#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CHD5	26038	broad.mit.edu	37	1	6203888	6203888	+	Missense_Mutation	SNP	C	C	A	rs139532134	byFrequency	TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:6203888C>A	ENST00000262450.3	-	13	2137	c.2038G>T	c.(2038-2040)Gtg>Ttg	p.V680L	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.V680L(1)		breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CTCACGTCCACAATGGGCGTG	0.617													C|||	3	0.000599042	0.0	0.0	5008	,	,		14973	0.0		0.001	False		,,,				2504	0.002						uc001amb.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12						c.(2038-2040)GTG>TTG		chromodomain helicase DNA binding protein 5		C	LEU/VAL	1,4405	2.1+/-5.4	0,1,2202	73.0	72.0	73.0		2038	3.8	0.9	1	dbSNP_134	73	9,8591	6.4+/-24.3	0,9,4291	yes	missense	CHD5	NM_015557.2	32	0,10,6493	AA,AC,CC		0.1047,0.0227,0.0769	benign	680/1955	6203888	10,12996	2203	4300	6503	SO:0001583	missense	26038				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding	g.chr1:6203888C>A	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2038G>T	1.37:g.6203888C>A	ENSP00000262450:p.Val680Leu		Somatic				CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA	p.V680L	NM_015557	NP_056372	WXS	Illumina HiSeq	Unspecified	Q8TDI0	CHD5_HUMAN		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)	13	2138	-	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)	680					A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	c.2038G>T	CCDS57.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	8.476	0.858763	0.17178	2.27E-4	0.001047	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	D	0.92911	-3.13	4.73	3.79	0.43588	.	0.083720	0.47852	D	0.000211	D	0.87775	0.6262	L	0.55990	1.75	0.80722	D	1	B	0.15930	0.015	B	0.14023	0.01	T	0.82252	-0.0549	10	0.30078	T	0.28	-30.1644	8.0886	0.30786	0.1594:0.761:0.0:0.0796	.	680	Q8TDI0	CHD5_HUMAN	L	680;196;88;88	ENSP00000262450:V680L	ENSP00000262450:V680L	V	-	1	0	CHD5	6126475	0.979000	0.34478	0.946000	0.38457	0.410000	0.31052	2.887000	0.48586	1.301000	0.44836	0.561000	0.74099	GTG		0.617	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557		5	39	1	0	8.12818e-05	0.001984	8.79322e-05	5	39				
AADACL3	126767	broad.mit.edu	37	1	12785267	12785267	+	Silent	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:12785267C>A	ENST00000359318.5	+	4	562	c.357C>A	c.(355-357)tcC>tcA	p.S119S	AADACL3_ENST00000332530.3_Silent_p.S49S	NM_001103170.1	NP_001096640.1	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3	119							hydrolase activity (GO:0016787)	p.S119S(1)|p.S49S(1)		breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	15	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TCCTGAAGTCCCTGGATGCAT	0.512																																							uc009vnn.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(355-357)TCC>TCA		arylacetamide deacetylase-like 3 isoform 1							102.0	107.0	105.0					1																	12785267		1962	4156	6118	SO:0001819	synonymous_variant	126767						hydrolase activity	g.chr1:12785267C>A		CCDS41253.1	1p36.21	2014-07-17			ENSG00000188984	ENSG00000188984			32037	protein-coding gene	gene with protein product							Standard	XM_006710337		Approved	OTTHUMG00000001887	uc009vnn.1	Q5VUY0	OTTHUMG00000001887	ENST00000359318.5:c.357C>A	1.37:g.12785267C>A			Somatic				AADACL3_uc001aug.1_Silent_p.S49S	p.S119S	NM_001103170	NP_001096640	WXS	Illumina HiSeq	Unspecified	Q5VUY0	ADCL3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	4	590	+	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	119					B3KXR9|Q5VUY1	Silent	SNP	ENST00000359318.5	37	c.357C>A	CCDS41253.1																																																																																				0.512	AADACL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005324.2	NM_001103170		15	78	1	0	1.05317e-09	0.020292	1.20507e-09	15	78				
WNT4	54361	broad.mit.edu	37	1	22447964	22447964	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:22447964C>T	ENST00000290167.6	-	3	462	c.419G>A	c.(418-420)aGg>aAg	p.R140K	WNT4_ENST00000542383.1_Missense_Mutation_p.R85K	NM_030761.4	NP_110388.2	P56705	WNT4_HUMAN	wingless-type MMTV integration site family, member 4	140					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|embryonic epithelial tube formation (GO:0001838)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization to plasma membrane (GO:0090002)|female gonad development (GO:0008585)|female sex determination (GO:0030237)|immature T cell proliferation in thymus (GO:0033080)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|mammary gland epithelium development (GO:0061180)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric nephron morphogenesis (GO:0072273)|metanephric tubule formation (GO:0072174)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of gene expression (GO:0010629)|negative regulation of male gonad development (GO:2000019)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of testicular blood vessel morphogenesis (GO:0061369)|negative regulation of testosterone biosynthetic process (GO:2000225)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of wound healing (GO:0061045)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via MAPK cascade (GO:0038030)|oocyte development (GO:0048599)|paramesonephric duct development (GO:0061205)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cortisol biosynthetic process (GO:2000066)|positive regulation of dermatome development (GO:0061184)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of meiosis (GO:0045836)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|protein palmitoylation (GO:0018345)|regulation of cell-cell adhesion (GO:0022407)|renal vesicle formation (GO:0072033)|renal vesicle induction (GO:0072034)|smooth muscle cell differentiation (GO:0051145)|somatotropin secreting cell differentiation (GO:0060126)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription corepressor activity (GO:0003714)	p.R140K(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	8		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		ATGCACTGTCCTGTCACAGCC	0.667																																							uc001bfs.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(418-420)AGG>AAG		wingless-type MMTV integration site family,							79.0	75.0	77.0					1																	22447964		2203	4300	6503	SO:0001583	missense	54361				adrenal gland development|androgen biosynthetic process|anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|dermatome development|endoderm development|epithelial to mesenchymal transition|establishment of protein localization in plasma membrane|female gonad development|female sex determination|liver development|male gonad development|mesonephric tubule development|metanephric mesenchymal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of male gonad development|negative regulation of testicular blood vessel morphogenesis|negative regulation of testosterone biosynthetic process|negative regulation of transcription, DNA-dependent|oocyte development|paramesonephric duct development|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of collagen biosynthetic process|positive regulation of cortisol biosynthetic process|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|protein palmitoylation|renal vesicle formation|smooth muscle cell differentiation|somatotropin secreting cell differentiation|tertiary branching involved in mammary gland duct morphogenesis|thyroid-stimulating hormone-secreting cell differentiation|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|extracellular space|Golgi apparatus|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|signal transducer activity|transcription corepressor activity	g.chr1:22447964C>T	AL031281	CCDS223.1	1p36.23-p35.1	2013-02-28			ENSG00000162552	ENSG00000162552		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12783	protein-coding gene	gene with protein product		603490				8168088	Standard	NM_030761		Approved	WNT-4	uc001bfs.4	P56705	OTTHUMG00000002894	ENST00000290167.6:c.419G>A	1.37:g.22447964C>T	ENSP00000290167:p.Arg140Lys		Somatic				WNT4_uc010odt.1_Missense_Mutation_p.R77K	p.R140K	NM_030761	NP_110388	WXS	Illumina HiSeq	Unspecified	P56705	WNT4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)	3	523	-		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	140					B4DJF9|Q5TZQ0|Q96T81|Q9BXF5|Q9H1J8|Q9UJM2	Missense_Mutation	SNP	ENST00000290167.6	37	c.419G>A	CCDS223.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485768	0.63962	.	.	ENSG00000162552	ENST00000290167;ENST00000542383	T;T	0.75050	-0.9;-0.9	4.65	4.65	0.58169	.	0.056192	0.64402	D	0.000002	T	0.73313	0.3571	L	0.42744	1.35	0.46901	D	0.999249	P	0.38395	0.629	B	0.44315	0.446	T	0.74325	-0.3702	10	0.42905	T	0.14	.	16.4483	0.83959	0.0:1.0:0.0:0.0	.	140	P56705	WNT4_HUMAN	K	140;85	ENSP00000290167:R140K;ENSP00000441033:R85K	ENSP00000290167:R140K	R	-	2	0	WNT4	22320551	1.000000	0.71417	0.996000	0.52242	0.707000	0.40811	4.774000	0.62339	2.303000	0.77524	0.555000	0.69702	AGG		0.667	WNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008088.2			13	74	0	0	0	0.007413	0	13	74				
NRD1	4898	broad.mit.edu	37	1	52283748	52283748	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:52283748G>A	ENST00000354831.7	-	12	1744	c.1555C>T	c.(1555-1557)Caa>Taa	p.Q519*	NRD1_ENST00000539524.1_Nonsense_Mutation_p.Q387*|NRD1_ENST00000544028.1_Nonsense_Mutation_p.Q319*|NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000352171.7_Nonsense_Mutation_p.Q451*	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	450					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.Q519*(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						CTGTAATGTTGCTGTTGAGGA	0.348																																							uc001ctc.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1555-1557)CAA>TAA		nardilysin isoform a							111.0	107.0	108.0					1																	52283748		2203	4300	6503	SO:0001587	stop_gained	4898				cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding	g.chr1:52283748G>A	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.1555C>T	1.37:g.52283748G>A	ENSP00000346890:p.Gln519*		Somatic				NRD1_uc009vzb.2_Nonsense_Mutation_p.Q214*|NRD1_uc001ctd.3_Nonsense_Mutation_p.Q451*|NRD1_uc001cte.2_Nonsense_Mutation_p.Q387*|NRD1_uc001ctf.2_Nonsense_Mutation_p.Q451*|NRD1_uc010ong.1_RNA|NRD1_uc009vzc.1_Nonsense_Mutation_p.Q319*	p.Q519*	NM_002525	NP_002516	WXS	Illumina HiSeq	Unspecified	O43847	NRDC_HUMAN			12	1877	-			450					A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Nonsense_Mutation	SNP	ENST00000354831.7	37	c.1555C>T	CCDS559.1	.	.	.	.	.	.	.	.	.	.	G	38	6.896695	0.97916	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	.	.	.	5.46	5.46	0.80206	.	0.098804	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-9.2571	16.1284	0.81410	0.0:0.2021:0.7979:0.0	.	.	.	.	X	451;519;387;451;319	.	ENSP00000262679:Q451X	Q	-	1	0	NRD1	52056336	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.695000	0.61767	2.578000	0.87016	0.655000	0.94253	CAA		0.348	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525		3	22	0	0	0	0.009096	0	3	22				
LMO4	8543	broad.mit.edu	37	1	87805268	87805268	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:87805268G>C	ENST00000370544.5	+	3	1066	c.286G>C	c.(286-288)Gcg>Ccg	p.A96P	LMO4_ENST00000489303.1_3'UTR|LMO4_ENST00000370542.1_Missense_Mutation_p.A96P	NM_006769.3	NP_006760.1	P61968	LMO4_HUMAN	LIM domain only 4	96	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of protein complex assembly (GO:0031333)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell activation (GO:0050865)|regulation of cell fate specification (GO:0042659)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron differentiation (GO:0021522)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)|ventral spinal cord interneuron differentiation (GO:0021514)|ventricular septum development (GO:0003281)	transcription factor complex (GO:0005667)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A96P(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(1)	9		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		GTCGATTCCTGCGAGTGAACT	0.398																																							uc001dmi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(286-288)GCG>CCG		LIM domain only 4							94.0	94.0	94.0					1																	87805268		2203	4300	6503	SO:0001583	missense	8543				neural tube closure|transcription from RNA polymerase II promoter	transcription factor complex	sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding	g.chr1:87805268G>C	U24576	CCDS713.1	1p22.3	2008-02-05			ENSG00000143013	ENSG00000143013			6644	protein-coding gene	gene with protein product		603129					Standard	NM_006769		Approved		uc001dmi.3	P61968	OTTHUMG00000010248	ENST00000370544.5:c.286G>C	1.37:g.87805268G>C	ENSP00000359575:p.Ala96Pro		Somatic				LMO4_uc001dmj.2_Missense_Mutation_p.A96P	p.A96P	NM_006769	NP_006760	WXS	Illumina HiSeq	Unspecified	P61968	LMO4_HUMAN		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)	3	1066	+		Lung NSC(277;0.179)	96			LIM zinc-binding 2.		D3DT23|O00158|O88894	Missense_Mutation	SNP	ENST00000370544.5	37	c.286G>C	CCDS713.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599767	0.87055	.	.	ENSG00000143013	ENST00000370544;ENST00000370542	D;D	0.87571	-2.27;-2.27	5.93	5.93	0.95920	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	T	0.80132	0.4567	N	0.13140	0.3	0.80722	D	1	B	0.30889	0.299	P	0.45639	0.488	T	0.77146	-0.2695	10	0.20519	T	0.43	.	20.3311	0.98718	0.0:0.0:1.0:0.0	.	96	P61968	LMO4_HUMAN	P	96	ENSP00000359575:A96P;ENSP00000359573:A96P	ENSP00000359573:A96P	A	+	1	0	LMO4	87577856	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.818000	0.99354	2.797000	0.96272	0.655000	0.94253	GCG		0.398	LMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028264.2	NM_006769		7	34	0	0	0	0.00308	0	7	34				
LRRC8B	23507	broad.mit.edu	37	1	90058463	90058463	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:90058463A>G	ENST00000330947.2	+	6	2633	c.2273A>G	c.(2272-2274)aAt>aGt	p.N758S	LRRC8B_ENST00000358200.4_Missense_Mutation_p.N758S|RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000439853.1_Missense_Mutation_p.N758S	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	758					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N758S(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		CTCATTGGTAATTACCTGGAA	0.433																																							uc001dni.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2272-2274)AAT>AGT		leucine rich repeat containing 8 family, member							146.0	133.0	138.0					1																	90058463		2203	4300	6503	SO:0001583	missense	23507					integral to membrane		g.chr1:90058463A>G	AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.2273A>G	1.37:g.90058463A>G	ENSP00000332674:p.Asn758Ser		Somatic				LRRC8B_uc001dnh.2_Missense_Mutation_p.N758S|LRRC8B_uc001dnj.2_Missense_Mutation_p.N758S	p.N758S	NM_001134476	NP_001127948	WXS	Illumina HiSeq	Unspecified	Q6P9F7	LRC8B_HUMAN		all cancers(265;0.00515)|Epithelial(280;0.0241)	8	2780	+		all_lung(203;0.17)	758			LRR 13.		D3DT28|Q6UY21|Q8N106|Q92627	Missense_Mutation	SNP	ENST00000330947.2	37	c.2273A>G	CCDS724.1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.980181	0.92982	.	.	ENSG00000197147	ENST00000330947;ENST00000358200;ENST00000439853	T;T;T	0.01495	4.83;4.83;4.83	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000002	T	0.09818	0.0241	M	0.90977	3.165	0.53688	D	0.999979	D	0.69078	0.997	D	0.79108	0.992	T	0.01130	-1.1442	9	.	.	.	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	758	Q6P9F7	LRC8B_HUMAN	S	758	ENSP00000332674:N758S;ENSP00000350933:N758S;ENSP00000400704:N758S	.	N	+	2	0	LRRC8B	89831051	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.875000	0.92372	2.323000	0.78572	0.528000	0.53228	AAT		0.433	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028008.1	NM_015350		25	94	0	0	0	0.01892	0	25	94				
DENND2C	163259	broad.mit.edu	37	1	115168247	115168247	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:115168247C>G	ENST00000393274.1	-	4	984	c.359G>C	c.(358-360)cGg>cCg	p.R120P	DENND2C_ENST00000393276.3_Missense_Mutation_p.R120P|DENND2C_ENST00000393277.1_Missense_Mutation_p.R120P|DENND2C_ENST00000481894.1_5'Flank	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	120					positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R120P(1)|p.R120Q(1)		NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCTTTGACCCGAGAACATAC	0.348																																							uc001efd.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	skin(3)	3						c.(358-360)CGG>CCG		DENN/MADD domain containing 2C							83.0	83.0	83.0					1																	115168247		2203	4300	6503	SO:0001583	missense	163259							g.chr1:115168247C>G		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.359G>C	1.37:g.115168247C>G	ENSP00000376955:p.Arg120Pro		Somatic				DENND2C_uc001eez.2_RNA|DENND2C_uc001efc.1_Missense_Mutation_p.R120P	p.R120P	NM_198459	NP_940861	WXS	Illumina HiSeq	Unspecified	Q68D51	DEN2C_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	4	1061	-	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	120					B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	ENST00000393274.1	37	c.359G>C	CCDS58018.1	.	.	.	.	.	.	.	.	.	.	C	9.634	1.137185	0.21123	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.09163	3.64;3.65;3.01	5.78	-1.35	0.09114	.	5.356300	0.00744	U	0.001035	T	0.07503	0.0189	L	0.42245	1.32	0.24446	N	0.9945	P;P	0.44195	0.586;0.828	B;P	0.47864	0.182;0.559	T	0.43605	-0.9381	10	0.72032	D	0.01	.	12.0155	0.53311	0.0:0.4344:0.0:0.5656	.	120;120	Q68D51;Q68D51-3	DEN2C_HUMAN;.	P	120	ENSP00000376957:R120P;ENSP00000376955:R120P;ENSP00000376958:R120P	ENSP00000358553:R120P	R	-	2	0	DENND2C	114969770	0.000000	0.05858	0.944000	0.38274	0.137000	0.21094	-2.121000	0.01322	-0.115000	0.11915	-0.145000	0.13849	CGG		0.348	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459		5	108	0	0	0	0.014758	0	5	108				
HMGCS2	3158	broad.mit.edu	37	1	120300051	120300051	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:120300051A>T	ENST00000369406.3	-	5	910	c.861T>A	c.(859-861)gaT>gaA	p.D287E	HMGCS2_ENST00000544913.2_Missense_Mutation_p.D245E|HMGCS2_ENST00000476640.1_5'UTR	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	287					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)	p.D287E(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		TGAAGGGTCGATCGCTGCCAG	0.507																																							uc001eid.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(859-861)GAT>GAA		hydroxymethylglutaryl-CoA synthase 2 isoform 1							79.0	70.0	73.0					1																	120300051		2203	4300	6503	SO:0001583	missense	3158				acetoacetic acid biosynthetic process|cholesterol biosynthetic process|isoprenoid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA synthase activity	g.chr1:120300051A>T	BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.861T>A	1.37:g.120300051A>T	ENSP00000358414:p.Asp287Glu		Somatic				HMGCS2_uc010oxj.1_Missense_Mutation_p.D245E|HMGCS2_uc001eie.2_Missense_Mutation_p.D195E	p.D287E	NM_005518	NP_005509	WXS	Illumina HiSeq	Unspecified	P54868	HMCS2_HUMAN		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)	5	912	-	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)	287					B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Missense_Mutation	SNP	ENST00000369406.3	37	c.861T>A	CCDS905.1	.	.	.	.	.	.	.	.	.	.	A	5.937	0.356935	0.11239	.	.	ENSG00000134240	ENST00000369406;ENST00000544913	T;T	0.76448	-1.02;-1.02	5.33	-9.54	0.00572	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.817821	0.11214	N	0.587417	T	0.21801	0.0525	N	0.05330	-0.07	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.33650	-0.9860	10	0.11182	T	0.66	-0.8851	5.4137	0.16361	0.1873:0.3187:0.4085:0.0855	.	245;287	B7Z8R3;P54868	.;HMCS2_HUMAN	E	287;245	ENSP00000358414:D287E;ENSP00000439495:D245E	ENSP00000358414:D287E	D	-	3	2	HMGCS2	120101574	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.158000	0.01281	-1.229000	0.02564	-0.256000	0.11100	GAT		0.507	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033469.2	NM_005518		7	22	0	0	0	0.001984	0	7	22				
SLC27A3	11000	broad.mit.edu	37	1	153748035	153748035	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:153748035A>G	ENST00000368661.3	+	1	268	c.203A>G	c.(202-204)cAc>cGc	p.H68R	SLC27A3_ENST00000484014.1_Intron|SLC27A3_ENST00000271857.2_Missense_Mutation_p.H149R	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	68					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)	p.H68R(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ctgAAGCTACACCTCTGGCCG	0.667																																							uc001fcz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(202-204)CAC>CGC		solute carrier family 27 member 3							29.0	30.0	30.0					1																	153748035		2202	4299	6501	SO:0001583	missense	11000				fatty acid metabolic process	integral to membrane|mitochondrial membrane	ligase activity|nucleotide binding	g.chr1:153748035A>G	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.203A>G	1.37:g.153748035A>G	ENSP00000357650:p.His68Arg		Somatic				SLC27A3_uc009won.2_RNA	p.H68R	NM_024330	NP_077306	WXS	Illumina HiSeq	Unspecified	Q5K4L6	S27A3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		1	268	+	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		68			Helical; (Potential).		Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	37	c.203A>G	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	A	18.99	3.738936	0.69304	.	.	ENSG00000143554	ENST00000271857;ENST00000368661	T;T	0.57107	0.42;0.46	3.92	-0.0666	0.13763	.	1.335270	0.04780	N	0.429683	T	0.12646	0.0307	N	0.14661	0.345	0.22050	N	0.999392	B	0.02656	0.0	B	0.01281	0.0	T	0.13150	-1.0520	10	0.36615	T	0.2	-10.279	2.3259	0.04222	0.5068:0.0:0.2566:0.2365	.	68	Q5K4L6	S27A3_HUMAN	R	149;68	ENSP00000271857:H149R;ENSP00000357650:H68R	ENSP00000271857:H149R	H	+	2	0	SLC27A3	152014659	0.000000	0.05858	0.954000	0.39281	0.982000	0.71751	-1.102000	0.03332	0.147000	0.19030	0.379000	0.24179	CAC		0.667	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330		7	13	0	0	0	0.001984	0	7	13				
FCER1A	2205	broad.mit.edu	37	1	159273855	159273855	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:159273855G>C	ENST00000368115.1	+	4	313	c.214G>C	c.(214-216)Gaa>Caa	p.E72Q	FCER1A_ENST00000368114.1_Missense_Mutation_p.E39Q	NM_002001.3	NP_001992.1	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide	72	Ig-like 1.				activation of JUN kinase activity (GO:0007257)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leukotriene biosynthetic process (GO:0019370)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of type I hypersensitivity (GO:0001812)|serotonin secretion (GO:0001820)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)	p.E72Q(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(19)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	CAGCCTTTCAGAAGAGACAAA	0.363																																							uc001ftq.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(2)|prostate(1)	5						c.(214-216)GAA>CAA		Fc fragment of IgE, high affinity I, receptor	Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)						72.0	71.0	71.0					1																	159273855		2203	4300	6503	SO:0001583	missense	2205					integral to plasma membrane		g.chr1:159273855G>C	BC015195	CCDS1184.1	1q23	2013-01-11			ENSG00000179639	ENSG00000179639		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3609	protein-coding gene	gene with protein product		147140		FCE1A		8245459	Standard	NM_002001		Approved		uc001ftq.3	P12319	OTTHUMG00000037176	ENST00000368115.1:c.214G>C	1.37:g.159273855G>C	ENSP00000357097:p.Glu72Gln		Somatic					p.E72Q	NM_002001	NP_001992	WXS	Illumina HiSeq	Unspecified	P12319	FCERA_HUMAN			4	313	+	all_hematologic(112;0.0429)		72			Extracellular (Potential).|Ig-like 1.			Missense_Mutation	SNP	ENST00000368115.1	37	c.214G>C	CCDS1184.1	.	.	.	.	.	.	.	.	.	.	G	2.667	-0.278444	0.05679	.	.	ENSG00000179639	ENST00000368115;ENST00000368114	T;T	0.12984	2.63;3.15	4.7	-9.4	0.00616	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	6.471380	0.00520	N	0.000197	T	0.01320	0.0043	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.34004	-0.9846	10	0.19147	T	0.46	.	1.7099	0.02890	0.215:0.3701:0.1337:0.2812	.	72	P12319	FCERA_HUMAN	Q	72;39	ENSP00000357097:E72Q;ENSP00000357096:E39Q	ENSP00000357096:E39Q	E	+	1	0	FCER1A	157540479	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.920000	0.00334	-2.198000	0.00749	-0.300000	0.09419	GAA		0.363	FCER1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090328.2	NM_002001		12	57	0	0	0	0.010729	0	12	57				
