_Mutation_p.T894M|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.T908M|DYSF_uc010fef.2_Missense_Mutation_p.T925M|DYSF_uc010fei.2_Missense_Mutation_p.T925M|DYSF_uc010fek.2_Missense_Mutation_p.T926M|DYSF_uc010fej.2_Missense_Mutation_p.T895M|DYSF_uc010fel.2_Missense_Mutation_p.T895M|DYSF_uc010feo.2_Missense_Mutation_p.T940M|DYSF_uc010fem.2_Missense_Mutation_p.T909M|DYSF_uc010fen.2_Missense_Mutation_p.T926M|DYSF_uc002sif.2_Missense_Mutation_p.T909M	p.T908M	NM_003494	NP_003485	WXS	Illumina HiSeq	Unspecified	O75923	DYSF_HUMAN			26	3099	+			908			Cytoplasmic (Potential).		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	c.2723C>T	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	C	9.803	1.181144	0.21787	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.82;-1.83;-1.83;-1.83;-1.83	4.94	2.12	0.27331	Ferlin/Peroxisome membrane (1);	0.294637	0.35772	N	0.002991	T	0.79179	0.4402	L	0.49640	1.575	0.40573	D	0.981323	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.29671	0.126;0.126;0.126;0.126;0.254;0.254;0.254;0.029;0.126;0.063;0.035;0.126;0.126;0.077	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.33960	0.065;0.065;0.065;0.065;0.173;0.173;0.173;0.041;0.065;0.048;0.032;0.065;0.065;0.029	T	0.70019	-0.4987	10	0.40728	T	0.16	-5.2005	6.4056	0.21662	0.0:0.6767:0.151:0.1723	.	940;926;909;895;926;895;925;894;939;925;908;894;909;908	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	M	939;925;925;908;908;940;909;895;909;926;926	ENSP00000407046:T939M;ENSP00000387137:T925M;ENSP00000386547:T925M;ENSP00000398305:T908M;ENSP00000258104:T908M;ENSP00000386683:T940M;ENSP00000377678:T909M;ENSP00000386285:T895M;ENSP00000386512:T909M;ENSP00000386881:T926M;ENSP00000386617:T926M	ENSP00000258104:T908M	T	+	2	0	DYSF	71648889	0.981000	0.34729	0.612000	0.29024	0.234000	0.25298	2.585000	0.46111	0.137000	0.18759	0.448000	0.29417	ACG		0.592	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		11	346	0	0	0	0.008291	0	11	346				
CNOT11	55571	broad.mit.edu	37	2	101874279	101874279	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr2:101874279G>A	ENST00000289382.3	+	2	704	c.541G>A	c.(541-543)Gaa>Aaa	p.E181K		NM_017546.4	NP_060016.3	Q9UKZ1	CNO11_HUMAN	CCR4-NOT transcription complex, subunit 11	181					cell proliferation (GO:0008283)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.E181K(1)									AACTCCACCAGAAAAGTTTTT	0.413																																							uc002taw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(541-543)GAA>AAA		hypothetical protein LOC55571							66.0	67.0	67.0					2																	101874279		2203	4300	6503	SO:0001583	missense	55571				cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol		g.chr2:101874279G>A	AF103798	CCDS2050.1	2q12.1	2013-01-24	2013-01-24	2013-01-24	ENSG00000158435	ENSG00000158435			25217	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 29"""	C2orf29		10497265, 23232451, 23303381	Standard	NM_017546		Approved	C40	uc002taw.4	Q9UKZ1	OTTHUMG00000130686	ENST00000289382.3:c.541G>A	2.37:g.101874279G>A	ENSP00000289382:p.Glu181Lys		Somatic					p.E181K	NM_017546	NP_060016	WXS	Illumina HiSeq	Unspecified	Q9UKZ1	CB029_HUMAN			2	623	+			181					Q6P2M9|Q8N681	Missense_Mutation	SNP	ENST00000289382.3	37	c.541G>A	CCDS2050.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.721335	0.89205	.	.	ENSG00000158435	ENST00000289382	T	0.39229	1.09	6.01	6.01	0.97437	.	0.048304	0.85682	D	0.000000	T	0.68293	0.2985	M	0.78049	2.395	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.68648	-0.5353	10	0.66056	D	0.02	-11.8389	20.5751	0.99360	0.0:0.0:1.0:0.0	.	181	Q9UKZ1	CB029_HUMAN	K	181	ENSP00000289382:E181K	ENSP00000289382:E181K	E	+	1	0	C2orf29	101240711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.581000	0.98210	2.869000	0.98440	0.558000	0.71614	GAA		0.413	CNOT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253181.1	NM_017546		21	47	0	0	0	0.004656	0	21	47				
CNOT11	55571	broad.mit.edu	37	2	101874347	101874347	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr2:101874347G>C	ENST00000289382.3	+	2	772	c.609G>C	c.(607-609)caG>caC	p.Q203H		NM_017546.4	NP_060016.3	Q9UKZ1	CNO11_HUMAN	CCR4-NOT transcription complex, subunit 11	203					cell proliferation (GO:0008283)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.Q203H(1)									CGCCTCGCCAGATTGCACTGA	0.493																																							uc002taw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(607-609)CAG>CAC		hypothetical protein LOC55571							102.0	89.0	93.0					2																	101874347		2203	4300	6503	SO:0001583	missense	55571				cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol		g.chr2:101874347G>C	AF103798	CCDS2050.1	2q12.1	2013-01-24	2013-01-24	2013-01-24	ENSG00000158435	ENSG00000158435			25217	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 29"""	C2orf29		10497265, 23232451, 23303381	Standard	NM_017546		Approved	C40	uc002taw.4	Q9UKZ1	OTTHUMG00000130686	ENST00000289382.3:c.609G>C	2.37:g.101874347G>C	ENSP00000289382:p.Gln203His		Somatic					p.Q203H	NM_017546	NP_060016	WXS	Illumina HiSeq	Unspecified	Q9UKZ1	CB029_HUMAN			2	691	+			203					Q6P2M9|Q8N681	Missense_Mutation	SNP	ENST00000289382.3	37	c.609G>C	CCDS2050.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436918	0.62955	.	.	ENSG00000158435	ENST00000289382	T	0.35421	1.31	6.14	6.14	0.99180	.	0.233710	0.45126	D	0.000381	T	0.60843	0.2300	M	0.64404	1.975	0.80722	D	1	D	0.67145	0.996	D	0.75484	0.986	T	0.54364	-0.8305	10	0.48119	T	0.1	-12.735	20.8597	0.99761	0.0:0.0:1.0:0.0	.	203	Q9UKZ1	CB029_HUMAN	H	203	ENSP00000289382:Q203H	ENSP00000289382:Q203H	Q	+	3	2	C2orf29	101240779	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.382000	0.73167	2.937000	0.99478	0.650000	0.86243	CAG		0.493	CNOT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253181.1	NM_017546		29	46	0	0	0	0.007291	0	29	46				
TANC1	85461	broad.mit.edu	37	2	160086373	160086373	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr2:160086373C>G	ENST00000263635.6	+	27	4673	c.4436C>G	c.(4435-4437)cCa>cGa	p.P1479R	TANC1_ENST00000454300.1_Missense_Mutation_p.P1373R	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1479					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.P1479R(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						AGGTCCCAGCCATCCTCATCT	0.532																																							uc002uag.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(4435-4437)CCA>CGA		tetratricopeptide repeat, ankyrin repeat and							97.0	105.0	102.0					2																	160086373		1986	4153	6139	SO:0001583	missense	85461					cell junction|postsynaptic density|postsynaptic membrane	binding	g.chr2:160086373C>G	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4436C>G	2.37:g.160086373C>G	ENSP00000263635:p.Pro1479Arg		Somatic				TANC1_uc010zcm.1_3'UTR|TANC1_uc010fon.2_Missense_Mutation_p.P323R	p.P1479R	NM_033394	NP_203752	WXS	Illumina HiSeq	Unspecified	Q9C0D5	TANC1_HUMAN			27	4710	+			1479					C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	37	c.4436C>G	CCDS42766.1	.	.	.	.	.	.	.	.	.	.	C	2.510	-0.313161	0.05422	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.70399	-0.48;-0.47	6.07	3.17	0.36434	.	0.414503	0.24409	N	0.038766	T	0.51329	0.1668	L	0.36672	1.1	0.09310	N	0.999997	P	0.41265	0.744	B	0.36666	0.23	T	0.43829	-0.9367	9	.	.	.	.	2.352	0.04286	0.2048:0.4865:0.109:0.1997	.	1479	Q9C0D5	TANC1_HUMAN	R	1373;1479	ENSP00000396339:P1373R;ENSP00000263635:P1479R	.	P	+	2	0	TANC1	159794619	0.008000	0.16893	0.293000	0.24932	0.053000	0.15095	0.120000	0.15647	0.892000	0.36259	0.655000	0.94253	CCA		0.532	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			28	65	0	0	0	0.007291	0	28	65				
XIRP2	129446	broad.mit.edu	37	2	168104901	168104901	+	Silent	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr2:168104901G>A	ENST00000409195.1	+	9	7088	c.6999G>A	c.(6997-6999)aaG>aaA	p.K2333K	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Silent_p.K2333K|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Silent_p.K2111K|XIRP2_ENST00000409043.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2158					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.K2333K(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CCACAGAGAAGATAAAGGCTG	0.433																																							uc002udx.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(6997-6999)AAG>AAA		xin actin-binding repeat containing 2 isoform 1							145.0	143.0	144.0					2																	168104901		1874	4098	5972	SO:0001819	synonymous_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168104901G>A	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6999G>A	2.37:g.168104901G>A			Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.K2158K|XIRP2_uc010fpq.2_Silent_p.K2111K|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	p.K2333K	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	7017	+			2158			Pro-rich.		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	c.6999G>A	CCDS42769.1																																																																																				0.433	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		31	80	0	0	0	0.010818	0	31	80				
WIPF1	7456	broad.mit.edu	37	2	175436481	175436481	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr2:175436481G>A	ENST00000392547.2	-	5	1151	c.1052C>T	c.(1051-1053)cCa>cTa	p.P351L	AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000359761.3_Missense_Mutation_p.P351L|WIPF1_ENST00000392546.2_Missense_Mutation_p.P351L|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000409891.1_Missense_Mutation_p.P351L|WIPF1_ENST00000409415.3_Missense_Mutation_p.P351L|WIPF1_ENST00000272746.5_Missense_Mutation_p.P351L|WIPF1_ENST00000467149.1_5'Flank	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	351	Pro-rich.				actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)	p.P351L(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						TGAACGTCCTGGCGAAGGTAA	0.627																																							uc002uiy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1051-1053)CCA>CTA		WAS/WASL interacting protein family, member 1							62.0	65.0	64.0					2																	175436481		2203	4300	6503	SO:0001583	missense	7456				actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding	g.chr2:175436481G>A	AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.1052C>T	2.37:g.175436481G>A	ENSP00000376330:p.Pro351Leu		Somatic				uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Missense_Mutation_p.P351L|WIPF1_uc010fqt.1_Missense_Mutation_p.P351L|WIPF1_uc002ujc.1_Missense_Mutation_p.P351L|WIPF1_uc002uiz.2_Missense_Mutation_p.P351L|WIPF1_uc002ujb.1_Missense_Mutation_p.P351L|WIPF1_uc010zep.1_Missense_Mutation_p.P351L	p.P351L	NM_003387	NP_003378	WXS	Illumina HiSeq	Unspecified	O43516	WIPF1_HUMAN			6	1384	-			351			Pro-rich.		B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Missense_Mutation	SNP	ENST00000392547.2	37	c.1052C>T	CCDS2260.1	.	.	.	.	.	.	.	.	.	.	G	7.931	0.740630	0.15642	.	.	ENSG00000115935	ENST00000392547;ENST00000272746;ENST00000359761;ENST00000392546;ENST00000409891;ENST00000409415	T;T;T;T;T;T	0.49432	1.51;1.51;1.51;1.51;0.89;0.78	5.03	3.19	0.36642	.	0.835159	0.10703	N	0.643855	T	0.45316	0.1336	M	0.61703	1.905	0.27157	N	0.961271	B;B;B;B	0.26845	0.161;0.1;0.161;0.1	B;B;B;B	0.23275	0.029;0.045;0.029;0.013	T	0.39941	-0.9589	10	0.59425	D	0.04	.	9.8061	0.40795	0.0775:0.141:0.7814:0.0	.	351;351;351;351	O43516-3;E9PB87;O43516-2;O43516	.;.;.;WIPF1_HUMAN	L	351	ENSP00000376330:P351L;ENSP00000272746:P351L;ENSP00000352802:P351L;ENSP00000376329:P351L;ENSP00000386431:P351L;ENSP00000387150:P351L	ENSP00000272746:P351L	P	-	2	0	WIPF1	175144727	0.187000	0.23238	0.000000	0.03702	0.026000	0.11368	2.866000	0.48420	0.508000	0.28173	0.536000	0.68110	CCA		0.627	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255453.1	NM_003387		25	33	0	0	0	0.021523	0	25	33				
SF3B1	23451	broad.mit.edu	37	2	198274563	198274563	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr2:198274563G>A	ENST00000335508.6	-	7	926	c.835C>T	c.(835-837)Cca>Tca	p.P279S		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	279	Interaction with PPP1R8.|U2AF homology region; mediates interaction with RMB39.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.P279S(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CCATGGCCTGGTGTCGCATGG	0.547			Mis		myelodysplastic syndrome																																		uc002uue.2		NA		Dom	yes		2	2q33.1	23451		"""splicing factor 3b, subunit 1, 155kDa"""			L					1	Substitution - Missense(1)		lung(1)	pancreas(3)|ovary(1)|breast(1)|skin(1)	6						c.(835-837)CCA>TCA		splicing factor 3b, subunit 1 isoform 1							235.0	235.0	235.0					2																	198274563		2203	4300	6503	SO:0001583	missense	23451				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	g.chr2:198274563G>A	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.835C>T	2.37:g.198274563G>A	ENSP00000335321:p.Pro279Ser		Somatic					p.P279S	NM_012433	NP_036565	WXS	Illumina HiSeq	Unspecified	O75533	SF3B1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.246)		7	883	-			279			Interaction with PPP1R8.		E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	c.835C>T	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.691018	0.68271	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.45377	0.1339	L	0.36672	1.1	0.80722	D	1	P	0.49090	0.919	B	0.40256	0.324	T	0.38394	-0.9663	9	0.30078	T	0.28	.	19.0839	0.93194	0.0:0.0:1.0:0.0	.	279	O75533	SF3B1_HUMAN	S	279	.	ENSP00000335321:P279S	P	-	1	0	SF3B1	197982808	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	9.750000	0.98875	2.502000	0.84385	0.655000	0.94253	CCA		0.547	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2			6	206	0	0	0	0.001168	0	6	206				
CXCR1	3577	broad.mit.edu	37	2	219029334	219029334	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr2:219029334C>G	ENST00000295683.2	-	2	721	c.601G>C	c.(601-603)Gtg>Ctg	p.V201L		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	201					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)	p.V201L(1)		endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	ATCCGCAACACCATCCGCCAT	0.517																																							uc002vhc.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(601-603)GTG>CTG		interleukin 8 receptor alpha							103.0	90.0	95.0					2																	219029334		2203	4300	6503	SO:0001583	missense	3577				dendritic cell chemotaxis|inflammatory response	integral to membrane|plasma membrane	interleukin-8 receptor activity	g.chr2:219029334C>G	U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.601G>C	2.37:g.219029334C>G	ENSP00000295683:p.Val201Leu		Somatic					p.V201L	NM_000634	NP_000625	WXS	Illumina HiSeq	Unspecified	P25024	CXCR1_HUMAN			2	720	-			201			Helical; Name=5; (Potential).		B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Missense_Mutation	SNP	ENST00000295683.2	37	c.601G>C	CCDS2409.1	.	.	.	.	.	.	.	.	.	.	C	9.243	1.038907	0.19669	.	.	ENSG00000163464	ENST00000295683;ENST00000421691	T	0.35973	1.28	4.63	1.74	0.24563	GPCR, rhodopsin-like superfamily (1);	0.574458	0.18608	N	0.136221	T	0.20820	0.0501	L	0.39085	1.19	0.21740	N	0.99956	B	0.11235	0.004	B	0.21151	0.033	T	0.25882	-1.0119	10	0.08381	T	0.77	.	3.996	0.09558	0.1662:0.5485:0.0:0.2853	.	201	P25024	CXCR1_HUMAN	L	201;145	ENSP00000295683:V201L	ENSP00000295683:V201L	V	-	1	0	CXCR1	218737579	0.000000	0.05858	0.326000	0.25389	0.980000	0.70556	0.419000	0.21247	0.455000	0.26910	0.561000	0.74099	GTG		0.517	CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256773.2	NM_000634		7	39	0	0	0	0.004482	0	7	39				
DUSP15	128853	broad.mit.edu	37	20	30451754	30451754	+	Silent	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr20:30451754G>A	ENST00000278979.3	-	5	286	c.210C>T	c.(208-210)ttC>ttT	p.F70F	DUSP15_ENST00000339738.5_Silent_p.F73F|DUSP15_ENST00000398083.1_5'UTR|DUSP15_ENST00000486996.1_5'UTR|DUSP15_ENST00000375966.4_Silent_p.F70F|DUSP15_ENST00000398084.2_5'UTR|DUSP15_ENST00000493115.1_5'UTR			Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15	70	Tyrosine-protein phosphatase.				positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.F70F(1)|p.F73F(1)		large_intestine(1)|lung(4)|pancreas(1)|stomach(1)	7			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AGCAGTGGATGAAGTTGATAC	0.557																																							uc002wwu.1		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)	1						c.(208-210)TTC>TTT		RecName: Full=Dual specificity protein phosphatase 15;          EC=3.1.3.48;          EC=3.1.3.16; AltName: Full=Vaccinia virus VH1-related dual-specific protein phosphatase Y; AltName: Full=VH1-related member Y;							131.0	104.0	113.0					20																	30451754		2203	4300	6503	SO:0001819	synonymous_variant	128853					cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr20:30451754G>A		CCDS13193.1, CCDS42862.1	20q11.21	2011-06-09	2005-03-09		ENSG00000149599	ENSG00000149599		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16236	protein-coding gene	gene with protein product			"""dual specificity phosphatase-like 15"""			15138252	Standard	NM_080611		Approved	bA243J16.6, VHY	uc002wwx.1	Q9H1R2	OTTHUMG00000032182	ENST00000278979.3:c.210C>T	20.37:g.30451754G>A			Somatic				DUSP15_uc002wwv.1_5'UTR|DUSP15_uc002www.1_5'UTR|DUSP15_uc002wwx.1_Silent_p.F73F	p.F70F			WXS	Illumina HiSeq	Unspecified	Q9H1R2	DUS15_HUMAN	Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)		5	287	-			70			Tyrosine-protein phosphatase.		A6NH79|A8MVC8|Q5QP62|Q5QP63|Q5QP65|Q6PGN7|Q8N826|Q9BX24	Silent	SNP	ENST00000278979.3	37	c.210C>T		.	.	.	.	.	.	.	.	.	.	G	12.01	1.809815	0.31961	.	.	ENSG00000149599	ENST00000375953;ENST00000428829	.	.	.	4.55	-0.945	0.10388	.	.	.	.	.	T	0.60779	0.2295	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62238	-0.6896	5	0.87932	D	0	.	7.8835	0.29635	0.5926:0.0:0.4074:0.0	.	.	.	.	L	62	.	ENSP00000365120:S62L	S	-	2	0	DUSP15	29915415	0.992000	0.36948	0.998000	0.56505	0.996000	0.88848	0.223000	0.17719	0.038000	0.15604	0.563000	0.77884	TCA		0.557	DUSP15-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078555.3	NM_080611		17	57	0	0	0	0.008871	0	17	57				
