#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
HPCA	3208	broad.mit.edu	37	1	33354743	33354743	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr1:33354743T>A	ENST00000373467.3	+	2	346	c.244T>A	c.(244-246)Ttt>Att	p.F82I	HPCA_ENST00000480118.1_3'UTR	NM_002143.2	NP_002134.2	P84074	HPCA_HUMAN	hippocalcin	82	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				inner ear development (GO:0048839)		actin binding (GO:0003779)|calcium ion binding (GO:0005509)	p.F82I(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CACCATAGACTTTCGGGAGTT	0.567																																							uc001bwh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(244-246)TTT>ATT		hippocalcin							139.0	124.0	129.0					1																	33354743		2203	4300	6503	SO:0001583	missense	3208						actin binding|calcium ion binding	g.chr1:33354743T>A	BC001777	CCDS370.1	1p35-p34.2	2013-01-10			ENSG00000121905	ENSG00000121905		"""EF-hand domain containing"""	5144	protein-coding gene	gene with protein product		142622				8166736, 9931466	Standard	NM_002143		Approved		uc001bwh.3	P84074	OTTHUMG00000004017	ENST00000373467.3:c.244T>A	1.37:g.33354743T>A	ENSP00000362566:p.Phe82Ile		Somatic					p.F82I	NM_002143	NP_002134	WXS	Illumina HiSeq	Unspecified	P84074	HPCA_HUMAN			2	284	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)	82			EF-hand 2.|1 (Potential).		B2R9T3|D3DPQ7|P32076|P41211|P70510	Missense_Mutation	SNP	ENST00000373467.3	37	c.244T>A	CCDS370.1	.	.	.	.	.	.	.	.	.	.	T	34	5.354659	0.95854	.	.	ENSG00000121905	ENST00000373467	T	0.72942	-0.7	5.22	5.22	0.72569	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.90075	0.6900	H	0.98370	4.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93546	0.6882	10	0.87932	D	0	.	14.3821	0.66919	0.0:0.0:0.0:1.0	.	82	P84074	HPCA_HUMAN	I	82	ENSP00000362566:F82I	ENSP00000362566:F82I	F	+	1	0	HPCA	33127330	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.795000	0.85887	2.333000	0.79357	0.533000	0.62120	TTT		0.567	HPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011480.1	NM_002143		27	49	0	0	0	0.007291	0	27	49				
SMAP2	64744	broad.mit.edu	37	1	40882768	40882769	+	Splice_Site	DNP	GG	GG	TT			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr1:40882768_40882769GG>TT	ENST00000539317.1	+	9	1117	c.924_924GG>TT	c.(922-924)caGG>caTTg	p.Q308H		NM_001198980.1	NP_001185909.1	Q8WU79	SMAP2_HUMAN	small ArfGAP2	388	Met-rich.				regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.?(1)		central_nervous_system(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			ACCTTACTCAGGTAAGCTACCC	0.505																																							uc001cfj.2		NA																	1	Unknown(1)		lung(1)		0						c.e9+1		small ArfGAP2																																				SO:0001630	splice_region_variant	64744				regulation of ARF GTPase activity	cytoplasm|nucleus	ARF GTPase activator activity|zinc ion binding	g.chr1:40882768_40882769GG>TT	AL137764	CCDS451.1, CCDS55592.1, CCDS55593.1, CCDS72763.1	1p35.3-p34.1	2008-09-22	2008-09-05	2008-01-09	ENSG00000084070	ENSG00000084070		"""ADP-ribosylation factor GTPase activating proteins"""	25082	protein-coding gene	gene with protein product			"""stromal membrane-associated protein 1-like"", ""stromal membrane-associated GTPase-activating protein 2"""	SMAP1L		16571680	Standard	NM_001198978		Approved		uc001cfj.3	Q8WU79	OTTHUMG00000007301	Exception_encountered	1.37:g.40882768_40882769delinsTT			Somatic				SMAP2_uc001cfk.2_Splice_Site_p.Q358_splice|SMAP2_uc010oji.1_Splice_Site_p.Q305_splice|SMAP2_uc010ojj.1_Splice_Site_p.Q204_splice	p.Q388_splice	NM_022733	NP_073570	WXS	Illumina HiSeq	Unspecified	Q8WU79	SMAP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)		9	1229	+	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)						B2R7T1|B7Z5B5|B7Z8V2|D3DPV2|Q5QPL2|Q96C93|Q9NST2|Q9UJL8	Splice_Site	DNP	ENST00000539317.1	37	c.1164_splice	CCDS55593.1																																																																																				0.505	SMAP2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022733	Missense_Mutation	3	19	0	0	0	0.004672	0	3	19				
C1orf168	199920	broad.mit.edu	37	1	57252852	57252852	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr1:57252852C>A	ENST00000343433.6	-	4	1029	c.949G>T	c.(949-951)Gag>Tag	p.E317*	C1orf168_ENST00000484327.1_5'UTR	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	317								p.E317*(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						ACTTACCTCTCTGGAGACAGG	0.488																																							uc001cym.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|skin(2)	5						c.(949-951)GAG>TAG		hypothetical protein LOC199920							122.0	109.0	113.0					1																	57252852		2203	4300	6503	SO:0001587	stop_gained	199920							g.chr1:57252852C>A	BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.949G>T	1.37:g.57252852C>A	ENSP00000345972:p.Glu317*		Somatic				C1orf168_uc009vzu.1_RNA	p.E317*	NM_001004303	NP_001004303	WXS	Illumina HiSeq	Unspecified	Q5VWT5	CA168_HUMAN			4	1355	-			317					Q63HM3|Q6ZUY6	Nonsense_Mutation	SNP	ENST00000343433.6	37	c.949G>T	CCDS30729.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.292210	0.80914	.	.	ENSG00000187889	ENST00000343433	.	.	.	5.26	4.34	0.51931	.	0.889394	0.09505	N	0.793114	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	9.4099	0.38485	0.0:0.9047:0.0:0.0953	.	.	.	.	X	317	.	ENSP00000345972:E317X	E	-	1	0	C1orf168	57025440	0.991000	0.36638	0.943000	0.38184	0.019000	0.09904	2.221000	0.42917	1.440000	0.47531	0.557000	0.71058	GAG		0.488	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2	NM_001004303		8	99	1	0	1.58986e-06	0.008291	2.06874e-06	8	99				
KCNH1	3756	broad.mit.edu	37	1	211280615	211280615	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr1:211280615G>T	ENST00000271751.4	-	2	211	c.184C>A	c.(184-186)Caa>Aaa	p.Q62K	KCNH1_ENST00000367007.4_Missense_Mutation_p.Q62K			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	62	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.Q62K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CTGCTTTTTTGCATCACTTCT	0.408																																							uc001hib.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(184-186)CAA>AAA		potassium voltage-gated channel, subfamily H,							136.0	138.0	138.0					1																	211280615		2203	4300	6503	SO:0001583	missense	3756				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity	g.chr1:211280615G>T	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.184C>A	1.37:g.211280615G>T	ENSP00000271751:p.Gln62Lys		Somatic				KCNH1_uc001hic.2_Missense_Mutation_p.Q62K	p.Q62K	NM_172362	NP_758872	WXS	Illumina HiSeq	Unspecified	O95259	KCNH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)	2	354	-			62			Cytoplasmic (Potential).|PAS.		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	c.184C>A	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.633431	0.87660	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.99519	-6.07;-6.07	5.62	5.62	0.85841	PAS (3);PAS fold (1);	0.000000	0.85682	D	0.000000	D	0.99566	0.9844	M	0.88105	2.93	0.80722	D	1	P;D	0.76494	0.835;0.999	P;D	0.66847	0.612;0.947	D	0.98472	1.0601	10	0.59425	D	0.04	.	18.6649	0.91486	0.0:0.0:1.0:0.0	.	62;62	Q14CL3;O95259	.;KCNH1_HUMAN	K	62	ENSP00000271751:Q62K;ENSP00000355974:Q62K	ENSP00000271751:Q62K	Q	-	1	0	KCNH1	209347238	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.417000	0.97391	2.634000	0.89283	0.655000	0.94253	CAA		0.408	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238		22	114	1	0	2.98393e-07	0.00278	3.97858e-07	22	114				
KCTD3	51133	broad.mit.edu	37	1	215792243	215792243	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr1:215792243G>T	ENST00000259154.4	+	16	1872	c.1578G>T	c.(1576-1578)caG>caT	p.Q526H	KCTD3_ENST00000495537.1_3'UTR	NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	526					protein homooligomerization (GO:0051260)			p.Q526H(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		GTGAGATCCAGGCTGTTGACT	0.413																																							uc001hks.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1576-1578)CAG>CAT		potassium channel tetramerisation domain							93.0	92.0	92.0					1																	215792243		2203	4300	6503	SO:0001583	missense	51133					voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	g.chr1:215792243G>T	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.1578G>T	1.37:g.215792243G>T	ENSP00000259154:p.Gln526His		Somatic				KCTD3_uc001hkt.2_Missense_Mutation_p.Q526H|KCTD3_uc010pub.1_Missense_Mutation_p.Q424H|KCTD3_uc009xdn.2_Missense_Mutation_p.Q250H	p.Q526H	NM_016121	NP_057205	WXS	Illumina HiSeq	Unspecified	Q9Y597	KCTD3_HUMAN		all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)	16	1872	+			526					A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	ENST00000259154.4	37	c.1578G>T	CCDS1515.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.918905	0.52546	.	.	ENSG00000136636	ENST00000259154	T	0.51325	0.71	5.6	-7.52	0.01341	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.57577	0.2063	L	0.53249	1.67	0.54753	D	0.999986	D;D;P;P	0.67145	0.994;0.996;0.894;0.621	P;D;B;B	0.64877	0.904;0.93;0.431;0.213	T	0.69250	-0.5194	10	0.87932	D	0	-16.5516	20.6177	0.99473	0.2082:0.0:0.7918:0.0	.	278;278;526;526	B7ZAF7;B4DJX2;Q9Y597-2;Q9Y597	.;.;.;KCTD3_HUMAN	H	526	ENSP00000259154:Q526H	ENSP00000259154:Q526H	Q	+	3	2	KCTD3	213858866	0.993000	0.37304	0.734000	0.30879	0.987000	0.75469	0.227000	0.17795	-1.508000	0.01800	-0.312000	0.09012	CAG		0.413	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121		13	52	1	0	0.000151284	0.001855	0.000181541	13	52				
OR2W3	343171	broad.mit.edu	37	1	248059653	248059653	+	Silent	SNP	C	C	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr1:248059653C>A	ENST00000360358.3	+	1	765	c.765C>A	c.(763-765)atC>atA	p.I255I	OR2W3_ENST00000537741.1_Silent_p.I255I	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I255I(1)		breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ATGGAAACATCATCTACATGT	0.527																																							uc001idp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)|pancreas(1)	3						c.(763-765)ATC>ATA		olfactory receptor, family 2, subfamily W,							143.0	131.0	135.0					1																	248059653		2203	4300	6503	SO:0001819	synonymous_variant	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248059653C>A	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.765C>A	1.37:g.248059653C>A			Somatic				OR2W3_uc010pzb.1_Silent_p.I255I	p.I255I	NM_001001957	NP_001001957	WXS	Illumina HiSeq	Unspecified	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	1034	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		255			Helical; Name=6; (Potential).		Q6IF06|Q8NG86	Silent	SNP	ENST00000360358.3	37	c.765C>A	CCDS31099.1																																																																																				0.527	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		6	105	1	0	8.12818e-05	0.001984	9.86341e-05	6	105				
OR2L13	284521	broad.mit.edu	37	1	248154224	248154224	+	Intron	SNP	C	C	T	rs4925586	byFrequency	TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr1:248154224C>T	ENST00000366478.2	+	1	194					NM_175911.2	NP_787107.1	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TTCCTATGGCCGGATTCTCCT	0.498													.|||	72	0.014377	0.0015	0.0202	5008	,	,		23061	0.0		0.0398	False		,,,				2504	0.0164						uc001idv.1		NA																	0					0						c.(412-414)CGG>TGG		RecName: Full=Olfactory receptor 2L5; AltName: Full=Olfactory receptor OR1-53;																																				SO:0001627	intron_variant	26247							g.chr1:248154224C>T	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000366478.2:c.-144+53538C>T	1.37:g.248154224C>T			Somatic				OR2L13_uc001ids.2_Intron	p.R138W	NR_002145		WXS	Illumina HiSeq	Unspecified					1	656	+								Q5VUR5	Missense_Mutation	SNP	ENST00000366478.2	37	c.412C>T	CCDS1637.1																																																																																				0.498	OR2L13-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_175911		23	42	0	0	0	0.00278	0	23	42				
RBP3	5949	broad.mit.edu	37	10	48385969	48385969	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr10:48385969G>T	ENST00000224600.4	-	2	3236	c.3123C>A	c.(3121-3123)aaC>aaA	p.N1041K	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	1041	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)	p.N1041K(1)		central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	AGTAGCCAATGTTGTCCTCAA	0.507																																							uc001jez.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(3121-3123)AAC>AAA		retinol-binding protein 3 precursor	Vitamin A(DB00162)						145.0	135.0	138.0					10																	48385969		2203	4300	6503	SO:0001583	missense	5949				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity	g.chr10:48385969G>T	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.3123C>A	10.37:g.48385969G>T	ENSP00000224600:p.Asn1041Lys		Somatic					p.N1041K	NM_002900	NP_002891	WXS	Illumina HiSeq	Unspecified	P10745	RET3_HUMAN			2	3237	-			1041			4 X approximate tandem repeats.|4.		Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	37	c.3123C>A	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550995	0.45383	.	.	ENSG00000107618	ENST00000224600	T	0.66280	-0.2	5.14	1.2	0.21068	Interphotoreceptor retinol-binding (2);	0.000000	0.85682	D	0.000000	T	0.76828	0.4042	M	0.83692	2.655	0.53688	D	0.999972	D	0.89917	1.0	D	0.91635	0.999	T	0.75811	-0.3186	10	0.87932	D	0	-46.409	9.5074	0.39056	0.2908:0.0:0.7092:0.0	.	1041	P10745	RET3_HUMAN	K	1041	ENSP00000224600:N1041K	ENSP00000224600:N1041K	N	-	3	2	RBP3	48005975	1.000000	0.71417	0.265000	0.24526	0.831000	0.47069	4.253000	0.58791	0.030000	0.15379	-0.224000	0.12420	AAC		0.507	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900		5	106	1	0	3.59834e-05	0.001168	4.51884e-05	5	106				
OR4C15	81309	broad.mit.edu	37	11	55322400	55322400	+	Silent	SNP	C	C	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr11:55322400C>T	ENST00000314644.2	+	1	618	c.618C>T	c.(616-618)ctC>ctT	p.L206L		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L206L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						CAGGGGGCCTCTTGCATTCCA	0.468										HNSCC(20;0.049)																													uc010rig.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(616-618)CTC>CTT		olfactory receptor, family 4, subfamily C,							92.0	87.0	89.0					11																	55322400		2201	4296	6497	SO:0001819	synonymous_variant	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55322400C>T	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.618C>T	11.37:g.55322400C>T		HNSCC(20;0.049)	Somatic					p.L206L	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	618	+			152			Helical; Name=4; (Potential).		Q6IFE2	Silent	SNP	ENST00000314644.2	37	c.618C>T	CCDS31501.1																																																																																				0.468	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		6	70	0	0	0	0.001168	0	6	70				
RSF1	51773	broad.mit.edu	37	11	77378462	77378462	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr11:77378462G>A	ENST00000308488.6	-	16	4128	c.3826C>T	c.(3826-3828)Cga>Tga	p.R1276*	RSF1_ENST00000480887.1_Nonsense_Mutation_p.R1024*|RSF1_ENST00000360355.2_Nonsense_Mutation_p.R1245*			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1276					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.R1276*(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			TCTGTGCTTCGGCCCCGCTTT	0.488																																							uc001oyn.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(3826-3828)CGA>TGA		remodeling and spacing factor 1							84.0	81.0	82.0					11																	77378462		2200	4292	6492	SO:0001587	stop_gained	51773				CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding	g.chr11:77378462G>A	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.3826C>T	11.37:g.77378462G>A	ENSP00000311513:p.Arg1276*		Somatic				RSF1_uc001oym.2_Nonsense_Mutation_p.R1024*	p.R1276*	NM_016578	NP_057662	WXS	Illumina HiSeq	Unspecified	Q96T23	RSF1_HUMAN	Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)		16	3946	-	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		1276					Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Nonsense_Mutation	SNP	ENST00000308488.6	37	c.3826C>T	CCDS8253.1	.	.	.	.	.	.	.	.	.	.	G	48	13.973023	0.99773	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355	.	.	.	5.13	5.13	0.70059	.	0.194718	0.25642	N	0.029271	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5127	13.3696	0.60705	0.0:0.0:0.8424:0.1576	.	.	.	.	X	1276;1024;1245	.	ENSP00000311513:R1276X	R	-	1	2	RSF1	77056110	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.016000	0.49607	2.681000	0.91329	0.462000	0.41574	CGA		0.488	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578		5	76	0	0	0	0.001168	0	5	76				
ALG9	79796	broad.mit.edu	37	11	111708285	111708285	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr11:111708285G>A	ENST00000531154.1	-	12	1337	c.865C>T	c.(865-867)Cca>Tca	p.P289S	ALG9_ENST00000524880.1_3'UTR|ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000398006.2_Missense_Mutation_p.P282S	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	453			V -> I (in dbSNP:rs10502151). {ECO:0000269|PubMed:12030331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15148656}.		cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)	p.P289S(1)|p.P685S(1)|p.P686S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		TGGATGGTTGGGTCTGTAGCA	0.473																																							uc001pmb.2		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(1)|ovary(1)	2						c.(1357-1359)CCA>TCA		asparagine-linked glycosylation 9 protein							131.0	135.0	134.0					11																	111708285		1881	4105	5986	SO:0001583	missense	79796				dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity	g.chr11:111708285G>A		CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.865C>T	11.37:g.111708285G>A	ENSP00000435517:p.Pro289Ser		Somatic				ALG9_uc001ply.2_Missense_Mutation_p.P282S|ALG9_uc001plz.2_Missense_Mutation_p.P289S|ALG9_uc010rwm.1_Missense_Mutation_p.P460S|ALG9_uc010rwn.1_Missense_Mutation_p.P407S|ALG9_uc010rwo.1_Missense_Mutation_p.P281S|ALG9_uc009yyh.1_Missense_Mutation_p.P348S	p.P453S	NM_001077690	NP_001071158	WXS	Illumina HiSeq	Unspecified	Q9H6U8	ALG9_HUMAN		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)	13	1456	-		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	453			Lumenal (Potential).		Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Missense_Mutation	SNP	ENST00000531154.1	37	c.1357C>T	CCDS41714.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.255407	0.80135	.	.	ENSG00000086848	ENST00000531154;ENST00000398006;ENST00000428306	T;T	0.64085	-0.08;-0.08	5.87	5.87	0.94306	.	0.044340	0.85682	D	0.000000	T	0.76162	0.3949	M	0.73598	2.24	0.80722	D	1	D;B;B;B	0.62365	0.991;0.335;0.449;0.339	P;B;B;B	0.62089	0.898;0.135;0.209;0.226	T	0.68481	-0.5397	10	0.09338	T	0.73	-5.1854	20.5827	0.99408	0.0:0.0:1.0:0.0	.	282;460;686;453	B4DQI3;Q9H6U8-3;B4DYW0;Q9H6U8	.;.;.;ALG9_HUMAN	S	289;282;686	ENSP00000435517:P289S;ENSP00000381090:P282S	ENSP00000381090:P282S	P	-	1	0	ALG9	111213495	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.949000	0.87791	2.941000	0.99782	0.655000	0.94253	CCA		0.473	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391485.1	NM_024740		19	30	0	0	0	0.008871	0	19	30				
SPX	80763	broad.mit.edu	37	12	21679861	21679861	+	Silent	SNP	G	G	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr12:21679861G>T	ENST00000256969.2	+	2	214	c.48G>T	c.(46-48)ctG>ctT	p.L16L		NM_030572.2	NP_085049.1	Q9BT56	SPXN_HUMAN		16					long-chain fatty acid import (GO:0044539)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of renal sodium excretion (GO:0035814)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of sensory perception of pain (GO:0051930)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)	p.L16L(1)		endometrium(3)|large_intestine(1)|lung(2)|urinary_tract(1)	7						CTCTTTTCCTGGTGTTTGTTT	0.448																																							uc001rfa.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(46-48)CTG>CTT		spexin precursor							160.0	162.0	161.0					12																	21679861		2203	4300	6503	SO:0001819	synonymous_variant	80763					extracellular region|nucleus|transport vesicle		g.chr12:21679861G>T																												ENST00000256969.2:c.48G>T	12.37:g.21679861G>T			Somatic				C12orf39_uc009ziv.1_5'Flank|C12orf39_uc009ziw.1_5'Flank	p.L16L	NM_030572	NP_085049	WXS	Illumina HiSeq	Unspecified	Q9BT56	SPXN_HUMAN			2	199	+			16					B3KND6	Silent	SNP	ENST00000256969.2	37	c.48G>T	CCDS31757.1																																																																																				0.448	C12orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402389.1			7	69	1	0	2.17888e-05	0.006214	2.76846e-05	7	69				