TSNAX	7257	broad.mit.edu	37	1	231700631	231700631	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:231700631C>G	ENST00000366639.4	+	6	1011	c.853C>G	c.(853-855)Caa>Gaa	p.Q285E	TSNAX-DISC1_ENST00000602962.1_Intron	NM_005999.2	NP_005990.1	Q99598	TSNAX_HUMAN	translin-associated factor X	285					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|sequence-specific DNA binding (GO:0043565)	p.Q285E(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				AATGATAGATCAAGAAGAGGG	0.333																																							uc001huw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(853-855)CAA>GAA		translin-associated factor X							73.0	74.0	74.0					1																	231700631		2203	4300	6503	SO:0001583	missense	7257				cell differentiation|multicellular organismal development|spermatogenesis	nucleus|perinuclear region of cytoplasm	protein transporter activity|sequence-specific DNA binding	g.chr1:231700631C>G	X95073	CCDS1596.1	1q42.2	2008-02-05			ENSG00000116918	ENSG00000116918			12380	protein-coding gene	gene with protein product		602964				9013868	Standard	NM_005999		Approved	TRAX	uc001huw.3	Q99598	OTTHUMG00000039486	ENST00000366639.4:c.853C>G	1.37:g.231700631C>G	ENSP00000355599:p.Gln285Glu		Somatic				TSNAX-DISC1_uc010pwe.1_Intron|TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron	p.Q285E	NM_005999	NP_005990	WXS	Illumina HiSeq	Unspecified	Q99598	TSNAX_HUMAN			6	1011	+		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)	285					B1APC6	Missense_Mutation	SNP	ENST00000366639.4	37	c.853C>G	CCDS1596.1	.	.	.	.	.	.	.	.	.	.	C	3.869	-0.028363	0.07589	.	.	ENSG00000116918	ENST00000366639	.	.	.	5.67	5.67	0.87782	.	0.345473	0.34932	N	0.003575	T	0.18923	0.0454	N	0.03608	-0.345	0.26424	N	0.976048	B	0.09022	0.002	B	0.04013	0.001	T	0.06917	-1.0800	9	0.02654	T	1	.	14.9009	0.70678	0.1434:0.8566:0.0:0.0	.	285	Q99598	TSNAX_HUMAN	E	285	.	ENSP00000355599:Q285E	Q	+	1	0	TSNAX	229767254	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.699000	0.47077	2.828000	0.97474	0.650000	0.86243	CAA		0.333	TSNAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095267.2	NM_005999		6	41	0	0	0	0.001984	0	6	41				
TSNAX	7257	broad.mit.edu	37	1	231700636	231700636	+	Silent	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:231700636A>G	ENST00000366639.4	+	6	1016	c.858A>G	c.(856-858)gaA>gaG	p.E286E	TSNAX-DISC1_ENST00000602962.1_Intron	NM_005999.2	NP_005990.1	Q99598	TSNAX_HUMAN	translin-associated factor X	286					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|sequence-specific DNA binding (GO:0043565)	p.E286E(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				TAGATCAAGAAGAGGGCATTT	0.328																																							uc001huw.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(856-858)GAA>GAG		translin-associated factor X							69.0	71.0	70.0					1																	231700636		2203	4300	6503	SO:0001819	synonymous_variant	7257				cell differentiation|multicellular organismal development|spermatogenesis	nucleus|perinuclear region of cytoplasm	protein transporter activity|sequence-specific DNA binding	g.chr1:231700636A>G	X95073	CCDS1596.1	1q42.2	2008-02-05			ENSG00000116918	ENSG00000116918			12380	protein-coding gene	gene with protein product		602964				9013868	Standard	NM_005999		Approved	TRAX	uc001huw.3	Q99598	OTTHUMG00000039486	ENST00000366639.4:c.858A>G	1.37:g.231700636A>G			Somatic				TSNAX-DISC1_uc010pwe.1_Intron|TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron	p.E286E	NM_005999	NP_005990	WXS	Illumina HiSeq	Unspecified	Q99598	TSNAX_HUMAN			6	1016	+		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)	286					B1APC6	Silent	SNP	ENST00000366639.4	37	c.858A>G	CCDS1596.1																																																																																				0.328	TSNAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095267.2	NM_005999		5	37	0	0	0	0.001168	0	5	37				
OR2W3	343171	broad.mit.edu	37	1	248059023	248059023	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:248059023C>G	ENST00000360358.3	+	1	135	c.135C>G	c.(133-135)atC>atG	p.I45M	OR2W3_ENST00000537741.1_Missense_Mutation_p.I45M	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I45M(1)		breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACACCACCATCATCCTGGTGT	0.582																																							uc001idp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|pancreas(1)	3						c.(133-135)ATC>ATG		olfactory receptor, family 2, subfamily W,							197.0	170.0	179.0					1																	248059023		2203	4300	6503	SO:0001583	missense	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248059023C>G	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.135C>G	1.37:g.248059023C>G	ENSP00000353516:p.Ile45Met		Somatic				OR2W3_uc010pzb.1_Missense_Mutation_p.I45M	p.I45M	NM_001001957	NP_001001957	WXS	Illumina HiSeq	Unspecified	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	404	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		45			Helical; Name=1; (Potential).		Q6IF06|Q8NG86	Missense_Mutation	SNP	ENST00000360358.3	37	c.135C>G	CCDS31099.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601584	0.46423	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	T;T	0.00527	6.79;6.79	5.29	3.41	0.39046	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000009	T	0.01523	0.0049	M	0.78916	2.43	0.38508	D	0.948402	D	0.89917	1.0	D	0.91635	0.999	T	0.58358	-0.7650	10	0.87932	D	0	.	9.1561	0.36994	0.1545:0.7683:0.0:0.0772	.	45	Q7Z3T1	OR2W3_HUMAN	M	45	ENSP00000445853:I45M;ENSP00000353516:I45M	ENSP00000353516:I45M	I	+	3	3	OR2W3	246125646	0.002000	0.14202	1.000000	0.80357	0.421000	0.31385	-1.689000	0.01923	0.781000	0.33589	0.609000	0.83330	ATC		0.582	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		7	124	0	0	0	0.00308	0	7	124				
AKR1E2	83592	broad.mit.edu	37	10	4877971	4877971	+	Silent	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:4877971C>G	ENST00000298375.7	+	4	500	c.429C>G	c.(427-429)ccC>ccG	p.P143P	AKR1E2_ENST00000525281.1_3'UTR|AKR1E2_ENST00000345253.5_Silent_p.P143P|AKR1E2_ENST00000532248.1_Silent_p.P143P|AKR1E2_ENST00000334019.4_Silent_p.P143P	NM_001040177.2	NP_001035267.1	Q96JD6	AKCL2_HUMAN	aldo-keto reductase family 1, member E2	143						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	1,5-anhydro-D-fructose reductase activity (GO:0050571)	p.P143P(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)	15						TGGTTATTCCCAGTGACACGG	0.567																																					NSCLC(43;343 1097 20371 28813 45509)	NSCLC(43;343 1097 20371 28813 45509)	uc001ihi.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(427-429)CCC>CCG		aldo-keto reductase family 1, member E2							130.0	98.0	109.0					10																	4877971		2203	4300	6503	SO:0001819	synonymous_variant	83592					cytoplasm	1,5-anhydro-D-fructose reductase activity	g.chr10:4877971C>G	AB040820	CCDS31134.1, CCDS59210.1, CCDS59209.1	10p15.2	2009-09-09	2009-09-09	2009-09-09	ENSG00000165568	ENSG00000165568		"""Aldo-keto reductases"""	23437	protein-coding gene	gene with protein product			"""aldo-keto reductase family 1, member C-like 2"""	AKRDC1, AKR1CL2			Standard	NM_001271021		Approved	MGC10612	uc001ihi.4	Q96JD6	OTTHUMG00000017577	ENST00000298375.7:c.429C>G	10.37:g.4877971C>G			Somatic				AKR1E2_uc001ihl.1_RNA|AKR1E2_uc010qam.1_Silent_p.P104P|AKR1E2_uc001ihh.1_Silent_p.P143P|AKR1E2_uc009xhw.2_Silent_p.P143P|AKR1E2_uc001ihj.2_RNA|AKR1E2_uc001ihk.2_Silent_p.P143P	p.P143P	NM_001040177	NP_001035267	WXS	Illumina HiSeq	Unspecified	Q96JD6	AKCL2_HUMAN			4	544	+			143					Q86Z16|Q86Z17|Q86Z18|Q9BU71	Silent	SNP	ENST00000298375.7	37	c.429C>G	CCDS31134.1																																																																																				0.567	AKR1E2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046520.4	NM_031436		7	41	0	0	0	0.00308	0	7	41				
ANKRD26	22852	broad.mit.edu	37	10	27329051	27329051	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:27329051C>T	ENST00000376087.4	-	21	2383	c.2218G>A	c.(2218-2220)Gaa>Aaa	p.E740K	ANKRD26_ENST00000436985.2_Missense_Mutation_p.E756K|ANKRD26_ENST00000376070.3_Missense_Mutation_p.E297K	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	739					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)		p.E740K(1)		breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TTTTTAAGTTCTAATAATCTT	0.299																																							uc001ith.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						c.(2215-2217)GAA>AAA		ankyrin repeat domain 26							70.0	61.0	64.0					10																	27329051		1798	4067	5865	SO:0001583	missense	22852					centrosome		g.chr10:27329051C>T	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.2218G>A	10.37:g.27329051C>T	ENSP00000365255:p.Glu740Lys		Somatic				ANKRD26_uc001itg.2_Missense_Mutation_p.E426K|ANKRD26_uc009xku.1_Missense_Mutation_p.E740K	p.E739K	NM_014915	NP_055730	WXS	Illumina HiSeq	Unspecified	Q9UPS8	ANR26_HUMAN			21	2387	-			739					A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	c.2215G>A	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.327292	0.60743	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	T;T;T	0.15603	2.41;2.41;2.41	5.18	3.34	0.38264	.	0.112714	0.37669	N	0.001994	T	0.28995	0.0720	L	0.51422	1.61	0.09310	N	1	P;P;D	0.63880	0.873;0.799;0.993	B;B;D	0.72625	0.319;0.17;0.978	T	0.04373	-1.0956	10	0.45353	T	0.12	.	5.7441	0.18110	0.0:0.6647:0.1599:0.1754	.	740;739;756	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	K	297;740;756	ENSP00000365238:E297K;ENSP00000365255:E740K;ENSP00000405112:E756K	ENSP00000365238:E297K	E	-	1	0	ANKRD26	27369057	0.999000	0.42202	0.019000	0.16419	0.960000	0.62799	0.778000	0.26732	0.683000	0.31428	0.585000	0.79938	GAA		0.299	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1			10	32	0	0	0	0.006214	0	10	32				
SLC35G1	159371	broad.mit.edu	37	10	95660511	95660511	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:95660511C>T	ENST00000427197.1	+	3	423	c.362C>T	c.(361-363)aCt>aTt	p.T121I	SLC35G1_ENST00000371408.3_Missense_Mutation_p.T120I	NM_001134658.1|NM_153226.2	NP_001128130.1|NP_694958.1	Q2M3R5	S35G1_HUMAN	solute carrier family 35, member G1	121	EamA 1.				calcium ion export from cell (GO:1990034)|cytosolic calcium ion homeostasis (GO:0051480)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T120I(1)									ATTTACAGAACTGGGTTTATA	0.294																																							uc001kjg.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(361-363)ACT>ATT		transmembrane protein 20 isoform 1							66.0	65.0	66.0					10																	95660511		2203	4299	6502	SO:0001583	missense	159371					integral to membrane		g.chr10:95660511C>T	AK091309	CCDS7432.1, CCDS44459.1	10q23.33	2013-05-22	2011-08-03	2011-08-03	ENSG00000176273	ENSG00000176273		"""Solute carriers"""	26607	protein-coding gene	gene with protein product			"""transmembrane protein 20"""	TMEM20		21569384	Standard	NM_153226		Approved	FLJ33990, C10orf60	uc001kjg.2	Q2M3R5	OTTHUMG00000018779	ENST00000427197.1:c.362C>T	10.37:g.95660511C>T	ENSP00000400932:p.Thr121Ile		Somatic				TMEM20_uc001kji.2_Intron|TMEM20_uc001kjf.1_Missense_Mutation_p.T120I|TMEM20_uc001kjh.2_Intron|TMEM20_uc010qnw.1_Missense_Mutation_p.T104I|TMEM20_uc001kjj.2_Intron	p.T121I	NM_001134658	NP_001128130	WXS	Illumina HiSeq	Unspecified	Q2M3R5	TMM20_HUMAN		STAD - Stomach adenocarcinoma(243;0.00345)	3	423	+		Colorectal(252;3.46e-05)|Renal(717;0.018)|Ovarian(717;0.0228)|all_hematologic(284;0.189)	121			DUF6 1.		Q86YG5|Q8NBA5	Missense_Mutation	SNP	ENST00000427197.1	37	c.362C>T	CCDS44459.1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.779785	0.49891	.	.	ENSG00000176273	ENST00000371408;ENST00000427197	T;T	0.68765	-0.35;-0.35	5.95	5.04	0.67666	.	0.092180	0.85682	D	0.000000	T	0.56673	0.2001	N	0.19112	0.55	0.48975	D	0.999736	B;B;B	0.23249	0.082;0.024;0.011	B;B;B	0.30716	0.119;0.053;0.012	T	0.52245	-0.8601	10	0.35671	T	0.21	.	17.2273	0.86974	0.0:0.874:0.126:0.0	.	104;121;120	B7ZKP0;Q2M3R5;Q2M3R5-2	.;S35G1_HUMAN;.	I	120;121	ENSP00000360462:T120I;ENSP00000400932:T121I	ENSP00000360462:T120I	T	+	2	0	SLC35G1	95650501	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.442000	0.66575	1.512000	0.48834	0.650000	0.86243	ACT		0.294	SLC35G1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_153226		7	52	0	0	0	0.001984	0	7	52				
PDZD7	79955	broad.mit.edu	37	10	102782064	102782064	+	Silent	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:102782064G>A	ENST00000370215.3	-	5	846	c.621C>T	c.(619-621)gtC>gtT	p.V207V		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	207						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.V207V(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CGATGCGCCGGACACCATCTT	0.592																																							uc001kso.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(619-621)GTC>GTT		PDZ domain containing 7							138.0	123.0	128.0					10																	102782064		2203	4300	6503	SO:0001819	synonymous_variant	79955					cilium|nucleus	protein binding	g.chr10:102782064G>A	AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.621C>T	10.37:g.102782064G>A			Somatic				PDZD7_uc001ksn.2_Silent_p.V207V	p.V207V	NM_024895	NP_079171	WXS	Illumina HiSeq	Unspecified	Q9H5P4	PDZD7_HUMAN		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)	5	836	-			207					D5FJ77|Q8N321	Silent	SNP	ENST00000370215.3	37	c.621C>T	CCDS31269.1																																																																																				0.592	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895		4	32	0	0	0	0.014758	0	4	32				
WDR11	55717	broad.mit.edu	37	10	122622304	122622304	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:122622304C>T	ENST00000263461.6	+	5	830	c.584C>T	c.(583-585)tCa>tTa	p.S195L		NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.S195L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						AAGCCTCCCTCAGGCCCTGGG	0.443																																							uc010qtf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(583-585)TCA>TTA		bromodomain and WD repeat domain containing 2							132.0	147.0	142.0					10																	122622304		2203	4300	6503	SO:0001583	missense	55717					integral to membrane		g.chr10:122622304C>T	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.584C>T	10.37:g.122622304C>T	ENSP00000263461:p.Ser195Leu		Somatic				WDR11_uc010qte.1_Intron|WDR11_uc001lfd.1_5'UTR	p.S195L	NM_018117	NP_060587	WXS	Illumina HiSeq	Unspecified	Q9BZH6	WDR11_HUMAN			5	822	+			195					A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000263461.6	37	c.584C>T	CCDS7619.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331018	0.60853	.	.	ENSG00000120008	ENST00000263461	T	0.28255	1.62	6.08	6.08	0.98989	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.313343	0.39544	N	0.001323	T	0.28995	0.0720	L	0.46157	1.445	0.36724	D	0.881339	B	0.17038	0.02	B	0.11329	0.006	T	0.11084	-1.0602	10	0.27785	T	0.31	-13.4102	14.7703	0.69671	0.0:0.9316:0.0:0.0684	.	195	Q9BZH6	WDR11_HUMAN	L	195	ENSP00000263461:S195L	ENSP00000263461:S195L	S	+	2	0	WDR11	122612294	0.998000	0.40836	0.969000	0.41365	0.994000	0.84299	3.898000	0.56281	2.894000	0.99253	0.655000	0.94253	TCA		0.443	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2			7	145	0	0	0	0.004482	0	7	145				
C10orf90	118611	broad.mit.edu	37	10	128193152	128193152	+	Missense_Mutation	SNP	C	C	T	rs148312578		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:128193152C>T	ENST00000284694.7	-	3	737	c.617G>A	c.(616-618)cGg>cAg	p.R206Q	C10orf90_ENST00000544758.1_Missense_Mutation_p.R303Q|C10orf90_ENST00000392694.1_Missense_Mutation_p.R159Q|C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000454341.1_Missense_Mutation_p.R206Q|C10orf90_ENST00000356858.3_Missense_Mutation_p.R159Q	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	206	Required for interaction with HDAC1. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.R206Q(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		AACCTTCAGCCGCACCACGGA	0.592											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001ljq.2		NA																	1	Substitution - Missense(1)	p.R206W(1)	lung(1)	ovary(1)|skin(1)	2						c.(616-618)CGG>CAG		hypothetical protein LOC118611		C	GLN/ARG	2,4404	2.1+/-5.4	0,2,2201	61.0	65.0	63.0		617	0.8	0.0	10	dbSNP_134	63	0,8600		0,0,4300	no	missense	C10orf90	NM_001004298.2	43	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	206/700	128193152	2,13004	2203	4300	6503	SO:0001583	missense	118611							g.chr10:128193152C>T	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.617G>A	10.37:g.128193152C>T	ENSP00000284694:p.Arg206Gln		Somatic	OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1563	C10orf90_uc001ljp.2_Missense_Mutation_p.R159Q|C10orf90_uc010qum.1_Missense_Mutation_p.R303Q|C10orf90_uc009yao.2_Missense_Mutation_p.R303Q|C10orf90_uc001ljs.1_Missense_Mutation_p.R159Q	p.R206Q	NM_001004298	NP_001004298	WXS	Illumina HiSeq	Unspecified	Q96M02	CJ090_HUMAN		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)	3	738	-		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)	206					B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	37	c.617G>A	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.907915	0.52333	4.54E-4	0.0	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642;ENST00000368674;ENST00000392694	T;T;T;T;T	0.22945	2.25;2.25;2.25;2.25;1.93	5.0	0.768	0.18487	.	1.379320	0.04752	N	0.424718	T	0.34948	0.0915	L	0.43152	1.355	0.09310	N	1	D;D;D;D;B	0.71674	0.993;0.993;0.998;0.992;0.221	P;P;P;P;B	0.55667	0.588;0.588;0.781;0.579;0.035	T	0.28933	-1.0028	10	0.39692	T	0.17	-1.055	8.0638	0.30648	0.0:0.3914:0.5148:0.0938	.	303;303;159;206;206	F5GZL2;B4DMQ6;Q5T024;Q96M02;Q96M02-2	.;.;.;CJ090_HUMAN;.	Q	159;206;206;303;206;159;159	ENSP00000284694:R206Q;ENSP00000398786:R206Q;ENSP00000444369:R303Q;ENSP00000405995:R206Q;ENSP00000376459:R159Q	ENSP00000284694:R206Q	R	-	2	0	C10orf90	128183142	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.162000	0.10012	0.279000	0.22186	0.655000	0.94253	CGG		0.592	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298		12	76	0	0	0	0.010729	0	12	76				
ASCL3	56676	broad.mit.edu	37	11	8959615	8959615	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:8959615C>A	ENST00000531618.1	-	1	143	c.94G>T	c.(94-96)Gag>Tag	p.E32*	ASCL3_ENST00000325884.1_Nonsense_Mutation_p.E32*			Q9NQ33	ASCL3_HUMAN	achaete-scute family bHLH transcription factor 3	31					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)	p.E32*(1)		breast(1)|large_intestine(2)|lung(5)|stomach(1)	9				Epithelial(150;1.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0228)		ACCATGGGCTCCAGATAGAAG	0.547																																							uc001mhd.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(94-96)GAG>TAG		ASCL3							163.0	175.0	171.0					11																	8959615		2201	4296	6497	SO:0001587	stop_gained	56676				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleolus	DNA binding	g.chr11:8959615C>A	AJ400877	CCDS7795.1	11p15.3	2013-10-17	2013-10-17			ENSG00000176009		"""Basic helix-loop-helix proteins"""	740	protein-coding gene	gene with protein product		609154	"""achaete-scute complex (Drosophila) homolog-like 3"", ""achaete-scute complex homolog 3 (Drosophila)"""			11528127	Standard	NM_020646		Approved	bHLHa42, HASH3, Sgn1	uc001mhd.1	Q9NQ33	OTTHUMG00000165679	ENST00000531618.1:c.94G>T	11.37:g.8959615C>A	ENSP00000435770:p.Glu32*		Somatic					p.E32*	NM_020646	NP_065697	WXS	Illumina HiSeq	Unspecified	Q9NQ33	ASCL3_HUMAN		Epithelial(150;1.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0228)	2	154	-			31					Q8WYQ6	Nonsense_Mutation	SNP	ENST00000531618.1	37	c.94G>T	CCDS7795.1	.	.	.	.	.	.	.	.	.	.	C	32	5.152947	0.94645	.	.	ENSG00000176009	ENST00000325884;ENST00000531618	.	.	.	5.72	5.72	0.89469	.	0.336529	0.25750	N	0.028549	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-21.597	18.0634	0.89384	0.0:1.0:0.0:0.0	.	.	.	.	X	32	.	ENSP00000318846:E32X	E	-	1	0	ASCL3	8916191	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.219000	0.51200	2.717000	0.92951	0.650000	0.86243	GAG		0.547	ASCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385773.1			7	119	1	0	1.12685e-05	0.004482	1.23023e-05	7	119				
RAG1	5896	broad.mit.edu	37	11	36596221	36596221	+	Missense_Mutation	SNP	C	C	T	rs201779957		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:36596221C>T	ENST00000299440.5	+	2	1479	c.1367C>T	c.(1366-1368)gCc>gTc	p.A456V		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	456					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A456V(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				GAGCTGGAGGCCATCATGCAG	0.557									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	uc001mwu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5						c.(1366-1368)GCC>GTC		recombination activating gene 1							71.0	65.0	67.0					11																	36596221		2202	4298	6500	SO:0001583	missense	5896	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:36596221C>T	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.1367C>T	11.37:g.36596221C>T	ENSP00000299440:p.Ala456Val		Somatic				RAG1_uc001mwt.2_RNA	p.A456V	NM_000448	NP_000439	WXS	Illumina HiSeq	Unspecified	P15918	RAG1_HUMAN			2	1491	+	all_lung(20;0.226)	all_hematologic(20;0.107)	456			NBD.		E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	37	c.1367C>T	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744474	0.89663	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	T;T	0.71934	-0.61;-0.6	5.58	5.58	0.84498	RAG nonamer-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.85504	0.5712	M	0.80982	2.52	0.80722	D	1	D	0.71674	0.998	D	0.72625	0.978	D	0.86848	0.2021	10	0.87932	D	0	.	19.6271	0.95682	0.0:1.0:0.0:0.0	.	456	P15918	RAG1_HUMAN	V	456	ENSP00000434610:A456V;ENSP00000299440:A456V	ENSP00000299440:A456V	A	+	2	0	RAG1	36552797	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	2.649000	0.89929	0.650000	0.86243	GCC		0.557	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448		8	46	0	0	0	0.00308	0	8	46				
LRRC4C	57689	broad.mit.edu	37	11	40136625	40136625	+	Silent	SNP	G	G	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:40136625G>T	ENST00000278198.2	-	2	3181	c.1218C>A	c.(1216-1218)ctC>ctA	p.L406L	LRRC4C_ENST00000527150.1_Silent_p.L406L|LRRC4C_ENST00000530763.1_Silent_p.L406L|LRRC4C_ENST00000528697.1_Silent_p.L406L			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	406	Ig-like C2-type.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.L406L(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TACCATCACTGAGCACAGCTA	0.448																																							uc001mxa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(3)|central_nervous_system(1)	8						c.(1216-1218)CTC>CTA		netrin-G1 ligand precursor							208.0	179.0	189.0					11																	40136625		2203	4300	6503	SO:0001819	synonymous_variant	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136625G>T	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1218C>A	11.37:g.40136625G>T			Somatic				LRRC4C_uc001mxc.1_Silent_p.L402L|LRRC4C_uc001mxd.1_Silent_p.L402L|LRRC4C_uc001mxb.1_Silent_p.L402L	p.L406L	NM_020929	NP_065980	WXS	Illumina HiSeq	Unspecified	Q9HCJ2	LRC4C_HUMAN			2	3182	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	406			Ig-like C2-type.		A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	37	c.1218C>A	CCDS31464.1																																																																																				0.448	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		23	111	1	0	1.1804e-14	0.021523	1.37713e-14	23	111				
OR8H3	390152	broad.mit.edu	37	11	55890333	55890333	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:55890333C>A	ENST00000313472.3	+	1	485	c.485C>A	c.(484-486)tCc>tAc	p.S162Y		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S162Y(1)|p.S162F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					AATGTGGTTTCCATGAGCAGA	0.438																																							uc001nii.1		NA																	2	Substitution - Missense(2)		lung(1)|skin(1)	ovary(2)	2						c.(484-486)TCC>TAC		olfactory receptor, family 8, subfamily H,							238.0	211.0	221.0					11																	55890333		2201	4296	6497	SO:0001583	missense	390152				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55890333C>A	AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.485C>A	11.37:g.55890333C>A	ENSP00000323928:p.Ser162Tyr		Somatic					p.S162Y	NM_001005201	NP_001005201	WXS	Illumina HiSeq	Unspecified	Q8N146	OR8H3_HUMAN			1	485	+	Esophageal squamous(21;0.00693)		162			Extracellular (Potential).		Q6IFB7	Missense_Mutation	SNP	ENST00000313472.3	37	c.485C>A	CCDS31519.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.029614	0.00041	.	.	ENSG00000181761	ENST00000313472	T	0.00107	8.72	3.62	-7.21	0.01490	GPCR, rhodopsin-like superfamily (1);	0.596206	0.16347	N	0.218385	T	0.00073	0.0002	N	0.21373	0.66	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.50381	-0.8835	10	0.02654	T	1	.	1.7399	0.02950	0.1303:0.2854:0.1446:0.4398	.	162	Q8N146	OR8H3_HUMAN	Y	162	ENSP00000323928:S162Y	ENSP00000323928:S162Y	S	+	2	0	OR8H3	55646909	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.028000	0.12350	-0.801000	0.04427	-1.402000	0.01139	TCC		0.438	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201		34	155	1	0	1.36615e-20	0.013726	1.62571e-20	34	155				