CECR2	27443	broad.mit.edu	37	22	18022656	18022656	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr22:18022656G>A	ENST00000400585.2	+	16	2773	c.2335G>A	c.(2335-2337)Gag>Aag	p.E779K	CECR2_ENST00000400573.5_Missense_Mutation_p.E920K|CECR2_ENST00000262608.8_Missense_Mutation_p.E921K			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	962					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)		p.E920K(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GAGGGCACCGGAGAACAGTGA	0.522																																							uc010gqw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2758-2760)GAG>AAG		cat eye syndrome chromosome region, candidate 2							51.0	54.0	53.0					22																	18022656		1954	4151	6105	SO:0001583	missense	27443				chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding	g.chr22:18022656G>A	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.2335G>A	22.37:g.18022656G>A	ENSP00000383428:p.Glu779Lys		Somatic				CECR2_uc010gqv.1_Missense_Mutation_p.E779K|CECR2_uc002zml.2_Missense_Mutation_p.E779K	p.E920K	NM_031413	NP_113601	WXS	Illumina HiSeq	Unspecified	Q9BXF3	CECR2_HUMAN		Lung(27;0.146)	15	2884	+		all_epithelial(15;0.139)	962					A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	ENST00000400585.2	37	c.2758G>A		.	.	.	.	.	.	.	.	.	.	G	12.85	2.062609	0.36373	.	.	ENSG00000099954	ENST00000400585;ENST00000400573;ENST00000262608	T;T;T	0.27256	1.81;1.8;1.68	4.64	1.47	0.22746	.	0.962960	0.08550	N	0.929215	T	0.17874	0.0429	N	0.22421	0.69	0.23070	N	0.998345	B;B;B	0.20887	0.049;0.02;0.02	B;B;B	0.14023	0.01;0.01;0.01	T	0.27571	-1.0070	10	0.72032	D	0.01	-6.6426	8.7589	0.34663	0.2511:0.0:0.7489:0.0	.	962;779;920	Q9BXF3;B7WPH3;E2QRE6	CECR2_HUMAN;.;.	K	779;920;921	ENSP00000383428:E779K;ENSP00000383417:E920K;ENSP00000262608:E921K	ENSP00000262608:E921K	E	+	1	0	CECR2	16402656	1.000000	0.71417	0.753000	0.31225	0.566000	0.35808	2.182000	0.42556	0.717000	0.32145	0.498000	0.49722	GAG		0.522	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	NM_031413		19	15	0	0	0	0.008871	0	19	15				
MLC1	23209	broad.mit.edu	37	22	50506929	50506929	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr22:50506929G>C	ENST00000311597.5	-	10	1433	c.827C>G	c.(826-828)tCt>tGt	p.S276C	MLC1_ENST00000450140.2_Missense_Mutation_p.S224C|MLC1_ENST00000538737.1_Missense_Mutation_p.S242C|MLC1_ENST00000431262.2_Missense_Mutation_p.S246C|MLC1_ENST00000395876.2_Missense_Mutation_p.S276C|MLC1_ENST00000535444.1_Missense_Mutation_p.S197C|MLC1_ENST00000483836.1_5'UTR	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	276					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.S276C(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		CAGATATCCAGAGGCTGTGAA	0.522																																							uc003bjg.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(826-828)TCT>TGT		megalencephalic leukoencephalopathy with							116.0	119.0	118.0					22																	50506929		2203	4300	6503	SO:0001583	missense	23209					basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity	g.chr22:50506929G>C	D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.827C>G	22.37:g.50506929G>C	ENSP00000310375:p.Ser276Cys		Somatic				MLC1_uc011arl.1_Missense_Mutation_p.S224C|MLC1_uc003bjh.1_Missense_Mutation_p.S276C|MLC1_uc011arm.1_Missense_Mutation_p.S246C|MLC1_uc011arn.1_Missense_Mutation_p.S197C|MLC1_uc011aro.1_Missense_Mutation_p.S242C	p.S276C	NM_139202	NP_631941	WXS	Illumina HiSeq	Unspecified	Q15049	MLC1_HUMAN		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)	10	1100	-		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)	276			Helical; (Potential).		B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	ENST00000311597.5	37	c.827C>G	CCDS14083.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.162994	0.38217	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000538737;ENST00000431262;ENST00000535444;ENST00000450140	D;D;D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48;-2.48;-2.48	4.63	3.61	0.41365	.	0.000000	0.85682	D	0.000000	D	0.92818	0.7716	M	0.70275	2.135	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.85130	0.997;0.997;0.995;0.997	D	0.92595	0.6086	10	0.87932	D	0	-21.0243	10.1962	0.43056	0.0962:0.0:0.9038:0.0	.	242;246;224;276	F5H1B9;B7Z659;B7Z1X1;Q15049	.;.;.;MLC1_HUMAN	C	276;276;242;246;197;224	ENSP00000379216:S276C;ENSP00000310375:S276C;ENSP00000445805:S242C;ENSP00000415877:S246C;ENSP00000438910:S197C;ENSP00000412448:S224C	ENSP00000310375:S276C	S	-	2	0	MLC1	48849056	1.000000	0.71417	0.251000	0.24312	0.046000	0.14306	6.536000	0.73842	1.066000	0.40716	0.563000	0.77884	TCT		0.522	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316979.2	NM_015166		28	44	0	0	0	0.007291	0	28	44				
TUBGCP6	85378	broad.mit.edu	37	22	50682674	50682674	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr22:50682674A>G	ENST00000248846.5	-	1	319	c.215T>C	c.(214-216)aTg>aCg	p.M72T	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.M72T|MAPK12_ENST00000497036.1_5'Flank|HDAC10_ENST00000498366.1_5'Flank			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	72					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.M72T(1)		breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AAAGGACAACATGAGGATCTT	0.517																																							uc003bkb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(214-216)ATG>ACG		tubulin, gamma complex associated protein 6							82.0	78.0	79.0					22																	50682674		2203	4300	6503	SO:0001583	missense	85378				G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding	g.chr22:50682674A>G	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.215T>C	22.37:g.50682674A>G	ENSP00000248846:p.Met72Thr		Somatic				TUBGCP6_uc010har.1_Missense_Mutation_p.M72T|TUBGCP6_uc010has.1_RNA|TUBGCP6_uc010hau.1_Missense_Mutation_p.M72T	p.M72T	NM_020461	NP_065194	WXS	Illumina HiSeq	Unspecified	Q96RT7	GCP6_HUMAN		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)	1	727	-		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	72					Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	37	c.215T>C	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.399582	0.62177	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.22336	2.29;1.96	4.27	4.27	0.50696	.	0.090226	0.85682	D	0.000000	T	0.31263	0.0791	L	0.36672	1.1	0.54753	D	0.999988	D;P;B	0.65815	0.995;0.911;0.45	P;P;B	0.59357	0.856;0.524;0.078	T	0.04930	-1.0917	10	0.62326	D	0.03	.	13.2374	0.59976	1.0:0.0:0.0:0.0	.	72;72;72	A7E2V7;B2RWN4;Q96RT7	.;.;GCP6_HUMAN	T	72	ENSP00000248846:M72T;ENSP00000397387:M72T	ENSP00000248846:M72T	M	-	2	0	TUBGCP6	49024801	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.286000	0.89916	1.796000	0.52611	0.459000	0.35465	ATG		0.517	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461		34	35	0	0	0	0.00623	0	34	35				
EFHB	151651	broad.mit.edu	37	3	19961408	19961408	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr3:19961408C>T	ENST00000295824.9	-	3	1074	c.913G>A	c.(913-915)Gaa>Aaa	p.E305K	EFHB_ENST00000344838.4_Missense_Mutation_p.E175K|EFHB_ENST00000498089.1_5'UTR	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	305							calcium ion binding (GO:0005509)	p.E303K(1)|p.E305K(1)		breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						AATACTCTTTCTACTCCAGCA	0.343																																							uc003cbl.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(913-915)GAA>AAA		EF hand domain family, member B							109.0	117.0	115.0					3																	19961408		2203	4299	6502	SO:0001583	missense	151651				signal transduction	proteinaceous extracellular matrix	calcium ion binding	g.chr3:19961408C>T	AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.913G>A	3.37:g.19961408C>T	ENSP00000295824:p.Glu305Lys		Somatic				EFHB_uc003cbm.2_Missense_Mutation_p.E175K	p.E305K	NM_144715	NP_653316	WXS	Illumina HiSeq	Unspecified	Q8N7U6	EFHB_HUMAN			3	1109	-			305					A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Missense_Mutation	SNP	ENST00000295824.9	37	c.913G>A	CCDS33715.2	.	.	.	.	.	.	.	.	.	.	C	13.20	2.164748	0.38217	.	.	ENSG00000163576	ENST00000295824;ENST00000344838;ENST00000389256;ENST00000440022	T;T;T;T	0.29142	1.88;1.94;2.19;1.58	5.04	2.22	0.28083	.	0.366667	0.26324	N	0.025037	T	0.25121	0.0610	L	0.50333	1.59	0.25626	N	0.986351	P;B	0.35155	0.487;0.158	B;B	0.35470	0.203;0.045	T	0.09862	-1.0655	9	.	.	.	-18.7522	8.5781	0.33612	0.0:0.7328:0.0:0.2672	.	175;305	Q8N7U6-3;Q8N7U6	.;EFHB_HUMAN	K	305;175;305;42	ENSP00000295824:E305K;ENSP00000342263:E175K;ENSP00000373908:E305K;ENSP00000396778:E42K	.	E	-	1	0	EFHB	19936412	0.151000	0.22747	0.939000	0.37840	0.989000	0.77384	0.460000	0.21924	0.629000	0.30376	0.561000	0.74099	GAA		0.343	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318673.2	NM_144715		18	61	0	0	0	0.007413	0	18	61				
NGLY1	55768	broad.mit.edu	37	3	25781184	25781184	+	Silent	SNP	T	T	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr3:25781184T>A	ENST00000280700.5	-	5	925	c.765A>T	c.(763-765)ggA>ggT	p.G255G	NGLY1_ENST00000417874.2_Silent_p.G213G|NGLY1_ENST00000422724.2_Intron|NGLY1_ENST00000396649.3_Silent_p.G255G|NGLY1_ENST00000428257.1_Silent_p.G255G	NM_018297.3	NP_060767.2	Q96IV0	NGLY1_HUMAN	N-glycanase 1	255					glycoprotein catabolic process (GO:0006516)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity (GO:0000224)	p.G255G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)	18						ACCTAGTCTGTCCACCACATT	0.423																																							uc003cdl.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(763-765)GGA>GGT		N-glycanase 1 isoform 1							146.0	128.0	134.0					3																	25781184		2203	4300	6503	SO:0001819	synonymous_variant	55768				glycoprotein catabolic process	cytoplasm	metal ion binding|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity|protein binding	g.chr3:25781184T>A	AF250924	CCDS33719.1, CCDS46777.1, CCDS46778.1, CCDS46779.1	3p23	2006-08-30			ENSG00000151092	ENSG00000151092			17646	protein-coding gene	gene with protein product		610661					Standard	NM_018297		Approved	FLJ11005, PNG1	uc003cdl.3	Q96IV0	OTTHUMG00000155600	ENST00000280700.5:c.765A>T	3.37:g.25781184T>A			Somatic				NGLY1_uc010hfg.2_Silent_p.G255G|NGLY1_uc003cdm.2_Silent_p.G255G|NGLY1_uc011awo.1_Silent_p.G213G|NGLY1_uc003cdk.2_Intron	p.G255G	NM_018297	NP_060767	WXS	Illumina HiSeq	Unspecified	Q96IV0	NGLY1_HUMAN			5	873	-			255					B4DJE9|Q59FB1|Q6PJD8|Q9BVR8|Q9NR70	Silent	SNP	ENST00000280700.5	37	c.765A>T	CCDS33719.1																																																																																				0.423	NGLY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340832.2			30	75	0	0	0	0.008361	0	30	75				
NCKIPSD	51517	broad.mit.edu	37	3	48719904	48719904	+	Silent	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr3:48719904G>A	ENST00000294129.2	-	3	482	c.363C>T	c.(361-363)acC>acT	p.T121T	NCKIPSD_ENST00000416649.2_Silent_p.T121T|NCKIPSD_ENST00000341520.4_Silent_p.T121T	NM_016453.2	NP_057537.1	Q9NZQ3	SPN90_HUMAN	NCK interacting protein with SH3 domain	121					cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|NLS-bearing protein import into nucleus (GO:0006607)|signal transduction (GO:0007165)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	cytoskeletal protein binding (GO:0008092)	p.T121T(2)		endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGTGGTCACTGGTTGATGAGG	0.582																																							uc003cun.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(361-363)ACC>ACT		NCK interacting protein with SH3 domain isoform							112.0	113.0	112.0					3																	48719904		2203	4300	6503	SO:0001819	synonymous_variant	51517				cytoskeleton organization|NLS-bearing substrate import into nucleus|signal transduction	intermediate filament|nucleus	cytoskeletal protein binding|SH3 domain binding	g.chr3:48719904G>A	AF178432	CCDS2776.1, CCDS46827.1	3p21	2008-07-18			ENSG00000213672	ENSG00000213672			15486	protein-coding gene	gene with protein product	"""dia interacting protein"", ""diaphanous protein interacting protein"", ""SH3 protein interacting with Nck, 90 kDa"""	606671				10648423, 10619843	Standard	NM_016453		Approved	AF3P21, SPIN90, ORF1, WISH, WASLBP, DIP1	uc003cun.3	Q9NZQ3	OTTHUMG00000133542	ENST00000294129.2:c.363C>T	3.37:g.48719904G>A			Somatic				NCKIPSD_uc003cum.2_Silent_p.T121T|NCKIPSD_uc010hkh.1_Silent_p.T121T	p.T121T	NM_016453	NP_057537	WXS	Illumina HiSeq	Unspecified	Q9NZQ3	SPN90_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	3	457	-			121					B4DFL5|Q6GU34|Q6SPF3|Q8TC10|Q9UGM8	Silent	SNP	ENST00000294129.2	37	c.363C>T	CCDS2776.1																																																																																				0.582	NCKIPSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257520.1	NM_016453		3	51	0	0	0	0.004672	0	3	51				
ROBO1	6091	broad.mit.edu	37	3	78710334	78710334	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr3:78710334G>T	ENST00000464233.1	-	16	2279	c.2166C>A	c.(2164-2166)gaC>gaA	p.D722E	ROBO1_ENST00000467549.1_Missense_Mutation_p.D686E|ROBO1_ENST00000495273.1_Missense_Mutation_p.D686E|ROBO1_ENST00000436010.2_Missense_Mutation_p.D683E	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	722	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.D699E(1)|p.D726E(1)|p.D686E(1)|p.D722E(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AAACTAACCAGTCTGATTCTC	0.398																																							uc003dqe.2		NA																	4	Substitution - Missense(4)		lung(4)	large_intestine(2)	2						c.(2164-2166)GAC>GAA		roundabout 1 isoform a							99.0	97.0	97.0					3																	78710334		1826	4089	5915	SO:0001583	missense	6091				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding	g.chr3:78710334G>T	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2166C>A	3.37:g.78710334G>T	ENSP00000420321:p.Asp722Glu		Somatic				ROBO1_uc003dqb.2_Missense_Mutation_p.D683E|ROBO1_uc003dqc.2_Missense_Mutation_p.D686E|ROBO1_uc003dqd.2_Missense_Mutation_p.D686E|ROBO1_uc010hoh.2_Translation_Start_Site|ROBO1_uc011bgl.1_Missense_Mutation_p.D294E|ROBO1_uc003dqf.1_Missense_Mutation_p.D401E	p.D722E	NM_002941	NP_002932	WXS	Illumina HiSeq	Unspecified	Q9Y6N7	ROBO1_HUMAN		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)	16	2374	-		Lung SC(41;0.0257)|Lung NSC(201;0.0439)	722			Extracellular (Potential).|Fibronectin type-III 2.		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	c.2166C>A	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	1.186	-0.636675	0.03557	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.5	1.53	0.23141	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.236227	0.49916	N	0.000135	T	0.25791	0.0628	N	0.08118	0	0.25955	N	0.982706	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.06405	0.001;0.001;0.002;0.002;0.002;0.001	T	0.15925	-1.0420	9	.	.	.	.	7.0502	0.25069	0.0:0.4474:0.3556:0.197	.	686;686;722;686;686;683	Q9Y6N7-3;Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;.;ROBO1_HUMAN;.;.;.	E	683;686;722;686;686;726	ENSP00000406043:D683E;ENSP00000420321:D722E;ENSP00000420637:D686E;ENSP00000417992:D686E	.	D	-	3	2	ROBO1	78793024	0.211000	0.23529	0.964000	0.40570	0.678000	0.39670	-0.344000	0.07780	-0.002000	0.14469	-0.270000	0.10280	GAC		0.398	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941		3	27	1	0	0.004672	0.004672	0.00493156	3	27				
OR5H15	403274	broad.mit.edu	37	3	97888478	97888478	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr3:97888478C>T	ENST00000356526.2	+	1	935	c.935C>T	c.(934-936)tCa>tTa	p.S312L		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S312L(2)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						GTTAAGGTTTCATACTAATAT	0.284																																							uc011bgu.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(934-936)TCA>TTA		olfactory receptor, family 5, subfamily H,							27.0	28.0	28.0					3																	97888478		2121	4258	6379	SO:0001583	missense	403274				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:97888478C>T		CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.935C>T	3.37:g.97888478C>T	ENSP00000373195:p.Ser312Leu		Somatic					p.S312L	NM_001005515	NP_001005515	WXS	Illumina HiSeq	Unspecified	A6NDH6	O5H15_HUMAN			1	935	+			312			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000356526.2	37	c.935C>T	CCDS33799.1	.	.	.	.	.	.	.	.	.	.	-	5.528	0.282419	0.10458	.	.	ENSG00000233412	ENST00000356526	T	0.00297	8.23	2.3	-0.592	0.11671	.	.	.	.	.	T	0.00109	0.0003	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20075	-1.0286	9	0.72032	D	0.01	.	5.4732	0.16682	0.0:0.3665:0.0:0.6335	.	312	A6NDH6	O5H15_HUMAN	L	312	ENSP00000373195:S312L	ENSP00000373195:S312L	S	+	2	0	OR5H15	99371168	0.000000	0.05858	0.001000	0.08648	0.171000	0.22731	-0.821000	0.04452	-0.072000	0.12864	0.162000	0.16502	TCA		0.284	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359109.1			5	21	0	0	0	0.014758	0	5	21				
