#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ESPNP	284729	broad.mit.edu	37	1	17017751	17017751	+	RNA	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:17017751C>G	ENST00000492551.1	-	0	1976					NR_026567.1				espin pseudogene																		GGTCCCACCTCCAGGCGGGCA	0.662																																							uc001azn.1		NA																	0					0						c.(1861-1863)TGG>TGC		RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;																																						284729							g.chr1:17017751C>G	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17017751C>G			Somatic					p.W621C	NR_026567		WXS	Illumina HiSeq	Unspecified					11	1977	-									Missense_Mutation	SNP	ENST00000492551.1	37	c.1863G>C																																																																																					0.662	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1			9	15	0	0	0	0.004482	0	9	15				
KANK4	163782	broad.mit.edu	37	1	62737210	62737210	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:62737210C>A	ENST00000371153.4	-	4	2330	c.1952G>T	c.(1951-1953)gGc>gTc	p.G651V	KANK4_ENST00000354381.3_Missense_Mutation_p.G23V|KANK4_ENST00000371150.1_Missense_Mutation_p.G7V	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	651						cytoplasm (GO:0005737)		p.G651V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						TGCACGGAAGCCATAGTCTTT	0.468																																							uc001dah.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|lung(1)	6						c.(1951-1953)GGC>GTC		ankyrin repeat domain 38							181.0	165.0	170.0					1																	62737210		2203	4300	6503	SO:0001583	missense	163782							g.chr1:62737210C>A	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.1952G>T	1.37:g.62737210C>A	ENSP00000360195:p.Gly651Val		Somatic				KANK4_uc001dai.3_Missense_Mutation_p.G23V|KANK4_uc001dag.3_Missense_Mutation_p.G7V	p.G651V	NM_181712	NP_859063	WXS	Illumina HiSeq	Unspecified	Q5T7N3	KANK4_HUMAN			4	2329	-			651					B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	c.1952G>T	CCDS620.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861108	0.71949	.	.	ENSG00000132854	ENST00000371153;ENST00000354381;ENST00000371150	T;T;T	0.51574	0.7;0.79;0.73	5.67	5.67	0.87782	.	0.000000	0.40222	N	0.001154	T	0.48519	0.1504	N	0.17474	0.49	0.58432	D	0.999998	D;P	0.67145	0.996;0.58	D;B	0.64237	0.923;0.251	T	0.40117	-0.9580	10	0.30078	T	0.28	-30.6437	13.0373	0.58879	0.0:0.9267:0.0:0.0733	.	23;651	Q5T7N3-2;Q5T7N3	.;KANK4_HUMAN	V	651;23;7	ENSP00000360195:G651V;ENSP00000346352:G23V;ENSP00000360192:G7V	ENSP00000346352:G23V	G	-	2	0	KANK4	62509798	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.361000	0.52306	2.677000	0.91161	0.561000	0.74099	GGC		0.468	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712		5	154	1	0	2.0095e-06	0.001984	2.15158e-06	5	154				
LRRIQ3	127255	broad.mit.edu	37	1	74507534	74507534	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:74507534A>G	ENST00000395089.1	-	6	1080	c.1081T>C	c.(1081-1083)Tca>Cca	p.S361P	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.S361P			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	361				S -> G (in Ref. 4; AAH62795). {ECO:0000305}.				p.S361P(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						AATGAACCTGAAGTGTATATG	0.353																																							uc001dfy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1081-1083)TCA>CCA		leucine-rich repeats and IQ motif containing 3							62.0	59.0	60.0					1																	74507534		1823	4084	5907	SO:0001583	missense	127255							g.chr1:74507534A>G	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1081T>C	1.37:g.74507534A>G	ENSP00000378524:p.Ser361Pro		Somatic				LRRIQ3_uc001dfz.3_RNA	p.S361P	NM_001105659	NP_001099129	WXS	Illumina HiSeq	Unspecified	A6PVS8	LRIQ3_HUMAN			7	1273	-			361	S -> G (in Ref. 4; AAH62795).				A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	c.1081T>C	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	A	11.21	1.570207	0.28003	.	.	ENSG00000162620	ENST00000395089;ENST00000354431	T;T	0.11604	2.76;2.76	5.62	0.491	0.16867	.	1.047440	0.07634	N	0.929114	T	0.02047	0.0064	N	0.24115	0.695	0.09310	N	1	B	0.18968	0.032	B	0.17433	0.018	T	0.47873	-0.9083	10	0.87932	D	0	.	2.2659	0.04078	0.4507:0.3151:0.0827:0.1514	.	361	A6PVS8	LRIQ3_HUMAN	P	361	ENSP00000378524:S361P;ENSP00000346414:S361P	ENSP00000346414:S361P	S	-	1	0	LRRIQ3	74280122	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.153000	0.16323	0.111000	0.17947	0.528000	0.53228	TCA		0.353	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258		28	68	0	0	0	0.004656	0	28	68				
MAGI3	260425	broad.mit.edu	37	1	114196630	114196630	+	Silent	SNP	A	A	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:114196630A>T	ENST00000307546.9	+	15	2694	c.2619A>T	c.(2617-2619)ccA>ccT	p.P873P	MAGI3_ENST00000369617.4_Silent_p.P898P|MAGI3_ENST00000369615.1_Silent_p.P873P|MAGI3_ENST00000369611.4_Silent_p.P873P	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	898					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAACAAACCACCTCCAGGAG	0.463																																							uc001edk.2		NA																	0				lung(3)|ovary(2)|central_nervous_system(1)	6						c.(2617-2619)CCA>CCT		membrane-associated guanylate kinase-related  3							139.0	147.0	144.0					1																	114196630		2203	4300	6503	SO:0001819	synonymous_variant	260425				apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding	g.chr1:114196630A>T	AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.2619A>T	1.37:g.114196630A>T			Somatic				MAGI3_uc001edh.3_Silent_p.P898P|MAGI3_uc001edi.3_Silent_p.P873P|MAGI3_uc010owm.1_Silent_p.P898P|MAGI3_uc001edj.2_Silent_p.P594P	p.P873P	NM_001142782	NP_001136254	WXS	Illumina HiSeq	Unspecified	Q5TCQ9	MAGI3_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	15	2800	+	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)	898			Interaction with LPAR2 and GRIN2B.|PDZ 5.		Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Silent	SNP	ENST00000307546.9	37	c.2619A>T	CCDS44196.1																																																																																				0.463	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900		69	139	0	0	0	0.01441	0	69	139				
BRINP3	339479	broad.mit.edu	37	1	190067206	190067206	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:190067206G>A	ENST00000367462.3	-	8	2474	c.2243C>T	c.(2242-2244)gCg>gTg	p.A748V	BRINP3_ENST00000534846.1_Missense_Mutation_p.A646V	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	748					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.A748V(1)									GGCATTAAACGCCTGCAGAGC	0.428																																							uc001gse.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(2242-2244)GCG>GTG		family with sequence similarity 5, member C							138.0	135.0	136.0					1																	190067206		2203	4300	6503	SO:0001583	missense	339479					extracellular region		g.chr1:190067206G>A	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2243C>T	1.37:g.190067206G>A	ENSP00000356432:p.Ala748Val		Somatic				FAM5C_uc010pot.1_Missense_Mutation_p.A646V	p.A748V	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			8	2475	-	Prostate(682;0.198)		748					B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	c.2243C>T	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023382	0.54683	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.18174	2.49;2.23	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.28167	0.0695	L	0.56769	1.78	0.58432	D	0.999998	D;D	0.60160	0.987;0.977	P;B	0.50162	0.633;0.43	T	0.00653	-1.1625	10	0.38643	T	0.18	.	16.9687	0.86294	0.0:0.0:1.0:0.0	.	646;748	B7Z260;Q76B58	.;FAM5C_HUMAN	V	748;646	ENSP00000356432:A748V;ENSP00000438022:A646V	ENSP00000356432:A748V	A	-	2	0	FAM5C	188333829	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.760000	0.98935	2.593000	0.87608	0.650000	0.86243	GCG		0.428	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		6	158	0	0	0	0.001984	0	6	158				
TP53BP2	7159	broad.mit.edu	37	1	223983555	223983555	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr1:223983555G>A	ENST00000343537.7	-	13	2977	c.2686C>T	c.(2686-2688)Cgc>Tgc	p.R896C	TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391878.2_Missense_Mutation_p.R767C|TP53BP2_ENST00000391879.2_Missense_Mutation_p.R129C	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	890	Mediates interaction with APC2.|Pro-rich.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)	p.R896C(1)|p.R767C(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		TCAGGCGGGCGCATGCTCACC	0.537																																							uc010pvb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)	3						c.(2686-2688)CGC>TGC		tumor protein p53 binding protein, 2 isoform 1							57.0	63.0	61.0					1																	223983555		2203	4300	6503	SO:0001583	missense	7159				apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity	g.chr1:223983555G>A	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.2686C>T	1.37:g.223983555G>A	ENSP00000341957:p.Arg896Cys		Somatic				TP53BP2_uc001hod.2_Missense_Mutation_p.R767C|TP53BP2_uc010puz.1_Missense_Mutation_p.R129C|TP53BP2_uc010pva.1_Missense_Mutation_p.R535C	p.R896C	NM_001031685	NP_001026855	WXS	Illumina HiSeq	Unspecified	Q13625	ASPP2_HUMAN		GBM - Glioblastoma multiforme(131;0.0958)	13	2978	-			890			Mediates interaction with APC2.|Pro-rich.		B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	37	c.2686C>T	CCDS44319.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.24|14.24	2.476424|2.476424	0.44044|0.44044	.|.	.|.	ENSG00000143514|ENSG00000143514	ENST00000494100|ENST00000391878;ENST00000343537;ENST00000391879	.|T;T;T	.|0.51325	.|0.79;0.96;0.71	5.37|5.37	2.45|2.45	0.29901|0.29901	.|Src homology-3 domain (1);	.|0.268229	.|0.43260	.|N	.|0.000590	T|T	0.33789|0.33789	0.0875|0.0875	L|L	0.38838|0.38838	1.175|1.175	0.80722|0.80722	D|D	1|1	.|B;B	.|0.16166	.|0.016;0.016	.|B;B	.|0.12156	.|0.007;0.007	T|T	0.14227|0.14227	-1.0480|-1.0480	5|10	.|0.54805	.|T	.|0.06	.|.	6.858|6.858	0.24052|0.24052	0.2052:0.0:0.6726:0.1222|0.2052:0.0:0.6726:0.1222	.|.	.|896;890	.|B4DG66;Q13625	.|.;ASPP2_HUMAN	V|C	229|767;896;129	.|ENSP00000375750:R767C;ENSP00000341957:R896C;ENSP00000375751:R129C	.|ENSP00000341957:R896C	A|R	-|-	2|1	0|0	TP53BP2|TP53BP2	222050178|222050178	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.955000|0.955000	0.61496|0.61496	1.430000|1.430000	0.34914|0.34914	0.655000|0.655000	0.30866|0.30866	0.563000|0.563000	0.77884|0.77884	GCG|CGC		0.537	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426		4	80	0	0	0	0.000602	0	4	80				
COL17A1	1308	broad.mit.edu	37	10	105800830	105800830	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr10:105800830G>A	ENST00000353479.5	-	39	2984	c.2694C>T	c.(2692-2694)tcC>tcT	p.S898S	COL17A1_ENST00000369733.3_Silent_p.S898S	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	898	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.S898S(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TACCTGAGTTGGACAGGAACG	0.577																																							uc001kxr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(2692-2694)TCC>TCT		alpha 1 type XVII collagen							137.0	127.0	130.0					10																	105800830		2203	4300	6503	SO:0001819	synonymous_variant	1308				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding	g.chr10:105800830G>A	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.2694C>T	10.37:g.105800830G>A			Somatic					p.S898S	NM_000494	NP_000485	WXS	Illumina HiSeq	Unspecified	Q9UMD9	COHA1_HUMAN		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	39	2863	-		Colorectal(252;0.103)|Breast(234;0.122)	898			Extracellular (Potential).|Triple-helical region.		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	ENST00000353479.5	37	c.2694C>T	CCDS7554.1																																																																																				0.577	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		6	46	0	0	0	0.00308	0	6	46				
OR4D9	390199	broad.mit.edu	37	11	59283060	59283060	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:59283060G>A	ENST00000329328.3	+	1	675	c.675G>A	c.(673-675)ctG>ctA	p.L225L		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L225L(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						TGATGATGCTGAGGTCTCACA	0.488																																							uc010rkv.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(673-675)CTG>CTA		olfactory receptor, family 4, subfamily D,							228.0	199.0	209.0					11																	59283060		2201	4295	6496	SO:0001819	synonymous_variant	390199				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59283060G>A	AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.675G>A	11.37:g.59283060G>A			Somatic					p.L225L	NM_001004711	NP_001004711	WXS	Illumina HiSeq	Unspecified	Q8NGE8	OR4D9_HUMAN			1	675	+			225			Cytoplasmic (Potential).		Q6IFF3	Silent	SNP	ENST00000329328.3	37	c.675G>A	CCDS31564.1																																																																																				0.488	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394237.1	NM_001004711		34	140	0	0	0	0.012213	0	34	140				
TMEM132A	54972	broad.mit.edu	37	11	60695271	60695271	+	Silent	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:60695271C>T	ENST00000453848.2	+	3	632	c.474C>T	c.(472-474)ccC>ccT	p.P158P	TMEM132A_ENST00000005286.4_Silent_p.P158P|RP11-881M11.4_ENST00000543907.1_RNA			Q24JP5	T132A_HUMAN	transmembrane protein 132A	158						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.P158P(2)		breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						GCAGCCTGCCCTGTGCCCGGC	0.657																																							uc001nqj.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(1)	1						c.(472-474)CCC>CCT		transmembrane protein 132A isoform b							33.0	36.0	35.0					11																	60695271		2200	4297	6497	SO:0001819	synonymous_variant	54972					endoplasmic reticulum membrane|Golgi membrane|integral to membrane		g.chr11:60695271C>T	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.474C>T	11.37:g.60695271C>T			Somatic				TMEM132A_uc001nqi.2_Silent_p.P158P|TMEM132A_uc001nqk.2_Silent_p.P171P|TMEM132A_uc001nql.1_Silent_p.P171P	p.P158P	NM_178031	NP_821174	WXS	Illumina HiSeq	Unspecified	Q24JP5	T132A_HUMAN			3	667	+			158			Extracellular (Potential).		Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Silent	SNP	ENST00000453848.2	37	c.474C>T	CCDS44618.1																																																																																				0.657	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870		10	44	0	0	0	0.010729	0	10	44				
MYRF	745	broad.mit.edu	37	11	61539415	61539415	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:61539415A>G	ENST00000278836.5	+	7	1202	c.1106A>G	c.(1105-1107)tAc>tGc	p.Y369C	MYRF_ENST00000327797.1_5'Flank|MYRF_ENST00000265460.5_Missense_Mutation_p.Y360C|TMEM258_ENST00000535042.1_Intron	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	369					central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y360C(1)									GATGCTAACTACAAGGAGCTG	0.617																																							uc001nsc.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1105-1107)TAC>TGC		myelin gene regulatory factor isoform 2							151.0	146.0	148.0					11																	61539415		2202	4299	6501	SO:0001583	missense	745				central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:61539415A>G		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.1106A>G	11.37:g.61539415A>G	ENSP00000278836:p.Tyr369Cys		Somatic				C11orf9_uc001nse.1_Missense_Mutation_p.Y360C	p.Y369C	NM_001127392	NP_001120864	WXS	Illumina HiSeq	Unspecified	Q9Y2G1	MRF_HUMAN			7	1202	+			369			NDT80.		O43582|Q9P1Q6	Missense_Mutation	SNP	ENST00000278836.5	37	c.1106A>G	CCDS44622.1	.	.	.	.	.	.	.	.	.	.	A	16.62	3.173042	0.57584	.	.	ENSG00000124920	ENST00000278836;ENST00000265460	T;T	0.31769	1.48;1.49	4.31	3.15	0.36227	NDT80 DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);	0.313296	0.35772	N	0.002985	T	0.43634	0.1256	L	0.46157	1.445	0.80722	D	1	D;B	0.71674	0.998;0.242	D;B	0.69479	0.964;0.068	T	0.21586	-1.0241	10	0.49607	T	0.09	-32.3325	10.2959	0.43625	0.852:0.0:0.0:0.148	.	360;369	Q9Y2G1-2;Q9Y2G1	.;MRF_HUMAN	C	369;360	ENSP00000278836:Y369C;ENSP00000265460:Y360C	ENSP00000265460:Y360C	Y	+	2	0	C11orf9	61295991	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	4.686000	0.61700	0.774000	0.33427	0.374000	0.22700	TAC		0.617	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398519.2	NM_013279		15	58	0	0	0	0.00499	0	15	58				
FRMD8	83786	broad.mit.edu	37	11	65172387	65172387	+	Missense_Mutation	SNP	C	C	T	rs531452921		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:65172387C>T	ENST00000317568.5	+	10	1287	c.1124C>T	c.(1123-1125)gCg>gTg	p.A375V	FRMD8_ENST00000416776.2_Missense_Mutation_p.A341V|FRMD8_ENST00000355991.5_Missense_Mutation_p.A319V	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	375	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)		p.A375V(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						AGCCAGGCGGCGGAGCCCGCA	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		16948	0.001		0.0	False		,,,				2504	0.0						uc001odu.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|pancreas(1)	2						c.(1123-1125)GCG>GTG		FERM domain containing 8							32.0	35.0	34.0					11																	65172387		2201	4297	6498	SO:0001583	missense	83786					cytoskeleton	binding	g.chr11:65172387C>T	AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.1124C>T	11.37:g.65172387C>T	ENSP00000319726:p.Ala375Val		Somatic				FRMD8_uc009yqj.2_Missense_Mutation_p.A319V|FRMD8_uc010rof.1_Missense_Mutation_p.A341V	p.A375V	NM_031904	NP_114110	WXS	Illumina HiSeq	Unspecified	Q9BZ67	FRMD8_HUMAN			10	1316	+			375			FERM.		B4E2P1|Q86V56|Q8NCB5	Missense_Mutation	SNP	ENST00000317568.5	37	c.1124C>T	CCDS8102.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013181	0.35511	.	.	ENSG00000126391	ENST00000317568;ENST00000355991;ENST00000416776	D;T;D	0.83335	-1.71;-1.12;-1.71	5.09	-0.7	0.11273	FERM domain (1);	0.390283	0.25076	N	0.033336	T	0.67458	0.2895	L	0.36672	1.1	0.09310	N	1	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.09377	0.001;0.004;0.001	T	0.49688	-0.8913	10	0.28530	T	0.3	-3.7516	3.27	0.06878	0.1244:0.5486:0.1221:0.2049	.	341;319;375	B4E2P1;Q9BZ67-2;Q9BZ67	.;.;FRMD8_HUMAN	V	375;319;341	ENSP00000319726:A375V;ENSP00000348270:A319V;ENSP00000392111:A341V	ENSP00000319726:A375V	A	+	2	0	FRMD8	64928963	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.709000	0.05030	-0.014000	0.14175	0.655000	0.94253	GCG		0.682	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388833.1	NM_031904		7	37	0	0	0	0.006214	0	7	37				
PPP6R3	55291	broad.mit.edu	37	11	68337296	68337296	+	Silent	SNP	T	T	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:68337296T>C	ENST00000393800.2	+	11	1463	c.1209T>C	c.(1207-1209)ccT>ccC	p.P403P	PPP6R3_ENST00000524845.1_Silent_p.P403P|PPP6R3_ENST00000534534.1_Silent_p.P171P|PPP6R3_ENST00000265637.4_Silent_p.P403P|PPP6R3_ENST00000524904.1_Silent_p.P403P|PPP6R3_ENST00000393799.2_Silent_p.P403P|PPP6R3_ENST00000393801.3_Silent_p.P403P|PPP6R3_ENST00000529710.1_Silent_p.P352P|PPP6R3_ENST00000527403.2_Silent_p.P403P|PPP6R3_ENST00000265636.5_Silent_p.P352P	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	403					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)	p.P352P(1)|p.P403P(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TTGCAAGTCCTTTTGAAAACA	0.333																																							uc001onw.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1207-1209)CCT>CCC		SAPS domain family, member 3 isoform 6							170.0	162.0	164.0					11																	68337296		2200	4294	6494	SO:0001819	synonymous_variant	55291				regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding	g.chr11:68337296T>C	AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.1209T>C	11.37:g.68337296T>C			Somatic				SAPS3_uc001onv.2_Silent_p.P403P|SAPS3_uc001ony.3_Silent_p.P403P|SAPS3_uc001onx.2_Silent_p.P403P|SAPS3_uc009ysh.2_Silent_p.P352P|SAPS3_uc001onu.2_Silent_p.P352P|SAPS3_uc010rqc.1_Silent_p.P171P|SAPS3_uc010rqd.1_Silent_p.P115P	p.P403P	NM_001164161	NP_001157633	WXS	Illumina HiSeq	Unspecified	Q5H9R7	PP6R3_HUMAN	LUAD - Lung adenocarcinoma(13;0.102)		11	1476	+			403					Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Silent	SNP	ENST00000393800.2	37	c.1209T>C	CCDS53672.1																																																																																				0.333	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395275.1	NM_018312		3	174	0	0	0	0.009096	0	3	174				