OR5A1	219982	broad.mit.edu	37	11	59211414	59211414	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:59211414C>T	ENST00000302030.2	+	1	798	c.773C>T	c.(772-774)gCc>gTc	p.A258V		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A258V(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						TTTGGGACAGCCCTTTTCGTG	0.552																																							uc001nnx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(772-774)GCC>GTC		olfactory receptor, family 5, subfamily A,							280.0	226.0	244.0					11																	59211414		2201	4295	6496	SO:0001583	missense	219982				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59211414C>T	AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.773C>T	11.37:g.59211414C>T	ENSP00000303096:p.Ala258Val		Somatic					p.A258V	NM_001004728	NP_001004728	WXS	Illumina HiSeq	Unspecified	Q8NGJ0	OR5A1_HUMAN			1	773	+			258			Helical; Name=6; (Potential).		B9EH58|Q6IFF2|Q96RB1	Missense_Mutation	SNP	ENST00000302030.2	37	c.773C>T	CCDS31561.1	.	.	.	.	.	.	.	.	.	.	C	9.366	1.069184	0.20147	.	.	ENSG00000172320	ENST00000302030	T	0.00123	8.7	5.98	4.11	0.48088	GPCR, rhodopsin-like superfamily (1);	0.126147	0.35970	N	0.002862	T	0.00073	0.0002	N	0.05441	-0.05	0.19775	N	0.999953	P	0.38473	0.633	B	0.39971	0.315	T	0.35699	-0.9778	10	0.14656	T	0.56	-16.4484	9.6756	0.40039	0.0:0.6567:0.2702:0.0731	.	258	Q8NGJ0	OR5A1_HUMAN	V	258	ENSP00000303096:A258V	ENSP00000303096:A258V	A	+	2	0	OR5A1	58967990	0.000000	0.05858	0.852000	0.33557	0.853000	0.48598	-0.330000	0.07925	1.533000	0.49186	0.650000	0.86243	GCC		0.552	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394233.1	NM_001004728		30	156	0	0	0	0.009535	0	30	156				
ARAP1	116985	broad.mit.edu	37	11	72412759	72412759	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:72412759T>G	ENST00000393609.3	-	16	2439	c.2237A>C	c.(2236-2238)cAc>cCc	p.H746P	ARAP1_ENST00000393605.3_Missense_Mutation_p.H506P|ARAP1_ENST00000359373.5_Missense_Mutation_p.H746P|ARAP1_ENST00000495878.1_5'Flank|ARAP1_ENST00000426523.1_Missense_Mutation_p.H501P|ARAP1_ENST00000334211.8_Missense_Mutation_p.H501P|ARAP1-AS2_ENST00000500163.2_RNA|ARAP1_ENST00000455638.2_Missense_Mutation_p.H746P|ARAP1_ENST00000429686.1_Missense_Mutation_p.H440P	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	746	PH 3. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.H506P(1)|p.H746P(1)		cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GAAGCCACTGTGGCTCACGGT	0.617																																					Ovarian(102;1198 1520 13195 17913 37529)	Ovarian(102;1198 1520 13195 17913 37529)	uc001osu.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(2236-2238)CAC>CCC		ArfGAP with RhoGAP domain, ankyrin repeat and PH							184.0	187.0	186.0					11																	72412759		2200	4293	6493	SO:0001583	missense	116985				actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding	g.chr11:72412759T>G	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.2237A>C	11.37:g.72412759T>G	ENSP00000377233:p.His746Pro		Somatic				ARAP1_uc001osv.2_Missense_Mutation_p.H746P|ARAP1_uc001osr.2_Missense_Mutation_p.H506P|ARAP1_uc001oss.2_Missense_Mutation_p.H501P|ARAP1_uc009yth.2_Missense_Mutation_p.H440P|ARAP1_uc010rre.1_Missense_Mutation_p.H501P|ARAP1_uc001osw.1_Missense_Mutation_p.H34P	p.H746P	NM_001040118	NP_001035207	WXS	Illumina HiSeq	Unspecified	Q96P48	ARAP1_HUMAN			16	2426	-			746			PH 3.		A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	c.2237A>C	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.378178	0.82682	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000427971;ENST00000452383;ENST00000340247	T;T;T;T;T;T;T;T;T	0.12255	2.7;2.7;2.7;2.7;2.7;2.7;2.7;2.7;2.7	5.57	5.57	0.84162	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.119726	0.56097	D	0.000029	T	0.33469	0.0864	M	0.62723	1.935	0.39326	D	0.965328	P;D;D;D;P	0.76494	0.953;0.999;0.988;0.983;0.942	P;D;P;P;P	0.68621	0.864;0.959;0.642;0.808;0.786	T	0.05468	-1.0883	10	0.48119	T	0.1	.	14.5616	0.68140	0.0:0.0:0.0:1.0	.	501;440;746;746;506	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	P	746;746;506;501;746;501;440;34;34;535	ENSP00000352332:H746P;ENSP00000390461:H746P;ENSP00000377230:H506P;ENSP00000335506:H501P;ENSP00000377233:H746P;ENSP00000392264:H501P;ENSP00000403127:H440P;ENSP00000411452:H34P;ENSP00000399118:H34P	ENSP00000335506:H501P	H	-	2	0	ARAP1	72090407	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.077000	0.64419	2.114000	0.64651	0.455000	0.32223	CAC		0.617	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118		37	159	0	0	0	0.009718	0	37	159				
P2RY6	5031	broad.mit.edu	37	11	73007896	73007896	+	Silent	SNP	C	C	T	rs567246681		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:73007896C>T	ENST00000393590.2	+	2	632	c.333C>T	c.(331-333)caC>caT	p.H111H	P2RY6_ENST00000540342.1_Silent_p.H111H|P2RY6_ENST00000393591.1_Silent_p.H111H|P2RY6_ENST00000393592.2_Silent_p.H111H|P2RY6_ENST00000349767.2_Silent_p.H111H|P2RY6_ENST00000540124.1_Silent_p.H111H|P2RY6_ENST00000542092.1_Silent_p.H111H|P2RY6_ENST00000538328.1_Silent_p.H111H	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	111					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)	p.H111H(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						CCAACCTGCACGGCAGCATCC	0.647																																							uc001otm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(331-333)CAC>CAT		pyrimidinergic receptor P2Y6							112.0	103.0	106.0					11																	73007896		2200	4293	6493	SO:0001819	synonymous_variant	5031				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr11:73007896C>T		CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.333C>T	11.37:g.73007896C>T			Somatic				P2RY6_uc001otn.2_Silent_p.H111H|P2RY6_uc001oto.2_Silent_p.H111H|P2RY6_uc001otp.2_Silent_p.H111H|P2RY6_uc001otq.2_Silent_p.H111H|P2RY6_uc001otr.2_Silent_p.H111H|P2RY6_uc001ots.2_Silent_p.H111H	p.H111H	NM_176796	NP_789766	WXS	Illumina HiSeq	Unspecified	Q15077	P2RY6_HUMAN			4	738	+			111			Helical; Name=3; (Potential).		Q15754	Silent	SNP	ENST00000393590.2	37	c.333C>T	CCDS8220.1																																																																																				0.647	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397349.1			14	106	0	0	0	0.004007	0	14	106				
KRT1	3848	broad.mit.edu	37	12	53074043	53074043	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:53074043C>T	ENST00000252244.3	-	1	148	c.90G>A	c.(88-90)agG>agA	p.R30R		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	30	Gly/Phe/Ser-rich.|Head.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.R30R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						TGCTGGTGGTCCTGCGCTGGT	0.562																																							uc001sau.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(88-90)AGG>AGA		keratin 1							75.0	81.0	79.0					12																	53074043		2203	4300	6503	SO:0001819	synonymous_variant	3848				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding	g.chr12:53074043C>T	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.90G>A	12.37:g.53074043C>T			Somatic				KRT1_uc001sav.1_Silent_p.R30R	p.R30R	NM_006121	NP_006112	WXS	Illumina HiSeq	Unspecified	P04264	K2C1_HUMAN			1	149	-			30			Head.|Gly/Phe/Ser-rich.		B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	ENST00000252244.3	37	c.90G>A	CCDS8836.1																																																																																				0.562	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121		6	38	0	0	0	0.001984	0	6	38				
HNRNPA1	3178	broad.mit.edu	37	12	54675629	54675629	+	Silent	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:54675629A>G	ENST00000340913.6	+	3	236	c.183A>G	c.(181-183)acA>acG	p.T61T	HNRNPA1_ENST00000547276.1_Silent_p.T61T|RP11-968A15.8_ENST00000553061.1_RNA|RP11-968A15.2_ENST00000547177.1_RNA|HNRNPA1_ENST00000330752.8_Silent_p.T61T|HNRNPA1_ENST00000546500.1_Silent_p.T61T|CBX5_ENST00000209875.4_5'Flank	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	61	Globular A domain.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)	p.T61T(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						GGTTTGTCACATATGCCACTG	0.473																																					Colon(83;502 1289 8436 16406 24870)	Colon(83;502 1289 8436 16406 24870)	uc001sfl.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|ovary(1)	3						c.(181-183)ACA>ACG		heterogeneous nuclear ribonucleoprotein A1							44.0	44.0	44.0					12																	54675629		2044	4194	6238	SO:0001819	synonymous_variant	3178				interspecies interaction between organisms|mRNA transport|nuclear import	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|single-stranded DNA binding	g.chr12:54675629A>G	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.183A>G	12.37:g.54675629A>G			Somatic				CBX5_uc001sfk.3_5'Flank|CBX5_uc001sfi.3_5'Flank|HNRNPA1_uc001sfm.2_Silent_p.T61T|HNRNPA1_uc009zng.2_Silent_p.T61T|HNRNPA1_uc009znh.2_Silent_p.T61T|HNRNPA1_uc009zni.2_Silent_p.T61T|HNRNPA1_uc001sfn.2_Silent_p.T61T|HNRNPA1_uc001sfo.3_RNA|HNRNPA1_uc001sfp.1_Silent_p.T16T|HNRNPA1_uc009znj.1_Silent_p.T16T	p.T61T	NM_031157	NP_112420	WXS	Illumina HiSeq	Unspecified	P09651	ROA1_HUMAN			3	287	+			61			Globular A domain.|RRM 1.		A8K4Z8|Q3MIB7|Q6PJZ7	Silent	SNP	ENST00000340913.6	37	c.183A>G	CCDS44909.1																																																																																				0.473	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157		5	36	0	0	0	0.001168	0	5	36				
COQ10A	93058	broad.mit.edu	37	12	56664024	56664024	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:56664024C>T	ENST00000308197.5	+	5	928	c.667C>T	c.(667-669)Cgt>Tgt	p.R223C	COQ10A_ENST00000433805.2_Missense_Mutation_p.R191C|RP11-977G19.14_ENST00000546464.1_RNA|COQ10A_ENST00000546544.1_Missense_Mutation_p.R206C	NM_144576.3	NP_653177.3	Q96MF6	CQ10A_HUMAN	coenzyme Q10 homolog A (S. cerevisiae)	223						mitochondrial inner membrane (GO:0005743)		p.R223C(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	8						TGCCTTTGAGCGTCGGGCAGC	0.517																																							uc001sko.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(667-669)CGT>TGT		coenzyme Q10 homolog A isoform a							149.0	148.0	148.0					12																	56664024		2001	4162	6163	SO:0001583	missense	93058					mitochondrial inner membrane		g.chr12:56664024C>T	AK057003	CCDS41796.1, CCDS44921.1	12q13.3	2011-09-16	2006-04-04		ENSG00000135469	ENSG00000135469			26515	protein-coding gene	gene with protein product			"""coenzyme Q10 homolog A (yeast)"""				Standard	NM_144576		Approved	FLJ32452	uc001sko.4	Q96MF6	OTTHUMG00000170283	ENST00000308197.5:c.667C>T	12.37:g.56664024C>T	ENSP00000312587:p.Arg223Cys		Somatic				COQ10A_uc001skp.3_Missense_Mutation_p.R191C|COQ10A_uc001skq.3_Missense_Mutation_p.R206C	p.R223C	NM_144576	NP_653177	WXS	Illumina HiSeq	Unspecified	Q96MF6	CQ10A_HUMAN			5	928	+			223					Q6GMR6|Q6UWB9|Q86X16|Q8TAL2|Q96MF1|Q9BUP4	Missense_Mutation	SNP	ENST00000308197.5	37	c.667C>T	CCDS41796.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321789	0.60634	.	.	ENSG00000135469	ENST00000308197;ENST00000433805;ENST00000546544	T;T;T	0.25250	1.81;1.84;1.82	4.85	3.94	0.45596	START-like domain (1);	0.053659	0.85682	D	0.000000	T	0.46092	0.1375	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	0.999;0.998;1.0	P;P;P	0.61800	0.894;0.872;0.872	T	0.51926	-0.8643	10	0.87932	D	0	.	13.7477	0.62885	0.1555:0.8445:0.0:0.0	.	206;228;223	Q96MF6-2;Q8TAL2;Q96MF6	.;.;CQ10A_HUMAN	C	223;191;206	ENSP00000312587:R223C;ENSP00000407843:R191C;ENSP00000446723:R206C	ENSP00000312587:R223C	R	+	1	0	COQ10A	54950291	1.000000	0.71417	0.999000	0.59377	0.280000	0.26924	4.449000	0.60034	1.380000	0.46344	-0.181000	0.13052	CGT		0.517	COQ10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408332.1	NM_144576		4	113	0	0	0	0.009096	0	4	113				
MBD6	114785	broad.mit.edu	37	12	57919411	57919411	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:57919411C>T	ENST00000355673.3	+	6	1016	c.660C>T	c.(658-660)atC>atT	p.I220I	MBD6_ENST00000431731.2_Silent_p.I220I	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	220	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.I220I(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						CACCTGCTATCAGCCTCAATG	0.647																																							uc001soj.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(3)|ovary(1)	4						c.(658-660)ATC>ATT		methyl-CpG binding domain protein 6							95.0	106.0	102.0					12																	57919411		2203	4300	6503	SO:0001819	synonymous_variant	114785					chromosome|nucleus	chromatin binding|DNA binding	g.chr12:57919411C>T	AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.660C>T	12.37:g.57919411C>T			Somatic				MBD6_uc001sok.1_Silent_p.I87I|MBD6_uc001sol.1_5'Flank	p.I220I	NM_052897	NP_443129	WXS	Illumina HiSeq	Unspecified	Q96DN6	MBD6_HUMAN			6	884	+			220			Pro-rich.		Q8N3M0|Q8NA81|Q96Q00	Silent	SNP	ENST00000355673.3	37	c.660C>T	CCDS8944.1																																																																																				0.647	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1			6	162	0	0	0	0.001984	0	6	162				
NAV3	89795	broad.mit.edu	37	12	78516195	78516196	+	Missense_Mutation	DNP	AC	AC	TG			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	AC	AC	-	-	AC	AC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:78516195_78516196AC>TG	ENST00000397909.2	+	16	4398_4399	c.4225_4226AC>TG	c.(4225-4227)ACt>TGt	p.T1409C	NAV3_ENST00000266692.7_Intron|NAV3_ENST00000536525.2_Missense_Mutation_p.T1409C|NAV3_ENST00000228327.6_Missense_Mutation_p.T1409C			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1409	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.T1409C(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TGTGAGATCTACTCTCTCAGAA	0.525										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(4225-4227)ACT>TGT		neuron navigator 3																																				SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78516195_78516196AC>TG	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	Exception_encountered	12.37:g.78516195_78516196delinsTG	ENSP00000381007:p.Thr1409Cys	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.T1409C|NAV3_uc010sub.1_Missense_Mutation_p.T909C|NAV3_uc009zsf.2_Intron	p.T1409C	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			16	4398_4399	+			1409			Ser-rich.		Q8NFW7|Q9Y2E7	Missense_Mutation	DNP	ENST00000397909.2	37	c.4225_4226AC>TG																																																																																					0.525	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		18	45	0	0	0	0.004672	0	18	45				
LRRIQ1	84125	broad.mit.edu	37	12	85449827	85449827	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:85449827A>C	ENST00000393217.2	+	8	1317	c.1256A>C	c.(1255-1257)aAg>aCg	p.K419T		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	419								p.K419T(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TCAAATGATAAGGGTGATATA	0.318																																							uc001tac.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1255-1257)AAG>ACG		leucine-rich repeats and IQ motif containing 1							80.0	92.0	88.0					12																	85449827		2202	4294	6496	SO:0001583	missense	84125							g.chr12:85449827A>C	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1256A>C	12.37:g.85449827A>C	ENSP00000376910:p.Lys419Thr		Somatic				LRRIQ1_uc001tab.1_Missense_Mutation_p.K419T|LRRIQ1_uc001taa.1_Missense_Mutation_p.K394T	p.K419T	NM_001079910	NP_001073379	WXS	Illumina HiSeq	Unspecified	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	8	1367	+			419					Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	c.1256A>C	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	A	13.61	2.288938	0.40494	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.60672	0.17	4.65	3.47	0.39725	.	0.382752	0.25578	N	0.029711	T	0.51058	0.1652	L	0.53249	1.67	0.09310	N	1	B;D	0.53151	0.123;0.958	B;P	0.47015	0.05;0.534	T	0.52200	-0.8607	10	0.66056	D	0.02	.	2.527	0.04694	0.6085:0.1567:0.0842:0.1506	.	419;394	Q96JM4;C9JI57	LRIQ1_HUMAN;.	T	419;394;419	ENSP00000376910:K419T	ENSP00000256007:K419T	K	+	2	0	LRRIQ1	83973958	0.006000	0.16342	0.018000	0.16275	0.057000	0.15508	1.434000	0.34958	0.703000	0.31848	0.260000	0.18958	AAG		0.318	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		15	95	0	0	0	0.004007	0	15	95				
CMKLR1	1240	broad.mit.edu	37	12	108686166	108686166	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:108686166T>C	ENST00000312143.7	-	3	937	c.574A>G	c.(574-576)Aac>Gac	p.N192D	CMKLR1_ENST00000397688.2_Missense_Mutation_p.N190D|CMKLR1_ENST00000550402.1_Missense_Mutation_p.N192D|CMKLR1_ENST00000412676.1_Missense_Mutation_p.N192D|CMKLR1_ENST00000552995.1_Missense_Mutation_p.N190D	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	192					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.N190D(1)		endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						AGGCTGAAGTTGTTGAAGCAG	0.567																																							uc009zuw.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)|pancreas(1)	5						c.(574-576)AAC>GAC		chemokine-like receptor 1 isoform a							77.0	79.0	78.0					12																	108686166		2093	4207	6300	SO:0001583	missense	1240				chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity	g.chr12:108686166T>C	U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.574A>G	12.37:g.108686166T>C	ENSP00000311733:p.Asn192Asp		Somatic				CMKLR1_uc001tmw.2_Missense_Mutation_p.N192D|CMKLR1_uc001tmv.2_Missense_Mutation_p.N190D|CMKLR1_uc009zuv.2_Missense_Mutation_p.N192D	p.N192D	NM_001142345	NP_001135817	WXS	Illumina HiSeq	Unspecified	Q99788	CML1_HUMAN			3	765	-			192			Extracellular (Potential).		A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Missense_Mutation	SNP	ENST00000312143.7	37	c.574A>G	CCDS44965.1	.	.	.	.	.	.	.	.	.	.	t	18.23	3.579039	0.65878	.	.	ENSG00000174600	ENST00000312143;ENST00000412676;ENST00000397688;ENST00000552995;ENST00000550402	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.46	5.46	0.80206	GPCR, rhodopsin-like superfamily (1);	0.101891	0.64402	D	0.000003	T	0.44644	0.1303	L	0.35288	1.05	0.48901	D	0.999729	P	0.43701	0.815	P	0.54706	0.759	T	0.40421	-0.9564	10	0.62326	D	0.03	.	14.7521	0.69533	0.0:0.0:0.0:1.0	.	192	Q99788	CML1_HUMAN	D	192;192;190;190;192	ENSP00000311733:N192D;ENSP00000401293:N192D;ENSP00000380803:N190D;ENSP00000447579:N190D;ENSP00000449716:N192D	ENSP00000311733:N192D	N	-	1	0	CMKLR1	107210296	1.000000	0.71417	1.000000	0.80357	0.580000	0.36256	7.471000	0.80985	2.081000	0.62600	0.450000	0.29827	AAC		0.567	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404867.1			6	33	0	0	0	0.006214	0	6	33				
CMKLR1	1240	broad.mit.edu	37	12	108686195	108686195	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:108686195T>G	ENST00000312143.7	-	3	908	c.545A>C	c.(544-546)aAc>aCc	p.N182T	CMKLR1_ENST00000397688.2_Missense_Mutation_p.N180T|CMKLR1_ENST00000550402.1_Missense_Mutation_p.N182T|CMKLR1_ENST00000412676.1_Missense_Mutation_p.N182T|CMKLR1_ENST00000552995.1_Missense_Mutation_p.N180T	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	182					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.N180T(1)		endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						CCCATGCAGGTTGGCTGTGTC	0.562																																							uc009zuw.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)|pancreas(1)	5						c.(544-546)AAC>ACC		chemokine-like receptor 1 isoform a							82.0	83.0	83.0					12																	108686195		2077	4209	6286	SO:0001583	missense	1240				chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity	g.chr12:108686195T>G	U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.545A>C	12.37:g.108686195T>G	ENSP00000311733:p.Asn182Thr		Somatic				CMKLR1_uc001tmw.2_Missense_Mutation_p.N182T|CMKLR1_uc001tmv.2_Missense_Mutation_p.N180T|CMKLR1_uc009zuv.2_Missense_Mutation_p.N182T	p.N182T	NM_001142345	NP_001135817	WXS	Illumina HiSeq	Unspecified	Q99788	CML1_HUMAN			3	736	-			182			Extracellular (Potential).		A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Missense_Mutation	SNP	ENST00000312143.7	37	c.545A>C	CCDS44965.1	.	.	.	.	.	.	.	.	.	.	t	0	-2.769856	0.00081	.	.	ENSG00000174600	ENST00000312143;ENST00000412676;ENST00000397688;ENST00000552995;ENST00000550402	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	4.8	-1.04	0.10068	GPCR, rhodopsin-like superfamily (1);	2.250920	0.02878	U	0.132487	T	0.18045	0.0433	N	0.02751	-0.505	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.13361	-1.0512	10	0.16420	T	0.52	.	5.0166	0.14339	0.2446:0.1501:0.0:0.6052	.	182	Q99788	CML1_HUMAN	T	182;182;180;180;182	ENSP00000311733:N182T;ENSP00000401293:N182T;ENSP00000380803:N180T;ENSP00000447579:N180T;ENSP00000449716:N182T	ENSP00000311733:N182T	N	-	2	0	CMKLR1	107210325	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.037000	0.03557	0.006000	0.14734	0.454000	0.30748	AAC		0.562	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404867.1			5	29	0	0	0	0.001984	0	5	29				
CMKLR1	1240	broad.mit.edu	37	12	108686229	108686229	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:108686229T>G	ENST00000312143.7	-	3	874	c.511A>C	c.(511-513)Agt>Cgt	p.S171R	CMKLR1_ENST00000397688.2_Missense_Mutation_p.S169R|CMKLR1_ENST00000550402.1_Missense_Mutation_p.S171R|CMKLR1_ENST00000412676.1_Missense_Mutation_p.S171R|CMKLR1_ENST00000552995.1_Missense_Mutation_p.S169R	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	171					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.S169R(1)		endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						GATGGGGAACTCAAGAAGAAA	0.572																																							uc009zuw.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)|pancreas(1)	5						c.(511-513)AGT>CGT		chemokine-like receptor 1 isoform a							83.0	84.0	84.0					12																	108686229		2059	4225	6284	SO:0001583	missense	1240				chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity	g.chr12:108686229T>G	U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.511A>C	12.37:g.108686229T>G	ENSP00000311733:p.Ser171Arg		Somatic				CMKLR1_uc001tmw.2_Missense_Mutation_p.S171R|CMKLR1_uc001tmv.2_Missense_Mutation_p.S169R|CMKLR1_uc009zuv.2_Missense_Mutation_p.S171R	p.S171R	NM_001142345	NP_001135817	WXS	Illumina HiSeq	Unspecified	Q99788	CML1_HUMAN			3	702	-			171			Helical; Name=4; (Potential).		A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Missense_Mutation	SNP	ENST00000312143.7	37	c.511A>C	CCDS44965.1	.	.	.	.	.	.	.	.	.	.	t	19.89	3.910576	0.72983	.	.	ENSG00000174600	ENST00000312143;ENST00000412676;ENST00000397688;ENST00000552995;ENST00000550402	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.32	3.97	0.46021	GPCR, rhodopsin-like superfamily (1);	0.127596	0.64402	D	0.000001	T	0.70325	0.3211	H	0.94385	3.53	0.50813	D	0.999898	D	0.64830	0.994	D	0.71656	0.974	T	0.77536	-0.2551	10	0.62326	D	0.03	.	10.9562	0.47358	0.0:0.087:0.0:0.913	.	171	Q99788	CML1_HUMAN	R	171;171;169;169;171	ENSP00000311733:S171R;ENSP00000401293:S171R;ENSP00000380803:S169R;ENSP00000447579:S169R;ENSP00000449716:S171R	ENSP00000311733:S171R	S	-	1	0	CMKLR1	107210359	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	6.267000	0.72546	2.019000	0.59389	0.454000	0.30748	AGT		0.572	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404867.1			4	37	0	0	0	0.001168	0	4	37				
RPH3A	22895	broad.mit.edu	37	12	113319638	113319638	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:113319638C>G	ENST00000389385.4	+	15	1810	c.1313C>G	c.(1312-1314)cCg>cGg	p.P438R	RPH3A_ENST00000415485.3_Missense_Mutation_p.P438R|RPH3A_ENST00000543106.2_Missense_Mutation_p.P438R|RPH3A_ENST00000551052.1_Missense_Mutation_p.P434R|RPH3A_ENST00000447659.2_Missense_Mutation_p.P389R|RPH3A_ENST00000548866.1_Missense_Mutation_p.P389R|RPH3A_ENST00000420983.2_Missense_Mutation_p.P438R|RPH3A_ENST00000549913.2_3'UTR	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	438	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)	p.P434R(1)		breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		CACCTCCTGCCGGGAGCCAGC	0.592																																							uc010syl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)	7						c.(1312-1314)CCG>CGG		rabphilin 3A homolog isoform 1							90.0	84.0	86.0					12																	113319638		2203	4300	6503	SO:0001583	missense	22895				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding	g.chr12:113319638C>G	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1313C>G	12.37:g.113319638C>G	ENSP00000374036:p.Pro438Arg		Somatic				RPH3A_uc001ttz.2_Missense_Mutation_p.P438R|RPH3A_uc001tty.2_Missense_Mutation_p.P434R|RPH3A_uc009zwe.1_Missense_Mutation_p.P434R|RPH3A_uc010sym.1_Missense_Mutation_p.P389R|RPH3A_uc001tua.2_Missense_Mutation_p.P198R	p.P438R	NM_001143854	NP_001137326	WXS	Illumina HiSeq	Unspecified	Q9Y2J0	RP3A_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.00453)	15	1675	+			438			C2 1.		B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	c.1313C>G	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451315	0.84209	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983;ENST00000549913;ENST00000552755	T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53	5.19	5.19	0.71726	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000009	T	0.61627	0.2362	M	0.85373	2.75	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;1.0	T	0.68500	-0.5392	10	0.87932	D	0	.	17.5196	0.87783	0.0:1.0:0.0:0.0	.	389;438;438;434	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	R	438;438;389;434;438;389;438;90;90	ENSP00000440384:P438R;ENSP00000374036:P438R;ENSP00000413254:P389R;ENSP00000448297:P434R;ENSP00000405357:P438R;ENSP00000450347:P389R;ENSP00000408889:P438R	ENSP00000374036:P438R	P	+	2	0	RPH3A	111804021	1.000000	0.71417	0.987000	0.45799	0.988000	0.76386	7.463000	0.80869	2.426000	0.82243	0.561000	0.74099	CCG		0.592	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954		4	85	0	0	0	0.014758	0	4	85				