TMTC1	83857	broad.mit.edu	37	12	29786142	29786142	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr12:29786142C>A	ENST00000539277.1	-	6	1124	c.1066G>T	c.(1066-1068)Gcc>Tcc	p.A356S	TMTC1_ENST00000256062.5_Missense_Mutation_p.A248S|TMTC1_ENST00000381224.2_Missense_Mutation_p.A310S|TMTC1_ENST00000551659.1_Missense_Mutation_p.A418S|TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000552618.1_Missense_Mutation_p.A418S	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	356						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.A248S(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					AAGATGGTGGCTAAGTTCCGC	0.483																																							uc001rjb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(742-744)GCC>TCC		transmembrane and tetratricopeptide repeat							124.0	112.0	116.0					12																	29786142		2203	4300	6503	SO:0001583	missense	83857					integral to membrane	binding	g.chr12:29786142C>A		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.1066G>T	12.37:g.29786142C>A	ENSP00000442046:p.Ala356Ser		Somatic				TMTC1_uc001riz.2_Missense_Mutation_p.A5S|TMTC1_uc001rja.2_Missense_Mutation_p.A92S|TMTC1_uc001rjc.1_Missense_Mutation_p.A310S	p.A248S	NM_175861	NP_787057	WXS	Illumina HiSeq	Unspecified	Q8IUR5	TMTC1_HUMAN			6	1216	-	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)		356			Helical; (Potential).		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	c.742G>T	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	.	29.3	4.992696	0.93167	.	.	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.53	5.53	0.82687	Domain of unknown function DUF1736 (1);	0.000000	0.85682	D	0.000000	T	0.64136	0.2571	M	0.67397	2.05	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.971;0.998	T	0.62416	-0.6859	9	.	.	.	-18.8081	18.03	0.89281	0.0:1.0:0.0:0.0	.	310;356;418	Q8IUR5-3;Q8IUR5;F8VTQ9	.;TMTC1_HUMAN;.	S	119;248;418;418;356;310	ENSP00000256062:A248S;ENSP00000448112:A418S;ENSP00000449043:A418S;ENSP00000442046:A356S;ENSP00000370622:A310S	.	A	-	1	0	TMTC1	29677409	1.000000	0.71417	0.974000	0.42286	0.989000	0.77384	6.989000	0.76219	2.582000	0.87167	0.655000	0.94253	GCC		0.483	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920		9	58	1	0	7.48243e-07	0.006214	9.85491e-07	9	58				
MGAT4C	25834	broad.mit.edu	37	12	86377333	86377333	+	Missense_Mutation	SNP	C	C	T	rs375819261		TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr12:86377333C>T	ENST00000604798.1	-	7	1467	c.263G>A	c.(262-264)cGc>cAc	p.R88H	MGAT4C_ENST00000393205.2_Missense_Mutation_p.R117H|MGAT4C_ENST00000549405.2_Missense_Mutation_p.R88H|MGAT4C_ENST00000332156.1_Missense_Mutation_p.R88H|MGAT4C_ENST00000552435.2_Missense_Mutation_p.R88H|MGAT4C_ENST00000552808.2_Missense_Mutation_p.R88H|MGAT4C_ENST00000548651.1_Missense_Mutation_p.R88H			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	88					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.R88H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						AGCTAGGTAGCGATAGGTGAC	0.318																																							uc001tai.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(262-264)CGC>CAC		alpha-1,3-mannosyl-glycoprotein		C	HIS/ARG	0,4406		0,0,2203	114.0	121.0	118.0		263	5.4	1.0	12		118	1,8599	1.2+/-3.3	0,1,4299	no	missense	MGAT4C	NM_013244.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	88/479	86377333	1,13005	2203	4300	6503	SO:0001583	missense	25834				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr12:86377333C>T		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.263G>A	12.37:g.86377333C>T	ENSP00000474896:p.Arg88His		Somatic				MGAT4C_uc001tal.3_Missense_Mutation_p.R88H|MGAT4C_uc001taj.3_Missense_Mutation_p.R88H|MGAT4C_uc001tak.3_Missense_Mutation_p.R88H|MGAT4C_uc010sum.1_Missense_Mutation_p.R112H|MGAT4C_uc001tah.3_Missense_Mutation_p.R88H	p.R88H	NM_013244	NP_037376	WXS	Illumina HiSeq	Unspecified	Q9UBM8	MGT4C_HUMAN			7	1513	-			88			Lumenal (Potential).		B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	ENST00000604798.1	37	c.263G>A	CCDS9030.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.433452	0.62955	0.0	1.16E-4	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225;ENST00000552435	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.29458	0.0734	N	0.19112	0.55	0.58432	D	0.999991	P;B	0.35401	0.499;0.439	B;B	0.27715	0.082;0.061	T	0.06445	-1.0826	10	0.34782	T	0.22	-2.1411	19.2681	0.93997	0.0:1.0:0.0:0.0	.	117;88	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	H	88;117;88;88;88;88;88;88	ENSP00000331664:R88H;ENSP00000376900:R117H;ENSP00000449022:R88H;ENSP00000446647:R88H;ENSP00000447253:R88H;ENSP00000449172:R88H	ENSP00000331664:R88H	R	-	2	0	MGAT4C	84901464	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.561000	0.86390	0.563000	0.77884	CGC		0.318	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244		12	137	0	0	0	0.00245	0	12	137				
DHX37	57647	broad.mit.edu	37	12	125441662	125441662	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr12:125441662G>A	ENST00000308736.2	-	17	2275	c.2177C>T	c.(2176-2178)cCg>cTg	p.P726L	DHX37_ENST00000544745.1_Missense_Mutation_p.P513L	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	726							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.P726L(1)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GGGGGGCGTCGGGAAGGGGAA	0.622																																							uc001ugy.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(2176-2178)CCG>CTG		DEAH (Asp-Glu-Ala-His) box polypeptide 37							68.0	68.0	68.0					12																	125441662		2203	4300	6503	SO:0001583	missense	57647						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr12:125441662G>A	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2177C>T	12.37:g.125441662G>A	ENSP00000311135:p.Pro726Leu		Somatic					p.P726L	NM_032656	NP_116045	WXS	Illumina HiSeq	Unspecified	Q8IY37	DHX37_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)	17	2276	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		726					Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	c.2177C>T	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.296471	0.81025	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.02345	4.33;4.33	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.12135	0.0295	L	0.53729	1.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00822	-1.1552	10	0.87932	D	0	.	15.9233	0.79592	0.0:0.0:1.0:0.0	.	726	Q8IY37	DHX37_HUMAN	L	726;513	ENSP00000311135:P726L;ENSP00000439009:P513L	ENSP00000311135:P726L	P	-	2	0	DHX37	124007615	1.000000	0.71417	0.919000	0.36401	0.715000	0.41141	8.888000	0.92464	2.253000	0.74438	0.555000	0.69702	CCG		0.622	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656		18	76	0	0	0	0.010504	0	18	76				
NRXN3	9369	broad.mit.edu	37	14	79117585	79117585	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr14:79117585C>A	ENST00000554719.1	+	3	509	c.18C>A	c.(16-18)gaC>gaA	p.D6E	NRXN3_ENST00000335750.5_Missense_Mutation_p.D6E	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	0					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.D6E(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GCTCGGACGACTTCTTCTATG	0.522																																							uc001xun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10						c.(16-18)GAC>GAA		neurexin 3 isoform 1 precursor							186.0	171.0	176.0					14																	79117585		2203	4300	6503	SO:0001583	missense	9369				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity	g.chr14:79117585C>A	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.18C>A	14.37:g.79117585C>A	ENSP00000451648:p.Asp6Glu		Somatic				NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.D140E	p.D6E	NM_004796	NP_004787	WXS	Illumina HiSeq	Unspecified	Q9Y4C0	NRX3A_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)	3	509	+		Renal(4;0.00876)	379			Laminin G-like 2.|Extracellular (Potential).		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	c.18C>A	CCDS9870.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.82|19.82	3.898979|3.898979	0.72754|0.72754	.|.	.|.	ENSG00000021645|ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750|ENST00000553363	T;T|.	0.79352|.	-1.26;-1.26|.	6.01|6.01	2.25|2.25	0.28309|0.28309	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51109|0.51109	0.1655|0.1655	.|.	.|.	.|.	0.33344|0.33344	D|D	0.570237|0.570237	P;D|.	0.54397|.	0.946;0.966|.	D;P|.	0.64042|.	0.921;0.687|.	T|T	0.57705|0.57705	-0.7765|-0.7765	8|4	.|.	.|.	.|.	.|.	10.5053|10.5053	0.44830|0.44830	0.0:0.7475:0.0:0.2525|0.0:0.7475:0.0:0.2525	.|.	379;6|.	Q9Y4C0;Q9Y4C0-3|.	NRX3A_HUMAN;.|.	E|I	379;377;6;6|152	ENSP00000451648:D6E;ENSP00000338349:D6E|.	.|.	D|L	+|+	3|1	2|0	NRXN3|NRXN3	78187338|78187338	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.805000|0.805000	0.45488|0.45488	0.694000|0.694000	0.25512|0.25512	0.155000|0.155000	0.19261|0.19261	-0.136000|-0.136000	0.14681|0.14681	GAC|CTT		0.522	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250		34	70	1	0	1.00001e-27	0.009718	1.42106e-27	34	70				
AQR	9716	broad.mit.edu	37	15	35149010	35149010	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr15:35149010G>C	ENST00000156471.5	-	35	4666	c.4441C>G	c.(4441-4443)Ccg>Gcg	p.P1481A		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	1481					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P1481A(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GTCTCTTCCGGGGCAGATGTG	0.473																																							uc001ziv.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(4441-4443)CCA>GCA		aquarius							91.0	91.0	91.0					15																	35149010		1975	4172	6147	SO:0001583	missense	9716					catalytic step 2 spliceosome	RNA binding	g.chr15:35149010G>C	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.4441C>G	15.37:g.35149010G>C	ENSP00000156471:p.Pro1481Ala		Somatic					p.P1481A	NM_014691	NP_055506	WXS	Illumina HiSeq	Unspecified	O60306	AQR_HUMAN		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)	35	4622	-		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)	1481					A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	c.4441C>G	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376367	0.24857	.	.	ENSG00000021776	ENST00000543879	.	.	.	5.12	-0.589	0.11683	.	0.741961	0.12088	N	0.500686	T	0.14442	0.0349	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29058	-1.0024	9	0.16896	T	0.51	-0.0784	5.0365	0.14438	0.0811:0.4059:0.3743:0.1388	.	1481	O60306	AQR_HUMAN	A	1481	.	ENSP00000445700:P1481A	P	-	1	0	AQR	32936302	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.019000	0.12546	0.024000	0.15214	-0.252000	0.11476	CCG		0.473	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691		7	77	0	0	0	0.00308	0	7	77				
SLC12A1	6557	broad.mit.edu	37	15	48527175	48527175	+	Missense_Mutation	SNP	G	G	C	rs536565201		TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr15:48527175G>C	ENST00000558405.1	+	8	1203	c.1189G>C	c.(1189-1191)Ggt>Cgt	p.G397R	SLC12A1_ENST00000396577.3_Missense_Mutation_p.G397R|SLC12A1_ENST00000330289.6_Missense_Mutation_p.G397R|SLC12A1_ENST00000380993.3_Missense_Mutation_p.G397R			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	397					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)	p.G397R(2)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	GATTCTTGCTGGTGCCAATAT	0.483																																							uc001zwn.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(1189-1191)GGT>CGT		sodium potassium chloride cotransporter 2	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)						133.0	133.0	133.0					15																	48527175		2198	4297	6495	SO:0001583	missense	6557				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity	g.chr15:48527175G>C		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.1189G>C	15.37:g.48527175G>C	ENSP00000453409:p.Gly397Arg		Somatic				SLC12A1_uc010uew.1_Missense_Mutation_p.G203R|SLC12A1_uc010bem.2_Missense_Mutation_p.G397R|SLC12A1_uc010uex.1_Missense_Mutation_p.G397R|SLC12A1_uc001zwq.3_Missense_Mutation_p.G168R|SLC12A1_uc001zwr.3_Missense_Mutation_p.G124R	p.G397R	NM_000338	NP_000329	WXS	Illumina HiSeq	Unspecified	Q13621	S12A1_HUMAN		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	9	1405	+		all_lung(180;0.00219)	397			Helical; (Potential).		A8JYA2|E9PDW4	Missense_Mutation	SNP	ENST00000558405.1	37	c.1189G>C	CCDS10129.2	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025527	0.93518	.	.	ENSG00000074803	ENST00000428362;ENST00000380993;ENST00000396577;ENST00000330289	D;D;D	0.98926	-5.24;-5.24;-5.24	5.32	5.32	0.75619	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.99498	0.9821	H	0.96861	3.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98192	1.0463	10	0.87932	D	0	.	19.3643	0.94456	0.0:0.0:1.0:0.0	.	397;397;397	Q8IUN5;E9PDW4;Q13621	.;.;S12A1_HUMAN	R	210;397;397;397	ENSP00000370381:G397R;ENSP00000379822:G397R;ENSP00000331550:G397R	ENSP00000331550:G397R	G	+	1	0	SLC12A1	46314467	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.645000	0.89757	0.655000	0.94253	GGT		0.483	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1			40	101	0	0	0	0.013114	0	40	101				
UNC13C	440279	broad.mit.edu	37	15	54707189	54707189	+	Silent	SNP	A	A	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr15:54707189A>G	ENST00000260323.11	+	18	4857	c.4857A>G	c.(4855-4857)caA>caG	p.Q1619Q	UNC13C_ENST00000537900.1_Silent_p.Q1617Q|UNC13C_ENST00000545554.1_Silent_p.Q1619Q	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1619					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.Q1619Q(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGTTTCCTCAAGAGCTGAACA	0.303																																							uc002ack.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|pancreas(2)	7						c.(4855-4857)CAA>CAG		unc-13 homolog C							94.0	93.0	93.0					15																	54707189		1812	4065	5877	SO:0001819	synonymous_variant	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54707189A>G	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4857A>G	15.37:g.54707189A>G			Somatic				UNC13C_uc002acl.2_Silent_p.Q449Q	p.Q1619Q	NM_001080534	NP_001074003	WXS	Illumina HiSeq	Unspecified	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	17	4857	+			1619					Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	37	c.4857A>G	CCDS45264.1																																																																																				0.303	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		6	46	0	0	0	0.001168	0	6	46				
CGNL1	84952	broad.mit.edu	37	15	57823948	57823948	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr15:57823948T>C	ENST00000281282.5	+	14	3340	c.3262T>C	c.(3262-3264)Tct>Cct	p.S1088P	CTD-2515H24.4_ENST00000566990.1_lincRNA	NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	1088				S -> T (in Ref. 3; BAB55415). {ECO:0000305}.		myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.S1088P(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		AGATTTGCTGTCTGAGAGGAT	0.443																																							uc002aeg.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(4)|central_nervous_system(1)	11						c.(3262-3264)TCT>CCT		cingulin-like 1							165.0	158.0	160.0					15																	57823948		2192	4292	6484	SO:0001583	missense	84952					myosin complex|tight junction	motor activity	g.chr15:57823948T>C	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.3262T>C	15.37:g.57823948T>C	ENSP00000281282:p.Ser1088Pro		Somatic				CGNL1_uc010bfw.2_Missense_Mutation_p.S1088P	p.S1088P	NM_032866	NP_116255	WXS	Illumina HiSeq	Unspecified	Q0VF96	CGNL1_HUMAN		all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)	14	3338	+			1088	S -> T (in Ref. 3; BAB55415).		Potential.		Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	37	c.3262T>C	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	T	19.14	3.770379	0.69992	.	.	ENSG00000128849	ENST00000281282	T	0.78246	-1.16	5.53	5.53	0.82687	Myosin tail (1);	0.000000	0.53938	D	0.000051	D	0.83294	0.5223	L	0.58101	1.795	0.28897	N	0.893515	D	0.64830	0.994	D	0.65773	0.938	T	0.78823	-0.2052	10	0.46703	T	0.11	-14.8529	10.0747	0.42353	0.0:0.0749:0.0:0.9251	.	1088	Q0VF96	CGNL1_HUMAN	P	1088	ENSP00000281282:S1088P	ENSP00000281282:S1088P	S	+	1	0	CGNL1	55611240	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.905000	0.48727	2.086000	0.62901	0.460000	0.39030	TCT		0.443	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866		8	119	0	0	0	0.006214	0	8	119				
BBS4	585	broad.mit.edu	37	15	73016905	73016905	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr15:73016905A>G	ENST00000268057.4	+	8	537	c.496A>G	c.(496-498)Agg>Ggg	p.R166G	BBS4_ENST00000539603.1_Missense_Mutation_p.R154G|BBS4_ENST00000542334.1_5'UTR|BBS4_ENST00000395205.2_Missense_Mutation_p.R174G	NM_033028.4	NP_149017.2	Q96RK4	BBS4_HUMAN	Bardet-Biedl syndrome 4	166	Interaction with PCM1.				adult behavior (GO:0030534)|brain morphogenesis (GO:0048854)|centrosome organization (GO:0051297)|cerebral cortex development (GO:0021987)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|dendrite development (GO:0016358)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|maintenance of protein location in nucleus (GO:0051457)|melanosome transport (GO:0032402)|metabolic process (GO:0008152)|microtubule anchoring at centrosome (GO:0034454)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of systemic arterial blood pressure (GO:0003085)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of cilium assembly (GO:0045724)|positive regulation of multicellular organism growth (GO:0040018)|protein localization to centrosome (GO:0071539)|protein localization to organelle (GO:0033365)|protein transport (GO:0015031)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of cytokinesis (GO:0032465)|regulation of lipid metabolic process (GO:0019216)|retina homeostasis (GO:0001895)|retinal rod cell development (GO:0046548)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)|spermatid development (GO:0007286)|striatum development (GO:0021756)|visual perception (GO:0007601)	BBSome (GO:0034464)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary membrane (GO:0060170)|cilium (GO:0005929)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|dynactin binding (GO:0034452)|microtubule motor activity (GO:0003777)|RNA polymerase II repressing transcription factor binding (GO:0001103)	p.R166G(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(1)	19						GAATCTTAATAGGCACGATCT	0.408									Bardet-Biedl syndrome																														uc002avb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(496-498)AGG>GGG		Bardet-Biedl syndrome 4							129.0	118.0	122.0					15																	73016905		2198	4297	6495	SO:0001583	missense	585	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	adult behavior|brain morphogenesis|cell cycle cytokinesis|centrosome organization|cerebral cortex development|convergent extension involved in gastrulation|dendrite development|fat cell differentiation|heart looping|hippocampus development|intracellular transport|maintenance of protein location in nucleus|melanosome transport|microtubule anchoring at centrosome|neural tube closure|nonmotile primary cilium assembly|photoreceptor cell maintenance|pigment granule aggregation in cell center|positive regulation of flagellum assembly|regulation of cilium beat frequency involved in ciliary motility|regulation of cytokinesis|regulation of lipid metabolic process|retina homeostasis|retinal rod cell development|sensory perception of smell|sensory processing|spermatid development|striatum development	BBSome|centriolar satellite|centriole|cilium membrane|microtubule basal body|motile cilium|nonmotile primary cilium|nucleus|pericentriolar material	alpha-tubulin binding|beta-tubulin binding|dynactin binding|microtubule motor activity	g.chr15:73016905A>G	AF090947	CCDS10246.1, CCDS58377.1	15q22.3-q23	2013-01-10			ENSG00000140463	ENSG00000140463		"""Tetratricopeptide (TTC) repeat domain containing"""	969	protein-coding gene	gene with protein product		600374				7711739, 11381270	Standard	NM_033028		Approved		uc002avb.3	Q96RK4	OTTHUMG00000133510	ENST00000268057.4:c.496A>G	15.37:g.73016905A>G	ENSP00000268057:p.Arg166Gly		Somatic				BBS4_uc010ukv.1_Missense_Mutation_p.R154G|BBS4_uc002avc.2_Translation_Start_Site|BBS4_uc002avd.2_Missense_Mutation_p.R174G|BBS4_uc010bja.2_Translation_Start_Site	p.R166G	NM_033028	NP_149017	WXS	Illumina HiSeq	Unspecified	Q96RK4	BBS4_HUMAN			8	539	+			166			Interaction with PCM1.|TPR 3.		B4E178|Q53DZ5|Q8NHU9|Q96H45	Missense_Mutation	SNP	ENST00000268057.4	37	c.496A>G	CCDS10246.1	.	.	.	.	.	.	.	.	.	.	A	17.26	3.344179	0.61073	.	.	ENSG00000140463	ENST00000268057;ENST00000539603;ENST00000395205	T;T;T	0.62941	-0.01;-0.01;-0.01	5.43	5.43	0.79202	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.255236	0.51477	D	0.000083	T	0.74176	0.3682	M	0.77486	2.375	0.80722	D	1	P;P;P	0.41546	0.71;0.515;0.754	P;B;P	0.53185	0.474;0.283;0.72	T	0.76969	-0.2762	10	0.62326	D	0.03	-8.7214	12.3064	0.54904	0.8588:0.1412:0.0:0.0	.	154;174;166	F5H7I8;Q96RK4-2;Q96RK4	.;.;BBS4_HUMAN	G	166;154;174	ENSP00000268057:R166G;ENSP00000442492:R154G;ENSP00000378631:R174G	ENSP00000268057:R166G	R	+	1	2	BBS4	70803958	1.000000	0.71417	0.817000	0.32601	0.990000	0.78478	4.707000	0.61852	2.187000	0.69744	0.402000	0.26972	AGG		0.408	BBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257473.2	NM_033028		3	91	0	0	0	0.004672	0	3	91				
