#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PLCH2	9651	broad.mit.edu	37	1	2420731	2420731	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:2420731G>A	ENST00000419816.2	+	9	1595	c.1321G>A	c.(1321-1323)Gac>Aac	p.D441N	PLCH2_ENST00000449969.1_Missense_Mutation_p.D414N|PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000378488.3_Missense_Mutation_p.D441N|PLCH2_ENST00000378486.3_Missense_Mutation_p.D441N			O75038	PLCH2_HUMAN	phospholipase C, eta 2	441	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.D441N(1)|p.D288N(1)		central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CATCCTTGGGGACAAGCTGGA	0.552																																							uc001aji.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(3)|ovary(1)|skin(1)	5						c.(1321-1323)GAC>AAC		phospholipase C, eta 2							151.0	154.0	153.0					1																	2420731		2120	4247	6367	SO:0001583	missense	9651				intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr1:2420731G>A	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.1321G>A	1.37:g.2420731G>A	ENSP00000389803:p.Asp441Asn		Somatic				PLCH2_uc010nyz.1_Missense_Mutation_p.D229N|PLCH2_uc009vle.1_Missense_Mutation_p.D229N|PLCH2_uc001ajj.1_Missense_Mutation_p.D229N|PLCH2_uc001ajk.1_Missense_Mutation_p.D229N	p.D441N	NM_014638	NP_055453	WXS	Illumina HiSeq	Unspecified	O75038	PLCH2_HUMAN		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)	9	1595	+	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	441			PI-PLC X-box.		A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37	c.1321G>A		.	.	.	.	.	.	.	.	.	.	G	33	5.231419	0.95207	.	.	ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000343889;ENST00000278878	T;T;T	0.58060	0.36;0.36;0.36	5.1	5.1	0.69264	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.052069	0.85682	D	0.000000	T	0.76011	0.3928	M	0.85630	2.765	0.80722	D	1	D;D;D;D	0.76494	0.996;0.999;0.995;0.999	D;D;D;D	0.75484	0.976;0.986;0.928;0.986	T	0.80819	-0.1212	10	0.87932	D	0	.	17.5209	0.87787	0.0:0.0:1.0:0.0	.	288;229;414;441	B9DI81;B9DI82;O75038-2;O75038	.;.;.;PLCH2_HUMAN	N	414;441;441;288;229	ENSP00000397289:D414N;ENSP00000367747:D441N;ENSP00000367749:D441N	ENSP00000278878:D229N	D	+	1	0	PLCH2	2410591	1.000000	0.71417	0.997000	0.53966	0.924000	0.55760	7.781000	0.85668	2.371000	0.80710	0.561000	0.74099	GAC		0.552	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638		16	65	0	0	0	0.004007	0	16	65				
ATP13A2	23400	broad.mit.edu	37	1	17331296	17331296	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:17331296G>A	ENST00000326735.8	-	5	401	c.368C>T	c.(367-369)tCc>tTc	p.S123F	ATP13A2_ENST00000452699.1_Missense_Mutation_p.S123F|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000341676.5_Missense_Mutation_p.S123F			Q9NQ11	AT132_HUMAN	ATPase type 13A2	123					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.S123F(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		CTCTGCCTGGGACTGTGGGGA	0.662																																							uc001baa.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(367-369)TCC>TTC		ATPase type 13A2 isoform 1							54.0	59.0	57.0					1																	17331296		2203	4300	6503	SO:0001583	missense	23400				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr1:17331296G>A	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.368C>T	1.37:g.17331296G>A	ENSP00000327214:p.Ser123Phe		Somatic				ATP13A2_uc001bab.2_Missense_Mutation_p.S123F|ATP13A2_uc001bac.2_Missense_Mutation_p.S123F	p.S123F	NM_022089	NP_071372	WXS	Illumina HiSeq	Unspecified	Q9NQ11	AT132_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	5	558	-		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)	123			Cytoplasmic (Potential).		O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	37	c.368C>T	CCDS175.1	.	.	.	.	.	.	.	.	.	.	G	4.583	0.108308	0.08780	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000511957	T;T;T;T	0.64260	1.9;1.9;1.9;-0.09	4.21	-3.27	0.05048	.	2.347610	0.01220	N	0.008094	T	0.41073	0.1143	N	0.08118	0	0.09310	N	1	B;B;B	0.20368	0.018;0.023;0.044	B;B;B	0.32928	0.063;0.004;0.155	T	0.25847	-1.0120	10	0.46703	T	0.11	-0.523	0.8787	0.01230	0.3168:0.1134:0.3486:0.2212	.	123;123;123	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	F	123;123;123;27	ENSP00000327214:S123F;ENSP00000341115:S123F;ENSP00000413307:S123F;ENSP00000427241:S27F	ENSP00000327214:S123F	S	-	2	0	ATP13A2	17203883	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.072000	0.11486	-0.497000	0.06641	-0.657000	0.03884	TCC		0.662	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089		13	78	0	0	0	0.00245	0	13	78				
PADI4	23569	broad.mit.edu	37	1	17666217	17666217	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:17666217G>A	ENST00000375448.4	+	6	587	c.561G>A	c.(559-561)acG>acA	p.T187T	AC004824.2_ENST00000602074.1_Intron	NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	187					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.T187T(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	CCCTGAGCACGAAGACCCCCA	0.562																																							uc001baj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(559-561)ACG>ACA		peptidyl arginine deiminase, type IV	L-Citrulline(DB00155)						151.0	124.0	133.0					1																	17666217		2203	4300	6503	SO:0001819	synonymous_variant	23569				chromatin modification|peptidyl-citrulline biosynthetic process from peptidyl-arginine|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity	g.chr1:17666217G>A	AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.561G>A	1.37:g.17666217G>A			Somatic				PADI4_uc009vpc.2_Silent_p.T187T	p.T187T	NM_012387	NP_036519	WXS	Illumina HiSeq	Unspecified	Q9UM07	PADI4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	6	589	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)	187					A8K392|B2RBW0|Q5VTZ8|Q70SX4	Silent	SNP	ENST00000375448.4	37	c.561G>A	CCDS180.1																																																																																				0.562	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006799.1	NM_012387		9	37	0	0	0	0.004482	0	9	37				
ARHGEF10L	55160	broad.mit.edu	37	1	17991008	17991008	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:17991008C>G	ENST00000361221.3	+	26	3086	c.2927C>G	c.(2926-2928)aCc>aGc	p.T976S	ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.T937S|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.T971S|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.T937S|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.T679S|ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.T749S|ARHGEF10L_ENST00000469726.1_3'UTR	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	976						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T976S(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CCTGTCCGCACCCTGTTGAGC	0.672																																							uc001ban.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|ovary(1)|pancreas(1)	3						c.(2926-2928)ACC>AGC		Rho guanine nucleotide exchange factor (GEF)							47.0	48.0	48.0					1																	17991008		2203	4300	6503	SO:0001583	missense	55160				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity	g.chr1:17991008C>G	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.2927C>G	1.37:g.17991008C>G	ENSP00000355060:p.Thr976Ser		Somatic				ARHGEF10L_uc009vpe.1_Missense_Mutation_p.T937S|ARHGEF10L_uc001bao.2_Missense_Mutation_p.T937S|ARHGEF10L_uc001bap.2_Missense_Mutation_p.T932S|ARHGEF10L_uc001baq.2_Missense_Mutation_p.T737S|ARHGEF10L_uc010ocs.1_Missense_Mutation_p.T749S|ARHGEF10L_uc001bar.2_Missense_Mutation_p.T679S|ARHGEF10L_uc009vpf.2_RNA	p.T976S	NM_018125	NP_060595	WXS	Illumina HiSeq	Unspecified	Q9HCE6	ARGAL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)	26	3086	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)	976					B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	37	c.2927C>G	CCDS182.1	.	.	.	.	.	.	.	.	.	.	C	0.102	-1.150274	0.01700	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T	0.59364	1.72;1.72;0.27;1.72;1.72;1.72	4.22	4.22	0.49857	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.420495	0.25511	N	0.030161	T	0.27933	0.0688	N	0.02169	-0.655	0.27270	N	0.958387	B;B;B;B;B;B;B	0.11235	0.001;0.001;0.004;0.0;0.001;0.003;0.003	B;B;B;B;B;B;B	0.14023	0.0;0.009;0.01;0.0;0.004;0.009;0.004	T	0.05115	-1.0905	10	0.02654	T	1	-22.5337	15.5245	0.75890	0.0:1.0:0.0:0.0	.	749;971;679;737;932;937;976	Q5VXI4;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;ARGAL_HUMAN	S	976;937;971;937;749;749;679	ENSP00000355060:T976S;ENSP00000399401:T937S;ENSP00000394621:T971S;ENSP00000364564:T937S;ENSP00000364557:T749S;ENSP00000167825:T679S	ENSP00000167825:T679S	T	+	2	0	ARHGEF10L	17863595	0.001000	0.12720	0.949000	0.38748	0.543000	0.35085	1.115000	0.31209	2.063000	0.61619	0.462000	0.41574	ACC		0.672	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125		5	18	0	0	0	0.001984	0	5	18				
BSND	7809	broad.mit.edu	37	1	55472787	55472787	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:55472787C>T	ENST00000371265.4	+	3	644	c.390C>T	c.(388-390)tcC>tcT	p.S130S		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	130					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)	p.S130S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						ACCACCGCTCCTTGCTGGCCC	0.607																																					Ovarian(191;1657 2078 22894 42033 48899)	Ovarian(191;1657 2078 22894 42033 48899)	uc001cye.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(388-390)TCC>TCT		barttin							67.0	65.0	65.0					1																	55472787		2203	4300	6503	SO:0001819	synonymous_variant	7809					basolateral plasma membrane|cytoplasm|integral to plasma membrane|protein complex		g.chr1:55472787C>T	AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.390C>T	1.37:g.55472787C>T			Somatic					p.S130S	NM_057176	NP_476517	WXS	Illumina HiSeq	Unspecified	Q8WZ55	BSND_HUMAN			3	633	+			130			Cytoplasmic (Potential).		Q6NT28	Silent	SNP	ENST00000371265.4	37	c.390C>T	CCDS602.1																																																																																				0.607	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022213.4	NM_057176		5	55	0	0	0	0.001984	0	5	55				
KANK4	163782	broad.mit.edu	37	1	62740490	62740490	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:62740490G>T	ENST00000371153.4	-	3	664	c.286C>A	c.(286-288)Cca>Aca	p.P96T	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	96						cytoplasm (GO:0005737)		p.P96T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						GCCTCCCTTGGCACCACGGGA	0.612																																							uc001dah.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|lung(1)	6						c.(286-288)CCA>ACA		ankyrin repeat domain 38							60.0	69.0	66.0					1																	62740490		2203	4300	6503	SO:0001583	missense	163782							g.chr1:62740490G>T	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.286C>A	1.37:g.62740490G>T	ENSP00000360195:p.Pro96Thr		Somatic				KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	p.P96T	NM_181712	NP_859063	WXS	Illumina HiSeq	Unspecified	Q5T7N3	KANK4_HUMAN			3	663	-			96					B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	c.286C>A	CCDS620.1	.	.	.	.	.	.	.	.	.	.	g	9.665	1.145095	0.21288	.	.	ENSG00000132854	ENST00000371153	T	0.76060	-0.99	4.99	-1.42	0.08913	.	0.904105	0.09142	N	0.842858	T	0.64768	0.2628	L	0.54323	1.7	0.09310	N	1	B	0.17038	0.02	B	0.11329	0.006	T	0.50857	-0.8778	10	0.38643	T	0.18	-0.2831	6.0384	0.19720	0.4419:0.1252:0.4329:0.0	.	96	Q5T7N3	KANK4_HUMAN	T	96	ENSP00000360195:P96T	ENSP00000360195:P96T	P	-	1	0	KANK4	62513078	0.017000	0.18338	0.000000	0.03702	0.002000	0.02628	1.459000	0.35234	-0.462000	0.06984	-0.987000	0.02553	CCA		0.612	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712		16	100	1	0	2.48551e-13	0.00499	3.69662e-13	16	100				
LRRIQ3	127255	broad.mit.edu	37	1	74507380	74507380	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:74507380C>T	ENST00000395089.1	-	6	1234	c.1235G>A	c.(1234-1236)aGa>aAa	p.R412K	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.R412K			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	412								p.R412K(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						CATACCAGCTCTTTGTGGTGC	0.368																																							uc001dfy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1234-1236)AGA>AAA		leucine-rich repeats and IQ motif containing 3							133.0	119.0	124.0					1																	74507380		1842	4084	5926	SO:0001583	missense	127255							g.chr1:74507380C>T	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1235G>A	1.37:g.74507380C>T	ENSP00000378524:p.Arg412Lys		Somatic				LRRIQ3_uc001dfz.3_RNA	p.R412K	NM_001105659	NP_001099129	WXS	Illumina HiSeq	Unspecified	A6PVS8	LRIQ3_HUMAN			7	1427	-			412					A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	c.1235G>A	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	C	9.200	1.028245	0.19512	.	.	ENSG00000162620	ENST00000395089;ENST00000354431	T;T	0.08008	3.14;3.14	5.77	3.91	0.45181	.	0.283676	0.25639	N	0.029298	T	0.01976	0.0062	L	0.34521	1.04	0.09310	N	1	B	0.17852	0.024	B	0.13407	0.009	T	0.45145	-0.9281	10	0.21540	T	0.41	.	9.2037	0.37275	0.0:0.8327:0.0:0.1673	.	412	A6PVS8	LRIQ3_HUMAN	K	412	ENSP00000378524:R412K;ENSP00000346414:R412K	ENSP00000346414:R412K	R	-	2	0	LRRIQ3	74279968	0.011000	0.17503	0.001000	0.08648	0.024000	0.10985	2.425000	0.44723	0.909000	0.36697	0.585000	0.79938	AGA		0.368	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258		37	82	0	0	0	0.004878	0	37	82				