CMSS1	84319	broad.mit.edu	37	3	99895199	99895199	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr3:99895199T>G	ENST00000421999.2	+	9	842	c.696T>G	c.(694-696)ttT>ttG	p.F232L	CMSS1_ENST00000489081.1_Missense_Mutation_p.F214L	NM_032359.3	NP_115735.2	Q9BQ75	CMS1_HUMAN	cms1 ribosomal small subunit homolog (yeast)	232							poly(A) RNA binding (GO:0044822)	p.F232L(1)									CCTTAAAATTTCTGGTTTTTG	0.388																																							uc003dtl.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(694-696)TTT>TTG		hypothetical protein LOC84319							85.0	88.0	87.0					3																	99895199		2203	4300	6503	SO:0001583	missense	84319						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr3:99895199T>G		CCDS2935.1, CCDS54618.1	3q12.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000184220	ENSG00000184220			28666	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 26"""	C3orf26		12477932	Standard	NM_032359		Approved	MGC4308	uc003dtl.3	Q9BQ75	OTTHUMG00000159054	ENST00000421999.2:c.696T>G	3.37:g.99895199T>G	ENSP00000410396:p.Phe232Leu		Somatic					p.F232L	NM_032359	NP_115735	WXS	Illumina HiSeq	Unspecified	Q9BQ75	CC026_HUMAN			9	839	+			232					A8K5S7|B4DUM1|E9PHS3	Missense_Mutation	SNP	ENST00000421999.2	37	c.696T>G	CCDS2935.1	.	.	.	.	.	.	.	.	.	.	T	9.093	1.002330	0.19121	.	.	ENSG00000184220	ENST00000421999;ENST00000489081;ENST00000478909	T;T;T	0.26660	1.72;1.72;1.72	4.84	2.39	0.29439	DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.106709	0.64402	D	0.000003	T	0.17450	0.0419	L	0.36672	1.1	0.30783	N	0.741815	B	0.28350	0.208	B	0.30251	0.113	T	0.15407	-1.0438	9	.	.	.	.	6.8985	0.24269	0.0:0.2944:0.0:0.7056	.	232	Q9BQ75	CC026_HUMAN	L	232;214;188	ENSP00000410396:F232L;ENSP00000419161:F214L;ENSP00000417293:F188L	.	F	+	3	2	C3orf26	101377889	0.998000	0.40836	1.000000	0.80357	0.130000	0.20726	0.313000	0.19415	0.273000	0.22049	0.482000	0.46254	TTT		0.388	CMSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353060.1	NM_032359		9	22	0	0	0	0.008291	0	9	22				
PHLDB2	90102	broad.mit.edu	37	3	111638039	111638039	+	Missense_Mutation	SNP	C	C	A	rs201756409		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr3:111638039C>A	ENST00000431670.2	+	4	2251	c.1840C>A	c.(1840-1842)Cag>Aag	p.Q614K	PHLDB2_ENST00000495180.1_Missense_Mutation_p.Q200K|PHLDB2_ENST00000481953.1_Missense_Mutation_p.Q614K|PHLDB2_ENST00000393923.3_Missense_Mutation_p.Q641K|PHLDB2_ENST00000412622.1_Missense_Mutation_p.Q614K|PHLDB2_ENST00000393925.3_Missense_Mutation_p.Q614K	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	614						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.Q614K(2)|p.Q641K(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						CATAAATGATCAGATGGATGA	0.378																																							uc010hqa.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(4)|skin(2)	6						c.(1840-1842)CAG>AAG		pleckstrin homology-like domain, family B,							109.0	110.0	109.0					3																	111638039		2203	4300	6503	SO:0001583	missense	90102					cytoplasm|intermediate filament cytoskeleton|plasma membrane		g.chr3:111638039C>A		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1840C>A	3.37:g.111638039C>A	ENSP00000405405:p.Gln614Lys		Somatic				PHLDB2_uc003dyc.2_Missense_Mutation_p.Q641K|PHLDB2_uc003dyd.2_Missense_Mutation_p.Q614K|PHLDB2_uc003dyg.2_Missense_Mutation_p.Q614K|PHLDB2_uc003dyh.2_Missense_Mutation_p.Q614K|PHLDB2_uc003dyi.2_Missense_Mutation_p.Q200K	p.Q614K	NM_001134438	NP_001127910	WXS	Illumina HiSeq	Unspecified	Q86SQ0	PHLB2_HUMAN			4	2251	+			614			Potential.		A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	37	c.1840C>A	CCDS46886.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697764	0.88830	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.53206	0.63;0.81;0.64;0.65;0.81;0.64;1.57	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.69780	0.3149	M	0.78049	2.395	0.58432	D	0.999994	P;D;D;D	0.76494	0.942;0.998;0.999;0.999	P;D;D;D	0.87578	0.684;0.983;0.998;0.998	T	0.71251	-0.4648	10	0.52906	T	0.07	.	16.4822	0.84160	0.0:1.0:0.0:0.0	.	200;614;614;641	E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;PHLB2_HUMAN;.;.	K	641;641;614;614;614;614;614;200	ENSP00000377500:Q641K;ENSP00000405405:Q614K;ENSP00000405292:Q614K;ENSP00000418296:Q614K;ENSP00000377502:Q614K;ENSP00000418319:Q614K;ENSP00000420303:Q200K	ENSP00000352764:Q641K	Q	+	1	0	PHLDB2	113120729	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.584000	0.74057	2.684000	0.91462	0.561000	0.74099	CAG		0.378	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753		16	58	1	0	7.07596e-05	0.006122	7.65816e-05	16	58				
ITGB5	3693	broad.mit.edu	37	3	124578095	124578095	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr3:124578095G>A	ENST00000296181.4	-	3	651	c.355C>T	c.(355-357)Cgg>Tgg	p.R119W		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	119					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)	p.R119W(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		TCACCGGGCCGGAGGTTCACG	0.592																																							uc003eho.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(355-357)CGG>TGG		integrin, beta 5 precursor							63.0	66.0	65.0					3																	124578095		2203	4300	6503	SO:0001583	missense	3693				cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity	g.chr3:124578095G>A	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.355C>T	3.37:g.124578095G>A	ENSP00000296181:p.Arg119Trp		Somatic					p.R119W	NM_002213	NP_002204	WXS	Illumina HiSeq	Unspecified	P18084	ITB5_HUMAN		GBM - Glioblastoma multiforme(114;0.163)	3	652	-			119			Extracellular (Potential).		B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	37	c.355C>T	CCDS3030.1	.	.	.	.	.	.	.	.	.	.	G	19.70	3.877305	0.72294	.	.	ENSG00000082781	ENST00000296181	D	0.95205	-3.64	5.26	2.37	0.29283	Integrin beta subunit, N-terminal (2);	0.059005	0.64402	D	0.000003	D	0.97785	0.9273	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97999	1.0359	10	0.87932	D	0	.	13.912	0.63873	0.0:0.0:0.4707:0.5293	.	119	P18084	ITB5_HUMAN	W	119	ENSP00000296181:R119W	ENSP00000296181:R119W	R	-	1	2	ITGB5	126060785	0.999000	0.42202	0.983000	0.44433	0.912000	0.54170	1.819000	0.39022	0.314000	0.23086	0.655000	0.94253	CGG		0.592	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213		20	55	0	0	0	0.012319	0	20	55				
MLF1	4291	broad.mit.edu	37	3	158322896	158322896	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr3:158322896C>T	ENST00000355893.5	+	7	850	c.712C>T	c.(712-714)Caa>Taa	p.Q238*	MLF1_ENST00000497004.1_3'UTR|MLF1_ENST00000469452.1_Nonsense_Mutation_p.Q170*|MLF1_ENST00000478894.2_Nonsense_Mutation_p.Q228*|MLF1_ENST00000471745.1_Nonsense_Mutation_p.Q228*|MLF1_ENST00000482628.1_Nonsense_Mutation_p.Q213*|MLF1_ENST00000484955.1_Nonsense_Mutation_p.Q213*|MLF1_ENST00000359117.5_Nonsense_Mutation_p.Q213*|MLF1_ENST00000392822.3_Nonsense_Mutation_p.Q269*	NM_022443.4	NP_071888.1	P58340	MLF1_HUMAN	myeloid leukemia factor 1	238					cell cycle arrest (GO:0007050)|myeloid progenitor cell differentiation (GO:0002318)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)	p.Q269*(1)|p.Q238*(1)		large_intestine(3)	3		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)			GGAGAAACCTCAACAAAGTCC	0.328			T	NPM1	AML																																		uc003fcb.2		NA		Dom	yes		3	3q25.1	4291	T	myeloid leukemia factor 1			L	NPM1		AML		2	Substitution - Nonsense(2)		lung(2)		0						c.(712-714)CAA>TAA		myeloid leukemia factor 1 isoform 1							61.0	64.0	63.0					3																	158322896		2203	4300	6503	SO:0001587	stop_gained	4291				cell cycle arrest|myeloid progenitor cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein domain specific binding	g.chr3:158322896C>T	L49054	CCDS3182.1, CCDS46945.1, CCDS56286.1, CCDS56287.1, CCDS56288.1	3q25	2008-07-18			ENSG00000178053	ENSG00000178053			7125	protein-coding gene	gene with protein product	"""myeloid leukemia factor 1 variant 1"", ""myeloid leukemia factor 1 variant 2"", ""myeloid leukemia factor 1 variant 3"""	601402				8570204	Standard	NM_022443		Approved		uc003fcb.3	P58340	OTTHUMG00000158775	ENST00000355893.5:c.712C>T	3.37:g.158322896C>T	ENSP00000348157:p.Gln238*		Somatic				MLF1_uc003fbz.2_Nonsense_Mutation_p.Q213*|MLF1_uc003fca.2_Nonsense_Mutation_p.Q213*|MLF1_uc003fbx.2_Nonsense_Mutation_p.Q228*|MLF1_uc003fcc.2_Nonsense_Mutation_p.Q269*|MLF1_uc003fby.2_Nonsense_Mutation_p.Q164*|MLF1_uc010hvx.2_Nonsense_Mutation_p.Q170*	p.Q238*	NM_022443	NP_071888	WXS	Illumina HiSeq	Unspecified	P58340	MLF1_HUMAN	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)		7	849	+		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	238					E9PEU9|Q2TLE3|Q2TLE5|Q8N8F8|Q96MH1	Nonsense_Mutation	SNP	ENST00000355893.5	37	c.712C>T	CCDS3182.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718300	0.89205	.	.	ENSG00000178053	ENST00000491767;ENST00000355893;ENST00000484955;ENST00000359117;ENST00000471745;ENST00000469452;ENST00000482628;ENST00000478894;ENST00000392822	.	.	.	5.47	3.5	0.40072	.	1.257560	0.05180	N	0.501119	.	.	.	.	.	.	0.52501	D	0.999959	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-1.3514	9.0302	0.36254	0.1815:0.6677:0.1508:0.0	.	.	.	.	X	164;238;213;213;228;170;213;228;269	.	ENSP00000348157:Q238X	Q	+	1	0	MLF1	159805590	0.004000	0.15560	0.008000	0.14137	0.914000	0.54420	1.700000	0.37815	1.239000	0.43787	0.585000	0.79938	CAA		0.328	MLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352164.3	NM_022443		4	13	0	0	0	0.009096	0	4	13				
BLOC1S4	55330	broad.mit.edu	37	4	6718324	6718324	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr4:6718324C>T	ENST00000320776.3	+	1	483	c.388C>T	c.(388-390)Cgc>Tgc	p.R130C		NM_018366.2	NP_060836.1	Q9NUP1	BL1S4_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino	130					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|platelet aggregation (GO:0070527)|post-Golgi vesicle-mediated transport (GO:0006892)	BLOC-1 complex (GO:0031083)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.R130C(1)									CGAGATGCGGCGCATCTACAG	0.692																																							uc003gjp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(388-390)CGC>TGC		cappuccino							15.0	13.0	13.0					4																	6718324		2145	4218	6363	SO:0001583	missense	55330				cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol		g.chr4:6718324C>T	BC001818	CCDS3393.1	4p16.1	2012-08-01	2012-08-01	2012-08-01	ENSG00000186222	ENSG00000186222		"""Biogenesis of lysosomal organelles complex-1 subunits"""	24206	protein-coding gene	gene with protein product		605695	"""cappuccino homolog (mouse)"""	CNO		12576321, 11110696	Standard	NM_018366		Approved	FLJ11230, BCAS4L	uc003gjp.1	Q9NUP1	OTTHUMG00000125510	ENST00000320776.3:c.388C>T	4.37:g.6718324C>T	ENSP00000318128:p.Arg130Cys		Somatic					p.R130C	NM_018366	NP_060836	WXS	Illumina HiSeq	Unspecified	Q9NUP1	CNO_HUMAN		Colorectal(103;0.0523)	1	483	+			130					Q6NVY6|Q96G84	Missense_Mutation	SNP	ENST00000320776.3	37	c.388C>T	CCDS3393.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360763	0.82353	.	.	ENSG00000186222	ENST00000320776	T	0.47177	0.85	4.18	4.18	0.49190	.	0.860244	0.10550	N	0.661564	T	0.45637	0.1352	L	0.36672	1.1	0.41847	D	0.990154	D	0.65815	0.995	P	0.46975	0.533	T	0.45629	-0.9248	10	0.56958	D	0.05	-27.3006	12.7525	0.57316	0.0:1.0:0.0:0.0	.	130	Q9NUP1	CNO_HUMAN	C	130	ENSP00000318128:R130C	ENSP00000318128:R130C	R	+	1	0	CNO	6769225	0.993000	0.37304	0.903000	0.35520	0.616000	0.37450	1.770000	0.38532	2.275000	0.75901	0.561000	0.74099	CGC		0.692	BLOC1S4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246837.1	NM_018366		9	10	0	0	0	0.004482	0	9	10				
PCDH10	57575	broad.mit.edu	37	4	134073258	134073258	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr4:134073258G>A	ENST00000264360.5	+	1	2789	c.1963G>A	c.(1963-1965)Gag>Aag	p.E655K	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	655	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E655K(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GCGGCCTTATGAGCTGGTGAT	0.692																																							uc003iha.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1963-1965)GAG>AAG		protocadherin 10 isoform 1 precursor							19.0	23.0	22.0					4																	134073258		2188	4284	6472	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134073258G>A	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1963G>A	4.37:g.134073258G>A	ENSP00000264360:p.Glu655Lys		Somatic				uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.E655K	p.E655K	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	2789	+			655			Cadherin 6.|Extracellular (Potential).		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.1963G>A	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547246	0.45383	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.54071	0.59	4.47	4.47	0.54385	Cadherin (4);Cadherin-like (1);	0.000000	0.43919	D	0.000509	T	0.42245	0.1194	N	0.26042	0.785	0.48288	D	0.999627	P;B	0.36683	0.565;0.001	B;B	0.36378	0.223;0.007	T	0.42207	-0.9465	10	0.40728	T	0.16	.	16.9329	0.86195	0.0:0.0:1.0:0.0	.	655;655	Q9P2E7;Q96SF0	PCD10_HUMAN;.	K	655	ENSP00000264360:E655K	ENSP00000264360:E655K	E	+	1	0	PCDH10	134292708	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.741000	0.74837	2.310000	0.77875	0.655000	0.94253	GAG		0.692	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		10	17	0	0	0	0.006214	0	10	17				
TRAPPC11	60684	broad.mit.edu	37	4	184596357	184596357	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr4:184596357G>T	ENST00000334690.6	+	7	903	c.701G>T	c.(700-702)aGt>aTt	p.S234I	TRAPPC11_ENST00000357207.4_Missense_Mutation_p.S234I|RNU6-335P_ENST00000364563.1_RNA|TRAPPC11_ENST00000511409.1_3'UTR	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	234					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.S234I(1)									GCTTTCTTCAGTGAGTTGAAA	0.249																																							uc003ivx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(700-702)AGT>ATT		hypothetical protein LOC60684 isoform a							44.0	47.0	46.0					4																	184596357		2199	4287	6486	SO:0001583	missense	60684							g.chr4:184596357G>T		CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.701G>T	4.37:g.184596357G>T	ENSP00000335371:p.Ser234Ile		Somatic				C4orf41_uc003ivw.2_Missense_Mutation_p.S234I|C4orf41_uc010isc.2_Intron	p.S234I	NM_021942	NP_068761	WXS	Illumina HiSeq	Unspecified	Q7Z392	CD041_HUMAN		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)	7	877	+		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)	234					A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	ENST00000334690.6	37	c.701G>T	CCDS34112.1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.890166	0.72524	.	.	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000360109	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.72787	0.3504	M	0.64170	1.965	0.80722	D	1	D;D	0.58620	0.972;0.983	P;P	0.56865	0.648;0.808	T	0.67914	-0.5547	9	0.23891	T	0.37	.	19.3719	0.94492	0.0:0.0:1.0:0.0	.	234;234	Q7Z392;Q7Z392-3	TPC11_HUMAN;.	I	234	.	ENSP00000335371:S234I	S	+	2	0	C4orf41	184833351	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.571000	0.74000	2.639000	0.89480	0.655000	0.94253	AGT		0.249	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2	NM_021942		7	7	1	0	0.00448238	0.004482	0.00476079	7	7				
ZFYVE16	9765	broad.mit.edu	37	5	79734068	79734068	+	Missense_Mutation	SNP	G	G	A	rs367799631		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr5:79734068G>A	ENST00000338008.5	+	3	1744	c.1564G>A	c.(1564-1566)Gca>Aca	p.A522T	ZFYVE16_ENST00000510158.1_Missense_Mutation_p.A522T|ZFYVE16_ENST00000505560.1_Missense_Mutation_p.A522T	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	522					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)	p.A522T(1)		breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		TGATGAAGGCGCAAAAAGTGG	0.353																																					Melanoma(150;1452 1854 16018 17851 37292)	Melanoma(150;1452 1854 16018 17851 37292)	uc003kgr.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1564-1566)GCA>ACA		zinc finger, FYVE domain containing 16		G	THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	74.0	78.0	76.0		1564,1564	3.2	0.9	5		76	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ZFYVE16	NM_001105251.1,NM_014733.3	58,58	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign,benign	522/1540,522/1540	79734068	2,13004	2203	4300	6503	SO:0001583	missense	9765				BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity	g.chr5:79734068G>A	AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.1564G>A	5.37:g.79734068G>A	ENSP00000337159:p.Ala522Thr		Somatic				ZFYVE16_uc010jak.1_Missense_Mutation_p.A522T|ZFYVE16_uc003kgp.2_Missense_Mutation_p.A522T|ZFYVE16_uc003kgq.3_Missense_Mutation_p.A522T|ZFYVE16_uc003kgs.3_Missense_Mutation_p.A522T	p.A522T	NM_001105251	NP_001098721	WXS	Illumina HiSeq	Unspecified	Q7Z3T8	ZFY16_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)	4	1866	+		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)	522					O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	ENST00000338008.5	37	c.1564G>A	CCDS4050.1	.	.	.	.	.	.	.	.	.	.	G	5.330	0.246272	0.10130	2.27E-4	1.16E-4	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.37584	1.19;1.19;1.19	5.63	3.24	0.37175	.	0.414834	0.25634	N	0.029328	T	0.15739	0.0379	N	0.08118	0	0.09310	N	0.999997	B;B	0.29671	0.0;0.254	B;B	0.19148	0.001;0.024	T	0.15983	-1.0418	10	0.25106	T	0.35	-1.1587	8.9058	0.35523	0.8526:0.0:0.1474:0.0	.	522;522	Q7Z3T8-3;Q7Z3T8	.;ZFY16_HUMAN	T	522	ENSP00000337159:A522T;ENSP00000423663:A522T;ENSP00000426848:A522T	ENSP00000337159:A522T	A	+	1	0	ZFYVE16	79769824	0.025000	0.19082	0.873000	0.34254	0.161000	0.22273	0.582000	0.23834	0.512000	0.28257	-1.004000	0.02495	GCA		0.353	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733		3	68	0	0	0	0.009096	0	3	68				