KIAA1024	23251	broad.mit.edu	37	15	79749976	79749976	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr15:79749976G>A	ENST00000305428.3	+	2	1562	c.1487G>A	c.(1486-1488)gGc>gAc	p.G496D		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	496						integral component of membrane (GO:0016021)		p.G496D(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						TCTGGTCAGGGCAAGTACAGT	0.537																																							uc002bew.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|central_nervous_system(1)	4						c.(1486-1488)GGC>GAC		hypothetical protein LOC23251							97.0	80.0	86.0					15																	79749976		2196	4293	6489	SO:0001583	missense	23251					integral to membrane		g.chr15:79749976G>A	AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.1487G>A	15.37:g.79749976G>A	ENSP00000307461:p.Gly496Asp		Somatic				KIAA1024_uc010unk.1_Missense_Mutation_p.G496D	p.G496D	NM_015206	NP_056021	WXS	Illumina HiSeq	Unspecified	Q9UPX6	K1024_HUMAN			2	1562	+			496					A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	c.1487G>A	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	G	5.176	0.217949	0.09810	.	.	ENSG00000169330	ENST00000305428	T	0.30714	1.52	4.92	2.95	0.34219	.	0.634091	0.17087	N	0.187532	T	0.25717	0.0626	L	0.47716	1.5	0.29604	N	0.847454	B	0.20052	0.041	B	0.19391	0.025	T	0.17167	-1.0378	9	.	.	.	.	10.0283	0.42085	0.0783:0.4388:0.483:0.0	.	496	Q9UPX6	K1024_HUMAN	D	496	ENSP00000307461:G496D	.	G	+	2	0	KIAA1024	77537031	0.985000	0.35326	0.997000	0.53966	0.116000	0.19942	1.610000	0.36869	0.430000	0.26230	-0.479000	0.04858	GGC		0.537	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206		13	24	0	0	0	0.013537	0	13	24				
MAN2A2	4122	broad.mit.edu	37	15	91453496	91453496	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr15:91453496A>C	ENST00000559717.1	+	10	2010	c.1551A>C	c.(1549-1551)ttA>ttC	p.L517F	MAN2A2_ENST00000431652.2_Intron|MAN2A2_ENST00000360468.3_Missense_Mutation_p.L517F|MAN2A2_ENST00000430376.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	517					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.L517F(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			ACAAGAGCTTAGACCGAGTCC	0.592																																							uc010bnz.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)	3						c.(1549-1551)TTA>TTC		mannosidase, alpha, class 2A, member 2							60.0	61.0	61.0					15																	91453496		2198	4298	6496	SO:0001583	missense	4122				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding	g.chr15:91453496A>C	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.1551A>C	15.37:g.91453496A>C	ENSP00000452948:p.Leu517Phe		Somatic				MAN2A2_uc010boa.2_Missense_Mutation_p.L559F|MAN2A2_uc002bqc.2_Missense_Mutation_p.L517F|MAN2A2_uc010uql.1_Missense_Mutation_p.L179F|MAN2A2_uc010uqm.1_Intron|MAN2A2_uc010uqn.1_5'Flank	p.L517F	NM_006122	NP_006113	WXS	Illumina HiSeq	Unspecified	P49641	MA2A2_HUMAN	Lung(145;0.229)		10	1666	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		517			Lumenal (Potential).		A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	c.1551A>C	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.503220	0.85176	.	.	ENSG00000196547	ENST00000360468	T	0.75589	-0.95	5.58	3.43	0.39272	Glycoside hydrolase, family 38, central domain (2);	0.123661	0.56097	D	0.000029	T	0.70605	0.3243	L	0.35854	1.095	0.80722	D	1	P;B;B	0.35982	0.531;0.338;0.319	P;B;P	0.46339	0.513;0.328;0.457	T	0.71427	-0.4596	10	0.66056	D	0.02	-18.8182	8.9804	0.35961	0.0864:0.0:0.7724:0.1412	.	145;517;517	B4DIK4;P49641-1;P49641	.;.;MA2A2_HUMAN	F	517	ENSP00000353655:L517F	ENSP00000353655:L517F	L	+	3	2	MAN2A2	89254500	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.633000	0.67825	1.162000	0.42619	0.397000	0.26171	TTA		0.592	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122		7	55	0	0	0	0.00308	0	7	55				
PRDM7	11105	broad.mit.edu	37	16	90128521	90128521	+	Silent	SNP	C	C	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr16:90128521C>T	ENST00000449207.2	-	7	709	c.690G>A	c.(688-690)gtG>gtA	p.V230V	PRDM7_ENST00000407825.1_Silent_p.V24V|PRDM7_ENST00000325921.6_Silent_p.V24V	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	230					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)	p.V230V(1)|p.V24V(1)		lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		GCCCCTTGTCCACTGCACTGT	0.567																																							uc010cje.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(688-690)GTG>GTA		PR domain containing 7 isoform 1							70.0	64.0	66.0					16																	90128521		2198	4300	6498	SO:0001819	synonymous_variant	11105					chromosome|nucleus	nucleic acid binding	g.chr16:90128521C>T	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.690G>A	16.37:g.90128521C>T			Somatic				PRDM7_uc002fqo.2_Silent_p.V24V|PRDM7_uc010cjf.2_Silent_p.V113V|PRDM7_uc010cjg.1_Silent_p.V24V|PRDM7_uc010cjh.1_RNA	p.V230V	NM_001098173	NP_001091643	WXS	Illumina HiSeq	Unspecified	Q9NQW5	PRDM7_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0278)	7	710	-		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)	230					A4Q9G8|Q08EM4|Q9NQW4	Silent	SNP	ENST00000449207.2	37	c.690G>A	CCDS45557.1																																																																																				0.567	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420560.1			13	37	0	0	0	0.013537	0	13	37				
ITGAE	3682	broad.mit.edu	37	17	3664699	3664699	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr17:3664699A>T	ENST00000263087.4	-	5	529	c.431T>A	c.(430-432)cTt>cAt	p.L144H		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	144					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.L144H(1)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		ATCCTTACCAAGGTCGAAGAA	0.587																																					NSCLC(182;635 2928 8995 38788)	NSCLC(182;635 2928 8995 38788)	uc002fwo.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|breast(1)|pancreas(1)	4						c.(430-432)CTT>CAT		integrin, alpha E precursor							69.0	69.0	69.0					17																	3664699		2203	4300	6503	SO:0001583	missense	3682				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr17:3664699A>T	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.431T>A	17.37:g.3664699A>T	ENSP00000263087:p.Leu144His		Somatic					p.L144H	NM_002208	NP_002199	WXS	Illumina HiSeq	Unspecified	P38570	ITAE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)	5	530	-			144			Extracellular (Potential).		Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	c.431T>A	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.415651	0.83449	.	.	ENSG00000083457	ENST00000263087	D	0.94862	-3.54	3.84	3.84	0.44239	.	.	.	.	.	D	0.94555	0.8246	L	0.47190	1.495	0.34057	D	0.65687	D	0.71674	0.998	P	0.60173	0.87	D	0.95620	0.8680	9	0.87932	D	0	.	9.2851	0.37753	1.0:0.0:0.0:0.0	.	144	P38570	ITAE_HUMAN	H	144	ENSP00000263087:L144H	ENSP00000263087:L144H	L	-	2	0	ITGAE	3611448	0.922000	0.31269	0.971000	0.41717	0.595000	0.36748	1.648000	0.37271	1.965000	0.57142	0.334000	0.21626	CTT		0.587	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208		4	71	0	0	0	0.009096	0	4	71				
BCL6B	255877	broad.mit.edu	37	17	6927925	6927925	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr17:6927925A>T	ENST00000293805.5	+	4	699	c.607A>T	c.(607-609)Aac>Tac	p.N203Y	BCL6B_ENST00000572216.1_3'UTR	NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	203					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N203Y(1)		skin(1)	1						CATCGTGCTAAACTCTCAGGC	0.607																																							uc002geg.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(607-609)AAC>TAC		B-cell CLL/lymphoma 6, member B (zinc finger							85.0	99.0	94.0					17																	6927925		1992	4164	6156	SO:0001583	missense	255877					nucleus	zinc ion binding	g.chr17:6927925A>T	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.607A>T	17.37:g.6927925A>T	ENSP00000293805:p.Asn203Tyr		Somatic				BCL6B_uc010clt.1_Missense_Mutation_p.N203Y	p.N203Y	NM_181844	NP_862827	WXS	Illumina HiSeq	Unspecified	Q8N143	BCL6B_HUMAN			4	664	+			203					Q6PCB4	Missense_Mutation	SNP	ENST00000293805.5	37	c.607A>T	CCDS42248.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.635022	0.87760	.	.	ENSG00000161940	ENST00000293805	T	0.10192	2.9	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.25082	0.0609	L	0.47190	1.495	0.46078	D	0.998851	D	0.89917	1.0	D	0.77557	0.99	T	0.00444	-1.1735	10	0.66056	D	0.02	.	11.8142	0.52199	1.0:0.0:0.0:0.0	.	203	Q8N143	BCL6B_HUMAN	Y	203	ENSP00000293805:N203Y	ENSP00000293805:N203Y	N	+	1	0	BCL6B	6868649	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	8.180000	0.89694	2.281000	0.76405	0.533000	0.62120	AAC		0.607	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439455.2	NM_181844		6	114	0	0	0	0.001168	0	6	114				
RARA	5914	broad.mit.edu	37	17	38510602	38510603	+	Missense_Mutation	DNP	TT	TT	AC			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	TT	TT	-	-	TT	TT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr17:38510602_38510603TT>AC	ENST00000254066.5	+	7	1311_1312	c.856_857TT>AC	c.(856-858)TTc>ACc	p.F286T	RARA_ENST00000425707.3_Missense_Mutation_p.F189T|RARA_ENST00000420042.1_3'UTR|RARA_ENST00000394089.2_Missense_Mutation_p.F286T|RARA_ENST00000394086.3_Missense_Mutation_p.F302T|RARA_ENST00000394081.3_Missense_Mutation_p.F281T	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha	286	Ligand-binding.				apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)	p.F286T(1)		breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CACCATGACCTTCTCGGACGGG	0.639			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL																																		uc002huk.1		NA		Dom	yes		17	17q12	5914	T	"""retinoic acid receptor, alpha"""			L	PML|ZNF145|TIF1|NUMA1|NPM1		APL		1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(856-858)TTC>ACC		retinoic acid receptor, alpha isoform 1	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)																																			SO:0001583	missense	5914				apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding	g.chr17:38510602_38510603TT>AC	X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	Exception_encountered	17.37:g.38510602_38510603delinsAC	ENSP00000254066:p.Phe286Thr		Somatic				RARA_uc002hul.3_Missense_Mutation_p.F286T|RARA_uc010wfe.1_Missense_Mutation_p.F189T|RARA_uc002hun.1_Missense_Mutation_p.F281T	p.F286T	NM_000964	NP_000955	WXS	Illumina HiSeq	Unspecified	P10276	RARA_HUMAN	STAD - Stomach adenocarcinoma(5;0.00143)		7	1311_1312	+		Breast(137;0.00328)	286			Ligand-binding.		B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	Missense_Mutation	DNP	ENST00000254066.5	37	c.856_857TT>AC	CCDS11366.1																																																																																				0.639	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257136.2			10	47	0	0	0	0.004672	0	10	47				
KRT31	3881	broad.mit.edu	37	17	39552825	39552825	+	Silent	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr17:39552825G>A	ENST00000251645.2	-	3	487	c.435C>T	c.(433-435)taC>taT	p.Y145Y		NM_002277.2	NP_002268.2	Q15323	K1H1_HUMAN	keratin 31	145	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)	p.Y145Y(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	31		Breast(137;0.000496)				GCTCGGTCTGGTACCTGCGCA	0.547																																							uc002hwn.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(433-435)TAC>TAT		keratin 31							62.0	54.0	57.0					17																	39552825		2203	4300	6503	SO:0001819	synonymous_variant	3881				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton	g.chr17:39552825G>A	X86570	CCDS11391.1	17q21.2	2014-05-20	2006-07-17	2006-07-17	ENSG00000094796	ENSG00000094796		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6448	protein-coding gene	gene with protein product	"""hard keratin type I 1"""	601077	"""keratin, hair, acidic, 1"""	KRTHA1		7578244, 16831889	Standard	NM_002277		Approved	Ha-1	uc002hwn.3	Q15323	OTTHUMG00000133423	ENST00000251645.2:c.435C>T	17.37:g.39552825G>A			Somatic				KRT31_uc010cxn.2_Silent_p.Y145Y	p.Y145Y	NM_002277	NP_002268	WXS	Illumina HiSeq	Unspecified	Q15323	K1H1_HUMAN			3	488	-		Breast(137;0.000496)	145			Rod.|Coil 1B.		Q9UE12	Silent	SNP	ENST00000251645.2	37	c.435C>T	CCDS11391.1																																																																																				0.547	KRT31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257286.1	NM_002277		4	44	0	0	0	0.000602	0	4	44				
KRT16	3868	broad.mit.edu	37	17	39767654	39767654	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr17:39767654C>G	ENST00000301653.4	-	3	778	c.714G>C	c.(712-714)gaG>gaC	p.E238D		NM_005557.3	NP_005548.2	P08779	K1C16_HUMAN	keratin 16	238	Coil 1B.|Rod.				aging (GO:0007568)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|epidermis development (GO:0008544)|hair cycle (GO:0042633)|intermediate filament cytoskeleton organization (GO:0045104)|negative regulation of cell migration (GO:0030336)	cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.E238D(1)		NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Breast(137;0.000307)				CGATCTGCATCTCCAGGTCAG	0.632																																							uc002hxg.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(712-714)GAG>GAC		keratin 16							78.0	76.0	77.0					17																	39767654		2203	4300	6503	SO:0001583	missense	3868				cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton	g.chr17:39767654C>G	S79867	CCDS11401.1	17q21.2	2013-01-16	2008-08-01		ENSG00000186832	ENSG00000186832		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6423	protein-coding gene	gene with protein product	"""focal non-epidermolytic palmoplantar keratoderma"""	148067				2451124, 16831889	Standard	NM_005557		Approved	NEPPK	uc002hxg.4	P08779	OTTHUMG00000133495	ENST00000301653.4:c.714G>C	17.37:g.39767654C>G	ENSP00000301653:p.Glu238Asp		Somatic				JUP_uc010wfs.1_Intron	p.E238D	NM_005557	NP_005548	WXS	Illumina HiSeq	Unspecified	P08779	K1C16_HUMAN			3	853	-		Breast(137;0.000307)	238			Coil 1B.|Rod.		A8K488|P30654|Q16402|Q9UBG8	Missense_Mutation	SNP	ENST00000301653.4	37	c.714G>C	CCDS11401.1	.	.	.	.	.	.	.	.	.	.	C	19.33	3.807101	0.70797	.	.	ENSG00000186832	ENST00000301653	D	0.91894	-2.93	4.63	2.59	0.31030	Filament (1);	0.122369	0.36338	N	0.002656	D	0.95598	0.8569	M	0.87381	2.88	0.42086	D	0.991278	D	0.69078	0.997	D	0.81914	0.995	D	0.95379	0.8471	10	0.87932	D	0	.	9.8982	0.41331	0.0:0.7376:0.0:0.2624	.	238	P08779	K1C16_HUMAN	D	238	ENSP00000301653:E238D	ENSP00000301653:E238D	E	-	3	2	KRT16	37021180	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.142000	0.31540	1.264000	0.44198	0.561000	0.74099	GAG		0.632	KRT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257408.1	NM_005557		26	60	0	0	0	0.004656	0	26	60				
C17orf47	284083	broad.mit.edu	37	17	56620680	56620680	+	Missense_Mutation	SNP	G	G	A	rs149389321		TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr17:56620680G>A	ENST00000321691.3	-	1	1049	c.868C>T	c.(868-870)Cgg>Tgg	p.R290W	RP11-112H10.4_ENST00000578022.1_RNA|RP11-112H10.4_ENST00000580769.1_RNA|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000412945.3_5'Flank|SEPT4_ENST00000457347.2_5'Flank	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	290								p.R290W(1)		NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGGTCTACCCGTGCAGAAACT	0.463													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20287	0.0		0.0	False		,,,				2504	0.0						uc002iwq.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(868-870)CGG>TGG		hypothetical protein LOC284083		G	TRP/ARG	0,4406		0,0,2203	91.0	84.0	86.0		868	1.4	0.0	17	dbSNP_134	86	3,8597	3.0+/-9.4	0,3,4297	yes	missense	C17orf47	NM_001038704.2	101	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	290/571	56620680	3,13003	2203	4300	6503	SO:0001583	missense	284083							g.chr17:56620680G>A		CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.868C>T	17.37:g.56620680G>A	ENSP00000354874:p.Arg290Trp		Somatic				SEPT4_uc010wnx.1_5'Flank|SEPT4_uc010wny.1_5'Flank	p.R290W	NM_001038704	NP_001033793	WXS	Illumina HiSeq	Unspecified	Q8NEP4	CQ047_HUMAN			1	1004	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		290					Q8N821	Missense_Mutation	SNP	ENST00000321691.3	37	c.868C>T	CCDS32691.1	.	.	.	.	.	.	.	.	.	.	G	10.63	1.403508	0.25291	0.0	3.49E-4	ENSG00000181013	ENST00000321691	T	0.36878	1.23	4.54	1.36	0.22044	.	1.490430	0.03911	N	0.281920	T	0.25791	0.0628	N	0.24115	0.695	0.09310	N	1	B	0.21688	0.059	B	0.17722	0.019	T	0.24835	-1.0149	10	0.56958	D	0.05	5.5608	4.5863	0.12284	0.1799:0.0:0.646:0.1741	.	290	Q8NEP4	CQ047_HUMAN	W	290	ENSP00000354874:R290W	ENSP00000354874:R290W	R	-	1	2	C17orf47	53975679	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.022000	0.13511	0.110000	0.17919	-1.008000	0.02478	CGG		0.463	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445443.1	NM_001038704		4	108	0	0	0	0.009096	0	4	108				
DTNA	1837	broad.mit.edu	37	18	32459575	32459575	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr18:32459575A>G	ENST00000399113.3	+	19	1973	c.1973A>G	c.(1972-1974)gAt>gGt	p.D658G	DTNA_ENST00000399121.5_Missense_Mutation_p.D605G|DTNA_ENST00000595022.1_Missense_Mutation_p.D598G|DTNA_ENST00000269192.7_Missense_Mutation_p.D367G|DTNA_ENST00000591182.1_Missense_Mutation_p.D306G|DTNA_ENST00000598334.1_Missense_Mutation_p.D598G|DTNA_ENST00000598142.1_Missense_Mutation_p.D601G|DTNA_ENST00000399097.3_Missense_Mutation_p.D306G|DTNA_ENST00000269190.7_Missense_Mutation_p.D659G|DTNA_ENST00000283365.9_Missense_Mutation_p.D601G|DTNA_ENST00000556414.3_Missense_Mutation_p.D310G|DTNA_ENST00000444659.1_Missense_Mutation_p.D658G|DTNA_ENST00000601125.1_Missense_Mutation_p.D280G|DTNA_ENST00000590831.2_Missense_Mutation_p.D84G			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	658					neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.D658G(1)|p.D306G(1)|p.D659G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						CAGTTTGAGGATCTTGTTCCC	0.443																																							uc010dmn.1		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(1972-1974)GAT>GGT		dystrobrevin alpha isoform 1							116.0	103.0	108.0					18																	32459575		2203	4300	6503	SO:0001583	missense	1837				neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding	g.chr18:32459575A>G	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1973A>G	18.37:g.32459575A>G	ENSP00000382064:p.Asp658Gly		Somatic				DTNA_uc002kxw.2_Missense_Mutation_p.D601G|DTNA_uc010dmj.2_Missense_Mutation_p.D598G|DTNA_uc002kxz.2_Missense_Mutation_p.D605G|DTNA_uc002kxy.2_Missense_Mutation_p.D598G|DTNA_uc010xby.1_Missense_Mutation_p.D348G|DTNA_uc010xbz.1_Missense_Mutation_p.D367G|DTNA_uc010xca.1_Missense_Mutation_p.D310G|DTNA_uc002kye.2_Missense_Mutation_p.D306G	p.D658G	NM_001390	NP_001381	WXS	Illumina HiSeq	Unspecified	Q9Y4J8	DTNA_HUMAN			19	1974	+			658					A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	ENST00000399113.3	37	c.1973A>G	CCDS59311.1	.	.	.	.	.	.	.	.	.	.	A	14.90	2.673300	0.47781	.	.	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000399114;ENST00000269190;ENST00000399097;ENST00000399121;ENST00000444659;ENST00000399113;ENST00000269192;ENST00000450377;ENST00000556414	T;T;T;T	0.19250	2.17;2.16;2.16;2.16	5.22	5.22	0.72569	.	0.101479	0.64402	D	0.000003	T	0.32346	0.0826	N	0.24115	0.695	0.41223	D	0.986523	D;B;B;B;B;B;B;B;P	0.76494	0.999;0.002;0.0;0.002;0.341;0.003;0.0;0.231;0.557	D;B;B;B;B;B;B;B;B	0.87578	0.998;0.002;0.0;0.001;0.085;0.001;0.001;0.039;0.058	T	0.11792	-1.0573	10	0.56958	D	0.05	-7.2671	14.0239	0.64573	1.0:0.0:0.0:0.0	.	310;367;348;658;601;306;605;609;601	B4DIU8;B4DIR0;B7Z3X3;Q9Y4J8;F5H5C1;Q9Y4J8-6;E9PEH8;Q59GK7;Q9Y4J8-2	.;.;.;DTNA_HUMAN;.;.;.;.;.	G	601;601;605;659;306;658;658;658;367;306;310	ENSP00000283365:D601G;ENSP00000269190:D659G;ENSP00000405819:D658G;ENSP00000382064:D658G	ENSP00000269190:D659G	D	+	2	0	DTNA	30713573	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	5.412000	0.66392	2.124000	0.65301	0.529000	0.55759	GAT		0.443	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390		3	77	0	0	0	0.004672	0	3	77				