MYO16	23026	broad.mit.edu	37	13	109496821	109496821	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr13:109496821G>A	ENST00000357550.2	+	9	1203	c.1162G>A	c.(1162-1164)Ggt>Agt	p.G388S	MYO16_ENST00000251041.5_Missense_Mutation_p.G388S|MYO16_ENST00000356711.2_Missense_Mutation_p.G388S	NM_001198950.1	NP_001185879.1			myosin XVI									p.G388S(2)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CATGATGAGCGGTTCCACCAA	0.388																																							uc001vqt.1		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(1162-1164)GGT>AGT		myosin heavy chain Myr 8							115.0	110.0	112.0					13																	109496821		2203	4300	6503	SO:0001583	missense	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109496821G>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1162G>A	13.37:g.109496821G>A	ENSP00000350160:p.Gly388Ser		Somatic				MYO16_uc010agk.1_Missense_Mutation_p.G410S|MYO16_uc001vqu.1_Missense_Mutation_p.G188S	p.G388S	NM_015011	NP_055826	WXS	Illumina HiSeq	Unspecified	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		10	1288	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		388						Missense_Mutation	SNP	ENST00000357550.2	37	c.1162G>A	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	7.681	0.689009	0.14973	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857	D;D;D	0.95001	-3.58;-3.58;-3.58	5.31	2.37	0.29283	.	1.185740	0.06604	N	0.754448	D	0.87720	0.6248	N	0.17082	0.46	0.09310	N	1	B;B	0.26081	0.064;0.141	B;B	0.16722	0.016;0.007	T	0.75243	-0.3386	9	.	.	.	.	7.5986	0.28063	0.5586:0.0:0.4414:0.0	.	388;388	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	S	388;388;388;388;176	ENSP00000349145:G388S;ENSP00000350160:G388S;ENSP00000251041:G388S	.	G	+	1	0	MYO16	108294822	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.681000	0.25320	0.212000	0.20703	-0.145000	0.13849	GGT		0.388	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		7	43	0	0	0	0.004482	0	7	43				
DYNC1H1	1778	broad.mit.edu	37	14	102500313	102500313	+	Splice_Site	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr14:102500313G>C	ENST00000360184.4	+	55	10578	c.10414G>C	c.(10414-10416)Gta>Cta	p.V3472L	DYNC1H1_ENST00000556791.1_3'UTR|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3472	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.V3472L(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TTCCTTTTAGGTAAACCGGAG	0.453																																							uc001yks.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(10414-10416)GTA>CTA		cytoplasmic dynein 1 heavy chain 1							76.0	78.0	78.0					14																	102500313		2203	4300	6503	SO:0001630	splice_region_variant	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102500313G>C	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10414-1G>C	14.37:g.102500313G>C			Somatic					p.V3472L	NM_001376	NP_001367	WXS	Illumina HiSeq	Unspecified	Q14204	DYHC1_HUMAN			55	10578	+			3472			Stalk (By similarity).|Potential.		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	c.10414G>C	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.965983	0.74131	.	.	ENSG00000197102	ENST00000360184	T	0.74315	-0.83	5.72	4.83	0.62350	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.84192	0.5418	M	0.69185	2.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84576	0.0658	9	.	.	.	.	14.7791	0.69751	0.0692:0.0:0.9308:0.0	.	3472	Q14204	DYHC1_HUMAN	L	3472	ENSP00000348965:V3472L	.	V	+	1	0	DYNC1H1	101570066	1.000000	0.71417	0.998000	0.56505	0.361000	0.29550	9.755000	0.98912	1.554000	0.49487	0.655000	0.94253	GTA		0.453	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	Missense_Mutation	15	58	0	0	0	0.003163	0	15	58				
OR4N4	283694	broad.mit.edu	37	15	22382659	22382659	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr15:22382659C>T	ENST00000328795.4	+	1	278	c.187C>T	c.(187-189)Ctg>Ttg	p.L63L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L63L(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTATTTATTTCTGGGCAACTT	0.463																																							uc001yuc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(1)	5						c.(187-189)CTG>TTG		olfactory receptor, family 4, subfamily N,							136.0	139.0	138.0					15																	22382659		2201	4293	6494	SO:0001819	synonymous_variant	283694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22382659C>T	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.187C>T	15.37:g.22382659C>T			Somatic				LOC727924_uc001yub.1_RNA|OR4N4_uc010tzv.1_Silent_p.L63L	p.L63L	NM_001005241	NP_001005241	WXS	Illumina HiSeq	Unspecified	Q8N0Y3	OR4N4_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	7	1168	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	63			Helical; Name=2; (Potential).		Q6IEY3|Q6IF56	Silent	SNP	ENST00000328795.4	37	c.187C>T	CCDS32173.1																																																																																				0.463	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			27	268	0	0	0	0.005524	0	27	268				
BUB1B	701	broad.mit.edu	37	15	40500858	40500858	+	Missense_Mutation	SNP	G	G	A	rs557521971		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr15:40500858G>A	ENST00000287598.6	+	16	2225	c.2030G>A	c.(2029-2031)cGt>cAt	p.R677H	BUB1B_ENST00000412359.3_Missense_Mutation_p.R691H	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	677					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R677H(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		GAAGACAGTCGTGAAGCCACA	0.343			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome				G|||	1	0.000199681	0.0	0.0	5008	,	,		18325	0.0		0.0	False		,,,				2504	0.001						uc001zkx.3		NA	yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	Mis|N|F|S	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)			M		rhabdomyosarcoma			1	Substitution - Missense(1)		lung(1)	stomach(2)|ovary(1)|kidney(1)	4						c.(2029-2031)CGT>CAT		budding uninhibited by benzimidazoles 1 beta							57.0	50.0	53.0					15																	40500858		2203	4300	6503	SO:0001583	missense	701	Mosaic_Variegated_Aneuploidy_Syndrome	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr15:40500858G>A	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2030G>A	15.37:g.40500858G>A	ENSP00000287598:p.Arg677His		Somatic					p.R677H	NM_001211	NP_001202	WXS	Illumina HiSeq	Unspecified	O60566	BUB1B_HUMAN		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)	16	2242	+		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	677					B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	ENST00000287598.6	37	c.2030G>A	CCDS10053.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.763788	0.31228	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.14893	2.47;2.47	4.91	1.65	0.23941	.	0.851355	0.10322	N	0.688641	T	0.15262	0.0368	L	0.54323	1.7	0.24591	N	0.99382	B	0.09022	0.002	B	0.06405	0.002	T	0.30822	-0.9965	10	0.45353	T	0.12	0.9519	4.0471	0.09778	0.5997:0.0:0.2051:0.1952	.	677	O60566	BUB1B_HUMAN	H	677;691;560	ENSP00000287598:R677H;ENSP00000398470:R691H	ENSP00000287598:R677H	R	+	2	0	BUB1B	38288150	0.971000	0.33674	0.170000	0.22879	0.842000	0.47809	1.982000	0.40638	0.059000	0.16252	-0.145000	0.13849	CGT		0.343	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252122.4			5	34	0	0	0	0.001984	0	5	34				
TRAP1	10131	broad.mit.edu	37	16	3725361	3725361	+	Silent	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr16:3725361G>A	ENST00000246957.5	-	8	940	c.852C>T	c.(850-852)ccC>ccT	p.P284P	TRAP1_ENST00000575671.1_Silent_p.P75P|TRAP1_ENST00000573872.1_5'UTR|TRAP1_ENST00000538171.1_Silent_p.P231P	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	284					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)	p.P284P(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				TCAAGTACAAGGGGAAGCTGA	0.483																																							uc002cvt.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(850-852)CCC>CCT		TNF receptor-associated protein 1 precursor							174.0	127.0	143.0					16																	3725361		2197	4300	6497	SO:0001819	synonymous_variant	10131				cellular response to oxidative stress|protein folding	mitochondrion	ATP binding|tumor necrosis factor receptor binding|unfolded protein binding	g.chr16:3725361G>A	AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.852C>T	16.37:g.3725361G>A			Somatic				TRAP1_uc002cvs.2_Silent_p.P75P|TRAP1_uc010uxf.1_Silent_p.P231P	p.P284P	NM_016292	NP_057376	WXS	Illumina HiSeq	Unspecified	Q12931	TRAP1_HUMAN			8	941	-		Ovarian(90;0.0261)	284					B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Silent	SNP	ENST00000246957.5	37	c.852C>T	CCDS10508.1																																																																																				0.483	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251586.2	NM_016292		6	28	0	0	0	0.001984	0	6	28				
CREBBP	1387	broad.mit.edu	37	16	3817765	3817765	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr16:3817765C>T	ENST00000262367.5	-	16	4015	c.3206G>A	c.(3205-3207)gGc>gAc	p.G1069D	CREBBP_ENST00000382070.3_Missense_Mutation_p.G1031D	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1069					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.G1069D(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AGAGGCTGTGCCGTTACTGCT	0.428			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																uc002cvv.2		NA		Dom/Rec	yes		16	16p13.3	1387	T|N|F|Mis|O	CREB binding protein (CBP)	yes	Rubinstein-Taybi syndrome	L	MLL|MORF|RUNXBP2		ALL|AML|DLBCL|B-NHL 		1	Substitution - Missense(1)	p.G1069S(1)	lung(1)	haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127						c.(3205-3207)GGC>GAC		CREB binding protein isoform a							250.0	221.0	231.0					16																	3817765		2197	4300	6497	SO:0001583	missense	1387	Rubinstein-Taybsyndrome			cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	g.chr16:3817765C>T	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3206G>A	16.37:g.3817765C>T	ENSP00000262367:p.Gly1069Asp		Somatic				CREBBP_uc002cvw.2_Missense_Mutation_p.G1031D	p.G1069D	NM_004380	NP_004371	WXS	Illumina HiSeq	Unspecified	Q92793	CBP_HUMAN		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)	16	3410	-		Ovarian(90;0.0266)	1069					D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	c.3206G>A	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.360463	0.24598	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.83837	-1.77;-1.71	5.61	4.65	0.58169	Bromodomain (1);	0.225081	0.39544	N	0.001321	T	0.73353	0.3576	L	0.38175	1.15	0.50467	D	0.999877	P;P	0.37061	0.58;0.58	B;B	0.37601	0.254;0.254	T	0.68334	-0.5436	10	0.11794	T	0.64	-6.8333	11.3701	0.49694	0.0:0.8586:0.0:0.1414	.	1099;1069	Q4LE28;Q92793	.;CBP_HUMAN	D	1069;1099;1031	ENSP00000262367:G1069D;ENSP00000371502:G1031D	ENSP00000262367:G1069D	G	-	2	0	CREBBP	3757766	0.003000	0.15002	0.111000	0.21465	0.344000	0.29017	1.670000	0.37502	1.481000	0.48307	0.655000	0.94253	GGC		0.428	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		4	113	0	0	0	0.009096	0	4	113				
MMP2	4313	broad.mit.edu	37	16	55522477	55522477	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr16:55522477C>G	ENST00000219070.4	+	6	1364	c.855C>G	c.(853-855)aaC>aaG	p.N285K	MMP2_ENST00000543485.1_Missense_Mutation_p.N209K|MMP2_ENST00000437642.2_Missense_Mutation_p.N235K|MMP2_ENST00000570308.1_Missense_Mutation_p.N209K	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	285	Collagen-binding.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.N285K(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	TGGGCGGCAACGCTGAAGGAC	0.622																																							uc002ehz.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11						c.(853-855)AAC>AAG		matrix metalloproteinase 2 isoform a	Marimastat(DB00786)|Sulindac(DB00605)						72.0	57.0	62.0					16																	55522477		2198	4300	6498	SO:0001583	missense	4313				angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding	g.chr16:55522477C>G		CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.855C>G	16.37:g.55522477C>G	ENSP00000219070:p.Asn285Lys		Somatic				MMP2_uc010vhd.1_Missense_Mutation_p.N209K|MMP2_uc010ccc.2_Missense_Mutation_p.N235K	p.N285K	NM_004530	NP_004521	WXS	Illumina HiSeq	Unspecified	P08253	MMP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	6	1166	+		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)	285			Collagen-binding.		B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	ENST00000219070.4	37	c.855C>G	CCDS10752.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.403932	0.42613	.	.	ENSG00000087245	ENST00000219070;ENST00000543485;ENST00000437642	T;T;T	0.10382	2.88;2.88;2.88	4.93	-8.02	0.01118	Peptidase M10, metallopeptidase (1);Fibronectin, type II, collagen-binding (2);Kringle-like fold (1);Peptidase, metallopeptidase (1);	0.095189	0.64402	D	0.000001	T	0.28067	0.0692	M	0.78801	2.425	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.52845	-0.8521	10	0.87932	D	0	.	17.6689	0.88211	0.0:0.1834:0.0:0.8166	.	235;285	E9PE45;P08253	.;MMP2_HUMAN	K	285;209;235	ENSP00000219070:N285K;ENSP00000444143:N209K;ENSP00000394237:N235K	ENSP00000219070:N285K	N	+	3	2	MMP2	54079978	0.003000	0.15002	0.118000	0.21660	0.451000	0.32288	-1.214000	0.02988	-1.810000	0.01230	-1.644000	0.00765	AAC		0.622	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3			3	16	0	0	0	0.009096	0	3	16				
COQ9	57017	broad.mit.edu	37	16	57490845	57490845	+	Missense_Mutation	SNP	A	A	G	rs578020795		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr16:57490845A>G	ENST00000262507.6	+	5	593	c.524A>G	c.(523-525)aAg>aGg	p.K175R	COQ9_ENST00000567072.1_Intron|COQ9_ENST00000567933.1_Intron	NM_020312.3	NP_064708.1	O75208	COQ9_HUMAN	coenzyme Q9	175					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)		p.K175R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)	16						TCTTCCAGGAAGAGGAAGACA	0.537													A|||	1	0.000199681	0.0	0.0	5008	,	,		21008	0.0		0.0	False		,,,				2504	0.001						uc002elq.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(523-525)AAG>AGG		coenzyme Q9 homolog precursor							79.0	69.0	72.0					16																	57490845		2198	4300	6498	SO:0001583	missense	57017				ubiquinone biosynthetic process	mitochondrion		g.chr16:57490845A>G	BC064946	CCDS32459.1	16q13	2013-10-18	2013-10-18	2006-01-13	ENSG00000088682	ENSG00000088682			25302	protein-coding gene	gene with protein product		612837	"""chromosome 16 open reading frame 49"", ""coenzyme Q9 homolog (yeast)"", ""coenzyme Q9 homolog (S. cerevisiae)"""	C16orf49		19375058	Standard	NM_020312		Approved	DKFZP434K046	uc002elq.3	O75208		ENST00000262507.6:c.524A>G	16.37:g.57490845A>G	ENSP00000262507:p.Lys175Arg		Somatic				COQ9_uc010vhn.1_3'UTR|COQ9_uc010vho.1_Missense_Mutation_p.K175R|COQ9_uc010vhp.1_Silent_p.E168E|COQ9_uc002elr.2_Intron|COQ9_uc002els.2_5'Flank	p.K175R	NM_020312	NP_064708	WXS	Illumina HiSeq	Unspecified	O75208	COQ9_HUMAN			5	540	+			175					A8K3L2|Q7L5V7|Q7Z5T6|Q8NBL4|Q9NTJ2|Q9P056	Missense_Mutation	SNP	ENST00000262507.6	37	c.524A>G	CCDS32459.1	.	.	.	.	.	.	.	.	.	.	A	13.62	2.290189	0.40494	.	.	ENSG00000088682	ENST00000262507	.	.	.	5.68	5.68	0.88126	.	0.196416	0.53938	D	0.000049	T	0.66509	0.2796	L	0.49126	1.545	0.80722	D	1	P;D	0.69078	0.909;0.997	P;P	0.61003	0.555;0.882	T	0.62455	-0.6851	9	0.23302	T	0.38	-24.4291	15.1173	0.72413	1.0:0.0:0.0:0.0	.	175;175	B4DIV2;O75208	.;COQ9_HUMAN	R	175	.	ENSP00000262507:K175R	K	+	2	0	COQ9	56048346	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.905000	0.63286	2.163000	0.67991	0.460000	0.39030	AAG		0.537	COQ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432598.3	NM_020312		8	23	0	0	0	0.00308	0	8	23				
MYO1C	4641	broad.mit.edu	37	17	1370595	1370595	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:1370595C>T	ENST00000575158.1	-	31	3177	c.3001G>A	c.(3001-3003)Gac>Aac	p.D1001N	MYO1C_ENST00000545534.2_Missense_Mutation_p.D1012N|MYO1C_ENST00000359786.5_Missense_Mutation_p.D1036N|MYO1C_ENST00000438665.2_Missense_Mutation_p.D1017N|MYO1C_ENST00000361007.2_Missense_Mutation_p.D1001N			Q12965	MYO1E_HUMAN	myosin IC	0					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)	p.D1001N(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GGTGTGAAGTCAATGGTGCCA	0.632																																							uc002fsp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3106-3108)GAC>AAC		myosin IC isoform a							57.0	45.0	49.0					17																	1370595		2203	4299	6502	SO:0001583	missense	4641				mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:1370595C>T	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.3001G>A	17.37:g.1370595C>T	ENSP00000459174:p.Asp1001Asn		Somatic				MYO1C_uc002fsn.2_Missense_Mutation_p.D1017N|MYO1C_uc002fso.2_Missense_Mutation_p.D1001N	p.D1036N	NM_001080779	NP_001074248	WXS	Illumina HiSeq	Unspecified	O00159	MYO1C_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	31	3326	-			1036					Q14778	Missense_Mutation	SNP	ENST00000575158.1	37	c.3106G>A	CCDS11003.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.043014	0.93685	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.32	5.32	0.75619	Myosin tail 2 (1);	0.217020	0.46145	D	0.000304	T	0.55816	0.1944	L	0.58969	1.84	0.80722	D	1	D;D	0.67145	0.996;0.992	D;D	0.66497	0.944;0.925	T	0.50250	-0.8850	10	0.41790	T	0.15	.	18.155	0.89688	0.0:1.0:0.0:0.0	.	1036;1017	O00159;O00159-3	MYO1C_HUMAN;.	N	1036;1017;1017;1001;1012	ENSP00000352834:D1036N;ENSP00000412197:D1017N;ENSP00000354283:D1001N;ENSP00000437685:D1012N	ENSP00000352834:D1036N	D	-	1	0	MYO1C	1317345	1.000000	0.71417	0.969000	0.41365	0.531000	0.34715	7.126000	0.77201	2.769000	0.95229	0.563000	0.77884	GAC		0.632	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2			4	12	0	0	0	0.014758	0	4	12				
NLRP1	22861	broad.mit.edu	37	17	5436224	5436224	+	Missense_Mutation	SNP	G	G	A	rs149973177		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:5436224G>A	ENST00000572272.1	-	11	3213	c.3214C>T	c.(3214-3216)Cct>Tct	p.P1072S	NLRP1_ENST00000262467.5_Missense_Mutation_p.P1076S|NLRP1_ENST00000345221.3_Missense_Mutation_p.P1072S|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000577119.1_Missense_Mutation_p.P1042S|NLRP1_ENST00000269280.4_Missense_Mutation_p.P1072S|NLRP1_ENST00000354411.3_Missense_Mutation_p.P1042S			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1072					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.P1072S(2)|p.P1076S(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GTCCCCAAAGGCTTCGTATGC	0.577																																							uc002gci.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9						c.(3214-3216)CCT>TCT		NLR family, pyrin domain containing 1 isoform 1							87.0	79.0	82.0					17																	5436224		2203	4300	6503	SO:0001583	missense	22861				defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding	g.chr17:5436224G>A	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3214C>T	17.37:g.5436224G>A	ENSP00000460475:p.Pro1072Ser		Somatic				NLRP1_uc002gcg.1_Missense_Mutation_p.P1076S|NLRP1_uc002gck.2_Missense_Mutation_p.P1072S|NLRP1_uc002gcj.2_Missense_Mutation_p.P1042S|NLRP1_uc002gcl.2_Missense_Mutation_p.P1042S|NLRP1_uc002gch.3_Missense_Mutation_p.P1072S|NLRP1_uc010clh.2_Missense_Mutation_p.P1072S	p.P1072S	NM_033004	NP_127497	WXS	Illumina HiSeq	Unspecified	Q9C000	NALP1_HUMAN			11	3769	-		Colorectal(1115;3.48e-05)	1072					E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	c.3214C>T	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	G	7.225	0.598095	0.13939	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221;ENST00000537069	T;T;T;T;T	0.70045	-0.45;-0.45;-0.43;-0.41;-0.43	3.94	-1.42	0.08913	.	0.413484	0.18022	N	0.154206	T	0.47303	0.1438	L	0.44542	1.39	0.09310	N	1	B;B;B;B;B;B	0.13594	0.006;0.008;0.008;0.001;0.002;0.001	B;B;B;B;B;B	0.17098	0.017;0.011;0.011;0.002;0.008;0.003	T	0.23154	-1.0196	10	0.14252	T	0.57	.	4.0203	0.09662	0.4132:0.1774:0.4094:0.0	.	338;1042;1042;1072;1072;1076	F5H042;Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;.;NALP1_HUMAN;.;.	S	1076;1076;1072;1042;1072;338	ENSP00000442029:P1076S;ENSP00000262467:P1076S;ENSP00000269280:P1072S;ENSP00000346390:P1042S;ENSP00000324366:P1072S	ENSP00000262467:P1076S	P	-	1	0	NLRP1	5376948	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.085000	0.11250	-0.191000	0.10448	-0.232000	0.12228	CCT		0.577	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004		14	37	0	0	0	0.016723	0	14	37				
NLGN2	57555	broad.mit.edu	37	17	7315483	7315483	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:7315483C>T	ENST00000302926.2	+	2	538	c.465C>T	c.(463-465)ctC>ctT	p.L155L	NLGN2_ENST00000575301.1_Silent_p.L155L	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	155					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.L155L(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				TAGGTCCGCTCACAAAAAAAC	0.522																																							uc002ggt.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(463-465)CTC>CTT		neuroligin 2 precursor							67.0	64.0	65.0					17																	7315483		2203	4300	6503	SO:0001819	synonymous_variant	57555				cell-cell junction maintenance|neuron cell-cell adhesion|positive regulation of synaptogenesis|regulation of inhibitory postsynaptic membrane potential|synapse assembly	cell surface|integral to plasma membrane|postsynaptic membrane	neurexin binding|receptor activity	g.chr17:7315483C>T	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.465C>T	17.37:g.7315483C>T			Somatic					p.L155L	NM_020795	NP_065846	WXS	Illumina HiSeq	Unspecified	Q8NFZ4	NLGN2_HUMAN			2	538	+		Prostate(122;0.157)	155			Extracellular (Potential).		Q9P2I1	Silent	SNP	ENST00000302926.2	37	c.465C>T	CCDS11103.1																																																																																				0.522	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2	NM_020795		12	23	0	0	0	0.013537	0	12	23				
TP53	7157	broad.mit.edu	37	17	7577085	7577085	+	Missense_Mutation	SNP	C	C	T	rs112431538		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:7577085C>T	ENST00000269305.4	-	8	1042	c.853G>A	c.(853-855)Gag>Aag	p.E285K	TP53_ENST00000445888.2_Missense_Mutation_p.E285K|TP53_ENST00000420246.2_Missense_Mutation_p.E285K|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.E285K|TP53_ENST00000455263.2_Missense_Mutation_p.E285K|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	285	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726, ECO:0000269|PubMed:1694291}.|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E285K(111)|p.E285*(24)|p.0?(8)|p.E285Q(4)|p.?(2)|p.R283fs*16(2)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.G279fs*59(1)|p.R283fs*56(1)|p.E285fs*20(1)|p.E285fs*13(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCTCTTCCTCTGTGCGCCGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		165	Substitution - Missense(115)|Substitution - Nonsense(24)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	p.E285K(95)|p.E285*(16)|p.E285V(13)|p.0?(7)|p.E285Q(4)|p.E285E(3)|p.E285G(3)|p.E285A(2)|p.?(2)|p.R283fs*16(2)|p.E285_N288delEEEN(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.V272_K292del21(1)|p.R283fs*59(1)|p.C275fs*20(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.E285fs*20(1)	urinary_tract(53)|breast(18)|large_intestine(15)|lung(11)|upper_aerodigestive_tract(10)|stomach(8)|haematopoietic_and_lymphoid_tissue(8)|central_nervous_system(6)|oesophagus(6)|liver(6)|skin(5)|prostate(4)|bone(4)|biliary_tract(3)|ovary(3)|adrenal_gland(1)|soft_tissue(1)|eye(1)|pancreas(1)|thyroid(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM995136	TP53	M	rs112431538	c.(853-855)GAG>AAG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							91.0	78.0	82.0					17																	7577085		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577085C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.853G>A	17.37:g.7577085C>T	ENSP00000269305:p.Glu285Lys	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E285K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E153K|TP53_uc010cng.1_Missense_Mutation_p.E153K|TP53_uc002gii.1_Missense_Mutation_p.E153K|TP53_uc010cnh.1_Missense_Mutation_p.E285K|TP53_uc010cni.1_Missense_Mutation_p.E285K|TP53_uc002gij.2_Missense_Mutation_p.E285K	p.E285K	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1047	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	285		E -> K (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.853G>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703759	0.88924	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99816	-6.91;-6.91;-6.91;-6.91;-6.91;-6.91	4.99	4.99	0.66335	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.89904	3.07	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.87578	0.994;0.983;0.994;0.998	D	0.96661	0.9489	10	0.87932	D	0	-38.0538	15.807	0.78520	0.0:1.0:0.0:0.0	.	285;285;285;285	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	K	285;285;285;285;285;274;153	ENSP00000352610:E285K;ENSP00000269305:E285K;ENSP00000398846:E285K;ENSP00000391127:E285K;ENSP00000391478:E285K;ENSP00000425104:E153K	ENSP00000269305:E285K	E	-	1	0	TP53	7517810	1.000000	0.71417	0.900000	0.35374	0.716000	0.41182	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAG		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		12	25	0	0	0	0.013537	0	12	25				