MMP27	64066	broad.mit.edu	37	11	102565710	102565710	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:102565710G>A	ENST00000260229.4	-	7	1112	c.1021C>T	c.(1021-1023)Ctg>Ttg	p.L341L		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	341					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L341L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	TTAAAAACCAGAATCTTATCT	0.428																																							uc001phd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1021-1023)CTG>TTG		matrix metalloproteinase 27 precursor							90.0	88.0	89.0					11																	102565710		2203	4299	6502	SO:0001819	synonymous_variant	64066				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102565710G>A	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.1021C>T	11.37:g.102565710G>A			Somatic					p.L341L	NM_022122	NP_071405	WXS	Illumina HiSeq	Unspecified	Q9H306	MMP27_HUMAN	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	7	1044	-	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	341			Hemopexin-like 2.		Q6UWK6	Silent	SNP	ENST00000260229.4	37	c.1021C>T	CCDS8319.1																																																																																				0.428	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122		7	31	0	0	0	0.001984	0	7	31				
MMP27	64066	broad.mit.edu	37	11	102565768	102565768	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:102565768G>C	ENST00000260229.4	-	7	1054	c.963C>G	c.(961-963)ttC>ttG	p.F321L		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	321					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.F321L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	GAGATGGCCAGAATGAAGCAA	0.423																																							uc001phd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(961-963)TTC>TTG		matrix metalloproteinase 27 precursor							121.0	115.0	117.0					11																	102565768		2203	4299	6502	SO:0001583	missense	64066				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102565768G>C	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.963C>G	11.37:g.102565768G>C	ENSP00000260229:p.Phe321Leu		Somatic					p.F321L	NM_022122	NP_071405	WXS	Illumina HiSeq	Unspecified	Q9H306	MMP27_HUMAN	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	7	986	-	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	321			Hemopexin-like 1.		Q6UWK6	Missense_Mutation	SNP	ENST00000260229.4	37	c.963C>G	CCDS8319.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605816	0.46527	.	.	ENSG00000137675	ENST00000260229	T	0.02421	4.3	5.8	0.1	0.14510	Hemopexin/matrixin, conserved site (1);Hemopexin/matrixin (2);	0.276123	0.31784	N	0.007073	T	0.04092	0.0114	M	0.69823	2.125	0.39052	D	0.960351	B	0.17465	0.022	B	0.18561	0.022	T	0.27640	-1.0068	10	0.46703	T	0.11	.	7.5146	0.27593	0.3196:0.0:0.5719:0.1084	.	321	Q9H306	MMP27_HUMAN	L	321	ENSP00000260229:F321L	ENSP00000260229:F321L	F	-	3	2	MMP27	102070978	0.996000	0.38824	0.991000	0.47740	0.992000	0.81027	0.226000	0.17776	0.102000	0.17638	0.655000	0.94253	TTC		0.423	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122		6	74	0	0	0	0.00308	0	6	74				
MMP27	64066	broad.mit.edu	37	11	102565801	102565801	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:102565801G>A	ENST00000260229.4	-	7	1021	c.930C>T	c.(928-930)atC>atT	p.I310I		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	310					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.I310I(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	CAACATCCGTGATATCATAAT	0.388																																							uc001phd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(928-930)ATC>ATT		matrix metalloproteinase 27 precursor							120.0	116.0	117.0					11																	102565801		2203	4299	6502	SO:0001819	synonymous_variant	64066				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102565801G>A	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.930C>T	11.37:g.102565801G>A			Somatic					p.I310I	NM_022122	NP_071405	WXS	Illumina HiSeq	Unspecified	Q9H306	MMP27_HUMAN	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	7	953	-	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	310			Hemopexin-like 1.		Q6UWK6	Silent	SNP	ENST00000260229.4	37	c.930C>T	CCDS8319.1																																																																																				0.388	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122		7	92	0	0	0	0.001984	0	7	92				
MMP12	4321	broad.mit.edu	37	11	102743681	102743681	+	RNA	SNP	G	G	A	rs201720785		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr11:102743681G>A	ENST00000532855.1	-	0	360							P39900	MMP12_HUMAN	matrix metallopeptidase 12 (macrophage elastase)						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|proteolysis (GO:0006508)|wound healing, spreading of epidermal cells (GO:0035313)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.H88H(1)		autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	26		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)|Marimastat(DB00786)	ATCGAGGTGCGTGCATCATCT	0.483																																							uc001phk.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(262-264)CAC>CAT		matrix metalloproteinase 12 preproprotein	Acetohydroxamic Acid(DB00551)						61.0	62.0	62.0					11																	102743681		1924	4109	6033			4321				positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102743681G>A	L23808	CCDS73375.1	11q22.3	2009-02-26	2005-08-08			ENSG00000262406			7158	protein-coding gene	gene with protein product		601046	"""matrix metalloproteinase 12 (macrophage elastase)"""				Standard	NM_002426		Approved	HME	uc001phk.3	P39900			11.37:g.102743681G>A			Somatic					p.H88H	NM_002426	NP_002417	WXS	Illumina HiSeq	Unspecified	P39900	MMP12_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.014)	2	309	-		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	88					B2R9X8|B7ZLF6|Q2M1L9	Silent	SNP	ENST00000532855.1	37	c.264C>T																																																																																					0.483	MMP12-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000386646.1	NM_002426		6	19	0	0	0	0.001168	0	6	19				
SLCO1B1	10599	broad.mit.edu	37	12	21355464	21355464	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr12:21355464T>C	ENST00000256958.2	+	10	1271	c.1175T>C	c.(1174-1176)tTa>tCa	p.L392S		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	392					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.L392S(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	GGAATGTTTTTAGGAGGATAT	0.289																																							uc001req.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8						c.(1174-1176)TTA>TCA		solute carrier organic anion transporter family,	Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)						55.0	55.0	55.0					12																	21355464		2203	4297	6500	SO:0001583	missense	10599				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity	g.chr12:21355464T>C		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.1175T>C	12.37:g.21355464T>C	ENSP00000256958:p.Leu392Ser		Somatic					p.L392S	NM_006446	NP_006437	WXS	Illumina HiSeq	Unspecified	Q9Y6L6	SO1B1_HUMAN			10	1279	+			392			Helical; Name=8; (Potential).		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	c.1175T>C	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	T	8.265	0.812079	0.16537	.	.	ENSG00000134538	ENST00000256958	T	0.52057	0.68	3.23	-4.38	0.03622	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	3.862930	0.01021	N	0.003998	T	0.36991	0.0987	L	0.39147	1.195	0.19300	N	0.999971	B	0.22983	0.078	B	0.29267	0.1	T	0.13656	-1.0501	10	0.21540	T	0.41	.	5.8434	0.18647	0.0:0.4846:0.1456:0.3698	.	392	Q9Y6L6	SO1B1_HUMAN	S	392	ENSP00000256958:L392S	ENSP00000256958:L392S	L	+	2	0	SLCO1B1	21246731	0.001000	0.12720	0.421000	0.26609	0.396000	0.30629	-0.230000	0.09083	-0.635000	0.05531	0.397000	0.26171	TTA		0.289	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446		18	30	0	0	0	0.007413	0	18	30				
RPL6	6128	broad.mit.edu	37	12	112843710	112843710	+	Missense_Mutation	SNP	T	T	G	rs148929822	byFrequency	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr12:112843710T>G	ENST00000424576.2	-	6	846	c.661A>C	c.(661-663)Aag>Cag	p.K221Q	RPL6_ENST00000202773.9_Missense_Mutation_p.K221Q	NM_001024662.1	NP_001019833.1	Q02878	RL6_HUMAN	ribosomal protein L6	221					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.K221Q(1)		cervix(1)|large_intestine(6)|lung(3)	10						TTCCGCAGCTTCTTCTTCTTG	0.423													T|||	5	0.000998403	0.0023	0.0029	5008	,	,		20900	0.0		0.0	False		,,,				2504	0.0						uc001ttu.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(661-663)AAG>CAG		ribosomal protein L6		T	GLN/LYS,GLN/LYS	7,4399	9.9+/-24.2	0,7,2196	76.0	82.0	80.0		661,661	1.2	1.0	12	dbSNP_134	80	2,8592	3.0+/-9.4	0,2,4295	no	missense,missense	RPL6	NM_000970.3,NM_001024662.1	53,53	0,9,6491	GG,GT,TT		0.0233,0.1589,0.0692	benign,benign	221/289,221/289	112843710	9,12991	2203	4297	6500	SO:0001583	missense	6128				endocrine pancreas development|regulation of transcription, DNA-dependent|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	DNA binding|RNA binding|structural constituent of ribosome	g.chr12:112843710T>G	X69391	CCDS9162.1	12q24.13	2014-06-05				ENSG00000089009		"""L ribosomal proteins"""	10362	protein-coding gene	gene with protein product		603703		TXREB1		8479925, 8457378	Standard	XM_005253920		Approved	TAXREB107, L6	uc001ttv.3	Q02878		ENST00000424576.2:c.661A>C	12.37:g.112843710T>G	ENSP00000403172:p.Lys221Gln		Somatic				RPL6_uc001ttv.2_Missense_Mutation_p.K221Q	p.K221Q	NM_001024662	NP_001019833	WXS	Illumina HiSeq	Unspecified	Q02878	RL6_HUMAN			6	890	-			221					Q2M3Q3|Q8WW97	Missense_Mutation	SNP	ENST00000424576.2	37	c.661A>C	CCDS9162.1	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	T	10.66	1.413528	0.25465	0.001589	2.33E-4	ENSG00000089009	ENST00000202773;ENST00000424576;ENST00000549923	T;T	0.34859	1.34;1.34	5.05	1.19	0.21007	Translation protein SH3-like, subgroup (1);	0.231515	0.50627	N	0.000109	T	0.19685	0.0473	L	0.31294	0.92	0.43412	D	0.995553	B	0.12630	0.006	B	0.24269	0.052	T	0.05209	-1.0899	10	0.37606	T	0.19	.	12.6313	0.56659	0.0:0.0:0.4153:0.5847	.	221	Q02878	RL6_HUMAN	Q	221;221;161	ENSP00000202773:K221Q;ENSP00000403172:K221Q	ENSP00000202773:K221Q	K	-	1	0	RPL6	111328093	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	3.047000	0.49854	-0.035000	0.13691	-0.438000	0.05819	AAG		0.423	RPL6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405422.1			15	79	0	0	0	0.00499	0	15	79				
CFL2	1073	broad.mit.edu	37	14	35182544	35182544	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr14:35182544G>A	ENST00000341223.3	-	2	378	c.227C>T	c.(226-228)cCt>cTt	p.P76L	CFL2_ENST00000556161.1_Missense_Mutation_p.P59L|CFL2_ENST00000298159.6_Missense_Mutation_p.P76L|CFL2_ENST00000555765.1_Missense_Mutation_p.P59L	NM_001243645.1|NM_021914.7	NP_001230574.1|NP_068733.1	Q9Y281	COF2_HUMAN	cofilin 2 (muscle)	76	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament depolymerization (GO:0030042)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of actin filament depolymerization (GO:0030836)|regulation of dendritic spine morphogenesis (GO:0061001)|sarcomere organization (GO:0045214)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|nucleus (GO:0005634)		p.P76L(1)		breast(3)|endometrium(2)|lung(3)	8	Breast(36;0.0361)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;6.07e-06)|Lung(238;2.23e-05)|Epithelial(34;0.0387)|all cancers(34;0.0814)	GBM - Glioblastoma multiforme(112;0.0424)		ATCATTCAGAGGTAGCAACTT	0.383																																							uc001wsg.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(226-228)CCT>CTT		cofilin 2							128.0	120.0	123.0					14																	35182544		2203	4300	6503	SO:0001583	missense	1073					cytoplasm|cytoskeleton|nuclear matrix	actin binding	g.chr14:35182544G>A	AF087867	CCDS9649.1, CCDS9650.1, CCDS58311.1	14q13.2	2014-09-17			ENSG00000165410	ENSG00000165410			1875	protein-coding gene	gene with protein product	"""nemaline myopathy type 7"""	601443				8800436	Standard	NM_138638		Approved	NEM7	uc001wsh.3	Q9Y281	OTTHUMG00000029536	ENST00000341223.3:c.227C>T	14.37:g.35182544G>A	ENSP00000340635:p.Pro76Leu		Somatic				CFL2_uc010tpn.1_Missense_Mutation_p.P59L|CFL2_uc001wsh.3_Missense_Mutation_p.P76L|CFL2_uc001wsi.3_Intron|CFL2_uc001wsj.3_Intron	p.P76L	NM_021914	NP_068733	WXS	Illumina HiSeq	Unspecified	Q9Y281	COF2_HUMAN	LUAD - Lung adenocarcinoma(48;6.07e-06)|Lung(238;2.23e-05)|Epithelial(34;0.0387)|all cancers(34;0.0814)	GBM - Glioblastoma multiforme(112;0.0424)	2	368	-	Breast(36;0.0361)|Hepatocellular(127;0.158)		76			ADF-H.		G3V5P4	Missense_Mutation	SNP	ENST00000341223.3	37	c.227C>T	CCDS9650.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.899313	0.72754	.	.	ENSG00000165410	ENST00000341223;ENST00000298159;ENST00000555765;ENST00000556161	D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98	6.02	6.02	0.97574	Actin-binding, cofilin/tropomyosin type (3);	0.000000	0.85682	D	0.000000	D	0.92948	0.7756	M	0.87827	2.91	0.80722	D	1	P	0.47350	0.894	P	0.57846	0.828	D	0.92592	0.6084	10	0.59425	D	0.04	-8.2054	20.5407	0.99260	0.0:0.0:1.0:0.0	.	76	Q9Y281	COF2_HUMAN	L	76;76;59;59	ENSP00000340635:P76L;ENSP00000298159:P76L;ENSP00000452451:P59L;ENSP00000452188:P59L	ENSP00000298159:P76L	P	-	2	0	CFL2	34252295	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.777000	0.99008	2.865000	0.98341	0.655000	0.94253	CCT		0.383	CFL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276639.1	NM_138638		26	88	0	0	0	0.005443	0	26	88				
SSTR1	6751	broad.mit.edu	37	14	38679102	38679102	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr14:38679102C>T	ENST00000267377.2	+	3	1125	c.508C>T	c.(508-510)Cgg>Tgg	p.R170W		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	170					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.R170W(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	CCGCTACCGCCGGCCCACCGT	0.637																																							uc001wul.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|ovary(1)|lung(1)	5						c.(508-510)CGG>TGG		somatostatin receptor 1	Octreotide(DB00104)						66.0	67.0	67.0					14																	38679102		2203	4299	6502	SO:0001583	missense	6751				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity	g.chr14:38679102C>T		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.508C>T	14.37:g.38679102C>T	ENSP00000267377:p.Arg170Trp		Somatic				SSTR1_uc010amu.1_Intron	p.R170W	NM_001049	NP_001040	WXS	Illumina HiSeq	Unspecified	P30872	SSR1_HUMAN	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	3	1125	+	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		170			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000267377.2	37	c.508C>T	CCDS9666.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.868842	0.72065	.	.	ENSG00000139874	ENST00000267377	T	0.38722	1.12	4.82	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000050	T	0.72890	0.3517	M	0.92367	3.3	0.53688	D	0.999975	D	0.89917	1.0	D	0.91635	0.999	T	0.80781	-0.1229	10	0.87932	D	0	.	17.0667	0.86561	0.0:1.0:0.0:0.0	.	170	P30872	SSR1_HUMAN	W	170	ENSP00000267377:R170W	ENSP00000267377:R170W	R	+	1	2	SSTR1	37748853	0.465000	0.25815	1.000000	0.80357	0.997000	0.91878	0.887000	0.28254	2.514000	0.84764	0.561000	0.74099	CGG		0.637	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2			5	39	0	0	0	0.001168	0	5	39				
MIA2	117153	broad.mit.edu	37	14	39716224	39716224	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr14:39716224A>T	ENST00000280082.3	+	4	645	c.446A>T	c.(445-447)gAt>gTt	p.D149V	MIA2_ENST00000556784.1_Missense_Mutation_p.D148V|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.D149V	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	149					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)		p.D149V(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		GAAGATAAAGATGAAAAATCT	0.299																																							uc001wux.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(445-447)GAT>GTT		melanoma inhibitory activity 2							37.0	42.0	40.0					14																	39716224		2198	4298	6496	SO:0001583	missense	117153					extracellular region		g.chr14:39716224A>T	BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.446A>T	14.37:g.39716224A>T	ENSP00000280082:p.Asp149Val		Somatic				MIA2_uc010amy.1_Missense_Mutation_p.D80V	p.D149V	NM_054024	NP_473365	WXS	Illumina HiSeq	Unspecified	Q96PC5	MIA2_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)	4	640	+	Hepatocellular(127;0.213)		149					A1L4H0|Q9H6C1	Missense_Mutation	SNP	ENST00000280082.3	37	c.446A>T	CCDS9672.1	.	.	.	.	.	.	.	.	.	.	A	13.88	2.370044	0.42003	.	.	ENSG00000150526;ENSG00000150526;ENSG00000258941	ENST00000280082;ENST00000556784;ENST00000553728	T;T;T	0.56275	0.47;0.5;2.89	5.64	5.64	0.86602	.	0.751878	0.11369	N	0.571096	T	0.69726	0.3143	M	0.69823	2.125	0.26223	N	0.979124	D;D	0.57571	0.966;0.98	P;P	0.58331	0.641;0.837	T	0.62950	-0.6745	9	.	.	.	-26.7396	15.8552	0.78972	1.0:0.0:0.0:0.0	.	149;149	Q96PC5;Q96PC5-2	MIA2_HUMAN;.	V	149;148;149	ENSP00000280082:D149V;ENSP00000451934:D148V;ENSP00000452252:D149V	.	D	+	2	0	MIA2;RP11-407N17.3	38785975	0.630000	0.27155	0.022000	0.16811	0.199000	0.23934	5.938000	0.70170	2.148000	0.66965	0.533000	0.62120	GAT		0.299	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3	NM_054024		9	34	0	0	0	0.006214	0	9	34				
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	RNA	SNP	G	G	A	rs201972834		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr15:102515299G>A	ENST00000557932.1	+	0	1145				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.G374S(10)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						TGGGGGCATCGGCAAGGCCAA	0.652																																							uc002cdi.2		NA																	10	Substitution - Missense(10)		kidney(7)|prostate(2)|endometrium(1)		0						c.(523-525)GGC>AGC		RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;																																						374666							g.chr15:102515299G>A			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515299G>A			Somatic				WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	p.G175S	NR_003659		WXS	Illumina HiSeq	Unspecified					9	1943	+									Missense_Mutation	SNP	ENST00000557932.1	37	c.523G>A		.	.	.	.	.	.	.	.	.	.	g	2.376	-0.343229	0.05243	.	.	ENSG00000185596	ENST00000338304;ENST00000398121	.	.	.	1.01	1.01	0.19927	.	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	-23.1056	7.9382	0.29941	0.0:0.0:1.0:0.0	.	.	.	.	S	383;374	.	.	G	+	1	0	WASH3P	100332822	1.000000	0.71417	0.997000	0.53966	0.230000	0.25150	8.205000	0.89743	0.863000	0.35553	0.184000	0.17185	GGC		0.652	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163		5	11	0	0	0	0.00308	0	5	11				
RRN3P1	730092	broad.mit.edu	37	16	21817457	21817457	+	RNA	SNP	G	G	A	rs202140854	byFrequency	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:21817457G>A	ENST00000546471.1	-	0	1601							Q2M238	RN3P1_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 1																		CTTACATCCAGCTTGAGTAGT	0.259																																							uc010vbl.1		NA																	0					0						c.(106-108)CTG>TTG		SubName: Full=Putative uncharacterized protein ENSP00000219758;																																						730092							g.chr16:21817457G>A			16p12.2	2012-10-16			ENSG00000248124	ENSG00000248124			30548	pseudogene	pseudogene						12477932	Standard	NR_003370		Approved		uc010vbl.1	Q2M238	OTTHUMG00000170417		16.37:g.21817457G>A			Somatic				uc002diq.3_Intron	p.L36L	NR_003370		WXS	Illumina HiSeq	Unspecified					7	603	-								A8K6T4|B3KWX9|O75704	Silent	SNP	ENST00000546471.1	37	c.106C>T																																																																																					0.259	RRN3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000409035.1	NR_003370		4	17	0	0	0	0.001168	0	4	17				