TCEB3B	51224	broad.mit.edu	37	18	44560673	44560673	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr18:44560673G>T	ENST00000332567.4	-	1	1315	c.963C>A	c.(961-963)gaC>gaA	p.D321E	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	321					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D321E(1)		breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GGTCCCGGCCGTCTAGACTGG	0.622																																							uc002lcr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|pancreas(1)	4						c.(961-963)GAC>GAA		elongin A2							85.0	85.0	85.0					18																	44560673		2202	4300	6502	SO:0001583	missense	51224				regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding	g.chr18:44560673G>T	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.963C>A	18.37:g.44560673G>T	ENSP00000331302:p.Asp321Glu		Somatic				KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	p.D321E	NM_016427	NP_057511	WXS	Illumina HiSeq	Unspecified	Q8IYF1	ELOA2_HUMAN			1	1316	-			321					Q9P2V9	Missense_Mutation	SNP	ENST00000332567.4	37	c.963C>A	CCDS11932.1	.	.	.	.	.	.	.	.	.	.	G	4.953	0.177003	0.09443	.	.	ENSG00000206181	ENST00000332567	T	0.06218	3.33	2.09	-2.51	0.06365	.	0.371038	0.18611	U	0.136167	T	0.03011	0.0089	N	0.20986	0.625	0.09310	N	1	B	0.25351	0.124	B	0.22152	0.038	T	0.44907	-0.9297	10	0.15066	T	0.55	.	4.5061	0.11889	0.2822:0.186:0.5317:0.0	.	321	Q8IYF1	ELOA2_HUMAN	E	321	ENSP00000331302:D321E	ENSP00000331302:D321E	D	-	3	2	TCEB3B	42814671	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.021000	0.13489	-0.743000	0.04784	-1.731000	0.00696	GAC		0.622	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427		11	134	1	0	9.70103e-10	0.008291	1.32622e-09	11	134				
FZR1	51343	broad.mit.edu	37	19	3533341	3533341	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr19:3533341C>T	ENST00000395095.3	+	11	1292	c.1292C>T	c.(1291-1293)cCc>cTc	p.P431L	FZR1_ENST00000313639.8_Missense_Mutation_p.P342L|FZR1_ENST00000441788.2_Missense_Mutation_p.P431L	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	431					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P431L(1)		endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGAAGTACCCCTCCCTGACC	0.657																																							uc010dtk.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|kidney(1)	2						c.(1291-1293)CCC>CTC		Fzr1 protein isoform 1							135.0	94.0	108.0					19																	3533341		2203	4300	6503	SO:0001583	missense	51343				activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|DNA repair|G2/M transition DNA damage checkpoint|mitosis|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	protein binding	g.chr19:3533341C>T	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.1292C>T	19.37:g.3533341C>T	ENSP00000378529:p.Pro431Leu		Somatic				FZR1_uc002lxt.2_Missense_Mutation_p.P431L|FZR1_uc002lxv.2_Missense_Mutation_p.P342L	p.P431L	NM_001136198	NP_001129670	WXS	Illumina HiSeq	Unspecified	Q9UM11	FZR_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	11	1326	+			431			WD 6.		O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	ENST00000395095.3	37	c.1292C>T	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	C	34	5.299183	0.95574	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.29655	1.56;1.56;5.01	5.34	5.34	0.76211	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75752	0.3892	H	0.99619	4.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.983;1.0;1.0	D	0.87509	0.2438	10	0.87932	D	0	-58.805	17.6064	0.88039	0.0:1.0:0.0:0.0	.	431;342;431	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	L	431;431;342	ENSP00000410369:P431L;ENSP00000378529:P431L;ENSP00000321800:P342L	ENSP00000321800:P342L	P	+	2	0	FZR1	3484341	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	7.584000	0.82572	2.500000	0.84329	0.455000	0.32223	CCC		0.657	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263		4	53	0	0	0	0.009096	0	4	53				
RFX2	5990	broad.mit.edu	37	19	6016244	6016244	+	Silent	SNP	A	A	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr19:6016244A>C	ENST00000303657.5	-	7	785	c.636T>G	c.(634-636)ggT>ggG	p.G212G	RFX2_ENST00000359161.3_Silent_p.G212G|RFX2_ENST00000592546.1_Silent_p.G187G|CTC-232P5.1_ENST00000587836.1_RNA	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	212					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G212G(1)		breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GGAGACTCACACCTTCCGCTG	0.512																																					Colon(38;171 817 19800 47433 48051)	Colon(38;171 817 19800 47433 48051)	uc002meb.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(4)|ovary(1)|skin(1)	6						c.(634-636)GGT>GGG		regulatory factor X2 isoform a							78.0	74.0	75.0					19																	6016244		2203	4300	6503	SO:0001819	synonymous_variant	5990				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr19:6016244A>C		CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.636T>G	19.37:g.6016244A>C			Somatic				RFX2_uc002mec.2_Silent_p.G187G	p.G212G	NM_000635	NP_000626	WXS	Illumina HiSeq	Unspecified	P48378	RFX2_HUMAN			7	905	-			212			RFX-type winged-helix.		A8K581|B3KNC4|Q6IQ44|Q8SNA2	Silent	SNP	ENST00000303657.5	37	c.636T>G	CCDS12157.1																																																																																				0.512	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452687.1	NM_000635		5	49	0	0	0	0.00308	0	5	49				
ACSBG2	81616	broad.mit.edu	37	19	6185606	6185606	+	Silent	SNP	T	T	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr19:6185606T>G	ENST00000586696.1	+	11	1758	c.1482T>G	c.(1480-1482)tcT>tcG	p.S494S	ACSBG2_ENST00000591403.1_Silent_p.S494S|ACSBG2_ENST00000252669.5_Silent_p.S494S|ACSBG2_ENST00000588485.1_Silent_p.S307S|ACSBG2_ENST00000588304.1_Silent_p.S444S|ACSBG2_ENST00000591741.1_3'UTR			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	494					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.S494S(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGCTACACTCTGGGGATCTGG	0.557																																							uc002mef.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1480-1482)TCT>TCG		bubblegum-related acyl-CoA synthetase 2							143.0	135.0	138.0					19																	6185606		2203	4300	6503	SO:0001819	synonymous_variant	81616				cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity	g.chr19:6185606T>G		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.1482T>G	19.37:g.6185606T>G			Somatic				ACSBG2_uc002mee.1_Silent_p.S307S|ACSBG2_uc002meg.1_Silent_p.S494S|ACSBG2_uc002meh.1_Silent_p.S494S|ACSBG2_uc002mei.1_Silent_p.S444S|ACSBG2_uc010xiz.1_Silent_p.S494S	p.S494S	NM_030924	NP_112186	WXS	Illumina HiSeq	Unspecified	Q5FVE4	ACBG2_HUMAN			11	1709	+			494					B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Silent	SNP	ENST00000586696.1	37	c.1482T>G	CCDS12159.1																																																																																				0.557	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924		10	89	0	0	0	0.006214	0	10	89				
C19orf47	126526	broad.mit.edu	37	19	40842259	40842259	+	Silent	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr19:40842259G>A	ENST00000582783.1	-	3	198	c.186C>T	c.(184-186)gcC>gcT	p.A62A	C19orf47_ENST00000392035.2_5'UTR|Y_RNA_ENST00000384551.1_RNA	NM_001256440.1	NP_001243369.1	Q8N9M1	CS047_HUMAN	chromosome 19 open reading frame 47	62						nucleus (GO:0005634)		p.A62A(1)		endometrium(5)|kidney(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20			Lung(22;0.000636)			CATAATTGACGGCAGGTCCTG	0.567																																							uc002oni.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(184-186)GCC>GCT		hypothetical protein LOC126526							68.0	61.0	63.0					19																	40842259		2203	4300	6503	SO:0001819	synonymous_variant	126526							g.chr19:40842259G>A	AL834131	CCDS58662.1	19q13.2	2012-07-20			ENSG00000160392	ENSG00000160392			26723	protein-coding gene	gene with protein product						12477932	Standard	NM_001256440		Approved	FLJ36888	uc002oni.5	Q8N9M1	OTTHUMG00000179028	ENST00000582783.1:c.186C>T	19.37:g.40842259G>A			Somatic				C19orf47_uc002ong.2_5'UTR|C19orf47_uc002onh.2_5'UTR	p.A62A	NM_178830	NP_849152	WXS	Illumina HiSeq	Unspecified	Q8N9M1	CS047_HUMAN	Lung(22;0.000636)		3	187	-			62					Q8IZ33|Q8N0V9	Silent	SNP	ENST00000582783.1	37	c.186C>T	CCDS58662.1																																																																																				0.567	C19orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444488.1	NM_178830		4	35	0	0	0	0.000602	0	4	35				
NLRP7	199713	broad.mit.edu	37	19	55447693	55447693	+	Missense_Mutation	SNP	G	G	A	rs143673542		TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr19:55447693G>A	ENST00000590030.1	-	5	2276	c.2236C>T	c.(2236-2238)Cgc>Tgc	p.R746C	NLRP7_ENST00000448121.2_Missense_Mutation_p.R718C|NLRP7_ENST00000340844.2_Missense_Mutation_p.R746C|NLRP7_ENST00000328092.5_Missense_Mutation_p.R718C|NLRP7_ENST00000446217.1_Missense_Mutation_p.R774C|NLRP7_ENST00000592784.1_Missense_Mutation_p.R746C|NLRP7_ENST00000588756.1_Missense_Mutation_p.R746C			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	746							ATP binding (GO:0005524)	p.R718C(1)|p.R746C(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		ATCATCGTGCGTTCCCACTCG	0.572																																							uc002qih.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|breast(1)|central_nervous_system(1)	3						c.(2236-2238)CGC>TGC		NACHT, leucine rich repeat and PYD containing 7		G	CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	127.0	94.0	105.0		2236,2152,2236	-2.5	0.0	19	dbSNP_134	105	0,8600		0,0,4300	no	missense,missense,missense	NLRP7	NM_001127255.1,NM_139176.3,NM_206828.3	180,180,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	746/1038,718/1010,746/981	55447693	1,13005	2203	4300	6503	SO:0001583	missense	199713						ATP binding	g.chr19:55447693G>A	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.2236C>T	19.37:g.55447693G>A	ENSP00000465520:p.Arg746Cys		Somatic				NLRP7_uc002qig.3_Missense_Mutation_p.R718C|NLRP7_uc002qii.3_Missense_Mutation_p.R746C|NLRP7_uc010esk.2_Missense_Mutation_p.R746C|NLRP7_uc010esl.2_Missense_Mutation_p.R774C	p.R746C	NM_206828	NP_996611	WXS	Illumina HiSeq	Unspecified	Q8WX94	NALP7_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	6	2312	-			746					E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	c.2236C>T	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	G	12.50	1.957641	0.34565	2.27E-4	0.0	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T	0.53857	0.6;0.6;0.6	2.31	-2.46	0.06461	.	.	.	.	.	T	0.48314	0.1493	N	0.21373	0.66	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	P;P;P;P	0.62382	0.854;0.795;0.795;0.901	T	0.42068	-0.9473	9	0.66056	D	0.02	.	5.0148	0.14330	0.0:0.1701:0.5688:0.2612	.	774;746;746;718	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	C	746;718;746;774;513	ENSP00000409137:R718C;ENSP00000339491:R746C;ENSP00000414273:R774C	ENSP00000329568:R746C	R	-	1	0	NLRP7	60139505	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.435000	0.06931	-0.463000	0.06973	-0.311000	0.09066	CGC		0.572	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176		5	29	0	0	0	0.000602	0	5	29				
SLC8A1	6546	broad.mit.edu	37	2	40342549	40342549	+	Silent	SNP	C	C	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr2:40342549C>A	ENST00000403092.1	-	11	2799	c.2766G>T	c.(2764-2766)gtG>gtT	p.V922V	SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1_ENST00000542756.1_Silent_p.V917V|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1_ENST00000402441.1_Silent_p.V886V|SLC8A1_ENST00000542024.1_Silent_p.V886V|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1_ENST00000405901.3_Silent_p.V917V|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000405269.1_Silent_p.V886V|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1_ENST00000408028.2_Silent_p.V914V|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1_ENST00000332839.4_Silent_p.V922V|SLC8A1_ENST00000406391.2_Silent_p.V886V|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1_ENST00000406785.2_Silent_p.V886V			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	922					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.V922V(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GCAGCACCCCCACATTGATGA	0.562																																							uc002rrx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2764-2766)GTG>GTT		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						88.0	79.0	82.0					2																	40342549		2203	4300	6503	SO:0001819	synonymous_variant	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40342549C>A		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.2766G>T	2.37:g.40342549C>A			Somatic				uc002rrw.2_Intron|SLC8A1_uc002rry.2_Silent_p.V917V|SLC8A1_uc002rrz.2_Silent_p.V909V|SLC8A1_uc002rsa.2_Silent_p.V886V|SLC8A1_uc002rsd.3_Silent_p.V886V	p.V922V	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			10	2790	-			922			Helical; (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Silent	SNP	ENST00000403092.1	37	c.2766G>T	CCDS1806.1																																																																																				0.562	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		7	40	1	0	1.06961e-07	0.00308	1.44398e-07	7	40				
PPP1R21	129285	broad.mit.edu	37	2	48738497	48738497	+	Nonsense_Mutation	SNP	A	A	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr2:48738497A>T	ENST00000294952.8	+	21	2360	c.2203A>T	c.(2203-2205)Aag>Tag	p.K735*	PPP1R21_ENST00000449090.2_Nonsense_Mutation_p.K693*|PPP1R21_ENST00000476199.1_3'UTR|PPP1R21_ENST00000281394.4_Nonsense_Mutation_p.K724*	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	735						membrane (GO:0016020)	phosphatase binding (GO:0019902)	p.K735*(1)|p.K724*(1)		endometrium(2)|kidney(4)|lung(9)	15						GACAACTACCAAGAGGAGTTA	0.373																																							uc002rwm.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(2203-2205)AAG>TAG		KLRAQ motif containing 1 isoform 1							208.0	190.0	196.0					2																	48738497		2203	4300	6503	SO:0001587	stop_gained	129285							g.chr2:48738497A>T	AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.2203A>T	2.37:g.48738497A>T	ENSP00000294952:p.Lys735*		Somatic				KLRAQ1_uc002rwl.2_Nonsense_Mutation_p.K689*|KLRAQ1_uc002rwk.2_Nonsense_Mutation_p.K724*|KLRAQ1_uc010yok.1_Nonsense_Mutation_p.K693*	p.K735*	NM_001135629	NP_001129101	WXS	Illumina HiSeq	Unspecified	Q6ZMI0	KLRAQ_HUMAN			21	2388	+			735			Potential.		B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Nonsense_Mutation	SNP	ENST00000294952.8	37	c.2203A>T	CCDS46278.1	.	.	.	.	.	.	.	.	.	.	A	40	8.038520	0.98621	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.563	16.4461	0.83932	1.0:0.0:0.0:0.0	.	.	.	.	X	724;735;693	.	ENSP00000281394:K724X	K	+	1	0	KLRAQ1	48592001	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.285000	0.76669	0.528000	0.53228	AAG		0.373	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251238.4	NM_152994		21	184	0	0	0	0.008871	0	21	184				
KCNJ3	3760	broad.mit.edu	37	2	155711377	155711377	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr2:155711377C>A	ENST00000295101.2	+	3	1535	c.1058C>A	c.(1057-1059)aCc>aAc	p.T353N	KCNJ3_ENST00000544049.1_3'UTR|KCNJ3_ENST00000493505.1_3'UTR	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	353					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	GAAGTCCCCACCCCACCTTAC	0.418																																							uc002tyv.1		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(1057-1059)ACC>AAC		potassium inwardly-rectifying channel J3	Halothane(DB01159)						110.0	111.0	110.0					2																	155711377		2203	4300	6503	SO:0001583	missense	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155711377C>A	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.1058C>A	2.37:g.155711377C>A	ENSP00000295101:p.Thr353Asn		Somatic				KCNJ3_uc010zce.1_3'UTR	p.T353N	NM_002239	NP_002230	WXS	Illumina HiSeq	Unspecified	P48549	IRK3_HUMAN			3	1253	+			353			Cytoplasmic (By similarity).		B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	c.1058C>A	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911512	0.72983	.	.	ENSG00000162989	ENST00000295101	D	0.94687	-3.49	5.7	5.7	0.88788	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.047489	0.85682	D	0.000000	D	0.97583	0.9208	M	0.86805	2.84	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	D	0.98039	1.0381	10	0.87932	D	0	.	18.8359	0.92162	0.0:1.0:0.0:0.0	.	353	P48549	IRK3_HUMAN	N	353	ENSP00000295101:T353N	ENSP00000295101:T353N	T	+	2	0	KCNJ3	155419623	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.704000	0.92352	0.650000	0.86243	ACC		0.418	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		6	102	1	0	8.12818e-05	0.001984	9.86341e-05	6	102				
XIRP2	129446	broad.mit.edu	37	2	168103814	168103814	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr2:168103814G>A	ENST00000409195.1	+	9	6001	c.5912G>A	c.(5911-5913)aGg>aAg	p.R1971K	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.R1749K|XIRP2_ENST00000295237.9_Missense_Mutation_p.R1971K|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1796					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.R1971K(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GCTGTCCAGAGGAACAAAAAT	0.458																																							uc002udx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(5911-5913)AGG>AAG		xin actin-binding repeat containing 2 isoform 1							42.0	41.0	41.0					2																	168103814		1910	4126	6036	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168103814G>A	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5912G>A	2.37:g.168103814G>A	ENSP00000386840:p.Arg1971Lys		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.R1796K|XIRP2_uc010fpq.2_Missense_Mutation_p.R1749K|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.R1971K	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	5930	+			1796					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.5912G>A	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	0.120	-1.127214	0.01770	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02631	4.22;4.22;4.22	5.73	-1.6	0.08426	.	0.512522	0.22936	N	0.053854	T	0.01835	0.0058	L	0.35723	1.085	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.001;0.003;0.003	T	0.50065	-0.8871	10	0.05620	T	0.96	0.1695	6.2056	0.20600	0.317:0.232:0.451:0.0	.	1796;1796;1749	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	K	1971;1971;1749	ENSP00000386840:R1971K;ENSP00000295237:R1971K;ENSP00000387255:R1749K	ENSP00000295237:R1971K	R	+	2	0	XIRP2	167812060	0.290000	0.24343	0.000000	0.03702	0.003000	0.03518	0.529000	0.23019	-0.706000	0.05028	-1.829000	0.00594	AGG		0.458	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		6	51	0	0	0	0.001168	0	6	51				
ZNF804A	91752	broad.mit.edu	37	2	185803464	185803464	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr2:185803464C>G	ENST00000302277.6	+	4	3935	c.3341C>G	c.(3340-3342)gCt>gGt	p.A1114G		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1114							metal ion binding (GO:0046872)	p.A1114G(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						gcagctgcagctgcagccgca	0.522																																							uc002uph.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(3340-3342)GCT>GGT		zinc finger protein 804A							40.0	49.0	46.0					2																	185803464		2203	4300	6503	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185803464C>G	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.3341C>G	2.37:g.185803464C>G	ENSP00000303252:p.Ala1114Gly		Somatic					p.A1114G	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	3935	+			1114					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.3341C>G	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	10.89	1.478934	0.26511	.	.	ENSG00000170396	ENST00000302277	T	0.05996	3.36	3.71	3.71	0.42584	.	0.000000	0.41605	D	0.000842	T	0.06781	0.0173	L	0.51422	1.61	0.09310	N	1	P	0.42908	0.793	B	0.35655	0.207	T	0.27297	-1.0078	10	0.72032	D	0.01	-5.0907	10.8489	0.46759	0.0:1.0:0.0:0.0	.	1114	Q7Z570	Z804A_HUMAN	G	1114	ENSP00000303252:A1114G	ENSP00000303252:A1114G	A	+	2	0	ZNF804A	185511709	0.933000	0.31639	0.012000	0.15200	0.427000	0.31564	2.448000	0.44926	1.886000	0.54624	0.305000	0.20034	GCT		0.522	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		4	62	0	0	0	0.009096	0	4	62				