ERICH3	127254	broad.mit.edu	37	1	75086594	75086594	+	Nonsense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:75086594G>C	ENST00000326665.5	-	8	1042	c.824C>G	c.(823-825)tCa>tGa	p.S275*	C1orf173_ENST00000420661.2_Nonsense_Mutation_p.S78*|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		275								p.S275*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AATCCTTCTTGAATCCTGAAA	0.318																																							uc001dgg.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(823-825)TCA>TGA		hypothetical protein LOC127254							66.0	63.0	64.0					1																	75086594		2203	4300	6503	SO:0001587	stop_gained	127254							g.chr1:75086594G>C																												ENST00000326665.5:c.824C>G	1.37:g.75086594G>C	ENSP00000322609:p.Ser275*		Somatic				uc001dgh.2_Intron|C1orf173_uc001dgi.3_Nonsense_Mutation_p.S69*	p.S275*	NM_001002912	NP_001002912	WXS	Illumina HiSeq	Unspecified	Q5RHP9	CA173_HUMAN			8	1043	-			275					Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Nonsense_Mutation	SNP	ENST00000326665.5	37	c.824C>G	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	18.34	3.603147	0.66445	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-3.149	20.239	0.98366	0.0:0.0:1.0:0.0	.	.	.	.	X	275;78	.	ENSP00000322609:S275X	S	-	2	0	C1orf173	74859182	0.938000	0.31826	0.954000	0.39281	0.060000	0.15804	4.644000	0.61397	2.884000	0.98904	0.655000	0.94253	TCA		0.318	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			4	39	0	0	0	0.009096	0	4	39				
FUBP1	8880	broad.mit.edu	37	1	78425923	78425923	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:78425923G>A	ENST00000370768.2	-	16	1603	c.1522C>T	c.(1522-1524)Cag>Tag	p.Q508*	FUBP1_ENST00000436586.2_Nonsense_Mutation_p.Q529*|FUBP1_ENST00000370767.1_Nonsense_Mutation_p.Q508*	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	508	Pro-rich.				positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.Q508*(1)		central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						CCCCATCCCTGGGGAGCATAT	0.438			"""F, N"""		oligodendroglioma																																		uc001dii.2		NA		Rec	yes		1	1p13.1	8880		far upstream element (FUSE) binding protein 1			O					1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(2)|lung(1)	3						c.(1522-1524)CAG>TAG		far upstream element-binding protein							50.0	54.0	53.0					1																	78425923		2203	4300	6503	SO:0001587	stop_gained	8880				transcription from RNA polymerase II promoter	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding	g.chr1:78425923G>A	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1522C>T	1.37:g.78425923G>A	ENSP00000359804:p.Gln508*		Somatic				FUBP1_uc001dih.3_RNA|FUBP1_uc010orm.1_Nonsense_Mutation_p.Q529*	p.Q508*	NM_003902	NP_003893	WXS	Illumina HiSeq	Unspecified	Q96AE4	FUBP1_HUMAN			16	1611	-			508			Pro-rich.		Q12828	Nonsense_Mutation	SNP	ENST00000370768.2	37	c.1522C>T	CCDS683.1	.	.	.	.	.	.	.	.	.	.	G	38	7.067670	0.98040	.	.	ENSG00000162613	ENST00000370773;ENST00000370767;ENST00000370768;ENST00000394922;ENST00000436586	.	.	.	5.6	4.69	0.59074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-8.3748	14.2284	0.65875	0.0712:0.0:0.9287:0.0	.	.	.	.	X	507;508;508;493;529	.	ENSP00000294623:Q507X	Q	-	1	0	FUBP1	78198511	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.561000	0.82288	1.362000	0.46000	0.650000	0.86243	CAG		0.438	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902		11	62	0	0	0	0.008291	0	11	62				
AMIGO1	57463	broad.mit.edu	37	1	110050444	110050444	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:110050444T>C	ENST00000369864.4	-	2	1440	c.1091A>G	c.(1090-1092)cAc>cGc	p.H364R	AMIGO1_ENST00000369862.1_Missense_Mutation_p.H364R					adhesion molecule with Ig-like domain 1									p.H364R(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0182)|Epithelial(280;0.046)|all cancers(265;0.0492)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)		ATGGTGTCCGTGCAAGGTGAA	0.517																																							uc001dxx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1090-1092)CAC>CGC		AMIGO protein precursor							176.0	148.0	157.0					1																	110050444		2203	4300	6503	SO:0001583	missense	57463				axonal fasciculation|heterophilic cell-cell adhesion|homophilic cell adhesion|myelination|positive regulation of axonogenesis	axon|integral to membrane		g.chr1:110050444T>C		CCDS30795.1	1p13.3	2013-01-11			ENSG00000181754	ENSG00000181754		"""Immunoglobulin superfamily / V-set domain containing"""	20824	protein-coding gene	gene with protein product	"""amphoterin-induced gene and open reading frame"""	615689				12629050	Standard	NM_020703		Approved	AMIGO, KIAA1163	uc001dxx.4	Q86WK6	OTTHUMG00000011653	ENST00000369864.4:c.1091A>G	1.37:g.110050444T>C	ENSP00000358880:p.His364Arg		Somatic					p.H364R	NM_020703	NP_065754	WXS	Illumina HiSeq	Unspecified	Q86WK6	AMGO1_HUMAN		Colorectal(144;0.0129)|Lung(183;0.0182)|Epithelial(280;0.046)|all cancers(265;0.0492)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)	2	1473	-		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)	364			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000369864.4	37	c.1091A>G	CCDS30795.1	.	.	.	.	.	.	.	.	.	.	T	5.626	0.300184	0.10622	.	.	ENSG00000181754	ENST00000369864;ENST00000369862	T;T	0.50001	0.76;0.76	6.17	3.77	0.43336	.	0.159697	0.39544	N	0.001328	T	0.20455	0.0492	L	0.47716	1.5	0.46458	D	0.999052	B	0.19817	0.039	B	0.13407	0.009	T	0.06409	-1.0828	10	0.15952	T	0.53	-10.9555	12.3779	0.55291	0.0:0.0:0.2663:0.7337	.	364	Q86WK6	AMGO1_HUMAN	R	364	ENSP00000358880:H364R;ENSP00000358878:H364R	ENSP00000358878:H364R	H	-	2	0	AMIGO1	109851967	0.001000	0.12720	0.963000	0.40424	0.974000	0.67602	0.258000	0.18387	0.508000	0.28173	0.533000	0.62120	CAC		0.517	AMIGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032247.1	NM_020703		7	49	0	0	0	0.00308	0	7	49				
PDE4DIP	9659	broad.mit.edu	37	1	144882871	144882871	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:144882871G>T	ENST00000369354.3	-	24	3337	c.3148C>A	c.(3148-3150)Ctg>Atg	p.L1050M	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.L1187M|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.L1187M|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.L1116M|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.L1050M			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1050					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.L1050M(2)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CAAAGGCTCAGCATGGTGTTC	0.493			T	PDGFRB	MPD																																		uc001elw.3		NA		Dom	yes		1	1q12	9659	T	phosphodiesterase 4D interacting protein (myomegalin)			L	PDGFRB		MPD		2	Substitution - Missense(2)		lung(2)	ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5						c.(3148-3150)CTG>ATG		phosphodiesterase 4D interacting protein isoform							225.0	210.0	215.0					1																	144882871		2203	4296	6499	SO:0001583	missense	9659				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding	g.chr1:144882871G>T	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.3148C>A	1.37:g.144882871G>T	ENSP00000358360:p.Leu1050Met		Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.L1116M|PDE4DIP_uc001elv.3_Missense_Mutation_p.L57M	p.L1050M	NM_014644	NP_055459	WXS	Illumina HiSeq	Unspecified	Q5VU43	MYOME_HUMAN		Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)	24	3439	-			1050					A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	c.3148C>A	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758639	0.69763	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.02103	4.45;4.46;4.57;4.49;4.48	5.9	4.04	0.47022	.	.	.	.	.	T	0.02649	0.0080	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.988;0.997	T	0.56691	-0.7937	9	0.56958	D	0.05	.	10.579	0.45244	0.1562:0.0:0.8438:0.0	.	1116;1050	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	M	1116;1050;1050;1187;1187	ENSP00000327209:L1116M;ENSP00000358360:L1050M;ENSP00000358363:L1050M;ENSP00000435654:L1187M;ENSP00000358366:L1187M	ENSP00000327209:L1116M	L	-	1	2	PDE4DIP	143594228	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.518000	0.53451	0.845000	0.35118	0.655000	0.94253	CTG		0.493	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359		20	275	1	0	2.21704e-12	0.00278	3.28539e-12	20	275				
PDE4DIP	9659	broad.mit.edu	37	1	144915608	144915608	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:144915608C>A	ENST00000369354.3	-	14	2006	c.1817G>T	c.(1816-1818)gGa>gTa	p.G606V	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.G743V|PDE4DIP_ENST00000369351.3_Missense_Mutation_p.G606V|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.G769V|PDE4DIP_ENST00000479408.2_Missense_Mutation_p.G393V|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.G606V|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.G769V|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.G743V|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.G672V|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.G606V			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	606					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.G606V(2)|p.G769V(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTGCCCTGGTCCAAGTTTGCA	0.468			T	PDGFRB	MPD																																		uc001elw.3		NA		Dom	yes		1	1q12	9659	T	phosphodiesterase 4D interacting protein (myomegalin)			L	PDGFRB		MPD		3	Substitution - Missense(3)		lung(3)	ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5						c.(1816-1818)GGA>GTA		phosphodiesterase 4D interacting protein isoform							135.0	125.0	129.0					1																	144915608		2203	4296	6499	SO:0001583	missense	9659				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding	g.chr1:144915608C>A	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.1817G>T	1.37:g.144915608C>A	ENSP00000358360:p.Gly606Val		Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.G672V|PDE4DIP_uc001emc.1_Missense_Mutation_p.G606V|PDE4DIP_uc001emd.1_Missense_Mutation_p.G606V|PDE4DIP_uc001emb.1_Missense_Mutation_p.G769V|PDE4DIP_uc001eme.1_Missense_Mutation_p.G135V|PDE4DIP_uc001emf.1_Missense_Mutation_p.G391V	p.G606V	NM_014644	NP_055459	WXS	Illumina HiSeq	Unspecified	Q5VU43	MYOME_HUMAN		Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)	14	2108	-			606			Potential.		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	c.1817G>T	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.489851	0.44249	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369353;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000313431;ENST00000529945;ENST00000479408	T;T;T;T;T;T;T;T;T;T	0.62941	4.69;4.79;4.79;4.79;4.79;3.79;3.8;2.72;2.72;-0.01	5.2	3.33	0.38152	.	.	.	.	.	T	0.52948	0.1766	L	0.57536	1.79	0.80722	D	1	P;D;P;P;P;D	0.89917	0.865;0.975;0.933;0.947;0.663;1.0	B;P;P;P;B;D	0.81914	0.301;0.69;0.804;0.481;0.323;0.995	T	0.63668	-0.6585	9	0.05721	T	0.95	.	7.8844	0.29642	0.0:0.7438:0.0:0.2562	.	769;393;606;769;672;606	E9PL24;E9PQG4;Q5VU43-7;Q5VU43-2;Q5VU43-3;Q5VU43	.;.;.;.;.;MYOME_HUMAN	V	672;606;606;769;743;743;606;606;769;769;393	ENSP00000327209:G672V;ENSP00000358360:G606V;ENSP00000358363:G606V;ENSP00000435654:G743V;ENSP00000358366:G743V;ENSP00000358357:G606V;ENSP00000358355:G606V;ENSP00000316434:G769V;ENSP00000433392:G769V;ENSP00000436791:G393V	ENSP00000327209:G672V	G	-	2	0	PDE4DIP	143626965	0.931000	0.31567	1.000000	0.80357	0.969000	0.65631	1.037000	0.30241	0.722000	0.32252	-0.802000	0.03209	GGA		0.468	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359		20	107	1	0	8.04996e-18	0.001882	1.26632e-17	20	107				
VPS45	11311	broad.mit.edu	37	1	150039930	150039930	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:150039930G>T	ENST00000369130.3	+	1	562	c.16G>T	c.(16-18)Gct>Tct	p.A6S	VPS45_ENST00000535106.1_Missense_Mutation_p.A6S|VPS45_ENST00000369128.5_Intron	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)	6					blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)		p.A6S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGTGGTTTTTGCTGTGAAGCA	0.498																																							uc001etp.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(16-18)GCT>TCT		vacuolar protein sorting 45A							161.0	164.0	163.0					1																	150039930		2203	4300	6503	SO:0001583	missense	11311				blood coagulation|intracellular protein transport|vesicle docking involved in exocytosis	endosome membrane|Golgi membrane|integral to membrane of membrane fraction		g.chr1:150039930G>T	U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.16G>T	1.37:g.150039930G>T	ENSP00000358126:p.Ala6Ser		Somatic				VPS45_uc010pbp.1_RNA|VPS45_uc010pbq.1_5'UTR|VPS45_uc010pbs.1_Intron|VPS45_uc009wlm.1_Missense_Mutation_p.A6S|VPS45_uc010pbr.1_Intron	p.A6S	NM_007259	NP_009190	WXS	Illumina HiSeq	Unspecified	Q9NRW7	VPS45_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		1	589	+	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		6					D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	Missense_Mutation	SNP	ENST00000369130.3	37	c.16G>T	CCDS944.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692981	0.88735	.	.	ENSG00000136631	ENST00000369130;ENST00000543996;ENST00000535106;ENST00000419023	T;T;T	0.30714	1.52;1.52;1.52	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.23727	0.0574	M	0.63428	1.95	0.80722	D	1	B;B	0.25105	0.118;0.118	B;B	0.21360	0.034;0.034	T	0.01988	-1.1234	10	0.48119	T	0.1	.	18.945	0.92618	0.0:0.0:1.0:0.0	.	6;6	Q53FR8;Q9NRW7	.;VPS45_HUMAN	S	6	ENSP00000358126:A6S;ENSP00000440690:A6S;ENSP00000400143:A6S	ENSP00000358126:A6S	A	+	1	0	VPS45	148306554	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.106000	0.94253	2.821000	0.97095	0.650000	0.86243	GCT		0.498	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034964.1	NM_007259		33	92	1	0	4.14481e-20	0.00623	6.67412e-20	33	92				