GPR98	84059	broad.mit.edu	37	5	89923136	89923136	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr5:89923136A>T	ENST00000405460.2	+	7	877	c.781A>T	c.(781-783)Agt>Tgt	p.S261C		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	261					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.S261C(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GAAAAATGATAGTCCCGTGAG	0.353																																							uc003kju.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|central_nervous_system(3)|pancreas(2)	16						c.(781-783)AGT>TGT		G protein-coupled receptor 98 precursor							81.0	81.0	81.0					5																	89923136		1852	4080	5932	SO:0001583	missense	84059				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr5:89923136A>T	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.781A>T	5.37:g.89923136A>T	ENSP00000384582:p.Ser261Cys		Somatic				GPR98_uc003kjt.2_5'UTR	p.S261C	NM_032119	NP_115495	WXS	Illumina HiSeq	Unspecified	Q8WXG9	GPR98_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)	7	877	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	261			Extracellular (Potential).		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	c.781A>T	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	18.26	3.583843	0.65992	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.29142	1.58	5.79	0.311	0.15831	.	0.244071	0.53938	D	0.000044	T	0.52964	0.1767	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.53725	-0.8398	10	0.87932	D	0	.	10.1539	0.42812	0.7539:0.0:0.2461:0.0	.	261	Q8WXG9	GPR98_HUMAN	C	261	ENSP00000384582:S261C	ENSP00000296619:S261C	S	+	1	0	GPR98	89958892	1.000000	0.71417	0.794000	0.32065	0.967000	0.64934	4.008000	0.57103	-0.160000	0.11002	-0.297000	0.09499	AGT		0.353	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		22	64	0	0	0	0.012319	0	22	64				
ZNF474	133923	broad.mit.edu	37	5	121488198	121488198	+	Missense_Mutation	SNP	T	T	G	rs150551514		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr5:121488198T>G	ENST00000296600.4	+	2	896	c.513T>G	c.(511-513)tgT>tgG	p.C171W	ZNF474_ENST00000514925.1_Intron|CTC-441N14.2_ENST00000504829.1_RNA|CTC-441N14.1_ENST00000505209.1_RNA	NM_207317.1	NP_997200.1	Q6S9Z5	ZN474_HUMAN	zinc finger protein 474	171							metal ion binding (GO:0046872)	p.C171W(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|stomach(1)	21		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)		GTGAATCCTGTGGCCGCACAT	0.532													T|||	1	0.000199681	0.0	0.0	5008	,	,		18037	0.001		0.0	False		,,,				2504	0.0						uc003ksv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(511-513)TGT>TGG		zinc finger protein 474							65.0	62.0	63.0					5																	121488198		2203	4300	6503	SO:0001583	missense	133923					intracellular	zinc ion binding	g.chr5:121488198T>G	AK057483	CCDS4130.1	5q23.2	2008-02-05			ENSG00000164185	ENSG00000164185		"""Zinc fingers, C2H2-type"""	23245	protein-coding gene	gene with protein product							Standard	NM_207317		Approved	4933409D10Rik, FLJ32921	uc003ksv.3	Q6S9Z5	OTTHUMG00000128911	ENST00000296600.4:c.513T>G	5.37:g.121488198T>G	ENSP00000296600:p.Cys171Trp		Somatic					p.C171W	NM_207317	NP_997200	WXS	Illumina HiSeq	Unspecified	Q6S9Z5	ZN474_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)	2	889	+		all_cancers(142;0.229)|Prostate(80;0.0387)	171			C2H2-type; degenerate.		A8K4M0|Q96M07	Missense_Mutation	SNP	ENST00000296600.4	37	c.513T>G	CCDS4130.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	T	13.31	2.197868	0.38806	.	.	ENSG00000164185	ENST00000296600	D	0.99960	-9.1	5.58	-0.927	0.10451	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	D	0.99951	0.9979	M	0.91459	3.21	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.96325	0.9239	10	0.87932	D	0	-16.7393	10.3917	0.44175	0.0:0.4338:0.0:0.5662	.	171	Q6S9Z5	ZN474_HUMAN	W	171	ENSP00000296600:C171W	ENSP00000296600:C171W	C	+	3	2	ZNF474	121516097	1.000000	0.71417	0.919000	0.36401	0.424000	0.31475	0.559000	0.23485	-0.387000	0.07809	-0.256000	0.11100	TGT		0.532	ZNF474-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250883.2	NM_207317		12	28	0	0	0	0.013537	0	12	28				
KDM3B	51780	broad.mit.edu	37	5	137734048	137734048	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr5:137734048G>C	ENST00000314358.5	+	10	3213	c.3013G>C	c.(3013-3015)Gag>Cag	p.E1005Q	KDM3B_ENST00000394866.1_Missense_Mutation_p.E661Q|KDM3B_ENST00000542866.1_Missense_Mutation_p.E37Q	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1005					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.E1005Q(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CGTAATGTCTGAGAAGGAGGC	0.473																																							uc003lcy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11						c.(3013-3015)GAG>CAG		jumonji domain containing 1B							122.0	119.0	120.0					5																	137734048		2203	4300	6503	SO:0001583	missense	51780				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr5:137734048G>C	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.3013G>C	5.37:g.137734048G>C	ENSP00000326563:p.Glu1005Gln		Somatic				KDM3B_uc010jew.1_Missense_Mutation_p.E661Q|KDM3B_uc011cys.1_Missense_Mutation_p.E37Q	p.E1005Q	NM_016604	NP_057688	WXS	Illumina HiSeq	Unspecified	Q7LBC6	KDM3B_HUMAN			10	3213	+			1005					A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	c.3013G>C	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	G	33	5.250251	0.95305	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	D;D;D	0.93712	-2.73;-3.27;-1.59	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.96846	0.8970	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.97395	0.9992	10	0.87932	D	0	-26.6742	18.7813	0.91933	0.0:0.0:1.0:0.0	.	661;1005	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	Q	1005;795;661;37	ENSP00000326563:E1005Q;ENSP00000378335:E661Q;ENSP00000439462:E37Q	ENSP00000326563:E1005Q	E	+	1	0	KDM3B	137761947	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.869000	0.99810	2.425000	0.82216	0.555000	0.69702	GAG		0.473	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604		18	47	0	0	0	0.006122	0	18	47				
PCDHB14	56122	broad.mit.edu	37	5	140605416	140605416	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr5:140605416G>T	ENST00000239449.4	+	1	2339	c.2339G>T	c.(2338-2340)gGt>gTt	p.G780V	PCDHB14_ENST00000515856.2_Missense_Mutation_p.G627V	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	780					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G780V(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CATGACACTGGTAGGAATATG	0.373																																					Ovarian(141;50 1831 27899 33809 37648)	Ovarian(141;50 1831 27899 33809 37648)	uc003ljb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2338-2340)GGT>GTT		protocadherin beta 14 precursor							76.0	86.0	83.0					5																	140605416		2203	4300	6503	SO:0001583	missense	56122				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140605416G>T	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2339G>T	5.37:g.140605416G>T	ENSP00000239449:p.Gly780Val		Somatic				PCDHB14_uc011dal.1_Missense_Mutation_p.G627V	p.G780V	NM_018934	NP_061757	WXS	Illumina HiSeq	Unspecified	Q9Y5E9	PCDBE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2339	+			780			Cytoplasmic (Potential).		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	c.2339G>T	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	8.727	0.915686	0.17907	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.14022	2.54;2.54	4.4	2.57	0.30868	.	.	.	.	.	T	0.18257	0.0438	M	0.84948	2.725	0.09310	N	0.999999	B	0.12013	0.005	B	0.15484	0.013	T	0.32613	-0.9900	9	0.52906	T	0.07	.	3.4125	0.07364	0.3046:0.0:0.5159:0.1795	.	780	Q9Y5E9	PCDBE_HUMAN	V	627;780	ENSP00000444518:G627V;ENSP00000239449:G780V	ENSP00000239449:G780V	G	+	2	0	PCDHB14	140585600	0.001000	0.12720	0.001000	0.08648	0.016000	0.09150	0.699000	0.25586	0.380000	0.24823	-0.237000	0.12165	GGT		0.373	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934		24	65	1	0	2.21704e-12	0.016522	2.66981e-12	24	65				
PCDHGB2	56103	broad.mit.edu	37	5	140741814	140741814	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr5:140741814C>G	ENST00000522605.1	+	1	2112	c.2112C>G	c.(2110-2112)ttC>ttG	p.F704L	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	704					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F704L(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCTTCTTCCTCGCGGTGA	0.582																																							uc003ljs.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2110-2112)TTC>TTG		protocadherin gamma subfamily B, 2 isoform 1							95.0	98.0	97.0					5																	140741814		2046	4193	6239	SO:0001583	missense	56103				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140741814C>G	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2112C>G	5.37:g.140741814C>G	ENSP00000429018:p.Phe704Leu		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.F704L|PCDHGA5_uc011das.1_5'Flank	p.F704L	NM_018923	NP_061746	WXS	Illumina HiSeq	Unspecified	Q9Y5G2	PCDGE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2112	+			704			Helical; (Potential).		Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	37	c.2112C>G	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.396924	0.01175	.	.	ENSG00000253910	ENST00000522605	T	0.00638	6.04	4.96	-1.49	0.08718	.	.	.	.	.	T	0.00144	0.0004	N	0.00007	-3.145	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45205	-0.9277	9	0.02654	T	1	.	7.681	0.28513	0.0:0.2432:0.4189:0.3379	.	704;704	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	L	704	ENSP00000429018:F704L	ENSP00000429018:F704L	F	+	3	2	PCDHGB2	140721998	0.000000	0.05858	0.370000	0.25965	0.432000	0.31715	-2.979000	0.00663	-0.265000	0.09352	0.461000	0.40582	TTC		0.582	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923		28	82	0	0	0	0.00632	0	28	82				
VARS	7407	broad.mit.edu	37	6	31746796	31746796	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr6:31746796G>A	ENST00000375663.3	-	29	4114	c.3674C>T	c.(3673-3675)tCg>tTg	p.S1225L	VWA7_ENST00000375686.3_5'Flank|VWA7_ENST00000467576.1_5'Flank|Y_RNA_ENST00000364685.1_RNA|VARS_ENST00000482996.1_5'Flank|VWA7_ENST00000375688.4_5'Flank|VWA7_ENST00000447450.1_5'Flank	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	1225					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)	p.S1225L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	AGGATAGCCCGAGGCAGCACG	0.657																																							uc003nxe.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(3673-3675)TCG>TTG		valyl-tRNA synthetase	L-Valine(DB00161)						40.0	45.0	43.0					6																	31746796		1505	2700	4205	SO:0001583	missense	7407				translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity	g.chr6:31746796G>A	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.3674C>T	6.37:g.31746796G>A	ENSP00000364815:p.Ser1225Leu		Somatic				C6orf27_uc011dog.1_5'Flank|C6orf27_uc003nxd.2_5'Flank|C6orf27_uc011doh.1_5'Flank|VARS_uc003nxf.1_Missense_Mutation_p.S162L	p.S1225L	NM_006295	NP_006286	WXS	Illumina HiSeq	Unspecified	P26640	SYVC_HUMAN			29	4097	-			1225					B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	ENST00000375663.3	37	c.3674C>T	CCDS34412.1	.	.	.	.	.	.	.	.	.	.	G	8.025	0.760467	0.15914	.	.	ENSG00000204394	ENST00000375663	T	0.04502	3.61	4.96	4.03	0.46877	.	0.498267	0.21429	N	0.074686	T	0.01489	0.0048	L	0.36672	1.1	0.19300	N	0.999974	B	0.28419	0.211	B	0.15484	0.013	T	0.42916	-0.9423	10	0.45353	T	0.12	-0.0136	10.0361	0.42129	0.1086:0.0:0.8914:0.0	.	1225	P26640	SYVC_HUMAN	L	1225	ENSP00000364815:S1225L	ENSP00000364815:S1225L	S	-	2	0	VARS	31854775	0.009000	0.17119	0.003000	0.11579	0.134000	0.20937	1.561000	0.36342	1.196000	0.43129	0.456000	0.33151	TCG		0.657	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295		14	28	0	0	0	0.016723	0	14	28				
CRISP3	10321	broad.mit.edu	37	6	49704133	49704133	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr6:49704133A>T	ENST00000393666.1	-	2	166	c.160T>A	c.(160-162)Tct>Act	p.S54T	CRISP3_ENST00000371159.4_Missense_Mutation_p.S85T|CRISP3_ENST00000263045.4_Missense_Mutation_p.S67T|CRISP3_ENST00000423399.2_Intron|CRISP3_ENST00000433368.2_Missense_Mutation_p.S77T			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	54	SCP.				defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)		p.S54T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			GCAGGGGGAGATACTGCTCTC	0.463																																							uc003ozs.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(160-162)TCT>ACT		cysteine-rich secretory protein 3 precursor							199.0	175.0	183.0					6																	49704133		2203	4300	6503	SO:0001583	missense	10321				innate immune response	proteinaceous extracellular matrix|specific granule		g.chr6:49704133A>T	X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.160T>A	6.37:g.49704133A>T	ENSP00000377274:p.Ser54Thr		Somatic					p.S54T	NM_006061	NP_006052	WXS	Illumina HiSeq	Unspecified	P54108	CRIS3_HUMAN	KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)		3	175	-	Lung NSC(77;0.0161)		54					A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Missense_Mutation	SNP	ENST00000393666.1	37	c.160T>A		.	.	.	.	.	.	.	.	.	.	A	8.224	0.803118	0.16397	.	.	ENSG00000096006	ENST00000263045;ENST00000433368;ENST00000393666;ENST00000371159;ENST00000354620	T;T;T;T;T	0.09445	2.98;2.98;2.98;2.98;2.98	4.9	0.931	0.19460	CAP domain (3);	0.756808	0.11417	U	0.566152	T	0.04952	0.0133	L	0.60957	1.885	0.32162	N	0.582818	P	0.39424	0.673	B	0.42522	0.39	T	0.37572	-0.9700	10	0.34782	T	0.22	.	5.7368	0.18071	0.5046:0.3344:0.0:0.161	.	54	P54108	CRIS3_HUMAN	T	67;77;54;85;77	ENSP00000263045:S67T;ENSP00000389026:S77T;ENSP00000377274:S54T;ENSP00000360201:S85T;ENSP00000346636:S77T	ENSP00000263045:S67T	S	-	1	0	CRISP3	49812092	0.002000	0.14202	0.036000	0.18154	0.210000	0.24377	1.106000	0.31098	-0.009000	0.14296	0.459000	0.35465	TCT		0.463	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006061		11	99	0	0	0	0.008291	0	11	99				
TINAG	27283	broad.mit.edu	37	6	54245341	54245341	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr6:54245341G>T	ENST00000259782.4	+	10	1364	c.1268G>T	c.(1267-1269)gGa>gTa	p.G423V		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	423					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.G423V(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			ACACTGAGAGGAGCACAAGGG	0.368																																							uc003pcj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1267-1269)GGA>GTA		tubulointerstitial nephritis antigen							110.0	119.0	116.0					6																	54245341		2203	4300	6503	SO:0001583	missense	27283				cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity	g.chr6:54245341G>T	AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.1268G>T	6.37:g.54245341G>T	ENSP00000259782:p.Gly423Val		Somatic				TINAG_uc010jzt.2_RNA	p.G423V	NM_014464	NP_055279	WXS	Illumina HiSeq	Unspecified	Q9UJW2	TINAG_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.246)		10	1414	+	Lung NSC(77;0.0518)		423					Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	37	c.1268G>T	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	G	12.50	1.955827	0.34471	.	.	ENSG00000137251	ENST00000339741;ENST00000259782;ENST00000370865	T	0.70749	-0.51	5.12	4.24	0.50183	Peptidase C1A, papain C-terminal (2);	0.196691	0.36134	N	0.002768	T	0.71719	0.3373	M	0.68728	2.09	0.80722	D	1	D	0.76494	0.999	D	0.68039	0.955	T	0.68891	-0.5289	10	0.26408	T	0.33	.	8.8761	0.35345	0.1006:0.0:0.8994:0.0	.	423	Q9UJW2	TINAG_HUMAN	V	282;423;102	ENSP00000259782:G423V	ENSP00000259782:G423V	G	+	2	0	TINAG	54353300	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.846000	0.48262	2.538000	0.85594	0.650000	0.86243	GGA		0.368	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464		11	13	1	0	2.80697e-09	0.010729	3.26526e-09	11	13				
BACH2	60468	broad.mit.edu	37	6	90660737	90660737	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr6:90660737T>A	ENST00000257749.4	-	7	1795	c.1088A>T	c.(1087-1089)cAc>cTc	p.H363L	BACH2_ENST00000537989.1_Missense_Mutation_p.H363L|RP3-512E2.2_ENST00000413986.1_RNA|RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000343122.3_Missense_Mutation_p.H363L	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	363						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.H363L(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CCTGGCAAAGTGCTGCTGAGA	0.547																																							uc011eab.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|pancreas(1)|lung(1)|skin(1)	6						c.(1087-1089)CAC>CTC		BTB and CNC homology 1, basic leucine zipper							49.0	50.0	50.0					6																	90660737		2202	4299	6501	SO:0001583	missense	60468					nucleus	protein dimerization activity|sequence-specific DNA binding	g.chr6:90660737T>A	AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1088A>T	6.37:g.90660737T>A	ENSP00000257749:p.His363Leu		Somatic				BACH2_uc003pnw.2_Missense_Mutation_p.H363L|BACH2_uc010kch.2_Missense_Mutation_p.H363L	p.H363L	NM_021813	NP_068585	WXS	Illumina HiSeq	Unspecified	Q9BYV9	BACH2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0799)	7	1897	-		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)	363					E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	ENST00000257749.4	37	c.1088A>T	CCDS5026.1	.	.	.	.	.	.	.	.	.	.	T	0.986	-0.695630	0.03279	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.35236	1.32;1.32;1.32	5.56	2.98	0.34508	.	0.169528	0.52532	D	0.000077	T	0.06188	0.0160	N	0.14661	0.345	0.31892	N	0.617024	B	0.02656	0.0	B	0.01281	0.0	T	0.31558	-0.9939	10	0.02654	T	1	-12.4847	12.2731	0.54719	0.0:0.0:0.2665:0.7335	.	363	Q9BYV9	BACH2_HUMAN	L	363	ENSP00000257749:H363L;ENSP00000437473:H363L;ENSP00000345642:H363L	ENSP00000257749:H363L	H	-	2	0	BACH2	90717458	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.847000	0.55895	0.911000	0.36747	0.533000	0.62120	CAC		0.547	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813		13	28	0	0	0	0.003163	0	13	28				