CFAP61	26074	broad.mit.edu	37	20	20278871	20278871	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr20:20278871G>C	ENST00000245957.5	+	25	3339	c.3263G>C	c.(3262-3264)cGa>cCa	p.R1088P	C20orf26_ENST00000377309.2_3'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		1088								p.R1088Q(3)|p.R1088P(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		ACTTACTTCCGAATTCATATT	0.458																																							uc002wru.2		NA																	4	Substitution - Missense(4)		large_intestine(3)|lung(1)	ovary(3)|pancreas(1)	4						c.(3262-3264)CGA>CCA		hypothetical protein LOC26074							78.0	75.0	76.0					20																	20278871		2203	4300	6503	SO:0001583	missense	26074							g.chr20:20278871G>C																												ENST00000245957.5:c.3263G>C	20.37:g.20278871G>C	ENSP00000245957:p.Arg1088Pro		Somatic				C20orf26_uc002wrw.2_RNA	p.R1088P	NM_015585	NP_056400	WXS	Illumina HiSeq	Unspecified	Q8NHU2	CT026_HUMAN		READ - Rectum adenocarcinoma(2;0.171)	25	3339	+			1088					A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	c.3263G>C	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064271	0.76187	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.50548	0.74	5.27	5.27	0.74061	.	0.300219	0.31922	N	0.006857	T	0.66137	0.2759	M	0.72894	2.215	0.80722	D	1	D	0.64830	0.994	P	0.58873	0.847	T	0.69439	-0.5145	10	0.72032	D	0.01	.	19.2438	0.93893	0.0:0.0:1.0:0.0	.	1088	Q8NHU2	CT026_HUMAN	P	1028;1054;1088	ENSP00000245957:R1088P	ENSP00000245957:R1088P	R	+	2	0	C20orf26	20226871	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	6.069000	0.71209	2.628000	0.89032	0.655000	0.94253	CGA		0.458	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3			4	53	0	0	0	0.000602	0	4	53				
KIZ-AS1	101929591	broad.mit.edu	37	20	21142930	21142930	+	RNA	SNP	A	A	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr20:21142930A>C	ENST00000591761.1	-	0	5142				PLK1S1_ENST00000457464.1_RNA|RP5-872K7.7_ENST00000425746.2_RNA																							GCTGAACTCAATTCCCCGTTA	0.433																																							uc002wsb.2		NA																	0					0						c.(823-825)AAT>ACT		polo-like kinase 1 substrate 1 isoform 1							124.0	124.0	124.0					20																	21142930		1886	4126	6012			55857				spindle organization	centrosome	protein kinase binding	g.chr20:21142930A>C																													20.37:g.21142930A>C			Somatic				PLK1S1_uc010zsh.1_Missense_Mutation_p.N172T|PLK1S1_uc010zsi.1_Missense_Mutation_p.N142T|PLK1S1_uc010zsj.1_RNA|uc002wsc.2_Intron|PLK1S1_uc002wsd.2_RNA	p.N275T	NM_018474	NP_060944	WXS	Illumina HiSeq	Unspecified	Q2M2Z5	KIZ_HUMAN			5	957	+			275						Missense_Mutation	SNP	ENST00000591761.1	37	c.824A>C																																																																																					0.433	RP4-777D9.2-002	KNOWN	basic	antisense	antisense	OTTHUMT00000078258.2			8	112	0	0	0	0.00308	0	8	112				
SYNDIG1	79953	broad.mit.edu	37	20	24565545	24565545	+	Silent	SNP	G	G	A	rs536225349	byFrequency	TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr20:24565545G>A	ENST00000376862.3	+	3	1167	c.534G>A	c.(532-534)ccG>ccA	p.P178P	SYNDIG1_ENST00000482637.1_3'UTR	NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	178					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)	p.P178P(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						TGATGCCCCCGCGGGACCACC	0.547													g|||	2	0.000399361	0.0	0.0	5008	,	,		18887	0.0		0.0	False		,,,				2504	0.002						uc002wtw.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(532-534)CCG>CCA		transmembrane protein 90B							138.0	126.0	130.0					20																	24565545		2203	4300	6503	SO:0001819	synonymous_variant	79953				response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane		g.chr20:24565545G>A	AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.534G>A	20.37:g.24565545G>A			Somatic					p.P178P	NM_024893	NP_079169	WXS	Illumina HiSeq	Unspecified	Q9H7V2	SYNG1_HUMAN			3	1167	+			178			Cytoplasmic (Potential).		Q6IA30|Q9H514	Silent	SNP	ENST00000376862.3	37	c.534G>A	CCDS13164.1																																																																																				0.547	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078376.1	NM_024893		4	109	0	0	0	0.009096	0	4	109				
TTLL9	164395	broad.mit.edu	37	20	30496492	30496492	+	Missense_Mutation	SNP	G	G	A	rs117415805		TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr20:30496492G>A	ENST00000375938.4	+	5	558	c.305G>A	c.(304-306)cGg>cAg	p.R102Q	TTLL9_ENST00000375922.4_Missense_Mutation_p.R52Q|TTLL9_ENST00000310998.4_Missense_Mutation_p.R52Q|TTLL9_ENST00000375934.4_Missense_Mutation_p.R84Q|TTLL9_ENST00000535842.1_Missense_Mutation_p.R102Q|TTLL9_ENST00000375921.2_Missense_Mutation_p.R52Q			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	102	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)	p.R102Q(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AGTCACTTCCGGAACCACTAT	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		19334	0.0		0.001	False		,,,				2504	0.0						uc010gdx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(304-306)CGG>CAG		tubulin tyrosine ligase-like family, member 9							50.0	52.0	51.0					20																	30496492		2091	4226	6317	SO:0001583	missense	164395				protein modification process	cilium|microtubule|microtubule basal body	ATP binding|tubulin-tyrosine ligase activity	g.chr20:30496492G>A	AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.305G>A	20.37:g.30496492G>A	ENSP00000365105:p.Arg102Gln		Somatic				TTLL9_uc002wwy.1_RNA|TTLL9_uc002wwz.1_RNA|TTLL9_uc002wxa.1_RNA|TTLL9_uc002wxb.1_RNA|TTLL9_uc010zto.1_RNA|TTLL9_uc002wxc.2_Intron|TTLL9_uc010ztp.1_RNA|TTLL9_uc010ztq.1_5'Flank	p.R102Q	NM_001008409	NP_001008409	WXS	Illumina HiSeq	Unspecified	Q3SXZ7	TTLL9_HUMAN	Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)		5	558	+			102			TTL.		A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Missense_Mutation	SNP	ENST00000375938.4	37	c.305G>A	CCDS42863.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	23.8	4.455689	0.84209	.	.	ENSG00000131044	ENST00000375938;ENST00000535842;ENST00000310998;ENST00000375921;ENST00000375934;ENST00000375922	T;T;T;T;T;T	0.05319	3.46;3.46;3.46;3.46;3.46;3.46	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.15522	0.0374	L	0.60904	1.88	0.54753	D	0.999981	D	0.56968	0.978	P	0.54238	0.746	T	0.00520	-1.1692	10	0.44086	T	0.13	.	14.9857	0.71345	0.0:0.0:1.0:0.0	.	102	Q3SXZ7	TTLL9_HUMAN	Q	102;102;52;52;84;52	ENSP00000365105:R102Q;ENSP00000442515:R102Q;ENSP00000308980:R52Q;ENSP00000365086:R52Q;ENSP00000365100:R84Q;ENSP00000365088:R52Q	ENSP00000308980:R52Q	R	+	2	0	TTLL9	29960153	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.553000	0.60753	2.377000	0.81083	0.561000	0.74099	CGG		0.562	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001008409		3	27	0	0	0	0.004672	0	3	27				
ADA	100	broad.mit.edu	37	20	43249764	43249764	+	Silent	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr20:43249764G>A	ENST00000372874.4	-	10	1004	c.870C>T	c.(868-870)taC>taT	p.Y290Y	PKIG_ENST00000372882.3_Intron|Z97053.1_ENST00000597250.1_5'Flank|ADA_ENST00000464097.1_5'UTR|PKIG_ENST00000372887.1_Intron|ADA_ENST00000537820.1_Silent_p.Y266Y	NM_000022.2	NP_000013.2	P00813	ADA_HUMAN	adenosine deaminase	290					adenosine catabolic process (GO:0006154)|aging (GO:0007568)|cell adhesion (GO:0007155)|dATP catabolic process (GO:0046061)|deoxyadenosine catabolic process (GO:0006157)|embryonic digestive tract development (GO:0048566)|germinal center B cell differentiation (GO:0002314)|histamine secretion (GO:0001821)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|negative regulation of adenosine receptor signaling pathway (GO:0060169)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of mucus secretion (GO:0070256)|negative regulation of penile erection (GO:0060407)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleobase-containing small molecule metabolic process (GO:0055086)|Peyer's patch development (GO:0048541)|placenta development (GO:0001890)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of germinal center formation (GO:0002636)|positive regulation of heart rate (GO:0010460)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide salvage (GO:0032261)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|purine-containing compound salvage (GO:0043101)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to morphine (GO:0043278)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|trophectodermal cell differentiation (GO:0001829)|xanthine biosynthetic process (GO:0046111)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|lysosome (GO:0005764)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenosine deaminase activity (GO:0004000)|purine nucleoside binding (GO:0001883)|zinc ion binding (GO:0008270)	p.Y290Y(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(2)|prostate(3)|skin(2)|urinary_tract(1)	18		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Dipyridamole(DB00975)|Edetic Acid(DB00974)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	TGTTGAGCGAGTAGTTAGCCT	0.463									Adenosine Deaminase Deficiency																														uc002xmj.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(868-870)TAC>TAT		adenosine deaminase	Adenosine(DB00640)|Cladribine(DB00242)|Dipyridamole(DB00975)|Erythromycin(DB00199)|Fludarabine(DB01073)|Idoxuridine(DB00249)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)						189.0	158.0	168.0					20																	43249764		2203	4300	6503	SO:0001819	synonymous_variant	100	Adenosine_Deaminase_Deficiency	Familial Cancer Database	Severe Combined Immunodeficiency (SCID) due to ADA-deficiency	adenosine catabolic process|cell adhesion|hypoxanthine salvage|inosine biosynthetic process|negative regulation of adenosine receptor signaling pathway|purine nucleotide salvage|purine ribonucleoside monophosphate biosynthetic process|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation	cell junction|cytoplasmic membrane-bounded vesicle lumen|cytosol|external side of plasma membrane|lysosome	adenosine deaminase activity|protein binding|zinc ion binding	g.chr20:43249764G>A	X02994	CCDS13335.1	20q13.12	2014-09-17			ENSG00000196839	ENSG00000196839	3.5.4.4		186	protein-coding gene	gene with protein product		608958				6198240, 6090454	Standard	NM_000022		Approved		uc002xmj.3	P00813	OTTHUMG00000033081	ENST00000372874.4:c.870C>T	20.37:g.43249764G>A			Somatic				ADA_uc010ggt.2_RNA	p.Y290Y	NM_000022	NP_000013	WXS	Illumina HiSeq	Unspecified	P00813	ADA_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		10	998	-		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	290					Q53F92|Q6LA59	Silent	SNP	ENST00000372874.4	37	c.870C>T	CCDS13335.1																																																																																				0.463	ADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080509.2	NM_000022		6	48	0	0	0	0.001168	0	6	48				
SETD2	29072	broad.mit.edu	37	3	47142964	47142964	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr3:47142964G>A	ENST00000409792.3	-	8	5041	c.4999C>T	c.(4999-5001)Cag>Tag	p.Q1667*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1667	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.Q1667*(1)|p.Q1164*(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTCTGGAACTGATAGTCAAAC	0.373			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		2	Substitution - Nonsense(2)		lung(2)	kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(4999-5001)CAG>TAG		SET domain containing 2							165.0	169.0	167.0					3																	47142964		2203	4300	6503	SO:0001587	stop_gained	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47142964G>A	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4999C>T	3.37:g.47142964G>A	ENSP00000386759:p.Gln1667*		Somatic				SETD2_uc003cqv.2_Nonsense_Mutation_p.Q1734*	p.Q1667*	NM_014159	NP_054878	WXS	Illumina HiSeq	Unspecified	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	8	5052	-		Acute lymphoblastic leukemia(5;0.0169)	1667			SET.		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	c.4999C>T	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	46	12.215991	0.99647	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	.	.	.	5.94	5.94	0.96194	.	0.000000	0.50627	D	0.000105	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	20.3736	0.98901	0.0:0.0:1.0:0.0	.	.	.	.	X	1667	.	ENSP00000386759:Q1667X	Q	-	1	0	SETD2	47117968	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.761000	0.98940	2.820000	0.97059	0.650000	0.86243	CAG		0.373	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		15	229	0	0	0	0.006122	0	15	229				
SETD2	29072	broad.mit.edu	37	3	47155459	47155459	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr3:47155459T>C	ENST00000409792.3	-	5	4664	c.4622A>G	c.(4621-4623)aAt>aGt	p.N1541S		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1541	AWS. {ECO:0000255|PROSITE- ProRule:PRU00562}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.N1038S(1)|p.N1541S(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AAACCGTCTATTGGAACAATA	0.398			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		2	Substitution - Missense(2)		lung(2)	kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(4621-4623)AAT>AGT		SET domain containing 2							134.0	133.0	133.0					3																	47155459		2203	4300	6503	SO:0001583	missense	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47155459T>C	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4622A>G	3.37:g.47155459T>C	ENSP00000386759:p.Asn1541Ser		Somatic				SETD2_uc003cqv.2_Missense_Mutation_p.N1530S	p.N1541S	NM_014159	NP_054878	WXS	Illumina HiSeq	Unspecified	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	5	4675	-		Acute lymphoblastic leukemia(5;0.0169)	1541			AWS.		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	c.4622A>G	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	17.55	3.418643	0.62622	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.86432	-2.12	5.06	5.06	0.68205	AWS (2);	0.000000	0.64402	D	0.000015	D	0.89959	0.6866	H	0.97023	3.925	0.80722	D	1	P;P	0.41131	0.739;0.739	B;B	0.28139	0.086;0.086	D	0.92533	0.6035	10	0.87932	D	0	.	15.0911	0.72195	0.0:0.0:0.0:1.0	.	1541;1541	F2Z317;Q9BYW2	.;SETD2_HUMAN	S	1541	ENSP00000386759:N1541S	ENSP00000386759:N1541S	N	-	2	0	SETD2	47130463	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.632000	0.83247	2.036000	0.60181	0.477000	0.44152	AAT		0.398	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		34	81	0	0	0	0.004878	0	34	81				
GLYCTK	132158	broad.mit.edu	37	3	52326927	52326928	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr3:52326927_52326928GG>AT	ENST00000436784.2	+	5	1417_1418	c.1357_1358GG>AT	c.(1357-1359)GGg>ATg	p.G453M	GLYCTK_ENST00000471180.1_Intron|GLYCTK_ENST00000354773.4_3'UTR|GLYCTK_ENST00000477382.1_3'UTR|GLYCTK_ENST00000305690.8_Intron|MIR135A1_ENST00000385191.1_RNA|GLYCTK_ENST00000473032.1_Intron|GLYCTK_ENST00000461183.1_Intron|GLYCTK-AS1_ENST00000493616.1_RNA			Q8IVS8	GLCTK_HUMAN	glycerate kinase	453					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glycerate kinase activity (GO:0008887)	p.G453M(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		TGGCACCGATGGGCAGGATGGG	0.649																																							uc003ddo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1357-1359)GGG>ATG		glycerate kinase isoform 1																																				SO:0001583	missense	132158				protein phosphorylation	Golgi apparatus|mitochondrion	ATP binding|glycerate kinase activity|protein binding	g.chr3:52326927_52326928GG>AT		CCDS2852.1, CCDS46841.1	3p21.1	2008-01-22			ENSG00000168237	ENSG00000168237	2.7.1.31		24247	protein-coding gene	gene with protein product		610516				16753811	Standard	NM_145262		Approved	HBEBP4, HBEBP2	uc003ddo.3	Q8IVS8	OTTHUMG00000158380	Exception_encountered	3.37:g.52326927_52326928delinsAT	ENSP00000389175:p.Gly453Met		Somatic				GLYCTK_uc003ddq.2_3'UTR|GLYCTK_uc003ddm.2_Intron|GLYCTK_uc003ddn.2_Intron|GLYCTK_uc003ddp.1_Intron|GLYCTK_uc003ddr.2_Missense_Mutation_p.G117M	p.G453M	NM_145262	NP_660305	WXS	Illumina HiSeq	Unspecified	Q8IVS8	GLCTK_HUMAN		BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)	5	1453_1454	+			453					Q0P630|Q2EZ43|Q6Y2K6|Q7Z6G5|Q86YR8|Q8TED2|Q8WTY2	Missense_Mutation	DNP	ENST00000436784.2	37	c.1357_1358GG>AT	CCDS2852.1																																																																																				0.649	GLYCTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350835.1	NM_145262		5	67	0	0	0	0.004672	0	5	67				
EPHA6	285220	broad.mit.edu	37	3	96706498	96706498	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr3:96706498C>A	ENST00000389672.5	+	3	813	c.775C>A	c.(775-777)Cgc>Agc	p.R259S	EPHA6_ENST00000470610.2_Missense_Mutation_p.R259S|EPHA6_ENST00000542517.1_Missense_Mutation_p.R165S	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	165						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)	p.R165S(2)|p.R259S(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						TTTGGGTGATCGCATCCTCAA	0.443																																							uc010how.1		NA																	3	Substitution - Missense(3)		lung(3)	stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						c.(775-777)CGC>AGC		EPH receptor A6 isoform a							201.0	207.0	206.0					3																	96706498		1900	4142	6042	SO:0001583	missense	285220					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:96706498C>A	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.775C>A	3.37:g.96706498C>A	ENSP00000374323:p.Arg259Ser		Somatic				EPHA6_uc003drp.1_Missense_Mutation_p.R259S	p.R259S	NM_001080448	NP_001073917	WXS	Illumina HiSeq	Unspecified	Q9UF33	EPHA6_HUMAN			3	818	+			164			Ephrin-binding.|Extracellular (Potential).		D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	37	c.775C>A	CCDS46876.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.477626|4.477626	0.84640|0.84640	.|.	.|.	ENSG00000080224|ENSG00000080224	ENST00000470610;ENST00000389672;ENST00000542517|ENST00000506569	T;T;T|.	0.03717|.	3.83;3.83;3.83|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	0.000000|.	0.64402|.	U|.	0.000013|.	T|.	0.78616|.	0.4311|.	M|M	0.79805|0.79805	2.47|2.47	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	T|.	0.79196|.	-0.1903|.	10|.	0.62326|.	D|.	0.03|.	.|.	18.3424|18.3424	0.90309|0.90309	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	259;259|.	B3KS12;E7EU71|.	.;.|.	S|X	259;259;165|203	ENSP00000420598:R259S;ENSP00000374323:R259S;ENSP00000439758:R165S|.	ENSP00000374323:R259S|.	R|S	+|+	1|2	0|0	EPHA6|EPHA6	98189188|98189188	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	7.818000|7.818000	0.86416|0.86416	2.554000|2.554000	0.86153|0.86153	0.655000|0.655000	0.94253|0.94253	CGC|TCG		0.443	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448		5	287	1	0	0.00198382	0.001984	0.00230379	5	287				
SLC9C1	285335	broad.mit.edu	37	3	111996575	111996575	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr3:111996575G>T	ENST00000305815.5	-	5	703	c.451C>A	c.(451-453)Ccc>Acc	p.P151T	SLC9C1_ENST00000467397.1_5'Flank|SLC9C1_ENST00000487372.1_Missense_Mutation_p.P151T	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	151					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.P151T(1)									GTTAGCATGGGATCTGAACTC	0.318																																							uc003dyu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)	5						c.(451-453)CCC>ACC		sperm-specific sodium proton exchanger							80.0	86.0	84.0					3																	111996575		2203	4300	6503	SO:0001583	missense	285335				cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity	g.chr3:111996575G>T	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.451C>A	3.37:g.111996575G>T	ENSP00000306627:p.Pro151Thr		Somatic				SLC9A10_uc011bhu.1_5'UTR|SLC9A10_uc010hqc.2_Missense_Mutation_p.P151T	p.P151T	NM_183061	NP_898884	WXS	Illumina HiSeq	Unspecified	Q4G0N8	S9A10_HUMAN			5	673	-			151			Helical; (Potential).		Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	c.451C>A	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.034412	0.54896	.	.	ENSG00000172139	ENST00000305815;ENST00000487372;ENST00000486574	T;T;T	0.19394	2.15;2.15;2.15	5.45	5.45	0.79879	Cation/H+ exchanger (1);	0.000000	0.56097	D	0.000037	T	0.43010	0.1228	L	0.58101	1.795	0.36049	D	0.840652	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.50171	-0.8859	10	0.56958	D	0.05	.	14.7775	0.69740	0.0:0.0:1.0:0.0	.	151;151	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	T	151;151;78	ENSP00000306627:P151T;ENSP00000420688:P151T;ENSP00000417274:P78T	ENSP00000306627:P151T	P	-	1	0	SLC9A10	113479265	1.000000	0.71417	0.998000	0.56505	0.291000	0.27294	4.760000	0.62235	2.549000	0.85964	0.655000	0.94253	CCC		0.318	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061		14	110	1	0	4.93089e-13	0.00245	6.82739e-13	14	110				