FLG	2312	broad.mit.edu	37	1	152286898	152286898	+	Missense_Mutation	SNP	C	C	A	rs113297198		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:152286898C>A	ENST00000368799.1	-	3	499	c.464G>T	c.(463-465)aGt>aTt	p.S155I	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	155					establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S155I(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTTTCAGAACTAGATTCATG	0.353									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(463-465)AGT>ATT		filaggrin							140.0	150.0	146.0					1																	152286898		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152286898C>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.464G>T	1.37:g.152286898C>A	ENSP00000357789:p.Ser155Ile		Somatic				uc001ezv.2_Intron	p.S155I	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	500	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		155					Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.464G>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	9.900	1.206707	0.22205	.	.	ENSG00000143631	ENST00000368799	T	0.00686	5.85	4.82	-9.65	0.00537	.	.	.	.	.	T	0.00328	0.0010	N	0.12182	0.205	0.09310	N	1	D	0.61080	0.989	P	0.53689	0.732	T	0.36553	-0.9743	9	0.46703	T	0.11	-3.45	10.4701	0.44631	0.0:0.1451:0.5155:0.3395	.	155	P20930	FILA_HUMAN	I	155	ENSP00000357789:S155I	ENSP00000357789:S155I	S	-	2	0	FLG	150553522	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.993000	0.00656	-2.310000	0.00650	-0.968000	0.02614	AGT		0.353	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		26	150	1	0	5.45024e-15	0.00333	8.31772e-15	26	150				
LCE1F	353137	broad.mit.edu	37	1	152748857	152748857	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:152748857C>A	ENST00000334371.2	+	1	10	c.10C>A	c.(10-12)Cag>Aag	p.Q4K		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	4					keratinization (GO:0031424)			p.Q4K(1)		kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GATGTCTTGCCAGCAGAGCCA	0.607																																							uc010pdv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(10-12)CAG>AAG		late cornified envelope 1F							59.0	59.0	59.0					1																	152748857		2203	4300	6503	SO:0001583	missense	353137				keratinization			g.chr1:152748857C>A		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.10C>A	1.37:g.152748857C>A	ENSP00000334187:p.Gln4Lys		Somatic					p.Q4K	NM_178354	NP_848131	WXS	Illumina HiSeq	Unspecified	Q5T754	LCE1F_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		1	10	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		4						Missense_Mutation	SNP	ENST00000334371.2	37	c.10C>A	CCDS1023.1	.	.	.	.	.	.	.	.	.	.	C	12.09	1.834773	0.32421	.	.	ENSG00000240386	ENST00000334371	T	0.07800	3.16	4.42	4.42	0.53409	.	0.000000	0.33534	N	0.004804	T	0.20251	0.0487	M	0.87456	2.885	0.26655	N	0.972025	P	0.52577	0.954	D	0.65140	0.932	T	0.01496	-1.1340	10	0.87932	D	0	.	12.7047	0.57054	0.0:1.0:0.0:0.0	.	4	Q5T754	LCE1F_HUMAN	K	4	ENSP00000334187:Q4K	ENSP00000334187:Q4K	Q	+	1	0	LCE1F	151015481	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	3.596000	0.54024	2.444000	0.82710	0.563000	0.77884	CAG		0.607	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354		6	41	1	0	8.12818e-05	0.001984	9.33828e-05	6	41				
RHBG	57127	broad.mit.edu	37	1	156354339	156354339	+	Missense_Mutation	SNP	T	T	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:156354339T>G	ENST00000368249.1	+	9	1294	c.1256T>G	c.(1255-1257)tTt>tGt	p.F419C	RHBG_ENST00000368246.2_Missense_Mutation_p.F419C|RHBG_ENST00000400992.2_Missense_Mutation_p.F387C|RHBG_ENST00000494874.1_Intron|RHBG_ENST00000255013.3_Missense_Mutation_p.F350C	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	419	Interaction with ANK3.				ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.F419C(2)|p.F387C(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					AAGCTACCCTTTCTGGACTCC	0.627											OREG0013871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010pho.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(1255-1257)TTT>TGT		Rhesus blood group, B glycoprotein							69.0	80.0	76.0					1																	156354339		1983	4153	6136	SO:0001583	missense	57127				transepithelial ammonium transport	anchored to plasma membrane|basolateral plasma membrane|cytoplasmic vesicle membrane|integral to plasma membrane|spectrin-associated cytoskeleton	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding	g.chr1:156354339T>G	AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.1256T>G	1.37:g.156354339T>G	ENSP00000357232:p.Phe419Cys		Somatic	OREG0013871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1777	RHBG_uc010phn.1_RNA|RHBG_uc001fos.2_Missense_Mutation_p.F350C|RHBG_uc009wrz.2_Missense_Mutation_p.F387C|RHBG_uc001for.2_Missense_Mutation_p.F389C	p.F419C	NM_020407	NP_065140	WXS	Illumina HiSeq	Unspecified	Q9H310	RHBG_HUMAN			9	1294	+	Hepatocellular(266;0.158)		419	F->A: Loss of interaction with ANK3. Intracellular retention; when associated with A-420 and A-421.		Interaction with ANK3.|Cytoplasmic (Potential).		A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Missense_Mutation	SNP	ENST00000368249.1	37	c.1256T>G		.	.	.	.	.	.	.	.	.	.	T	13.78	2.338569	0.41398	.	.	ENSG00000132677	ENST00000368249;ENST00000368246;ENST00000400992;ENST00000255013	T;T;T;T	0.22945	2.07;2.11;1.93;1.93	5.94	-9.27	0.00659	Ammonium transporter AmtB-like (2);	0.757532	0.12873	N	0.432077	T	0.03695	0.0105	N	0.16862	0.45	0.09310	N	0.999995	B;B;B	0.19817	0.0;0.007;0.039	B;B;B	0.23275	0.002;0.007;0.045	T	0.41251	-0.9519	10	0.56958	D	0.05	-16.9918	6.5589	0.22476	0.1898:0.0703:0.576:0.1639	.	419;387;456	Q9H310;Q9H310-3;Q5SZW5	RHBG_HUMAN;.;.	C	419;419;387;350	ENSP00000357232:F419C;ENSP00000357229:F419C;ENSP00000383777:F387C;ENSP00000255013:F350C	ENSP00000255013:F350C	F	+	2	0	RHBG	154620963	0.930000	0.31532	0.042000	0.18584	0.872000	0.50106	0.498000	0.22530	-1.275000	0.02417	-0.488000	0.04728	TTT		0.627	RHBG-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000060589.2	NM_001256395		12	45	0	0	0	0.00245	0	12	45				
ATP1A4	480	broad.mit.edu	37	1	160125911	160125911	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:160125911C>T	ENST00000368081.4	+	4	959	c.488C>T	c.(487-489)tCc>tTc	p.S163F		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	163					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.S163F(2)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCCAAGAGCTCCAAGATCATG	0.512																																							uc001fve.3		NA																	2	Substitution - Missense(2)		lung(1)|skin(1)	ovary(2)|skin(2)	4						c.(487-489)TCC>TTC		Na+/K+ -ATPase alpha 4 subunit isoform 1							147.0	125.0	133.0					1																	160125911		2203	4300	6503	SO:0001583	missense	480				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160125911C>T	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.488C>T	1.37:g.160125911C>T	ENSP00000357060:p.Ser163Phe		Somatic				ATP1A4_uc001fvf.3_RNA	p.S163F	NM_144699	NP_653300	WXS	Illumina HiSeq	Unspecified	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		4	967	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		163			Cytoplasmic (Potential).		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	c.488C>T	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.378350	0.82682	.	.	ENSG00000132681	ENST00000368081	D	0.90900	-2.75	4.56	4.56	0.56223	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.94873	0.8343	M	0.91406	3.205	0.80722	D	1	D	0.57899	0.981	P	0.59487	0.858	D	0.95736	0.8779	10	0.87932	D	0	.	14.8916	0.70614	0.0:1.0:0.0:0.0	.	163	Q13733	AT1A4_HUMAN	F	163	ENSP00000357060:S163F	ENSP00000357060:S163F	S	+	2	0	ATP1A4	158392535	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.609000	0.82925	2.359000	0.80004	0.462000	0.41574	TCC		0.512	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		14	72	0	0	0	0.003163	0	14	72				
FCRLA	84824	broad.mit.edu	37	1	161680999	161680999	+	Splice_Site	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:161680999C>A	ENST00000236938.6	+	3	527	c.285C>A	c.(283-285)gaC>gaA	p.D95E	FCRLA_ENST00000367953.3_Splice_Site_p.D84E|FCRLA_ENST00000546024.1_Intron|FCRLA_ENST00000367959.2_Splice_Site_p.D101E|FCRLA_ENST00000367949.2_Intron|FCRLA_ENST00000350710.3_Intron|FCRLA_ENST00000540926.1_Splice_Site_p.D84E|FCRLA_ENST00000349527.4_Splice_Site_p.D78E|FCRLA_ENST00000309691.6_Intron|FCRLA_ENST00000470841.1_3'UTR|FCRLA_ENST00000367950.1_Intron|FCRLA_ENST00000367957.2_Intron|FCRLA_ENST00000294796.4_Intron|FCRLA_ENST00000540521.1_Intron	NM_032738.3	NP_116127.3	Q7L513	FCRLA_HUMAN	Fc receptor-like A	78	Ig-like C2-type 1.				cell differentiation (GO:0030154)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)		p.D101E(1)|p.D78E(1)		breast(1)|kidney(12)|large_intestine(4)|lung(13)|prostate(1)|skin(2)|stomach(1)	34	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			GGACCATAGACTGGCTGATCC	0.592																																							uc001gbe.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(301-303)GAC>GAA		Fc receptor-like and mucin-like 1							30.0	33.0	32.0					1																	161680999		2203	4300	6503	SO:0001630	splice_region_variant	84824				cell differentiation	cytoplasm|extracellular region		g.chr1:161680999C>A	AF531423	CCDS30926.1, CCDS53415.1, CCDS53416.1, CCDS53417.1, CCDS53418.1, CCDS53419.1, CCDS53420.1	1q23.3	2014-01-28	2006-09-26	2006-09-26	ENSG00000132185	ENSG00000132185		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18504	protein-coding gene	gene with protein product		606891	"""Fc receptor-like and mucin-like 1"""	FCRLM1		11754007	Standard	NM_001184866		Approved	MGC4595, FCRLc2, FCRLb, FCRLc1, FCRLd, FCRLe, FCRL, FCRLa, FREB, FCRLX	uc001gbe.3	Q7L513	OTTHUMG00000034537	ENST00000236938.6:c.284-1C>A	1.37:g.161680999C>A			Somatic				FCRLA_uc001gbd.2_Missense_Mutation_p.D95E|FCRLA_uc001gbf.2_Intron|FCRLA_uc001gbg.2_Intron|FCRLA_uc009wuo.2_Intron|FCRLA_uc009wup.2_Intron|FCRLA_uc009wuq.2_Intron	p.D101E	NM_032738	NP_116127	WXS	Illumina HiSeq	Unspecified	Q7L513	FCRLA_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00301)		4	545	+	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		78			Ig-like C2-type 1.		A0N0M1|A6NC03|A6NL20|F5H720|F8W743|G3V1J2|Q5VXA1|Q5VXA2|Q5VXA3|Q5VXA4|Q5VXB0|Q5VXB1|Q8NEW4|Q8WXH3|Q96PC6|Q96PJ0|Q96PJ1|Q96PJ2|Q96PJ4|Q9BR57	Missense_Mutation	SNP	ENST00000236938.6	37	c.303C>A	CCDS30926.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453628	0.63290	.	.	ENSG00000132185	ENST00000236938;ENST00000367959;ENST00000540926;ENST00000349527;ENST00000367953	T;T;T;T;T	0.00724	5.78;5.78;5.78;5.78;5.78	4.99	2.06	0.26882	.	0.000000	0.49305	D	0.000150	T	0.01029	0.0034	L	0.48174	1.505	0.43279	D	0.995241	D;D	0.89917	1.0;0.991	D;P	0.87578	0.998;0.86	T	0.67654	-0.5615	10	0.56958	D	0.05	.	7.4462	0.27213	0.0:0.7237:0.0:0.2763	.	101;95	A6NC03;Q7L513-9	.;.	E	95;101;84;78;84	ENSP00000236938:D95E;ENSP00000356936:D101E;ENSP00000446380:D84E;ENSP00000294798:D78E;ENSP00000356930:D84E	ENSP00000236938:D95E	D	+	3	2	FCRLA	159947623	0.978000	0.34361	1.000000	0.80357	0.968000	0.65278	-0.236000	0.09003	0.699000	0.31761	-0.748000	0.03510	GAC		0.592	FCRLA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083574.1	NM_032738	Missense_Mutation	3	18	1	0	0.004672	0.004672	0.00500222	3	18				
XCL2	6846	broad.mit.edu	37	1	168511287	168511287	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:168511287C>T	ENST00000367819.2	-	2	152	c.120G>A	c.(118-120)ctG>ctA	p.L40L		NM_003175.3	NP_003166.1	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2	40					blood circulation (GO:0008015)|cell chemotaxis (GO:0060326)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)	p.L40L(1)		large_intestine(1)|lung(6)|ovary(1)	8	all_hematologic(923;0.215)					TGCTAACTGGCAGTCGCTGGG	0.483																																							uc001gfn.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(118-120)CTG>CTA		chemokine (C motif) ligand 2 precursor							138.0	114.0	122.0					1																	168511287		2203	4298	6501	SO:0001819	synonymous_variant	6846				blood circulation|chemotaxis|immune response|signal transduction	extracellular space	chemokine activity	g.chr1:168511287C>T	BC070309	CCDS1273.1	1q24.2	2013-02-28	2002-08-22	2002-08-23	ENSG00000143185	ENSG00000143185		"""Endogenous ligands"""	10646	protein-coding gene	gene with protein product		604828	"""small inducible cytokine subfamily C, member 2"""	SCYC2		7875320	Standard	NM_003175		Approved	SCM-1b	uc001gfn.4	Q9UBD3	OTTHUMG00000034549	ENST00000367819.2:c.120G>A	1.37:g.168511287C>T			Somatic					p.L40L	NM_003175	NP_003166	WXS	Illumina HiSeq	Unspecified	Q9UBD3	XCL2_HUMAN			2	153	-	all_hematologic(923;0.215)		40						Silent	SNP	ENST00000367819.2	37	c.120G>A	CCDS1273.1																																																																																				0.483	XCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083613.1	NM_003175		8	56	0	0	0	0.006214	0	8	56				