ITGAM	3684	broad.mit.edu	37	16	31282350	31282351	+	Missense_Mutation	DNP	GG	GG	TT	rs531779676		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:31282350_31282351GG>TT	ENST00000287497.8	+	6	578_579	c.503_504GG>TT	c.(502-504)cGG>cTT	p.R168L	ITGAM_ENST00000544665.3_Missense_Mutation_p.R168L			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	168	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)	p.R168L(1)		endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GACTTTCGGCGGATGAAGGAGT	0.505																																							uc002ebq.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(502-504)CGG>CTT		integrin alpha M isoform 2 precursor																																				SO:0001583	missense	3684				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity	g.chr16:31282350_31282351GG>TT	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		Exception_encountered	16.37:g.31282350_31282351delinsTT	ENSP00000287497:p.Arg168Leu		Somatic				ITGAM_uc002ebr.2_Missense_Mutation_p.R168L	p.R168L	NM_000632	NP_000623	WXS	Illumina HiSeq	Unspecified	P11215	ITAM_HUMAN			6	601_602	+			168			VWFA.|Extracellular (Potential).		Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	DNP	ENST00000287497.8	37	c.503_504GG>TT	CCDS45470.1																																																																																				0.505	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632		50	133	0	0	0	0.004672	0	50	133				
SALL1	6299	broad.mit.edu	37	16	51173914	51173914	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:51173914C>T	ENST00000251020.4	-	2	2252	c.2219G>A	c.(2218-2220)gGc>gAc	p.G740D	SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.G643D	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	740					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G740D(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GAAAGCCCGGCCACAGATCTT	0.552																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(3)	8						c.(2218-2220)GGC>GAC		sal-like 1 isoform a							57.0	58.0	57.0					16																	51173914		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51173914C>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2219G>A	16.37:g.51173914C>T	ENSP00000251020:p.Gly740Asp		Somatic				SALL1_uc010vgr.1_Missense_Mutation_p.G643D|SALL1_uc010cbv.2_Intron	p.G740D	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	2250	-		all_cancers(37;0.0322)	740			C2H2-type 4.		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.2219G>A	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682955	0.68157	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.07444	3.19;3.19	5.3	5.3	0.74995	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.15305	0.0369	N	0.21240	0.645	0.80722	D	1	B	0.29341	0.242	P	0.46718	0.525	T	0.27157	-1.0082	10	0.59425	D	0.04	.	19.0235	0.92923	0.0:1.0:0.0:0.0	.	740	Q9NSC2	SALL1_HUMAN	D	740;643;704	ENSP00000251020:G740D;ENSP00000407914:G643D	ENSP00000251020:G740D	G	-	2	0	SALL1	49731415	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	7.818000	0.86416	2.490000	0.84030	0.454000	0.30748	GGC		0.552	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		6	33	0	0	0	0.001168	0	6	33				
IRX6	79190	broad.mit.edu	37	16	55360423	55360423	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:55360423C>T	ENST00000290552.7	+	2	1553	c.221C>T	c.(220-222)cCc>cTc	p.P74L	IRX6_ENST00000558315.1_3'UTR|RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	74					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.P74H(1)|p.P74L(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						TATGGAGCACCCTATGCGGCC	0.672																																							uc002ehy.2		NA																	2	Substitution - Missense(2)	p.P74H(1)	lung(1)|central_nervous_system(1)	central_nervous_system(5)|ovary(1)	6						c.(220-222)CCC>CTC		iroquois homeobox protein 6							15.0	15.0	15.0					16																	55360423		2196	4299	6495	SO:0001583	missense	79190					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr16:55360423C>T	AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.221C>T	16.37:g.55360423C>T	ENSP00000290552:p.Pro74Leu		Somatic				IRX6_uc002ehx.2_Missense_Mutation_p.P74L|IRX6_uc010ccb.1_RNA	p.P74L	NM_024335	NP_077311	WXS	Illumina HiSeq	Unspecified	P78412	IRX6_HUMAN			2	754	+			74					B2RN06|Q7Z2K0	Missense_Mutation	SNP	ENST00000290552.7	37	c.221C>T	CCDS32449.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838459	0.91117	.	.	ENSG00000159387	ENST00000290552	D	0.84944	-1.92	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.92909	0.7744	M	0.85197	2.74	0.80722	D	1	D	0.76494	0.999	D	0.66979	0.948	D	0.93408	0.6766	10	0.62326	D	0.03	-19.5591	18.8934	0.92414	0.0:1.0:0.0:0.0	.	74	P78412	IRX6_HUMAN	L	74	ENSP00000290552:P74L	ENSP00000290552:P74L	P	+	2	0	IRX6	53917924	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	6.897000	0.75671	2.701000	0.92244	0.462000	0.41574	CCC		0.672	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335		5	6	0	0	0	0.001984	0	5	6				
PKD1L2	114780	broad.mit.edu	37	16	81151065	81151065	+	RNA	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:81151065G>T	ENST00000534142.1	-	0	1071				PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000525539.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AGCTGGCCAGGATGATGGCCA	0.612																																							uc002fgh.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(6682-6684)ATC>ATA		polycystin 1-like 2 isoform a							76.0	80.0	79.0					16																	81151065		1959	4148	6107			114780				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding	g.chr16:81151065G>T	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81151065G>T			Somatic				PKD1L2_uc002fgf.1_Silent_p.I28I|PKD1L2_uc002fgg.1_RNA	p.I2228I	NM_052892	NP_443124	WXS	Illumina HiSeq	Unspecified	Q7Z442	PK1L2_HUMAN			41	6684	-			2228			Helical; (Potential).		Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000534142.1	37	c.6684C>A																																																																																					0.612	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	polymorphic_pseudogene	OTTHUMT00000387969.1			41	50	1	0	1.00001e-27	0.009718	1.2184e-27	41	50				
TUBB8P7	197331	broad.mit.edu	37	16	90161578	90161578	+	RNA	SNP	G	G	A	rs13337896	byFrequency	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:90161578G>A	ENST00000564451.1	+	0	931				TUBB8P7_ENST00000567960.1_RNA					tubulin, beta 8 class VIII pseudogene 7									p.R105H(3)									GCCAAGGGACGCTACACCGAA	0.587													.|||	668	0.133387	0.0386	0.1499	5008	,	,		18807	0.4087		0.0537	False		,,,				2504	0.0481						uc002fqp.2		NA																	3	Substitution - Missense(3)		urinary_tract(1)|prostate(1)|kidney(1)		NA						c.(451-453)ACG>ACA		Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																																						0							g.chr16:90161578G>A			16q24.3	2013-02-18			ENSG00000261812	ENSG00000261812			42345	pseudogene	pseudogene							Standard	NG_002334		Approved				OTTHUMG00000172847		16.37:g.90161578G>A			Somatic				uc002fqq.2_Silent_p.T168T	p.T151T			WXS	Illumina HiSeq	Unspecified					3	931	+									Silent	SNP	ENST00000564451.1	37	c.453G>A																																																																																					0.587	TUBB8P7-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000420856.1	NG_002334		6	21	0	0	0	0.001168	0	6	21				
ZZEF1	23140	broad.mit.edu	37	17	3990763	3990763	+	Silent	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:3990763C>T	ENST00000381638.2	-	14	2431	c.2307G>A	c.(2305-2307)caG>caA	p.Q769Q	ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	769							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.Q769Q(1)		central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TCCAGAAGATCTGCAAATCAA	0.303																																							uc002fxe.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(2305-2307)CAG>CAA		zinc finger, ZZ type with EF hand domain 1							64.0	69.0	68.0					17																	3990763		2203	4300	6503	SO:0001819	synonymous_variant	23140						calcium ion binding|zinc ion binding	g.chr17:3990763C>T	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.2307G>A	17.37:g.3990763C>T			Somatic				ZZEF1_uc002fxk.1_Silent_p.Q769Q	p.Q769Q	NM_015113	NP_055928	WXS	Illumina HiSeq	Unspecified	O43149	ZZEF1_HUMAN			14	2371	-			769					A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	ENST00000381638.2	37	c.2307G>A	CCDS11043.1																																																																																				0.303	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113		8	41	0	0	0	0.006214	0	8	41				
RABEP1	9135	broad.mit.edu	37	17	5286437	5286437	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:5286437G>A	ENST00000546142.2	+	18	2695	c.2508G>A	c.(2506-2508)cgG>cgA	p.R836R	RABEP1_ENST00000408982.2_Silent_p.R803R|RABEP1_ENST00000262477.6_Silent_p.R836R|RABEP1_ENST00000341923.6_Silent_p.R803R|RABEP1_ENST00000537505.1_Silent_p.R793R|NUP88_ENST00000573169.1_Intron			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	836					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)	p.R836R(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						AGCGGATCCGGCAAGCTGACT	0.473																																							uc002gbm.3		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(2506-2508)CGG>CGA		rabaptin, RAB GTPase binding effector protein 1							70.0	75.0	74.0					17																	5286437		2154	4296	6450	SO:0001819	synonymous_variant	9135				apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity	g.chr17:5286437G>A	AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.2508G>A	17.37:g.5286437G>A			Somatic				RABEP1_uc010vsw.1_Silent_p.R793R|RABEP1_uc002gbl.3_Silent_p.R803R|NUP88_uc002gbn.2_Intron	p.R836R	NM_004703	NP_004694	WXS	Illumina HiSeq	Unspecified	Q15276	RABE1_HUMAN			18	2732	+			836					B2RAG7|O95369|Q8IVX3	Silent	SNP	ENST00000546142.2	37	c.2508G>A	CCDS45592.1																																																																																				0.473	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439349.1	NM_004703		3	53	0	0	0	0.004672	0	3	53				
TP53	7157	broad.mit.edu	37	17	7577085	7577085	+	Nonsense_Mutation	SNP	C	C	A	rs112431538		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:7577085C>A	ENST00000269305.4	-	8	1042	c.853G>T	c.(853-855)Gag>Tag	p.E285*	TP53_ENST00000359597.4_Nonsense_Mutation_p.E285*|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Nonsense_Mutation_p.E285*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E285*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E285*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	285	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726, ECO:0000269|PubMed:1694291}.|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E285K(111)|p.E285*(24)|p.0?(8)|p.E285Q(4)|p.?(2)|p.R283fs*16(2)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.G279fs*59(1)|p.R283fs*56(1)|p.E285fs*20(1)|p.E285fs*13(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCTCTTCCTCTGTGCGCCGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		165	Substitution - Missense(115)|Substitution - Nonsense(24)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	p.E285K(95)|p.E285*(16)|p.E285V(13)|p.0?(7)|p.E285Q(4)|p.E285E(3)|p.E285G(3)|p.E285A(2)|p.?(2)|p.R283fs*16(2)|p.E285_N288delEEEN(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.V272_K292del21(1)|p.R283fs*59(1)|p.C275fs*20(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.E285fs*20(1)	urinary_tract(53)|breast(18)|large_intestine(15)|lung(11)|upper_aerodigestive_tract(10)|stomach(8)|haematopoietic_and_lymphoid_tissue(8)|central_nervous_system(6)|oesophagus(6)|liver(6)|skin(5)|prostate(4)|bone(4)|biliary_tract(3)|ovary(3)|adrenal_gland(1)|soft_tissue(1)|eye(1)|pancreas(1)|thyroid(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM995136	TP53	M	rs112431538	c.(853-855)GAG>TAG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							91.0	78.0	82.0					17																	7577085		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577085C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.853G>T	17.37:g.7577085C>A	ENSP00000269305:p.Glu285*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.E285*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.E153*|TP53_uc010cng.1_Nonsense_Mutation_p.E153*|TP53_uc002gii.1_Nonsense_Mutation_p.E153*|TP53_uc010cnh.1_Nonsense_Mutation_p.E285*|TP53_uc010cni.1_Nonsense_Mutation_p.E285*|TP53_uc002gij.2_Nonsense_Mutation_p.E285*	p.E285*	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1047	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	285		E -> K (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.853G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	36	5.741087	0.96873	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-38.0538	15.807	0.78520	0.0:1.0:0.0:0.0	.	.	.	.	X	285;285;285;285;285;274;153	.	ENSP00000269305:E285X	E	-	1	0	TP53	7517810	1.000000	0.71417	0.900000	0.35374	0.716000	0.41182	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAG		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		33	22	1	0	2.08457e-15	0.010818	2.37596e-15	33	22				
PIP4K2B	8396	broad.mit.edu	37	17	36935652	36935652	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:36935652C>T	ENST00000269554.3	-	5	1118	c.638G>A	c.(637-639)cGc>cAc	p.R213H	PIP4K2B_ENST00000311500.6_5'UTR	NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	213	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)	p.R213H(1)		endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						GTCATACTTGCGATGCACAGT	0.552																																							uc002hqs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(637-639)CGC>CAC		phosphatidylinositol-5-phosphate 4-kinase, type							173.0	142.0	152.0					17																	36935652		2203	4300	6503	SO:0001583	missense	8396				cell surface receptor linked signaling pathway	endoplasmic reticulum membrane|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|receptor signaling protein activity	g.chr17:36935652C>T	U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.638G>A	17.37:g.36935652C>T	ENSP00000269554:p.Arg213His		Somatic				PIP4K2B_uc010wdt.1_Missense_Mutation_p.R213H|PIP4K2B_uc010wdu.1_Missense_Mutation_p.R149H	p.R213H	NM_003559	NP_003550	WXS	Illumina HiSeq	Unspecified	P78356	PI42B_HUMAN			5	1119	-			213			PIPK.		Q5U0E8|Q8TBP2	Missense_Mutation	SNP	ENST00000269554.3	37	c.638G>A	CCDS11329.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.879734	0.91740	.	.	ENSG00000141720	ENST00000269554;ENST00000311500	T	0.38722	1.12	5.1	5.1	0.69264	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.66934	0.2840	M	0.83312	2.635	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.999;0.999	P;P;D	0.67725	0.838;0.75;0.953	T	0.71368	-0.4614	10	0.62326	D	0.03	-15.9524	17.237	0.87001	0.0:1.0:0.0:0.0	.	213;213;213	C9JMM2;P78356-2;P78356	.;.;PI42B_HUMAN	H	213	ENSP00000269554:R213H	ENSP00000269554:R213H	R	-	2	0	PIP4K2B	34189178	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.326000	0.59241	2.649000	0.89929	0.655000	0.94253	CGC		0.552	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256791.1	NM_003559		4	139	0	0	0	0.001168	0	4	139				
MED13	9969	broad.mit.edu	37	17	60040305	60040305	+	Silent	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:60040305G>T	ENST00000397786.2	-	21	4948	c.4872C>A	c.(4870-4872)atC>atA	p.I1624I		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1624					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.I1624I(1)		breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CATCTGTGGGGATTCCCACTT	0.388																																							uc002izo.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(4870-4872)ATC>ATA		mediator complex subunit 13							111.0	108.0	109.0					17																	60040305		1861	4108	5969	SO:0001819	synonymous_variant	9969				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:60040305G>T	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.4872C>A	17.37:g.60040305G>T			Somatic					p.I1624I	NM_005121	NP_005112	WXS	Illumina HiSeq	Unspecified	Q9UHV7	MED13_HUMAN			21	4949	-			1624					B2RU05|O60334	Silent	SNP	ENST00000397786.2	37	c.4872C>A	CCDS42366.1																																																																																				0.388	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121		41	156	1	0	5.44703e-19	0.009718	6.41539e-19	41	156				
CEP95	90799	broad.mit.edu	37	17	62504728	62504728	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:62504728A>G	ENST00000556440.2	+	2	548	c.38A>G	c.(37-39)aAt>aGt	p.N13S	CEP95_ENST00000553412.1_5'UTR|DDX5_ENST00000450599.2_5'Flank|DDX5_ENST00000578804.1_5'Flank|CEP95_ENST00000581056.1_Missense_Mutation_p.N13S|DDX5_ENST00000225792.5_5'Flank	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	13						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)		p.N13S(2)		endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						ACCATTGCCAATAACCTTCTT	0.348																																							uc002jem.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(37-39)AAT>AGT		coiled-coil domain containing 45							93.0	88.0	89.0					17																	62504728		1836	4092	5928	SO:0001583	missense	90799					centrosome|spindle pole	protein binding	g.chr17:62504728A>G	AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.38A>G	17.37:g.62504728A>G	ENSP00000450461:p.Asn13Ser		Somatic				CCDC45_uc002jen.2_RNA|CCDC45_uc010wqb.1_5'UTR|DDX5_uc010deh.2_5'Flank|DDX5_uc002jek.2_5'Flank|DDX5_uc002jej.2_5'Flank|DDX5_uc010wqa.1_5'Flank	p.N13S	NM_138363	NP_612372	WXS	Illumina HiSeq	Unspecified	Q96GE4	CEP95_HUMAN	BRCA - Breast invasive adenocarcinoma(8;8.6e-12)		2	96	+	Breast(5;1.32e-14)		13					B4DMD2|Q96M81	Missense_Mutation	SNP	ENST00000556440.2	37	c.38A>G	CCDS45763.1	.	.	.	.	.	.	.	.	.	.	A	12.64	1.997373	0.35226	.	.	ENSG00000258890	ENST00000553956;ENST00000556440	T;D	0.98150	1.53;-4.75	5.43	4.36	0.52297	.	0.045428	0.85682	N	0.000000	D	0.96555	0.8876	M	0.78801	2.425	0.80722	D	1	B	0.32245	0.361	B	0.31946	0.138	D	0.94984	0.8128	10	0.87932	D	0	-14.4857	11.0042	0.47624	0.9273:0.0:0.0727:0.0	.	13	Q96GE4	CEP95_HUMAN	S	13	ENSP00000452317:N13S;ENSP00000450461:N13S	ENSP00000438458:N13S	N	+	2	0	CEP95	59935190	1.000000	0.71417	1.000000	0.80357	0.354000	0.29330	6.525000	0.73795	0.921000	0.36994	0.459000	0.35465	AAT		0.348	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2	NM_138363		22	48	0	0	0	0.014323	0	22	48				
TBC1D16	125058	broad.mit.edu	37	17	77915948	77915948	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:77915948C>T	ENST00000310924.2	-	11	2081	c.1966G>A	c.(1966-1968)Gtc>Atc	p.V656I	TBC1D16_ENST00000340848.7_Missense_Mutation_p.V294I|TBC1D16_ENST00000576768.1_Missense_Mutation_p.V281I	NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	656							Rab GTPase activator activity (GO:0005097)	p.V656I(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			TGCTCGATGACGTCATCCCCG	0.612																																					Ovarian(14;397 562 4850 31922 49378)	Ovarian(14;397 562 4850 31922 49378)	uc002jxj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1966-1968)GTC>ATC		TBC1 domain family, member 16							73.0	47.0	56.0					17																	77915948		2202	4300	6502	SO:0001583	missense	125058					intracellular	Rab GTPase activator activity	g.chr17:77915948C>T	AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.1966G>A	17.37:g.77915948C>T	ENSP00000309794:p.Val656Ile		Somatic				TBC1D16_uc002jxh.2_Missense_Mutation_p.V294I|TBC1D16_uc002jxi.2_Missense_Mutation_p.V281I	p.V656I	NM_019020	NP_061893	WXS	Illumina HiSeq	Unspecified	Q8TBP0	TBC16_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)		11	2082	-	all_neural(118;0.167)		656					B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Missense_Mutation	SNP	ENST00000310924.2	37	c.1966G>A	CCDS11766.1	.	.	.	.	.	.	.	.	.	.	C	14.55	2.567442	0.45694	.	.	ENSG00000167291	ENST00000340848;ENST00000310924	T;T	0.13901	2.55;2.55	4.55	3.57	0.40892	Rab-GAP/TBC domain (2);	0.271872	0.36482	N	0.002572	T	0.26521	0.0648	L	0.48935	1.535	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.68192	0.945;0.945;0.956	T	0.00742	-1.1585	10	0.31617	T	0.26	-42.7584	12.4138	0.55481	0.0:0.9169:0.0:0.0831	.	656;656;294	Q8TBP0;B9A6L7;Q8N3Z4	TBC16_HUMAN;.;.	I	294;656	ENSP00000341517:V294I;ENSP00000309794:V656I	ENSP00000309794:V656I	V	-	1	0	TBC1D16	75530543	1.000000	0.71417	0.849000	0.33467	0.817000	0.46193	5.434000	0.66526	0.881000	0.35993	0.484000	0.47621	GTC		0.612	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437145.1	NM_019020		5	18	0	0	0	0.001168	0	5	18				