ACACA	31	broad.mit.edu	37	17	35512644	35512644	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:35512644G>C	ENST00000394406.2	-	43	5487	c.5297C>G	c.(5296-5298)tCt>tGt	p.S1766C	ACACA_ENST00000360679.3_Missense_Mutation_p.S1708C|ACACA_ENST00000335166.5_Missense_Mutation_p.S1688C|ACACA_ENST00000353139.5_Missense_Mutation_p.S1803C|ACACA_ENST00000361253.5_5'UTR	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1766	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.S1708C(1)|p.S1803C(1)		NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	ACAATGGACAGAGTTGAGAGC	0.353																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	uc002hnm.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|ovary(1)	2						c.(5296-5298)TCT>TGT		acetyl-Coenzyme A carboxylase alpha isoform 2	Biotin(DB00121)						146.0	141.0	143.0					17																	35512644		2203	4300	6503	SO:0001583	missense	31				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding	g.chr17:35512644G>C	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.5297C>G	17.37:g.35512644G>C	ENSP00000377928:p.Ser1766Cys		Somatic				ACACA_uc002hnk.2_Missense_Mutation_p.S1688C|ACACA_uc002hnl.2_Missense_Mutation_p.S1708C|ACACA_uc002hnn.2_Missense_Mutation_p.S1766C|ACACA_uc002hno.2_Missense_Mutation_p.S1803C|ACACA_uc010cuy.2_Missense_Mutation_p.S411C|ACACA_uc010wdc.1_5'UTR	p.S1766C	NM_198836	NP_942133	WXS	Illumina HiSeq	Unspecified	Q13085	ACACA_HUMAN			43	5488	-		Breast(25;0.00157)|Ovarian(249;0.15)	1766			Carboxyltransferase.		B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	37	c.5297C>G	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.945787	0.92593	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330	D;D;D;D	0.95724	-3.79;-3.79;-3.79;-3.78	5.11	5.11	0.69529	Carboxyl transferase (1);Acetyl-coenzyme A carboxyltransferase, N-terminal (1);	0.111999	0.64402	D	0.000006	D	0.98182	0.9399	M	0.91090	3.175	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.993;0.975	D;D;P;P	0.70016	0.967;0.938;0.814;0.718	D	0.99053	1.0828	10	0.72032	D	0.01	-9.3883	18.8863	0.92379	0.0:0.0:1.0:0.0	.	465;1803;1766;1708	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	C	1803;1708;1766;1790;1688;465	ENSP00000344789:S1803C;ENSP00000353898:S1708C;ENSP00000377928:S1766C;ENSP00000335323:S1688C	ENSP00000335323:S1688C	S	-	2	0	ACACA	32586757	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.619000	0.98369	2.537000	0.85549	0.555000	0.69702	TCT		0.353	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836		22	94	0	0	0	0.004656	0	22	94				
CDK12	51755	broad.mit.edu	37	17	37687195	37687195	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:37687195G>C	ENST00000447079.4	+	14	4132	c.4099G>C	c.(4099-4101)Gtc>Ctc	p.V1367L	CDK12_ENST00000430627.2_Missense_Mutation_p.V1358L	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	1367					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.V1367L(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						AGAATCCTTGGTCCAGACCCT	0.537			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													uc010cvv.2		NA		Rec	yes		17	17q12	51755		cyclin-dependent kinase 12			E					1	Substitution - Missense(1)		lung(1)	ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						c.(4099-4101)GTC>CTC		Cdc2-related kinase, arginine/serine-rich							72.0	70.0	71.0					17																	37687195		2203	4300	6503	SO:0001583	missense	51755				mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr17:37687195G>C	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.4099G>C	17.37:g.37687195G>C	ENSP00000398880:p.Val1367Leu	TCGA Ovarian(9;0.13)	Somatic				CDK12_uc002hrw.3_Missense_Mutation_p.V1358L	p.V1367L	NM_016507	NP_057591	WXS	Illumina HiSeq	Unspecified	Q9NYV4	CDK12_HUMAN			14	4685	+			1367					A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	c.4099G>C	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415194	0.25552	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.68624	-0.33;-0.34	5.44	3.36	0.38483	.	0.450396	0.18685	N	0.134043	T	0.45054	0.1323	N	0.14661	0.345	0.26032	N	0.981729	B;B	0.11235	0.002;0.004	B;B	0.16289	0.007;0.015	T	0.26189	-1.0110	10	0.33940	T	0.23	-0.4652	7.0061	0.24838	0.1598:0.2412:0.5991:0.0	.	1367;1358	Q9NYV4;Q9NYV4-2	CDK12_HUMAN;.	L	1358;1367	ENSP00000407720:V1358L;ENSP00000398880:V1367L	ENSP00000407720:V1358L	V	+	1	0	CDK12	34940721	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.955000	0.29188	1.466000	0.48025	0.650000	0.86243	GTC		0.537	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507		9	38	0	0	0	0.004482	0	9	38				
C17orf53	78995	broad.mit.edu	37	17	42226342	42226342	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:42226342A>C	ENST00000319977.4	+	3	1408	c.1171A>C	c.(1171-1173)Acc>Ccc	p.T391P	C17orf53_ENST00000245382.6_Missense_Mutation_p.T391P|C17orf53_ENST00000585683.1_Missense_Mutation_p.T391P	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	391										NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCATCCCTCCACCCGAGCCAA	0.622																																							uc002ifi.1		NA																	0					0						c.(1171-1173)ACC>CCC		hypothetical protein LOC78995							46.0	52.0	50.0					17																	42226342		2203	4300	6503	SO:0001583	missense	78995							g.chr17:42226342A>C	AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.1171A>C	17.37:g.42226342A>C	ENSP00000313500:p.Thr391Pro		Somatic				C17orf53_uc010czq.1_Missense_Mutation_p.T391P|C17orf53_uc002ifj.1_Missense_Mutation_p.T391P|C17orf53_uc002ifk.1_RNA	p.T391P	NM_024032	NP_076937	WXS	Illumina HiSeq	Unspecified	Q8N3J3	CQ053_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.114)	3	1356	+		Breast(137;0.0364)|Prostate(33;0.0376)	391					A8K7A9|Q9BWM9|Q9HAI1	Missense_Mutation	SNP	ENST00000319977.4	37	c.1171A>C	CCDS11477.1	.	.	.	.	.	.	.	.	.	.	A	3.654	-0.071016	0.07228	.	.	ENSG00000125319	ENST00000319977;ENST00000245382	T;T	0.46819	0.86;0.86	5.41	-1.1	0.09872	.	0.667170	0.14187	N	0.335630	T	0.29093	0.0723	L	0.38531	1.155	0.09310	N	1	B;B;B	0.14438	0.002;0.01;0.002	B;B;B	0.11329	0.004;0.006;0.004	T	0.17440	-1.0369	10	0.45353	T	0.12	-0.1114	1.2519	0.01984	0.3837:0.2556:0.2364:0.1243	.	391;391;391	A8K7A9;Q8N3J3-3;Q8N3J3	.;.;CQ053_HUMAN	P	391	ENSP00000313500:T391P;ENSP00000245382:T391P	ENSP00000245382:T391P	T	+	1	0	C17orf53	39581868	0.000000	0.05858	0.000000	0.03702	0.223000	0.24884	-0.147000	0.10234	-0.242000	0.09667	0.459000	0.35465	ACC		0.622	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1	NM_024032		9	55	0	0	0	0.010504	0	9	55				
OR4D1	26689	broad.mit.edu	37	17	56233005	56233005	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:56233005T>A	ENST00000268912.5	+	1	512	c.491T>A	c.(490-492)cTt>cAt	p.L164H		NM_012374.1	NP_036506.1	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D, member 1	164					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L164H(1)		kidney(2)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13						GCTCTGATACTTCCACTGCCC	0.527																																							uc010wno.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(490-492)CTT>CAT		olfactory receptor, family 4, subfamily D,							101.0	98.0	99.0					17																	56233005		2203	4300	6503	SO:0001583	missense	26689				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr17:56233005T>A	X89670	CCDS42365.1	17q22	2012-08-09			ENSG00000141194	ENSG00000141194		"""GPCR / Class A : Olfactory receptors"""	8293	protein-coding gene	gene with protein product				OR4D3		9119360	Standard	NM_012374		Approved	TPCR16	uc010wno.2	Q15615		ENST00000268912.5:c.491T>A	17.37:g.56233005T>A	ENSP00000365451:p.Leu164His		Somatic				MSX2P1_uc002ivn.2_5'Flank	p.L164H	NM_012374	NP_036506	WXS	Illumina HiSeq	Unspecified	Q15615	OR4D1_HUMAN			1	491	+			164			Extracellular (Potential).		B2RN14|Q8NGB1|Q96R76	Missense_Mutation	SNP	ENST00000268912.5	37	c.491T>A	CCDS42365.1	.	.	.	.	.	.	.	.	.	.	t	16.42	3.118747	0.56505	.	.	ENSG00000141194	ENST00000268912	T	0.00235	8.48	5.63	5.63	0.86233	GPCR, rhodopsin-like superfamily (1);	0.213333	0.23429	U	0.048274	T	0.00580	0.0019	M	0.83774	2.66	0.22996	N	0.998457	D	0.69078	0.997	D	0.69479	0.964	T	0.46414	-0.9193	10	0.72032	D	0.01	-30.034	13.7938	0.63157	0.0:0.0:0.0:1.0	.	164	Q15615	OR4D1_HUMAN	H	164	ENSP00000365451:L164H	ENSP00000365451:L164H	L	+	2	0	OR4D1	53588004	0.000000	0.05858	0.982000	0.44146	0.836000	0.47400	0.702000	0.25631	2.142000	0.66516	0.443000	0.29094	CTT		0.527	OR4D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443364.1			13	75	0	0	0	0.004007	0	13	75				
DSC1	1823	broad.mit.edu	37	18	28728565	28728565	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr18:28728565T>A	ENST00000257198.5	-	6	929	c.668A>T	c.(667-669)gAa>gTa	p.E223V	RP11-408H20.2_ENST00000581836.1_RNA|DSC1_ENST00000257197.3_Missense_Mutation_p.E223V	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	223	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E223V(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			GAGTGGATATTCTGGTGCATA	0.368																																							uc002kwn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(667-669)GAA>GTA		desmocollin 1 isoform Dsc1a preproprotein							147.0	139.0	142.0					18																	28728565		2203	4300	6503	SO:0001583	missense	1823				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding	g.chr18:28728565T>A	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.668A>T	18.37:g.28728565T>A	ENSP00000257198:p.Glu223Val		Somatic				DSC1_uc002kwm.2_Missense_Mutation_p.E223V	p.E223V	NM_024421	NP_077739	WXS	Illumina HiSeq	Unspecified	Q08554	DSC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00778)		6	930	-			223			Cadherin 1.|Extracellular (Potential).		Q9HB01	Missense_Mutation	SNP	ENST00000257198.5	37	c.668A>T	CCDS11894.1	.	.	.	.	.	.	.	.	.	.	T	16.78	3.218597	0.58560	.	.	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.54479	0.57;0.57	5.07	5.07	0.68467	Cadherin (4);Cadherin-like (1);	0.289116	0.24172	N	0.040899	T	0.71022	0.3291	H	0.94886	3.595	0.48511	D	0.999667	P;P	0.47841	0.782;0.901	P;P	0.48598	0.583;0.583	T	0.79415	-0.1813	10	0.52906	T	0.07	.	14.1075	0.65101	0.0:0.0:0.0:1.0	.	223;223	Q08554;Q9HB00	DSC1_HUMAN;.	V	223	ENSP00000257197:E223V;ENSP00000257198:E223V	ENSP00000257197:E223V	E	-	2	0	DSC1	26982563	0.997000	0.39634	0.665000	0.29768	0.364000	0.29643	5.248000	0.65421	2.030000	0.59900	0.533000	0.62120	GAA		0.368	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421		16	79	0	0	0	0.004007	0	16	79				
MOCOS	55034	broad.mit.edu	37	18	33779985	33779985	+	Silent	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr18:33779985G>A	ENST00000261326.5	+	4	660	c.639G>A	c.(637-639)ctG>ctA	p.L213L		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase									p.L213L(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GATACCCCCTGTCCTGGATAG	0.577																																							uc002kzq.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(637-639)CTG>CTA		molybdenum cofactor sulfurase	Pyridoxal Phosphate(DB00114)						74.0	75.0	75.0					18																	33779985		2203	4300	6503	SO:0001819	synonymous_variant	55034				Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding	g.chr18:33779985G>A	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.639G>A	18.37:g.33779985G>A			Somatic					p.L213L	NM_017947	NP_060417	WXS	Illumina HiSeq	Unspecified	Q96EN8	MOCOS_HUMAN			4	662	+			213						Silent	SNP	ENST00000261326.5	37	c.639G>A	CCDS11919.1																																																																																				0.577	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1			13	40	0	0	0	0.020292	0	13	40				
KEAP1	9817	broad.mit.edu	37	19	10602796	10602796	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr19:10602796C>G	ENST00000171111.5	-	3	1329	c.782G>C	c.(781-783)cGg>cCg	p.R261P	KEAP1_ENST00000588024.1_5'UTR|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000393623.2_Missense_Mutation_p.R261P	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	261	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.R261P(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GACGTAGAACCGTCGCTGTTC	0.632																																							uc002moq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(781-783)CGG>CCG		kelch-like ECH-associated protein 1							66.0	63.0	64.0					19																	10602796		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10602796C>G	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.782G>C	19.37:g.10602796C>G	ENSP00000171111:p.Arg261Pro		Somatic				KEAP1_uc002mop.1_5'UTR|KEAP1_uc002mor.1_Missense_Mutation_p.R261P	p.R261P	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		3	938	-			261			BACK.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.782G>C	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.679502	0.88542	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.69306	-0.39;-0.39	5.61	5.61	0.85477	BTB/Kelch-associated (2);	0.107337	0.64402	D	0.000005	T	0.80534	0.4641	M	0.82923	2.615	0.80722	D	1	D	0.61697	0.99	P	0.56788	0.806	T	0.82969	-0.0193	10	0.62326	D	0.03	.	17.1459	0.86766	0.0:1.0:0.0:0.0	.	261	Q14145	KEAP1_HUMAN	P	261	ENSP00000171111:R261P;ENSP00000377245:R261P	ENSP00000171111:R261P	R	-	2	0	KEAP1	10463796	0.965000	0.33210	1.000000	0.80357	0.649000	0.38597	2.496000	0.45346	2.656000	0.90262	0.561000	0.74099	CGG		0.632	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		13	36	0	0	0	0.003163	0	13	36				
APOB	338	broad.mit.edu	37	2	21236089	21236089	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:21236089C>G	ENST00000233242.1	-	25	4286	c.4159G>C	c.(4159-4161)Gct>Cct	p.A1387P		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1387					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.A1387P(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGTAACGAGCCCGAAGGCTG	0.532																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(4159-4161)GCT>CCT		apolipoprotein B precursor	Atorvastatin(DB01076)						169.0	158.0	162.0					2																	21236089		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21236089C>G	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4159G>C	2.37:g.21236089C>G	ENSP00000233242:p.Ala1387Pro		Somatic					p.A1387P	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			25	4287	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1387					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.4159G>C	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500661	0.44455	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01313	5.02	5.31	2.25	0.28309	.	0.528961	0.18603	N	0.136381	T	0.04497	0.0123	M	0.64997	1.995	0.31897	N	0.616434	D	0.71674	0.998	P	0.62649	0.905	T	0.12967	-1.0527	10	0.72032	D	0.01	.	5.7782	0.18292	0.2504:0.562:0.0:0.1877	.	1387	P04114	APOB_HUMAN	P	1387	ENSP00000233242:A1387P	ENSP00000233242:A1387P	A	-	1	0	APOB	21089594	0.896000	0.30565	0.047000	0.18901	0.236000	0.25371	1.832000	0.39151	0.686000	0.31488	0.557000	0.71058	GCT		0.532	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			28	100	0	0	0	0.010818	0	28	100				
DOK1	1796	broad.mit.edu	37	2	74784050	74784050	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:74784050C>T	ENST00000233668.5	+	5	1924	c.1255C>T	c.(1255-1257)Ccc>Tcc	p.P419S	DOK1_ENST00000340004.6_3'UTR|M1AP_ENST00000464686.1_5'Flank|LOXL3_ENST00000409986.1_5'Flank|DOK1_ENST00000480318.1_3'UTR|LOXL3_ENST00000393937.2_5'Flank|DOK1_ENST00000409429.1_Missense_Mutation_p.P280S|LOXL3_ENST00000264094.3_5'Flank	NM_001381.3	NP_001372.1	Q99704	DOK1_HUMAN	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	419	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|insulin receptor signaling pathway (GO:0008286)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor signaling protein activity (GO:0005057)	p.P419S(1)		endometrium(3)|large_intestine(2)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						GAGCACAAAGCCCCTCCTTGC	0.612																																					Esophageal Squamous(36;520 860 12502 33616 51270)	Esophageal Squamous(36;520 860 12502 33616 51270)	uc002sms.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1255-1257)CCC>TCC		docking protein 1							131.0	135.0	133.0					2																	74784050		2203	4300	6503	SO:0001583	missense	1796				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol|perinuclear region of cytoplasm	insulin receptor binding	g.chr2:74784050C>T	U70987	CCDS1954.1, CCDS56125.1	2p13	2008-05-21	2002-08-29		ENSG00000115325	ENSG00000115325			2990	protein-coding gene	gene with protein product		602919	"""docking protein 1, 62kD (downstream of tyrosine kinase 1)"""			9008160, 9790776, 15546884	Standard	NM_001381		Approved	p62dok	uc002sms.3	Q99704	OTTHUMG00000129956	ENST00000233668.5:c.1255C>T	2.37:g.74784050C>T	ENSP00000233668:p.Pro419Ser		Somatic				LOXL3_uc002smp.1_5'Flank|LOXL3_uc002smq.1_5'Flank|LOXL3_uc010ffn.1_5'Flank|DOK1_uc002smr.2_Missense_Mutation_p.P280S|DOK1_uc010ffo.2_Missense_Mutation_p.P280S|DOK1_uc002smt.2_Missense_Mutation_p.P205S|DOK1_uc002smu.2_Missense_Mutation_p.P205S|DOK1_uc010yrz.1_Missense_Mutation_p.P408S|DOK1_uc002smv.2_Missense_Mutation_p.P280S|DOK1_uc002smw.1_Missense_Mutation_p.P205S	p.P419S	NM_001381	NP_001372	WXS	Illumina HiSeq	Unspecified	Q99704	DOK1_HUMAN			5	1277	+			419			Pro-rich.		O43204|Q53TY2|Q9UHG6	Missense_Mutation	SNP	ENST00000233668.5	37	c.1255C>T	CCDS1954.1	.	.	.	.	.	.	.	.	.	.	C	18.45	3.626867	0.66901	.	.	ENSG00000115325	ENST00000409429;ENST00000233668	T;T	0.39592	1.07;1.13	5.09	4.22	0.49857	.	1.022250	0.07803	N	0.956884	T	0.44074	0.1276	M	0.61703	1.905	0.80722	D	1	B;B	0.22276	0.067;0.016	B;B	0.21151	0.033;0.02	T	0.20472	-1.0274	10	0.44086	T	0.13	-13.3198	11.2739	0.49155	0.0:0.9114:0.0:0.0886	.	408;419	B4DJN1;Q99704	.;DOK1_HUMAN	S	280;419	ENSP00000387016:P280S;ENSP00000233668:P419S	ENSP00000233668:P419S	P	+	1	0	DOK1	74637558	0.983000	0.35010	0.993000	0.49108	0.905000	0.53344	1.003000	0.29809	1.386000	0.46466	0.561000	0.74099	CCC		0.612	DOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252218.3	NM_001381		21	129	0	0	0	0.014323	0	21	129				
XIRP2	129446	broad.mit.edu	37	2	168106620	168106620	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:168106620G>C	ENST00000409195.1	+	9	8807	c.8718G>C	c.(8716-8718)gaG>gaC	p.E2906D	XIRP2_ENST00000409273.1_Missense_Mutation_p.E2684D|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.E2906D	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2731					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.E2906D(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GCATACAAGAGAAACAAGTCT	0.378																																							uc002udx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(8716-8718)GAG>GAC		xin actin-binding repeat containing 2 isoform 1							78.0	73.0	75.0					2																	168106620		1826	4084	5910	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168106620G>C	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.8718G>C	2.37:g.168106620G>C	ENSP00000386840:p.Glu2906Asp		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.E2731D|XIRP2_uc010fpq.2_Missense_Mutation_p.E2684D|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.E252D	p.E2906D	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	8736	+			2731					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.8718G>C	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.799471	0.31869	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02916	4.11;4.11;4.13	6.02	5.14	0.70334	.	0.588053	0.18190	N	0.148851	T	0.01870	0.0059	N	0.08118	0	0.09310	N	0.99999	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.001;0.003;0.003	T	0.47522	-0.9111	10	0.28530	T	0.3	-5.6194	9.0917	0.36614	0.0782:0.1465:0.7753:0.0	.	2731;2731;2684	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	D	2906;2906;2684;320	ENSP00000386840:E2906D;ENSP00000295237:E2906D;ENSP00000387255:E2684D	ENSP00000295237:E2906D	E	+	3	2	XIRP2	167814866	0.991000	0.36638	1.000000	0.80357	0.609000	0.37215	0.468000	0.22051	1.533000	0.49186	0.655000	0.94253	GAG		0.378	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		12	77	0	0	0	0.010729	0	12	77				
COL5A2	1290	broad.mit.edu	37	2	189950490	189950490	+	Silent	SNP	T	T	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:189950490T>C	ENST00000374866.3	-	10	973	c.699A>G	c.(697-699)gcA>gcG	p.A233A		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	233					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.A233A(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CTGTAGGTCCTGCACCACCCT	0.393																																							uc002uqk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(697-699)GCA>GCG		alpha 2 type V collagen preproprotein							83.0	79.0	80.0					2																	189950490		2203	4300	6503	SO:0001819	synonymous_variant	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189950490T>C	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.699A>G	2.37:g.189950490T>C			Somatic				COL5A2_uc010frx.2_5'UTR	p.A233A	NM_000393	NP_000384	WXS	Illumina HiSeq	Unspecified	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		10	974	-			233					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	ENST00000374866.3	37	c.699A>G	CCDS33350.1																																																																																				0.393	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		10	47	0	0	0	0.006214	0	10	47				
RPE	6120	broad.mit.edu	37	2	210882212	210882212	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:210882212A>G	ENST00000359429.6	+	5	590	c.493A>G	c.(493-495)Acc>Gcc	p.T165A	RPE_ENST00000452025.1_Missense_Mutation_p.T165A|RPE_ENST00000411934.2_Missense_Mutation_p.T97A|RPE_ENST00000445268.1_Missense_Mutation_p.T97A|RPE_ENST00000454822.1_Missense_Mutation_p.T115A|RPE_ENST00000438204.2_Missense_Mutation_p.T97A|RPE_ENST00000436630.2_Missense_Mutation_p.T115A|RPE_ENST00000540255.1_Intron|RPE_ENST00000435437.2_Missense_Mutation_p.T165A|RPE_ENST00000354506.6_Missense_Mutation_p.T157A|RPE_ENST00000429921.1_Missense_Mutation_p.T115A|RPE_ENST00000429907.1_Missense_Mutation_p.T97A	NM_199229.1	NP_954699.1	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase	165					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|ribulose-phosphate 3-epimerase activity (GO:0004750)	p.T115A(1)|p.T165A(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	9				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		CTGGTTGAGGACCCAGTTCCC	0.448																																							uc002vdn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(493-495)ACC>GCC		ribulose-5-phosphate-3-epimerase isoform 1							133.0	124.0	127.0					2																	210882212		2203	4300	6503	SO:0001583	missense	6120				pentose-phosphate shunt	cytosol	metal ion binding|protein homodimerization activity|ribulose-phosphate 3-epimerase activity	g.chr2:210882212A>G		CCDS2388.1, CCDS42810.1, CCDS63107.1, CCDS63108.1	2q32-q33.3	2012-10-02			ENSG00000197713	ENSG00000197713	5.1.3.1		10293	protein-coding gene	gene with protein product		180480					Standard	NM_199229		Approved		uc002vdn.4	Q96AT9	OTTHUMG00000154690	ENST00000359429.6:c.493A>G	2.37:g.210882212A>G	ENSP00000352401:p.Thr165Ala		Somatic				RPE_uc002vdm.2_Missense_Mutation_p.T165A|RPE_uc002vdo.2_Missense_Mutation_p.T115A|RPE_uc010zjf.1_Intron|RPE_uc002vdp.2_Missense_Mutation_p.T112A|RPE_uc010fup.2_Missense_Mutation_p.T97A|RPE_uc002vdq.2_Missense_Mutation_p.T115A|RPE_uc002vdr.2_Missense_Mutation_p.T80A	p.T165A	NM_199229	NP_954699	WXS	Illumina HiSeq	Unspecified	Q96AT9	RPE_HUMAN		Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)	5	498	+			165					A8K4S0|B4E016|C9JPQ7|O43767|Q53TV9|Q8N215|Q96N34|Q9BSB5	Missense_Mutation	SNP	ENST00000359429.6	37	c.493A>G	CCDS2388.1	.	.	.	.	.	.	.	.	.	.	A	4.743	0.138226	0.09083	.	.	ENSG00000197713	ENST00000359429;ENST00000436630;ENST00000408981;ENST00000454822;ENST00000429921;ENST00000438265;ENST00000429907;ENST00000441588;ENST00000445268;ENST00000452025;ENST00000438204;ENST00000411934;ENST00000435437;ENST00000354506	.	.	.	5.34	5.34	0.76211	Aldolase-type TIM barrel (1);Ribulose-phosphate binding barrel (1);	0.140295	0.64402	D	0.000004	T	0.18635	0.0447	N	0.00608	-1.33	0.44000	D	0.996706	B;B;B;B	0.28178	0.202;0.005;0.0;0.0	B;B;B;B	0.34093	0.175;0.014;0.001;0.001	T	0.24368	-1.0162	9	0.16420	T	0.52	.	10.5253	0.44945	0.8555:0.0:0.0:0.1445	.	135;157;165;165	B3KTW7;E7EW52;Q96AT9;C9J9T0	.;.;RPE_HUMAN;.	A	165;115;97;115;115;115;97;97;97;165;97;97;165;157	.	ENSP00000346501:T157A	T	+	1	0	RPE	210590457	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.886000	0.56190	2.144000	0.66660	0.533000	0.62120	ACC		0.448	RPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336574.2	NM_006916		4	57	0	0	0	0.009096	0	4	57				