XCL1	6375	broad.mit.edu	37	1	168549359	168549359	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:168549359G>A	ENST00000367818.3	+	2	285	c.120G>A	c.(118-120)ctG>ctA	p.L40L		NM_002995.2	NP_002986.1	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	40					cell-cell signaling (GO:0007267)|cellular response to interleukin-4 (GO:0071353)|cellular response to transforming growth factor beta stimulus (GO:0071560)|immune response (GO:0006955)|mature natural killer cell chemotaxis (GO:0035782)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T-helper 1 cell activation (GO:2000518)|negative regulation of T-helper 1 type immune response (GO:0002826)|negative regulation of transcription, DNA-templated (GO:0045892)|neutrophil chemotaxis (GO:0030593)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000566)|positive regulation of granzyme A production (GO:2000513)|positive regulation of granzyme B production (GO:0071663)|positive regulation of immunoglobulin production in mucosal tissue (GO:2000558)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 cell cytokine production (GO:2000556)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of thymocyte migration (GO:2000412)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of inflammatory response (GO:0050727)|release of sequestered calcium ion into cytosol (GO:0051209)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|protein homodimerization activity (GO:0042803)	p.L40L(1)		kidney(2)|lung(7)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.208)					CCCAGCGACTGCCGGTTAGCA	0.473																																							uc001gfo.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(118-120)CTG>CTA		chemokine (C motif) ligand 1							155.0	146.0	149.0					1																	168549359		2203	4300	6503	SO:0001819	synonymous_variant	6375				CD4-positive, alpha-beta T cell proliferation|CD8-positive, alpha-beta T cell proliferation|cell-cell signaling|cellular response to interleukin-4|cellular response to transforming growth factor beta stimulus|immunoglobulin production in mucosal tissue|lymphocyte chemotaxis|negative regulation of interferon-gamma production|negative regulation of interleukin-2 production|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell cytokine production|negative regulation of T-helper 1 cell activation|negative regulation of transcription, DNA-dependent|neutrophil chemotaxis|positive regulation of activated T cell proliferation|positive regulation of B cell chemotaxis|positive regulation of granzyme A production|positive regulation of granzyme B production|positive regulation of interleukin-10 production|positive regulation of natural killer cell chemotaxis|positive regulation of neutrophil chemotaxis|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell chemotaxis|positive regulation of T cell cytokine production|positive regulation of T cell mediated cytotoxicity|positive regulation of thymocyte migration|positive regulation of transforming growth factor-beta production|regulation of inflammatory response|release of sequestered calcium ion into cytosol|response to virus|T-helper 1 cell cytokine production|T-helper 2 cell cytokine production	extracellular space	chemokine activity|protein homodimerization activity	g.chr1:168549359G>A	D43768	CCDS1274.1	1q24.2	2014-01-30	2002-08-22	2002-08-23	ENSG00000143184	ENSG00000143184		"""Endogenous ligands"""	10645	protein-coding gene	gene with protein product		600250	"""small inducible cytokine subfamily C, member 1 (lymphotactin)"""	LTN, SCYC1		7602097, 7875320	Standard	NM_002995		Approved	LPTN, ATAC, SCM-1a, SCM-1, lymphotactin	uc001gfo.2	P47992	OTTHUMG00000034548	ENST00000367818.3:c.120G>A	1.37:g.168549359G>A			Somatic					p.L40L	NM_002995	NP_002986	WXS	Illumina HiSeq	Unspecified	P47992	XCL1_HUMAN			2	140	+	all_hematologic(923;0.208)		40					Q52MA8	Silent	SNP	ENST00000367818.3	37	c.120G>A	CCDS1274.1																																																																																				0.473	XCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083612.1	NM_002995		15	126	0	0	0	0.006122	0	15	126				
KLHL20	27252	broad.mit.edu	37	1	173703228	173703228	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:173703228G>A	ENST00000209884.4	+	3	536	c.400G>A	c.(400-402)Gaa>Aaa	p.E134K	KLHL20_ENST00000493170.1_3'UTR|KLHL20_ENST00000546011.1_Intron	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	134	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)	p.E134K(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						GATAACAGTAGAAGAGGGCAA	0.473																																					GBM(159;862 2695 6559 23041)	GBM(159;862 2695 6559 23041)	uc001gjc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(400-402)GAA>AAA		kelch-like 20							99.0	87.0	91.0					1																	173703228		2203	4300	6503	SO:0001583	missense	27252				cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity	g.chr1:173703228G>A	AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.400G>A	1.37:g.173703228G>A	ENSP00000209884:p.Glu134Lys		Somatic				KLHL20_uc010pmr.1_Intron|KLHL20_uc009wwf.2_Missense_Mutation_p.E116K|KLHL20_uc001gjd.2_Missense_Mutation_p.E134K	p.E134K	NM_014458	NP_055273	WXS	Illumina HiSeq	Unspecified	Q9Y2M5	KLH20_HUMAN			3	579	+			134			BTB.		B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	ENST00000209884.4	37	c.400G>A	CCDS1310.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985489	0.74589	.	.	ENSG00000076321	ENST00000209884	T	0.70869	-0.52	5.63	5.63	0.86233	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.72095	0.3418	L	0.41079	1.255	0.80722	D	1	D;P	0.60160	0.987;0.623	D;B	0.63192	0.912;0.253	T	0.69254	-0.5193	9	.	.	.	.	18.5195	0.90947	0.0:0.0:1.0:0.0	.	134;134	Q9BS75;Q9Y2M5	.;KLH20_HUMAN	K	134	ENSP00000209884:E134K	.	E	+	1	0	KLHL20	171969851	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	9.731000	0.98807	2.664000	0.90586	0.644000	0.83932	GAA		0.473	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458		9	63	0	0	0	0.006214	0	9	63				
TNR	7143	broad.mit.edu	37	1	175355420	175355420	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:175355420G>C	ENST00000367674.2	-	8	2233	c.1525C>G	c.(1525-1527)Cag>Gag	p.Q509E	TNR_ENST00000263525.2_Missense_Mutation_p.Q509E			Q92752	TENR_HUMAN	tenascin R	509	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.Q509E(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					ACCAGGATCTGCGTGGGGCCG	0.483																																							uc001gkp.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(1525-1527)CAG>GAG		tenascin R precursor							30.0	33.0	32.0					1																	175355420		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175355420G>C	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1525C>G	1.37:g.175355420G>C	ENSP00000356646:p.Gln509Glu		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.Q509E	p.Q509E	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			6	1606	-	Renal(580;0.146)		509			Fibronectin type-III 3.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.1525C>G	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.722041	0.48728	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.04156	3.69;3.69	5.68	5.68	0.88126	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.137197	0.50627	D	0.000113	T	0.06142	0.0159	L	0.49455	1.56	0.51233	D	0.999917	B	0.18310	0.027	B	0.25614	0.062	T	0.18745	-1.0327	10	0.06891	T	0.86	.	14.2576	0.66062	0.0:0.0:0.851:0.149	.	509	Q92752	TENR_HUMAN	E	509	ENSP00000356646:Q509E;ENSP00000263525:Q509E	ENSP00000263525:Q509E	Q	-	1	0	TNR	173622043	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.128000	0.77217	2.660000	0.90430	0.650000	0.86243	CAG		0.483	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		2	18	0	0	0	0.009096	0	2	18				
TNR	7143	broad.mit.edu	37	1	175365934	175365934	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:175365934G>C	ENST00000367674.2	-	5	1694	c.986C>G	c.(985-987)cCa>cGa	p.P329R	TNR_ENST00000263525.2_Missense_Mutation_p.P329R			Q92752	TENR_HUMAN	tenascin R	329	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.P329R(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CAAGTCCTCTGGAGGGGCAAC	0.557																																							uc001gkp.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(985-987)CCA>CGA		tenascin R precursor							74.0	77.0	76.0					1																	175365934		2203	4300	6503	SO:0001583	missense	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175365934G>C	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.986C>G	1.37:g.175365934G>C	ENSP00000356646:p.Pro329Arg		Somatic				TNR_uc009wwu.1_Missense_Mutation_p.P329R|TNR_uc010pmz.1_Intron	p.P329R	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			3	1067	-	Renal(580;0.146)		329			Fibronectin type-III 1.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.986C>G	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205942	0.79127	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.79845	-1.31;-1.31	5.95	5.95	0.96441	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.060171	0.64402	D	0.000003	D	0.91456	0.7303	M	0.87269	2.87	0.80722	D	1	D	0.71674	0.998	D	0.73380	0.98	D	0.91949	0.5569	10	0.87932	D	0	.	19.9698	0.97280	0.0:0.0:1.0:0.0	.	329	Q92752	TENR_HUMAN	R	329	ENSP00000356646:P329R;ENSP00000263525:P329R	ENSP00000263525:P329R	P	-	2	0	TNR	173632557	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.168000	0.71908	2.817000	0.96982	0.563000	0.77884	CCA		0.557	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		20	98	0	0	0	0.002096	0	20	98				
FAM20B	9917	broad.mit.edu	37	1	179013192	179013192	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:179013192G>A	ENST00000263733.4	+	2	546	c.210G>A	c.(208-210)tgG>tgA	p.W70*		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	70						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)	p.W70*(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						CAGCCCAGTGGGTGGTTCCCC	0.562																																							uc001gmc.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(208-210)TGG>TGA		hypothetical protein LOC9917 precursor							59.0	58.0	58.0					1																	179013192		2203	4300	6503	SO:0001587	stop_gained	9917					Golgi membrane|integral to membrane	ATP binding|kinase activity|phosphotransferase activity, alcohol group as acceptor	g.chr1:179013192G>A	AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.210G>A	1.37:g.179013192G>A	ENSP00000263733:p.Trp70*		Somatic					p.W70*	NM_014864	NP_055679	WXS	Illumina HiSeq	Unspecified	O75063	XYLK_HUMAN			2	503	+			70			Lumenal (Potential).		Q5W0C3|Q5W0C4	Nonsense_Mutation	SNP	ENST00000263733.4	37	c.210G>A	CCDS1328.1	.	.	.	.	.	.	.	.	.	.	G	37	6.165678	0.97338	.	.	ENSG00000116199	ENST00000440702;ENST00000263733	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-43.1128	20.5752	0.99366	0.0:0.0:1.0:0.0	.	.	.	.	X	70	.	ENSP00000263733:W70X	W	+	3	0	FAM20B	177279815	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.868000	0.98415	0.557000	0.71058	TGG		0.562	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084922.1	NM_014864		8	48	0	0	0	0.00308	0	8	48				
BRINP3	339479	broad.mit.edu	37	1	190423887	190423887	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:190423887T>C	ENST00000367462.3	-	2	365	c.134A>G	c.(133-135)gAc>gGc	p.D45G	BRINP3_ENST00000534846.1_Missense_Mutation_p.T7A	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	45					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.D45G(1)									GAGGAGCCAGTCGAAGGGGCT	0.498																																							uc001gse.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(133-135)GAC>GGC		family with sequence similarity 5, member C							83.0	81.0	82.0					1																	190423887		2203	4300	6503	SO:0001583	missense	339479					extracellular region		g.chr1:190423887T>C	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.134A>G	1.37:g.190423887T>C	ENSP00000356432:p.Asp45Gly		Somatic				FAM5C_uc010pot.1_Missense_Mutation_p.T7A	p.D45G	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			2	366	-	Prostate(682;0.198)		45					B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	c.134A>G	CCDS1373.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.99|16.99	3.273600|3.273600	0.59649|0.59649	.|.	.|.	ENSG00000162670|ENSG00000162670	ENST00000367462;ENST00000445957|ENST00000534846	T;T|T	0.56776|0.16897	2.22;0.44|2.31	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.12390|0.12390	0.0301|0.0301	N|N	0.14661|0.14661	0.345|0.345	0.27575|0.27575	N|N	0.949761|0.949761	D|B	0.63880|0.21606	0.993|0.058	D|B	0.72338|0.21917	0.977|0.037	T|T	0.15206|0.15206	-1.0445|-1.0445	10|9	0.40728|0.44086	T|T	0.16|0.13	.|.	13.4268|13.4268	0.61030|0.61030	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	45|7	Q76B58|B7Z260	FAM5C_HUMAN|.	G|A	45|7	ENSP00000356432:D45G;ENSP00000393441:D45G|ENSP00000438022:T7A	ENSP00000356432:D45G|ENSP00000438022:T7A	D|T	-|-	2|1	0|0	FAM5C|FAM5C	188690510|188690510	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.899000|5.899000	0.69846|0.69846	2.055000|2.055000	0.61198|0.61198	0.533000|0.533000	0.62120|0.62120	GAC|ACT		0.498	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		5	25	0	0	0	0.000602	0	5	25				
KCNT2	343450	broad.mit.edu	37	1	196227445	196227445	+	Silent	SNP	A	A	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:196227445A>C	ENST00000294725.9	-	26	4005	c.3090T>G	c.(3088-3090)ggT>ggG	p.G1030G	KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000367431.4_Silent_p.G964G|KCNT2_ENST00000367433.5_Silent_p.G1006G|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Silent_p.G963G			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1030					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.G1030G(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CAGCTGTTTTACCAGAGTGTT	0.473																																							uc001gtd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|breast(1)|skin(1)	7						c.(3088-3090)GGT>GGG		potassium channel, subfamily T, member 2							123.0	115.0	118.0					1																	196227445		2203	4300	6503	SO:0001819	synonymous_variant	343450					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr1:196227445A>C	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.3090T>G	1.37:g.196227445A>C			Somatic				KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Silent_p.G963G|KCNT2_uc001gtf.1_Silent_p.G1006G|KCNT2_uc001gtg.1_RNA|KCNT2_uc001gth.1_Silent_p.G534G	p.G1030G	NM_198503	NP_940905	WXS	Illumina HiSeq	Unspecified	Q6UVM3	KCNT2_HUMAN			26	3150	-			1030			Cytoplasmic (Potential).|ATP (Potential).		Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	ENST00000294725.9	37	c.3090T>G	CCDS1384.1																																																																																				0.473	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503		9	77	0	0	0	0.006214	0	9	77				