KLHL6	89857	broad.mit.edu	37	3	183217479	183217479	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr3:183217479T>C	ENST00000341319.3	-	4	1081	c.1046A>G	c.(1045-1047)gAg>gGg	p.E349G		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	349					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)			p.E349G(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CTTGGCCACCTCCAGGCGGCT	0.547																																							uc003flr.2		NA																	1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3						c.(1045-1047)GAG>GGG		kelch-like 6							89.0	80.0	83.0					3																	183217479		2203	4300	6503	SO:0001583	missense	89857							g.chr3:183217479T>C	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1046A>G	3.37:g.183217479T>C	ENSP00000341342:p.Glu349Gly		Somatic				KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_Intron	p.E349G	NM_130446	NP_569713	WXS	Illumina HiSeq	Unspecified	Q8WZ60	KLHL6_HUMAN	all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)		4	1104	-	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		349			Kelch 1.		B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	c.1046A>G	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	T	14.41	2.527418	0.44969	.	.	ENSG00000172578	ENST00000341319	T	0.67523	-0.27	5.12	5.12	0.69794	Kelch-type beta propeller (1);	0.045277	0.85682	D	0.000000	T	0.59266	0.2181	L	0.47716	1.5	0.58432	D	0.999999	B	0.20780	0.048	B	0.13407	0.009	T	0.55270	-0.8167	10	0.23302	T	0.38	.	15.234	0.73413	0.0:0.0:0.0:1.0	.	349	Q8WZ60	KLHL6_HUMAN	G	349	ENSP00000341342:E349G	ENSP00000341342:E349G	E	-	2	0	KLHL6	184700173	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.655000	0.83696	2.068000	0.61886	0.454000	0.30748	GAG		0.547	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446		4	122	0	0	0	0.000602	0	4	122				
ANKRD17	26057	broad.mit.edu	37	4	74043241	74043241	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr4:74043241A>C	ENST00000358602.4	-	2	519	c.403T>G	c.(403-405)Ttc>Gtc	p.F135V	ANKRD17_ENST00000330838.6_Missense_Mutation_p.F135V|ANKRD17_ENST00000509867.2_Missense_Mutation_p.F22V	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	135					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.F135V(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCCAAAATGAAAGACTCCACC	0.433																																							uc003hgp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10						c.(403-405)TTC>GTC		ankyrin repeat domain protein 17 isoform a							62.0	58.0	60.0					4																	74043241		2203	4299	6502	SO:0001583	missense	26057				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding	g.chr4:74043241A>C	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.403T>G	4.37:g.74043241A>C	ENSP00000351416:p.Phe135Val		Somatic				ANKRD17_uc003hgo.2_Missense_Mutation_p.F22V|ANKRD17_uc003hgq.2_Missense_Mutation_p.F135V|ANKRD17_uc003hgr.2_Missense_Mutation_p.F135V	p.F135V	NM_032217	NP_115593	WXS	Illumina HiSeq	Unspecified	O75179	ANR17_HUMAN	Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		2	520	-	Breast(15;0.000295)		135					E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	c.403T>G	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	A	29.9	5.041814	0.93685	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.80909	-1.43;-1.43;-1.28	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000002	D	0.84543	0.5495	L	0.48642	1.525	0.41931	D	0.99056	D;D;D;B	0.64830	0.964;0.994;0.962;0.197	P;P;P;B	0.59012	0.622;0.85;0.548;0.029	D	0.85333	0.1091	10	0.49607	T	0.09	.	15.8528	0.78947	1.0:0.0:0.0:0.0	.	135;135;135;22	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	V	135;135;135;22;135	ENSP00000351416:F135V;ENSP00000332265:F135V;ENSP00000427151:F22V	ENSP00000332265:F135V	F	-	1	0	ANKRD17	74262105	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.339000	0.96797	2.141000	0.66446	0.482000	0.46254	TTC		0.433	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217		6	50	0	0	0	0.001168	0	6	50				
CCDC158	339965	broad.mit.edu	37	4	77283379	77283379	+	Silent	SNP	T	T	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr4:77283379T>C	ENST00000388914.3	-	12	2072	c.1920A>G	c.(1918-1920)gcA>gcG	p.A640A		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	640								p.A640A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						GCTCAGAGCCTGCATTCACCA	0.408																																							uc003hkb.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|pancreas(1)	6						c.(1918-1920)GCA>GCG		coiled-coil domain containing 158							159.0	160.0	159.0					4																	77283379		1967	4153	6120	SO:0001819	synonymous_variant	339965							g.chr4:77283379T>C	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.1920A>G	4.37:g.77283379T>C			Somatic					p.A640A	NM_001042784	NP_001036249	WXS	Illumina HiSeq	Unspecified	Q5M9N0	CD158_HUMAN			12	2073	-			640			Potential.		Q8IYQ1|Q8N7D4|Q8N7E3	Silent	SNP	ENST00000388914.3	37	c.1920A>G	CCDS43242.1																																																																																				0.408	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784		3	180	0	0	0	0.001168	0	3	180				
WDFY3	23001	broad.mit.edu	37	4	85626628	85626628	+	Silent	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr4:85626628G>A	ENST00000295888.4	-	54	8661	c.8254C>T	c.(8254-8256)Ctg>Ttg	p.L2752L	WDFY3_ENST00000322366.6_Silent_p.L2735L	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2752	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.|Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.L2752L(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGCTTAGCCAGGTTTCTAAAC	0.393																																							uc003hpd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(8254-8256)CTG>TTG		WD repeat and FYVE domain containing 3 isoform							198.0	175.0	182.0					4																	85626628		2203	4300	6503	SO:0001819	synonymous_variant	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85626628G>A	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.8254C>T	4.37:g.85626628G>A			Somatic				WDFY3_uc003hpe.1_Silent_p.L363L	p.L2752L	NM_014991	NP_055806	WXS	Illumina HiSeq	Unspecified	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	54	8662	-		Hepatocellular(203;0.114)	2752			BEACH.		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	c.8254C>T	CCDS3609.1																																																																																				0.393	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		4	137	0	0	0	0.000602	0	4	137				
RAPGEF2	9693	broad.mit.edu	37	4	160264217	160264217	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr4:160264217A>G	ENST00000264431.4	+	15	2941	c.2522A>G	c.(2521-2523)cAa>cGa	p.Q841R		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	841	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)	p.Q829R(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CAAGATCTCCAAGACCTGTTT	0.413																																							uc003iqg.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|upper_aerodigestive_tract(1)|skin(1)	4						c.(2521-2523)CAA>CGA		Rap guanine nucleotide exchange factor 2							109.0	100.0	103.0					4																	160264217		1892	4115	6007	SO:0001583	missense	9693				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr4:160264217A>G	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.2522A>G	4.37:g.160264217A>G	ENSP00000264431:p.Gln841Arg		Somatic					p.Q841R	NM_014247	NP_055062	WXS	Illumina HiSeq	Unspecified	Q9Y4G8	RPGF2_HUMAN		COAD - Colon adenocarcinoma(41;0.0817)	15	2832	+	all_hematologic(180;0.24)		841			Ras-GEF.		D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	c.2522A>G	CCDS43277.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.925826	0.92319	.	.	ENSG00000109756	ENST00000264431	T	0.30714	1.52	5.82	5.82	0.92795	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.50565	0.1623	L	0.53780	1.695	0.80722	D	1	D	0.55800	0.973	D	0.65233	0.933	T	0.50575	-0.8812	10	0.72032	D	0.01	.	16.1761	0.81851	1.0:0.0:0.0:0.0	.	841	Q9Y4G8	RPGF2_HUMAN	R	841	ENSP00000264431:Q841R	ENSP00000264431:Q841R	Q	+	2	0	RAPGEF2	160483667	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.235000	0.95353	2.215000	0.71742	0.459000	0.35465	CAA		0.413	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247		5	54	0	0	0	0.001168	0	5	54				
CDH10	1008	broad.mit.edu	37	5	24498627	24498627	+	Splice_Site	SNP	G	G	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr5:24498627G>C	ENST00000264463.4	-	9	1902	c.1395C>G	c.(1393-1395)aaC>aaG	p.N465K	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	465	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N465K(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		CTTTGGGATTGTCTGGAAAAG	0.368										HNSCC(23;0.051)																													uc003jgr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(1393-1395)AAC>AAG		cadherin 10, type 2 preproprotein							74.0	76.0	76.0					5																	24498627		2203	4300	6503	SO:0001630	splice_region_variant	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24498627G>C	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1394-1C>G	5.37:g.24498627G>C		HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.N465K	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	9	1727	-			465			Cadherin 4.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.1395C>G	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004250	0.35320	.	.	ENSG00000040731	ENST00000264463	T	0.61040	0.14	5.42	-2.19	0.07015	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.54464	0.1860	L	0.52905	1.665	0.39440	D	0.967233	B	0.33299	0.407	B	0.43018	0.405	T	0.50980	-0.8763	10	0.38643	T	0.18	.	11.4919	0.50385	0.6486:0.0:0.3514:0.0	.	465	Q9Y6N8	CAD10_HUMAN	K	465	ENSP00000264463:N465K	ENSP00000264463:N465K	N	-	3	2	CDH10	24534384	0.996000	0.38824	0.969000	0.41365	0.877000	0.50540	0.388000	0.20735	-0.556000	0.06134	-0.150000	0.13652	AAC		0.368	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	Missense_Mutation	7	82	0	0	0	0.00308	0	7	82				
PDZD2	23037	broad.mit.edu	37	5	32093041	32093041	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr5:32093041G>A	ENST00000438447.1	+	21	8144	c.7756G>A	c.(7756-7758)Gac>Aac	p.D2586N	PDZD2_ENST00000282493.3_Missense_Mutation_p.D2586N			O15018	PDZD2_HUMAN	PDZ domain containing 2	2586					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.D2586N(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CTCAGCGGGGGACCAGCAAAG	0.348																																							uc003jhl.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						c.(7756-7758)GAC>AAC		PDZ domain containing 2							62.0	64.0	63.0					5																	32093041		2203	4300	6503	SO:0001583	missense	23037				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus		g.chr5:32093041G>A	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.7756G>A	5.37:g.32093041G>A	ENSP00000402033:p.Asp2586Asn		Somatic				PDZD2_uc003jhm.2_Missense_Mutation_p.D2586N	p.D2586N	NM_178140	NP_835260	WXS	Illumina HiSeq	Unspecified	O15018	PDZD2_HUMAN			21	8144	+			2586					Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	c.7756G>A	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.414978	0.42817	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.08370	3.1;3.1	5.92	2.55	0.30701	.	0.502898	0.18323	N	0.144750	T	0.04272	0.0118	N	0.17082	0.46	0.23076	N	0.998339	B	0.12630	0.006	B	0.09377	0.004	T	0.44205	-0.9343	10	0.21014	T	0.42	.	4.2592	0.10733	0.117:0.1368:0.6045:0.1417	.	2586	O15018	PDZD2_HUMAN	N	2586;2387;2586	ENSP00000402033:D2586N;ENSP00000282493:D2586N	ENSP00000282493:D2586N	D	+	1	0	PDZD2	32128798	1.000000	0.71417	0.088000	0.20740	0.909000	0.53808	3.334000	0.52097	0.193000	0.20303	0.650000	0.86243	GAC		0.348	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			16	33	0	0	0	0.00499	0	16	33				
NADK2	133686	broad.mit.edu	37	5	36211993	36211993	+	Silent	SNP	T	T	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr5:36211993T>A	ENST00000381937.4	-	7	812	c.813A>T	c.(811-813)ccA>ccT	p.P271P	NADK2_ENST00000282512.3_Silent_p.P108P|NADK2_ENST00000514504.1_Silent_p.P271P|NADK2_ENST00000511613.1_5'UTR|NADK2_ENST00000397338.1_Silent_p.P108P|NADK2_ENST00000506945.1_Silent_p.P108P	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	271					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)	p.P108P(1)|p.P271P(1)									GTGCTCTCACTGGCAGAAGTT	0.378																																							uc003jkf.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(811-813)CCA>CCT		hypothetical protein LOC133686 isoform 1							126.0	130.0	128.0					5																	36211993		2203	4300	6503	SO:0001819	synonymous_variant	133686						NAD+ kinase activity	g.chr5:36211993T>A	BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.813A>T	5.37:g.36211993T>A			Somatic				C5orf33_uc003jke.3_RNA|C5orf33_uc010iux.2_Silent_p.P108P|C5orf33_uc003jkg.3_Silent_p.P108P|C5orf33_uc011cov.1_Silent_p.P108P	p.P271P	NM_001085411	NP_001078880	WXS	Illumina HiSeq	Unspecified	Q4G0N4	NAKD1_HUMAN	Epithelial(62;0.0254)|all cancers(62;0.0805)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		7	813	-	all_lung(31;5.63e-05)		271					B5MC93|Q6UTX5|Q96NM0	Silent	SNP	ENST00000381937.4	37	c.813A>T	CCDS47197.1																																																																																				0.378	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367541.1	NM_153013		5	149	0	0	0	0.001984	0	5	149				
NIPBL	25836	broad.mit.edu	37	5	37064848	37064848	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr5:37064848C>T	ENST00000282516.8	+	47	8768	c.8269C>T	c.(8269-8271)Cgc>Tgc	p.R2757C		NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2757					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.R2757C(1)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CCGTGATGGCCGCAAACTGGT	0.453																																							uc003jkl.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9						c.(8269-8271)CGC>TGC		delangin isoform A							87.0	82.0	84.0					5																	37064848		2203	4300	6503	SO:0001583	missense	25836				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding	g.chr5:37064848C>T	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.8269C>T	5.37:g.37064848C>T	ENSP00000282516:p.Arg2757Cys		Somatic				NIPBL_uc003jkk.3_3'UTR|NIPBL_uc003jkn.2_3'UTR	p.R2757C	NM_133433	NP_597677	WXS	Illumina HiSeq	Unspecified	Q6KC79	NIPBL_HUMAN	Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)		47	8768	+	all_lung(31;0.000447)|Hepatocellular(1;0.108)		2757					Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	c.8269C>T	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	C	15.43	2.831296	0.50845	.	.	ENSG00000164190	ENST00000282516	D	0.94687	-3.49	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.94892	0.8349	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.95274	0.8380	10	0.87932	D	0	-3.4263	14.9201	0.70832	0.143:0.857:0.0:0.0	.	2757	Q6KC79	NIPBL_HUMAN	C	2757	ENSP00000282516:R2757C	ENSP00000282516:R2757C	R	+	1	0	NIPBL	37100605	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.598000	0.67585	2.764000	0.94973	0.655000	0.94253	CGC		0.453	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384		5	79	0	0	0	0.000602	0	5	79				
SLC17A1	6568	broad.mit.edu	37	6	25813103	25813103	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr6:25813103T>C	ENST00000244527.4	-	8	968	c.853A>G	c.(853-855)Act>Gct	p.T285A	SLC17A1_ENST00000468082.1_Intron|SLC17A1_ENST00000427328.1_Intron|SLC17A1_ENST00000476801.1_Missense_Mutation_p.T285A	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	285					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.T285A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						AACATTGGAGTGTATAGTGTC	0.353																																							uc003nfh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(853-855)ACT>GCT		solute carrier family 17 (sodium phosphate),							65.0	64.0	65.0					6																	25813103		2203	4300	6503	SO:0001583	missense	6568				sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity	g.chr6:25813103T>C		CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.853A>G	6.37:g.25813103T>C	ENSP00000244527:p.Thr285Ala		Somatic				SLC17A1_uc011djy.1_RNA|SLC17A1_uc010jqb.1_Missense_Mutation_p.T283A|SLC17A1_uc010jqc.1_Intron	p.T285A	NM_005074	NP_005065	WXS	Illumina HiSeq	Unspecified	Q14916	NPT1_HUMAN			8	969	-			285					A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	ENST00000244527.4	37	c.853A>G	CCDS4565.1	.	.	.	.	.	.	.	.	.	.	T	6.175	0.400523	0.11696	.	.	ENSG00000124568	ENST00000244527;ENST00000476801	T;T	0.57595	0.39;0.39	3.67	1.18	0.20946	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.727850	0.03303	N	0.189379	T	0.29850	0.0746	L	0.60455	1.87	0.09310	N	1	B	0.32324	0.364	B	0.36378	0.223	T	0.31998	-0.9923	10	0.62326	D	0.03	.	2.8826	0.05652	0.2486:0.1192:0.0:0.6322	.	285	Q14916	NPT1_HUMAN	A	285	ENSP00000244527:T285A;ENSP00000420614:T285A	ENSP00000244527:T285A	T	-	1	0	SLC17A1	25921082	0.090000	0.21635	0.000000	0.03702	0.001000	0.01503	0.376000	0.20535	0.235000	0.21160	-0.250000	0.11733	ACT		0.353	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2			6	62	0	0	0	0.001984	0	6	62				
TNXB	7148	broad.mit.edu	37	6	32011811	32011811	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr6:32011811T>C	ENST00000375244.3	-	34	11560	c.11359A>G	c.(11359-11361)Aaa>Gaa	p.K3787E	TNXB_ENST00000451343.1_Missense_Mutation_p.K216E|TNXB_ENST00000375247.2_Missense_Mutation_p.K3785E			P22105	TENX_HUMAN	tenascin XB	3832	Fibronectin type-III 29. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.K216E(1)|p.K3787E(1)|p.K3852E(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TAGGAGACTTTGAAGCTGTCC	0.617																																							uc003nzl.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(11353-11355)AAA>GAA		tenascin XB isoform 1 precursor							7.0	8.0	8.0					6																	32011811		1452	2644	4096	SO:0001583	missense	7148				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding	g.chr6:32011811T>C	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.11359A>G	6.37:g.32011811T>C	ENSP00000364393:p.Lys3787Glu		Somatic				TNXB_uc003nzg.1_Missense_Mutation_p.K216E|TNXB_uc003nzh.1_Missense_Mutation_p.K254E	p.K3785E	NM_019105	NP_061978	WXS	Illumina HiSeq	Unspecified	P22105	TENX_HUMAN			34	11555	-			3832			Fibronectin type-III 30.		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37	c.11353A>G		.	.	.	.	.	.	.	.	.	.	T	18.37	3.609248	0.66558	.	.	ENSG00000168477	ENST00000375244;ENST00000451343;ENST00000375247	T;T;T	0.55052	0.54;0.54;0.54	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000011	T	0.52208	0.1720	M	0.74258	2.255	0.37101	D	0.899915	D	0.62365	0.991	P	0.61477	0.889	T	0.62034	-0.6939	10	0.02654	T	1	.	14.9277	0.70893	0.0:0.0:0.0:1.0	.	3785	P22105-3	.	E	3787;216;3785	ENSP00000364393:K3787E;ENSP00000407685:K216E;ENSP00000364396:K3785E	ENSP00000364393:K3787E	K	-	1	0	TNXB	32119790	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.321000	0.33678	2.177000	0.69029	0.533000	0.62120	AAA		0.617	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		3	1	0	0	0	0.001984	0	3	1				