BAHCC1	57597	broad.mit.edu	37	17	79409981	79409981	+	Missense_Mutation	SNP	C	C	T	rs530051904		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:79409981C>T	ENST00000307745.7	+	9	1606	c.1606C>T	c.(1606-1608)Cca>Tca	p.P536S															p.P536S(1)									GGCCGGCCCCCCAGGGGCACA	0.692													c|||	1	0.000199681	0.0	0.0	5008	,	,		14644	0.001		0.0	False		,,,				2504	0.0						uc002kaf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1606-1608)CCA>TCA		BAH domain and coiled-coil containing 1							13.0	16.0	15.0					17																	79409981		1843	4058	5901	SO:0001583	missense	57597						DNA binding	g.chr17:79409981C>T																												ENST00000307745.7:c.1606C>T	17.37:g.79409981C>T	ENSP00000303486:p.Pro536Ser		Somatic				BAHCC1_uc002kae.2_5'Flank	p.P536S	NM_001080519	NP_001073988	WXS	Illumina HiSeq	Unspecified	Q9P281	BAHC1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)		3	1606	+	all_neural(118;0.0804)|Melanoma(429;0.242)		536						Missense_Mutation	SNP	ENST00000307745.7	37	c.1606C>T		.	.	.	.	.	.	.	.	.	.	c	12.83	2.056931	0.36277	.	.	ENSG00000171282	ENST00000307745	T	0.11063	2.81	4.08	4.08	0.47627	.	.	.	.	.	T	0.15998	0.0385	N	0.19112	0.55	0.21256	N	0.999746	D	0.61697	0.99	P	0.60068	0.868	T	0.26950	-1.0088	9	0.22706	T	0.39	.	15.2241	0.73336	0.0:1.0:0.0:0.0	.	536	Q9P281	BAHC1_HUMAN	S	536	ENSP00000303486:P536S	ENSP00000303486:P536S	P	+	1	0	AC110285.1	77024576	0.006000	0.16342	0.033000	0.17914	0.020000	0.10135	0.287000	0.18920	2.110000	0.64415	0.457000	0.33378	CCA		0.692	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				20	12	0	0	0	0.014323	0	20	12				
P4HB	5034	broad.mit.edu	37	17	79804869	79804869	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr17:79804869C>T	ENST00000331483.4	-	6	1031	c.809G>A	c.(808-810)gGc>gAc	p.G270D	P4HB_ENST00000576390.1_Intron|P4HB_ENST00000472244.1_5'UTR|P4HB_ENST00000439918.2_Missense_Mutation_p.G226D	NM_000918.3	NP_000909.2	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta polypeptide	270					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein folding (GO:0006457)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|procollagen-proline 4-dioxygenase complex (GO:0016222)	poly(A) RNA binding (GO:0044822)|procollagen-proline 4-dioxygenase activity (GO:0004656)|protein disulfide isomerase activity (GO:0003756)	p.G270D(1)		NS(1)|breast(1)|large_intestine(2)|lung(17)|urinary_tract(1)	22	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			GCTCAGTTTGCCGTCATAGTC	0.507																																					Colon(49;444 983 1296 7887 42561)	Colon(49;444 983 1296 7887 42561)	uc002kbn.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(808-810)GGC>GAC		prolyl 4-hydroxylase, beta subunit precursor							232.0	235.0	234.0					17																	79804869		2203	4298	6501	SO:0001583	missense	5034				cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity	g.chr17:79804869C>T	J02783	CCDS11787.1	17q25	2011-10-19	2008-12-09		ENSG00000185624	ENSG00000185624	1.14.11.2, 5.3.4.1	"""Protein disulfide isomerases"""	8548	protein-coding gene	gene with protein product	"""protein disulfide isomerase-associated 1"", ""protein disulfide isomerase family A, member 1"", ""collagen prolyl 4-hydroxylase beta"""	176790	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase-associated 1)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide"""	PO4DB, ERBA2L		8111381	Standard	NM_000918		Approved	PDIA1, PROHB, DSI, GIT, PDI, PO4HB, P4Hbeta	uc002kbn.1	P07237	OTTHUMG00000150269	ENST00000331483.4:c.809G>A	17.37:g.79804869C>T	ENSP00000327801:p.Gly270Asp		Somatic				P4HB_uc002kbl.1_5'UTR|P4HB_uc002kbm.1_5'UTR	p.G270D	NM_000918	NP_000909	WXS	Illumina HiSeq	Unspecified	P07237	PDIA1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)		6	1006	-	all_neural(118;0.0878)|Ovarian(332;0.12)		270					B2RDQ2|P30037|P32079|Q15205|Q6LDE5	Missense_Mutation	SNP	ENST00000331483.4	37	c.809G>A	CCDS11787.1	.	.	.	.	.	.	.	.	.	.	C	5.760	0.324650	0.10900	.	.	ENSG00000185624	ENST00000331483;ENST00000537205;ENST00000436463	T	0.27402	1.67	5.77	3.37	0.38596	Thioredoxin-like fold (1);	0.532850	0.22932	N	0.053898	T	0.09992	0.0245	N	0.01789	-0.72	0.09310	N	0.999998	B	0.02656	0.0	B	0.06405	0.002	T	0.30208	-0.9986	10	0.12766	T	0.61	.	7.4573	0.27274	0.0:0.6679:0.1477:0.1844	.	270	P07237	PDIA1_HUMAN	D	270;213;254	ENSP00000327801:G270D	ENSP00000327801:G270D	G	-	2	0	P4HB	77398158	0.035000	0.19736	0.680000	0.29994	0.545000	0.35147	0.530000	0.23036	1.392000	0.46585	0.650000	0.86243	GGC		0.507	P4HB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317250.3	NM_000918		6	409	0	0	0	0.001168	0	6	409				
CCDC178	374864	broad.mit.edu	37	18	30791980	30791980	+	Silent	SNP	T	T	A	rs61749300		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr18:30791980T>A	ENST00000383096.3	-	20	2300	c.2118A>T	c.(2116-2118)gcA>gcT	p.A706A	CCDC178_ENST00000583930.1_Silent_p.A706A|CCDC178_ENST00000579947.1_Silent_p.A706A|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000403303.1_Silent_p.A706A|CCDC178_ENST00000300227.8_Silent_p.A668A|CCDC178_ENST00000402325.1_Silent_p.A706A|CCDC178_ENST00000406524.2_Silent_p.A706A			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	706								p.A668A(1)|p.A706A(1)									ACACAGTTTGTGCATGTTCCC	0.323																																							uc002kxn.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2116-2118)GCA>GCT		hypothetical protein LOC374864 isoform 1							83.0	79.0	80.0					18																	30791980		2200	4298	6498	SO:0001819	synonymous_variant	374864							g.chr18:30791980T>A	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.2118A>T	18.37:g.30791980T>A			Somatic				C18orf34_uc010dme.1_Silent_p.A220A|C18orf34_uc010xbr.1_Silent_p.A706A|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Silent_p.A668A|C18orf34_uc002kxp.2_Silent_p.A706A	p.A706A	NM_001105528	NP_001098998	WXS	Illumina HiSeq	Unspecified	Q5BJE1	CR034_HUMAN			19	2260	-			706					A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Silent	SNP	ENST00000383096.3	37	c.2118A>T	CCDS42424.1																																																																																				0.323	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		7	27	0	0	0	0.00308	0	7	27				
RPSAP58	388524	broad.mit.edu	37	19	24010294	24010294	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr19:24010294C>G	ENST00000496398.1	+	4	754	c.331C>G	c.(331-333)Cag>Gag	p.Q111E	RPSAP58_ENST00000354585.4_Missense_Mutation_p.Q111E|RP11-255H23.4_ENST00000599944.1_lincRNA|RP11-255H23.2_ENST00000471224.1_RNA					ribosomal protein SA pseudogene 58									p.Q111E(12)		endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						CTTCACTAACCAGATCCAGGC	0.567																																							uc002nrn.2		NA																	12	Substitution - Missense(12)		kidney(6)|urinary_tract(2)|prostate(2)|endometrium(2)		0						c.(331-333)CAG>GAG		ribosomal protein SA																																				SO:0001583	missense	388524							g.chr19:24010294C>G			19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.331C>G	19.37:g.24010294C>G	ENSP00000417240:p.Gln111Glu		Somatic					p.Q111E	NM_002295	NP_002286	WXS	Illumina HiSeq	Unspecified					4	754	+									Missense_Mutation	SNP	ENST00000496398.1	37	c.331C>G		.	.	.	.	.	.	.	.	.	.	.	13.90	2.375690	0.42105	.	.	ENSG00000205246	ENST00000496398;ENST00000354585	T;T	0.21932	1.98;1.98	2.52	2.52	0.30459	.	0.000000	0.64402	U	0.000001	T	0.17619	0.0423	.	.	.	0.48830	D	0.999718	B	0.34226	0.443	B	0.32624	0.149	T	0.11084	-1.0602	9	0.72032	D	0.01	.	10.8987	0.47038	0.0:1.0:0.0:0.0	.	111	A6NE09	.	E	111	ENSP00000417240:Q111E;ENSP00000346598:Q111E	ENSP00000346598:Q111E	Q	+	1	0	RPSAP58	23802134	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	4.812000	0.62613	1.477000	0.48234	0.627000	0.83407	CAG		0.567	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350238.1	NR_003662		3	49	0	0	0	0.004672	0	3	49				
GYS1	2997	broad.mit.edu	37	19	49494725	49494725	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr19:49494725G>T	ENST00000323798.3	-	2	330	c.134C>A	c.(133-135)aCg>aAg	p.T45K	GYS1_ENST00000263276.6_Missense_Mutation_p.T45K|RUVBL2_ENST00000601968.1_5'Flank|GYS1_ENST00000544287.1_Intron|GYS1_ENST00000540532.1_Intron|GYS1_ENST00000541188.1_Intron|RUVBL2_ENST00000413176.2_5'Flank|RUVBL2_ENST00000595090.1_5'Flank|GYS1_ENST00000457974.1_5'UTR	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	45					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)	p.T45K(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		CTGCAGCACCGTGTAGATGCC	0.672																																							uc002plp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(133-135)ACG>AAG		glycogen synthase 1 (muscle) isoform 1							105.0	117.0	113.0					19																	49494725		2203	4300	6503	SO:0001583	missense	2997				glucose metabolic process|glycogen biosynthetic process	cytosol	glycogen (starch) synthase activity|protein binding	g.chr19:49494725G>T		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.134C>A	19.37:g.49494725G>T	ENSP00000317904:p.Thr45Lys		Somatic				GYS1_uc010xzy.1_Intron|GYS1_uc010emm.2_Missense_Mutation_p.T45K|GYS1_uc010xzz.1_Intron|GYS1_uc010yaa.1_Intron|RUVBL2_uc002plq.1_5'Flank|RUVBL2_uc010yab.1_5'Flank|RUVBL2_uc002plr.1_5'Flank|RUVBL2_uc002pls.1_5'Flank|RUVBL2_uc010emn.1_5'Flank	p.T45K	NM_002103	NP_002094	WXS	Illumina HiSeq	Unspecified	P13807	GYS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)	2	375	-		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)	45					Q9BTT9	Missense_Mutation	SNP	ENST00000323798.3	37	c.134C>A	CCDS12747.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971264	0.92919	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000457974	T;T	0.75821	-0.27;-0.97	4.78	4.78	0.61160	.	0.103133	0.64402	D	0.000004	D	0.88636	0.6490	M	0.91612	3.225	0.36641	D	0.876833	D;P	0.69078	0.997;0.943	D;P	0.79784	0.993;0.844	D	0.93088	0.6497	10	0.87932	D	0	-17.1897	15.6819	0.77376	0.0:0.0:1.0:0.0	.	45;45	Q9BTT9;P13807	.;GYS1_HUMAN	K	45;45;44	ENSP00000317904:T45K;ENSP00000263276:T45K	ENSP00000263276:T45K	T	-	2	0	GYS1	54186537	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.176000	0.94839	2.381000	0.81170	0.591000	0.81541	ACG		0.672	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103		14	108	1	0	2.32078e-09	0.003163	2.53612e-09	14	108				
SIGLEC9	27180	broad.mit.edu	37	19	51630513	51630513	+	Silent	SNP	T	T	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr19:51630513T>A	ENST00000250360.3	+	4	1042	c.975T>A	c.(973-975)ccT>ccA	p.P325P	SIGLEC9_ENST00000440804.3_Silent_p.P325P	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	325	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.P325P(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CTCAGAACCCTCTCGGCTCTC	0.612																																							uc002pvu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(973-975)CCT>CCA		sialic acid binding Ig-like lectin 9 precursor							31.0	30.0	30.0					19																	51630513		2203	4300	6503	SO:0001819	synonymous_variant	27180				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding	g.chr19:51630513T>A	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.975T>A	19.37:g.51630513T>A			Somatic				SIGLEC9_uc010yct.1_Silent_p.P325P	p.P325P	NM_014441	NP_055256	WXS	Illumina HiSeq	Unspecified	Q9Y336	SIGL9_HUMAN		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)	4	1042	+		all_neural(266;0.0529)	325			Extracellular (Potential).|Ig-like C2-type 2.		Q6GTU4|Q9BYI9	Silent	SNP	ENST00000250360.3	37	c.975T>A	CCDS12825.1																																																																																				0.612	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441		6	14	0	0	0	0.001168	0	6	14				
NLRP4	147945	broad.mit.edu	37	19	56382251	56382251	+	Missense_Mutation	SNP	C	C	G	rs144714657		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr19:56382251C>G	ENST00000301295.6	+	7	2835	c.2413C>G	c.(2413-2415)Cgt>Ggt	p.R805G	NLRP4_ENST00000346986.5_Missense_Mutation_p.R749G|NLRP4_ENST00000587891.1_Missense_Mutation_p.R730G	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	805					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.R805G(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		AATGCTTCTGCGTAACAAGAG	0.522																																							uc002qmd.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15						c.(2413-2415)CGT>GGT		NLR family, pyrin domain containing 4							173.0	144.0	154.0					19																	56382251		2203	4300	6503	SO:0001583	missense	147945						ATP binding	g.chr19:56382251C>G	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2413C>G	19.37:g.56382251C>G	ENSP00000301295:p.Arg805Gly		Somatic				NLRP4_uc002qmf.2_Missense_Mutation_p.R730G|NLRP4_uc010etf.2_Missense_Mutation_p.R580G	p.R805G	NM_134444	NP_604393	WXS	Illumina HiSeq	Unspecified	Q96MN2	NALP4_HUMAN		GBM - Glioblastoma multiforme(193;0.0606)	7	2835	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	805					Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	c.2413C>G	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	5.301	0.240906	0.10077	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.53206	0.63;2.49	3.62	-7.08	0.01558	.	.	.	.	.	T	0.24736	0.0600	L	0.31752	0.955	0.09310	N	1	B;B;B	0.25312	0.077;0.123;0.045	B;B;B	0.28011	0.068;0.085;0.024	T	0.25676	-1.0125	9	0.22706	T	0.39	.	0.4498	0.00499	0.3981:0.2321:0.1473:0.2225	.	749;730;805	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	G	805;749	ENSP00000301295:R805G;ENSP00000344787:R749G	ENSP00000301295:R805G	R	+	1	0	NLRP4	61074063	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.293000	0.00258	-1.593000	0.01617	-0.310000	0.09108	CGT		0.522	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444		25	39	0	0	0	0.003954	0	25	39				
NCOA1	8648	broad.mit.edu	37	2	24930566	24930566	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr2:24930566T>G	ENST00000406961.1	+	13	2879	c.2227T>G	c.(2227-2229)Tca>Gca	p.S743A	NCOA1_ENST00000348332.3_Missense_Mutation_p.S743A|NCOA1_ENST00000538539.1_Missense_Mutation_p.S743A|NCOA1_ENST00000395856.3_Missense_Mutation_p.S743A|NCOA1_ENST00000288599.5_Missense_Mutation_p.S743A|NCOA1_ENST00000405141.1_Missense_Mutation_p.S743A|NCOA1_ENST00000407230.1_Missense_Mutation_p.S592A			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	743					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.S743A(2)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAAAAAGAATCAAAAGACCA	0.383			T	PAX3	alveolar rhadomyosarcoma																																		uc002rfk.2		NA		Dom	yes		2	2p23	8648	T	nuclear receptor coactivator 1			M	PAX3		alveolar rhadomyosarcoma	PAX3/NCOA1(8)	2	Substitution - Missense(2)		lung(2)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11						c.(2227-2229)TCA>GCA		nuclear receptor coactivator 1 isoform 1							83.0	78.0	80.0					2																	24930566		2203	4300	6503	SO:0001583	missense	8648							g.chr2:24930566T>G	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.2227T>G	2.37:g.24930566T>G	ENSP00000385216:p.Ser743Ala		Somatic				NCOA1_uc010eye.2_Missense_Mutation_p.S743A|NCOA1_uc002rfi.2_Missense_Mutation_p.S592A|NCOA1_uc002rfj.2_Missense_Mutation_p.S743A|NCOA1_uc002rfl.2_Missense_Mutation_p.S743A	p.S743A	NM_003743	NP_003734	WXS	Illumina HiSeq	Unspecified	Q15788	NCOA1_HUMAN			11	2485	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		743					O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	c.2227T>G	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	T	11.29	1.594742	0.28445	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.01947	4.65;4.65;4.54;4.65;4.65;4.65;4.65	6.04	4.9	0.64082	.	0.566156	0.18200	N	0.148552	T	0.01320	0.0043	N	0.08118	0	0.29551	N	0.851381	B;B;B;B	0.28850	0.225;0.144;0.225;0.131	B;B;B;B	0.27262	0.078;0.035;0.078;0.058	T	0.42716	-0.9435	10	0.12766	T	0.61	.	8.1563	0.31171	0.0:0.0708:0.1363:0.7928	.	743;743;743;592	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	A	743;743;592;743;743;743;743	ENSP00000385216:S743A;ENSP00000385097:S743A;ENSP00000385195:S592A;ENSP00000444039:S743A;ENSP00000320940:S743A;ENSP00000288599:S743A;ENSP00000379197:S743A	ENSP00000288599:S743A	S	+	1	0	NCOA1	24784070	0.891000	0.30450	1.000000	0.80357	0.997000	0.91878	1.385000	0.34408	2.317000	0.78254	0.460000	0.39030	TCA		0.383	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223		24	34	0	0	0	0.014323	0	24	34				
XDH	7498	broad.mit.edu	37	2	31598368	31598368	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr2:31598368G>A	ENST00000379416.3	-	15	1528	c.1480C>T	c.(1480-1482)Ctg>Ttg	p.L494L		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	494					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)	p.L494L(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GGCAGATGCAGCTCCTCTGCC	0.627																																					Colon(66;682 1445 30109 40147)	Colon(66;682 1445 30109 40147)	uc002rnv.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8						c.(1480-1482)CTG>TTG		xanthine dehydrogenase	Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)						70.0	63.0	65.0					2																	31598368		2203	4300	6503	SO:0001819	synonymous_variant	7498				purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity	g.chr2:31598368G>A	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.1480C>T	2.37:g.31598368G>A			Somatic					p.L494L	NM_000379	NP_000370	WXS	Illumina HiSeq	Unspecified	P47989	XDH_HUMAN			15	1559	-	Acute lymphoblastic leukemia(172;0.155)		494					Q16681|Q16712|Q4PJ16	Silent	SNP	ENST00000379416.3	37	c.1480C>T	CCDS1775.1																																																																																				0.627	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379		22	26	0	0	0	0.012319	0	22	26				
SLC25A12	8604	broad.mit.edu	37	2	172644412	172644412	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr2:172644412G>A	ENST00000422440.2	-	16	1668	c.1631C>T	c.(1630-1632)aCa>aTa	p.T544I	SLC25A12_ENST00000392592.4_Missense_Mutation_p.T437I	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	544					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)	p.T544I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	CTGCAGTCTTGTCTTGATGAC	0.493																																							uc002uhh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1630-1632)ACA>ATA		solute carrier family 25, member 12	L-Aspartic Acid(DB00128)						53.0	53.0	53.0					2																	172644412		2203	4300	6503	SO:0001583	missense	8604				gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding	g.chr2:172644412G>A	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1631C>T	2.37:g.172644412G>A	ENSP00000388658:p.Thr544Ile		Somatic				SLC25A12_uc010fqh.2_Missense_Mutation_p.T437I	p.T544I	NM_003705	NP_003696	WXS	Illumina HiSeq	Unspecified	O75746	CMC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.216)		16	1720	-			544			Solcar 3.		B3KR64|Q96AM8	Missense_Mutation	SNP	ENST00000422440.2	37	c.1631C>T	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	G	33	5.267172	0.95399	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	D;D	0.82433	-1.61;-1.61	5.6	5.6	0.85130	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.91952	0.7451	M	0.81239	2.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92253	0.5810	10	0.87932	D	0	-13.9328	19.9823	0.97331	0.0:0.0:1.0:0.0	.	437;544	B3KR64;O75746	.;CMC1_HUMAN	I	544;437	ENSP00000388658:T544I;ENSP00000376371:T437I	ENSP00000376371:T437I	T	-	2	0	SLC25A12	172352658	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.809000	0.99208	2.788000	0.95919	0.650000	0.86243	ACA		0.493	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705		10	21	0	0	0	0.001855	0	10	21				