ASPM	259266	broad.mit.edu	37	1	197059495	197059495	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:197059495C>A	ENST00000367409.4	-	24	9916	c.9660G>T	c.(9658-9660)tgG>tgT	p.W3220C	ASPM_ENST00000294732.7_Missense_Mutation_p.W1635C|ASPM_ENST00000367408.1_Missense_Mutation_p.W885C	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3220	IQ 39. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.W3220C(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TTTTCTTCCTCCAAGAATAGC	0.303																																							uc001gtu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(9658-9660)TGG>TGT		asp (abnormal spindle)-like, microcephaly							50.0	48.0	49.0					1																	197059495		2202	4299	6501	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197059495C>A	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.9660G>T	1.37:g.197059495C>A	ENSP00000356379:p.Trp3220Cys		Somatic				ASPM_uc001gtv.2_Missense_Mutation_p.W1635C|ASPM_uc001gtw.3_Missense_Mutation_p.W1068C	p.W3220C	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			24	9917	-			3220			IQ 39.		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.9660G>T	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.487226	0.44249	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	T;T;T	0.24538	1.85;1.85;1.85	5.44	4.52	0.55395	.	0.361758	0.27084	N	0.021015	T	0.29158	0.0725	L	0.59436	1.845	0.31916	N	0.614032	B;B;B	0.34349	0.45;0.063;0.386	B;B;B	0.41174	0.169;0.063;0.349	T	0.34625	-0.9821	10	0.35671	T	0.21	.	8.7503	0.34611	0.1502:0.7741:0.0:0.0757	.	1206;1635;3220	E7EQ84;Q4G1H1;Q8IZT6	.;.;ASPM_HUMAN	C	3220;1635;885;1206	ENSP00000356379:W3220C;ENSP00000294732:W1635C;ENSP00000356378:W885C	ENSP00000294732:W1635C	W	-	3	0	ASPM	195326118	1.000000	0.71417	0.986000	0.45419	0.986000	0.74619	2.228000	0.42981	1.281000	0.44480	0.655000	0.94253	TGG		0.303	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		8	43	1	0	0.000157383	0.00308	0.000177817	8	43				
ASPM	259266	broad.mit.edu	37	1	197112565	197112565	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:197112565C>A	ENST00000367409.4	-	3	1073	c.817G>T	c.(817-819)Gag>Tag	p.E273*	ASPM_ENST00000294732.7_Nonsense_Mutation_p.E273*	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	273					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.E273*(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ACAGCTTTCTCATTAAAAGAA	0.363																																							uc001gtu.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(817-819)GAG>TAG		asp (abnormal spindle)-like, microcephaly							91.0	89.0	90.0					1																	197112565		2203	4299	6502	SO:0001587	stop_gained	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197112565C>A	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.817G>T	1.37:g.197112565C>A	ENSP00000356379:p.Glu273*		Somatic				ASPM_uc001gtv.2_Nonsense_Mutation_p.E273*|ASPM_uc001gtw.3_Intron	p.E273*	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			3	1074	-			273					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Nonsense_Mutation	SNP	ENST00000367409.4	37	c.817G>T	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	32	5.159398	0.94686	.	.	ENSG00000066279	ENST00000367409;ENST00000294732	.	.	.	5.49	4.55	0.56014	.	0.346876	0.27710	N	0.018167	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	14.7606	0.69604	0.0:0.8558:0.1442:0.0	.	.	.	.	X	273	.	ENSP00000294732:E273X	E	-	1	0	ASPM	195379188	0.030000	0.19436	0.885000	0.34714	0.104000	0.19210	1.096000	0.30976	1.412000	0.46977	0.637000	0.83480	GAG		0.363	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		21	134	1	0	3.51602e-12	0.008871	5.17284e-12	21	134				
CRB1	23418	broad.mit.edu	37	1	197390222	197390222	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:197390222C>T	ENST00000367400.3	+	6	1399	c.1264C>T	c.(1264-1266)Cat>Tat	p.H422Y	CRB1_ENST00000543483.1_Missense_Mutation_p.H121Y|CRB1_ENST00000538660.1_Missense_Mutation_p.H422Y|CRB1_ENST00000367397.1_5'UTR|CRB1_ENST00000544212.1_5'UTR|CRB1_ENST00000476483.1_3'UTR|CRB1_ENST00000535699.1_Missense_Mutation_p.H353Y|CRB1_ENST00000367399.2_Missense_Mutation_p.H310Y	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	422	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H422Y(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TTATACTTGCCATTGCCCATT	0.413																																							uc001gtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)	9						c.(1264-1266)CAT>TAT		crumbs homolog 1 precursor							162.0	147.0	152.0					1																	197390222		2203	4300	6503	SO:0001583	missense	23418				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding	g.chr1:197390222C>T		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1264C>T	1.37:g.197390222C>T	ENSP00000356370:p.His422Tyr		Somatic				CRB1_uc010poz.1_Missense_Mutation_p.H353Y|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.H310Y|CRB1_uc010ppb.1_Missense_Mutation_p.H422Y|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_5'UTR|CRB1_uc001gub.1_Missense_Mutation_p.H71Y	p.H422Y	NM_201253	NP_957705	WXS	Illumina HiSeq	Unspecified	P82279	CRUM1_HUMAN			6	1399	+			422			Extracellular (Potential).|EGF-like 10; calcium-binding (Potential).		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	c.1264C>T	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034713	0.75617	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000543483;ENST00000367401	D;D;D;D;D	0.91521	-2.35;-2.35;-2.35;-2.35;-2.86	5.57	5.57	0.84162	EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.92815	0.7715	L	0.39898	1.24	0.80722	D	1	D;D;D;D;D	0.65815	0.995;0.984;0.969;0.988;0.994	D;P;P;P;P	0.67231	0.95;0.849;0.84;0.732;0.86	D	0.90920	0.4782	9	0.28530	T	0.3	.	19.5429	0.95281	0.0:1.0:0.0:0.0	.	422;353;310;71;422	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	Y	353;422;422;310;121;71	ENSP00000438786:H353Y;ENSP00000438091:H422Y;ENSP00000356370:H422Y;ENSP00000356369:H310Y;ENSP00000439579:H121Y	ENSP00000356369:H310Y	H	+	1	0	CRB1	195656845	0.792000	0.28813	0.478000	0.27316	0.987000	0.75469	3.615000	0.54167	2.607000	0.88179	0.585000	0.79938	CAT		0.413	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		39	152	0	0	0	0.00623	0	39	152				
KIF21B	23046	broad.mit.edu	37	1	200960801	200960801	+	Missense_Mutation	SNP	C	C	T	rs528414543		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:200960801C>T	ENST00000422435.2	-	17	2754	c.2438G>A	c.(2437-2439)aGg>aAg	p.R813K	KIF21B_ENST00000461742.2_Missense_Mutation_p.R813K|KIF21B_ENST00000360529.5_Missense_Mutation_p.R813K|KIF21B_ENST00000332129.2_Missense_Mutation_p.R813K	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	813					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R813K(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GGTCTTCCTCCTCAGGACCAT	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		18573	0.0		0.0	False		,,,				2504	0.001						uc001gvs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)	6						c.(2437-2439)AGG>AAG		kinesin family member 21B							65.0	60.0	62.0					1																	200960801		2203	4300	6503	SO:0001583	missense	23046				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:200960801C>T	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.2438G>A	1.37:g.200960801C>T	ENSP00000411831:p.Arg813Lys		Somatic				KIF21B_uc001gvr.1_Missense_Mutation_p.R813K|KIF21B_uc009wzl.1_Missense_Mutation_p.R813K|KIF21B_uc010ppn.1_Missense_Mutation_p.R813K	p.R813K	NM_017596	NP_060066	WXS	Illumina HiSeq	Unspecified	O75037	KI21B_HUMAN			17	2755	-			813			Potential.		B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	c.2438G>A	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153570	0.78114	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.32734	0.0839	L	0.37561	1.115	0.58432	D	0.999993	D;D;D;D	0.61697	0.982;0.982;0.982;0.99	D;D;D;D	0.72982	0.952;0.952;0.952;0.979	T	0.02958	-1.1089	10	0.06625	T	0.88	.	17.8557	0.88762	0.0:1.0:0.0:0.0	.	813;813;813;813	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	K	813	ENSP00000328494:R813K;ENSP00000353724:R813K;ENSP00000433808:R813K;ENSP00000411831:R813K	ENSP00000328494:R813K	R	-	2	0	KIF21B	199227424	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.855000	0.62925	2.270000	0.75569	0.561000	0.74099	AGG		0.607	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332		7	39	0	0	0	0.006214	0	7	39				
KIF21B	23046	broad.mit.edu	37	1	200969654	200969654	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:200969654G>C	ENST00000422435.2	-	11	1865	c.1549C>G	c.(1549-1551)Ctg>Gtg	p.L517V	KIF21B_ENST00000461742.2_Missense_Mutation_p.L517V|KIF21B_ENST00000360529.5_Missense_Mutation_p.L517V|KIF21B_ENST00000332129.2_Missense_Mutation_p.L517V	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	517					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L517V(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GAAGCACCCAGGGAGTAGGGG	0.662																																							uc001gvs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)	6						c.(1549-1551)CTG>GTG		kinesin family member 21B							34.0	43.0	40.0					1																	200969654		2203	4300	6503	SO:0001583	missense	23046				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:200969654G>C	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.1549C>G	1.37:g.200969654G>C	ENSP00000411831:p.Leu517Val		Somatic				KIF21B_uc001gvr.1_Missense_Mutation_p.L517V|KIF21B_uc009wzl.1_Missense_Mutation_p.L517V|KIF21B_uc010ppn.1_Missense_Mutation_p.L517V	p.L517V	NM_017596	NP_060066	WXS	Illumina HiSeq	Unspecified	O75037	KI21B_HUMAN			11	1866	-			517			Potential.		B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	c.1549C>G	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	G	7.750	0.703142	0.15172	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.71698	-0.25;-0.56;-0.59;-0.28	5.17	3.11	0.35812	.	0.820120	0.10625	N	0.652922	T	0.53351	0.1791	L	0.35723	1.085	0.31002	N	0.720267	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.06405	0.001;0.001;0.001;0.002	T	0.49000	-0.8984	10	0.16420	T	0.52	.	3.1713	0.06554	0.1644:0.1423:0.5484:0.1449	.	517;517;517;517	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	V	517	ENSP00000328494:L517V;ENSP00000353724:L517V;ENSP00000433808:L517V;ENSP00000411831:L517V	ENSP00000328494:L517V	L	-	1	2	KIF21B	199236277	1.000000	0.71417	0.969000	0.41365	0.637000	0.38172	2.357000	0.44125	2.421000	0.82119	0.514000	0.50259	CTG		0.662	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332		10	89	0	0	0	0.008291	0	10	89				
IGFN1	91156	broad.mit.edu	37	1	201187763	201187763	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:201187763C>A	ENST00000335211.4	+	18	10005	c.9875C>A	c.(9874-9876)gCt>gAt	p.A3292D	IGFN1_ENST00000295591.8_Missense_Mutation_p.A452D	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	835						nucleus (GO:0005634)|Z disc (GO:0030018)		p.A3292D(1)|p.A452D(1)		autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCATCGGATGCTGTCTTTGCT	0.627																																							uc001gwc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(1354-1356)GCT>GAT		RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;							45.0	43.0	44.0					1																	201187763		2203	4300	6503	SO:0001583	missense	91156							g.chr1:201187763C>A	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.9875C>A	1.37:g.201187763C>A	ENSP00000334714:p.Ala3292Asp		Somatic				IGFN1_uc001gwb.2_RNA	p.A452D	NM_178275	NP_840059	WXS	Illumina HiSeq	Unspecified					7	2127	+								F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	c.1355C>A	CCDS53455.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.30|16.30	3.083159|3.083159	0.55861|0.55861	.|.	.|.	ENSG00000163395|ENSG00000163395	ENST00000335211;ENST00000295591|ENST00000412892	T;T|.	0.54866|.	0.55;0.55|.	4.9|4.9	2.95|2.95	0.34219|0.34219	.|.	0.583874|.	0.17888|.	N|.	0.158635|.	T|.	0.59569|.	0.2203|.	M|M	0.83012|0.83012	2.62|2.62	0.09310|0.09310	N|N	1|1	D|.	0.60575|.	0.988|.	D|.	0.68039|.	0.955|.	T|.	0.51624|.	-0.8682|.	10|.	0.72032|.	D|.	0.01|.	.|.	9.1893|9.1893	0.37189|0.37189	0.0:0.823:0.0:0.177|0.0:0.823:0.0:0.177	.|.	3292|.	F8WAI1|.	.|.	D|X	3292;452|709	ENSP00000334714:A3292D;ENSP00000295591:A452D|.	ENSP00000295591:A452D|.	A|C	+|+	2|3	0|2	IGFN1|IGFN1	199454386|199454386	0.005000|0.005000	0.15991|0.15991	0.028000|0.028000	0.17463|0.17463	0.007000|0.007000	0.05969|0.05969	1.984000|1.984000	0.40658|0.40658	0.534000|0.534000	0.28695|0.28695	-0.258000|-0.258000	0.10820|0.10820	GCT|TGC		0.627	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275		8	26	1	0	7.48243e-07	0.006214	9.50408e-07	8	26				
CR2	1380	broad.mit.edu	37	1	207649641	207649641	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:207649641G>T	ENST00000367058.3	+	14	2791	c.2602G>T	c.(2602-2604)Gct>Tct	p.A868S	CR2_ENST00000367057.3_Missense_Mutation_p.A927S|CR2_ENST00000367059.3_Intron|CR2_ENST00000458541.2_Missense_Mutation_p.A841S	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	868	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)	p.A927S(1)		NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TGGAAACATAGCTCGATTTTC	0.507																																							uc001hfw.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						c.(2602-2604)GCT>TCT		complement component (3d/Epstein Barr virus)							151.0	137.0	142.0					1																	207649641		2203	4300	6503	SO:0001583	missense	1380				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity	g.chr1:207649641G>T	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2602G>T	1.37:g.207649641G>T	ENSP00000356025:p.Ala868Ser		Somatic				CR2_uc001hfv.2_Missense_Mutation_p.A927S|CR2_uc009xch.2_Intron	p.A868S	NM_001877	NP_001868	WXS	Illumina HiSeq	Unspecified	P20023	CR2_HUMAN			14	2696	+			868			Sushi 14.|Extracellular (Potential).		C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	37	c.2602G>T	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.047143	0.00398	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000458541	T;T;T	0.63417	-0.04;-0.04;-0.04	4.87	-3.44	0.04796	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.33644	0.0870	N	0.17872	0.535	0.09310	N	1	B;B	0.24186	0.099;0.02	B;B	0.24848	0.056;0.039	T	0.27971	-1.0058	9	0.09338	T	0.73	.	0.4957	0.00571	0.318:0.1254:0.3003:0.2563	.	868;927	P20023;P20023-3	CR2_HUMAN;.	S	868;927;841	ENSP00000356025:A868S;ENSP00000356024:A927S;ENSP00000404222:A841S	ENSP00000356024:A927S	A	+	1	0	CR2	205716264	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.249000	0.18216	-0.806000	0.04398	-0.905000	0.02835	GCT		0.507	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877		4	79	1	0	0.00909568	0.009096	0.00963765	4	79				