SLC22A16	85413	broad.mit.edu	37	6	110763563	110763563	+	Missense_Mutation	SNP	G	G	T	rs140212592		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr6:110763563G>T	ENST00000368919.3	-	4	1133	c.1067C>A	c.(1066-1068)aCg>aAg	p.T356K	SLC22A16_ENST00000439654.1_Missense_Mutation_p.T356K|RN7SL617P_ENST00000485298.2_RNA|SLC22A16_ENST00000330550.4_Missense_Mutation_p.T322K	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	356					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)	p.T356K(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	TGTCCTTTTCGTAATGCTCCA	0.393																																							uc003puf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1066-1068)ACG>AAG		solute carrier family 22, member 16							123.0	120.0	121.0					6																	110763563		2203	4300	6503	SO:0001583	missense	85413				acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity	g.chr6:110763563G>T		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.1067C>A	6.37:g.110763563G>T	ENSP00000357915:p.Thr356Lys		Somatic				SLC22A16_uc003pue.2_Missense_Mutation_p.T337K	p.T356K	NM_033125	NP_149116	WXS	Illumina HiSeq	Unspecified	Q86VW1	S22AG_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	4	1134	-		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)	356					O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	ENST00000368919.3	37	c.1067C>A	CCDS5084.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695078	0.48202	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654;ENST00000434949;ENST00000437378	T;T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87;-0.78	4.78	3.91	0.45181	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.273189	0.41194	D	0.000938	T	0.39655	0.1086	N	0.08118	0	0.80722	D	1	B;B	0.25007	0.116;0.095	B;B	0.22880	0.042;0.025	T	0.41645	-0.9497	10	0.48119	T	0.1	.	13.6331	0.62206	0.0:0.2168:0.7832:0.0	.	356;322	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	K	356;273;322;356;186;313	ENSP00000357915:T356K;ENSP00000395642:T273K;ENSP00000328583:T322K;ENSP00000408799:T356K;ENSP00000409306:T186K;ENSP00000416310:T313K	ENSP00000328583:T322K	T	-	2	0	SLC22A16	110870256	1.000000	0.71417	0.004000	0.12327	0.002000	0.02628	5.619000	0.67729	1.129000	0.42072	0.655000	0.94253	ACG		0.393	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125		34	78	1	0	5.43694e-19	0.005524	6.68861e-19	34	78				
FRK	2444	broad.mit.edu	37	6	116263687	116263687	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr6:116263687A>G	ENST00000606080.1	-	8	1854	c.1408T>C	c.(1408-1410)Tgg>Cgg	p.W470R	FRK_ENST00000538210.1_Missense_Mutation_p.W328R	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	470	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.W470R(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	TCTGCATTCCAGCACTCCAAC	0.418																																							uc003pwi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)	6						c.(1408-1410)TGG>CGG		fyn-related kinase							149.0	138.0	141.0					6																	116263687		2203	4300	6503	SO:0001583	missense	2444				negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr6:116263687A>G	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.1408T>C	6.37:g.116263687A>G	ENSP00000476145:p.Trp470Arg		Somatic					p.W470R	NM_002031	NP_002022	WXS	Illumina HiSeq	Unspecified	P42685	FRK_HUMAN		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	8	1855	-		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)	470			Protein kinase.		B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	37	c.1408T>C	CCDS5103.1	.	.	.	.	.	.	.	.	.	.	A	15.07	2.723965	0.48728	.	.	ENSG00000111816	ENST00000368626;ENST00000538210	D;D	0.86562	-2.14;-2.14	5.59	5.59	0.84812	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000020	D	0.95020	0.8388	H	0.95816	3.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96476	0.9352	10	0.87932	D	0	.	15.7621	0.78091	1.0:0.0:0.0:0.0	.	470	P42685	FRK_HUMAN	R	470;328	ENSP00000357615:W470R;ENSP00000443075:W328R	ENSP00000357615:W470R	W	-	1	0	FRK	116370380	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	9.339000	0.96797	2.134000	0.65973	0.482000	0.46254	TGG		0.418	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031		29	66	0	0	0	0.007291	0	29	66				
MAP3K5	4217	broad.mit.edu	37	6	136963676	136963676	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr6:136963676G>C	ENST00000359015.4	-	12	2180	c.1820C>G	c.(1819-1821)tCt>tGt	p.S607C	MAP3K5_ENST00000355845.4_5'UTR|RP3-325F22.3_ENST00000432477.1_RNA	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	607					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)	p.S607C(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		CCTGACAGAAGAGGCACTAAA	0.333																																							uc003qhc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|lung(1)	5						c.(1819-1821)TCT>TGT		mitogen-activated protein kinase kinase kinase							148.0	158.0	154.0					6																	136963676		2203	4300	6503	SO:0001583	missense	4217				activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding	g.chr6:136963676G>C	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.1820C>G	6.37:g.136963676G>C	ENSP00000351908:p.Ser607Cys		Somatic				MAP3K5_uc011edj.1_5'UTR|MAP3K5_uc011edk.1_Missense_Mutation_p.S452C	p.S607C	NM_005923	NP_005914	WXS	Illumina HiSeq	Unspecified	Q99683	M3K5_HUMAN		GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)	12	2181	-	Colorectal(23;0.24)		607					A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	37	c.1820C>G	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872258	0.33069	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.71222	-0.55	4.94	4.94	0.65067	.	0.859555	0.10378	N	0.681852	T	0.69878	0.3160	M	0.80183	2.485	0.33656	D	0.60911	D;B	0.53462	0.96;0.214	P;B	0.48270	0.572;0.174	T	0.73084	-0.4094	10	0.87932	D	0	.	11.1485	0.48444	0.0:0.0:0.7044:0.2956	.	687;607	Q59GL6;Q99683	.;M3K5_HUMAN	C	607;687	ENSP00000351908:S607C	ENSP00000351908:S607C	S	-	2	0	MAP3K5	137005369	0.998000	0.40836	0.874000	0.34290	0.943000	0.58893	4.447000	0.60020	2.453000	0.82957	0.563000	0.77884	TCT		0.333	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1			40	69	0	0	0	0.011902	0	40	69				
REPS1	85021	broad.mit.edu	37	6	139241422	139241422	+	Silent	SNP	C	C	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr6:139241422C>A	ENST00000450536.2	-	12	2032	c.1458G>T	c.(1456-1458)gtG>gtT	p.V486V	REPS1_ENST00000409812.2_Silent_p.V459V|REPS1_ENST00000367663.4_Silent_p.V459V|REPS1_ENST00000258062.5_Silent_p.V486V|REPS1_ENST00000415951.2_Silent_p.V459V			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	486					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)	p.V434V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		CAGATGGTTTCACAAGTAATG	0.318																																							uc003qii.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|breast(1)	2						c.(1456-1458)GTG>GTT		RALBP1 associated Eps domain containing 1							144.0	149.0	147.0					6																	139241422		2202	4300	6502	SO:0001819	synonymous_variant	85021					coated pit|plasma membrane	calcium ion binding|SH3 domain binding	g.chr6:139241422C>A		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1458G>T	6.37:g.139241422C>A			Somatic				REPS1_uc003qig.3_Silent_p.V459V|REPS1_uc011edr.1_Silent_p.V486V|REPS1_uc003qij.2_Silent_p.V459V|REPS1_uc003qik.2_Silent_p.V92V	p.V486V	NM_031922	NP_114128	WXS	Illumina HiSeq	Unspecified	Q96D71	REPS1_HUMAN		GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)	12	2037	-			486					B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Silent	SNP	ENST00000450536.2	37	c.1458G>T																																																																																					0.318	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3			16	72	1	0	6.94344e-10	0.006122	8.13239e-10	16	72				
MIOS	54468	broad.mit.edu	37	7	7612605	7612605	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr7:7612605G>A	ENST00000340080.4	+	4	920	c.499G>A	c.(499-501)Gaa>Aaa	p.E167K	MIOS_ENST00000405785.1_Missense_Mutation_p.E167K	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	167						lysosomal membrane (GO:0005765)		p.E167K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTCAGCAGGTGAAACTGAAAC	0.383																																							uc003srf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(499-501)GAA>AAA		missing oocyte, meiosis regulator, homolog							50.0	47.0	48.0					7																	7612605		1866	4111	5977	SO:0001583	missense	54468							g.chr7:7612605G>A		CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.499G>A	7.37:g.7612605G>A	ENSP00000339881:p.Glu167Lys		Somatic				MIOS_uc010ktp.1_Missense_Mutation_p.E167K	p.E167K	NM_019005	NP_061878	WXS	Illumina HiSeq	Unspecified	Q9NXC5	MIO_HUMAN			4	807	+			167					B2RTV6|O75216|Q7L551|Q9H092	Missense_Mutation	SNP	ENST00000340080.4	37	c.499G>A	CCDS43554.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.776424	0.49786	.	.	ENSG00000164654	ENST00000340080;ENST00000405785;ENST00000456533	T;T	0.42900	0.96;0.96	5.85	5.85	0.93711	WD40/YVTN repeat-like-containing domain (1);	0.104565	0.64402	D	0.000003	T	0.31606	0.0802	N	0.22421	0.69	0.58432	D	0.999997	B	0.19817	0.039	B	0.15870	0.014	T	0.14117	-1.0484	10	0.10111	T	0.7	-29.447	20.5471	0.99284	0.0:0.0:1.0:0.0	.	167	Q9NXC5	MIO_HUMAN	K	167	ENSP00000339881:E167K;ENSP00000384088:E167K	ENSP00000339881:E167K	E	+	1	0	MIOS	7579130	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.390000	0.97246	2.941000	0.99782	0.655000	0.94253	GAA		0.383	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326218.1	NM_019005		8	48	0	0	0	0.00308	0	8	48				
ZMIZ2	83637	broad.mit.edu	37	7	44799010	44799010	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr7:44799010G>C	ENST00000309315.4	+	7	1067	c.944G>C	c.(943-945)gGc>gCc	p.G315A	ZMIZ2_ENST00000413916.1_Missense_Mutation_p.G283A|ZMIZ2_ENST00000433667.1_Missense_Mutation_p.G283A|ZMIZ2_ENST00000441627.1_Missense_Mutation_p.G315A|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.G315A	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	315	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)	p.G315A(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CTGCAGCAGGGCATGACCCAG	0.697																																					NSCLC(20;604 852 1948 16908 50522)	NSCLC(20;604 852 1948 16908 50522)	uc003tlr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|breast(1)	5						c.(943-945)GGC>GCC		zinc finger, MIZ-type containing 2 isoform 1							35.0	41.0	39.0					7																	44799010		2008	4149	6157	SO:0001583	missense	83637				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding	g.chr7:44799010G>C	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.944G>C	7.37:g.44799010G>C	ENSP00000311778:p.Gly315Ala		Somatic				ZMIZ2_uc003tlq.2_Missense_Mutation_p.G283A|ZMIZ2_uc003tls.2_Missense_Mutation_p.G315A|ZMIZ2_uc003tlt.2_5'Flank|ZMIZ2_uc010kyj.2_5'Flank	p.G315A	NM_031449	NP_113637	WXS	Illumina HiSeq	Unspecified	Q8NF64	ZMIZ2_HUMAN			7	1067	+			315			Pro-rich.		A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	c.944G>C	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.034464	0.35893	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.39787	1.49;1.06;1.06;1.06;1.48	4.38	3.46	0.39613	.	0.365474	0.21773	N	0.069322	T	0.30854	0.0778	L	0.29908	0.895	0.33175	D	0.548755	B;B;B	0.10296	0.002;0.003;0.002	B;B;B	0.13407	0.009;0.005;0.009	T	0.30822	-0.9965	10	0.18710	T	0.47	-8.6644	15.3672	0.74531	0.0:0.1527:0.8473:0.0	.	315;315;283	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	A	283;315;315;283;315;315	ENSP00000409648:G283A;ENSP00000311778:G315A;ENSP00000414723:G315A;ENSP00000396601:G283A;ENSP00000265346:G315A	ENSP00000265346:G315A	G	+	2	0	ZMIZ2	44765535	0.000000	0.05858	0.834000	0.33040	0.932000	0.56968	0.010000	0.13242	2.232000	0.73038	0.462000	0.41574	GGC		0.697	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449		15	59	0	0	0	0.00499	0	15	59				
ZNF804B	219578	broad.mit.edu	37	7	88847483	88847483	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr7:88847483G>C	ENST00000333190.4	+	2	732	c.123G>C	c.(121-123)aaG>aaC	p.K41N		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	41							metal ion binding (GO:0046872)	p.K41N(2)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TTGCAGAAAAGAAGTCCACAG	0.343										HNSCC(36;0.09)																													uc011khi.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11						c.(121-123)AAG>AAC		zinc finger protein 804B							69.0	69.0	69.0					7																	88847483		2203	4300	6503	SO:0001583	missense	219578					intracellular	zinc ion binding	g.chr7:88847483G>C	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.123G>C	7.37:g.88847483G>C	ENSP00000329638:p.Lys41Asn	HNSCC(36;0.09)	Somatic					p.K41N	NM_181646	NP_857597	WXS	Illumina HiSeq	Unspecified	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)		2	661	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		41					B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	c.123G>C	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532568	0.64972	.	.	ENSG00000182348	ENST00000333190	T	0.10763	2.84	5.05	4.17	0.49024	.	0.000000	0.52532	D	0.000066	T	0.16214	0.0390	N	0.24115	0.695	0.25143	N	0.99049	D	0.89917	1.0	D	0.72075	0.976	T	0.03068	-1.1076	10	0.87932	D	0	-12.5161	6.6374	0.22891	0.1562:0.1483:0.6955:0.0	.	41	A4D1E1	Z804B_HUMAN	N	41	ENSP00000329638:K41N	ENSP00000329638:K41N	K	+	3	2	ZNF804B	88685419	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.329000	0.52060	1.365000	0.46057	0.484000	0.47621	AAG		0.343	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		3	33	0	0	0	0.009096	0	3	33				
AGFG2	3268	broad.mit.edu	37	7	100159952	100159952	+	Silent	SNP	C	C	T	rs550739522		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr7:100159952C>T	ENST00000300176.4	+	7	1070	c.948C>T	c.(946-948)gaC>gaT	p.D316D	AGFG2_ENST00000262935.4_3'UTR|AGFG2_ENST00000474713.1_3'UTR	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	316					regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.D316D(2)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCCTCGCAGACGTGGGCAGCT	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		17703	0.0		0.001	False		,,,				2504	0.0						uc003uvf.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)	1						c.(946-948)GAC>GAT		ArfGAP with FG repeats 2							43.0	47.0	46.0					7																	100159952		2203	4300	6503	SO:0001819	synonymous_variant	3268				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr7:100159952C>T	AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.948C>T	7.37:g.100159952C>T			Somatic				AGFG2_uc010lgy.2_Missense_Mutation_p.T178M	p.D316D	NM_006076	NP_006067	WXS	Illumina HiSeq	Unspecified	O95081	AGFG2_HUMAN			7	1084	+			316					O75429|Q96AB9|Q96GL4	Silent	SNP	ENST00000300176.4	37	c.948C>T	CCDS5697.1	.	.	.	.	.	.	.	.	.	.	C	3.110	-0.182952	0.06340	.	.	ENSG00000106351	ENST00000429987	.	.	.	4.61	-3.03	0.05429	.	.	.	.	.	T	0.47783	0.1464	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39418	-0.9615	4	.	.	.	-23.1344	5.1848	0.15178	0.0:0.3746:0.1604:0.465	.	.	.	.	M	58	.	.	T	+	2	0	AGFG2	99997888	0.140000	0.22579	0.373000	0.26003	0.380000	0.30137	-0.905000	0.04075	-0.629000	0.05575	-0.477000	0.04895	ACG		0.637	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342769.1	NM_006076		7	31	0	0	0	0.001984	0	7	31				
GPR22	2845	broad.mit.edu	37	7	107115456	107115456	+	Silent	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr7:107115456G>A	ENST00000304402.4	+	3	2294	c.951G>A	c.(949-951)ttG>ttA	p.L317L	COG5_ENST00000347053.3_Intron|COG5_ENST00000393603.2_Intron|COG5_ENST00000475638.2_Intron|COG5_ENST00000297135.3_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	317					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.L317L(1)		large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						TGTCTTTATTGATTATTTCTA	0.373																																							uc003vef.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(949-951)TTG>TTA		G protein-coupled receptor 22							112.0	115.0	114.0					7																	107115456		2203	4300	6503	SO:0001819	synonymous_variant	2845					integral to plasma membrane	G-protein coupled receptor activity	g.chr7:107115456G>A	U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.951G>A	7.37:g.107115456G>A			Somatic				COG5_uc003vec.2_Intron|COG5_uc003ved.2_Intron|COG5_uc003vee.2_Intron	p.L317L	NM_005295	NP_005286	WXS	Illumina HiSeq	Unspecified	Q99680	GPR22_HUMAN			3	2297	+			317			Helical; Name=6; (Potential).		O14554	Silent	SNP	ENST00000304402.4	37	c.951G>A	CCDS5744.1																																																																																				0.373	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337598.1			8	55	0	0	0	0.004482	0	8	55				