MYO1B	4430	broad.mit.edu	37	2	192225432	192225432	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr2:192225432C>G	ENST00000392318.3	+	8	885	c.638C>G	c.(637-639)tCt>tGt	p.S213C	MYO1B_ENST00000304164.4_Missense_Mutation_p.S213C|MYO1B_ENST00000339514.4_Missense_Mutation_p.S213C|MYO1B_ENST00000392316.1_Missense_Mutation_p.S213C	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	213	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.S213C(2)		NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			CAGCTGCTCTCTGGTGCCTCT	0.413																																							uc010fsg.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|large_intestine(2)|ovary(1)	8						c.(637-639)TCT>TGT		myosin IB isoform 1							194.0	187.0	189.0					2																	192225432		2203	4300	6503	SO:0001583	missense	4430					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr2:192225432C>G	L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.638C>G	2.37:g.192225432C>G	ENSP00000376132:p.Ser213Cys		Somatic				MYO1B_uc002usq.2_Missense_Mutation_p.S213C|MYO1B_uc002usr.2_Missense_Mutation_p.S213C|MYO1B_uc002uss.1_Missense_Mutation_p.S213C	p.S213C	NM_001130158	NP_001123630	WXS	Illumina HiSeq	Unspecified	O43795	MYO1B_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)		8	893	+			213			Myosin head-like.		O43794|Q7Z6L5	Missense_Mutation	SNP	ENST00000392318.3	37	c.638C>G	CCDS46477.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.369914	0.61624	.	.	ENSG00000128641	ENST00000339514;ENST00000439452;ENST00000392318;ENST00000304164;ENST00000451437;ENST00000392316	D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37	5.71	5.71	0.89125	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.86838	0.6029	L	0.42686	1.345	0.80722	D	1	B;B	0.21452	0.056;0.011	B;B	0.27608	0.081;0.033	T	0.82468	-0.0442	10	0.44086	T	0.13	.	18.0408	0.89318	0.0:1.0:0.0:0.0	.	213;213	O43795;O43795-2	MYO1B_HUMAN;.	C	213	ENSP00000341903:S213C;ENSP00000376132:S213C;ENSP00000306382:S213C;ENSP00000388140:S213C;ENSP00000376130:S213C	ENSP00000306382:S213C	S	+	2	0	MYO1B	191933677	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.115000	0.77110	2.681000	0.91329	0.655000	0.94253	TCT		0.413	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223		90	112	0	0	0	0.01441	0	90	112				
SPAG4	6676	broad.mit.edu	37	20	34207180	34207180	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr20:34207180G>A	ENST00000374273.3	+	9	969	c.857G>A	c.(856-858)tGg>tAg	p.W286*		NM_003116.1	NP_003107.1	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	286	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|motile cilium (GO:0031514)	structural molecule activity (GO:0005198)	p.W286*(1)		NS(1)|cervix(5)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			GCCTACTTCTGGAATCGCTTC	0.597																																							uc002xdb.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(856-858)TGG>TAG		sperm associated antigen 4							121.0	120.0	121.0					20																	34207180		2203	4300	6503	SO:0001587	stop_gained	6676				spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity	g.chr20:34207180G>A	AF043344	CCDS13259.1	20q11.2	2010-04-23			ENSG00000061656	ENSG00000061656			11214	protein-coding gene	gene with protein product	"""acrosomal protein ACR55"", ""Sad1 and UNC84 domain containing 4"", ""cancer/testis antigen 127"""	603038				9691178, 10373309	Standard	NM_003116		Approved	SUN4, CT127	uc002xdb.1	Q9NPE6	OTTHUMG00000032352	ENST00000374273.3:c.857G>A	20.37:g.34207180G>A	ENSP00000363391:p.Trp286*		Somatic				SPAG4_uc010zvi.1_Nonsense_Mutation_p.W209*	p.W286*	NM_003116	NP_003107	WXS	Illumina HiSeq	Unspecified	Q9NPE6	SPAG4_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.0127)		9	974	+	Lung NSC(9;0.0053)|all_lung(11;0.00785)		286			SUN.		O43648	Nonsense_Mutation	SNP	ENST00000374273.3	37	c.857G>A	CCDS13259.1	.	.	.	.	.	.	.	.	.	.	G	36	5.598909	0.96614	.	.	ENSG00000061656	ENST00000374273;ENST00000454819	.	.	.	4.87	4.87	0.63330	.	0.225360	0.40554	N	0.001067	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	8.0143	13.7084	0.62654	0.0:0.0:1.0:0.0	.	.	.	.	X	286;161	.	ENSP00000363391:W286X	W	+	2	0	SPAG4	33670594	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.550000	0.60733	2.695000	0.91970	0.462000	0.41574	TGG		0.597	SPAG4-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078896.1	NM_003116		27	203	0	0	0	0.010818	0	27	203				
SPAG4	6676	broad.mit.edu	37	20	34208665	34208665	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr20:34208665G>C	ENST00000374273.3	+	11	1249	c.1137G>C	c.(1135-1137)gaG>gaC	p.E379D		NM_003116.1	NP_003107.1	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	379	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|motile cilium (GO:0031514)	structural molecule activity (GO:0005198)	p.E379D(1)		NS(1)|cervix(5)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			TCGATGTTGAGAAATCGGAGA	0.507																																							uc002xdb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1135-1137)GAG>GAC		sperm associated antigen 4							104.0	112.0	109.0					20																	34208665		2203	4300	6503	SO:0001583	missense	6676				spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity	g.chr20:34208665G>C	AF043344	CCDS13259.1	20q11.2	2010-04-23			ENSG00000061656	ENSG00000061656			11214	protein-coding gene	gene with protein product	"""acrosomal protein ACR55"", ""Sad1 and UNC84 domain containing 4"", ""cancer/testis antigen 127"""	603038				9691178, 10373309	Standard	NM_003116		Approved	SUN4, CT127	uc002xdb.1	Q9NPE6	OTTHUMG00000032352	ENST00000374273.3:c.1137G>C	20.37:g.34208665G>C	ENSP00000363391:p.Glu379Asp		Somatic				SPAG4_uc010zvi.1_Missense_Mutation_p.E302D	p.E379D	NM_003116	NP_003107	WXS	Illumina HiSeq	Unspecified	Q9NPE6	SPAG4_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.0127)		11	1254	+	Lung NSC(9;0.0053)|all_lung(11;0.00785)		379			SUN.		O43648	Missense_Mutation	SNP	ENST00000374273.3	37	c.1137G>C	CCDS13259.1	.	.	.	.	.	.	.	.	.	.	G	7.371	0.626789	0.14257	.	.	ENSG00000061656	ENST00000374273;ENST00000430878	T;T	0.39406	1.08;1.08	5.22	3.23	0.37069	Sad1/UNC-like, C-terminal (2);	0.259903	0.37095	N	0.002260	T	0.27205	0.0667	N	0.20986	0.625	0.31586	N	0.654557	B	0.31655	0.334	B	0.35182	0.197	T	0.25328	-1.0135	10	0.27082	T	0.32	-28.5757	7.8716	0.29569	0.19:0.0:0.81:0.0	.	379	Q9NPE6	SPAG4_HUMAN	D	379;83	ENSP00000363391:E379D;ENSP00000399231:E83D	ENSP00000363391:E379D	E	+	3	2	SPAG4	33672079	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	0.625000	0.24477	1.418000	0.47098	0.655000	0.94253	GAG		0.507	SPAG4-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078896.1	NM_003116		20	279	0	0	0	0.012319	0	20	279				
COL6A2	1292	broad.mit.edu	37	21	47532313	47532313	+	Missense_Mutation	SNP	G	G	T	rs376139670		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr21:47532313G>T	ENST00000300527.4	+	3	640	c.536G>T	c.(535-537)cGg>cTg	p.R179L	COL6A2_ENST00000409416.1_Missense_Mutation_p.R179L|COL6A2_ENST00000310645.5_Missense_Mutation_p.R179L|COL6A2_ENST00000357838.4_Missense_Mutation_p.R179L|COL6A2_ENST00000397763.1_Missense_Mutation_p.R179L	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	179	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)		p.R179L(3)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CAGGCCGAGCGGGCCCGCGAG	0.716																																							uc002zia.1		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(7)|ovary(1)	8						c.(535-537)CGG>CTG		alpha 2 type VI collagen isoform 2C2 precursor							11.0	16.0	14.0					21																	47532313		2172	4267	6439	SO:0001583	missense	1292				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	g.chr21:47532313G>T	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.536G>T	21.37:g.47532313G>T	ENSP00000300527:p.Arg179Leu		Somatic				COL6A2_uc002zhy.1_Missense_Mutation_p.R179L|COL6A2_uc002zhz.1_Missense_Mutation_p.R179L|COL6A2_uc002zib.1_Intron	p.R179L	NM_001849	NP_001840	WXS	Illumina HiSeq	Unspecified	P12110	CO6A2_HUMAN		Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)	3	618	+	Breast(49;0.245)		179			VWFA 1.|Nonhelical region.		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	c.536G>T	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.232554	0.58777	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000436769;ENST00000409416;ENST00000397763	D;D;D;T;D;D	0.84589	-1.87;-1.87;-1.87;-1.32;-1.87;-1.87	4.34	4.34	0.51931	von Willebrand factor, type A (3);	0.311585	0.29376	N	0.012335	D	0.90614	0.7057	M	0.62723	1.935	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.997;0.995	D;D;P	0.85130	0.997;0.942;0.902	D	0.89066	0.3466	10	0.28530	T	0.3	-16.8014	17.2361	0.86999	0.0:0.0:1.0:0.0	.	179;179;179	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	L	179	ENSP00000300527:R179L;ENSP00000350497:R179L;ENSP00000312529:R179L;ENSP00000390418:R179L;ENSP00000387115:R179L;ENSP00000380870:R179L	ENSP00000300527:R179L	R	+	2	0	COL6A2	46356741	0.337000	0.24766	0.999000	0.59377	0.798000	0.45092	2.392000	0.44433	2.142000	0.66516	0.467000	0.42956	CGG		0.716	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			14	10	1	0	1.3612e-06	0.003163	1.47232e-06	14	10				
TOP3B	8940	broad.mit.edu	37	22	22323138	22323138	+	Silent	SNP	A	A	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr22:22323138A>G	ENST00000398793.2	-	7	1025	c.591T>C	c.(589-591)acT>acC	p.T197T	TOP3B_ENST00000357179.5_Silent_p.T197T|TOP3B_ENST00000413067.2_5'UTR	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	197					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)	p.T197T(2)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		GGAAATATTTAGTCTGAAACC	0.488																																							uc002zvs.2		NA																	2	Substitution - coding silent(2)		lung(2)	kidney(1)	1						c.(589-591)ACT>ACC		topoisomerase (DNA) III beta							90.0	100.0	96.0					22																	22323138		2203	4300	6503	SO:0001819	synonymous_variant	8940				DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding	g.chr22:22323138A>G	AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.591T>C	22.37:g.22323138A>G			Somatic				TOP3B_uc010gtm.1_5'Flank|TOP3B_uc002zvr.2_5'UTR|TOP3B_uc010gtl.2_Silent_p.T197T|TOP3B_uc002zvt.3_Silent_p.T197T	p.T197T	NM_003935	NP_003926	WXS	Illumina HiSeq	Unspecified	O95985	TOP3B_HUMAN		READ - Rectum adenocarcinoma(21;0.145)	7	1026	-	Colorectal(54;0.105)		197					A0M8Q3|Q9BUP5	Silent	SNP	ENST00000398793.2	37	c.591T>C	CCDS13797.1																																																																																				0.488	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320251.1	NM_003935		3	99	0	0	0	0.009096	0	3	99				
FGD5	152273	broad.mit.edu	37	3	14862467	14862467	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr3:14862467C>A	ENST00000285046.5	+	1	1999	c.1889C>A	c.(1888-1890)aCa>aAa	p.T630K	FGD5_ENST00000543601.1_Missense_Mutation_p.T389K	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	630					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.T630K(1)|p.T389K(1)		NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						AAGCCCATCACAAAGAGCTCT	0.547																																							uc003bzc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|kidney(1)|pancreas(1)	5						c.(1888-1890)ACA>AAA		FYVE, RhoGEF and PH domain containing 5							69.0	68.0	68.0					3																	14862467		1972	4148	6120	SO:0001583	missense	152273				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr3:14862467C>A	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.1889C>A	3.37:g.14862467C>A	ENSP00000285046:p.Thr630Lys		Somatic				FGD5_uc011avk.1_Missense_Mutation_p.T630K	p.T630K	NM_152536	NP_689749	WXS	Illumina HiSeq	Unspecified	Q6ZNL6	FGD5_HUMAN			1	1999	+			630					B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	c.1889C>A	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129288	0.77549	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.79141	-1.24;-1.04	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000015	D	0.88258	0.6388	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	D	0.89389	0.3687	10	0.87932	D	0	-32.3126	19.0321	0.92961	0.0:1.0:0.0:0.0	.	389;630	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	K	630;389	ENSP00000285046:T630K;ENSP00000445949:T389K	ENSP00000285046:T630K	T	+	2	0	FGD5	14837471	1.000000	0.71417	0.995000	0.50966	0.604000	0.37047	7.344000	0.79328	2.485000	0.83878	0.655000	0.94253	ACA		0.547	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536		9	36	1	0	0.00829132	0.008291	0.00861647	9	36				
DPPA4	55211	broad.mit.edu	37	3	109049557	109049557	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr3:109049557G>A	ENST00000335658.6	-	5	547	c.493C>T	c.(493-495)Cct>Tct	p.P165S	DPPA4_ENST00000478791.1_5'UTR	NM_018189.3	NP_060659.3	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	165					lung-associated mesenchyme development (GO:0060484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.P165S(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(17)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25						ACTTCAGGAGGATGTGTCTCA	0.483																																							uc003dxq.3		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(493-495)CCT>TCT		developmental pluripotency associated 4							84.0	89.0	87.0					3																	109049557		2203	4300	6503	SO:0001583	missense	55211					nucleus	protein binding	g.chr3:109049557G>A	AK001575	CCDS33814.1	3q13.13	2014-01-28			ENSG00000121570	ENSG00000121570			19200	protein-coding gene	gene with protein product		614125					Standard	NM_018189		Approved	FLJ10713	uc003dxq.4	Q7L190	OTTHUMG00000159222	ENST00000335658.6:c.493C>T	3.37:g.109049557G>A	ENSP00000335306:p.Pro165Ser		Somatic				DPPA4_uc011bho.1_Intron|DPPA4_uc011bhp.1_Missense_Mutation_p.P165S	p.P165S	NM_018189	NP_060659	WXS	Illumina HiSeq	Unspecified	Q7L190	DPPA4_HUMAN			5	548	-			165					A8K4M7|Q9H9N5|Q9NVI6	Missense_Mutation	SNP	ENST00000335658.6	37	c.493C>T	CCDS33814.1	.	.	.	.	.	.	.	.	.	.	G	7.473	0.646981	0.14516	.	.	ENSG00000121570	ENST00000335658	T	0.25085	1.82	3.9	-0.196	0.13232	.	0.385759	0.22556	N	0.058524	T	0.10423	0.0255	N	0.17474	0.49	0.09310	N	1	P;B	0.42692	0.787;0.386	B;B	0.36186	0.219;0.131	T	0.23297	-1.0192	9	.	.	.	0.0	4.5118	0.11915	0.2098:0.3551:0.4351:0.0	.	155;165	B7Z5Q7;Q7L190	.;DPPA4_HUMAN	S	165	ENSP00000335306:P165S	.	P	-	1	0	DPPA4	110532247	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.067000	0.14510	-0.049000	0.13379	0.563000	0.77884	CCT		0.483	DPPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353897.1	NM_018189		36	58	0	0	0	0.004289	0	36	58				
TTC14	151613	broad.mit.edu	37	3	180320181	180320181	+	Silent	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr3:180320181C>T	ENST00000296015.4	+	1	264	c.132C>T	c.(130-132)ggC>ggT	p.G44G	RP11-496B10.3_ENST00000472596.1_lincRNA|TTC14_ENST00000412756.2_Silent_p.G44G|TTC14_ENST00000382584.4_Silent_p.G44G	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	44							RNA binding (GO:0003723)	p.G44G(1)		endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CAGCCCGGGGCCCGCCGCCCC	0.672																																							uc003fkk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(130-132)GGC>GGT		tetratricopeptide repeat domain 14 isoform a							14.0	15.0	14.0					3																	180320181		2200	4294	6494	SO:0001819	synonymous_variant	151613						RNA binding	g.chr3:180320181C>T	AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.132C>T	3.37:g.180320181C>T			Somatic				TTC14_uc003fkl.2_Silent_p.G44G|TTC14_uc003fkm.2_Silent_p.G44G	p.G44G	NM_133462	NP_597719	WXS	Illumina HiSeq	Unspecified	Q96N46	TTC14_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)		1	264	+	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		44					G5E9X0|Q6UWJ7|Q8TF22	Silent	SNP	ENST00000296015.4	37	c.132C>T	CCDS3237.1																																																																																				0.672	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462		5	5	0	0	0	0.001168	0	5	5				
RGS12	6002	broad.mit.edu	37	4	3344679	3344679	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:3344679C>T	ENST00000344733.5	+	3	2801	c.1897C>T	c.(1897-1899)Cgg>Tgg	p.R633W	RGS12_ENST00000306648.7_Missense_Mutation_p.R31W|RGS12_ENST00000543385.1_Missense_Mutation_p.R633W|RGS12_ENST00000382788.3_Missense_Mutation_p.R633W|RGS12_ENST00000336727.3_Missense_Mutation_p.R633W	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	633					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)	p.R633W(1)		autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AAAATTTGGGCGGGGAACTGG	0.448																																							uc003ggw.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1897-1899)CGG>TGG		regulator of G-protein signalling 12 isoform 1							127.0	127.0	127.0					4																	3344679		2203	4300	6503	SO:0001583	missense	6002					condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity	g.chr4:3344679C>T	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.1897C>T	4.37:g.3344679C>T	ENSP00000339381:p.Arg633Trp		Somatic				RGS12_uc003ggu.2_Missense_Mutation_p.R633W|RGS12_uc010ics.1_5'UTR|RGS12_uc011bvr.1_RNA|RGS12_uc003ggv.2_Missense_Mutation_p.R633W|RGS12_uc003ggy.1_Missense_Mutation_p.R31W|RGS12_uc003ggx.1_Missense_Mutation_p.R633W	p.R633W	NM_198229	NP_937872	WXS	Illumina HiSeq	Unspecified	O14924	RGS12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	3	2801	+			633					B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	37	c.1897C>T	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199678	0.79015	.	.	ENSG00000159788	ENST00000543385;ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648	T;T;T;T;T	0.38887	1.25;1.42;1.43;1.43;1.11	4.92	3.17	0.36434	.	0.372941	0.24412	N	0.038760	T	0.51584	0.1683	L	0.54323	1.7	0.09310	N	0.999999	D;D;D;D	0.76494	0.998;0.998;0.999;0.999	P;B;P;D	0.64687	0.799;0.409;0.849;0.928	T	0.35500	-0.9786	10	0.72032	D	0.01	-11.3791	6.542	0.22385	0.0:0.7848:0.0:0.2152	.	31;633;633;633	Q8WX95;Q8WX97;O14924;O14924-4	.;.;RGS12_HUMAN;.	W	633;633;633;633;31	ENSP00000440566:R633W;ENSP00000339381:R633W;ENSP00000338509:R633W;ENSP00000372238:R633W;ENSP00000304459:R31W	ENSP00000304459:R31W	R	+	1	2	RGS12	3314477	0.000000	0.05858	0.086000	0.20670	0.609000	0.37215	0.024000	0.13555	1.065000	0.40693	0.655000	0.94253	CGG		0.448	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926		10	57	0	0	0	0.013537	0	10	57				
C1QTNF7	114905	broad.mit.edu	37	4	15444073	15444073	+	Missense_Mutation	SNP	G	G	C	rs563271263		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:15444073G>C	ENST00000444304.2	+	3	846	c.520G>C	c.(520-522)Gag>Cag	p.E174Q	C1QTNF7_ENST00000429690.1_Missense_Mutation_p.E174Q|C1QTNF7_ENST00000295297.4_Missense_Mutation_p.E181Q			Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	174	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)		p.E174Q(1)|p.E174K(1)		endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	16						CCTCTTCAACGAGGGAGAGCA	0.443																																							uc011bxb.1		NA																	2	Substitution - Missense(2)		prostate(1)|lung(1)		0						c.(520-522)GAG>CAG		C1q and tumor necrosis factor related protein 7							160.0	176.0	170.0					4																	15444073		2203	4300	6503	SO:0001583	missense	114905					collagen		g.chr4:15444073G>C	AF329839	CCDS3414.1, CCDS47025.1	4p15.3	2008-08-29			ENSG00000163145	ENSG00000163145			14342	protein-coding gene	gene with protein product							Standard	NM_001135170		Approved	CTRP7	uc003gnp.3	Q9BXJ2	OTTHUMG00000097095	ENST00000444304.2:c.520G>C	4.37:g.15444073G>C	ENSP00000388914:p.Glu174Gln		Somatic				C1QTNF7_uc003gno.2_Missense_Mutation_p.E181Q|C1QTNF7_uc003gnp.2_Missense_Mutation_p.E174Q	p.E174Q	NM_001135171	NP_001128643	WXS	Illumina HiSeq	Unspecified	Q9BXJ2	C1QT7_HUMAN			3	747	+			174			C1q.		B2RBT3|J3KPW3	Missense_Mutation	SNP	ENST00000444304.2	37	c.520G>C	CCDS3414.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.036659	0.75617	.	.	ENSG00000163145	ENST00000295297;ENST00000429690;ENST00000444304	D;D;D	0.85773	-2.03;-2.03;-2.03	5.8	5.8	0.92144	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.054356	0.64402	D	0.000001	D	0.89287	0.6672	L	0.43152	1.355	0.80722	D	1	D	0.69078	0.997	D	0.64144	0.922	D	0.87294	0.2301	9	.	.	.	.	20.0545	0.97645	0.0:0.0:1.0:0.0	.	174	Q9BXJ2	C1QT7_HUMAN	Q	181;174;174	ENSP00000295297:E181Q;ENSP00000410722:E174Q;ENSP00000388914:E174Q	.	E	+	1	0	C1QTNF7	15053171	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	9.830000	0.99415	2.748000	0.94277	0.655000	0.94253	GAG		0.443	C1QTNF7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000250891.2			7	269	0	0	0	0.00308	0	7	269				