FRG1B	284802	broad.mit.edu	37	20	29624081	29624081	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr20:29624081A>T	ENST00000278882.3	+	4	485	c.105A>T	c.(103-105)ttA>ttT	p.L35F	FRG1B_ENST00000439954.2_Missense_Mutation_p.L40F|FRG1B_ENST00000358464.4_Missense_Mutation_p.L35F			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	35								p.L35F(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CTGTCAAATTATCTGATTCCA	0.289																																							uc010ztl.1		NA																	2	Substitution - Missense(2)		urinary_tract(2)		0						c.(13-15)TTA>TTT		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29624081A>T			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.105A>T	20.37:g.29624081A>T	ENSP00000278882:p.Leu35Phe		Somatic				FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron	p.L5F			WXS	Illumina HiSeq	Unspecified					1	47	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.15A>T		.	.	.	.	.	.	.	.	.	.	a	11.95	1.790802	0.31685	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.47528	0.84	1.91	-1.81	0.07882	.	0.161701	0.38164	U	0.001783	T	0.58509	0.2127	.	.	.	0.39031	D	0.959935	D	0.55800	0.973	D	0.66979	0.948	T	0.58244	-0.7670	9	0.62326	D	0.03	.	6.4213	0.21746	0.4291:0.0:0.5708:0.0	.	40	F5H5R5	.	F	35;40;35	ENSP00000408863:L40F	ENSP00000278882:L35F	L	+	3	2	FRG1B	28237742	0.999000	0.42202	0.982000	0.44146	0.503000	0.33858	0.300000	0.19156	-0.401000	0.07644	0.155000	0.16302	TTA		0.289	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		3	11	0	0	0	0.009096	0	3	11				
DSN1	79980	broad.mit.edu	37	20	35384135	35384135	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr20:35384135G>A	ENST00000426836.1	-	9	1195	c.823C>T	c.(823-825)Cag>Tag	p.Q275*	DSN1_ENST00000373745.3_Nonsense_Mutation_p.Q275*|DSN1_ENST00000373734.4_Nonsense_Mutation_p.Q168*|DSN1_ENST00000373740.3_Nonsense_Mutation_p.Q203*|DSN1_ENST00000473615.1_5'UTR|DSN1_ENST00000448110.2_Nonsense_Mutation_p.Q259*|DSN1_ENST00000373750.4_Nonsense_Mutation_p.Q275*	NM_001145316.1	NP_001138788.1	Q9H410	DSN1_HUMAN	DSN1, MIS12 kinetochore complex component	275					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)		p.Q275*(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	16		Myeloproliferative disorder(115;0.00874)				AATATTTTCTGGTAGTCAGGT	0.398																																							uc010gfr.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(823-825)CAG>TAG		DSN1, MIND kinetochore complex component,							118.0	104.0	109.0					20																	35384135		2203	4300	6503	SO:0001587	stop_gained	79980				cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding	g.chr20:35384135G>A	AK023408	CCDS13286.1, CCDS46596.1, CCDS46597.1	20q11.23	2013-07-03	2013-07-03	2006-11-07	ENSG00000149636	ENSG00000149636			16165	protein-coding gene	gene with protein product	"""kinetochore null 3 homolog (C. elegans)"""	609175	"""chromosome 20 open reading frame 172"", ""DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C20orf172		16585270, 20819937	Standard	NM_001145315		Approved	dJ469A13.2, MIS13, KNL3, hKNL-3	uc002xfz.3	Q9H410	OTTHUMG00000032396	ENST00000426836.1:c.823C>T	20.37:g.35384135G>A	ENSP00000389810:p.Gln275*		Somatic				DSN1_uc002xfz.2_Nonsense_Mutation_p.Q275*|DSN1_uc002xfy.3_Nonsense_Mutation_p.Q65*|DSN1_uc002xga.2_Nonsense_Mutation_p.Q275*|DSN1_uc010zvs.1_Nonsense_Mutation_p.Q168*|DSN1_uc002xgc.2_Nonsense_Mutation_p.Q259*|DSN1_uc002xgb.2_Nonsense_Mutation_p.Q259*	p.Q275*	NM_001145316	NP_001138788	WXS	Illumina HiSeq	Unspecified	Q9H410	DSN1_HUMAN			9	1196	-		Myeloproliferative disorder(115;0.00874)	275					B4DWT2|E1P5U9|Q5JW55|Q5JW56|Q9H8P4	Nonsense_Mutation	SNP	ENST00000426836.1	37	c.823C>T	CCDS13286.1	.	.	.	.	.	.	.	.	.	.	G	37	6.423683	0.97555	.	.	ENSG00000149636	ENST00000426836;ENST00000373745;ENST00000448110;ENST00000373733;ENST00000373750;ENST00000373740;ENST00000373734;ENST00000449595	.	.	.	5.3	5.3	0.74995	.	0.136977	0.49916	D	0.000137	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-14.32	14.3286	0.66537	0.0:0.0:1.0:0.0	.	.	.	.	X	275;275;259;208;275;203;168;259	.	ENSP00000362838:Q208X	Q	-	1	0	DSN1	34817549	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.922000	0.63404	2.761000	0.94854	0.650000	0.86243	CAG		0.398	DSN1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079043.2	NM_024918		12	45	0	0	0	0.010729	0	12	45				
ITSN1	6453	broad.mit.edu	37	21	35190760	35190760	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr21:35190760A>G	ENST00000381318.3	+	23	3205	c.2917A>G	c.(2917-2919)Ata>Gta	p.I973V	ITSN1_ENST00000399353.1_Missense_Mutation_p.I931V|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000437442.2_Missense_Mutation_p.I968V|ITSN1_ENST00000399367.3_Missense_Mutation_p.I968V|ITSN1_ENST00000399355.2_Missense_Mutation_p.I973V|ITSN1_ENST00000381285.4_Missense_Mutation_p.I973V|ITSN1_ENST00000399326.3_Missense_Mutation_p.I968V|ITSN1_ENST00000379960.5_Intron|ITSN1_ENST00000399349.1_Missense_Mutation_p.I968V|ITSN1_ENST00000381291.4_Missense_Mutation_p.I973V|ITSN1_ENST00000399352.1_Missense_Mutation_p.I968V	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	973					apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I973V(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						TTCAGGGCCCATAAGGAAGTC	0.403																																							uc002yta.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2917-2919)ATA>GTA		intersectin 1 isoform ITSN-l							164.0	160.0	162.0					21																	35190760		2203	4300	6503	SO:0001583	missense	6453				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity	g.chr21:35190760A>G	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.2917A>G	21.37:g.35190760A>G	ENSP00000370719:p.Ile973Val		Somatic				DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Missense_Mutation_p.I968V|ITSN1_uc010gmg.2_Missense_Mutation_p.I931V|ITSN1_uc010gmh.2_Intron|ITSN1_uc002ysw.2_Missense_Mutation_p.I973V|ITSN1_uc010gmi.2_Missense_Mutation_p.I936V|ITSN1_uc010gmj.2_Missense_Mutation_p.I852V|ITSN1_uc002ysy.2_Missense_Mutation_p.I968V|ITSN1_uc002ysx.2_Missense_Mutation_p.I931V|ITSN1_uc002ytb.1_Missense_Mutation_p.I968V|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Missense_Mutation_p.I936V|ITSN1_uc010gml.2_Intron|ITSN1_uc002ytj.2_Missense_Mutation_p.I968V|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Missense_Mutation_p.I907V|ITSN1_uc002ytg.1_Missense_Mutation_p.I26V	p.I973V	NM_003024	NP_003015	WXS	Illumina HiSeq	Unspecified	Q15811	ITSN1_HUMAN			23	3185	+			973					A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	c.2917A>G	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	A	9.988	1.229888	0.22542	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000437442;ENST00000399326	T;T;T;T;T;T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48	5.75	-4.59	0.03400	.	0.555853	0.20931	N	0.083092	T	0.04137	0.0115	N	0.03324	-0.35	0.80722	D	1	B;B;B;B;B;B;B;B;B;B	0.25351	0.0;0.007;0.124;0.002;0.0;0.0;0.002;0.002;0.0;0.004	B;B;B;B;B;B;B;B;B;B	0.17433	0.0;0.007;0.018;0.004;0.0;0.0;0.004;0.004;0.0;0.004	T	0.43310	-0.9399	10	0.18276	T	0.48	.	10.024	0.42059	0.3728:0.1175:0.5097:0.0	.	936;936;931;968;25;973;968;973;968;931	A8D7D0;A7XZY7;A8CTY7;A8CTY3;Q7Z452;F8W7U0;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;.;ITSN1_HUMAN;.;.	V	931;973;973;973;973;968;968;968;973;968;968;968	ENSP00000382290:I931V;ENSP00000370719:I973V;ENSP00000370691:I973V;ENSP00000370685:I973V;ENSP00000382301:I968V;ENSP00000382289:I968V;ENSP00000382292:I973V;ENSP00000382286:I968V;ENSP00000387377:I968V;ENSP00000382265:I968V	ENSP00000370685:I973V	I	+	1	0	ITSN1	34112630	0.520000	0.26250	0.320000	0.25306	0.920000	0.55202	0.156000	0.16382	-1.181000	0.02730	-0.563000	0.04171	ATA		0.403	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024		20	100	0	0	0	0.012319	0	20	100				
ANO10	55129	broad.mit.edu	37	3	43596810	43596810	+	Missense_Mutation	SNP	C	C	T	rs372086237		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr3:43596810C>T	ENST00000292246.3	-	10	1798	c.1628G>A	c.(1627-1629)cGt>cAt	p.R543H	ANO10_ENST00000414522.2_Missense_Mutation_p.R543H|ANO10_ENST00000396091.3_Missense_Mutation_p.R477H|ANO10_ENST00000350459.4_Missense_Mutation_p.R353H|ANO10_ENST00000451430.2_Missense_Mutation_p.R432H	NM_018075.3	NP_060545.3	Q9NW15	ANO10_HUMAN	anoctamin 10	543					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell death (GO:0008219)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)	p.R543H(1)		NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(3)|skin(3)	29						TGAGAATGGACGTTTGAAGAC	0.363																																							uc003cmv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1627-1629)CGT>CAT		transmembrane protein 16K		C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	96.0	95.0	95.0		1628,1430,1295,1058,1628	5.5	1.0	3		95	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	ANO10	NM_001204831.1,NM_001204832.1,NM_001204833.1,NM_001204834.1,NM_018075.3	29,29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	543/628,477/595,432/550,353/471,543/661	43596810	1,13005	2203	4300	6503	SO:0001583	missense	55129				cell death	chloride channel complex	chloride channel activity	g.chr3:43596810C>T	AL832508	CCDS2710.2, CCDS56247.1, CCDS56248.1, CCDS56249.1, CCDS56250.1	3p22.1-p21.33	2014-04-09	2008-08-28	2008-08-28	ENSG00000160746	ENSG00000160746		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25519	protein-coding gene	gene with protein product		613726	"""transmembrane protein 16K"""	TMEM16K		12477932, 24692353	Standard	NM_001204831		Approved	FLJ10375, MGC47890, SCAR10	uc003cmv.3	Q9NW15	OTTHUMG00000133044	ENST00000292246.3:c.1628G>A	3.37:g.43596810C>T	ENSP00000292246:p.Arg543His		Somatic				ANO10_uc011azs.1_Missense_Mutation_p.R543H|ANO10_uc003cmw.2_Missense_Mutation_p.R477H|ANO10_uc010hil.2_Missense_Mutation_p.R353H|ANO10_uc011azt.1_Missense_Mutation_p.R432H	p.R543H	NM_018075	NP_060545	WXS	Illumina HiSeq	Unspecified	Q9NW15	ANO10_HUMAN			10	1799	-			543			Cytoplasmic (Potential).		A8K8K3|A8MV74|B3KTZ1|B3KY93|B4DJ83|B4DNK2|B7WP12|C9JHS1|Q8IXX9	Missense_Mutation	SNP	ENST00000292246.3	37	c.1628G>A	CCDS2710.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.8|25.8	4.679365|4.679365	0.88542|0.88542	0.0|0.0	1.16E-4|1.16E-4	ENSG00000160746|ENSG00000160746	ENST00000292246;ENST00000350459;ENST00000396091;ENST00000414522;ENST00000451430|ENST00000448045	D;D;D;D;D|.	0.81659|.	-1.52;-1.52;-1.52;-1.52;-1.52|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87204|0.87204	0.6119|0.6119	M|M	0.93241|0.93241	3.395|3.395	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;0.999;0.998;0.997;0.999|.	D|D	0.90150|0.90150	0.4220|0.4220	10|5	0.87932|.	D|.	0|.	.|.	19.4505|19.4505	0.94865|0.94865	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	432;543;353;477;543|.	Q9NW15-4;C9JHS1;Q9NW15-2;Q9NW15-3;Q9NW15|.	.;.;.;.;ANO10_HUMAN|.	H|I	543;353;477;543;432|32	ENSP00000292246:R543H;ENSP00000327767:R353H;ENSP00000379398:R477H;ENSP00000396990:R543H;ENSP00000394119:R432H|.	ENSP00000292246:R543H|.	R|V	-|-	2|1	0|0	ANO10|ANO10	43571814|43571814	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.974000|0.974000	0.67602|0.67602	6.094000|6.094000	0.71431|0.71431	2.597000|2.597000	0.87782|0.87782	0.655000|0.655000	0.94253|0.94253	CGT|GTC		0.363	ANO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256649.2	NM_018075		14	53	0	0	0	0.003163	0	14	53				
PTH1R	5745	broad.mit.edu	37	3	46937261	46937261	+	Missense_Mutation	SNP	C	C	A	rs572975854		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr3:46937261C>A	ENST00000313049.5	+	3	418	c.215C>A	c.(214-216)gCg>gAg	p.A72E	PTH1R_ENST00000490109.1_3'UTR|PTH1R_ENST00000430002.2_Missense_Mutation_p.A72E|PTH1R_ENST00000449590.1_Missense_Mutation_p.A72E|PTH1R_ENST00000418619.1_Missense_Mutation_p.A72E			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	72					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)	p.A72E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	TGGACATCTGCGTCCACATCA	0.552											OREG0015543	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003cqm.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(214-216)GCG>GAG		parathyroid hormone receptor 1 precursor							151.0	121.0	131.0					3																	46937261		2203	4300	6503	SO:0001583	missense	5745	Ollier_disease_/_Maffucsyndrome				cytoplasm|integral to plasma membrane|nucleus	parathyroid hormone receptor activity|peptide hormone binding|protein self-association	g.chr3:46937261C>A		CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.215C>A	3.37:g.46937261C>A	ENSP00000321999:p.Ala72Glu		Somatic	OREG0015543	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	943	PTH1R_uc003cqn.2_Missense_Mutation_p.A72E	p.A72E	NM_000316	NP_000307	WXS	Illumina HiSeq	Unspecified	Q03431	PTH1R_HUMAN			5	418	+			72			Extracellular (Potential).		Q2M1U3	Missense_Mutation	SNP	ENST00000313049.5	37	c.215C>A	CCDS2747.1	.	.	.	.	.	.	.	.	.	.	C	0.211	-1.036330	0.02029	.	.	ENSG00000160801	ENST00000449590;ENST00000418619;ENST00000427125;ENST00000430002;ENST00000313049;ENST00000313063	T;T;T;T;T	0.50548	0.74;0.74;0.75;0.74;0.74	4.9	0.966	0.19667	GPCR, family 2, extracellular hormone receptor domain (1);	.	.	.	.	T	0.25195	0.0612	N	0.22421	0.69	0.09310	N	1	B	0.29646	0.253	B	0.18561	0.022	T	0.15694	-1.0428	9	0.42905	T	0.14	.	1.397	0.02263	0.174:0.4632:0.169:0.1937	.	72	Q03431	PTH1R_HUMAN	E	72;72;72;72;72;244	ENSP00000402723:A72E;ENSP00000411424:A72E;ENSP00000400977:A72E;ENSP00000413774:A72E;ENSP00000321999:A72E	ENSP00000321999:A72E	A	+	2	0	PTH1R	46912265	0.000000	0.05858	0.001000	0.08648	0.222000	0.24845	0.387000	0.20718	0.678000	0.31325	0.561000	0.74099	GCG		0.552	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257481.1	NM_000316		8	31	1	0	0.00307968	0.00308	0.00321475	8	31				
FAM3D	131177	broad.mit.edu	37	3	58629398	58629398	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr3:58629398G>T	ENST00000358781.2	-	6	623	c.313C>A	c.(313-315)Ctg>Atg	p.L105M		NM_138805.2	NP_620160.1	Q96BQ1	FAM3D_HUMAN	family with sequence similarity 3, member D	105					negative regulation of insulin secretion (GO:0046676)	extracellular region (GO:0005576)	cytokine activity (GO:0005125)	p.L105M(1)		large_intestine(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(55;0.000225)|Kidney(10;0.000667)|KIRC - Kidney renal clear cell carcinoma(10;0.000802)|OV - Ovarian serous cystadenocarcinoma(275;0.169)		CCATTCACCAGGGCGATGTTT	0.498																																							uc003dkq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(313-315)CTG>ATG		family with sequence similarity 3, member D							210.0	163.0	179.0					3																	58629398		2203	4300	6503	SO:0001583	missense	131177				negative regulation of insulin secretion	extracellular region	cytokine activity	g.chr3:58629398G>T	AF494381	CCDS2893.1	3p21.1	2008-07-18			ENSG00000198643	ENSG00000198643			18665	protein-coding gene	gene with protein product		608619				12160727	Standard	NM_138805		Approved	EF7, OIT1	uc003dkq.3	Q96BQ1	OTTHUMG00000159148	ENST00000358781.2:c.313C>A	3.37:g.58629398G>T	ENSP00000351632:p.Leu105Met		Somatic					p.L105M	NM_138805	NP_620160	WXS	Illumina HiSeq	Unspecified	Q96BQ1	FAM3D_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000225)|Kidney(10;0.000667)|KIRC - Kidney renal clear cell carcinoma(10;0.000802)|OV - Ovarian serous cystadenocarcinoma(275;0.169)	6	610	-			105					Q547G2	Missense_Mutation	SNP	ENST00000358781.2	37	c.313C>A	CCDS2893.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.374757	0.61735	.	.	ENSG00000198643	ENST00000358781;ENST00000483787;ENST00000489857	T;T;T	0.24350	1.86;1.86;1.86	4.56	2.68	0.31781	.	0.117417	0.37761	N	0.001957	T	0.48660	0.1512	M	0.81942	2.565	0.37150	D	0.902101	D	0.89917	1.0	D	0.91635	0.999	T	0.54330	-0.8310	10	0.56958	D	0.05	-9.9084	9.2452	0.37520	0.0:0.1589:0.6764:0.1647	.	105	Q96BQ1	FAM3D_HUMAN	M	105;104;68	ENSP00000351632:L105M;ENSP00000417099:L104M;ENSP00000417453:L68M	ENSP00000351632:L105M	L	-	1	2	FAM3D	58604438	0.993000	0.37304	0.974000	0.42286	0.989000	0.77384	1.907000	0.39897	0.417000	0.25871	0.591000	0.81541	CTG		0.498	FAM3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353494.1	NM_138805		10	39	1	0	1.08611e-07	0.010729	1.21931e-07	10	39				
HAUS3	79441	broad.mit.edu	37	4	2242226	2242226	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr4:2242226G>A	ENST00000243706.4	-	2	677	c.448C>T	c.(448-450)Cag>Tag	p.Q150*	POLN_ENST00000511885.2_Intron|POLN_ENST00000515357.1_Intron|HAUS3_ENST00000443786.2_Nonsense_Mutation_p.Q150*|HAUS3_ENST00000506763.1_Nonsense_Mutation_p.Q150*	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	150					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.Q150*(1)		breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCTTGACTCTGCTTCAGCTTT	0.363																																							uc003ges.1		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(2)|breast(2)	4						c.(448-450)CAG>TAG		HAUS augmin-like complex, subunit 3							124.0	122.0	123.0					4																	2242226		2203	4300	6503	SO:0001587	stop_gained	79441				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle		g.chr4:2242226G>A	AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.448C>T	4.37:g.2242226G>A	ENSP00000243706:p.Gln150*		Somatic				POLN_uc011bvi.1_Intron|HAUS3_uc011bvj.1_Nonsense_Mutation_p.Q150*|HAUS3_uc003get.1_Nonsense_Mutation_p.Q150*	p.Q150*	NM_024511	NP_078787	WXS	Illumina HiSeq	Unspecified	Q68CZ6	HAUS3_HUMAN			2	678	-			150			Potential.		B4DF64|O43606|Q8TAZ5|Q9BTJ9	Nonsense_Mutation	SNP	ENST00000243706.4	37	c.448C>T	CCDS33941.1	.	.	.	.	.	.	.	.	.	.	G	35	5.582358	0.96578	.	.	ENSG00000214367	ENST00000506763;ENST00000243706;ENST00000443786	.	.	.	5.29	2.27	0.28462	.	0.219785	0.37483	U	0.002077	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-26.1678	9.8756	0.41202	0.0:0.539:0.3431:0.118	.	.	.	.	X	150	.	ENSP00000243706:Q150X	Q	-	1	0	HAUS3	2212024	1.000000	0.71417	0.993000	0.49108	0.937000	0.57800	2.896000	0.48656	0.657000	0.30906	0.655000	0.94253	CAG		0.363	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357446.1	NM_024511		18	72	0	0	0	0.00499	0	18	72				
ENAM	10117	broad.mit.edu	37	4	71508556	71508556	+	Nonsense_Mutation	SNP	T	T	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr4:71508556T>A	ENST00000396073.3	+	9	1694	c.1413T>A	c.(1411-1413)taT>taA	p.Y471*	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	471					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.Y471*(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			AATCAAATTATAAACTGCCTC	0.388																																							uc011caw.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(1411-1413)TAT>TAA		enamelin precursor							34.0	37.0	36.0					4																	71508556		2183	4298	6481	SO:0001587	stop_gained	10117				bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel	g.chr4:71508556T>A	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1413T>A	4.37:g.71508556T>A	ENSP00000379383:p.Tyr471*		Somatic					p.Y471*	NM_031889	NP_114095	WXS	Illumina HiSeq	Unspecified	Q9NRM1	ENAM_HUMAN	Lung(101;0.235)		9	1694	+			471					Q17RI5|Q9H3D1	Nonsense_Mutation	SNP	ENST00000396073.3	37	c.1413T>A	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	T	37	6.111714	0.97291	.	.	ENSG00000132464	ENST00000396073	.	.	.	5.93	0.749	0.18381	.	0.123452	0.37437	N	0.002086	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.6437	8.0393	0.30513	0.0:0.309:0.0:0.691	.	.	.	.	X	471	.	ENSP00000379383:Y471X	Y	+	3	2	ENAM	71727420	1.000000	0.71417	0.873000	0.34254	0.567000	0.35839	1.105000	0.31086	0.157000	0.19338	-0.290000	0.09829	TAT		0.388	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889		8	33	0	0	0	0.004482	0	8	33				
NPY5R	4889	broad.mit.edu	37	4	164272190	164272190	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr4:164272190C>T	ENST00000515560.1	+	4	2287	c.765C>T	c.(763-765)atC>atT	p.I255I	NPY5R_ENST00000338566.3_Silent_p.I255I|NPY5R_ENST00000506953.1_Silent_p.I255I			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	255					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)	p.I255I(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				ATGAGATGATCAACTTAACTC	0.383																																					Melanoma(139;1287 1774 9781 19750 25599)	Melanoma(139;1287 1774 9781 19750 25599)	uc003iqn.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(6)|skin(1)	7						c.(763-765)ATC>ATT		neuropeptide Y receptor Y5							68.0	69.0	68.0					4																	164272190		2203	4300	6503	SO:0001819	synonymous_variant	4889				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane		g.chr4:164272190C>T	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.765C>T	4.37:g.164272190C>T			Somatic					p.I255I	NM_006174	NP_006165	WXS	Illumina HiSeq	Unspecified	Q15761	NPY5R_HUMAN			4	947	+	all_hematologic(180;0.166)	Prostate(90;0.109)	255			Cytoplasmic (Potential).		Q6GTR7|Q92916	Silent	SNP	ENST00000515560.1	37	c.765C>T	CCDS3804.1																																																																																				0.383	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174		3	62	0	0	0	0.004672	0	3	62				
POLK	51426	broad.mit.edu	37	5	74892989	74892989	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:74892989G>T	ENST00000241436.4	+	13	2643	c.2471G>T	c.(2470-2472)aGc>aTc	p.S824I	POLK_ENST00000380481.3_Missense_Mutation_p.S734I|POLK_ENST00000352007.5_Missense_Mutation_p.S626I|POLK_ENST00000508526.1_Missense_Mutation_p.S626I|POLK_ENST00000504026.1_Intron|CTC-366B18.2_ENST00000511329.1_RNA|POLK_ENST00000506928.1_3'UTR	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	824					DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.S824I(2)		endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		CCCAAAGAAAGCTCCAGAAGT	0.294								DNA polymerases (catalytic subunits)																															uc003kdw.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|kidney(2)	4						c.(2470-2472)AGC>ATC	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA-directed DNA polymerase kappa							69.0	79.0	76.0					5																	74892989		2200	4293	6493	SO:0001583	missense	51426				DNA replication|nucleotide-excision repair, DNA gap filling	nucleus	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding	g.chr5:74892989G>T	AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.2471G>T	5.37:g.74892989G>T	ENSP00000241436:p.Ser824Ile		Somatic				POLK_uc003kdx.2_RNA|POLK_uc003kdy.2_RNA|POLK_uc010izq.2_Missense_Mutation_p.S626I|POLK_uc003kec.2_Missense_Mutation_p.S734I|POLK_uc010izr.2_RNA|POLK_uc010izs.2_RNA|POLK_uc003ked.2_Intron|POLK_uc003kee.2_Intron|POLK_uc003kef.2_Missense_Mutation_p.S734I	p.S824I	NM_016218	NP_057302	WXS	Illumina HiSeq	Unspecified	Q9UBT6	POLK_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)	13	2567	+		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)	824					B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Missense_Mutation	SNP	ENST00000241436.4	37	c.2471G>T	CCDS4030.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.807235	0.31961	.	.	ENSG00000122008	ENST00000241436;ENST00000352007;ENST00000508526;ENST00000380481	T;T;T;T	0.58358	1.13;0.34;0.34;1.13	5.49	2.6	0.31112	.	0.812696	0.12194	N	0.490863	T	0.50446	0.1616	L	0.59436	1.845	0.09310	N	1	P;P	0.45474	0.859;0.71	B;B	0.43274	0.414;0.303	T	0.40997	-0.9533	10	0.72032	D	0.01	-3.3952	9.0637	0.36449	0.3788:0.0:0.6212:0.0	.	626;824	Q9UBT6-3;Q9UBT6	.;POLK_HUMAN	I	824;626;626;734	ENSP00000241436:S824I;ENSP00000342256:S626I;ENSP00000426853:S626I;ENSP00000369848:S734I	ENSP00000241436:S824I	S	+	2	0	POLK	74928745	0.099000	0.21834	0.358000	0.25811	0.712000	0.41017	0.385000	0.20685	0.626000	0.30322	0.650000	0.86243	AGC		0.294	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	NM_016218		16	76	1	0	1.02788e-11	0.00499	1.18755e-11	16	76				
TTC37	9652	broad.mit.edu	37	5	94878980	94878980	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:94878980C>A	ENST00000358746.2	-	5	440	c.142G>T	c.(142-144)Gtt>Ttt	p.V48F		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	48						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)		p.V48F(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						GCTGCAGCAACGCCAATAAAA	0.373																																							uc003klb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(142-144)GTT>TTT		tetratricopeptide repeat domain 37							127.0	134.0	131.0					5																	94878980		2203	4300	6503	SO:0001583	missense	9652						binding	g.chr5:94878980C>A	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.142G>T	5.37:g.94878980C>A	ENSP00000351596:p.Val48Phe		Somatic				TTC37_uc010jbf.1_Intron	p.V48F	NM_014639	NP_055454	WXS	Illumina HiSeq	Unspecified	Q6PGP7	TTC37_HUMAN			5	412	-			48			TPR 2.		O15077|Q6PJI3	Missense_Mutation	SNP	ENST00000358746.2	37	c.142G>T	CCDS4072.1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.616140	0.66672	.	.	ENSG00000198677	ENST00000358746;ENST00000513823	T;T	0.44083	0.93;0.93	5.88	5.88	0.94601	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.069724	0.56097	D	0.000027	T	0.44498	0.1296	L	0.33293	1	0.41263	D	0.986791	D	0.61697	0.99	D	0.63381	0.914	T	0.23940	-1.0174	10	0.08179	T	0.78	.	10.534	0.44994	0.1262:0.6945:0.1793:0.0	.	48	Q6PGP7	TTC37_HUMAN	F	48	ENSP00000351596:V48F;ENSP00000425403:V48F	ENSP00000351596:V48F	V	-	1	0	TTC37	94904736	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	0.683000	0.25349	2.789000	0.95967	0.655000	0.94253	GTT		0.373	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639		16	99	1	0	1.3612e-06	0.003163	1.51386e-06	16	99				