C6orf222	389384	broad.mit.edu	37	6	36298275	36298275	+	Missense_Mutation	SNP	A	A	T	rs201336652		TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr6:36298275A>T	ENST00000437635.2	-	2	370	c.193T>A	c.(193-195)Tct>Act	p.S65T		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	65								p.S65T(1)		breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						GCCTCTGCAGATGGAGCTGGG	0.632																																							uc003oly.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.(193-195)TCT>ACT		hypothetical protein LOC389384							47.0	50.0	49.0					6																	36298275		2203	4300	6503	SO:0001583	missense	389384							g.chr6:36298275A>T		CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.193T>A	6.37:g.36298275A>T	ENSP00000418983:p.Ser65Thr		Somatic					p.S65T	NM_001010903	NP_001010903	WXS	Illumina HiSeq	Unspecified	P0C671	CF222_HUMAN			2	371	-			65					B2RTY8	Missense_Mutation	SNP	ENST00000437635.2	37	c.193T>A	CCDS34439.1	.	.	.	.	.	.	.	.	.	.	A	14.29	2.490297	0.44249	.	.	ENSG00000189325	ENST00000437635	T	0.51817	0.69	4.09	-3.43	0.04810	.	1.504960	0.04212	N	0.331856	T	0.13884	0.0336	L	0.27053	0.805	0.09310	N	1	P	0.46784	0.884	B	0.42916	0.402	T	0.06935	-1.0799	10	0.24483	T	0.36	-30.5764	5.2968	0.15756	0.4782:0.1548:0.367:0.0	.	65	P0C671	CF222_HUMAN	T	65	ENSP00000418983:S65T	ENSP00000418983:S65T	S	-	1	0	C6orf222	36406253	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.751000	0.04803	-0.695000	0.05105	0.240000	0.17902	TCT		0.632	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903		5	83	0	0	0	0.001984	0	5	83				
BCKDHB	594	broad.mit.edu	37	6	81053483	81053483	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr6:81053483A>C	ENST00000320393.6	+	10	1188	c.1141A>C	c.(1141-1143)Aag>Cag	p.K381Q	BCKDHB_ENST00000356489.5_Missense_Mutation_p.K381Q|BCKDHB_ENST00000545529.1_3'UTR	NM_183050.2	NP_898871.1	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1, beta polypeptide	381					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)	p.K381Q(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(1)	15		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		AGACAAATGGAAGTGTTATGA	0.393																																							uc003pjd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1141-1143)AAG>CAG		branched chain keto acid dehydrogenase E1 beta							143.0	135.0	138.0					6																	81053483		2203	4300	6503	SO:0001583	missense	594				branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding	g.chr6:81053483A>C	M55575	CCDS4994.1	6q14.1	2008-07-31	2008-07-31		ENSG00000083123	ENSG00000083123			987	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	248611					Standard	NM_183050		Approved		uc003pje.2	P21953	OTTHUMG00000016430	ENST00000320393.6:c.1141A>C	6.37:g.81053483A>C	ENSP00000318351:p.Lys381Gln		Somatic				BCKDHB_uc003pje.2_Missense_Mutation_p.K381Q	p.K381Q	NM_000056	NP_000047	WXS	Illumina HiSeq	Unspecified	P21953	ODBB_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0291)	10	1208	+		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)	381					Q5T2J3|Q9BQL0	Missense_Mutation	SNP	ENST00000320393.6	37	c.1141A>C	CCDS4994.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.471452	0.84533	.	.	ENSG00000083123	ENST00000320393;ENST00000356489;ENST00000541767	D;D	0.94092	-3.35;-3.35	5.96	5.96	0.96718	Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (1);Transketolase-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90191	0.6934	M	0.76838	2.35	0.80722	D	1	P	0.49961	0.93	B	0.36989	0.238	D	0.92152	0.5729	10	0.87932	D	0	-19.1848	15.6258	0.76855	1.0:0.0:0.0:0.0	.	381	P21953	ODBB_HUMAN	Q	381;381;311	ENSP00000318351:K381Q;ENSP00000348880:K381Q	ENSP00000318351:K381Q	K	+	1	0	BCKDHB	81110202	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.820000	0.92003	2.284000	0.76573	0.528000	0.53228	AAG		0.393	BCKDHB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043911.2	NM_000056		23	63	0	0	0	0.005443	0	23	63				
CCNC	892	broad.mit.edu	37	6	99994324	99994324	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr6:99994324G>A	ENST00000520429.1	-	10	1070	c.625C>T	c.(625-627)Cag>Tag	p.Q209*	CCNC_ENST00000523985.1_Nonsense_Mutation_p.Q124*|CCNC_ENST00000369220.4_Nonsense_Mutation_p.Q208*|CCNC_ENST00000523799.1_Nonsense_Mutation_p.Q124*|CCNC_ENST00000520371.1_Nonsense_Mutation_p.Q209*|CCNC_ENST00000518714.1_Nonsense_Mutation_p.Q209*	NM_001013399.1|NM_005190.3	NP_001013417.1|NP_005181.2	P24863	CCNC_HUMAN	cyclin C	209					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|mediator complex (GO:0016592)|nucleoplasm (GO:0005654)		p.Q209*(1)					all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.064)		TCTTTCTGCTGTACAACACAG	0.363																																					GBM(57;273 1020 40094 44454 49348)	GBM(57;273 1020 40094 44454 49348)	uc003pqe.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(625-627)CAG>TAG		cyclin C isoform a							102.0	99.0	100.0					6																	99994324		2203	4300	6503	SO:0001587	stop_gained	892				regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	DNA-directed RNA polymerase II, holoenzyme	protein kinase binding	g.chr6:99994324G>A		CCDS34502.1, CCDS47461.1	6q21	2008-02-05			ENSG00000112237	ENSG00000112237			1581	protein-coding gene	gene with protein product		123838				1833066	Standard	XM_005267202		Approved	CycC	uc003pqe.3	P24863	OTTHUMG00000015268	ENST00000520429.1:c.625C>T	6.37:g.99994324G>A	ENSP00000428982:p.Gln209*		Somatic				uc003pqc.2_Intron|CCNC_uc003pqd.2_Nonsense_Mutation_p.Q124*|CCNC_uc010kcr.2_RNA|CCNC_uc010kcs.2_Nonsense_Mutation_p.Q208*|CCNC_uc011eah.1_Nonsense_Mutation_p.Q124*	p.Q209*	NM_005190	NP_005181	WXS	Illumina HiSeq	Unspecified	P24863	CCNC_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.064)	10	912	-		all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)	209					B4DPZ1|Q9H543	Nonsense_Mutation	SNP	ENST00000520429.1	37	c.625C>T	CCDS34502.1	.	.	.	.	.	.	.	.	.	.	G	37	6.153524	0.97329	.	.	ENSG00000112237	ENST00000520429;ENST00000369220;ENST00000520371;ENST00000523799;ENST00000486428;ENST00000523985;ENST00000518714;ENST00000524049	.	.	.	5.93	5.07	0.68467	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.8859	14.8714	0.70459	0.0684:0.0:0.9316:0.0	.	.	.	.	X	209;208;209;124;155;124;209;124	.	.	Q	-	1	0	CCNC	100101045	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	1.507000	0.48752	0.655000	0.94253	CAG		0.363	CCNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041613.2	NM_005190		4	39	0	0	0	0.000602	0	4	39				
CTGF	1490	broad.mit.edu	37	6	132270574	132270574	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr6:132270574T>G	ENST00000367976.3	-	5	1080	c.880A>C	c.(880-882)Acc>Ccc	p.T294P	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	294	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.|Heparin-binding.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		CTGTGGGGGGTGCAGCATCGG	0.522																																					Esophageal Squamous(127;510 1660 12817 24400 38449)	Esophageal Squamous(127;510 1660 12817 24400 38449)	uc003qcz.2		NA																	0					0						c.(880-882)ACC>CCC		connective tissue growth factor precursor							173.0	168.0	170.0					6																	132270574		2203	4300	6503	SO:0001583	missense	1490				cellular lipid metabolic process|DNA replication|epidermis development|regulation of cell growth|response to wounding	plasma membrane|proteinaceous extracellular matrix	heparin binding|insulin-like growth factor binding	g.chr6:132270574T>G	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.880A>C	6.37:g.132270574T>G	ENSP00000356954:p.Thr294Pro		Somatic					p.T294P	NM_001901	NP_001892	WXS	Illumina HiSeq	Unspecified	P29279	CTGF_HUMAN		GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)	5	1086	-	Breast(56;0.0602)		294			CTCK.|Heparin-binding.		E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	ENST00000367976.3	37	c.880A>C	CCDS5151.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.311436	0.81358	.	.	ENSG00000118523	ENST00000367976	T	0.16897	2.31	5.55	5.55	0.83447	Cystine knot (1);Cystine knot, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.33818	0.0876	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.13415	-1.0510	10	0.87932	D	0	.	15.9906	0.80202	0.0:0.0:0.0:1.0	.	294	P29279	CTGF_HUMAN	P	294	ENSP00000356954:T294P	ENSP00000356954:T294P	T	-	1	0	CTGF	132312267	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.997000	0.88414	2.238000	0.73509	0.477000	0.44152	ACC		0.522	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901		7	111	0	0	0	0.00333	0	7	111				
CCZ1B	221960	broad.mit.edu	37	7	6840708	6840708	+	Splice_Site	SNP	T	T	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr7:6840708T>A	ENST00000316731.8	-	14	1838		c.e14-2		CCZ1B_ENST00000538180.1_Splice_Site	NM_198097.3	NP_932765.1	P86790	CCZ1B_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae)							lysosome (GO:0005764)|membrane (GO:0016020)		p.?(1)									TCATCCACTCTGCAAGACGAG	0.463																																							uc003sqx.1		NA																	1	Unknown(1)		lung(1)		0						c.e14-1		hypothetical protein LOC221960							85.0	88.0	87.0					7																	6840708		1880	3887	5767	SO:0001630	splice_region_variant	221960					lysosomal membrane		g.chr7:6840708T>A	BC010130	CCDS5354.1	7p22.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000146574	ENSG00000146574			21717	protein-coding gene	gene with protein product	"""similar to CGI-43 protein"""		"""chromosome 7 open reading frame 28B"""	C7orf28B		12477932	Standard	NM_198097		Approved	DKFZP586I1023, H_NH0577018.2, MGC19819	uc003sqx.2	P86790	OTTHUMG00000152441	ENST00000316731.8:c.1266-2A>T	7.37:g.6840708T>A			Somatic				C7orf28B_uc011jxd.1_Splice_Site_p.R279_splice	p.R422_splice	NM_198097	NP_932765	WXS	Illumina HiSeq	Unspecified	P86791	CCZ1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)	14	1299	-		Ovarian(82;0.232)						A2RU45|O95766|Q9UG65|Q9Y359	Splice_Site	SNP	ENST00000316731.8	37	c.1266_splice	CCDS5354.1	.	.	.	.	.	.	.	.	.	.	T	7.509	0.654328	0.14580	.	.	ENSG00000146574	ENST00000316731;ENST00000538180	.	.	.	3.04	3.04	0.35103	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2241	0.37395	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	C7orf28B	6807233	1.000000	0.71417	0.986000	0.45419	0.148000	0.21650	7.566000	0.82347	1.241000	0.43820	0.158000	0.16466	.		0.463	CCZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246858.1	NM_198097	Intron	6	32	0	0	0	0.001984	0	6	32				
ZNF655	79027	broad.mit.edu	37	7	99170026	99170026	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr7:99170026C>G	ENST00000394163.2	+	3	478	c.295C>G	c.(295-297)Ctt>Gtt	p.L99V	GS1-259H13.10_ENST00000455905.1_Intron|ZNF655_ENST00000425063.1_3'UTR|ZNF655_ENST00000424881.1_Missense_Mutation_p.L134V|GS1-259H13.10_ENST00000486324.1_Intron|ZNF655_ENST00000493277.1_Missense_Mutation_p.L134V|ZNF655_ENST00000252713.4_Missense_Mutation_p.L99V|ZNF655_ENST00000419215.2_3'UTR	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	99					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L99V(1)|p.L134V(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					ATTAGAAAGACTTCAGGAAAT	0.388																																							uc003urh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(295-297)CTT>GTT		zinc finger protein 655 isoform a							60.0	60.0	60.0					7																	99170026		2203	4300	6503	SO:0001583	missense	79027				G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding	g.chr7:99170026C>G	AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.295C>G	7.37:g.99170026C>G	ENSP00000377718:p.Leu99Val		Somatic				ZNF655_uc010lga.2_Missense_Mutation_p.L134V|ZNF655_uc010lgc.2_Missense_Mutation_p.L134V|ZNF655_uc003urj.2_Missense_Mutation_p.L99V|ZNF655_uc003urk.2_5'UTR|ZNF655_uc010lgd.2_5'UTR	p.L99V	NM_138494	NP_612503	WXS	Illumina HiSeq	Unspecified	Q8N720	ZN655_HUMAN			3	688	+	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)		99					A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Missense_Mutation	SNP	ENST00000394163.2	37	c.295C>G	CCDS5669.1	.	.	.	.	.	.	.	.	.	.	C	9.710	1.156802	0.21454	.	.	ENSG00000197343	ENST00000252713;ENST00000493277;ENST00000422164;ENST00000424881;ENST00000394163	T;T;T;T;T	0.32023	3.5;3.41;1.47;3.41;3.5	4.22	3.32	0.38043	.	0.000000	0.41500	D	0.000861	T	0.23249	0.0562	N	0.24115	0.695	0.80722	D	1	B;B	0.27229	0.172;0.107	B;B	0.31686	0.134;0.063	T	0.13926	-1.0491	10	0.87932	D	0	-2.6734	12.3441	0.55111	0.0:0.8282:0.1718:0.0	.	134;99	Q8N720-3;Q8N720	.;ZN655_HUMAN	V	99;134;134;134;99	ENSP00000252713:L99V;ENSP00000419135:L134V;ENSP00000389260:L134V;ENSP00000393876:L134V;ENSP00000377718:L99V	ENSP00000252713:L99V	L	+	1	0	ZNF655	99007962	0.000000	0.05858	1.000000	0.80357	0.970000	0.65996	0.231000	0.17872	1.360000	0.45960	0.650000	0.86243	CTT		0.388	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000344929.1	NM_138494		23	44	0	0	0	0.014323	0	23	44				
LAMB4	22798	broad.mit.edu	37	7	107696313	107696313	+	Silent	SNP	A	A	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr7:107696313A>G	ENST00000388781.3	-	25	3602	c.3519T>C	c.(3517-3519)ctT>ctC	p.L1173L	LAMB4_ENST00000205386.4_Silent_p.L1173L|LAMB4_ENST00000388780.3_Silent_p.L1173L	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1173	Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.L1173L(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						AGTGACATTGAAGACAAGTAG	0.537																																							uc010ljo.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						c.(3517-3519)CTT>CTC		laminin, beta 4 precursor							92.0	90.0	91.0					7																	107696313		2203	4300	6503	SO:0001819	synonymous_variant	22798				cell adhesion	basement membrane		g.chr7:107696313A>G	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.3519T>C	7.37:g.107696313A>G			Somatic				LAMB4_uc003vey.2_Silent_p.L1173L|LAMB4_uc010ljp.1_Silent_p.L142L	p.L1173L	NM_007356	NP_031382	WXS	Illumina HiSeq	Unspecified	A4D0S4	LAMB4_HUMAN			25	3603	-			1173			Laminin EGF-like 13.		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Silent	SNP	ENST00000388781.3	37	c.3519T>C	CCDS34732.1																																																																																				0.537	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		20	35	0	0	0	0.003954	0	20	35				
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3	V600E(UACC257_SKIN)|V600D(K029AX_SKIN)|V600E(HS695T_SKIN)|V600E(COLO679_SKIN)|V600E(BT474_BREAST)|V600E(IGR39_SKIN)|V600E(A101D_SKIN)|V600E(COLO783_SKIN)|V600E(IGR37_SKIN)|V600E(A375_SKIN)|V600E(WM793_SKIN)|V600E(COLO818_SKIN)|V600E(HS294T_SKIN)|V600E(SKMEL28_SKIN)|V600E(DU4475_BREAST)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(IGR1_SKIN)|V600E(SKHEP1_LIVER)|V600E(WM983B_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(RVH421_SKIN)|V600D(WM2664_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(SKMEL24_SKIN)|V600D(WM115_SKIN)|V600E(MALME3M_SKIN)|V600E(A673_BONE)|V600E(C32_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO800_SKIN)|V600E(COLO741_SKIN)|V600E(HS939T_SKIN)|V600E(COLO205_LARGE_INTESTINE)|V600E(K029AX_SKIN)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(SH4_SKIN)|V600E(WM88_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO849_SKIN)|V600E(MELHO_SKIN)|V600E(BHT101_THYROID)|V600E(G361_SKIN)|V600E(UACC62_SKIN)|V600E(BCPAP_THYROID)|V600E(8505C_THYROID)|V600E(SW1417_LARGE_INTESTINE)|V600E(COLO829_SKIN)|V600E(RKO_LARGE_INTESTINE)|V600E(A2058_SKIN)|V600E(RPMI7951_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(SKMEL5_SKIN)|V600E(ES2_OVARY)|V600E(LOXIMVI_SKIN)	61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	p.V600E(16892)|p.V600?(325)|p.V600K(176)|p.V600R(36)|p.V600M(25)|p.V600A(23)|p.V600D(21)|p.V600G(11)|p.V600_K601>E(8)|p.T599_V600insTT(3)|p.T599_R603>I(2)|p.T599_V600>IAL(2)|p.V600L(2)|p.T599_V600insT(2)|p.V600_W604del(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insV(1)|p.T599_V600insDFGLAT(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290						c.(1798-1800)GTG>GAG		B-Raf	Sorafenib(DB00398)						112.0	104.0	107.0					7																	140453136		2203	4300	6503	SO:0001583	missense	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140453136A>T	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu		Somatic					p.V600E	NM_004333	NP_004324	WXS	Illumina HiSeq	Unspecified	P15056	BRAF_HUMAN			15	1860	-	Melanoma(164;0.00956)		600		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions).|V -> E (in sarcoma, colorectal adenocarcinoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis).	Protein kinase.		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	c.1799T>A	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333		32	58	0	0	0	0.003271	0	32	58				
PARP10	84875	broad.mit.edu	37	8	145049463	145049463	+	IGR	SNP	A	A	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr8:145049463A>G	ENST00000313028.7	-	0	3497				PLEC_ENST00000527096.1_Silent_p.P25P|PLEC_ENST00000356346.3_5'Flank|PLEC_ENST00000436759.2_Silent_p.P25P	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10						negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.P25P(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTGTGTCCCCAGGGCTGGGCG	0.677											OREG0019050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003zaj.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						c.(73-75)CCT>CCC		plectin isoform 1c							35.0	44.0	41.0					8																	145049463		2082	4194	6276	SO:0001628	intergenic_variant	5339				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle	g.chr8:145049463A>G	AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7			8.37:g.145049463A>G			Somatic	OREG0019050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1691	PLEC_uc003zah.2_5'Flank	p.P25P	NM_000445	NP_000436	WXS	Illumina HiSeq	Unspecified	Q15149	PLEC_HUMAN			2	124	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					Q8N2I0|Q8WV05|Q96CH7|Q96K72	Silent	SNP	ENST00000313028.7	37	c.75T>C	CCDS34960.1																																																																																				0.677	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789		4	29	0	0	0	0.001168	0	4	29				
PIGO	84720	broad.mit.edu	37	9	35091859	35091859	+	Silent	SNP	C	C	A	rs368209276		TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr9:35091859C>A	ENST00000378617.3	-	7	2419	c.2025G>T	c.(2023-2025)gcG>gcT	p.A675A	PIGO_ENST00000298004.5_Intron|PIGO_ENST00000361778.2_Intron|PIGO_ENST00000341666.3_Silent_p.A675A	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	675					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.A675A(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CCACCAGCGCCGCCACACAAG	0.602																																							uc003zwd.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(2023-2025)GCG>GCT		phosphatidylinositol glycan anchor biosynthesis,							44.0	46.0	45.0					9																	35091859		2203	4300	6503	SO:0001819	synonymous_variant	84720				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	transferase activity	g.chr9:35091859C>A	AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.2025G>T	9.37:g.35091859C>A			Somatic				PIGO_uc003zwc.1_3'UTR|PIGO_uc003zwe.2_Intron|PIGO_uc003zwf.2_Intron|PIGO_uc003zwg.1_Silent_p.A238A	p.A675A	NM_032634	NP_116023	WXS	Illumina HiSeq	Unspecified	Q8TEQ8	PIGO_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)		7	2421	-			675			Helical; (Potential).		B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Silent	SNP	ENST00000378617.3	37	c.2025G>T	CCDS6575.1																																																																																				0.602	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634		4	40	1	0	0.000602214	0.000602	0.000706947	4	40				
TRPM6	140803	broad.mit.edu	37	9	77354328	77354328	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr9:77354328T>G	ENST00000360774.1	-	35	5762	c.5525A>C	c.(5524-5526)tAt>tCt	p.Y1842S	TRPM6_ENST00000376864.4_Missense_Mutation_p.Y1846S|TRPM6_ENST00000376872.3_Missense_Mutation_p.Y797S|TRPM6_ENST00000376871.3_Missense_Mutation_p.Y679S|TRPM6_ENST00000449912.2_Missense_Mutation_p.Y1837S|TRPM6_ENST00000361255.3_Missense_Mutation_p.Y1837S|TRPM6_ENST00000451710.3_Missense_Mutation_p.Y1846S	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1842	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.Y1842S(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GTTGAAGGTATAGATCAATTT	0.368																																							uc004ajl.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(5524-5526)TAT>TCT		transient receptor potential cation channel,							385.0	336.0	352.0					9																	77354328		2203	4300	6503	SO:0001583	missense	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77354328T>G	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5525A>C	9.37:g.77354328T>G	ENSP00000354006:p.Tyr1842Ser		Somatic				TRPM6_uc004ajk.1_Missense_Mutation_p.Y1837S|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.Y793S|TRPM6_uc010mpd.1_Missense_Mutation_p.Y675S|TRPM6_uc010mpe.1_Missense_Mutation_p.Y389S|TRPM6_uc004ajj.1_Missense_Mutation_p.Y798S	p.Y1842S	NM_017662	NP_060132	WXS	Illumina HiSeq	Unspecified	Q9BX84	TRPM6_HUMAN			35	5763	-			1842			Alpha-type protein kinase.|Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	c.5525A>C	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.330295	0.60743	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870;ENST00000376864	T;T;T;T;T;T;T	0.05925	3.37;3.37;3.37;3.37;3.37;3.37;3.37	5.8	4.66	0.58398	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.337565	0.34879	N	0.003607	T	0.07098	0.0180	N	0.02916	-0.46	0.38370	D	0.944851	B;B;P;D;D;D	0.89917	0.041;0.34;0.537;0.999;1.0;0.999	B;B;B;D;D;D	0.71184	0.054;0.234;0.437;0.972;0.97;0.952	T	0.49428	-0.8941	10	0.54805	T	0.06	.	6.8767	0.24151	0.1335:0.0704:0.0:0.7961	.	389;675;793;1842;1837;1837	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;.;TRPM6_HUMAN;.;.	S	1842;1846;797;679;1837;1837;388;1846	ENSP00000354006:Y1842S;ENSP00000407341:Y1846S;ENSP00000366068:Y797S;ENSP00000366067:Y679S;ENSP00000396672:Y1837S;ENSP00000354962:Y1837S;ENSP00000366060:Y1846S	ENSP00000354006:Y1842S	Y	-	2	0	TRPM6	76544148	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	2.420000	0.44679	1.028000	0.39785	0.528000	0.53228	TAT		0.368	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		5	114	0	0	0	0.000602	0	5	114				