DOCK4	9732	broad.mit.edu	37	7	111629071	111629071	+	Splice_Site	SNP	C	C	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr7:111629071C>G	ENST00000437633.1	-	6	719	c.463G>C	c.(463-465)Gaa>Caa	p.E155Q	DOCK4_ENST00000428084.1_Splice_Site_p.E155Q|DOCK4_ENST00000476846.1_5'UTR	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	155					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.E155Q(1)|p.E143Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				AATACTCACTCATTGCCCCAG	0.567																																							uc003vfx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4						c.(463-465)GAA>CAA		dedicator of cytokinesis 4							53.0	55.0	54.0					7																	111629071		2052	4191	6243	SO:0001630	splice_region_variant	9732				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding	g.chr7:111629071C>G		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.464+1G>C	7.37:g.111629071C>G			Somatic				DOCK4_uc003vfy.2_Missense_Mutation_p.E155Q|DOCK4_uc003vga.1_5'UTR|DOCK4_uc010ljt.1_Missense_Mutation_p.E155Q|DOCK4_uc003vgb.1_Missense_Mutation_p.E79Q	p.E155Q	NM_014705	NP_055520	WXS	Illumina HiSeq	Unspecified	Q8N1I0	DOCK4_HUMAN			6	732	-		Acute lymphoblastic leukemia(1;0.0441)	155					O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	c.463G>C	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.9|23.9	4.465087|4.465087	0.84425|0.84425	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250|ENST00000445943	T;T|.	0.02837|.	4.14;4.14|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.100558|.	0.64402|.	D|.	0.000002|.	T|T	0.69214|0.69214	0.3086|0.3086	L|L	0.48174|0.48174	1.505|1.505	0.80722|0.80722	D|D	1|1	B;P;P;P|.	0.41420|.	0.193;0.57;0.749;0.749|.	B;B;B;B|.	0.40741|.	0.091;0.269;0.339;0.258|.	T|T	0.64786|0.64786	-0.6325|-0.6325	10|5	0.41790|.	T|.	0.15|.	.|.	18.6737|18.6737	0.91521|0.91521	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	155;155;155;155|.	A4D0S8;Q149N6;Q149N5;Q8N1I0|.	.;.;.;DOCK4_HUMAN|.	Q|I	143;155;155;143;154|142	ENSP00000410746:E155Q;ENSP00000404179:E155Q|.	ENSP00000345432:E143Q|.	E|M	-|-	1|3	0|0	DOCK4|DOCK4	111416307|111416307	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.942000|0.942000	0.58702|0.58702	7.768000|7.768000	0.85345|0.85345	2.637000|2.637000	0.89404|0.89404	0.561000|0.561000	0.74099|0.74099	GAA|ATG		0.567	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	Missense_Mutation	4	7	0	0	0	0.009096	0	4	7				
AKR1D1	6718	broad.mit.edu	37	7	137761344	137761344	+	Nonsense_Mutation	SNP	C	C	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr7:137761344C>G	ENST00000242375.3	+	1	122	c.80C>G	c.(79-81)tCa>tGa	p.S27*	AKR1D1_ENST00000432161.1_Nonsense_Mutation_p.S27*|AKR1D1_ENST00000468877.2_Intron|AKR1D1_ENST00000411726.2_Nonsense_Mutation_p.S27*	NM_005989.3	NP_005980.1	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	27					androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|C21-steroid hormone metabolic process (GO:0008207)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|steroid binding (GO:0005496)	p.S27*(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	23					Azelaic Acid(DB00548)|Finasteride(DB01216)	GGTACCTACTCAGAACCTAAA	0.398																																							uc003vtz.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(79-81)TCA>TGA		aldo-keto reductase family 1, member D1							246.0	197.0	213.0					7																	137761344		2203	4300	6503	SO:0001587	stop_gained	6718				androgen metabolic process|bile acid biosynthetic process|bile acid catabolic process|C21-steroid hormone metabolic process|cholesterol catabolic process|digestion	cytosol	aldo-keto reductase (NADP) activity|delta4-3-oxosteroid 5beta-reductase activity|steroid binding	g.chr7:137761344C>G	Z28339	CCDS5846.1, CCDS55169.1, CCDS55170.1	7q32-q33	2012-12-04	2012-12-04		ENSG00000122787	ENSG00000122787	1.3.99.6	"""Aldo-keto reductases"""	388	protein-coding gene	gene with protein product	"""delta 4-3-ketosteroid-5-beta-reductase"""	604741	"""aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)"""	SRD5B1		7508385, 10343119	Standard	NM_005989		Approved		uc003vtz.3	P51857	OTTHUMG00000155787	ENST00000242375.3:c.80C>G	7.37:g.137761344C>G	ENSP00000242375:p.Ser27*		Somatic				AKR1D1_uc011kqb.1_Nonsense_Mutation_p.S27*|AKR1D1_uc011kqc.1_Intron|AKR1D1_uc011kqd.1_Intron|AKR1D1_uc011kqe.1_Nonsense_Mutation_p.S27*|AKR1D1_uc011kqf.1_Nonsense_Mutation_p.S27*	p.S27*	NM_005989	NP_005980	WXS	Illumina HiSeq	Unspecified	P51857	AK1D1_HUMAN			1	149	+			27					A1L4P6|A8K060|B4DPN3|B4DPN8	Nonsense_Mutation	SNP	ENST00000242375.3	37	c.80C>G	CCDS5846.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830018	0.91036	.	.	ENSG00000122787	ENST00000432161;ENST00000411726;ENST00000242375;ENST00000438242	.	.	.	4.92	4.92	0.64577	.	0.336851	0.27478	N	0.019186	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	13.8114	0.63266	0.0:1.0:0.0:0.0	.	.	.	.	X	27	.	ENSP00000242375:S27X	S	+	2	0	AKR1D1	137411884	0.895000	0.30542	0.933000	0.37362	0.499000	0.33736	1.519000	0.35888	2.721000	0.93114	0.650000	0.86243	TCA		0.398	AKR1D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341637.1	NM_005989		8	12	0	0	0	0.004482	0	8	12				
OR2A2	442361	broad.mit.edu	37	7	143807577	143807577	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr7:143807577A>C	ENST00000408979.2	+	1	971	c.902A>C	c.(901-903)cAc>cCc	p.H301P		NM_001005480.2	NP_001005480.2	Q6IF42	OR2A2_HUMAN	olfactory receptor, family 2, subfamily A, member 2	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H301P(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)|skin(4)	22	Melanoma(164;0.0783)					GGCGCCCTCCACAGAGCACTC	0.463																																							uc011ktz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(901-903)CAC>CCC		olfactory receptor, family 2, subfamily A,							98.0	95.0	96.0					7																	143807577		1912	4132	6044	SO:0001583	missense	442361				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143807577A>C		CCDS43671.1	7q35	2013-09-20		2004-03-10	ENSG00000221989	ENSG00000221989		"""GPCR / Class A : Olfactory receptors"""	8230	protein-coding gene	gene with protein product				OR2A2P, OR2A17P			Standard	NM_001005480		Approved	OST008	uc011ktz.2	Q6IF42	OTTHUMG00000158001	ENST00000408979.2:c.902A>C	7.37:g.143807577A>C	ENSP00000386209:p.His301Pro		Somatic					p.H301P	NM_001005480	NP_001005480	WXS	Illumina HiSeq	Unspecified	Q6IF42	OR2A2_HUMAN			1	902	+	Melanoma(164;0.0783)		301			Cytoplasmic (Potential).		B2RN85|Q8NGT6	Missense_Mutation	SNP	ENST00000408979.2	37	c.902A>C	CCDS43671.1	.	.	.	.	.	.	.	.	.	.	A	6.479	0.456574	0.12283	.	.	ENSG00000221989	ENST00000408979	T	0.37235	1.21	3.47	-3.62	0.04543	.	1.727610	0.03983	U	0.293647	T	0.28067	0.0692	L	0.32530	0.975	0.09310	N	1	B	0.33883	0.43	B	0.33339	0.162	T	0.36648	-0.9739	10	0.66056	D	0.02	-0.7808	9.0933	0.36623	0.6729:0.0:0.3271:0.0	.	301	Q6IF42	OR2A2_HUMAN	P	301	ENSP00000386209:H301P	ENSP00000386209:H301P	H	+	2	0	OR2A2	143438510	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.968000	0.00323	-1.071000	0.03145	-0.385000	0.06624	CAC		0.463	OR2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349978.1			34	66	0	0	0	0.013726	0	34	66				
TNKS	8658	broad.mit.edu	37	8	9609136	9609136	+	Silent	SNP	T	T	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:9609136T>G	ENST00000310430.6	+	19	2876	c.2850T>G	c.(2848-2850)gcT>gcG	p.A950A	TNKS_ENST00000518281.1_Silent_p.A713A	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	950					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)	p.A950A(2)		NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		ATATCAGAGCTTTGCTGATAG	0.393																																							uc003wss.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(4)|ovary(2)|kidney(1)	7						c.(2848-2850)GCT>GCG		tankyrase, TRF1-interacting ankyrin-related							134.0	136.0	135.0					8																	9609136		2203	4300	6503	SO:0001819	synonymous_variant	8658				mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding	g.chr8:9609136T>G	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.2850T>G	8.37:g.9609136T>G			Somatic				TNKS_uc011kww.1_Silent_p.A713A|TNKS_uc010lrt.1_RNA	p.A950A	NM_003747	NP_003738	WXS	Illumina HiSeq	Unspecified	O95271	TNKS1_HUMAN		COAD - Colon adenocarcinoma(149;0.0467)	19	2855	+			950					O95272|Q4G0F2	Silent	SNP	ENST00000310430.6	37	c.2850T>G	CCDS5974.1																																																																																				0.393	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747		42	132	0	0	0	0.01441	0	42	132				
RP1L1	94137	broad.mit.edu	37	8	10467205	10467205	+	Missense_Mutation	SNP	T	T	G	rs543345184		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:10467205T>G	ENST00000382483.3	-	4	4626	c.4403A>C	c.(4402-4404)cAg>cCg	p.Q1468P		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1548					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.Q1468P(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGAGCCACTCTGCCTCTCGCT	0.662																																							uc003wtc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(4402-4404)CAG>CCG		retinitis pigmentosa 1-like 1							53.0	60.0	57.0					8																	10467205		2004	4205	6209	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10467205T>G	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4403A>C	8.37:g.10467205T>G	ENSP00000371923:p.Gln1468Pro		Somatic					p.Q1468P	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	4632	-			1468					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.4403A>C	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	T	10.82	1.459616	0.26248	.	.	ENSG00000183638	ENST00000382483	T	0.05925	3.37	4.63	-1.13	0.09775	.	0.792986	0.10306	N	0.690625	T	0.04137	0.0115	N	0.14661	0.345	0.09310	N	1	B	0.15473	0.013	B	0.11329	0.006	T	0.40997	-0.9533	10	0.66056	D	0.02	0.0106	8.6198	0.33853	0.0:0.0789:0.5592:0.3619	.	1468	A6NKC6	.	P	1468	ENSP00000371923:Q1468P	ENSP00000371923:Q1468P	Q	-	2	0	RP1L1	10504615	0.005000	0.15991	0.000000	0.03702	0.001000	0.01503	0.703000	0.25646	-0.338000	0.08413	-0.488000	0.04728	CAG		0.662	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			34	78	0	0	0	0.017118	0	34	78				
FAM160B2	64760	broad.mit.edu	37	8	21951987	21951987	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:21951987G>A	ENST00000289921.7	+	2	128	c.82G>A	c.(82-84)Gag>Aag	p.E28K		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	28								p.E28K(1)		endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						GGCCTTCGTGGAGCACTGGAA	0.672																																							uc011kyx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(82-84)GAG>AAG		retinoic acid induced 16							56.0	61.0	59.0					8																	21951987		2073	4213	6286	SO:0001583	missense	64760							g.chr8:21951987G>A	AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.82G>A	8.37:g.21951987G>A	ENSP00000289921:p.Glu28Lys		Somatic				FAM160B2_uc011kyw.1_Missense_Mutation_p.E28K|FAM160B2_uc011kyy.1_RNA	p.E28K	NM_022749	NP_073586	WXS	Illumina HiSeq	Unspecified	Q86V87	F16B2_HUMAN			2	133	+			28					B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Missense_Mutation	SNP	ENST00000289921.7	37	c.82G>A	CCDS6021.2	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432997	0.43224	.	.	ENSG00000158863	ENST00000289921	T	0.14022	2.54	4.98	4.98	0.66077	.	0.299351	0.30911	N	0.008634	T	0.09158	0.0226	N	0.22421	0.69	0.38326	D	0.943672	B	0.29862	0.259	B	0.24394	0.053	T	0.26121	-1.0112	10	0.31617	T	0.26	-14.9292	11.6188	0.51104	0.0:0.1799:0.8201:0.0	.	28	Q86V87	F16B2_HUMAN	K	28	ENSP00000289921:E28K	ENSP00000289921:E28K	E	+	1	0	FAM160B2	22007933	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	1.993000	0.40747	2.317000	0.78254	0.561000	0.74099	GAG		0.672	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375334.2			18	34	0	0	0	0.012319	0	18	34				
GINS4	84296	broad.mit.edu	37	8	41387758	41387758	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:41387758G>A	ENST00000276533.3	+	2	247	c.37G>A	c.(37-39)Gat>Aat	p.D13N	GINS4_ENST00000523277.2_Missense_Mutation_p.D13N|GINS4_ENST00000520710.1_Missense_Mutation_p.D13N|GINS4_ENST00000518671.1_Missense_Mutation_p.D13N	NM_032336.2	NP_115712.1	Q9BRT9	SLD5_HUMAN	GINS complex subunit 4 (Sld5 homolog)	13					DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)		p.D13N(1)		breast(1)|lung(2)|skin(1)	4	Ovarian(28;0.014)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.00732)|Lung NSC(58;0.0207)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00329)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			ACAGGACTCTGATGGGGGTAG	0.478																																							uc003xnx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(37-39)GAT>AAT		GINS complex subunit 4							123.0	119.0	120.0					8																	41387758		2203	4300	6503	SO:0001583	missense	84296				DNA strand elongation involved in DNA replication|S phase of mitotic cell cycle	cytoplasm|nucleoplasm		g.chr8:41387758G>A	BC005995	CCDS6116.1	8p11.21	2006-05-04			ENSG00000147536	ENSG00000147536			28226	protein-coding gene	gene with protein product		610611				12477932	Standard	NM_032336		Approved	MGC14799, SLD5	uc003xnx.3	Q9BRT9	OTTHUMG00000164079	ENST00000276533.3:c.37G>A	8.37:g.41387758G>A	ENSP00000276533:p.Asp13Asn		Somatic				GINS4_uc003xny.2_Missense_Mutation_p.D13N	p.D13N	NM_032336	NP_115712	WXS	Illumina HiSeq	Unspecified	Q9BRT9	SLD5_HUMAN	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00329)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)		2	247	+	Ovarian(28;0.014)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.00732)|Lung NSC(58;0.0207)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	13					B2R8H5|D3DSY0|Q8N648	Missense_Mutation	SNP	ENST00000276533.3	37	c.37G>A	CCDS6116.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213544	0.58452	.	.	ENSG00000147536	ENST00000276533;ENST00000520710;ENST00000518671;ENST00000523277	.	.	.	5.1	4.21	0.49690	.	0.462515	0.22074	N	0.064983	T	0.36441	0.0967	L	0.34521	1.04	0.44547	D	0.997509	B	0.32245	0.361	B	0.25140	0.058	T	0.18745	-1.0327	9	0.30078	T	0.28	-18.7442	9.957	0.41673	0.095:0.0:0.905:0.0	.	13	Q9BRT9	SLD5_HUMAN	N	13	.	ENSP00000276533:D13N	D	+	1	0	GINS4	41506915	1.000000	0.71417	0.967000	0.41034	0.539000	0.34962	4.313000	0.59160	2.379000	0.81126	0.561000	0.74099	GAT		0.478	GINS4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377150.1	NM_032336		17	52	0	0	0	0.014323	0	17	52				
CYP7A1	1581	broad.mit.edu	37	8	59409214	59409214	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:59409214G>A	ENST00000301645.3	-	3	994	c.857C>T	c.(856-858)tCg>tTg	p.S286L		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	286					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.S286L(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				GTTTGCTTGCGATGCCCAGAG	0.423									Neonatal Giant Cell Hepatitis																														uc003xtm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(856-858)TCG>TTG		cytochrome P450, family 7, subfamily A,							130.0	126.0	128.0					8																	59409214		2203	4300	6503	SO:0001583	missense	1581	Neonatal_Giant_Cell_Hepatitis	Familial Cancer Database	Neonatal Hemochromatosis	bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding	g.chr8:59409214G>A	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.857C>T	8.37:g.59409214G>A	ENSP00000301645:p.Ser286Leu		Somatic					p.S286L	NM_000780	NP_000771	WXS	Illumina HiSeq	Unspecified	P22680	CP7A1_HUMAN			3	920	-		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)	286					P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	ENST00000301645.3	37	c.857C>T	CCDS6171.1	.	.	.	.	.	.	.	.	.	.	G	32	5.168475	0.94768	.	.	ENSG00000167910	ENST00000301645	T	0.70164	-0.46	5.62	5.62	0.85841	.	0.179828	0.51477	D	0.000097	D	0.85017	0.5601	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.86360	0.1716	10	0.66056	D	0.02	-11.4708	20.0185	0.97487	0.0:0.0:1.0:0.0	.	286	P22680	CP7A1_HUMAN	L	286	ENSP00000301645:S286L	ENSP00000301645:S286L	S	-	2	0	CYP7A1	59571768	1.000000	0.71417	0.327000	0.25402	0.944000	0.59088	9.702000	0.98712	2.809000	0.96659	0.467000	0.42956	TCG		0.423	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780		39	97	0	0	0	0.005524	0	39	97				
ZFPM2	23414	broad.mit.edu	37	8	106431460	106431460	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:106431460G>C	ENST00000407775.2	+	2	379	c.129G>C	c.(127-129)gaG>gaC	p.E43D	ZFPM2_ENST00000520492.1_5'UTR	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	43					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E43D(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TTCCATTGGAGGAAAGCTTTT	0.408																																							uc003ymd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)	5						c.(127-129)GAG>GAC		zinc finger protein, multitype 2							104.0	102.0	102.0					8																	106431460		1851	4095	5946	SO:0001583	missense	23414				blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding	g.chr8:106431460G>C	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.129G>C	8.37:g.106431460G>C	ENSP00000384179:p.Glu43Asp		Somatic					p.E43D	NM_012082	NP_036214	WXS	Illumina HiSeq	Unspecified	Q8WW38	FOG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)		2	152	+			43					Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	c.129G>C	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.223919	0.79576	.	.	ENSG00000169946	ENST00000407775	T	0.20738	2.05	5.37	5.37	0.77165	.	0.000000	0.56097	D	0.000029	T	0.38161	0.1030	L	0.38838	1.175	0.80722	D	1	D	0.58970	0.984	D	0.68192	0.956	T	0.04870	-1.0921	10	0.46703	T	0.11	.	19.0988	0.93265	0.0:0.0:1.0:0.0	.	43	Q8WW38	FOG2_HUMAN	D	43	ENSP00000384179:E43D	ENSP00000384179:E43D	E	+	3	2	ZFPM2	106500636	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.562000	0.82300	2.528000	0.85240	0.591000	0.81541	GAG		0.408	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			14	45	0	0	0	0.016723	0	14	45				