PLXNA2	5362	broad.mit.edu	37	1	208270154	208270154	+	Silent	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:208270154C>A	ENST00000367033.3	-	7	2563	c.1806G>T	c.(1804-1806)gtG>gtT	p.V602V		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	602					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.V602V(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CCTGCCCCTCCACCTCTGTCA	0.562																																							uc001hgz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1804-1806)GTG>GTT		plexin A2 precursor							76.0	64.0	68.0					1																	208270154		2203	4300	6503	SO:0001819	synonymous_variant	5362				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr1:208270154C>A	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.1806G>T	1.37:g.208270154C>A			Somatic					p.V602V	NM_025179	NP_079455	WXS	Illumina HiSeq	Unspecified	O75051	PLXA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.199)	7	2564	-			602			Extracellular (Potential).		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	ENST00000367033.3	37	c.1806G>T	CCDS31013.1																																																																																				0.562	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179		10	37	1	0	7.48243e-07	0.006214	9.50408e-07	10	37				
TATDN3	128387	broad.mit.edu	37	1	212976051	212976051	+	Missense_Mutation	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:212976051T>A	ENST00000366974.4	+	5	361	c.267T>A	c.(265-267)gaT>gaA	p.D89E	TATDN3_ENST00000526997.1_Missense_Mutation_p.D89E|TATDN3_ENST00000531963.1_Missense_Mutation_p.D89E|TATDN3_ENST00000530441.1_Missense_Mutation_p.M61K|TATDN3_ENST00000526641.1_Intron|TATDN3_ENST00000525569.1_3'UTR|TATDN3_ENST00000532324.1_Missense_Mutation_p.D89E|TATDN3_ENST00000366973.4_Missense_Mutation_p.D89E	NM_001042552.2|NM_001042553.2|NM_001146169.1|NM_001146171.1	NP_001036017.1|NP_001036018.1|NP_001139641.1|NP_001139643.1	Q17R31	TATD3_HUMAN	TatD DNase domain containing 3	89					DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)	p.D89E(1)		endometrium(1)|large_intestine(2)|lung(6)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)		AGGATTTGGATGTAGCTTTGC	0.383																																							uc001hjo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(265-267)GAT>GAA		TatD DNase domain containing 3 isoform 1							130.0	127.0	128.0					1																	212976051		2203	4300	6503	SO:0001583	missense	128387					nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding	g.chr1:212976051T>A	AL832248	CCDS31019.1, CCDS41465.1, CCDS53475.1, CCDS53476.1, CCDS53477.1	1q32.3	2008-02-05			ENSG00000203705	ENSG00000203705			27010	protein-coding gene	gene with protein product							Standard	NM_001042552		Approved		uc001hjo.2	Q17R31	OTTHUMG00000036805	ENST00000366974.4:c.267T>A	1.37:g.212976051T>A	ENSP00000355941:p.Asp89Glu		Somatic				TATDN3_uc010ptj.1_Missense_Mutation_p.D89E|TATDN3_uc010ptk.1_Missense_Mutation_p.D89E|TATDN3_uc001hjp.2_Missense_Mutation_p.D89E|TATDN3_uc010ptl.1_Intron|TATDN3_uc010ptm.1_Missense_Mutation_p.D37E	p.D89E	NM_001042552	NP_001036017	WXS	Illumina HiSeq	Unspecified	Q17R31	TATD3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)	5	361	+			89					A6NGS3|B7Z1C1|B7Z978|B7ZLQ6|E9PJE5|E9PNH3|G3V151|Q4G0L1	Missense_Mutation	SNP	ENST00000366974.4	37	c.267T>A	CCDS31019.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	10.78|10.78|10.78	1.446763|1.446763|1.446763	0.25987|0.25987|0.25987	.|.|.	.|.|.	ENSG00000203705|ENSG00000203705|ENSG00000203705	ENST00000488246|ENST00000532324;ENST00000366974;ENST00000531963;ENST00000366973;ENST00000526997;ENST00000530399|ENST00000530441	.|.|.	.|.|.	.|.|.	5.58|5.58|5.58	-3.36|-3.36|-3.36	0.04913|0.04913|0.04913	.|.|.	.|0.392641|.	.|0.30159|.	.|N|.	.|0.010263|.	T|T|T	0.18593|0.18593|0.18593	0.0446|0.0446|0.0446	N|N|N	0.13299|0.13299|0.13299	0.325|0.325|0.325	0.29777|0.29777|0.29777	N|N|N	0.83432|0.83432|0.83432	.|B;B;B;B;B|.	.|0.02656|.	.|0.0;0.0;0.0;0.0;0.0|.	.|B;B;B;B;B|.	.|0.01281|.	.|0.0;0.0;0.0;0.0;0.0|.	T|T|T	0.31166|0.31166|0.31166	-0.9953|-0.9953|-0.9953	5|9|6	.|0.02654|0.87932	.|T|D	.|1|0	-9.9597|-9.9597|-9.9597	2.0824|2.0824|2.0824	0.03638|0.03638|0.03638	0.1114:0.1948:0.3452:0.3486|0.1114:0.1948:0.3452:0.3486|0.1114:0.1948:0.3452:0.3486	.|.|.	.|37;89;89;89;89|.	.|B7Z2Z9;G3V151;E9PJE5;Q17R31-2;Q17R31|.	.|.;.;.;.;TATD3_HUMAN|.	S|E|K	89|89;89;89;89;89;88|61	.|.|.	.|ENSP00000355940:D89E|ENSP00000432730:M61K	C|D|M	+|+|+	1|3|2	0|2|0	TATDN3|TATDN3|TATDN3	211042674|211042674|211042674	0.748000|0.748000|0.748000	0.28294|0.28294|0.28294	0.025000|0.025000|0.025000	0.17156|0.17156|0.17156	0.965000|0.965000|0.965000	0.64279|0.64279|0.64279	0.440000|0.440000|0.440000	0.21592|0.21592|0.21592	-0.469000|-0.469000|-0.469000	0.06911|0.06911|0.06911	-0.379000|-0.379000|-0.379000	0.06801|0.06801|0.06801	TGT|GAT|ATG		0.383	TATDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089396.2	XM_375838		14	86	0	0	0	0.003163	0	14	86				
SUSD4	55061	broad.mit.edu	37	1	223465926	223465926	+	Silent	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:223465926T>C	ENST00000343846.3	-	2	849	c.216A>G	c.(214-216)ggA>ggG	p.G72G	SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000494793.2_Silent_p.G72G|SUSD4_ENST00000366878.4_Silent_p.G72G|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000484758.2_Intron|SUSD4_ENST00000344029.6_Silent_p.G72G			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	72	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.G72G(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		AGAAAACCCCTCCGCTGGGGG	0.502																																							uc001hnx.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(214-216)GGA>GGG		sushi domain containing 4 isoform a							68.0	78.0	75.0					1																	223465926		2203	4300	6503	SO:0001819	synonymous_variant	55061					integral to membrane		g.chr1:223465926T>C	AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.216A>G	1.37:g.223465926T>C			Somatic				SUSD4_uc001hny.3_Silent_p.G72G|SUSD4_uc010puw.1_5'UTR|SUSD4_uc001hnz.2_Silent_p.G72G|SUSD4_uc010pux.1_Intron	p.G72G	NM_017982	NP_060452	WXS	Illumina HiSeq	Unspecified	Q5VX71	SUSD4_HUMAN		GBM - Glioblastoma multiforme(131;0.0611)	2	850	-			72			Sushi 1.|Extracellular (Potential).		D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Silent	SNP	ENST00000343846.3	37	c.216A>G	CCDS41471.1																																																																																				0.502	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982		10	81	0	0	0	0.001368	0	10	81				
IBA57	200205	broad.mit.edu	37	1	228362874	228362874	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:228362874A>T	ENST00000366711.3	+	3	733	c.731A>T	c.(730-732)gAg>gTg	p.E244V	IBA57_ENST00000484749.1_3'UTR|IBA57_ENST00000546123.1_Missense_Mutation_p.E51V	NM_001010867.2	NP_001010867.1	Q5T440	CAF17_HUMAN	IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)	244					glycine catabolic process (GO:0006546)|heme biosynthetic process (GO:0006783)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|poly(A) RNA binding (GO:0044822)	p.E244V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|prostate(1)	11						CTGCCCCTGGAGTCCAACCTG	0.632																																							uc001hsl.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(730-732)GAG>GTG		hypothetical protein LOC200205 precursor							59.0	61.0	61.0					1																	228362874		2203	4300	6503	SO:0001583	missense	200205				glycine catabolic process|heme biosynthetic process	mitochondrion	aminomethyltransferase activity	g.chr1:228362874A>T	AK022796	CCDS31046.1	1q42.13	2011-03-11	2011-03-11	2011-03-11	ENSG00000181873	ENSG00000181873			27302	protein-coding gene	gene with protein product	"""iron-sulfur cluster assembly factor for biotin synthase- and aconitase-like mitochondrial proteins, with a mass of 57kDa"""	615316	"""chromosome 1 open reading frame 69"""	C1orf69			Standard	NM_001010867		Approved	FLJ12734	uc001hsl.4	Q5T440	OTTHUMG00000039769	ENST00000366711.3:c.731A>T	1.37:g.228362874A>T	ENSP00000355672:p.Glu244Val		Somatic				C1orf69_uc010pvw.1_Missense_Mutation_p.E51V	p.E244V	NM_001010867	NP_001010867	WXS	Illumina HiSeq	Unspecified	Q5T440	CAF17_HUMAN			3	820	+		Prostate(94;0.0405)	244						Missense_Mutation	SNP	ENST00000366711.3	37	c.731A>T	CCDS31046.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.995380	0.93167	.	.	ENSG00000181873	ENST00000366711;ENST00000546123	T;T	0.58652	0.32;0.32	5.6	5.6	0.85130	YgfZ/GcvT conserved site (1);Glycine cleavage T-protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83161	0.5194	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88455	0.3051	10	0.87932	D	0	-41.3533	15.7878	0.78322	1.0:0.0:0.0:0.0	.	244	Q5T440	CAF17_HUMAN	V	244;51	ENSP00000355672:E244V;ENSP00000437347:E51V	ENSP00000355672:E244V	E	+	2	0	IBA57	226429497	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	8.752000	0.91632	2.133000	0.65898	0.533000	0.62120	GAG		0.632	IBA57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095980.1	NM_001010867		10	85	0	0	0	0.008291	0	10	85				
RHOU	58480	broad.mit.edu	37	1	228879403	228879403	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:228879403G>T	ENST00000366691.3	+	3	1359	c.693G>T	c.(691-693)caG>caT	p.Q231H		NM_021205.5	NP_067028.1			ras homolog family member U									p.Q231H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	13	Breast(184;0.162)	Prostate(94;0.183)				CTCAGCAACAGCCAAAGAAGT	0.468																																							uc001htf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(691-693)CAG>CAT		ras homolog gene family, member U							99.0	109.0	106.0					1																	228879403		2203	4299	6502	SO:0001583	missense	58480				regulation of small GTPase mediated signal transduction	cell projection|cytosol|focal adhesion|Golgi membrane|podosome	GTP binding|metal ion binding|protein binding	g.chr1:228879403G>T		CCDS1575.1	1q42.11-q42.3	2012-02-27	2012-02-27	2004-03-24	ENSG00000116574	ENSG00000116574			17794	protein-coding gene	gene with protein product	"""Ryu GTPase"", ""Wnt-1 responsive Cdc42 homolog"", ""2310026M05Rik"", ""GTP-binding protein like 1"", ""CDC42-like GTPase"", ""GTP-binding protein SB128"", ""ras-like gene family member U"""	606366	"""ras homolog gene family, member U"""	ARHU		11459829	Standard	NM_021205		Approved	WRCH-1, DJ646B12.2, FLJ10616, WRCH1, CDC42L1, hG28K, fJ646B12.2	uc001htf.3	Q7L0Q8	OTTHUMG00000037919	ENST00000366691.3:c.693G>T	1.37:g.228879403G>T	ENSP00000355652:p.Gln231His		Somatic					p.Q231H	NM_021205	NP_067028	WXS	Illumina HiSeq	Unspecified	Q7L0Q8	RHOU_HUMAN			3	1314	+	Breast(184;0.162)	Prostate(94;0.183)	231						Missense_Mutation	SNP	ENST00000366691.3	37	c.693G>T	CCDS1575.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378555	0.42207	.	.	ENSG00000116574	ENST00000366691	T	0.68765	-0.35	4.95	3.96	0.45880	.	0.343617	0.34777	N	0.003687	T	0.55353	0.1915	L	0.40543	1.245	0.39297	D	0.964834	B	0.06786	0.001	B	0.09377	0.004	T	0.59354	-0.7470	10	0.66056	D	0.02	.	10.0713	0.42335	0.1068:0.0:0.8932:0.0	.	231	Q7L0Q8	RHOU_HUMAN	H	231	ENSP00000355652:Q231H	ENSP00000355652:Q231H	Q	+	3	2	RHOU	226946026	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.740000	0.55082	2.557000	0.86248	0.655000	0.94253	CAG		0.468	RHOU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092555.1	NM_021205		18	107	1	0	1.33834e-09	0.007413	1.8246e-09	18	107				
RYR2	6262	broad.mit.edu	37	1	237813179	237813179	+	Silent	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:237813179A>G	ENST00000366574.2	+	50	7832	c.7515A>G	c.(7513-7515)gcA>gcG	p.A2505A	RYR2_ENST00000542537.1_Silent_p.A2489A|RYR2_ENST00000360064.6_Silent_p.A2503A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2505	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.A2503A(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTTTTCAGGCAGCTTTGAGTG	0.458																																							uc001hyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(7513-7515)GCA>GCG		cardiac muscle ryanodine receptor							108.0	103.0	104.0					1																	237813179		1950	4130	6080	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237813179A>G	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7515A>G	1.37:g.237813179A>G			Somatic					p.A2505A	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		50	7635	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2505			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.7515A>G	CCDS55691.1																																																																																				0.458	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		11	102	0	0	0	0.000978	0	11	102				
RYR2	6262	broad.mit.edu	37	1	237921011	237921011	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:237921011A>T	ENST00000366574.2	+	82	11577	c.11260A>T	c.(11260-11262)Atg>Ttg	p.M3754L	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.M3738L|RYR2_ENST00000360064.6_Missense_Mutation_p.M3760L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3754					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.M3752L(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AACTGGACCAATGGTAGCAGC	0.353																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(11260-11262)ATG>TTG		cardiac muscle ryanodine receptor							121.0	117.0	118.0					1																	237921011		1849	4084	5933	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237921011A>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11260A>T	1.37:g.237921011A>T	ENSP00000355533:p.Met3754Leu		Somatic				RYR2_uc010pya.1_Missense_Mutation_p.M169L	p.M3754L	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		82	11380	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3754					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.11260A>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002295	0.74932	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.88818	-2.43;-2.43;-2.43	5.33	5.33	0.75918	.	0.000000	0.85682	U	0.000000	D	0.93465	0.7915	M	0.80183	2.485	0.80722	D	1	P;P	0.45531	0.812;0.86	P;B	0.56563	0.801;0.333	D	0.94232	0.7477	10	0.72032	D	0.01	.	15.5959	0.76578	1.0:0.0:0.0:0.0	.	728;3754	B4DGV4;Q92736	.;RYR2_HUMAN	L	3754;3760;3738;728	ENSP00000355533:M3754L;ENSP00000353174:M3760L;ENSP00000443798:M3738L	ENSP00000353174:M3760L	M	+	1	0	RYR2	235987634	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.253000	0.95501	2.127000	0.65507	0.533000	0.62120	ATG		0.353	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		16	82	0	0	0	0.00499	0	16	82				