MYOT	9499	broad.mit.edu	37	5	137206504	137206504	+	Missense_Mutation	SNP	C	C	T	rs121908457		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:137206504C>T	ENST00000239926.4	+	2	538	c.164C>T	c.(163-165)tCc>tTc	p.S55F	MYOT_ENST00000421631.2_Intron|MYOT_ENST00000509812.1_Intron|RP11-381K20.2_ENST00000514616.1_RNA|MYOT_ENST00000515645.1_Intron	NM_006790.2	NP_006781	Q9UBF9	MYOTI_HUMAN	myotilin	55			S -> F (in LGMD1A and MFM3). {ECO:0000269|PubMed:12428213, ECO:0000269|PubMed:15111675}.		muscle contraction (GO:0006936)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	structural constituent of muscle (GO:0008307)	p.S55F(1)		cervix(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTTTCTGCCTCCTCAACACTG	0.542																																							uc011cye.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1	GRCh37	CM023181	MYOT	M	rs121908457	c.(163-165)TCC>TTC		myotilin isoform b							142.0	129.0	134.0					5																	137206504		2203	4300	6503	SO:0001583	missense	9499				muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle	g.chr5:137206504C>T	AF133820	CCDS4194.1, CCDS47268.1, CCDS75309.1	5q31.2	2014-09-17	2005-09-07	2005-09-07	ENSG00000120729	ENSG00000120729		"""Immunoglobulin superfamily / I-set domain containing"""	12399	protein-coding gene	gene with protein product		604103	"""titin immunoglobulin domain protein (myotilin)"", ""limb-girdle muscular dystrophy 1A (autosomal dominant)"""	TTID, LGMD1A, LGMD1		10486214, 10369880	Standard	NM_006790		Approved		uc003lbv.3	Q9UBF9	OTTHUMG00000129154	ENST00000239926.4:c.164C>T	5.37:g.137206504C>T	ENSP00000239926:p.Ser55Phe		Somatic				MYOT_uc003lbv.2_Missense_Mutation_p.S55F|MYOT_uc011cyg.1_Intron|MYOT_uc011cyh.1_Intron	p.S55F	NM_001135940	NP_001129412	WXS	Illumina HiSeq	Unspecified	Q9UBF9	MYOTI_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		2	181	+			55		S -> F (in LGMD1A and MFM3).			A0A4R6|B4DT79	Missense_Mutation	SNP	ENST00000239926.4	37	c.164C>T	CCDS4194.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.214701	0.79352	.	.	ENSG00000120729	ENST00000239926	T	0.70516	-0.49	6.02	6.02	0.97574	.	0.098116	0.44902	D	0.000408	T	0.72407	0.3456	N	0.24115	0.695	0.80722	A	1	D	0.67145	0.996	P	0.56700	0.804	T	0.74954	-0.3488	9	0.62326	D	0.03	.	18.7178	0.91682	0.0:1.0:0.0:0.0	.	55	Q9UBF9	MYOTI_HUMAN	F	55	ENSP00000239926:S55F	ENSP00000239926:S55F	S	+	2	0	MYOT	137234403	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.360000	0.66086	2.857000	0.98124	0.650000	0.86243	TCC		0.542	MYOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251219.2	NM_006790		17	66	0	0	0	0.006122	0	17	66				
CTNNA1	1495	broad.mit.edu	37	5	138269764	138269764	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:138269764A>G	ENST00000302763.7	+	18	2797	c.2707A>G	c.(2707-2709)Atg>Gtg	p.M903V	CTNNA1_ENST00000540387.1_Missense_Mutation_p.M533V|CTNNA1_ENST00000355078.5_Missense_Mutation_p.M800V|CTNNA1_ENST00000518825.1_3'UTR	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	903					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.M903V(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GTTCAAAGCTATGGACAGCAT	0.527																																							uc003ldh.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11						c.(2707-2709)ATG>GTG		catenin, alpha 1							41.0	41.0	41.0					5																	138269764		2203	4300	6503	SO:0001583	missense	1495				adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding	g.chr5:138269764A>G	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2707A>G	5.37:g.138269764A>G	ENSP00000304669:p.Met903Val		Somatic				CTNNA1_uc011cyx.1_Missense_Mutation_p.M800V|CTNNA1_uc011cyy.1_Missense_Mutation_p.M780V|CTNNA1_uc003ldi.2_Missense_Mutation_p.M601V|CTNNA1_uc003ldj.2_3'UTR|CTNNA1_uc003ldl.2_Missense_Mutation_p.M533V	p.M903V	NM_001903	NP_001894	WXS	Illumina HiSeq	Unspecified	P35221	CTNA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		18	2802	+			903					Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	37	c.2707A>G	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	A	11.26	1.587034	0.28268	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000540387;ENST00000520520	T;T;T	0.26660	2.15;1.72;2.31	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.21631	0.0521	L	0.36672	1.1	0.58432	D	0.999998	B;B	0.17268	0.021;0.012	B;B	0.12837	0.008;0.008	T	0.03148	-1.1067	10	0.32370	T	0.25	-10.118	14.1296	0.65245	1.0:0.0:0.0:0.0	.	780;903	B4DKT9;P35221	.;CTNA1_HUMAN	V	800;903;926;888;533;133	ENSP00000347190:M800V;ENSP00000304669:M903V;ENSP00000438476:M533V	ENSP00000304669:M903V	M	+	1	0	CTNNA1	138297663	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	8.704000	0.91351	2.014000	0.59158	0.459000	0.35465	ATG		0.527	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903		6	30	0	0	0	0.001168	0	6	30				
PCDHA1	56147	broad.mit.edu	37	5	140167508	140167508	+	Missense_Mutation	SNP	C	C	G	rs367694549		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:140167508C>G	ENST00000504120.2	+	1	1633	c.1633C>G	c.(1633-1635)Ctg>Gtg	p.L545V	PCDHA1_ENST00000378133.3_Missense_Mutation_p.L545V|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	545	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L545V(2)		breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGCCGCCTCTGGGCAGCAA	0.682													.|||	1	0.000199681	0.0	0.0014	5008	,	,		16565	0.0		0.0	False		,,,				2504	0.0						uc003lhb.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1633-1635)CTG>GTG		protocadherin alpha 1 isoform 1 precursor							70.0	75.0	73.0					5																	140167508		2203	4294	6497	SO:0001583	missense	56147				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140167508C>G	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1633C>G	5.37:g.140167508C>G	ENSP00000420840:p.Leu545Val		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Missense_Mutation_p.L545V	p.L545V	NM_018900	NP_061723	WXS	Illumina HiSeq	Unspecified	Q9Y5I3	PCDA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1633	+			545			Cadherin 5.|Extracellular (Potential).		O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	c.1633C>G	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	c	16.64	3.178119	0.57692	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	T;T	0.55234	0.53;0.53	3.53	2.65	0.31530	Cadherin (4);Cadherin-like (1);	0.000000	0.31156	U	0.008151	T	0.77890	0.4198	H	0.96833	3.89	0.32087	N	0.592365	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.985	T	0.80892	-0.1179	10	0.87932	D	0	.	7.7466	0.28873	0.0:0.8017:0.0:0.1983	.	545;545	Q9Y5I3;Q9Y5I3-3	PCDA1_HUMAN;.	V	545	ENSP00000420840:L545V;ENSP00000367373:L545V	ENSP00000367373:L545V	L	+	1	2	PCDHA1	140147692	0.971000	0.33674	0.717000	0.30585	0.866000	0.49608	2.365000	0.44196	0.595000	0.29777	0.555000	0.69702	CTG		0.682	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900		4	100	0	0	0	0.009096	0	4	100				
ABLIM3	22885	broad.mit.edu	37	5	148626096	148626096	+	Missense_Mutation	SNP	G	G	A	rs369536848		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:148626096G>A	ENST00000506113.1	+	16	2020	c.1538G>A	c.(1537-1539)cGc>cAc	p.R513H	ABLIM3_ENST00000508983.1_Missense_Mutation_p.R480H|RP11-331K21.1_ENST00000522685.1_RNA|ABLIM3_ENST00000504238.1_Missense_Mutation_p.R402H|AC012613.2_ENST00000523176.1_RNA|ABLIM3_ENST00000356541.3_Missense_Mutation_p.R402H|ABLIM3_ENST00000309868.7_Missense_Mutation_p.R513H|ABLIM3_ENST00000517451.1_5'UTR|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000326685.7_Missense_Mutation_p.R418H			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	513					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)	p.R513H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATTTTGACCGCAGCATGCAC	0.493													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16352	0.0		0.0	False		,,,				2504	0.0						uc003lpy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1537-1539)CGC>CAC		actin binding LIM protein family, member 3							103.0	88.0	93.0					5																	148626096		2203	4300	6503	SO:0001583	missense	22885				axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding	g.chr5:148626096G>A	AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.1538G>A	5.37:g.148626096G>A	ENSP00000425394:p.Arg513His		Somatic				ABLIM3_uc003lpz.1_Missense_Mutation_p.R513H|ABLIM3_uc003lqa.1_Missense_Mutation_p.R410H|ABLIM3_uc003lqb.2_Missense_Mutation_p.R402H|ABLIM3_uc003lqc.1_Missense_Mutation_p.R480H|ABLIM3_uc003lqd.1_Missense_Mutation_p.R418H|ABLIM3_uc003lqf.2_Missense_Mutation_p.R402H|ABLIM3_uc003lqe.1_Missense_Mutation_p.R402H	p.R513H	NM_014945	NP_055760	WXS	Illumina HiSeq	Unspecified	O94929	ABLM3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		17	1789	+			513					A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	ENST00000506113.1	37	c.1538G>A	CCDS4294.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.329386	0.41197	.	.	ENSG00000173210	ENST00000326685;ENST00000356541;ENST00000309868;ENST00000506113;ENST00000504238;ENST00000508983	T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43	5.81	3.86	0.44501	.	0.157318	0.64402	N	0.000018	T	0.22003	0.0530	L	0.27053	0.805	0.45477	D	0.998446	B;B;B	0.17268	0.002;0.002;0.021	B;B;B	0.08055	0.002;0.002;0.003	T	0.02774	-1.1112	10	0.48119	T	0.1	.	11.825	0.52261	0.1523:0.0:0.8477:0.0	.	418;402;513	O94929-3;O94929-2;O94929	.;.;ABLM3_HUMAN	H	418;402;513;513;402;480	ENSP00000315841:R418H;ENSP00000348938:R402H;ENSP00000310309:R513H;ENSP00000425394:R513H;ENSP00000421183:R402H;ENSP00000420855:R480H	ENSP00000310309:R513H	R	+	2	0	ABLIM3	148606289	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.502000	0.53332	0.672000	0.31204	0.655000	0.94253	CGC		0.493	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373435.1	NM_014945		3	48	0	0	0	0.009096	0	3	48				
NMUR2	56923	broad.mit.edu	37	5	151775143	151775143	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:151775143C>A	ENST00000255262.3	-	3	979	c.814G>T	c.(814-816)Gtc>Ttc	p.V272F	NMUR2_ENST00000518933.1_5'UTR	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	272					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)	p.V272F(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AAGACCAAGACAACTGAAAAT	0.458																																							uc003luv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8						c.(814-816)GTC>TTC		neuromedin U receptor 2							122.0	107.0	112.0					5																	151775143		2203	4300	6503	SO:0001583	missense	56923				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity	g.chr5:151775143C>A	AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.814G>T	5.37:g.151775143C>A	ENSP00000255262:p.Val272Phe		Somatic					p.V272F	NM_020167	NP_064552	WXS	Illumina HiSeq	Unspecified	Q9GZQ4	NMUR2_HUMAN	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)		3	980	-		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	272			Helical; Name=6; (Potential).		Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	37	c.814G>T	CCDS4321.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.775013	0.49786	.	.	ENSG00000132911	ENST00000255262	T	0.43294	0.95	5.8	2.67	0.31697	GPCR, rhodopsin-like superfamily (1);	0.443303	0.22940	N	0.053795	T	0.53465	0.1798	M	0.88512	2.96	0.38713	D	0.953253	B	0.32653	0.379	B	0.38296	0.27	T	0.61515	-0.7047	10	0.72032	D	0.01	-17.0956	12.5414	0.56172	0.0:0.7431:0.0:0.2569	.	272	Q9GZQ4	NMUR2_HUMAN	F	272	ENSP00000255262:V272F	ENSP00000255262:V272F	V	-	1	0	NMUR2	151755336	1.000000	0.71417	0.997000	0.53966	0.747000	0.42532	1.631000	0.37092	0.387000	0.25024	-0.797000	0.03246	GTC		0.458	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167		4	11	1	0	0.00024832	0.009096	0.000266217	4	11				
LSM11	134353	broad.mit.edu	37	5	157181030	157181030	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:157181030G>A	ENST00000286307.5	+	3	663	c.607G>A	c.(607-609)Gag>Aag	p.E203K		NM_173491.2	NP_775762.1	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	203	SM 1.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U7 snRNP (GO:0005683)	U7 snRNA binding (GO:0071209)	p.E203K(1)		breast(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	7	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGATGTGGATGAGACCTACCG	0.408																																							uc003lxe.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(607-609)GAG>AAG		LSM11, U7 small nuclear RNA associated							132.0	114.0	120.0					5																	157181030		2203	4300	6503	SO:0001583	missense	134353				histone mRNA 3'-end processing|S phase of mitotic cell cycle|termination of RNA polymerase II transcription	histone pre-mRNA 3'end processing complex|nucleoplasm|U7 snRNP	protein binding|U7 snRNA binding	g.chr5:157181030G>A	AK095592	CCDS4342.1	5q33.3	2008-02-05	2004-04-28		ENSG00000155858	ENSG00000155858			30860	protein-coding gene	gene with protein product			"""LSM11 homolog, U7 small nuclear RNA associated (S. cerevisiae)"""			12975319	Standard	NM_173491		Approved	FLJ38273	uc003lxe.1	P83369	OTTHUMG00000130255	ENST00000286307.5:c.607G>A	5.37:g.157181030G>A	ENSP00000286307:p.Glu203Lys		Somatic				LSM11_uc003lxf.1_5'Flank	p.E203K	NM_173491	NP_775762	WXS	Illumina HiSeq	Unspecified	P83369	LSM11_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		3	611	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	203			SM 1.		A0AVQ1|Q7Z7P0|Q8N975	Missense_Mutation	SNP	ENST00000286307.5	37	c.607G>A	CCDS4342.1	.	.	.	.	.	.	.	.	.	.	G	36	5.846231	0.97016	.	.	ENSG00000155858	ENST00000286307	T	0.59638	0.25	6.17	6.17	0.99709	Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (2);	0.000000	0.85682	D	0.000000	T	0.81351	0.4804	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82486	-0.0433	10	0.87932	D	0	-23.9066	20.8794	0.99867	0.0:0.0:1.0:0.0	.	203	P83369	LSM11_HUMAN	K	203	ENSP00000286307:E203K	ENSP00000286307:E203K	E	+	1	0	LSM11	157113608	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.521000	0.98029	2.941000	0.99782	0.655000	0.94253	GAG		0.408	LSM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252580.2	NM_173491		14	40	0	0	0	0.003163	0	14	40				
ATP10B	23120	broad.mit.edu	37	5	160114890	160114890	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:160114890C>T	ENST00000327245.5	-	5	1038	c.192G>A	c.(190-192)agG>agA	p.R64R	ATP10B_ENST00000518411.1_5'UTR|CTC-529G1.1_ENST00000524198.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	64					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R64R(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGGGTATCTCCTGGAGACCT	0.498																																							uc003lym.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(190-192)AGG>AGA		ATPase, class V, type 10B							236.0	240.0	239.0					5																	160114890		1975	4156	6131	SO:0001819	synonymous_variant	23120				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr5:160114890C>T	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.192G>A	5.37:g.160114890C>T			Somatic				ATP10B_uc003lyp.2_Silent_p.R64R|ATP10B_uc011deg.1_Silent_p.R108R|ATP10B_uc003lyo.2_5'Flank	p.R64R	NM_025153	NP_079429	WXS	Illumina HiSeq	Unspecified	O94823	AT10B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		5	1039	-	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	64			Cytoplasmic (Potential).		Q9H725	Silent	SNP	ENST00000327245.5	37	c.192G>A	CCDS43394.1																																																																																				0.498	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		27	127	0	0	0	0.00632	0	27	127				
ATXN1	6310	broad.mit.edu	37	6	16327538	16327538	+	Missense_Mutation	SNP	C	C	T	rs554480203		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr6:16327538C>T	ENST00000244769.4	-	8	1940	c.1004G>A	c.(1003-1005)gGg>gAg	p.G335E	ATXN1_ENST00000436367.1_Missense_Mutation_p.G335E	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	335					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.G335E(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				GGACGGGGCCCCGTACCGCCG	0.682																																							uc003nbt.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|central_nervous_system(1)	4						c.(1003-1005)GGG>GAG		ataxin 1							38.0	46.0	43.0					6																	16327538		2203	4300	6503	SO:0001583	missense	6310				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association	g.chr6:16327538C>T	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.1004G>A	6.37:g.16327538C>T	ENSP00000244769:p.Gly335Glu		Somatic				ATXN1_uc010jpi.2_Missense_Mutation_p.G335E|ATXN1_uc010jpj.1_Intron	p.G335E	NM_000332	NP_000323	WXS	Illumina HiSeq	Unspecified	P54253	ATX1_HUMAN			8	1975	-	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)	335					Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	c.1004G>A	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.704189	0.88924	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.80393	-1.37;-1.37	5.07	5.07	0.68467	.	0.149903	0.64402	D	0.000012	D	0.87346	0.6154	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88588	0.3141	10	0.72032	D	0.01	-20.3666	18.4555	0.90718	0.0:1.0:0.0:0.0	.	335	P54253	ATX1_HUMAN	E	335	ENSP00000244769:G335E;ENSP00000416360:G335E	ENSP00000244769:G335E	G	-	2	0	ATXN1	16435517	1.000000	0.71417	0.988000	0.46212	0.983000	0.72400	5.525000	0.67110	2.353000	0.79882	0.561000	0.74099	GGG		0.682	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332		21	70	0	0	0	0.010504	0	21	70				
UHRF1BP1	54887	broad.mit.edu	37	6	34825625	34825625	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr6:34825625C>G	ENST00000192788.5	+	13	1869	c.1698C>G	c.(1696-1698)atC>atG	p.I566M	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.I566M	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	566							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)	p.I566M(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						TCAAAGCTATCTACAAGCTGG	0.443																																							uc003oju.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1696-1698)ATC>ATG		ICBP90 binding protein 1							138.0	128.0	131.0					6																	34825625		1906	4122	6028	SO:0001583	missense	54887							g.chr6:34825625C>G	AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.1698C>G	6.37:g.34825625C>G	ENSP00000192788:p.Ile566Met		Somatic				UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_5'Flank	p.I566M	NM_017754	NP_060224	WXS	Illumina HiSeq	Unspecified	Q6BDS2	URFB1_HUMAN			13	1932	+			566					Q9NXE0	Missense_Mutation	SNP	ENST00000192788.5	37	c.1698C>G	CCDS43455.1	.	.	.	.	.	.	.	.	.	.	C	7.433	0.639113	0.14386	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.09163	3.01;3.01	6.06	2.34	0.29019	.	0.052873	0.85682	D	0.000000	T	0.02267	0.0070	L	0.29908	0.895	0.37901	D	0.931051	P	0.36438	0.553	B	0.37888	0.26	T	0.48479	-0.9032	10	0.25106	T	0.35	-21.0565	2.4016	0.04402	0.1214:0.4496:0.2358:0.1931	.	566	Q6BDS2	URFB1_HUMAN	M	566	ENSP00000192788:I566M;ENSP00000400628:I566M	ENSP00000192788:I566M	I	+	3	3	UHRF1BP1	34933603	0.997000	0.39634	1.000000	0.80357	0.999000	0.98932	0.572000	0.23684	0.445000	0.26639	0.655000	0.94253	ATC		0.443	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754		7	104	0	0	0	0.001984	0	7	104				
PNLDC1	154197	broad.mit.edu	37	6	160239658	160239658	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr6:160239658A>C	ENST00000610273.1	+	16	1367	c.1196A>C	c.(1195-1197)aAc>aCc	p.N399T	PNLDC1_ENST00000392167.3_Missense_Mutation_p.N410T	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	399						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.N399T(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AACCAAGTGAACCTCATCCGA	0.572																																							uc003qsx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1195-1197)AAC>ACC		poly(A)-specific ribonuclease (PARN)-like domain							80.0	76.0	78.0					6																	160239658		2203	4300	6503	SO:0001583	missense	154197					integral to membrane|nucleus	nucleic acid binding	g.chr6:160239658A>C	AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1196A>C	6.37:g.160239658A>C	ENSP00000476448:p.Asn399Thr		Somatic				PNLDC1_uc003qsy.1_Missense_Mutation_p.N410T	p.N399T	NM_173516	NP_775787	WXS	Illumina HiSeq	Unspecified	Q8NA58	PNDC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)	16	1367	+		Breast(66;0.00519)|Ovarian(120;0.123)	399			Cytoplasmic (Potential).		Q5TAP7|Q8N7X5	Missense_Mutation	SNP	ENST00000610273.1	37	c.1196A>C	CCDS5271.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.133169	0.77662	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000001	T	0.47451	0.1446	L	0.29908	0.895	0.33162	D	0.547108	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.46555	-0.9183	9	0.20519	T	0.43	.	14.4446	0.67340	1.0:0.0:0.0:0.0	.	410;399	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	T	399;410	.	ENSP00000275275:N399T	N	+	2	0	PNLDC1	160159648	1.000000	0.71417	0.719000	0.30619	0.800000	0.45204	5.731000	0.68554	2.149000	0.67028	0.459000	0.35465	AAC		0.572	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516		7	34	0	0	0	0.008291	0	7	34				
KCND2	3751	broad.mit.edu	37	7	119914843	119914843	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr7:119914843C>G	ENST00000331113.4	+	1	1122	c.157C>G	c.(157-159)Cag>Gag	p.Q53E		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	53					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.Q53E(2)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CACCCGCTTCCAGACGTGGCA	0.562																																							uc003vjj.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.(157-159)CAG>GAG		potassium voltage-gated channel, Shal-related							129.0	136.0	134.0					7																	119914843		2203	4300	6503	SO:0001583	missense	3751				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding	g.chr7:119914843C>G	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.157C>G	7.37:g.119914843C>G	ENSP00000333496:p.Gln53Glu		Somatic					p.Q53E	NM_012281	NP_036413	WXS	Illumina HiSeq	Unspecified	Q9NZV8	KCND2_HUMAN			1	1122	+	all_neural(327;0.117)		53			Cytoplasmic (Potential).		O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	37	c.157C>G	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	C	3.666	-0.068604	0.07228	.	.	ENSG00000184408	ENST00000331113	T	0.74947	-0.89	5.51	5.51	0.81932	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	T	0.49047	0.1534	N	0.01228	-0.945	0.53688	D	0.999975	B	0.06786	0.001	B	0.10450	0.005	T	0.51364	-0.8715	9	.	.	.	.	19.427	0.94746	0.0:1.0:0.0:0.0	.	53	Q9NZV8	KCND2_HUMAN	E	53	ENSP00000333496:Q53E	.	Q	+	1	0	KCND2	119702079	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.863000	0.62983	2.603000	0.88011	0.655000	0.94253	CAG		0.562	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281		5	192	0	0	0	0.014758	0	5	192				
SND1	27044	broad.mit.edu	37	7	127724820	127724820	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr7:127724820G>T	ENST00000354725.3	+	19	2349	c.2155G>T	c.(2155-2157)Gcc>Tcc	p.A719S	MIR593_ENST00000384856.1_RNA	NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	719					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)	p.A719S(1)		central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						CAATGACATTGCCAGTCACCC	0.562																																							uc003vmi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2155-2157)GCC>TCC		staphylococcal nuclease domain containing 1							98.0	85.0	89.0					7																	127724820		2203	4300	6503	SO:0001583	missense	27044				gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity	g.chr7:127724820G>T		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2155G>T	7.37:g.127724820G>T	ENSP00000346762:p.Ala719Ser		Somatic				SND1_uc010lle.2_Missense_Mutation_p.A372S	p.A719S	NM_014390	NP_055205	WXS	Illumina HiSeq	Unspecified	Q7KZF4	SND1_HUMAN			19	2381	+			719					Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	c.2155G>T	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	G	8.849	0.944133	0.18281	.	.	ENSG00000197157	ENST00000354725;ENST00000438400;ENST00000486037	T;T	0.09350	2.99;2.99	5.52	-3.09	0.05331	Maternal tudor protein (1);	0.329287	0.35207	N	0.003365	T	0.04679	0.0127	L	0.27053	0.805	0.45330	D	0.998329	B	0.02656	0.0	B	0.06405	0.002	T	0.45977	-0.9224	10	0.08599	T	0.76	-1.4859	5.3507	0.16034	0.2329:0.0:0.2528:0.5142	.	719	Q7KZF4	SND1_HUMAN	S	719;709;205	ENSP00000346762:A719S;ENSP00000419327:A205S	ENSP00000346762:A719S	A	+	1	0	SND1	127512056	0.618000	0.27051	0.527000	0.27925	0.890000	0.51754	0.828000	0.27435	-0.723000	0.04915	-0.291000	0.09656	GCC		0.562	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390		6	37	1	0	0.00116845	0.001168	0.00124147	6	37				