KCNV1	27012	broad.mit.edu	37	8	110984680	110984680	+	Silent	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:110984680G>A	ENST00000524391.1	-	3	1830	c.798C>T	c.(796-798)gaC>gaT	p.D266D	RP11-696P8.2_ENST00000530667.1_RNA|KCNV1_ENST00000297404.1_Silent_p.D266D			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	266					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)	p.D266D(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			AGCGACACCTGTCCCGCACAC	0.532																																							uc003ynr.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|kidney(1)	2						c.(796-798)GAC>GAT		potassium channel, subfamily V, member 1							85.0	71.0	76.0					8																	110984680		2203	4300	6503	SO:0001819	synonymous_variant	27012					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity	g.chr8:110984680G>A	AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.798C>T	8.37:g.110984680G>A			Somatic				KCNV1_uc010mcw.2_Silent_p.D266D	p.D266D	NM_014379	NP_055194	WXS	Illumina HiSeq	Unspecified	Q6PIU1	KCNV1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)		2	1140	-	all_neural(195;0.219)		266			Cytoplasmic (Potential).		Q9UHJ4	Silent	SNP	ENST00000524391.1	37	c.798C>T	CCDS6314.1																																																																																				0.532	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385525.1	NM_014379		9	37	0	0	0	0.004482	0	9	37				
TRPS1	7227	broad.mit.edu	37	8	116426804	116426804	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:116426804G>T	ENST00000220888.5	-	6	3452	c.3293C>A	c.(3292-3294)cCc>cAc	p.P1098H	TRPS1_ENST00000519076.1_Missense_Mutation_p.P852H|TRPS1_ENST00000395715.3_Missense_Mutation_p.P1111H|TRPS1_ENST00000520276.1_Missense_Mutation_p.P1102H			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1098	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P1111H(1)|p.P1098H(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATGTACAAAGGGAAGTCCAAA	0.463									Langer-Giedion syndrome																														uc003ynz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(3292-3294)CCC>CAC		zinc finger transcription factor TRPS1							129.0	125.0	126.0					8																	116426804		1887	4113	6000	SO:0001583	missense	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116426804G>T	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3293C>A	8.37:g.116426804G>T	ENSP00000220888:p.Pro1098His		Somatic				TRPS1_uc011lhy.1_Missense_Mutation_p.P1102H|TRPS1_uc003yny.2_Missense_Mutation_p.P1111H|TRPS1_uc010mcy.2_Missense_Mutation_p.P1098H	p.P1098H	NM_014112	NP_054831	WXS	Illumina HiSeq	Unspecified	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		6	3752	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		1098			Mediates interaction with RNF4 (By similarity).		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37	c.3293C>A		.	.	.	.	.	.	.	.	.	.	G	18.64	3.667247	0.67814	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	D;D;D;D	0.98968	-5.28;-5.25;-5.16;-5.25	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.98280	0.9430	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.99937	1.1366	10	0.87932	D	0	.	19.865	0.96801	0.0:0.0:1.0:0.0	.	1102;1098;1111	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	H	1111;1098;852;1102	ENSP00000379065:P1111H;ENSP00000220888:P1098H;ENSP00000428910:P852H;ENSP00000428680:P1102H	ENSP00000220888:P1098H	P	-	2	0	TRPS1	116495980	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.619000	0.98369	2.685000	0.91497	0.655000	0.94253	CCC		0.463	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		24	43	1	0	1.64293e-13	0.01892	1.99249e-13	24	43				
ZNF250	58500	broad.mit.edu	37	8	146107103	146107103	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:146107103G>C	ENST00000292579.7	-	6	1596	c.1480C>G	c.(1480-1482)Ctg>Gtg	p.L494V	ZNF250_ENST00000342660.6_Intron|ZNF250_ENST00000417550.2_Missense_Mutation_p.L489V|ZNF250_ENST00000543949.1_Intron	NM_001109689.3|NM_021061.4	NP_001103159.1|NP_066405.1	P15622	ZN250_HUMAN	zinc finger protein 250	494					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L494V(1)		endometrium(4)|kidney(2)|lung(8)|skin(1)	15	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		TGCACAATCAGAGTTGCTTTC	0.557																																					NSCLC(16;520 556 24096 40084 43446)	NSCLC(16;520 556 24096 40084 43446)	uc003zeq.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1480-1482)CTG>GTG		zinc finger protein 250 isoform a							82.0	69.0	74.0					8																	146107103		2203	4300	6503	SO:0001583	missense	58500				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:146107103G>C	AK095705	CCDS34972.1, CCDS55282.1	8q24.3	2013-01-08	2004-11-08			ENSG00000196150		"""Zinc fingers, C2H2-type"", ""-"""	13044	protein-coding gene	gene with protein product			"""zinc finger protein 647"""	ZNF647		12477932	Standard	NM_021061		Approved	MGC9718, ZFP647	uc003zer.4	P15622		ENST00000292579.7:c.1480C>G	8.37:g.146107103G>C	ENSP00000292579:p.Leu494Val		Somatic				COMMD5_uc010mgf.2_Intron|ZNF250_uc003zer.3_Missense_Mutation_p.L489V|ZNF250_uc010mgg.2_Missense_Mutation_p.L489V	p.L494V	NM_021061	NP_066405	WXS	Illumina HiSeq	Unspecified	P15622	ZN250_HUMAN	Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)	6	1597	-	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		494			C2H2-type 11.		D3DWP1|Q59HE9|Q8N942|Q96AH9	Missense_Mutation	SNP	ENST00000292579.7	37	c.1480C>G	CCDS34972.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464268	0.43736	.	.	ENSG00000196150	ENST00000292579;ENST00000417550;ENST00000394912	T;T	0.14766	2.48;2.48	4.1	4.1	0.47936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38959	N	0.001503	T	0.36110	0.0955	M	0.79926	2.475	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.87578	0.992;0.998	T	0.10245	-1.0638	10	0.87932	D	0	-25.0961	9.9057	0.41375	0.0981:0.0:0.9019:0.0	.	489;494	D3DWP1;P15622	.;ZN250_HUMAN	V	494;489;377	ENSP00000292579:L494V;ENSP00000393442:L489V	ENSP00000292579:L494V	L	-	1	2	ZNF250	146077907	0.998000	0.40836	0.998000	0.56505	0.567000	0.35839	3.104000	0.50306	2.592000	0.87571	0.484000	0.47621	CTG		0.557	ZNF250-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382968.1	NM_021061		5	14	0	0	0	0.014758	0	5	14				
RIC1	57589	broad.mit.edu	37	9	5757362	5757362	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr9:5757362C>A	ENST00000414202.2	+	17	2094	c.1903C>A	c.(1903-1905)Cgc>Agc	p.R635S	KIAA1432_ENST00000449720.2_Missense_Mutation_p.R519S|KIAA1432_ENST00000251879.6_Missense_Mutation_p.R635S|KIAA1432_ENST00000418622.3_Missense_Mutation_p.R556S|KIAA1432_ENST00000381532.2_Missense_Mutation_p.R556S	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.R556G(1)|p.R556S(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TTCCATGTCACGCTACATTCC	0.423																																							uc003zji.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)		0						c.(1666-1668)CGC>AGC		connexin 43-interacting protein 150 isoform a							318.0	286.0	297.0					9																	5757362		2203	4300	6503	SO:0001583	missense	57589					integral to membrane		g.chr9:5757362C>A																												ENST00000414202.2:c.1903C>A	9.37:g.5757362C>A	ENSP00000416696:p.Arg635Ser		Somatic				KIAA1432_uc003zjh.2_Missense_Mutation_p.R556S|KIAA1432_uc003zjl.3_Missense_Mutation_p.R519S|KIAA1432_uc003zjj.1_Missense_Mutation_p.R98S	p.R556S	NM_020829	NP_065880	WXS	Illumina HiSeq	Unspecified	Q4ADV7	RIC1_HUMAN		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)	16	1759	+		Acute lymphoblastic leukemia(23;0.154)	635						Missense_Mutation	SNP	ENST00000414202.2	37	c.1666C>A	CCDS34982.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.73|12.73	2.024885|2.024885	0.35701|0.35701	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720|ENST00000545641	.|.	.|.	.|.	6.07|6.07	5.17|5.17	0.71159|0.71159	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56307|0.56307	0.1976|0.1976	L|L	0.28694|0.28694	0.88|0.88	0.80722|0.80722	D|D	1|1	P;P;P;B|.	0.39920|.	0.695;0.517;0.576;0.256|.	B;B;B;B|.	0.33121|.	0.158;0.119;0.1;0.107|.	T|T	0.52503|0.52503	-0.8567|-0.8567	9|5	0.06099|.	T|.	0.92|.	-13.4886|-13.4886	17.0019|17.0019	0.86383|0.86383	0.1282:0.8718:0.0:0.0|0.1282:0.8718:0.0:0.0	.|.	519;556;635;635|.	B7ZM67;B2RN24;Q4ADV7;G5E932|.	.;.;RIC1_HUMAN;.|.	S|K	635;635;556;556;519|526	.|.	ENSP00000251879:R635S|.	R|T	+|+	1|2	0|0	KIAA1432|KIAA1432	5747362|5747362	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.738000|5.738000	0.68613|0.68613	1.552000|1.552000	0.49463|0.49463	0.655000|0.655000	0.94253|0.94253	CGC|ACG		0.423	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3			8	148	1	0	5.18039e-06	0.00308	5.71514e-06	8	148				
CD72	971	broad.mit.edu	37	9	35611857	35611857	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr9:35611857C>A	ENST00000396757.1	-	8	1058	c.894G>T	c.(892-894)tgG>tgT	p.W298C	CD72_ENST00000259633.4_Missense_Mutation_p.W298C|CD72_ENST00000490239.1_5'UTR			P21854	CD72_HUMAN	CD72 molecule	298	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor binding (GO:0005102)|transmembrane signaling receptor activity (GO:0004888)	p.W298C(1)		large_intestine(5)|liver(1)|lung(6)	12			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGAGGCCAGTCCAATATGAAT	0.433											OREG0019172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003zxb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(892-894)TGG>TGT		CD72 molecule							197.0	170.0	179.0					9																	35611857		2203	4300	6503	SO:0001583	missense	971				axon guidance|cell adhesion	integral to plasma membrane	receptor binding|sugar binding|transmembrane receptor activity	g.chr9:35611857C>A		CCDS6581.1	9p	2008-07-21	2006-03-28		ENSG00000137101	ENSG00000137101		"""CD molecules"""	1696	protein-coding gene	gene with protein product		107272	"""CD72 antigen"""			2044654, 1711157	Standard	NM_001782		Approved	LYB2, CD72b	uc003zxb.2	P21854	OTTHUMG00000019870	ENST00000396757.1:c.894G>T	9.37:g.35611857C>A	ENSP00000379980:p.Trp298Cys		Somatic	OREG0019172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	856	CD72_uc003zxc.1_Missense_Mutation_p.W83C|CD72_uc010mkt.1_Missense_Mutation_p.W83C	p.W298C	NM_001782	NP_001773	WXS	Illumina HiSeq	Unspecified	P21854	CD72_HUMAN	Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		7	1018	-			298			C-type lectin.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000396757.1	37	c.894G>T	CCDS6581.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.807182	0.50421	.	.	ENSG00000137101	ENST00000396757;ENST00000396759;ENST00000259633	T;T	0.57595	0.39;0.39	4.36	4.36	0.52297	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.183599	0.28247	N	0.016055	T	0.68550	0.3013	M	0.68593	2.085	0.58432	D	0.999999	D	0.89917	1.0	D	0.76071	0.987	T	0.71020	-0.4713	10	0.87932	D	0	-6.5174	12.7021	0.57038	0.0:1.0:0.0:0.0	.	298	P21854	CD72_HUMAN	C	298	ENSP00000379980:W298C;ENSP00000259633:W298C	ENSP00000259633:W298C	W	-	3	0	CD72	35601857	0.800000	0.28916	0.817000	0.32601	0.013000	0.08279	1.666000	0.37460	2.702000	0.92279	0.655000	0.94253	TGG		0.433	CD72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052336.1	NM_001782		18	24	1	0	5.03518e-11	0.007413	5.97928e-11	18	24				
SPATA31D1	389763	broad.mit.edu	37	9	84605787	84605787	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr9:84605787G>C	ENST00000344803.2	+	4	449	c.402G>C	c.(400-402)aaG>aaC	p.K134N		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	134					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.K134N(2)									GGGTGTGTAAGAGAGCAACTG	0.552																																							uc004amn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(400-402)AAG>AAC		hypothetical protein LOC389763							116.0	111.0	112.0					9																	84605787		1995	4160	6155	SO:0001583	missense	389763					integral to membrane		g.chr9:84605787G>C		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.402G>C	9.37:g.84605787G>C	ENSP00000341988:p.Lys134Asn		Somatic					p.K134N	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	449	+			134						Missense_Mutation	SNP	ENST00000344803.2	37	c.402G>C	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.895033	0.00522	.	.	ENSG00000214929	ENST00000344803	T	0.03745	3.82	2.95	-3.65	0.04502	.	0.114333	0.39146	N	0.001451	T	0.01092	0.0036	N	0.02275	-0.615	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37478	-0.9704	10	0.02654	T	1	-13.1197	7.4703	0.27344	0.0:0.5934:0.1654:0.2412	.	134	Q6ZQQ2	F75D1_HUMAN	N	134	ENSP00000341988:K134N	ENSP00000341988:K134N	K	+	3	2	FAM75D1	83795607	0.020000	0.18652	0.001000	0.08648	0.007000	0.05969	-0.512000	0.06313	-1.361000	0.02169	-1.127000	0.01993	AAG		0.552	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		12	15	0	0	0	0.010729	0	12	15				
NDUFA8	4702	broad.mit.edu	37	9	124906576	124906576	+	Nonsense_Mutation	SNP	C	C	A	rs374672994		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr9:124906576C>A	ENST00000373768.3	-	4	604	c.463G>T	c.(463-465)Gag>Tag	p.E155*	NDUFA8_ENST00000537618.1_Intron	NM_014222.2	NP_055037.1	P51970	NDUA8_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa	155					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|protein complex binding (GO:0032403)	p.E155*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)	9						AGATCTCCCTCGATCTCAGGG	0.542																																							uc004blv.2		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(1)	1						c.(463-465)GAG>TAG		NADH dehydrogenase (ubiquinone) 1 alpha	NADH(DB00157)						108.0	91.0	96.0					9																	124906576		2203	4300	6503	SO:0001587	stop_gained	4702				mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity	g.chr9:124906576C>A	AF044953	CCDS6835.1	9q33.2	2011-07-04	2002-08-29		ENSG00000119421	ENSG00000119421		"""Mitochondrial respiratory chain complex / Complex I"""	7692	protein-coding gene	gene with protein product	"""complex I PGIV subunit"""	603359	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 (19kD, PGIV)"""			9763677	Standard	NM_014222		Approved	PGIV, MGC793	uc004blv.3	P51970	OTTHUMG00000020598	ENST00000373768.3:c.463G>T	9.37:g.124906576C>A	ENSP00000362873:p.Glu155*		Somatic					p.E155*	NM_014222	NP_055037	WXS	Illumina HiSeq	Unspecified	P51970	NDUA8_HUMAN			4	605	-			155					B1AM93|Q9Y6N0	Nonsense_Mutation	SNP	ENST00000373768.3	37	c.463G>T	CCDS6835.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.238794	0.39598	.	.	ENSG00000119421	ENST00000373768	.	.	.	5.67	3.78	0.43462	.	0.091750	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-19.6508	9.9407	0.41578	0.0:0.7853:0.1377:0.0769	.	.	.	.	X	155	.	ENSP00000362873:E155X	E	-	1	0	NDUFA8	123946397	1.000000	0.71417	0.514000	0.27761	0.002000	0.02628	4.502000	0.60400	1.416000	0.47057	-0.221000	0.12465	GAG		0.542	NDUFA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053909.1	NM_014222		17	14	1	0	9.16793e-09	0.00499	1.05927e-08	17	14				
FCN2	2220	broad.mit.edu	37	9	137777710	137777710	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr9:137777710G>T	ENST00000291744.6	+	6	536	c.526G>T	c.(526-528)Ggg>Tgg	p.G176W	FCN2_ENST00000350339.2_Missense_Mutation_p.G138W	NM_004108.2	NP_004099.2	Q15485	FCN2_HUMAN	ficolin (collagen/fibrinogen domain containing lectin) 2	176	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|opsonization (GO:0008228)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|carbohydrate binding (GO:0030246)	p.G176W(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	20		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		GTTCTGGCTGGGGAATGACAA	0.672																																							uc004cfg.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(526-528)GGG>TGG		ficolin 2 isoform a precursor							54.0	54.0	54.0					9																	137777710		2203	4300	6503	SO:0001583	missense	2220				complement activation, lectin pathway|opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|calcium-dependent protein binding|receptor binding|sugar binding	g.chr9:137777710G>T	D49353	CCDS6983.1	9q34	2013-09-12	2013-09-12		ENSG00000160339	ENSG00000160339		"""Fibrinogen C domain containing"""	3624	protein-coding gene	gene with protein product	"""hucolin"", ""collagen/fibrinogen domain-containing protein 2"", ""ficolin B"", ""serum lectin p35"", ""L-ficolin"""	601624	"""ficolin (collagen/fibrinogen domain-containing lectin) 2 (hucolin)"""			8884275	Standard	XM_006717015		Approved	P35, FCNL, EBP-37, ficolin-2	uc004cfg.1	Q15485	OTTHUMG00000020892	ENST00000291744.6:c.526G>T	9.37:g.137777710G>T	ENSP00000291744:p.Gly176Trp		Somatic				FCN2_uc004cfh.1_Missense_Mutation_p.G138W	p.G176W	NM_004108	NP_004099	WXS	Illumina HiSeq	Unspecified	Q15485	FCN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)	6	536	+		Myeloproliferative disorder(178;0.0333)	176			Fibrinogen C-terminal.		A6NFG7|A8K478|Q6IS69|Q7M4P4|Q9UC57	Missense_Mutation	SNP	ENST00000291744.6	37	c.526G>T	CCDS6983.1	.	.	.	.	.	.	.	.	.	.	G	19.63	3.864418	0.71949	.	.	ENSG00000160339	ENST00000350339;ENST00000291744	T;T	0.78126	-1.15;-1.15	3.96	3.96	0.45880	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.164918	0.28296	N	0.015879	D	0.93923	0.8055	H	0.99946	5.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96045	0.9027	10	0.87932	D	0	.	13.5067	0.61486	0.0:0.0:1.0:0.0	.	138;176	Q15485-2;Q15485	.;FCN2_HUMAN	W	138;176	ENSP00000291741:G138W;ENSP00000291744:G176W	ENSP00000291744:G176W	G	+	1	0	FCN2	136917531	1.000000	0.71417	0.991000	0.47740	0.906000	0.53458	4.501000	0.60393	1.720000	0.51447	0.563000	0.77884	GGG		0.672	FCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054960.1	NM_004108		10	19	1	0	2.27111e-07	0.013537	2.57192e-07	10	19				