OR2T12	127064	broad.mit.edu	37	1	248458341	248458341	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:248458341G>A	ENST00000317996.1	-	1	539	c.540C>T	c.(538-540)ccC>ccT	p.P180P		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P180P(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GCACCAACACGGGGGCCTCGC	0.562																																							uc010pzj.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(538-540)CCC>CCT		olfactory receptor, family 2, subfamily T,							174.0	133.0	147.0					1																	248458341		2201	4298	6499	SO:0001819	synonymous_variant	127064				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248458341G>A	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.540C>T	1.37:g.248458341G>A			Somatic					p.P180P	NM_001004692	NP_001004692	WXS	Illumina HiSeq	Unspecified	Q8NG77	O2T12_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0201)		1	540	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		180			Extracellular (Potential).			Silent	SNP	ENST00000317996.1	37	c.540C>T	CCDS31110.1																																																																																				0.562	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692		15	63	0	0	0	0.00499	0	15	63				
OR2T12	127064	broad.mit.edu	37	1	248458344	248458344	+	Silent	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:248458344G>C	ENST00000317996.1	-	1	536	c.537C>G	c.(535-537)gcC>gcG	p.A179A		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A179A(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			CCAACACGGGGGCCTCGCAGA	0.567																																							uc010pzj.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(535-537)GCC>GCG		olfactory receptor, family 2, subfamily T,							169.0	130.0	143.0					1																	248458344		2201	4298	6499	SO:0001819	synonymous_variant	127064				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248458344G>C	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.537C>G	1.37:g.248458344G>C			Somatic					p.A179A	NM_001004692	NP_001004692	WXS	Illumina HiSeq	Unspecified	Q8NG77	O2T12_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0201)		1	537	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		179			Extracellular (Potential).			Silent	SNP	ENST00000317996.1	37	c.537C>G	CCDS31110.1																																																																																				0.567	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692		13	60	0	0	0	0.003163	0	13	60				
OR2M7	391196	broad.mit.edu	37	1	248487249	248487249	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:248487249C>T	ENST00000317965.2	-	1	650	c.622G>A	c.(622-624)Gtt>Att	p.V208I		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V208I(1)		breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACAGGGAAAACAAGCATTACT	0.428																																							uc010pzk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(622-624)GTT>ATT		olfactory receptor, family 2, subfamily M,							300.0	285.0	290.0					1																	248487249		2203	4300	6503	SO:0001583	missense	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248487249C>T	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.622G>A	1.37:g.248487249C>T	ENSP00000324557:p.Val208Ile		Somatic					p.V208I	NM_001004691	NP_001004691	WXS	Illumina HiSeq	Unspecified	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	622	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		208			Helical; Name=5; (Potential).		B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	c.622G>A	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	C	5.585	0.292645	0.10567	.	.	ENSG00000177186	ENST00000317965	T	0.37411	1.2	1.55	-3.11	0.05299	GPCR, rhodopsin-like superfamily (1);	0.885835	0.09007	U	0.862084	T	0.15305	0.0369	N	0.11560	0.145	0.09310	N	1	B	0.09022	0.002	B	0.13407	0.009	T	0.20174	-1.0283	10	0.56958	D	0.05	.	1.1085	0.01699	0.1607:0.2909:0.3195:0.2289	.	208	Q8NG81	OR2M7_HUMAN	I	208	ENSP00000324557:V208I	ENSP00000324557:V208I	V	-	1	0	OR2M7	246553872	0.000000	0.05858	0.070000	0.20053	0.148000	0.21650	-3.223000	0.00551	-0.680000	0.05211	0.194000	0.17425	GTT		0.428	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		96	325	0	0	0	0.00361	0	96	325				
OR2M7	391196	broad.mit.edu	37	1	248487840	248487840	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:248487840C>T	ENST00000317965.2	-	1	59	c.31G>A	c.(31-33)Gac>Aac	p.D11N		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D11N(1)		breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGAGGAAGTCAGAGTTGAAG	0.458																																							uc010pzk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(31-33)GAC>AAC		olfactory receptor, family 2, subfamily M,							185.0	188.0	187.0					1																	248487840		2203	4300	6503	SO:0001583	missense	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248487840C>T	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.31G>A	1.37:g.248487840C>T	ENSP00000324557:p.Asp11Asn		Somatic					p.D11N	NM_001004691	NP_001004691	WXS	Illumina HiSeq	Unspecified	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	31	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		11			Extracellular (Potential).		B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	c.31G>A	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	C	7.285	0.609932	0.14066	.	.	ENSG00000177186	ENST00000317965	T	0.03094	4.05	1.8	1.8	0.24995	.	0.505404	0.14488	U	0.316517	T	0.06872	0.0175	M	0.79475	2.455	0.09310	N	1	B	0.24043	0.096	B	0.23018	0.043	T	0.13791	-1.0496	10	0.52906	T	0.07	.	10.4143	0.44311	0.0:1.0:0.0:0.0	.	11	Q8NG81	OR2M7_HUMAN	N	11	ENSP00000324557:D11N	ENSP00000324557:D11N	D	-	1	0	OR2M7	246554463	0.001000	0.12720	0.043000	0.18650	0.354000	0.29330	-0.151000	0.10175	0.998000	0.38996	0.194000	0.17425	GAC		0.458	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		30	186	0	0	0	0.003271	0	30	186				
MYO3A	53904	broad.mit.edu	37	10	26462618	26462618	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:26462618A>T	ENST00000265944.5	+	30	3591	c.3425A>T	c.(3424-3426)gAa>gTa	p.E1142V	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1142					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E1142V(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AAACAAGCAGAAAATGCAATC	0.328																																							uc001isn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						c.(3424-3426)GAA>GTA		myosin IIIA							36.0	36.0	36.0					10																	26462618		2203	4300	6503	SO:0001583	missense	53904				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity	g.chr10:26462618A>T	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3425A>T	10.37:g.26462618A>T	ENSP00000265944:p.Glu1142Val		Somatic				MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	p.E1142V	NM_017433	NP_059129	WXS	Illumina HiSeq	Unspecified	Q8NEV4	MYO3A_HUMAN			30	3785	+			1142					Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	c.3425A>T	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	A	12.22	1.873766	0.33069	.	.	ENSG00000095777	ENST00000265944	T	0.78481	-1.18	5.42	1.71	0.24356	.	0.265994	0.42172	D	0.000754	T	0.58409	0.2120	L	0.27053	0.805	0.80722	D	1	B	0.29862	0.259	B	0.27608	0.081	T	0.38134	-0.9675	10	0.21540	T	0.41	.	5.761	0.18201	0.7112:0.1419:0.1469:0.0	.	1142	Q8NEV4	MYO3A_HUMAN	V	1142	ENSP00000265944:E1142V	ENSP00000265944:E1142V	E	+	2	0	MYO3A	26502624	1.000000	0.71417	0.085000	0.20634	0.812000	0.45895	2.949000	0.49074	0.094000	0.17404	0.533000	0.62120	GAA		0.328	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433		4	38	0	0	0	0.009096	0	4	38				
LRRC18	474354	broad.mit.edu	37	10	50121502	50121502	+	Silent	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:50121502T>C	ENST00000374160.3	-	1	775	c.699A>G	c.(697-699)agA>agG	p.R233R	LRRC18_ENST00000298124.3_Silent_p.R233R|WDFY4_ENST00000325239.5_Intron|WDFY4_ENST00000413659.2_Intron|RP11-523O18.7_ENST00000430438.1_RNA	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	233						cytoplasm (GO:0005737)		p.R233R(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						AGATGGTCTTTCTCGGTGTCG	0.522																																							uc001jhd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(697-699)AGA>AGG		leucine rich repeat containing 18							205.0	206.0	206.0					10																	50121502		2203	4300	6503	SO:0001819	synonymous_variant	474354					cytoplasm		g.chr10:50121502T>C	AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.699A>G	10.37:g.50121502T>C			Somatic				WDFY4_uc001jha.3_Intron|LRRC18_uc001jhe.1_Silent_p.R233R	p.R233R	NM_001006939	NP_001006940	WXS	Illumina HiSeq	Unspecified	Q8N456	LRC18_HUMAN			1	779	-			233					Q6UY02	Silent	SNP	ENST00000374160.3	37	c.699A>G	CCDS31197.1																																																																																				0.522	LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047964.1	NM_001006939		25	192	0	0	0	0.003954	0	25	192				
ERCC6	2074	broad.mit.edu	37	10	50679090	50679090	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:50679090G>T	ENST00000355832.5	-	17	3079	c.3001C>A	c.(3001-3003)Ctc>Atc	p.L1001I	RP11-123B3.2_ENST00000423283.1_RNA|ERCC6_ENST00000465653.1_5'Flank|ERCC6_ENST00000542458.1_Missense_Mutation_p.L371I	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	1001	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						AGCTCATAGAGATCATTGGAT	0.328								Direct reversal of damage;Nucleotide excision repair (NER)																															uc001jhs.3		NA																	0				lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						c.(3001-3003)CTC>ATC	Direct_reversal_of_damage|NER	excision repair cross-complementing rodent							200.0	220.0	213.0					10																	50679090		2203	4300	6503	SO:0001583	missense	2074				base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding	g.chr10:50679090G>T	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.3001C>A	10.37:g.50679090G>T	ENSP00000348089:p.Leu1001Ile		Somatic				ERCC6_uc009xod.2_Missense_Mutation_p.L161I|ERCC6_uc010qgr.1_Missense_Mutation_p.L371I|ERCC6_uc001jhr.3_Missense_Mutation_p.L369I	p.L1001I	NM_000124	NP_000115	WXS	Illumina HiSeq	Unspecified	Q03468	ERCC6_HUMAN			17	3155	-			1001			Helicase C-terminal.		D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	37	c.3001C>A	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517912	0.64634	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	T;T	0.78481	-1.18;-1.18	5.8	5.8	0.92144	Helicase, C-terminal (1);	.	.	.	.	T	0.72977	0.3528	N	0.21373	0.66	0.48452	D	0.999657	P;P	0.51057	0.941;0.571	P;B	0.45794	0.493;0.188	T	0.75714	-0.3221	9	0.54805	T	0.06	-18.0071	20.063	0.97692	0.0:0.0:1.0:0.0	.	1001;378	Q03468;Q59FF6	ERCC6_HUMAN;.	I	1001;378;371	ENSP00000348089:L1001I;ENSP00000445134:L371I	ENSP00000348089:L1001I	L	-	1	0	ERCC6	50349096	1.000000	0.71417	0.972000	0.41901	0.961000	0.63080	5.861000	0.69553	2.735000	0.93741	0.655000	0.94253	CTC		0.328	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124		13	187	1	0	2.31682e-05	0.003163	2.75459e-05	13	187				
ZWINT	11130	broad.mit.edu	37	10	58119843	58119843	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:58119843C>A	ENST00000373944.3	-	3	230	c.192G>T	c.(190-192)caG>caT	p.Q64H	ZWINT_ENST00000318387.2_5'Flank|ZWINT_ENST00000460654.1_5'Flank|ZWINT_ENST00000361148.6_Missense_Mutation_p.Q64H|ZWINT_ENST00000395405.1_Missense_Mutation_p.Q64H			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	64					establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)	p.Q64H(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						CCAGGATGTTCTGCAGGAAAT	0.562																																							uc001jjx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(190-192)CAG>CAT		ZW10 interactor isoform a							57.0	54.0	55.0					10																	58119843		2203	4300	6503	SO:0001583	missense	11130				cell division|establishment of localization in cell|mitotic cell cycle checkpoint|mitotic prometaphase|mitotic sister chromatid segregation|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytosol|nucleus	protein N-terminus binding	g.chr10:58119843C>A	AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.192G>T	10.37:g.58119843C>A	ENSP00000363055:p.Gln64His		Somatic				ZWINT_uc001jjy.1_Missense_Mutation_p.Q64H|ZWINT_uc001jka.1_Missense_Mutation_p.Q64H|ZWINT_uc009xoy.1_Intron	p.Q64H	NM_007057	NP_008988	WXS	Illumina HiSeq	Unspecified	O95229	ZWINT_HUMAN			3	229	-			64					A6NNV6|Q0D2I3|Q9BWD0	Missense_Mutation	SNP	ENST00000373944.3	37	c.192G>T	CCDS7249.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633671	0.47049	.	.	ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000373940;ENST00000361148	T;T;T	0.57595	0.39;0.39;0.39	4.64	3.74	0.42951	.	0.000000	0.44483	D	0.000450	T	0.65863	0.2732	M	0.64997	1.995	0.31543	N	0.659686	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.69723	-0.5068	10	0.72032	D	0.01	-5.671	8.6745	0.34170	0.0:0.8927:0.0:0.1073	.	64;64	A6NNV6;O95229	.;ZWINT_HUMAN	H	64	ENSP00000363055:Q64H;ENSP00000378801:Q64H;ENSP00000354921:Q64H	ENSP00000354921:Q64H	Q	-	3	2	ZWINT	57789849	1.000000	0.71417	0.995000	0.50966	0.856000	0.48823	1.243000	0.32767	1.093000	0.41377	0.644000	0.83932	CAG		0.562	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048132.1			12	47	1	0	4.84862e-15	0.000978	7.42728e-15	12	47				