KMT2C	58508	broad.mit.edu	37	7	151849821	151849821	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr7:151849821C>A	ENST00000262189.6	-	49	12713	c.12495G>T	c.(12493-12495)caG>caT	p.Q4165H	KMT2C_ENST00000485241.1_5'Flank|KMT2C_ENST00000355193.2_Missense_Mutation_p.Q4222H	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4165					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.Q4165H(1)|p.Q4222H(1)									GTACATTAGGCTGCTTCAGCC	0.473																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(12493-12495)CAG>CAT		myeloid/lymphoid or mixed-lineage leukemia 3							119.0	108.0	111.0					7																	151849821		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151849821C>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12495G>T	7.37:g.151849821C>A	ENSP00000262189:p.Gln4165His		Somatic				MLL3_uc003wkz.2_Missense_Mutation_p.Q3283H|MLL3_uc003wkx.2_Missense_Mutation_p.Q323H|MLL3_uc003wky.2_Missense_Mutation_p.Q1729H	p.Q4165H	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	49	12714	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	4165					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.12495G>T	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.43|14.43	2.532431|2.532431	0.45073|0.45073	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000360104|ENST00000262189;ENST00000355193;ENST00000424877	.|D;D;D	.|0.89050	.|-1.78;-1.76;-2.46	5.71|5.71	1.31|1.31	0.21738|0.21738	.|.	.|0.179504	.|0.26058	.|U	.|0.026598	D|D	0.91408|0.91408	0.7289|0.7289	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.61697	.|0.99;0.988;0.978	.|D;P;P	.|0.64877	.|0.93;0.847;0.847	D|D	0.89928|0.89928	0.4064|0.4064	5|10	.|0.62326	.|D	.|0.03	.|.	10.5206|10.5206	0.44916|0.44916	0.0:0.6116:0.0:0.3884|0.0:0.6116:0.0:0.3884	.|.	.|4165;3283;4222	.|Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	.|MLL3_HUMAN;.;.	S|H	1726|4165;4222;782	.|ENSP00000262189:Q4165H;ENSP00000347325:Q4222H;ENSP00000410411:Q782H	.|ENSP00000262189:Q4165H	A|Q	-|-	1|3	0|2	MLL3|MLL3	151480754|151480754	0.991000|0.991000	0.36638|0.36638	0.911000|0.911000	0.35937|0.35937	0.963000|0.963000	0.63663|0.63663	0.118000|0.118000	0.15605|0.15605	0.339000|0.339000	0.23719|0.23719	-0.145000|-0.145000	0.13849|0.13849	GCC|CAG		0.473	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			16	88	1	0	3.52763e-06	0.00499	3.88693e-06	16	88				
MTMR9	66036	broad.mit.edu	37	8	11174186	11174186	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr8:11174186G>C	ENST00000221086.3	+	8	1591	c.1118G>C	c.(1117-1119)gGt>gCt	p.G373A	MTMR9_ENST00000526292.1_Missense_Mutation_p.G288A|AF131216.6_ENST00000498997.2_RNA	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	373	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)	p.G373A(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CCCTAGGCTGGTCACCCATTC	0.522																																							uc003wtm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1117-1119)GGT>GCT		myotubularin related protein 9							59.0	47.0	51.0					8																	11174186		2203	4300	6503	SO:0001583	missense	66036					cytoplasm	phosphatase activity|protein binding	g.chr8:11174186G>C	AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.1118G>C	8.37:g.11174186G>C	ENSP00000221086:p.Gly373Ala		Somatic				MTMR9_uc010lrx.2_Missense_Mutation_p.G266A|MTMR9_uc011kxa.1_Missense_Mutation_p.G288A|uc003wtn.1_RNA	p.G373A	NM_015458	NP_056273	WXS	Illumina HiSeq	Unspecified	Q96QG7	MTMR9_HUMAN	STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)	8	1516	+			373			Myotubularin phosphatase.		B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Missense_Mutation	SNP	ENST00000221086.3	37	c.1118G>C	CCDS5979.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.728298	0.89390	.	.	ENSG00000104643	ENST00000221086;ENST00000526292	D;D	0.99098	-5.42;-5.42	4.87	4.87	0.63330	Myotubularin phosphatase domain (1);	0.000000	0.85682	D	0.000000	D	0.99492	0.9819	H	0.94345	3.525	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98233	1.0484	10	0.87932	D	0	.	17.156	0.86791	0.0:0.0:1.0:0.0	.	373	Q96QG7	MTMR9_HUMAN	A	373;288	ENSP00000221086:G373A;ENSP00000433239:G288A	ENSP00000221086:G373A	G	+	2	0	MTMR9	11211596	1.000000	0.71417	0.998000	0.56505	0.933000	0.57130	9.428000	0.97476	2.540000	0.85666	0.591000	0.81541	GGT		0.522	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207307.2	NM_015458		5	10	0	0	0	0.014758	0	5	10				
RAD54B	25788	broad.mit.edu	37	8	95416341	95416341	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr8:95416341C>T	ENST00000336148.5	-	6	1032	c.908G>A	c.(907-909)gGa>gAa	p.G303E		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	303					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)	p.G303E(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GAATATGATTCCTTCTTTCTG	0.328								Direct reversal of damage;Homologous recombination																															uc003ygk.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(2)|lung(1)|skin(1)	4						c.(907-909)GGA>GAA	Direct_reversal_of_damage|Homologous_recombination	RAD54 homolog B							87.0	76.0	80.0					8																	95416341		2203	4300	6503	SO:0001583	missense	25788				double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding	g.chr8:95416341C>T	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.908G>A	8.37:g.95416341C>T	ENSP00000336606:p.Gly303Glu		Somatic				RAD54B_uc010may.1_Missense_Mutation_p.G110E|RAD54B_uc003ygl.1_RNA	p.G303E	NM_012415	NP_036547	WXS	Illumina HiSeq	Unspecified	O95073	FSBP_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00217)		6	1006	-	Breast(36;4.5e-05)		Error:Variant_position_missing_in_O95073_after_alignment					F6WBS8	Missense_Mutation	SNP	ENST00000336148.5	37	c.908G>A	CCDS6262.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.949492	0.92660	.	.	ENSG00000197275	ENST00000336148	D	0.94457	-3.43	5.24	5.24	0.73138	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98785	0.9591	H	0.99650	4.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99521	1.0958	10	0.87932	D	0	-30.5474	18.8189	0.92088	0.0:1.0:0.0:0.0	.	303	Q9Y620	RA54B_HUMAN	E	303	ENSP00000336606:G303E	ENSP00000336606:G303E	G	-	2	0	RAD54B	95485517	1.000000	0.71417	0.949000	0.38748	0.984000	0.73092	7.818000	0.86416	2.436000	0.82500	0.655000	0.94253	GGA		0.328	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415		11	31	0	0	0	0.010729	0	11	31				
TRIB1	10221	broad.mit.edu	37	8	126445604	126445604	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr8:126445604C>T	ENST00000311922.3	+	2	988	c.406C>T	c.(406-408)Cag>Tag	p.Q136*	TRIB1_ENST00000520847.1_5'UTR|TRIB1_ENST00000521778.1_3'UTR|TRIB1_ENST00000519576.1_5'Flank	NM_001282985.1|NM_025195.2	NP_001269914.1|NP_079471.1			tribbles pseudokinase 1									p.Q136*(1)		NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			GCCTTACATCCAGCTGCCATC	0.512																																							uc003yrx.2		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(1)	1						c.(406-408)CAG>TAG		G-protein-coupled receptor induced protein							197.0	200.0	199.0					8																	126445604		2203	4300	6503	SO:0001587	stop_gained	10221				JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity	g.chr8:126445604C>T	AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000311922.3:c.406C>T	8.37:g.126445604C>T	ENSP00000312150:p.Gln136*		Somatic				TRIB1_uc011lis.1_5'UTR|TRIB1_uc010mdn.2_5'Flank	p.Q136*	NM_025195	NP_079471	WXS	Illumina HiSeq	Unspecified	Q96RU8	TRIB1_HUMAN	STAD - Stomach adenocarcinoma(47;0.000918)		2	988	+	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		136			Protein kinase.			Nonsense_Mutation	SNP	ENST00000311922.3	37	c.406C>T	CCDS6357.1	.	.	.	.	.	.	.	.	.	.	C	42	9.268368	0.99120	.	.	ENSG00000173334	ENST00000311922	.	.	.	4.91	4.04	0.47022	.	0.000000	0.31809	U	0.007024	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.2446	9.7924	0.40715	0.0:0.8418:0.0:0.1582	.	.	.	.	X	136	.	ENSP00000312150:Q136X	Q	+	1	0	TRIB1	126514786	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.174000	0.42482	1.216000	0.43427	0.511000	0.50034	CAG		0.512	TRIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381430.1	NM_025195		6	205	0	0	0	0.001984	0	6	205				
TRIB1	10221	broad.mit.edu	37	8	126448609	126448609	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr8:126448609G>T	ENST00000519576.1	+	2	585	c.322G>T	c.(322-324)Gag>Tag	p.E108*	TRIB1_ENST00000311922.3_Nonsense_Mutation_p.E339*|TRIB1_ENST00000520847.1_Nonsense_Mutation_p.E173*					tribbles pseudokinase 1									p.E339*(2)		NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			CCCCTGGTTTGAGTCCGTCTT	0.547																																							uc003yrx.2		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(1)	1						c.(1015-1017)GAG>TAG		G-protein-coupled receptor induced protein							85.0	87.0	86.0					8																	126448609		2203	4300	6503	SO:0001587	stop_gained	10221				JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity	g.chr8:126448609G>T	AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000519576.1:c.322G>T	8.37:g.126448609G>T	ENSP00000428879:p.Glu108*		Somatic				TRIB1_uc011lis.1_Nonsense_Mutation_p.E173*|TRIB1_uc010mdn.2_Nonsense_Mutation_p.E108*	p.E339*	NM_025195	NP_079471	WXS	Illumina HiSeq	Unspecified	Q96RU8	TRIB1_HUMAN	STAD - Stomach adenocarcinoma(47;0.000918)		3	1597	+	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		339						Nonsense_Mutation	SNP	ENST00000519576.1	37	c.1015G>T		.	.	.	.	.	.	.	.	.	.	G	25.2	4.612419	0.87258	.	.	ENSG00000173334	ENST00000311922;ENST00000520847;ENST00000519576	.	.	.	5.62	2.72	0.32119	.	0.000000	0.33572	U	0.004769	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.3933	9.7985	0.40751	0.0:0.2542:0.4831:0.2627	.	.	.	.	X	339;173;108	.	ENSP00000312150:E339X	E	+	1	0	TRIB1	126517791	0.984000	0.35163	0.099000	0.21106	0.426000	0.31534	2.437000	0.44828	0.261000	0.21753	0.561000	0.74099	GAG		0.547	TRIB1-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000381433.1	NM_025195		11	87	1	0	1.08611e-07	0.010729	1.21931e-07	11	87				
ZNF252P	286101	broad.mit.edu	37	8	146220464	146220464	+	RNA	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr8:146220464G>A	ENST00000426361.2	-	0	245				RP5-1047A19.4_ENST00000530223.1_RNA	NR_023392.1				zinc finger protein 252, pseudogene											endometrium(1)	1						TGACCAGTCTGGGGGCACTGG	0.478																																							uc003zey.2		NA																	0					0						c.(193-195)GGG>AGG		Homo sapiens mRNA for Tmp21-II putative transcribed pseudogene.																																						286102							g.chr8:146220464G>A	BC019922		8q24.3	2012-10-05	2012-04-19	2012-04-19	ENSG00000196922	ENSG00000196922			13046	pseudogene	pseudogene			"""zinc finger protein 252"""	ZNF252			Standard	NR_023392		Approved		uc011llo.2		OTTHUMG00000165201		8.37:g.146220464G>A			Somatic				ZNF252_uc003zew.3_Intron|ZNF252_uc011llo.1_Intron	p.G65R	NR_002807		WXS	Illumina HiSeq	Unspecified					1	214	+									Missense_Mutation	SNP	ENST00000426361.2	37	c.193G>A																																																																																					0.478	ZNF252P-008	KNOWN	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000451422.1	NR_023392		5	26	0	0	0	0.014758	0	5	26				
KIAA0020	9933	broad.mit.edu	37	9	2811463	2811463	+	Silent	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr9:2811463C>A	ENST00000397885.2	-	15	1739	c.1533G>T	c.(1531-1533)gtG>gtT	p.V511V		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	511						endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.V511V(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		GAATGTCAGACACCAACACAC	0.537																																							uc003zhp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1531-1533)GTG>GTT		KIAA0020 protein							188.0	164.0	172.0					9																	2811463		2203	4300	6503	SO:0001819	synonymous_variant	9933					endoplasmic reticulum|nucleolus	RNA binding	g.chr9:2811463C>A	AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1533G>T	9.37:g.2811463C>A			Somatic				KIAA0020_uc010mhc.1_Silent_p.V510V|KIAA0020_uc003zhq.1_Silent_p.V510V	p.V511V	NM_014878	NP_055693	WXS	Illumina HiSeq	Unspecified	Q15397	K0020_HUMAN		GBM - Glioblastoma multiforme(50;0.0319)	15	1629	-			511					A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Silent	SNP	ENST00000397885.2	37	c.1533G>T	CCDS6448.2																																																																																				0.537	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051529.3	NM_014878		15	87	1	0	4.75885e-15	0.00499	5.60696e-15	15	87				
SH2D3C	10044	broad.mit.edu	37	9	130536699	130536699	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr9:130536699A>G	ENST00000314830.8	-	2	198	c.85T>C	c.(85-87)Tcc>Ccc	p.S29P	SH2D3C_ENST00000373277.4_5'Flank|SH2D3C_ENST00000471939.1_5'Flank	NM_170600.2	NP_733745.1	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C	29					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)	p.S29P(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGAGTGAAGGACCGAGGGAGG	0.512																																							uc004bsc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(85-87)TCC>CCC		SH2 domain containing 3C isoform a							62.0	58.0	59.0					9																	130536699		2203	4300	6503	SO:0001583	missense	10044				JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity	g.chr9:130536699A>G	AF124251	CCDS6877.1, CCDS6878.1, CCDS48026.1, CCDS48028.1, CCDS59145.1	9q33.1-q33.3	2013-02-14	2002-01-14		ENSG00000095370	ENSG00000095370		"""SH2 domain containing"""	16884	protein-coding gene	gene with protein product		604722	"""SH2 domain-containing 3C"""			10187783	Standard	NM_170600		Approved	NSP3	uc004bsc.3	Q8N5H7	OTTHUMG00000020717	ENST00000314830.8:c.85T>C	9.37:g.130536699A>G	ENSP00000317817:p.Ser29Pro		Somatic				SH2D3C_uc004bsd.1_5'UTR	p.S29P	NM_170600	NP_733745	WXS	Illumina HiSeq	Unspecified	Q8N5H7	SH2D3_HUMAN			2	227	-			29					A8K5S8|E9PG48|Q5HYE5|Q5JU31|Q6UY42|Q8N6X3|Q9Y2X5	Missense_Mutation	SNP	ENST00000314830.8	37	c.85T>C	CCDS6877.1	.	.	.	.	.	.	.	.	.	.	A	13.54	2.267217	0.40095	.	.	ENSG00000095370	ENST00000314830	T	0.12879	2.64	5.03	3.82	0.43975	.	0.229896	0.30714	N	0.009026	T	0.11707	0.0285	L	0.29908	0.895	0.80722	D	1	P	0.48911	0.917	P	0.46049	0.502	T	0.08534	-1.0717	10	0.27785	T	0.31	-0.2429	9.4644	0.38804	0.8427:0.0:0.0:0.1573	.	29	Q8N5H7	SH2D3_HUMAN	P	29	ENSP00000317817:S29P	ENSP00000317817:S29P	S	-	1	0	SH2D3C	129576520	0.905000	0.30787	1.000000	0.80357	0.978000	0.69477	0.537000	0.23144	2.034000	0.60081	0.459000	0.35465	TCC		0.512	SH2D3C-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054264.1	NM_005489		3	28	0	0	0	0.004672	0	3	28				
PHKA2	5256	broad.mit.edu	37	X	18927024	18927024	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chrX:18927024C>T	ENST00000379942.4	-	21	2920	c.2255G>A	c.(2254-2256)aGa>aAa	p.R752K		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	752					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.R752K(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					ATGGTCATCTCTGGGCCACTG	0.468																																							uc004cyv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2254-2256)AGA>AAA		phosphorylase kinase, alpha 2 (liver)							220.0	188.0	199.0					X																	18927024		2203	4300	6503	SO:0001583	missense	5256				glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:18927024C>T		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2255G>A	X.37:g.18927024C>T	ENSP00000369274:p.Arg752Lys		Somatic				PHKA2_uc004cyu.3_Missense_Mutation_p.R50K	p.R752K	NM_000292	NP_000283	WXS	Illumina HiSeq	Unspecified	P46019	KPB2_HUMAN			21	2685	-	Hepatocellular(33;0.183)		752					A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	c.2255G>A	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.286603	0.40494	.	.	ENSG00000044446	ENST00000379942	D	0.90504	-2.68	5.55	2.28	0.28536	Glycoside hydrolase 15-related (1);	0.271740	0.41500	D	0.000861	T	0.80363	0.4609	L	0.31578	0.945	0.38142	D	0.938479	B	0.02656	0.0	B	0.10450	0.005	T	0.67356	-0.5691	10	0.24483	T	0.36	-4.4402	2.8389	0.05523	0.0:0.3038:0.2349:0.4612	.	752	P46019	KPB2_HUMAN	K	752	ENSP00000369274:R752K	ENSP00000369274:R752K	R	-	2	0	PHKA2	18836945	0.636000	0.27207	0.992000	0.48379	0.935000	0.57460	0.819000	0.27308	0.479000	0.27511	0.529000	0.55759	AGA		0.468	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		26	68	0	0	0	0.004656	0	26	68				
DMD	1756	broad.mit.edu	37	X	32361373	32361373	+	Silent	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chrX:32361373G>A	ENST00000357033.4	-	40	5823	c.5617C>T	c.(5617-5619)Cta>Tta	p.L1873L	DMD_ENST00000378677.2_Silent_p.L1869L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1873	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.L1873L(1)|p.L532L(1)|p.L1869L(1)|p.L1868L(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GAAATTTCTAGAGCCTTTTTT	0.378																																							uc004dda.1		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(5617-5619)CTA>TTA		dystrophin Dp427m isoform							108.0	97.0	100.0					X																	32361373		2202	4300	6502	SO:0001819	synonymous_variant	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32361373G>A	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5617C>T	X.37:g.32361373G>A			Somatic				DMD_uc004dcw.2_Silent_p.L529L|DMD_uc004dcx.2_Silent_p.L532L|DMD_uc004dcz.2_Silent_p.L1750L|DMD_uc004dcy.1_Silent_p.L1869L|DMD_uc004ddb.1_Silent_p.L1865L|DMD_uc010ngo.1_Intron	p.L1873L	NM_004006	NP_003997	WXS	Illumina HiSeq	Unspecified	P11532	DMD_HUMAN			40	5861	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1873			Interaction with SYNM (By similarity).		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	c.5617C>T	CCDS14233.1																																																																																				0.378	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		17	35	0	0	0	0.007413	0	17	35				
GPR112	139378	broad.mit.edu	37	X	135487991	135487991	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chrX:135487991G>A	ENST00000394143.1	+	23	9086	c.8795G>A	c.(8794-8796)cGg>cAg	p.R2932Q	GPR112_ENST00000412101.1_Missense_Mutation_p.R2727Q|GPR112_ENST00000394141.1_Missense_Mutation_p.R2727Q|GPR112_ENST00000370652.1_Missense_Mutation_p.R2932Q|GPR112_ENST00000287534.4_Missense_Mutation_p.R2685Q	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2932					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R2932Q(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AAGACTCGGCGGAAGATGATC	0.458																																							uc004ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(8794-8796)CGG>CAG		G-protein coupled receptor 112							150.0	131.0	137.0					X																	135487991		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135487991G>A	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8795G>A	X.37:g.135487991G>A	ENSP00000377699:p.Arg2932Gln		Somatic				GPR112_uc010nsb.1_Missense_Mutation_p.R2727Q	p.R2932Q	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			23	9086	+	Acute lymphoblastic leukemia(192;0.000127)		2932			Cytoplasmic (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.8795G>A	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.883870	0.33255	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17	4.71	-2.74	0.05932	GPCR, family 2-like (1);	.	.	.	.	T	0.28300	0.0699	L	0.39147	1.195	0.09310	N	1	P;B	0.36048	0.534;0.129	B;B	0.33750	0.059;0.169	T	0.13176	-1.0519	9	0.66056	D	0.02	.	13.1032	0.59233	0.6964:0.0:0.3036:0.0	.	2727;2932	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	Q	2932;2932;2727;2685;2727	ENSP00000377699:R2932Q;ENSP00000359686:R2932Q;ENSP00000416526:R2727Q;ENSP00000287534:R2685Q;ENSP00000377697:R2727Q	ENSP00000287534:R2685Q	R	+	2	0	GPR112	135315657	0.000000	0.05858	0.001000	0.08648	0.385000	0.30292	-0.544000	0.06077	-0.868000	0.04058	-0.208000	0.12717	CGG		0.458	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			14	47	0	0	0	0.016723	0	14	47				
LRRTM3	347731	broad.mit.edu	37	10	68686763	68686763	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:68686763delC	ENST00000361320.4	+	2	667	c.89delC	c.(88-90)gccfs	p.A30fs	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	30					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						CTTTCTTCTGCCGAACGAGGA	0.438																																							uc001jmz.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(88-90)GCCfs		leucine rich repeat transmembrane neuronal 3							101.0	95.0	97.0					10																	68686763		2203	4300	6503	SO:0001589	frameshift_variant	347731					integral to membrane		g.chr10:68686763delC	BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.89delC	10.37:g.68686763delC	ENSP00000355187:p.Ala30fs		Somatic				CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Frame_Shift_Del_p.A30fs	p.A30fs	NM_178011	NP_821079	WXS	Illumina HiSeq	Unspecified	Q86VH5	LRRT3_HUMAN			2	639	+			30					A8K2A3|Q2NKX7|Q6N0A3	Frame_Shift_Del	DEL	ENST00000361320.4	37	c.89delC	CCDS7270.1																																																																																				0.438	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2	NM_178011		7	68	NA	NA	NA	NA	NA	7	68	---	---	---	---
NFE2	4778	broad.mit.edu	37	12	54686563	54686571	+	In_Frame_Del	DEL	CGTAGGAAA	CGTAGGAAA	-	rs201993310		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	CGTAGGAAA	CGTAGGAAA	-	-	CGTAGGAAA	CGTAGGAAA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:54686563_54686571delCGTAGGAAA	ENST00000540264.2	-	2	1218_1226	c.709_717delTTTCCTACG	c.(709-717)tttcctacgdel	p.FPT237del	NFE2_ENST00000553070.1_In_Frame_Del_p.FPT237del|RP11-968A15.8_ENST00000553061.1_RNA|NFE2_ENST00000312156.4_In_Frame_Del_p.FPT237del|NFE2_ENST00000435572.2_In_Frame_Del_p.FPT237del			Q16621	NFE2_HUMAN	nuclear factor, erythroid 2	237					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|hemostasis (GO:0007599)|labyrinthine layer blood vessel development (GO:0060716)|multicellular organismal development (GO:0007275)|negative regulation of bone mineralization (GO:0030502)|negative regulation of syncytium formation by plasma membrane fusion (GO:0034242)|nucleosome disassembly (GO:0006337)|positive regulation of peptidyl-lysine acetylation (GO:2000758)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(7)|upper_aerodigestive_tract(2)	16						CAATCTTGTCCGTAGGAAAAGGAATCTTC	0.589																																							uc009znk.2		NA																	0					0						c.(709-717)TTTCCTACGdel		nuclear factor, erythroid derived 2 isoform 1																																				SO:0001651	inframe_deletion	4778				blood circulation|blood coagulation|multicellular organismal development|nucleosome disassembly|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	actin cytoskeleton|cytoplasm|PML body	protein dimerization activity|protein N-terminus binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|WW domain binding	g.chr12:54686563_54686571delCGTAGGAAA	BC005044	CCDS8876.1	12q13	2013-08-23	2013-08-23			ENSG00000123405		"""basic leucine zipper proteins"""	7780	protein-coding gene	gene with protein product		601490	"""nuclear factor (erythroid-derived 2), 45kD"", ""nuclear factor (erythroid-derived 2), 45kDa"""			8355703	Standard	NM_001136023		Approved	NF-E2	uc001sfr.5	Q16621		ENST00000540264.2:c.709_717delTTTCCTACG	12.37:g.54686563_54686571delCGTAGGAAA	ENSP00000439120:p.Phe237_Thr239del		Somatic				NFE2_uc001sfq.2_In_Frame_Del_p.FPT237del|NFE2_uc001sfr.3_In_Frame_Del_p.FPT237del|NFE2_uc009znl.2_In_Frame_Del_p.FPT237del	p.FPT237del	NM_006163	NP_006154	WXS	Illumina HiSeq	Unspecified	Q16621	NFE2_HUMAN			2	1219_1227	-			237_239					Q07720|Q6ICV9	In_Frame_Del	DEL	ENST00000540264.2	37	c.709_717delTTTCCTACG	CCDS8876.1																																																																																				0.589	NFE2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405747.1	NM_006163		7	52	NA	NA	NA	NA	NA	7	52	---	---	---	---
CTDSP1	58190	broad.mit.edu	37	2	219266341	219266342	+	Frame_Shift_Ins	INS	-	-	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:219266341_219266342insA	ENST00000273062.2	+	2	458_459	c.122_123insA	c.(121-126)tcactcfs	p.L42fs	CTDSP1_ENST00000488627.1_3'UTR|CTDSP1_ENST00000443891.1_Frame_Shift_Ins_p.L42fs|RP11-378A13.2_ENST00000608367.1_RNA|MIR26B_ENST00000362251.2_RNA	NM_021198.2|NM_182642.2	NP_067021.1|NP_872580.1	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1	42					negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|protein dephosphorylation (GO:0006470)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			NS(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	8		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATCCTCCACTCACTCTTCTGCT	0.639																																							uc002vhy.2		NA																	0				ovary(1)	1						c.(121-123)TCAfs		CTD (carboxy-terminal domain, RNA polymerase II,																																				SO:0001589	frameshift_variant	58190				protein dephosphorylation|regulation of transcription from RNA polymerase II promoter	nucleus	CTD phosphatase activity|metal ion binding|protein binding	g.chr2:219266341_219266342insA	AF229162	CCDS2416.1, CCDS56166.1	2q35	2010-06-21			ENSG00000144579	ENSG00000144579		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	21614	protein-coding gene	gene with protein product	"""nuclear LIM interactor-interacting factor"", ""small CTD phosphatase 1"""	605323				11950066, 12721286	Standard	NM_021198		Approved	NLIIF, SCP1	uc021vwv.1	Q9GZU7	OTTHUMG00000133109	ENST00000273062.2:c.123dupA	2.37:g.219266342_219266342dupA	ENSP00000273062:p.Leu42fs		Somatic				CTDSP1_uc002vhx.2_Frame_Shift_Ins_p.S41fs|CTDSP1_uc002vhz.2_5'Flank|uc010zkd.1_5'Flank|MIR26B_hsa-mir-26b|MI0000084_5'Flank	p.S41fs	NM_021198	NP_067021	WXS	Illumina HiSeq	Unspecified	Q9GZU7	CTDS1_HUMAN		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	2	458_459	+		Renal(207;0.0915)	41					C9IYG0|Q7Z5Q3|Q7Z5Q4	Frame_Shift_Ins	INS	ENST00000273062.2	37	c.122_123insA	CCDS2416.1																																																																																				0.639	CTDSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256774.1	NM_182642, NM_021198		10	69	NA	NA	NA	NA	NA	10	69	---	---	---	---