TECRL	253017	broad.mit.edu	37	4	65146797	65146797	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:65146797G>T	ENST00000381210.3	-	11	1036	c.926C>A	c.(925-927)tCa>tAa	p.S309*	TECRL_ENST00000507440.1_Nonsense_Mutation_p.S309*	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	309					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)	p.S309*(1)		endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						ACTAATCCATGATCCAATCTG	0.284																																							uc003hcv.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(925-927)TCA>TAA		steroid 5 alpha-reductase 2-like 2							107.0	92.0	97.0					4																	65146797		2202	4294	6496	SO:0001587	stop_gained	253017				lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors	g.chr4:65146797G>T	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.926C>A	4.37:g.65146797G>T	ENSP00000370607:p.Ser309*		Somatic				TECRL_uc010ihi.2_Intron	p.S309*	NM_001010874	NP_001010874	WXS	Illumina HiSeq	Unspecified	Q5HYJ1	TECRL_HUMAN			11	1035	-			309						Nonsense_Mutation	SNP	ENST00000381210.3	37	c.926C>A	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	G	37	6.573404	0.97676	.	.	ENSG00000205678	ENST00000507440;ENST00000381210	.	.	.	4.92	4.92	0.64577	.	0.153338	0.44688	D	0.000423	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0806	13.9695	0.64230	0.0:0.0:1.0:0.0	.	.	.	.	X	309	.	ENSP00000370607:S309X	S	-	2	0	TECRL	64829392	1.000000	0.71417	0.998000	0.56505	0.919000	0.55068	6.482000	0.73613	2.424000	0.82194	0.650000	0.86243	TCA		0.284	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874		5	25	1	0	3.59834e-05	0.001168	3.77647e-05	5	25				
WDFY3	23001	broad.mit.edu	37	4	85781638	85781638	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:85781638C>T	ENST00000295888.4	-	4	514	c.107G>A	c.(106-108)tGc>tAc	p.C36Y	WDFY3_ENST00000322366.6_Missense_Mutation_p.C36Y	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	36					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.C36Y(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGGAGGATGGCACAACTCCGT	0.557																																							uc003hpd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(106-108)TGC>TAC		WD repeat and FYVE domain containing 3 isoform							144.0	133.0	137.0					4																	85781638		2203	4300	6503	SO:0001583	missense	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85781638C>T	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.107G>A	4.37:g.85781638C>T	ENSP00000295888:p.Cys36Tyr		Somatic				WDFY3_uc003hpf.2_Missense_Mutation_p.C36Y	p.C36Y	NM_014991	NP_055806	WXS	Illumina HiSeq	Unspecified	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	4	515	-		Hepatocellular(203;0.114)	36					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	c.107G>A	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.577037	0.86645	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000509172	T;T	0.64438	-0.1;-0.1	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.68879	0.3049	L	0.38175	1.15	0.80722	D	1	D;D	0.69078	0.997;0.997	P;P	0.59703	0.85;0.862	T	0.63019	-0.6730	10	0.25751	T	0.34	.	19.8968	0.96969	0.0:1.0:0.0:0.0	.	36;36	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	Y	36	ENSP00000318466:C36Y;ENSP00000295888:C36Y	ENSP00000295888:C36Y	C	-	2	0	WDFY3	86000662	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	5.783000	0.68982	2.691000	0.91804	0.655000	0.94253	TGC		0.557	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		16	47	0	0	0	0.006122	0	16	47				
NAP1L5	266812	broad.mit.edu	37	4	89618409	89618409	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:89618409C>T	ENST00000323061.5	-	1	977	c.497G>A	c.(496-498)gGg>gAg	p.G166E	HERC3_ENST00000543130.1_Intron|HERC3_ENST00000264345.3_Intron|HERC3_ENST00000402738.1_Intron	NM_153757.2	NP_715638.1	Q96NT1	NP1L5_HUMAN	nucleosome assembly protein 1-like 5	166					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)		p.G166E(1)		endometrium(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(123;0.000181)		ATGTTTGGCCCCCGCGGCAGC	0.612																																							uc003hrx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(496-498)GGG>GAG		nucleosome assembly protein 1-like 5							97.0	105.0	103.0					4																	89618409		2203	4300	6503	SO:0001583	missense	266812				nucleosome assembly	nucleus	protein binding	g.chr4:89618409C>T	NM_153757	CCDS3632.1	4q21-q22	2006-04-12			ENSG00000177432	ENSG00000177432			19968	protein-coding gene	gene with protein product		612203				12383514	Standard	NM_153757		Approved	DRLM	uc003hrx.3	Q96NT1	OTTHUMG00000130950	ENST00000323061.5:c.497G>A	4.37:g.89618409C>T	ENSP00000320488:p.Gly166Glu		Somatic				HERC3_uc003hrw.1_Intron|HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron	p.G166E	NM_153757	NP_715638	WXS	Illumina HiSeq	Unspecified	Q96NT1	NP1L5_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000181)	1	615	-			166						Missense_Mutation	SNP	ENST00000323061.5	37	c.497G>A	CCDS3632.1	.	.	.	.	.	.	.	.	.	.	C	9.013	0.982935	0.18889	.	.	ENSG00000177432	ENST00000323061	T	0.43688	0.94	2.53	1.68	0.24146	.	.	.	.	.	T	0.20820	0.0501	N	0.14661	0.345	0.09310	N	1	B	0.18968	0.032	B	0.14578	0.011	T	0.26258	-1.0108	9	0.10377	T	0.69	.	6.7897	0.23693	0.0:0.5031:0.4969:0.0	.	166	Q96NT1	NP1L5_HUMAN	E	166	ENSP00000320488:G166E	ENSP00000320488:G166E	G	-	2	0	NAP1L5	89837432	0.001000	0.12720	0.006000	0.13384	0.010000	0.07245	0.759000	0.26461	0.647000	0.30713	0.637000	0.83480	GGG		0.612	NAP1L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253551.1	NM_153757		27	75	0	0	0	0.008361	0	27	75				
PCDH18	54510	broad.mit.edu	37	4	138453153	138453153	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr4:138453153C>G	ENST00000344876.4	-	1	476	c.90G>C	c.(88-90)ttG>ttC	p.L30F	PCDH18_ENST00000507846.1_Intron|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.L30F	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	30	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L30F(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TCCTGTATTTCAAATTCTTGC	0.378																																							uc003ihe.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(3)|skin(2)	5						c.(88-90)TTG>TTC		protocadherin 18 precursor							135.0	136.0	136.0					4																	138453153		2203	4300	6503	SO:0001583	missense	54510				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:138453153C>G	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.90G>C	4.37:g.138453153C>G	ENSP00000355082:p.Leu30Phe		Somatic				PCDH18_uc003ihf.3_Missense_Mutation_p.L23F|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Intron|PCDH18_uc011cha.1_Intron	p.L30F	NM_019035	NP_061908	WXS	Illumina HiSeq	Unspecified	Q9HCL0	PCD18_HUMAN			1	477	-	all_hematologic(180;0.24)		30			Extracellular (Potential).|Cadherin 1.		A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	c.90G>C	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.459145	0.63401	.	.	ENSG00000189184	ENST00000344876;ENST00000412923	T;T	0.38887	1.11;1.11	5.37	4.54	0.55810	Cadherin, N-terminal (1);Cadherin (2);	0.000000	0.30850	U	0.008746	T	0.60971	0.2310	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.976;0.999	T	0.63611	-0.6598	10	0.87932	D	0	.	6.9812	0.24704	0.0:0.7058:0.1433:0.1509	.	30;30	Q9HCL0-2;Q9HCL0	.;PCD18_HUMAN	F	30	ENSP00000355082:L30F;ENSP00000390688:L30F	ENSP00000355082:L30F	L	-	3	2	PCDH18	138672603	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.984000	0.29565	1.270000	0.44297	0.561000	0.74099	TTG		0.378	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035		3	117	0	0	0	0.009096	0	3	117				
C5orf51	285636	broad.mit.edu	37	5	41904478	41904478	+	Silent	SNP	C	C	G	rs368457381		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr5:41904478C>G	ENST00000381647.2	+	1	28	c.9C>G	c.(7-9)gcC>gcG	p.A3A	C5orf51_ENST00000505931.2_Intron	NM_175921.4	NP_787117.3	A6NDU8	CE051_HUMAN	chromosome 5 open reading frame 51	3								p.A3A(1)		endometrium(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						CCATGGCGGCCGCAGTCTCTA	0.662																																							uc003jmo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(7-9)GCC>GCG		hypothetical protein LOC285636							23.0	25.0	24.0					5																	41904478		2187	4276	6463	SO:0001819	synonymous_variant	285636							g.chr5:41904478C>G	AL833916, AK094002	CCDS34151.1	5p13.1	2008-07-18			ENSG00000205765	ENSG00000205765			27750	protein-coding gene	gene with protein product						14702039	Standard	NM_175921		Approved	LOC285636	uc003jmo.3	A6NDU8	OTTHUMG00000162084	ENST00000381647.2:c.9C>G	5.37:g.41904478C>G			Somatic					p.A3A	NM_175921	NP_787117	WXS	Illumina HiSeq	Unspecified	A6NDU8	CE051_HUMAN			1	9	+			3					A2RRM9	Silent	SNP	ENST00000381647.2	37	c.9C>G	CCDS34151.1																																																																																				0.662	C5orf51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367144.1	NM_175921		10	10	0	0	0	0.001855	0	10	10				
ITGA2	3673	broad.mit.edu	37	5	52360756	52360756	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr5:52360756G>A	ENST00000296585.5	+	14	1760	c.1617G>A	c.(1615-1617)caG>caA	p.Q539Q		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	539					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.Q539Q(2)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TTTTGGGTCAGCACCAATTTC	0.428																																							uc003joy.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(1)	1						c.(1615-1617)CAG>CAA		integrin alpha 2 precursor							111.0	115.0	113.0					5																	52360756		2203	4300	6503	SO:0001819	synonymous_variant	3673				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity	g.chr5:52360756G>A		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1617G>A	5.37:g.52360756G>A			Somatic				ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Silent_p.Q463Q|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	p.Q539Q	NM_002203	NP_002194	WXS	Illumina HiSeq	Unspecified	P17301	ITA2_HUMAN			14	1760	+		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)	539			FG-GAP 5.|Extracellular (Potential).		Q14595	Silent	SNP	ENST00000296585.5	37	c.1617G>A	CCDS3957.1																																																																																				0.428	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203		3	50	0	0	0	0.009096	0	3	50				
RIOK2	55781	broad.mit.edu	37	5	96503628	96503628	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr5:96503628C>G	ENST00000283109.3	-	8	1008	c.940G>C	c.(940-942)Gaa>Caa	p.E314Q	RIOK2_ENST00000508447.1_Missense_Mutation_p.E314Q|CTD-2215E18.1_ENST00000509481.1_Intron	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	314	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E314Q(2)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		TGAAGCAGTTCATCATCTGCC	0.408																																							uc003kmz.2		NA																	2	Substitution - Missense(2)		lung(2)	kidney(1)	1						c.(940-942)GAA>CAA		RIO kinase 2 isoform 1							65.0	69.0	68.0					5																	96503628		2202	4300	6502	SO:0001583	missense	55781						ATP binding|protein serine/threonine kinase activity	g.chr5:96503628C>G	AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.940G>C	5.37:g.96503628C>G	ENSP00000283109:p.Glu314Gln		Somatic				RIOK2_uc003kna.3_Missense_Mutation_p.E314Q	p.E314Q	NM_018343	NP_060813	WXS	Illumina HiSeq	Unspecified	Q9BVS4	RIOK2_HUMAN		COAD - Colon adenocarcinoma(37;0.0657)	8	1050	-		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)	314			Protein kinase.		D6RDI3|Q9NUT0	Missense_Mutation	SNP	ENST00000283109.3	37	c.940G>C	CCDS4089.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286113	0.80803	.	.	ENSG00000058729	ENST00000283109;ENST00000508447	T;T	0.27402	1.67;1.67	5.65	5.65	0.86999	.	0.402810	0.30473	N	0.009551	T	0.37348	0.1000	M	0.77103	2.36	0.41166	D	0.986134	P;B	0.38473	0.633;0.155	B;B	0.30646	0.118;0.094	T	0.44019	-0.9355	10	0.59425	D	0.04	-0.3768	19.3193	0.94231	0.0:1.0:0.0:0.0	.	314;314	D6RDI3;Q9BVS4	.;RIOK2_HUMAN	Q	314	ENSP00000283109:E314Q;ENSP00000420932:E314Q	ENSP00000283109:E314Q	E	-	1	0	RIOK2	96529384	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.949000	0.56668	2.658000	0.90341	0.460000	0.39030	GAA		0.408	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250628.1	NM_018343		26	91	0	0	0	0.00632	0	26	91				
PCDHGB1	56104	broad.mit.edu	37	5	140730641	140730641	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr5:140730641G>A	ENST00000523390.1	+	1	814	c.814G>A	c.(814-816)Gca>Aca	p.A272T	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	272	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A272T(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCATTAATGCAGAGATCAC	0.498																																							uc003ljo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(814-816)GCA>ACA		protocadherin gamma subfamily B, 1 isoform 1							124.0	130.0	128.0					5																	140730641		2022	4182	6204	SO:0001583	missense	56104				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140730641G>A	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.814G>A	5.37:g.140730641G>A	ENSP00000429273:p.Ala272Thr		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc011daq.1_Missense_Mutation_p.A272T	p.A272T	NM_018922	NP_061745	WXS	Illumina HiSeq	Unspecified	Q9Y5G3	PCDGD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	814	+			272			Extracellular (Potential).|Cadherin 3.		Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	c.814G>A	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	22.5	4.297255	0.81025	.	.	ENSG00000254221	ENST00000523390	T	0.40225	1.04	5.58	5.58	0.84498	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.69486	0.3116	M	0.84948	2.725	0.28430	N	0.91732	D;D	0.61697	0.99;0.985	P;D	0.65233	0.89;0.933	T	0.66559	-0.5893	9	0.87932	D	0	.	19.5432	0.95282	0.0:0.0:1.0:0.0	.	272;272	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	T	272	ENSP00000429273:A272T	ENSP00000429273:A272T	A	+	1	0	PCDHGB1	140710825	0.980000	0.34600	0.970000	0.41538	0.952000	0.60782	4.717000	0.61923	2.782000	0.95742	0.563000	0.77884	GCA		0.498	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922		24	89	0	0	0	0.00333	0	24	89				
TENM2	57451	broad.mit.edu	37	5	167551958	167551958	+	Silent	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr5:167551958C>A	ENST00000518659.1	+	11	2151	c.2112C>A	c.(2110-2112)gtC>gtA	p.V704V	TENM2_ENST00000520394.1_Silent_p.V472V|TENM2_ENST00000403607.2_Silent_p.V537V|TENM2_ENST00000519204.1_Silent_p.V583V|CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000545108.1_Silent_p.V704V	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	704	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.V704V(1)|p.V537V(1)|p.V583V(1)									TGGCGAGGGTCCAGTGCCCAG	0.617																																							uc010jjd.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(6)|central_nervous_system(4)	10						c.(2110-2112)GTC>GTA		odz, odd Oz/ten-m homolog 2							47.0	52.0	50.0					5																	167551958		2140	4253	6393	SO:0001819	synonymous_variant	57451							g.chr5:167551958C>A	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.2112C>A	5.37:g.167551958C>A			Somatic				ODZ2_uc003lzr.3_Silent_p.V472V|ODZ2_uc003lzt.3_Silent_p.V68V|ODZ2_uc010jje.2_5'UTR|uc003lzs.1_Intron	p.V704V	NM_001122679	NP_001116151	WXS	Illumina HiSeq	Unspecified			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	11	2112	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Silent	SNP	ENST00000518659.1	37	c.2112C>A																																																																																					0.617	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		4	19	1	0	0.00909568	0.009096	0.0093606	4	19				
PAK1IP1	55003	broad.mit.edu	37	6	10702848	10702848	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:10702848C>A	ENST00000379568.3	+	4	710	c.419C>A	c.(418-420)tCg>tAg	p.S140*		NM_017906.2	NP_060376.2	Q9NWT1	PK1IP_HUMAN	PAK1 interacting protein 1	140					cell proliferation (GO:0008283)|negative regulation of signal transduction (GO:0009968)|palate development (GO:0060021)	nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.S140Y(1)		kidney(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.117)				TTGGCCCTGTCGGTTGGTACA	0.408																																							uc003mzg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(418-420)TCG>TAG		PAK1 interacting protein 1							103.0	97.0	99.0					6																	10702848		2203	4300	6503	SO:0001587	stop_gained	55003				negative regulation of signal transduction	nucleolus|plasma membrane		g.chr6:10702848C>A	AF283303	CCDS34339.1	6p24.1	2013-05-21			ENSG00000111845	ENSG00000111845		"""WD repeat domain containing"""	20882	protein-coding gene	gene with protein product		607811				11371639	Standard	XM_005249204		Approved	FLJ20624, hPIP1, PIP1, bA421M1.5, MAK11, WDR84	uc003mzg.3	Q9NWT1	OTTHUMG00000014245	ENST00000379568.3:c.419C>A	6.37:g.10702848C>A	ENSP00000368887:p.Ser140*		Somatic					p.S140*	NM_017906	NP_060376	WXS	Illumina HiSeq	Unspecified	Q9NWT1	PK1IP_HUMAN			4	450	+	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.117)	140			WD 3.		Q5T4J2|Q96QJ8|Q96T87	Nonsense_Mutation	SNP	ENST00000379568.3	37	c.419C>A	CCDS34339.1	.	.	.	.	.	.	.	.	.	.	C	38	7.046189	0.98025	.	.	ENSG00000111845	ENST00000379568	.	.	.	5.76	5.76	0.90799	.	0.055227	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0683	17.4698	0.87642	0.0:1.0:0.0:0.0	.	.	.	.	X	140	.	ENSP00000368887:S140X	S	+	2	0	PAK1IP1	10810834	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	7.075000	0.76798	2.713000	0.92767	0.655000	0.94253	TCG		0.408	PAK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039835.1	NM_017906		30	112	1	0	1.61788e-16	0.012213	1.88456e-16	30	112				
HIST1H3F	8968	broad.mit.edu	37	6	26250719	26250719	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:26250719G>T	ENST00000446824.2	-	1	116	c.115C>A	c.(115-117)Ccc>Acc	p.P39T	HIST1H2BH_ENST00000356350.2_5'Flank	NM_021018.2	NP_066298.1	P68431	H31_HUMAN	histone cluster 1, H3f	39					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.P39T(1)		lung(6)|urinary_tract(1)	7						TAGCGGTGGGGCTTCTTCACG	0.612																																							uc003nhg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(115-117)CCC>ACC		histone cluster 1, H3f							76.0	81.0	80.0					6																	26250719		2203	4300	6503	SO:0001583	missense	8968				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26250719G>T	Z80786	CCDS4600.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000256316	ENSG00000277775		"""Histones / Replication-dependent"""	4773	protein-coding gene	gene with protein product		602816	"""H3 histone family, member I"", ""histone 1, H3f"""	H3FI		9119399, 12408966	Standard	NM_021018		Approved	H3/i	uc003nhg.1	P68431	OTTHUMG00000014435	ENST00000446824.2:c.115C>A	6.37:g.26250719G>T	ENSP00000444823:p.Pro39Thr		Somatic				HIST1H2BH_uc003nhh.2_5'Flank	p.P39T	NM_021018	NP_066298	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	117	-			39					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000446824.2	37	c.115C>A	CCDS4600.1	.	.	.	.	.	.	.	.	.	.	.	14.92	2.680140	0.47886	.	.	ENSG00000256316	ENST00000446824	T	0.46819	0.86	4.73	4.73	0.59995	.	.	.	.	.	T	0.60274	0.2256	.	.	.	0.45118	D	0.998131	.	.	.	.	.	.	T	0.65393	-0.6179	6	0.87932	D	0	.	17.5462	0.87863	0.0:0.0:1.0:0.0	.	.	.	.	T	39	ENSP00000444823:P39T	ENSP00000444823:P39T	P	-	1	0	HIST1H3F	26358698	1.000000	0.71417	0.999000	0.59377	0.886000	0.51366	7.676000	0.84012	2.555000	0.86185	0.491000	0.48974	CCC		0.612	HIST1H3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040098.1	NM_021018		27	89	1	0	6.55177e-30	0.007291	8.07544e-30	27	89				