PRPF4	9128	broad.mit.edu	37	9	116053798	116053798	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr9:116053798T>C	ENST00000374198.4	+	14	1529	c.1427T>C	c.(1426-1428)aTc>aCc	p.I476T	PRPF4_ENST00000374199.4_Missense_Mutation_p.I475T	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	476					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)		p.I476T(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						ACAGCCAAGATCTGGACGCAC	0.502																																							uc004bgx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1426-1428)ATC>ACC		PRP4 pre-mRNA processing factor 4 homolog							101.0	96.0	97.0					9																	116053798		2203	4300	6503	SO:0001583	missense	9128					Cajal body|nuclear speck|spliceosomal complex|U4/U6 snRNP	protein binding	g.chr9:116053798T>C	AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.1427T>C	9.37:g.116053798T>C	ENSP00000363313:p.Ile476Thr		Somatic				PRPF4_uc004bgy.2_Missense_Mutation_p.I475T	p.I476T	NM_004697	NP_004688	WXS	Illumina HiSeq	Unspecified	O43172	PRP4_HUMAN			14	1477	+			476			WD 6.		O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Missense_Mutation	SNP	ENST00000374198.4	37	c.1427T>C	CCDS6791.1	.	.	.	.	.	.	.	.	.	.	T	18.36	3.607177	0.66558	.	.	ENSG00000136875	ENST00000374199;ENST00000374198	T;T	0.66638	-0.22;-0.22	5.95	5.95	0.96441	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.219451	0.48286	D	0.000189	T	0.74261	0.3693	M	0.71871	2.18	0.80722	D	1	P;P	0.46912	0.886;0.848	P;P	0.49387	0.609;0.609	T	0.77933	-0.2402	10	0.87932	D	0	.	15.6048	0.76658	0.0:0.0:0.0:1.0	.	491;476	Q59EL4;O43172	.;PRP4_HUMAN	T	475;476	ENSP00000363315:I475T;ENSP00000363313:I476T	ENSP00000363313:I476T	I	+	2	0	PRPF4	115093619	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.653000	0.67967	2.279000	0.76181	0.533000	0.62120	ATC		0.502	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053708.2	NM_004697		3	83	0	0	0	0.004672	0	3	83				
ZNF711	7552	broad.mit.edu	37	X	84526181	84526181	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chrX:84526181C>A	ENST00000373165.3	+	9	1939	c.1633C>A	c.(1633-1635)Caa>Aaa	p.Q545K	ZNF711_ENST00000360700.4_Missense_Mutation_p.Q591K|ZNF711_ENST00000542798.1_Missense_Mutation_p.Q387K|ZNF711_ENST00000395402.1_Missense_Mutation_p.Q553K|ZNF711_ENST00000276123.3_Missense_Mutation_p.Q545K	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	545					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.Q545K(2)|p.Q555K(2)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						GTGTGCAGATCAATCAAATCT	0.393																																							uc004eeo.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|skin(1)	4						c.(1633-1635)CAA>AAA		zinc finger protein 711							47.0	39.0	42.0					X																	84526181		2203	4299	6502	SO:0001583	missense	7552				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding	g.chrX:84526181C>A	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.1633C>A	X.37:g.84526181C>A	ENSP00000362260:p.Gln545Lys		Somatic				ZNF711_uc004eep.2_Missense_Mutation_p.Q545K|ZNF711_uc004eeq.2_Missense_Mutation_p.Q591K|ZNF711_uc011mqy.1_Missense_Mutation_p.Q144K	p.Q545K	NM_021998	NP_068838	WXS	Illumina HiSeq	Unspecified	Q9Y462	ZN711_HUMAN			9	1980	+			545			C2H2-type 5.		B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	c.1633C>A	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.798811	0.31777	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.13196	2.61;2.61;2.61;2.61;2.61	5.19	4.33	0.51752	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.41712	D	0.000821	T	0.05181	0.0138	N	0.01122	-1.005	0.44188	D	0.997005	P;B	0.40000	0.698;0.131	B;B	0.37091	0.241;0.016	T	0.47497	-0.9113	10	0.66056	D	0.02	-11.468	13.2127	0.59834	0.0:0.9207:0.0:0.0793	.	591;545	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	K	553;545;545;591;387	ENSP00000378798:Q553K;ENSP00000362260:Q545K;ENSP00000276123:Q545K;ENSP00000353922:Q591K;ENSP00000442071:Q387K	ENSP00000276123:Q545K	Q	+	1	0	ZNF711	84412837	1.000000	0.71417	0.967000	0.41034	0.990000	0.78478	5.999000	0.70665	0.982000	0.38575	0.513000	0.50165	CAA		0.393	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998		10	38	1	0	6.40141e-05	0.010729	7.94658e-05	10	38				
RPA4	29935	broad.mit.edu	37	X	96139775	96139775	+	Missense_Mutation	SNP	G	G	A	rs139569203	byFrequency	TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chrX:96139775G>A	ENST00000373040.3	+	1	869	c.466G>A	c.(466-468)Gtg>Atg	p.V156M	DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000373061.3_Intron|DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000324765.8_Intron|DIAPH2_ENST00000373054.4_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	156					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)	p.V156M(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						CGAGTTCACCGTGCATATTCT	0.443								Other identified genes with known or suspected DNA repair function					G|||	1	0.000264901	0.0	0.0	3775	,	,		16071	0.0		0.0	False		,,,				2504	0.001						uc004efv.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(466-468)GTG>ATG	Other_identified_genes_with_known_or_suspected_DNA_repair_function	replication protein A4, 34kDa		G	,,MET/VAL	0,3835		0,0,0,1632,571	128.0	105.0	113.0		,,466	-2.7	0.0	X	dbSNP_134	113	1,6727		0,0,1,2428,1871	no	intron,intron,missense	DIAPH2,RPA4	NM_006729.4,NM_007309.3,NM_013347.4	,,21	0,0,1,4060,2442	AA,AG,A,GG,G		0.0149,0.0,0.0095	,,benign	,,156/262	96139775	1,10562	2203	4300	6503	SO:0001583	missense	29935				DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding	g.chrX:96139775G>A	U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.466G>A	X.37:g.96139775G>A	ENSP00000362131:p.Val156Met		Somatic				DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	p.V156M	NM_013347	NP_037479	WXS	Illumina HiSeq	Unspecified	Q13156	RFA4_HUMAN			1	764	+			156					Q3SY03	Missense_Mutation	SNP	ENST00000373040.3	37	c.466G>A	CCDS35345.1	.	.	.	.	.	.	.	.	.	.	G	8.014	0.758229	0.15846	0.0	1.49E-4	ENSG00000204086	ENST00000373040	T	0.44482	0.92	3.81	-2.67	0.06059	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.17450	0.0419	N	0.11560	0.145	0.09310	N	1	B	0.27117	0.168	B	0.12156	0.007	T	0.15065	-1.0450	9	0.26408	T	0.33	-1.9946	5.1674	0.15092	0.2697:0.0:0.541:0.1892	.	156	Q13156	RFA4_HUMAN	M	156	ENSP00000362131:V156M	ENSP00000362131:V156M	V	+	1	0	RPA4	96026431	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.457000	0.06745	-0.699000	0.05077	0.600000	0.82982	GTG		0.443	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057464.1	NM_013347		6	81	0	0	0	0.001168	0	6	81				
GPRASP2	114928	broad.mit.edu	37	X	101970221	101970221	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chrX:101970221G>T	ENST00000535209.1	+	4	1255	c.424G>T	c.(424-426)Gca>Tca	p.A142S	GPRASP2_ENST00000332262.5_Missense_Mutation_p.A142S|GPRASP2_ENST00000543253.1_Missense_Mutation_p.A142S			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	142						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)	p.A142S(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						AGTGTCACAGGCAGAAGGAGT	0.527																																							uc004ejk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(424-426)GCA>TCA		G protein-coupled receptor associated sorting							106.0	103.0	104.0					X																	101970221		2203	4300	6503	SO:0001583	missense	114928					cytoplasm	protein binding	g.chrX:101970221G>T	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.424G>T	X.37:g.101970221G>T	ENSP00000437394:p.Ala142Ser		Somatic				GPRASP2_uc004ejl.2_Missense_Mutation_p.A142S|GPRASP2_uc004ejm.2_Missense_Mutation_p.A142S|GPRASP2_uc011mrp.1_5'Flank	p.A142S	NM_138437	NP_612446	WXS	Illumina HiSeq	Unspecified	Q96D09	GASP2_HUMAN			4	1758	+			142					D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	c.424G>T	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	G	0.401	-0.918245	0.02396	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.07021	3.23;3.23;3.23	4.63	-5.15	0.02866	.	1.037060	0.07654	N	0.932494	T	0.03305	0.0096	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.46789	-0.9166	10	0.02654	T	1	.	8.1301	0.31022	0.1101:0.0:0.5172:0.3727	.	142	Q96D09	GASP2_HUMAN	S	142	ENSP00000437872:A142S;ENSP00000437394:A142S;ENSP00000339057:A142S	ENSP00000339057:A142S	A	+	1	0	GPRASP2	101856877	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-1.443000	0.02405	-1.095000	0.03050	-0.364000	0.07487	GCA		0.527	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437		12	170	1	0	3.07112e-06	0.010729	3.94858e-06	12	170				
ZNF280C	55609	broad.mit.edu	37	X	129349244	129349244	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chrX:129349244G>C	ENST00000370978.4	-	15	2055	c.1902C>G	c.(1900-1902)caC>caG	p.H634Q		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	634					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H634Q(1)		endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						ATATAGAAAAGTGGCTTGCAA	0.338																																							uc004evm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1900-1902)CAC>CAG		zinc finger protein 280C							94.0	98.0	97.0					X																	129349244		2203	4299	6502	SO:0001583	missense	55609				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:129349244G>C	AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.1902C>G	X.37:g.129349244G>C	ENSP00000360017:p.His634Gln		Somatic				ZNF280C_uc010nrf.1_Missense_Mutation_p.H585Q	p.H634Q	NM_017666	NP_060136	WXS	Illumina HiSeq	Unspecified	Q8ND82	Z280C_HUMAN			15	2056	-			634					A8K2V8|Q9NXR3	Missense_Mutation	SNP	ENST00000370978.4	37	c.1902C>G	CCDS14622.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385501	0.61956	.	.	ENSG00000056277	ENST00000066465;ENST00000370978;ENST00000447817	T;T	0.37235	1.59;1.21	4.37	3.41	0.39046	.	.	.	.	.	T	0.52041	0.1710	M	0.69358	2.11	0.29093	N	0.88195	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.48490	-0.9031	9	0.87932	D	0	.	4.4102	0.11429	0.2738:0.0:0.7262:0.0	.	585;634	Q9UJJ2;Q8ND82	.;Z280C_HUMAN	Q	585;634;585	ENSP00000360017:H634Q;ENSP00000408521:H585Q	ENSP00000066465:H585Q	H	-	3	2	ZNF280C	129176925	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.869000	0.27996	2.026000	0.59711	0.523000	0.50628	CAC		0.338	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058251.1	NM_017666		3	163	0	0	0	0.004672	0	3	163				
ZIC3	7547	broad.mit.edu	37	X	136648858	136648858	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chrX:136648858T>A	ENST00000287538.5	+	1	558	c.8T>A	c.(7-9)aTg>aAg	p.M3K	ZIC3_ENST00000370606.3_Missense_Mutation_p.M3K|RP1-137H15.2_ENST00000442841.1_RNA|RP1-137H15.2_ENST00000456631.1_RNA	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	3					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M3K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					CCCATGACGATGCTCCTGGAC	0.682																																							uc004fak.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(7-9)ATG>AAG		zinc finger protein of the cerebellum 3							16.0	14.0	15.0					X																	136648858		2193	4299	6492	SO:0001583	missense	7547				cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:136648858T>A	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.8T>A	X.37:g.136648858T>A	ENSP00000287538:p.Met3Lys		Somatic					p.M3K	NM_003413	NP_003404	WXS	Illumina HiSeq	Unspecified	O60481	ZIC3_HUMAN			1	513	+	Acute lymphoblastic leukemia(192;0.000127)		3					B2CNW4|Q14DE5|Q5JY75	Missense_Mutation	SNP	ENST00000287538.5	37	c.8T>A	CCDS14663.1	.	.	.	.	.	.	.	.	.	.	t	16.47	3.132992	0.56828	.	.	ENSG00000156925	ENST00000287538;ENST00000370606	T;T	0.14893	2.47;2.5	4.07	2.83	0.33086	.	0.043805	0.85682	N	0.000000	T	0.29716	0.0742	L	0.54323	1.7	0.54753	D	0.999982	D	0.55800	0.973	D	0.64042	0.921	T	0.01472	-1.1346	10	0.87932	D	0	.	7.0749	0.25199	0.2047:0.0:0.0:0.7953	.	3	O60481	ZIC3_HUMAN	K	3	ENSP00000287538:M3K;ENSP00000359638:M3K	ENSP00000287538:M3K	M	+	2	0	ZIC3	136476524	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.746000	0.62133	0.426000	0.26116	0.427000	0.28365	ATG		0.682	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1			3	3	0	0	0	0.009096	0	3	3				
MAGEC3	139081	broad.mit.edu	37	X	140985257	140985257	+	Silent	SNP	G	G	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chrX:140985257G>A	ENST00000298296.1	+	7	1713	c.1713G>A	c.(1711-1713)gtG>gtA	p.V571V	MAGEC3_ENST00000443323.2_Silent_p.V193V|MAGEC3_ENST00000409007.1_Silent_p.V273V|MAGEC3_ENST00000536088.1_Silent_p.V273V|MAGEC3_ENST00000544766.1_Silent_p.V273V	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	571	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.V273V(2)|p.V571V(2)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					TCTGGGAAGTGTTGAGTGCAA	0.493																																							uc011mwp.1		NA																	4	Substitution - coding silent(4)		lung(4)	skin(2)|central_nervous_system(1)	3						c.(1711-1713)GTG>GTA		melanoma antigen family C, 3 isoform 1							106.0	100.0	102.0					X																	140985257		2203	4300	6503	SO:0001819	synonymous_variant	139081							g.chrX:140985257G>A	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1713G>A	X.37:g.140985257G>A			Somatic				MAGEC3_uc004fbs.2_Silent_p.V273V|MAGEC3_uc010nsj.2_Silent_p.V273V	p.V571V	NM_138702	NP_619647	WXS	Illumina HiSeq	Unspecified	Q8TD91	MAGC3_HUMAN			7	1713	+	Acute lymphoblastic leukemia(192;6.56e-05)		571			MAGE 2.		Q3SYA7|Q5JZ43|Q9BZ80	Silent	SNP	ENST00000298296.1	37	c.1713G>A	CCDS14676.1																																																																																				0.493	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702		8	109	0	0	0	0.004482	0	8	109				
WASH6P	653440	broad.mit.edu	37	X	155252868	155252868	+	RNA	SNP	T	T	A			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chrX:155252868T>A	ENST00000461007.1	+	0	1876				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.P304P(5)									TAGCCGAGCCTCTCAAGGCAG	0.632																																							uc004fnw.1		NA																	5	Substitution - coding silent(5)		kidney(3)|endometrium(2)		NA						c.(910-912)CCT>CCA		WAS protein family homolog 1																																						0							g.chrX:155252868T>A	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252868T>A			Somatic				uc004fnx.3_Silent_p.P90P	p.P304P	NM_182905	NP_878908	WXS	Illumina HiSeq	Unspecified					6	1571	+								A6NGF1|Q8N305	Silent	SNP	ENST00000461007.1	37	c.912T>A																																																																																					0.632	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1	NG_008380		3	9	0	0	0	0.009096	0	3	9				
PTPRC	5788	broad.mit.edu	37	1	198668699	198668699	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr1:198668699delC	ENST00000367376.2	+	5	470	c.299delC	c.(298-300)tcafs	p.S101fs	PTPRC_ENST00000391970.3_3'UTR|PTPRC_ENST00000348564.6_Intron|PTPRC_ENST00000442510.2_Frame_Shift_Del_p.S103fs|PTPRC_ENST00000594404.1_Intron|PTPRC_ENST00000352140.3_Frame_Shift_Del_p.S101fs	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	101					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TTAGGTGTTTCATCAGTACAG	0.488											OREG0014061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001gur.1		NA																	0				breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						c.(298-300)TCAfs		protein tyrosine phosphatase, receptor type, C							97.0	100.0	99.0					1																	198668699		2203	4300	6503	SO:0001589	frameshift_variant	5788				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:198668699delC	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.299delC	1.37:g.198668699delC	ENSP00000356346:p.Ser101fs		Somatic	OREG0014061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2100	PTPRC_uc001gus.1_Frame_Shift_Del_p.S100fs|PTPRC_uc001gut.1_Intron|PTPRC_uc009wze.1_Frame_Shift_Del_p.S36fs|PTPRC_uc009wzf.1_Frame_Shift_Del_p.S36fs|PTPRC_uc010ppg.1_Frame_Shift_Del_p.S36fs|PTPRC_uc001guu.1_Frame_Shift_Del_p.S143fs|PTPRC_uc001guv.1_RNA|PTPRC_uc001guw.1_RNA	p.S100fs	NM_002838	NP_002829	WXS	Illumina HiSeq	Unspecified	P08575	PTPRC_HUMAN			5	479	+			100			Extracellular (Potential).		A8K7W6|Q16614|Q9H0Y6	Frame_Shift_Del	DEL	ENST00000367376.2	37	c.299delC																																																																																					0.488	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				8	78	NA	NA	NA	NA	NA	8	78	---	---	---	---
SETD2	29072	broad.mit.edu	37	3	47161858	47161859	+	Frame_Shift_Ins	INS	-	-	C			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr3:47161858_47161859insC	ENST00000409792.3	-	3	4309_4310	c.4267_4268insG	c.(4267-4269)gacfs	p.D1423fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1423					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TTTCTTTCTGTCCTGAAGCTCA	0.45			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		0				kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.(4267-4269)GACfs		SET domain containing 2																																				SO:0001589	frameshift_variant	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47161858_47161859insC	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4268dupG	3.37:g.47161860_47161860dupC	ENSP00000386759:p.Asp1423fs		Somatic				SETD2_uc003cqv.2_Frame_Shift_Ins_p.D1412fs	p.D1423fs	NM_014159	NP_054878	WXS	Illumina HiSeq	Unspecified	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	3	4320_4321	-		Acute lymphoblastic leukemia(5;0.0169)	1423					O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Ins	INS	ENST00000409792.3	37	c.4267_4268insG	CCDS2749.2																																																																																				0.450	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		8	67	NA	NA	NA	NA	NA	8	67	---	---	---	---
FGB	2244	broad.mit.edu	37	4	155487738	155487738	+	Frame_Shift_Del	DEL	A	A	-			TCGA-50-5942-01A-21D-1753-08	TCGA-50-5942-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	95475c1b-086d-4e09-a871-47d8f76c1a07	a4369d21-eae0-469b-8ac3-75a0affb1e1f	g.chr4:155487738delA	ENST00000302068.4	+	3	467	c.404delA	c.(403-405)gaafs	p.E135fs	FGB_ENST00000502545.1_3'UTR|FGB_ENST00000509493.1_Intron	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	135					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AACAATGTGGAAGCTGTTTCC	0.428																																					NSCLC(106;1133 1613 21870 46110 52656)	NSCLC(106;1133 1613 21870 46110 52656)	uc003ioa.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(403-405)GAAfs		fibrinogen, beta chain preproprotein	Sucralfate(DB00364)						171.0	160.0	164.0					4																	155487738		2203	4300	6503	SO:0001589	frameshift_variant	2244				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155487738delA		CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.404delA	4.37:g.155487738delA	ENSP00000306099:p.Glu135fs		Somatic				FGB_uc010ipu.1_RNA|FGB_uc003iob.3_Frame_Shift_Del_p.E132fs|FGB_uc010ipv.2_Frame_Shift_Del_p.E73fs|FGB_uc010ipw.2_Frame_Shift_Del_p.E132fs|FGB_uc003ioc.3_Intron	p.E135fs	NM_005141	NP_005132	WXS	Illumina HiSeq	Unspecified	P02675	FIBB_HUMAN			3	443	+	all_hematologic(180;0.215)	Renal(120;0.0458)	135					A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Frame_Shift_Del	DEL	ENST00000302068.4	37	c.404delA	CCDS3786.1																																																																																				0.428	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317595.1	NM_005141		8	137	NA	NA	NA	NA	NA	8	137	---	---	---	---