CD99	4267	broad.mit.edu	37	X	2635666	2635666	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chrX:2635666A>T	ENST00000381192.3	+	3	303	c.121A>T	c.(121-123)Act>Tct	p.T41S	CD99_ENST00000381187.3_Intron|CD99_ENST00000381184.1_Missense_Mutation_p.T41S|CD99_ENST00000482405.2_3'UTR	NM_001277710.1|NM_002414.3	NP_001264639.1|NP_002405.1	P14209	CD99_HUMAN	CD99 molecule	41					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.T41S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	11						CAAGAAACCCACTGCAATCCC	0.408																																							uc004cqm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(121-123)ACT>TCT		CD99 antigen isoform a precursor							143.0	144.0	144.0					X																	2635666		2203	4296	6499	SO:0001583	missense	4267				cell adhesion	cytoplasm|integral to plasma membrane		g.chrX:2635666A>T	M16279	CCDS14119.1, CCDS48071.1, CCDS75947.1	Xp22.32 and Yp11.3	2012-10-02	2006-03-28	2003-02-14	ENSG00000002586	ENSG00000002586		"""Pseudoautosomal regions / PAR1"", ""CD molecules"""	7082	protein-coding gene	gene with protein product		313470, 450000	"""antigen identified by monoclonal antibodies 12E7, F21 and O13"", ""CD99 antigen"""	MIC2			Standard	NM_001122898		Approved		uc004cqm.3	P14209	OTTHUMG00000021073	ENST00000381192.3:c.121A>T	X.37:g.2635666A>T	ENSP00000370588:p.Thr41Ser		Somatic				CD99_uc010nda.2_Intron|CD99_uc004cqn.2_RNA|CD99_uc004cqo.2_Missense_Mutation_p.T41S	p.T41S	NM_002414	NP_002405	WXS	Illumina HiSeq	Unspecified	P14209	CD99_HUMAN			3	295	+			41			Extracellular (Potential).		A6NIW1|O00518|Q6ICV7	Missense_Mutation	SNP	ENST00000381192.3	37	c.121A>T	CCDS14119.1	.	.	.	.	.	.	.	.	.	.	a	10.29	1.308882	0.23821	.	.	ENSG00000002586	ENST00000381192;ENST00000381184;ENST00000449611	T;T;T	0.22134	1.97;1.97;1.97	1.11	1.11	0.20524	.	0.920034	0.09063	U	0.854026	T	0.29028	0.0721	.	.	.	0.09310	N	1	P;P	0.51057	0.941;0.941	P;P	0.60415	0.874;0.874	T	0.22487	-1.0215	9	0.26408	T	0.33	.	4.119	0.10095	1.0:0.0:0.0:0.0	.	41;41	B2R932;P14209	.;CD99_HUMAN	S	41;41;84	ENSP00000370588:T41S;ENSP00000370579:T41S;ENSP00000405544:T84S	ENSP00000370579:T41S	T	+	1	0	CD99	2645666	0.007000	0.16637	0.011000	0.14972	0.025000	0.11179	1.409000	0.34680	0.695000	0.31675	0.350000	0.21858	ACT		0.408	CD99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055624.1	NM_001122898		7	32	0	0	0	0.004482	0	7	32				
MAGEE1	57692	broad.mit.edu	37	X	75648900	75648900	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chrX:75648900G>A	ENST00000361470.2	+	1	855	c.577G>A	c.(577-579)Gat>Aat	p.D193N		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	193	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.D193N(2)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						GCCCACCCCTGATGAGGGACC	0.697																																							uc004ecm.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(3)|ovary(1)|pancreas(1)|skin(1)	6						c.(577-579)GAT>AAT		melanoma antigen family E, 1							29.0	25.0	26.0					X																	75648900		2198	4295	6493	SO:0001583	missense	57692					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane		g.chrX:75648900G>A	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.577G>A	X.37:g.75648900G>A	ENSP00000354912:p.Asp193Asn		Somatic					p.D193N	NM_020932	NP_065983	WXS	Illumina HiSeq	Unspecified	Q9HCI5	MAGE1_HUMAN			1	784	+			193			Pro-rich.		Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	ENST00000361470.2	37	c.577G>A	CCDS14433.1	.	.	.	.	.	.	.	.	.	.	G	5.015	0.188415	0.09547	.	.	ENSG00000198934	ENST00000361470	T	0.11063	2.81	2.05	-1.08	0.09936	.	.	.	.	.	T	0.04407	0.0121	N	0.14661	0.345	0.09310	N	1	B	0.18968	0.032	B	0.08055	0.003	T	0.44922	-0.9296	9	0.15066	T	0.55	.	2.2905	0.04137	0.3112:0.0:0.2724:0.4164	.	193	Q9HCI5	MAGE1_HUMAN	N	193	ENSP00000354912:D193N	ENSP00000354912:D193N	D	+	1	0	MAGEE1	75565304	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-3.526000	0.00441	-0.473000	0.06871	0.529000	0.55759	GAT		0.697	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932		5	10	0	0	0	0.014758	0	5	10				
PRRG3	79057	broad.mit.edu	37	X	150869297	150869297	+	Missense_Mutation	SNP	G	G	C	rs139807152	byFrequency	TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chrX:150869297G>C	ENST00000370353.3	+	4	878	c.488G>C	c.(487-489)cGg>cCg	p.R163P	PRRG3_ENST00000538575.1_Missense_Mutation_p.R163P			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	163						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.R163P(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					GGGCCCAGTCGGGGGGGCAGG	0.672																																							uc004few.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(487-489)CGG>CCG		proline rich Gla (G-carboxyglutamic acid) 3							31.0	28.0	29.0					X																	150869297		2202	4297	6499	SO:0001583	missense	79057					extracellular region|integral to membrane	calcium ion binding	g.chrX:150869297G>C	AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.488G>C	X.37:g.150869297G>C	ENSP00000359378:p.Arg163Pro		Somatic					p.R163P	NM_024082	NP_076987	WXS	Illumina HiSeq	Unspecified	Q9BZD7	TMG3_HUMAN			4	878	+	Acute lymphoblastic leukemia(192;6.56e-05)		163			Cytoplasmic (Potential).		A1A523|A1A575|Q8N2N6	Missense_Mutation	SNP	ENST00000370353.3	37	c.488G>C	CCDS14699.1	.	.	.	.	.	.	.	.	.	.	G	1.537	-0.542749	0.04053	.	.	ENSG00000130032	ENST00000538575;ENST00000370353	D;D	0.98400	-4.91;-4.91	4.84	2.06	0.26882	.	0.647558	0.13317	N	0.396971	D	0.94315	0.8173	N	0.19112	0.55	0.09310	N	1	P	0.47106	0.89	B	0.43301	0.415	D	0.89187	0.3548	9	.	.	.	-13.994	7.1642	0.25681	0.3197:0.0:0.6803:0.0	.	163	Q9BZD7	TMG3_HUMAN	P	163	ENSP00000440217:R163P;ENSP00000359378:R163P	.	R	+	2	0	PRRG3	150619953	0.123000	0.22298	0.003000	0.11579	0.195000	0.23768	1.564000	0.36375	0.420000	0.25954	-0.266000	0.10368	CGG		0.672	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060880.1	NM_024082		18	14	0	0	0	0.012319	0	18	14				
LRRC37A6P	387646	broad.mit.edu	37	10	27539361	27539361	+	lincRNA	DEL	G	G	-			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr10:27539361delG	ENST00000574842.1	+	0	630				LRRC37A6P_ENST00000284414.4_RNA																							AGGCTCAGTTGGGGCCTCCTC	0.582																																							uc001its.2		NA																	0					0						c.(31-33)CCAfs		SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;							48.0	49.0	49.0					10																	27539361		692	1591	2283			387646							g.chr10:27539361delG																													10.37:g.27539361delG			Somatic					p.P11fs	NR_003525		WXS	Illumina HiSeq	Unspecified					1	1875	-									Frame_Shift_Del	DEL	ENST00000574842.1	37	c.32delC																																																																																					0.582	RP11-85G18.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000436904.1			14	33	NA	NA	NA	NA	NA	14	33	---	---	---	---
PRR35	146325	broad.mit.edu	37	16	613941	613942	+	Frame_Shift_Ins	INS	-	-	C			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr16:613941_613942insC	ENST00000409413.3	+	2	926_927	c.647_648insC	c.(646-651)agccccfs	p.SP216fs		NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		216	Pro-rich.									central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						TACCCGCTCAGCCCCGGCCTCT	0.718																																							uc002chk.2		NA																	0				central_nervous_system(1)	1						c.(646-648)AGCfs		hypothetical protein LOC146325																																				SO:0001589	frameshift_variant	146325							g.chr16:613941_613942insC																												ENST00000409413.3:c.651dupC	16.37:g.613945_613945dupC	ENSP00000386499:p.Ser216fs		Somatic					p.S216fs	NM_145270	NP_660313	WXS	Illumina HiSeq	Unspecified	P0CG20	CP011_HUMAN			2	926_927	+			216			Pro-rich.		B8ZZ27|Q8N233|Q96AX3|Q96S23	Frame_Shift_Ins	INS	ENST00000409413.3	37	c.647_648insC	CCDS45365.1																																																																																				0.718	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333913.1			2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
MAP2K3	5606	broad.mit.edu	37	17	21204251	21204251	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr17:21204251delG	ENST00000342679.4	+	5	594	c.345delG	c.(343-345)atgfs	p.M115fs	MAP2K3_ENST00000361818.5_Frame_Shift_Del_p.M86fs|MAP2K3_ENST00000316920.6_Frame_Shift_Del_p.M86fs	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	115	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		ACATCAACATGCGCACGGTCG	0.587																																							uc002gys.2		NA																	0					0						c.(343-345)ATGfs		mitogen-activated protein kinase kinase 3							181.0	144.0	157.0					17																	21204251		2203	4300	6503	SO:0001589	frameshift_variant	5606				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr17:21204251delG	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.345delG	17.37:g.21204251delG	ENSP00000345083:p.Met115fs		Somatic				MAP2K3_uc002gyt.2_Frame_Shift_Del_p.M86fs|MAP2K3_uc002gyu.2_Frame_Shift_Del_p.M86fs	p.M115fs	NM_145109	NP_659731	WXS	Illumina HiSeq	Unspecified	P46734	MP2K3_HUMAN		COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)	5	610	+			115			Protein kinase.		B3KSK7|Q99441|Q9UE71|Q9UE72	Frame_Shift_Del	DEL	ENST00000342679.4	37	c.345delG	CCDS11217.1																																																																																				0.587	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109		10	119	NA	NA	NA	NA	NA	10	119	---	---	---	---
LIF	3976	broad.mit.edu	37	22	30640019	30640019	+	Frame_Shift_Del	DEL	T	T	-			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr22:30640019delT	ENST00000249075.3	-	3	385	c.230delA	c.(229-231)aacfs	p.N77fs	RP1-102K2.8_ENST00000608354.1_RNA|RP1-102K2.8_ENST00000593843.1_RNA|LIF_ENST00000403987.3_Frame_Shift_Del_p.Q17fs	NM_002309.4	NP_002300.1	P15018	LIF_HUMAN	leukemia inhibitory factor	77					blood vessel remodeling (GO:0001974)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|immune response (GO:0006955)|leukemia inhibitory factor signaling pathway (GO:0048861)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|multicellular organismal development (GO:0007275)|muscle organ morphogenesis (GO:0048644)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|neuron development (GO:0048666)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cell proliferation (GO:0008284)|positive regulation of histone H3-K27 acetylation (GO:1901676)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|spongiotrophoblast differentiation (GO:0060708)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|leukemia inhibitory factor receptor binding (GO:0005146)|receptor binding (GO:0005102)|RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001135)			breast(1)|lung(3)|skin(3)	7			Epithelial(10;0.171)			CTTGTCCAGGTTGTTGGGGAA	0.642																																							uc003agz.2		NA																	0					0						c.(229-231)AACfs		leukemia inhibitory factor (cholinergic							75.0	67.0	69.0					22																	30640019		2203	4300	6503	SO:0001589	frameshift_variant	3976				immune response|leukemia inhibitory factor signaling pathway|negative regulation of hormone secretion|positive regulation of cell proliferation|positive regulation of macrophage differentiation|positive regulation of MAPKKK cascade|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of peptidyl-serine phosphorylation of STAT protein|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of metanephric nephron tubule epithelial cell differentiation		cytokine activity|growth factor activity|leukemia inhibitory factor receptor binding	g.chr22:30640019delT		CCDS13872.1, CCDS58799.1	22q12.2	2012-02-09	2012-02-09		ENSG00000128342	ENSG00000128342			6596	protein-coding gene	gene with protein product	"""differentiation inhibitory activity"", ""differentiation-inducing factor"", ""hepatocyte-stimulating factor III"", ""cholinergic differentiation factor"", ""human interleukin in DA cells"""	159540				1714745, 8058719	Standard	NM_002309		Approved	CDF, DIA, HILDA	uc003agz.3	P15018	OTTHUMG00000150910	ENST00000249075.3:c.230delA	22.37:g.30640019delT	ENSP00000249075:p.Asn77fs		Somatic				LIF_uc011aks.1_Frame_Shift_Del_p.Q17fs|uc003aha.2_5'Flank	p.N77fs	NM_002309	NP_002300	WXS	Illumina HiSeq	Unspecified	P15018	LIF_HUMAN	Epithelial(10;0.171)		3	342	-			77					B2RCW7|B5MC23|Q52LZ2	Frame_Shift_Del	DEL	ENST00000249075.3	37	c.230delA	CCDS13872.1																																																																																				0.642	LIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320508.1	NM_002309		8	30	NA	NA	NA	NA	NA	8	30	---	---	---	---
DLC1	10395	broad.mit.edu	37	8	12958176	12958177	+	Frame_Shift_Ins	INS	-	-	A			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:12958176_12958177insA	ENST00000276297.4	-	9	2078_2079	c.1669_1670insT	c.(1669-1671)tctfs	p.S557fs	DLC1_ENST00000358919.2_Frame_Shift_Ins_p.S120fs|DLC1_ENST00000520226.1_Frame_Shift_Ins_p.S46fs|DLC1_ENST00000512044.2_Frame_Shift_Ins_p.S154fs	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	557					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TTGTTTTGGAGAAAAGACATCA	0.589																																							uc003wwm.2		NA																	0				ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						c.(1669-1671)TCTfs		deleted in liver cancer 1 isoform 1																																				SO:0001589	frameshift_variant	10395				actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding	g.chr8:12958176_12958177insA	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1670dupT	8.37:g.12958180_12958180dupA	ENSP00000276297:p.Ser557fs		Somatic				DLC1_uc003wwk.1_Frame_Shift_Ins_p.S120fs|DLC1_uc003wwl.1_Frame_Shift_Ins_p.S154fs|DLC1_uc011kxx.1_Frame_Shift_Ins_p.S46fs	p.S557fs	NM_182643	NP_872584	WXS	Illumina HiSeq	Unspecified	Q96QB1	RHG07_HUMAN			9	2113_2114	-			557					B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Frame_Shift_Ins	INS	ENST00000276297.4	37	c.1669_1670insT	CCDS5989.1																																																																																				0.589	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094		15	45	NA	NA	NA	NA	NA	15	45	---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32616840	32616841	+	Frame_Shift_Ins	INS	-	-	G			TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr8:32616840_32616841insG	ENST00000405005.3	+	10	947_948	c.947_948insG	c.(946-951)aacgtcfs	p.NV316fs	NRG1_ENST00000523079.1_Frame_Shift_Ins_p.NV313fs|NRG1_ENST00000287845.5_Frame_Shift_Ins_p.NV287fs|NRG1_ENST00000356819.4_Frame_Shift_Ins_p.NV321fs|NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000519301.1_Frame_Shift_Ins_p.NV266fs|NRG1_ENST00000287842.3_Frame_Shift_Ins_p.NV313fs|NRG1_ENST00000539990.1_Frame_Shift_Ins_p.NV159fs|NRG1_ENST00000521670.1_Frame_Shift_Ins_p.NV316fs|NRG1_ENST00000338921.4_Frame_Shift_Ins_p.NV324fs			Q02297	NRG1_HUMAN	neuregulin 1	316					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GTATCTAAAAACGTCATCTCCA	0.396																																							uc003xiv.2		NA																	0					0						c.(946-948)AACfs		neuregulin 1 isoform HRG-alpha																																				SO:0001589	frameshift_variant	3084				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity	g.chr8:32616840_32616841insG	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	Exception_encountered	8.37:g.32616840_32616841insG	ENSP00000384620:p.Asn316fs		Somatic				NRG1_uc011lbf.1_Frame_Shift_Ins_p.N313fs|NRG1_uc010lvo.2_Frame_Shift_Ins_p.N313fs|NRG1_uc003xiu.2_Frame_Shift_Ins_p.N321fs|NRG1_uc003xiw.2_Frame_Shift_Ins_p.N313fs|NRG1_uc003xit.2_Frame_Shift_Ins_p.N316fs|NRG1_uc010lvr.2_Frame_Shift_Ins_p.N58fs|NRG1_uc010lvs.2_Frame_Shift_Ins_p.N58fs|NRG1_uc010lvp.2_Frame_Shift_Ins_p.N270fs|NRG1_uc010lvq.2_Frame_Shift_Ins_p.N253fs|NRG1_uc011lbg.1_Frame_Shift_Ins_p.N162fs|NRG1_uc011lbh.1_Frame_Shift_Ins_p.N159fs|NRG1_uc003xja.2_Frame_Shift_Ins_p.N127fs	p.N316fs	NM_013964	NP_039258	WXS	Illumina HiSeq	Unspecified	Q02297	NRG1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)	10	1464_1465	+		Breast(100;0.203)	316			Cytoplasmic (Potential).		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Frame_Shift_Ins	INS	ENST00000405005.3	37	c.947_948insG	CCDS6085.1																																																																																				0.396	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1			20	75	NA	NA	NA	NA	NA	20	75	---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-50-5936-01A-11D-1625-08	TCGA-50-5936-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08	9c9f5938-1cd9-47f6-adb1-f0293a8a9eca	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		5	14	1	1	0.184627	0.014758	0.185713	5	14	NA	NA	NA	NA