DDX39B	7919	broad.mit.edu	37	6	31508296	31508296	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:31508296T>G	ENST00000396172.1	-	2	644	c.14A>C	c.(13-15)gAt>gCt	p.D5A	ATP6V1G2-DDX39B_ENST00000376185.1_3'UTR|DDX39B_ENST00000417556.2_Missense_Mutation_p.D5A|SNORD84_ENST00000584275.1_RNA|ATP6V1G2-DDX39B_ENST00000475917.1_5'Flank|DDX39B_ENST00000458640.1_Missense_Mutation_p.D5A|DDX39B_ENST00000449074.2_Missense_Mutation_p.D5A|DDX39B_ENST00000415382.2_Start_Codon_SNP_p.M1L|DDX39B_ENST00000453105.2_Start_Codon_SNP_p.M1L|DDX39B_ENST00000376177.2_Missense_Mutation_p.D5A|DDX39B-AS1_ENST00000416684.1_RNA|DDX39B-AS1_ENST00000420520.1_RNA	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B	5					ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)	p.D5A(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						ATTGTCCACATCGTTCTCTGC	0.552																																							uc003ntt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(13-15)GAT>GCT		HLA-B associated transcript 1							77.0	70.0	72.0					6																	31508296		2203	4300	6503	SO:0001583	missense	7919				intronless viral mRNA export from host nucleus|RNA secondary structure unwinding|spliceosome assembly	nuclear speck|spliceosomal complex|transcription export complex	ATP binding|ATP-dependent protein binding|ATP-dependent RNA helicase activity|identical protein binding|U4 snRNA binding|U6 snRNA binding	g.chr6:31508296T>G	Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.14A>C	6.37:g.31508296T>G	ENSP00000379475:p.Asp5Ala		Somatic				BAT1_uc003nts.2_Missense_Mutation_p.D5A|BAT1_uc011dnn.1_Missense_Mutation_p.M1L|BAT1_uc003ntu.2_Missense_Mutation_p.D5A|BAT1_uc003ntv.2_Missense_Mutation_p.D5A|BAT1_uc003ntw.2_Missense_Mutation_p.D5A|BAT1_uc003ntx.2_Missense_Mutation_p.D5A|BAT1_uc011dno.1_Missense_Mutation_p.M1L|BAT1_uc011dnp.1_Missense_Mutation_p.M1L|BAT1_uc011dnq.1_RNA	p.D5A	NM_004640	NP_004631	WXS	Illumina HiSeq	Unspecified	Q13838	DX39B_HUMAN			2	645	-			5					B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	Missense_Mutation	SNP	ENST00000396172.1	37	c.14A>C	CCDS4697.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.346903|4.346903	0.82022|0.82022	.|.	.|.	ENSG00000198563|ENSG00000198563	ENST00000376177;ENST00000458640;ENST00000396172;ENST00000417556;ENST00000427214;ENST00000428098;ENST00000419338;ENST00000456662;ENST00000449074;ENST00000428450;ENST00000449757;ENST00000456976;ENST00000418897;ENST00000419020;ENST00000458215|ENST00000415382;ENST00000431908;ENST00000453105	T;T;T;T;T;T;T;T;T;T;T;T;T;T|T;T;T	0.44881|0.40756	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91|1.02;2.71;3.58	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.23014|0.23014	0.0556|0.0556	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	B;B;B|B;B;B	0.34241|0.11235	0.007;0.265;0.444|0.004;0.0;0.0	B;B;B|B;B;B	0.41946|0.11329	0.005;0.371;0.219|0.006;0.004;0.001	T|T	0.11108|0.11108	-1.0601|-1.0601	10|9	0.35671|0.87932	T|D	0.21|0	-14.9029|-14.9029	13.6077|13.6077	0.62056|0.62056	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	25;5;5|1;1;1	Q59G92;Q13838;Q5STU3|B4DIZ8;B4DIJ6;B4DP52	.;DX39B_HUMAN;.|.;.;.	A|L	5;5;5;5;5;5;5;5;5;5;28;5;20;5;5|1	ENSP00000365347:D5A;ENSP00000416269:D5A;ENSP00000379475:D5A;ENSP00000412582:D5A;ENSP00000399371:D5A;ENSP00000392672:D5A;ENSP00000410313:D5A;ENSP00000416350:D5A;ENSP00000391946:D5A;ENSP00000405707:D5A;ENSP00000409426:D28A;ENSP00000393984:D5A;ENSP00000399841:D20A;ENSP00000405245:D5A|ENSP00000392669:M1L;ENSP00000408000:M1L;ENSP00000400328:M1L	ENSP00000365347:D5A|ENSP00000392669:M1L	D|M	-|-	2|1	0|0	DDX39B|DDX39B	31616275|31616275	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	7.448000|7.448000	0.80631|0.80631	2.095000|2.095000	0.63458|0.63458	0.460000|0.460000	0.39030|0.39030	GAT|ATG		0.552	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259083.1	NM_004640		16	66	0	0	0	0.007413	0	16	66				
BTNL2	56244	broad.mit.edu	37	6	32362585	32362585	+	Silent	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:32362585G>A	ENST00000374993.1	-	6	1295	c.1296C>T	c.(1294-1296)gaC>gaT	p.D432D	BTNL2_ENST00000414363.1_Silent_p.D222D|HCG23_ENST00000426643.1_RNA|BTNL2_ENST00000429232.2_3'UTR|BTNL2_ENST00000544175.1_Silent_p.D155D|BTNL2_ENST00000540315.1_Silent_p.D222D|BTNL2_ENST00000374995.3_Silent_p.D338D|BTNL2_ENST00000454136.3_Silent_p.D432D	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	432						integral component of membrane (GO:0016021)		p.D432D(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						AACAAGTGACGTCCACAGCGG	0.498																																							uc003obg.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(1294-1296)GAC>GAT		butyrophilin-like 2							180.0	173.0	175.0					6																	32362585		2203	4300	6503	SO:0001819	synonymous_variant	56244					integral to membrane		g.chr6:32362585G>A	AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.1296C>T	6.37:g.32362585G>A			Somatic				BTNL2_uc010jty.1_Silent_p.D155D|BTNL2_uc010jtz.1_RNA|BTNL2_uc010jua.1_Silent_p.D222D	p.D432D	NM_019602	NP_062548	WXS	Illumina HiSeq	Unspecified	Q9UIR0	BTNL2_HUMAN			6	1296	-			432			Extracellular (Potential).		A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Silent	SNP	ENST00000374993.1	37	c.1296C>T																																																																																					0.498	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_019602		29	135	0	0	0	0.010818	0	29	135				
PLEKHG1	57480	broad.mit.edu	37	6	151142342	151142342	+	Missense_Mutation	SNP	C	C	T	rs140780640	byFrequency	TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:151142342C>T	ENST00000358517.2	+	13	1631	c.1420C>T	c.(1420-1422)Cgg>Tgg	p.R474W	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.R474W			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	474							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R474W(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		ACCTTCCTCACGGTCACATAA	0.333													C|||	2	0.000399361	0.0	0.0	5008	,	,		17168	0.0		0.002	False		,,,				2504	0.0						uc003qny.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1420-1422)CGG>TGG		pleckstrin homology domain containing, family G		C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	135.0	133.0	133.0		1420	3.4	1.0	6	dbSNP_134	133	3,8597	3.0+/-9.4	0,3,4297	yes	missense	PLEKHG1	NM_001029884.1	101	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	probably-damaging	474/1386	151142342	4,13002	2203	4300	6503	SO:0001583	missense	57480				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr6:151142342C>T	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.1420C>T	6.37:g.151142342C>T	ENSP00000351318:p.Arg474Trp		Somatic				PLEKHG1_uc011eel.1_Missense_Mutation_p.R514W|PLEKHG1_uc011eem.1_Missense_Mutation_p.R533W|PLEKHG1_uc003qnz.2_Missense_Mutation_p.R474W	p.R474W	NM_001029884	NP_001025055	WXS	Illumina HiSeq	Unspecified	Q9ULL1	PKHG1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)	14	1732	+			474					Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	c.1420C>T	CCDS34552.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	C	17.12	3.308226	0.60305	2.27E-4	3.49E-4	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.61392	0.11;0.11	5.77	3.36	0.38483	.	0.188109	0.56097	D	0.000021	T	0.56108	0.1963	L	0.40543	1.245	0.43913	D	0.996551	B;D;D	0.89917	0.004;1.0;1.0	B;D;D	0.74674	0.006;0.984;0.984	T	0.61860	-0.6976	10	0.87932	D	0	.	12.5405	0.56167	0.7262:0.2738:0.0:0.0	.	281;474;474	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	W	474	ENSP00000356297:R474W;ENSP00000351318:R474W	ENSP00000351318:R474W	R	+	1	2	PLEKHG1	151184035	0.883000	0.30277	0.993000	0.49108	0.967000	0.64934	1.664000	0.37439	0.516000	0.28340	-0.485000	0.04761	CGG		0.333	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1			14	41	0	0	0	0.00245	0	14	41				
SYNE1	23345	broad.mit.edu	37	6	152671318	152671318	+	Silent	SNP	T	T	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr6:152671318T>C	ENST00000367255.5	-	72	12487	c.11886A>G	c.(11884-11886)caA>caG	p.Q3962Q	SYNE1_ENST00000448038.1_Intron|SYNE1_ENST00000265368.4_Silent_p.Q3962Q|SYNE1_ENST00000341594.5_Silent_p.Q3886Q|SYNE1_ENST00000423061.1_Intron	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3962					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.Q3962Q(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGTGGGCCAATTGCTGGGTGA	0.557										HNSCC(10;0.0054)																													uc010kiw.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(11884-11886)CAA>CAG		spectrin repeat containing, nuclear envelope 1							108.0	95.0	99.0					6																	152671318		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152671318T>C	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11886A>G	6.37:g.152671318T>C		HNSCC(10;0.0054)	Somatic				SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Silent_p.Q3962Q|SYNE1_uc010kja.1_Silent_p.Q667Q	p.Q3962Q	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	72	12488	-		Ovarian(120;0.0955)	3962			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.11886A>G	CCDS5236.2																																																																																				0.557	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		9	41	0	0	0	0.008291	0	9	41				
EGFR	1956	broad.mit.edu	37	7	55259515	55259515	+	Missense_Mutation	SNP	T	T	G	rs121434568		TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr7:55259515T>G	ENST00000275493.2	+	21	2750	c.2573T>G	c.(2572-2574)cTg>cGg	p.L858R	EGFR_ENST00000454757.2_Missense_Mutation_p.L805R|EGFR_ENST00000455089.1_Missense_Mutation_p.L813R|EGFR_ENST00000442591.1_Intron|EGFR-AS1_ENST00000442411.1_RNA	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	858	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> M (found in a lung cancer sample). {ECO:0000269|PubMed:16533793}.|L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity; more sensitive to gefitinib than wild-type; dbSNP:rs121434568). {ECO:0000269|PubMed:15118125, ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L858R(1489)|p.L858Q(1)|p.L858K(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GATTTTGGGCTGGCCAAACTG	0.537	L858R(NCIH1975_LUNG)	8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2	L858R(NCIH1975_LUNG)	8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		1491	Substitution - Missense(1491)	p.L858R(3429)|p.L858L(4)|p.L858M(4)|p.L858Q(3)|p.L858A(2)|p.L858W(1)|p.L858P(1)|p.L858K(1)|p.L858G(1)	lung(1475)|upper_aerodigestive_tract(5)|thyroid(4)|large_intestine(2)|peritoneum(1)|stomach(1)|thymus(1)|breast(1)|ovary(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2572-2574)CTG>CGG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						105.0	98.0	101.0					7																	55259515		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55259515T>G		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2573T>G	7.37:g.55259515T>G	ENSP00000275493:p.Leu858Arg	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)	Somatic				EGFR_uc010kzg.1_Missense_Mutation_p.L813R|EGFR_uc011kco.1_Missense_Mutation_p.L805R|uc003tqo.2_5'Flank	p.L858R	NM_005228	NP_005219	WXS	Illumina HiSeq	Unspecified	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		21	2819	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		858		L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity).|L -> M (found in a lung cancer sample).	Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2573T>G	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601026	0.87055	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.91351	-2.83;-2.83;-2.83	5.71	5.71	0.89125	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.137592	0.50627	D	0.000117	D	0.96340	0.8806	M	0.92555	3.32	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.956;0.999	D	0.97213	0.9872	10	0.87932	D	0	.	14.8112	0.69996	0.0:0.0:0.0:1.0	.	813;858	Q504U8;P00533	.;EGFR_HUMAN	R	813;728;858;805	ENSP00000415559:L813R;ENSP00000275493:L858R;ENSP00000395243:L805R	ENSP00000275493:L858R	L	+	2	0	EGFR	55227009	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.890000	0.87313	2.176000	0.68965	0.528000	0.53228	CTG		0.537	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		23	57	0	0	0	0.00278	0	23	57				
WBSCR17	64409	broad.mit.edu	37	7	71175812	71175812	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr7:71175812G>A	ENST00000333538.5	+	10	2201	c.1567G>A	c.(1567-1569)Gac>Aac	p.D523N	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	523	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.D523N(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ACTCCTCCCTGACACCCGCTG	0.612																																							uc003tvy.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7						c.(1567-1569)GAC>AAC		UDP-GalNAc:polypeptide							82.0	76.0	78.0					7																	71175812		2203	4300	6503	SO:0001583	missense	64409					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr7:71175812G>A	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1567G>A	7.37:g.71175812G>A	ENSP00000329654:p.Asp523Asn		Somatic				WBSCR17_uc003tvz.2_Missense_Mutation_p.D222N	p.D523N	NM_022479	NP_071924	WXS	Illumina HiSeq	Unspecified	Q6IS24	GLTL3_HUMAN			10	1567	+		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)	523			Ricin B-type lectin.|Lumenal (Potential).		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	c.1567G>A	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	G	30	5.050955	0.93740	.	.	ENSG00000185274	ENST00000333538	T	0.29655	1.56	5.28	5.28	0.74379	Ricin B-related lectin (1);Ricin B lectin (3);	0.091308	0.85682	D	0.000000	T	0.55481	0.1923	M	0.69248	2.105	0.53688	D	0.999979	D	0.89917	1.0	D	0.91635	0.999	T	0.55095	-0.8194	10	0.59425	D	0.04	.	17.6589	0.88185	0.0:0.0:1.0:0.0	.	523	Q6IS24	GLTL3_HUMAN	N	523	ENSP00000329654:D523N	ENSP00000329654:D523N	D	+	1	0	WBSCR17	70813748	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.623000	0.83113	2.746000	0.94184	0.655000	0.94253	GAC		0.612	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479		15	61	0	0	0	0.003163	0	15	61				
HEPACAM2	253012	broad.mit.edu	37	7	92838013	92838013	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr7:92838013G>A	ENST00000394468.2	-	4	969	c.892C>T	c.(892-894)Cgc>Tgc	p.R298C	HEPACAM2_ENST00000341723.4_Missense_Mutation_p.R286C|HEPACAM2_ENST00000453812.2_Missense_Mutation_p.R321C|HEPACAM2_ENST00000440868.1_Missense_Mutation_p.R286C	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	298	Ig-like C2-type 2.				centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)		p.R286C(1)|p.R298C(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						ACTTCTAAGCGAGGCCCATGC	0.448																																							uc003umm.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(1)|kidney(1)	5						c.(892-894)CGC>TGC		HEPACAM family member 2 isoform 1							167.0	150.0	155.0					7																	92838013		2203	4300	6503	SO:0001583	missense	253012					integral to membrane		g.chr7:92838013G>A	AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.892C>T	7.37:g.92838013G>A	ENSP00000377980:p.Arg298Cys		Somatic				HEPACAM2_uc003uml.2_Missense_Mutation_p.R286C|HEPACAM2_uc010lff.2_Missense_Mutation_p.R286C|HEPACAM2_uc011khy.1_Missense_Mutation_p.R321C	p.R298C	NM_001039372	NP_001034461	WXS	Illumina HiSeq	Unspecified	A8MVW5	HECA2_HUMAN			4	915	-			298			Ig-like C2-type 2.|Extracellular (Potential).		B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	ENST00000394468.2	37	c.892C>T	CCDS43616.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.140329	0.56936	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	T;T;T;T	0.13420	2.59;2.59;2.59;2.59	5.23	4.33	0.51752	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.812864	0.11860	N	0.522500	T	0.20495	0.0493	L	0.29908	0.895	0.25737	N	0.985201	D;D;D;D	0.76494	0.999;0.999;0.976;0.99	P;P;P;P	0.60609	0.863;0.877;0.621;0.614	T	0.10042	-1.0647	10	0.66056	D	0.02	2.2898	7.3252	0.26551	0.1446:0.145:0.7104:0.0	.	321;286;298;286	E9PDV5;C9JN07;A8MVW5;A8MVW5-2	.;.;HECA2_HUMAN;.	C	298;286;286;321	ENSP00000377980:R298C;ENSP00000340532:R286C;ENSP00000389592:R286C;ENSP00000390204:R321C	ENSP00000340532:R286C	R	-	1	0	HEPACAM2	92675949	0.931000	0.31567	0.879000	0.34478	0.859000	0.49053	3.040000	0.49799	1.488000	0.48433	0.655000	0.94253	CGC		0.448	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1	NM_198151		39	59	0	0	0	0.004878	0	39	59				
PSMC2	5701	broad.mit.edu	37	7	103006539	103006539	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr7:103006539G>A	ENST00000435765.1	+	10	1184	c.773G>A	c.(772-774)cGt>cAt	p.R258H	SLC26A5_ENST00000393735.2_Intron|SLC26A5_ENST00000339444.6_Intron|PSMC2_ENST00000544811.1_Missense_Mutation_p.R121H|SLC26A5_ENST00000356767.4_Intron|PSMC2_ENST00000292644.3_Missense_Mutation_p.R258H	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2	258					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.R258H(1)		breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						CGAATGGTTCGTGAACTCTTT	0.313																																							uc003vbs.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(772-774)CGT>CAT		proteasome 26S ATPase subunit 2							101.0	110.0	107.0					7																	103006539		2203	4300	6503	SO:0001583	missense	5701				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding	g.chr7:103006539G>A	D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	ENST00000435765.1:c.773G>A	7.37:g.103006539G>A	ENSP00000391211:p.Arg258His		Somatic				SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|PSMC2_uc011klo.1_Missense_Mutation_p.R121H	p.R258H	NM_002803	NP_002794	WXS	Illumina HiSeq	Unspecified	P35998	PRS7_HUMAN			9	843	+			258					A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Missense_Mutation	SNP	ENST00000435765.1	37	c.773G>A	CCDS5731.1	.	.	.	.	.	.	.	.	.	.	G	33	5.223571	0.95139	.	.	ENSG00000161057	ENST00000435765;ENST00000292644;ENST00000544811	D;D;D	0.94232	-3.38;-3.38;-3.38	5.51	5.51	0.81932	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.96540	0.8871	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96764	0.9563	10	0.87932	D	0	-13.5644	19.4632	0.94927	0.0:0.0:1.0:0.0	.	258	P35998	PRS7_HUMAN	H	258;258;121	ENSP00000391211:R258H;ENSP00000292644:R258H;ENSP00000445546:R121H	ENSP00000292644:R258H	R	+	2	0	PSMC2	102793775	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	9.285000	0.95894	2.610000	0.88304	0.650000	0.86243	CGT		0.313	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347922.1	NM_002803		25	91	0	0	0	0.008361	0	25	91				
MKLN1	4289	broad.mit.edu	37	7	131113849	131113849	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr7:131113849C>T	ENST00000352689.6	+	9	945	c.905C>T	c.(904-906)gCg>gTg	p.A302V	MKLN1_ENST00000421797.2_Missense_Mutation_p.A210V	NM_013255.4	NP_037387.2	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs	302					signal transduction (GO:0007165)	cytoplasm (GO:0005737)		p.A302V(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					GACTTCTGGGCGTACAGTGTG	0.388																																							uc011kpm.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(904-906)GCG>GTG		muskelin 1, intracellular mediator containing							121.0	117.0	119.0					7																	131113849		2203	4300	6503	SO:0001583	missense	4289				signal transduction	cytoplasm	protein binding	g.chr7:131113849C>T	AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880	ENST00000352689.6:c.905C>T	7.37:g.131113849C>T	ENSP00000323527:p.Ala302Val		Somatic				MKLN1_uc011kpl.1_Missense_Mutation_p.A279V|MKLN1_uc010lmh.2_Missense_Mutation_p.A302V|MKLN1_uc003vqs.2_Missense_Mutation_p.A95V	p.A302V	NM_013255	NP_037387	WXS	Illumina HiSeq	Unspecified	Q9UL63	MKLN1_HUMAN			9	969	+	Melanoma(18;0.162)		302			Kelch 1.		A4D1M8|A6NG43|Q9NSK4|Q9NUS8	Missense_Mutation	SNP	ENST00000352689.6	37	c.905C>T	CCDS34754.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026853	0.54683	.	.	ENSG00000128585	ENST00000421797;ENST00000352689	T;T	0.35236	1.32;1.32	6.16	6.16	0.99307	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.24851	0.0603	N	0.11756	0.17	0.80722	D	1	B;B;B	0.21071	0.044;0.051;0.051	B;B;B	0.24155	0.051;0.01;0.01	T	0.11084	-1.0602	10	0.11485	T	0.65	-14.6359	19.848	0.96722	0.0:1.0:0.0:0.0	.	302;279;210	Q9UL63;B4DG30;C9J7E8	MKLN1_HUMAN;.;.	V	210;302	ENSP00000398094:A210V;ENSP00000323527:A302V	ENSP00000323527:A302V	A	+	2	0	MKLN1	130764389	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.648000	0.83479	2.937000	0.99478	0.650000	0.86243	GCG		0.388	MKLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337473.4	NM_013255		9	80	0	0	0	0.008291	0	9	80				
CSMD1	64478	broad.mit.edu	37	8	3226892	3226892	+	Splice_Site	SNP	G	G	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr8:3226892G>C	ENST00000520002.1	-	20	3341	c.2786C>G	c.(2785-2787)gCt>gGt	p.A929G	CSMD1_ENST00000400186.3_Splice_Site_p.A929G|CSMD1_ENST00000537824.1_Splice_Site_p.A928G|CSMD1_ENST00000602723.1_Splice_Site_p.A929G|CSMD1_ENST00000539096.1_Splice_Site_p.A928G|CSMD1_ENST00000542608.1_Splice_Site_p.A928G|CSMD1_ENST00000602557.1_Splice_Site_p.A929G			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	929	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.A928G(1)|p.A657G(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCCACATAGAGCTTAAAATAA	0.388																																							uc011kwk.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(2785-2787)GCT>GGT		CUB and Sushi multiple domains 1 precursor							46.0	43.0	44.0					8																	3226892		1832	4091	5923	SO:0001630	splice_region_variant	64478					integral to membrane		g.chr8:3226892G>C			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2786-1C>G	8.37:g.3226892G>C			Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.A321G|CSMD1_uc003wqe.2_Missense_Mutation_p.A85G	p.A929G	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	19	3176	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	929			Extracellular (Potential).|Sushi 5.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.2786C>G		.	.	.	.	.	.	.	.	.	.	G	24.7	4.563621	0.86335	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77	5.2	5.2	0.72013	Complement control module (2);Sushi/SCR/CCP (1);	0.000000	0.64402	D	0.000001	T	0.49150	0.1540	L	0.57130	1.785	0.80722	D	1	D;P;P	0.71674	0.998;0.73;0.539	D;P;B	0.75484	0.986;0.638;0.327	T	0.43032	-0.9416	10	0.48119	T	0.1	.	18.7722	0.91896	0.0:0.0:1.0:0.0	.	929;929;929	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	G	929;929;791;928;928;928	ENSP00000383047:A929G;ENSP00000430733:A929G;ENSP00000441462:A928G;ENSP00000446243:A928G;ENSP00000441675:A928G	ENSP00000320445:A791G	A	-	2	0	CSMD1	3214299	1.000000	0.71417	0.409000	0.26459	0.006000	0.05464	9.538000	0.98072	2.410000	0.81850	0.563000	0.77884	GCT		0.388	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	Missense_Mutation	3	19	0	0	0	0.004672	0	3	19				
FDFT1	2222	broad.mit.edu	37	8	11683576	11683576	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr8:11683576G>A	ENST00000220584.4	+	5	776	c.554G>A	c.(553-555)cGt>cAt	p.R185H	FDFT1_ENST00000525777.1_Missense_Mutation_p.R100H|FDFT1_ENST00000528812.1_Missense_Mutation_p.R121H|FDFT1_ENST00000525900.1_Missense_Mutation_p.R178H|FDFT1_ENST00000530664.1_Missense_Mutation_p.R121H|FDFT1_ENST00000446331.2_Intron|FDFT1_ENST00000443614.2_Missense_Mutation_p.R142H|FDFT1_ENST00000528643.1_Missense_Mutation_p.R100H|FDFT1_ENST00000538689.1_Missense_Mutation_p.R74H	NM_004462.3	NP_004453.3	P37268	FDFT_HUMAN	farnesyl-diphosphate farnesyltransferase 1	185					cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	farnesyl-diphosphate farnesyltransferase activity (GO:0004310)|oxidoreductase activity (GO:0016491)|squalene synthase activity (GO:0051996)	p.R185H(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)	12	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)		GGCCTTTCCCGTCTTTTCTCA	0.428																																							uc003wui.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(553-555)CGT>CAT		squalene synthase							108.0	105.0	106.0					8																	11683576		2203	4300	6503	SO:0001583	missense	2222				cholesterol biosynthetic process|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	farnesyl-diphosphate farnesyltransferase activity|oxidoreductase activity|protein binding|squalene synthase activity	g.chr8:11683576G>A	X69141	CCDS5985.1, CCDS75696.1, CCDS75697.1	8p23.1-p22	2005-03-07			ENSG00000079459	ENSG00000079459	2.5.1.21		3629	protein-coding gene	gene with protein product	"""squalene synthase"""	184420					Standard	NM_001287742		Approved		uc003wui.3	P37268	OTTHUMG00000090801	ENST00000220584.4:c.554G>A	8.37:g.11683576G>A	ENSP00000220584:p.Arg185His		Somatic				FDFT1_uc003wuh.2_Missense_Mutation_p.R121H|FDFT1_uc010lsa.1_Missense_Mutation_p.R100H|FDFT1_uc011kxe.1_Missense_Mutation_p.R121H|FDFT1_uc011kxf.1_Missense_Mutation_p.R142H|FDFT1_uc011kxg.1_Intron|FDFT1_uc003wuj.2_Missense_Mutation_p.R178H|FDFT1_uc010lsb.2_Missense_Mutation_p.R121H|FDFT1_uc011kxh.1_Missense_Mutation_p.R121H|FDFT1_uc011kxi.1_RNA|FDFT1_uc011kxj.1_Missense_Mutation_p.R121H|FDFT1_uc003wuk.2_Missense_Mutation_p.R244H|FDFT1_uc011kxk.1_Missense_Mutation_p.R100H	p.R185H	NM_004462	NP_004453	WXS	Illumina HiSeq	Unspecified	P37268	FDFT_HUMAN	STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)	5	706	+	all_epithelial(15;0.234)		185					B3KQ95|B4DJE5|B4DT56|B7Z1J3|Q96GT0	Missense_Mutation	SNP	ENST00000220584.4	37	c.554G>A	CCDS5985.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.514958	0.27123	.	.	ENSG00000079459	ENST00000538689;ENST00000220584;ENST00000443614;ENST00000525900;ENST00000528812;ENST00000530664;ENST00000528643;ENST00000525777	D;D;D;D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	5.21	2.47	0.30058	Terpenoid synthase (2);Squalene/phytoene synthase, conserved site (1);	0.192595	0.44902	D	0.000407	D	0.83524	0.5273	L	0.38838	1.175	0.29756	N	0.835961	D;D;D;D	0.76494	0.999;0.999;0.996;0.996	D;P;P;P	0.63488	0.915;0.899;0.844;0.844	T	0.78645	-0.2123	10	0.56958	D	0.05	-6.0711	9.5043	0.39037	0.2258:0.0:0.7742:0.0	.	142;242;178;185	B4DJE5;B4DND3;E9PNM1;P37268	.;.;.;FDFT_HUMAN	H	74;185;142;178;121;121;100;100	ENSP00000444248:R74H;ENSP00000220584:R185H;ENSP00000390367:R142H;ENSP00000434714:R178H;ENSP00000431749:R121H;ENSP00000432331:R121H;ENSP00000431649:R100H;ENSP00000436069:R100H	ENSP00000220584:R185H	R	+	2	0	FDFT1	11720985	0.979000	0.34478	0.003000	0.11579	0.180000	0.23129	2.752000	0.47516	0.461000	0.27071	0.561000	0.74099	CGT		0.428	FDFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207588.2			20	85	0	0	0	0.014323	0	20	85				
PTDSS1	9791	broad.mit.edu	37	8	97321848	97321848	+	Silent	SNP	T	T	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr8:97321848T>C	ENST00000517309.1	+	9	1397	c.1071T>C	c.(1069-1071)ttT>ttC	p.F357F	PTDSS1_ENST00000522072.1_Silent_p.F154F|Y_RNA_ENST00000362862.1_RNA|PTDSS1_ENST00000455950.2_Silent_p.F211F	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	357					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.F357F(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	GCTGGGTGTTTGGGTGAGTAA	0.408																																							uc003yht.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1069-1071)TTT>TTC		phosphatidylserine synthase 1	Phosphatidylserine(DB00144)						91.0	86.0	88.0					8																	97321848		2203	4300	6503	SO:0001819	synonymous_variant	9791				phosphatidylserine biosynthetic process	integral to membrane	transferase activity	g.chr8:97321848T>C	D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.1071T>C	8.37:g.97321848T>C			Somatic				PTDSS1_uc003yhu.1_Silent_p.F211F	p.F357F	NM_014754	NP_055569	WXS	Illumina HiSeq	Unspecified	P48651	PTSS1_HUMAN			9	1173	+	Breast(36;6.18e-05)		357			Helical; (Potential).		E5RFC5|Q9BUQ5	Silent	SNP	ENST00000517309.1	37	c.1071T>C	CCDS6271.1																																																																																				0.408	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379743.2			18	38	0	0	0	0.00278	0	18	38				
CSMD3	114788	broad.mit.edu	37	8	113564858	113564858	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr8:113564858C>A	ENST00000297405.5	-	26	4570	c.4326G>T	c.(4324-4326)atG>atT	p.M1442I	CSMD3_ENST00000352409.3_Missense_Mutation_p.M1442I|CSMD3_ENST00000343508.3_Missense_Mutation_p.M1402I|CSMD3_ENST00000455883.2_Missense_Mutation_p.M1338I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1442	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.M1442I(1)|p.M1402I(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CAATCATCCACATGCAACGCA	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(4324-4326)ATG>ATT		CUB and Sushi multiple domains 3 isoform 1							80.0	75.0	77.0					8																	113564858		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113564858C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4326G>T	8.37:g.113564858C>A	ENSP00000297405:p.Met1442Ile	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.M714I|CSMD3_uc003ynt.2_Missense_Mutation_p.M1402I|CSMD3_uc011lhx.1_Missense_Mutation_p.M1338I	p.M1442I	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			26	4485	-			1442			Extracellular (Potential).|CUB 8.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.4326G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	7.506	0.653735	0.14580	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33	4.74	2.86	0.33363	CUB (5);	0.136174	0.50627	D	0.000114	T	0.20414	0.0491	N	0.00317	-1.655	0.27235	N	0.959297	B;B;B	0.20988	0.05;0.034;0.009	B;B;B	0.26614	0.061;0.071;0.018	T	0.21042	-1.0257	10	0.33940	T	0.23	.	6.3439	0.21339	0.0:0.6837:0.1497:0.1665	.	1338;1442;1402	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	I	1402;1442;782;1338;1442	ENSP00000345799:M1402I;ENSP00000297405:M1442I;ENSP00000341558:M782I;ENSP00000412263:M1338I;ENSP00000343124:M1442I	ENSP00000297405:M1442I	M	-	3	0	CSMD3	113634034	0.999000	0.42202	1.000000	0.80357	0.974000	0.67602	0.523000	0.22925	0.653000	0.30826	0.655000	0.94253	ATG		0.378	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		28	42	1	0	7.01153e-11	0.007291	7.7419e-11	28	42				
ASS1	445	broad.mit.edu	37	9	133364742	133364742	+	Silent	SNP	C	C	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr9:133364742C>A	ENST00000372394.1	+	13	1342	c.861C>A	c.(859-861)ggC>ggA	p.G287G	ASS1_ENST00000352480.5_Silent_p.G287G|ASS1_ENST00000493984.2_3'UTR|ASS1_ENST00000372393.3_Silent_p.G287G			P00966	ASSY_HUMAN	argininosuccinate synthase 1	287					acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)	p.G287G(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	CCCCAGCAGGCACCATCCTTT	0.488																																							uc004bzm.2		NA																	1	Substitution - coding silent(1)		kidney(1)	ovary(1)	1						c.(859-861)GGC>GGA		argininosuccinate synthetase 1	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)						100.0	108.0	105.0					9																	133364742		2203	4300	6503	SO:0001819	synonymous_variant	445				arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding	g.chr9:133364742C>A	X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.861C>A	9.37:g.133364742C>A			Somatic				ASS1_uc004bzn.2_Silent_p.G287G|ASS1_uc010mza.2_Silent_p.G363G|ASS1_uc004bzo.2_Silent_p.G268G|ASS1_uc010mzb.2_Silent_p.G325G|ASS1_uc004bzp.2_Silent_p.G287G|ASS1_uc010mzc.2_Silent_p.G287G	p.G287G	NM_000050	NP_000041	WXS	Illumina HiSeq	Unspecified	P00966	ASSY_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000514)	13	1217	+			287					Q6LDL2|Q86UZ0|Q96GT4	Silent	SNP	ENST00000372394.1	37	c.861C>A	CCDS6933.1																																																																																				0.488	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054652.1	NM_000050		8	96	1	0	2.52707e-12	0.006214	2.81968e-12	8	96				
TUBBP5	643224	broad.mit.edu	37	9	141071420	141071420	+	RNA	SNP	G	G	A			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr9:141071420G>A	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5									p.D347N(3)									CTGGTTCCCCGACAACGTAAA	0.512																																							uc004com.2		NA																	3	Substitution - Missense(3)		urinary_tract(2)|kidney(1)		0						c.(823-825)GAC>AAC		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141071420G>A	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071420G>A			Somatic				TUBBP5_uc010ncq.2_3'UTR	p.D275N			WXS	Illumina HiSeq	Unspecified					4	1084	+									Missense_Mutation	SNP	ENST00000503395.1	37	c.823G>A																																																																																					0.512	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		6	75	0	0	0	0.004482	0	6	75				
TUBBP5	643224	broad.mit.edu	37	9	141071629	141071629	+	RNA	SNP	T	T	C			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr9:141071629T>C	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5																		GCAACATGAATGACCTGGTGT	0.537																																							uc004com.2		NA																	0					0						c.(1030-1032)AAT>AAC		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141071629T>C	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071629T>C			Somatic				TUBBP5_uc010ncq.2_3'UTR	p.N344N			WXS	Illumina HiSeq	Unspecified					4	1293	+									Silent	SNP	ENST00000503395.1	37	c.1032T>C																																																																																					0.537	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		27	82	0	0	0	0.003954	0	27	82				
ATRX	546	broad.mit.edu	37	X	76875916	76875916	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chrX:76875916G>T	ENST00000373344.5	-	20	5433	c.5219C>A	c.(5218-5220)tCa>tAa	p.S1740*	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Nonsense_Mutation_p.S1702*	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1740	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.S1740*(2)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CCTCCTCCTTGATCGTATAGA	0.333			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		3	Substitution - Nonsense(2)|Unknown(1)		lung(2)|bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(5218-5220)TCA>TAA		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						81.0	68.0	72.0					X																	76875916		2202	4294	6496	SO:0001587	stop_gained	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76875916G>T	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5219C>A	X.37:g.76875916G>T	ENSP00000362441:p.Ser1740*		Somatic				ATRX_uc004ecq.3_Nonsense_Mutation_p.S1702*|ATRX_uc004eco.3_Nonsense_Mutation_p.S1525*	p.S1740*	NM_000489	NP_000480	WXS	Illumina HiSeq	Unspecified	P46100	ATRX_HUMAN			20	5451	-			1740			Helicase ATP-binding.		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	ENST00000373344.5	37	c.5219C>A	CCDS14434.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.822097|5.822097	0.96989|0.96989	.|.	.|.	ENSG00000085224|ENSG00000085224	ENST00000400866|ENST00000373344;ENST00000395603	.|.	.|.	.|.	4.57|4.57	4.57|4.57	0.56435|0.56435	.|.	.|0.084915	.|0.49916	.|D	.|0.000125	T|.	0.52008|.	0.1708|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.43605|.	-0.9381|.	4|.	.|0.08837	.|T	.|0.75	-4.159|-4.159	16.6125|16.6125	0.84892|0.84892	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	K|X	29|1740;1702	.|.	.|ENSP00000362441:S1740X	Q|S	-|-	1|2	0|0	ATRX|ATRX	76762572|76762572	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.439000|9.439000	0.97543|0.97543	1.833000|1.833000	0.53350|0.53350	0.600000|0.600000	0.82982|0.82982	CAA|TCA		0.333	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		8	43	1	0	1.12685e-05	0.004482	1.19446e-05	8	43				
ACTRT1	139741	broad.mit.edu	37	X	127185954	127185954	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chrX:127185954G>T	ENST00000371124.3	-	1	428	c.232C>A	c.(232-234)Ctg>Atg	p.L78M		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	78						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.L78M(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						CCTGTTACCAGTCCACGCTCA	0.493																																							uc004eum.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|skin(1)	5						c.(232-234)CTG>ATG		actin-related protein T1							184.0	170.0	175.0					X																	127185954		2203	4300	6503	SO:0001583	missense	139741					cytoplasm|cytoskeleton		g.chrX:127185954G>T	AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.232C>A	X.37:g.127185954G>T	ENSP00000360165:p.Leu78Met		Somatic					p.L78M	NM_138289	NP_612146	WXS	Illumina HiSeq	Unspecified	Q8TDG2	ACTT1_HUMAN			1	429	-			78					Q6X7C1|Q96L10	Missense_Mutation	SNP	ENST00000371124.3	37	c.232C>A	CCDS14611.1	.	.	.	.	.	.	.	.	.	.	G	4.813	0.151153	0.09185	.	.	ENSG00000123165	ENST00000371124	D	0.94793	-3.52	3.76	1.91	0.25777	.	0.335252	0.21605	N	0.071900	D	0.88636	0.6490	L	0.28694	0.88	0.23940	N	0.996407	P	0.39883	0.693	B	0.40782	0.34	T	0.81980	-0.0684	10	0.87932	D	0	.	3.9688	0.09444	0.1207:0.0:0.4617:0.4175	.	78	Q8TDG2	ACTT1_HUMAN	M	78	ENSP00000360165:L78M	ENSP00000360165:L78M	L	-	1	2	ACTRT1	127013635	0.902000	0.30710	0.002000	0.10522	0.101000	0.19017	1.590000	0.36654	0.372000	0.24591	0.544000	0.68410	CTG		0.493	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058192.1	NM_138289		64	210	1	0	3.37043e-27	0.01441	4.05984e-27	64	210				
RSPRY1	89970	broad.mit.edu	37	16	57261295	57261295	+	Frame_Shift_Del	DEL	T	T	-			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr16:57261295delT	ENST00000537866.1	+	11	2076	c.1203delT	c.(1201-1203)tatfs	p.Y401fs	RSPRY1_ENST00000563073.1_3'UTR|RSPRY1_ENST00000394420.4_Frame_Shift_Del_p.Y401fs			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	401	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular region (GO:0005576)	zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						CCTGTGCGTATGATGGCTGCC	0.483																																							uc002elb.2		NA																	0				ovary(1)	1						c.(1201-1203)TATfs		ring finger and SPRY domain containing 1							131.0	106.0	114.0					16																	57261295		2198	4300	6498	SO:0001589	frameshift_variant	89970					extracellular region	zinc ion binding	g.chr16:57261295delT	AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.1203delT	16.37:g.57261295delT	ENSP00000443176:p.Tyr401fs		Somatic				RSPRY1_uc002elc.2_Frame_Shift_Del_p.Y401fs|RSPRY1_uc002eld.2_Frame_Shift_Del_p.Y401fs	p.Y401fs	NM_133368	NP_588609	WXS	Illumina HiSeq	Unspecified	Q96DX4	RSPRY_HUMAN			11	1481	+			401			B30.2/SPRY.		Q6UX21|Q8ND53	Frame_Shift_Del	DEL	ENST00000537866.1	37	c.1203delT	CCDS10775.1																																																																																				0.483	RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432953.1	NM_133368		13	40	NA	NA	NA	NA	NA	13	40	---	---	---	---
OR7G1	125962	broad.mit.edu	37	19	9226266	9226266	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5944-01A-11D-1753-08	TCGA-50-5944-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	a314ee0c-694b-4ac8-b572-ff1fbbda4765	c84c2300-f61a-4475-800d-75efe77a7716	g.chr19:9226266delG	ENST00000541538.1	-	1	173	c.174delC	c.(172-174)cccfs	p.P58fs	OR7G1_ENST00000293614.1_Frame_Shift_Del_p.P58fs	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						GGAAGTACATGGGGGTGTGGA	0.483																																							uc002mks.1		NA																	0				ovary(2)	2						c.(172-174)CCCfs		olfactory receptor, family 7, subfamily G,							143.0	138.0	140.0					19																	9226266		2203	4300	6503	SO:0001589	frameshift_variant	125962				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9226266delG		CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.174delC	19.37:g.9226266delG	ENSP00000444134:p.Pro58fs		Somatic					p.P58fs	NM_001005192	NP_001005192	WXS	Illumina HiSeq	Unspecified	Q8NGA0	OR7G1_HUMAN			1	174	-			58			Helical; Name=2; (Potential).		Q6IFJ5|Q96RA1	Frame_Shift_Del	DEL	ENST00000541538.1	37	c.174delC	CCDS32898.2																																																																																				0.483	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397912.1			53	38	NA	NA	NA	NA	NA	53	38	---	---	---	---