JMJD1C	221037	broad.mit.edu	37	10	64967523	64967523	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:64967523C>A	ENST00000399262.2	-	10	4124	c.3906G>T	c.(3904-3906)atG>atT	p.M1302I	JMJD1C_ENST00000402544.1_Missense_Mutation_p.M1083I|JMJD1C_ENST00000399251.1_Missense_Mutation_p.M1083I|JMJD1C_ENST00000542921.1_Missense_Mutation_p.M1120I	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1302					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TGACAGATGCCATAGCAGCCT	0.423																																							uc001jmn.2		NA																	0				ovary(4)|breast(1)|central_nervous_system(1)	6						c.(3904-3906)ATG>ATT		jumonji domain containing 1C isoform a							116.0	113.0	114.0					10																	64967523		1931	4122	6053	SO:0001583	missense	221037				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding	g.chr10:64967523C>A	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.3906G>T	10.37:g.64967523C>A	ENSP00000382204:p.Met1302Ile		Somatic				JMJD1C_uc001jml.2_Missense_Mutation_p.M1083I|JMJD1C_uc001jmm.2_Missense_Mutation_p.M1014I|JMJD1C_uc010qiq.1_Missense_Mutation_p.M1120I|JMJD1C_uc009xpi.2_Missense_Mutation_p.M1120I|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc009xpk.1_Missense_Mutation_p.M339I	p.M1302I	NM_032776	NP_116165	WXS	Illumina HiSeq	Unspecified	Q15652	JHD2C_HUMAN			10	4206	-	Prostate(12;0.0119)|all_hematologic(501;0.191)		1302					A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	c.3906G>T	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	C	7.275	0.607882	0.14002	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.53640	0.96;0.61;2.51;0.96	5.94	1.5	0.22942	.	0.397578	0.32002	N	0.006739	T	0.22898	0.0553	N	0.14661	0.345	0.30166	N	0.801756	B;B;B	0.13594	0.008;0.008;0.008	B;B;B	0.15484	0.013;0.013;0.013	T	0.05971	-1.0853	10	0.45353	T	0.12	-1.8844	1.0657	0.01610	0.4267:0.2403:0.1148:0.2182	.	843;1302;1120	A6PW35;Q15652;A0T124	.;JHD2C_HUMAN;.	I	1302;1083;1083;1120	ENSP00000382204:M1302I;ENSP00000384990:M1083I;ENSP00000382195:M1083I;ENSP00000444682:M1120I	ENSP00000382195:M1083I	M	-	3	0	JMJD1C	64637529	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.523000	0.22925	0.812000	0.34326	0.591000	0.81541	ATG		0.423	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241		35	151	1	0	1.42033e-22	0.004289	2.333e-22	35	151				
VCL	7414	broad.mit.edu	37	10	75874084	75874084	+	Missense_Mutation	SNP	G	G	T	rs397517238		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:75874084G>T	ENST00000211998.4	+	20	3186	c.3092G>T	c.(3091-3093)cGg>cTg	p.R1031L	VCL_ENST00000372755.3_Missense_Mutation_p.R963L|VCL_ENST00000417648.2_Missense_Mutation_p.R224L	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	1031	C-terminal tail.|Facilitates phospholipid membrane insertion. {ECO:0000250}.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.R1031L(1)	VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GAGGTGACTCGGTTGGCCAAG	0.552																																							uc001jwd.2		NA																VCL/ALK(4)	1	Substitution - Missense(1)		lung(1)	kidney(4)|ovary(1)|central_nervous_system(1)	6						c.(3091-3093)CGG>CTG		vinculin isoform meta-VCL							94.0	86.0	89.0					10																	75874084		2203	4300	6503	SO:0001583	missense	7414				adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity	g.chr10:75874084G>T	M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.3092G>T	10.37:g.75874084G>T	ENSP00000211998:p.Arg1031Leu		Somatic				VCL_uc009xrr.2_Missense_Mutation_p.R712L|VCL_uc010qky.1_Missense_Mutation_p.R938L|VCL_uc001jwe.2_Missense_Mutation_p.R963L|VCL_uc010qkz.1_Missense_Mutation_p.R224L	p.R1031L	NM_014000	NP_054706	WXS	Illumina HiSeq	Unspecified	P18206	VINC_HUMAN			20	3186	+	Prostate(51;0.0112)		1031			C-terminal tail.|Facilitates phospholipid membrane insertion (By similarity).		Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	ENST00000211998.4	37	c.3092G>T	CCDS7341.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429753	0.62844	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000417648;ENST00000537043;ENST00000436396	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.98	5.08	0.68730	.	0.260600	0.34386	N	0.004004	T	0.51295	0.1666	L	0.39898	1.24	0.80722	D	1	P;P;B;P	0.42296	0.775;0.612;0.072;0.554	P;B;B;B	0.51742	0.678;0.23;0.037;0.175	T	0.54463	-0.8290	10	0.87932	D	0	.	11.3592	0.49633	0.138:0.0:0.862:0.0	.	224;890;963;1031	B4DTM7;F5H7T3;P18206-2;P18206	.;.;.;VINC_HUMAN	L	963;1031;224;890;703	ENSP00000361841:R963L;ENSP00000211998:R1031L;ENSP00000411887:R224L;ENSP00000415489:R703L	ENSP00000211998:R1031L	R	+	2	0	VCL	75544090	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	4.673000	0.61604	1.539000	0.49286	0.650000	0.86243	CGG		0.552	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000		8	42	1	0	1.12685e-05	0.004482	1.35554e-05	8	42				
SH2D4B	387694	broad.mit.edu	37	10	82369203	82369203	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:82369203G>T	ENST00000470604.2	+	6	878	c.878G>T	c.(877-879)cGc>cTc	p.R293L	SH2D4B_ENST00000313455.4_Missense_Mutation_p.R246L|SH2D4B_ENST00000339284.2_Missense_Mutation_p.R294L|SH2D4B_ENST00000372150.3_3'UTR			Q5SQS7	SH24B_HUMAN	SH2 domain containing 4B	293								p.R294L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)	13			Colorectal(32;0.229)			CGCCCGCTGCGCCCAGTCTCC	0.612																																							uc001kck.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(880-882)CGC>CTC		SH2 domain containing 4B isoform 1							62.0	63.0	62.0					10																	82369203		2203	4300	6503	SO:0001583	missense	387694							g.chr10:82369203G>T		CCDS7370.1, CCDS44449.1	10q23.1	2013-02-14			ENSG00000178217	ENSG00000178217		"""SH2 domain containing"""	31440	protein-coding gene	gene with protein product							Standard	NM_207372		Approved		uc001kck.1	Q5SQS7	OTTHUMG00000018617	ENST00000470604.2:c.878G>T	10.37:g.82369203G>T	ENSP00000417953:p.Arg293Leu		Somatic				SH2D4B_uc001kcl.1_Missense_Mutation_p.R246L|SH2D4B_uc001kcm.1_Missense_Mutation_p.R41L	p.R294L	NM_207372	NP_997255	WXS	Illumina HiSeq	Unspecified	Q5SQS7	SH24B_HUMAN	Colorectal(32;0.229)		6	1311	+			293					Q5SQS5|Q6ZVW9|Q6ZVZ3	Missense_Mutation	SNP	ENST00000470604.2	37	c.881G>T		.	.	.	.	.	.	.	.	.	.	G	18.81	3.702104	0.68501	.	.	ENSG00000178217	ENST00000339284;ENST00000470604;ENST00000313455	T;T;T	0.10960	2.82;2.82;2.82	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000003	T	0.15349	0.0370	M	0.69823	2.125	0.53688	D	0.999976	P;P;B	0.49090	0.666;0.919;0.338	B;B;B	0.38327	0.247;0.271;0.209	T	0.02691	-1.1123	10	0.54805	T	0.06	-4.3849	16.5076	0.84276	0.0:0.0:1.0:0.0	.	293;246;294	Q5SQS7;Q5SQS7-3;Q5SQS7-2	SH24B_HUMAN;.;.	L	294;293;246	ENSP00000345295:R294L;ENSP00000417953:R293L;ENSP00000314242:R246L	ENSP00000314242:R246L	R	+	2	0	SH2D4B	82359183	0.988000	0.35896	0.958000	0.39756	0.846000	0.48090	6.864000	0.75494	2.495000	0.84180	0.563000	0.77884	CGC		0.612	SH2D4B-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_351984		4	61	1	0	2.56e-06	0.009096	3.1922e-06	4	61				
CCSER2	54462	broad.mit.edu	37	10	86259667	86259667	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:86259667G>T	ENST00000224756.8	+	10	2547	c.2362G>T	c.(2362-2364)Ggc>Tgc	p.G788C	CCSER2_ENST00000543283.1_Missense_Mutation_p.G215C|CCSER2_ENST00000372088.2_Intron|CCSER2_ENST00000494144.1_Intron	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	788					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)		p.G788C(1)									TCCTTGGCAGGGCTCCTTCCA	0.527																																							uc001kdh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2362-2364)GGC>TGC		granule cell antiserum positive 14							130.0	116.0	121.0					10																	86259667		2203	4300	6503	SO:0001583	missense	54462							g.chr10:86259667G>T		CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.2362G>T	10.37:g.86259667G>T	ENSP00000224756:p.Gly788Cys		Somatic				FAM190B_uc010qmd.1_Intron|FAM190B_uc001kdi.1_Intron|FAM190B_uc010qme.1_Missense_Mutation_p.G215C	p.G788C	NM_018999	NP_061872	WXS	Illumina HiSeq	Unspecified	Q9H7U1	F190B_HUMAN			10	2556	+			788					B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Missense_Mutation	SNP	ENST00000224756.8	37	c.2362G>T	CCDS31235.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.601234	0.66445	.	.	ENSG00000107771	ENST00000224756;ENST00000543283	T;T	0.25085	2.14;1.82	5.96	5.96	0.96718	.	0.136830	0.46442	D	0.000281	T	0.46483	0.1395	L	0.45581	1.43	0.46654	D	0.999148	D	0.89917	1.0	D	0.97110	1.0	T	0.14671	-1.0464	10	0.49607	T	0.09	.	17.9083	0.88926	0.0:0.0:1.0:0.0	.	788	Q9H7U1	F190B_HUMAN	C	788;215	ENSP00000224756:G788C;ENSP00000439944:G215C	ENSP00000224756:G788C	G	+	1	0	FAM190B	86249647	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.616000	0.83018	2.833000	0.97629	0.555000	0.69702	GGC		0.527	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049132.2	NM_018999		8	85	1	0	3.09899e-07	0.004482	3.99838e-07	8	85				
PLCE1	51196	broad.mit.edu	37	10	95892185	95892185	+	Missense_Mutation	SNP	T	T	A	rs374646299		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:95892185T>A	ENST00000371380.3	+	2	1696	c.1461T>A	c.(1459-1461)ttT>ttA	p.F487L	PLCE1_ENST00000371375.1_Missense_Mutation_p.F179L|PLCE1_ENST00000371385.3_Missense_Mutation_p.F179L|PLCE1_ENST00000260766.3_Missense_Mutation_p.F487L			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	487					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)	p.F179L(1)|p.F487L(1)		liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TCAGTACTTTTGGAGGATCCA	0.433																																							uc001kjk.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(1459-1461)TTT>TTA		phospholipase C, epsilon 1 isoform 1							111.0	105.0	107.0					10																	95892185		1981	4158	6139	SO:0001583	missense	51196				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity	g.chr10:95892185T>A		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1461T>A	10.37:g.95892185T>A	ENSP00000360431:p.Phe487Leu		Somatic				PLCE1_uc010qnx.1_Missense_Mutation_p.F487L|PLCE1_uc001kjm.2_Missense_Mutation_p.F179L	p.F487L	NM_016341	NP_057425	WXS	Illumina HiSeq	Unspecified	Q9P212	PLCE1_HUMAN			3	2095	+		Colorectal(252;0.0458)	487					A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	c.1461T>A	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	T	13.66	2.303731	0.40795	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	4.84	0.697	0.18081	Ras guanine nucleotide exchange factor, domain (1);	0.451703	0.21555	N	0.072676	T	0.46054	0.1373	N	0.14661	0.345	0.27535	N	0.950988	B;B;B	0.11235	0.003;0.004;0.003	B;B;B	0.12837	0.008;0.003;0.008	T	0.22977	-1.0201	10	0.33940	T	0.23	.	4.3807	0.11293	0.2105:0.2178:0.0:0.5718	.	487;179;487	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	L	487;487;179;179	ENSP00000260766:F487L;ENSP00000360431:F487L;ENSP00000360438:F179L;ENSP00000360426:F179L	ENSP00000260766:F487L	F	+	3	2	PLCE1	95882175	0.050000	0.20438	1.000000	0.80357	0.907000	0.53573	-1.261000	0.02855	0.250000	0.21479	0.460000	0.39030	TTT		0.433	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341		19	107	0	0	0	0.010504	0	19	107				
CNNM1	26507	broad.mit.edu	37	10	101090479	101090479	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:101090479C>T	ENST00000356713.4	+	1	1624	c.1335C>T	c.(1333-1335)gaC>gaT	p.D445D	CNNM1_ENST00000370534.4_Silent_p.D80D|CNNM1_ENST00000446890.1_Silent_p.D374D|CNNM1_ENST00000370528.3_Silent_p.D374D	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	445	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.D80D(1)|p.D445D(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		TGCGCTCAGACGCGGTGCTCG	0.602																																							uc001kpp.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1333-1335)GAC>GAT		cyclin M1							79.0	66.0	70.0					10																	101090479		2203	4300	6503	SO:0001819	synonymous_variant	26507				ion transport	integral to membrane|plasma membrane		g.chr10:101090479C>T	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.1335C>T	10.37:g.101090479C>T			Somatic				CNNM1_uc009xwe.2_Silent_p.D445D|CNNM1_uc010qpi.1_Silent_p.D445D|CNNM1_uc009xwf.2_Silent_p.D445D	p.D445D	NM_020348	NP_065081	WXS	Illumina HiSeq	Unspecified	Q9NRU3	CNNM1_HUMAN		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)	1	1624	+		Colorectal(252;0.234)	445			CBS 1.		Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Silent	SNP	ENST00000356713.4	37	c.1335C>T	CCDS7478.2																																																																																				0.602	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348		5	35	0	0	0	0.001168	0	5	35				
WNT8B	7479	broad.mit.edu	37	10	102242208	102242208	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:102242208C>T	ENST00000343737.5	+	6	819	c.691C>T	c.(691-693)Cgc>Tgc	p.R231C		NM_003393.3	NP_003384.2	Q93098	WNT8B_HUMAN	wingless-type MMTV integration site family, member 8B	231					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|negative regulation of gene expression (GO:0010629)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of gene expression (GO:0010628)|response to estradiol (GO:0032355)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.R231C(1)		breast(1)|large_intestine(1)|ovary(1)|skin(1)	4		Colorectal(252;0.117)		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)		CGCGGCCGGCCGCGGCGCCAT	0.667											OREG0020440	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001krb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|large_intestine(1)|skin(1)	4						c.(691-693)CGC>TGC		wingless-type MMTV integration site family,							20.0	23.0	22.0					10																	102242208		2194	4294	6488	SO:0001583	missense	7479				anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|determination of dorsal identity|endoderm development|eye development|gastrulation|hypothalamus development|negative regulation of anterior neural cell fate commitment of the neural plate by Wnt receptor signaling pathway|otic placode formation|positive regulation of gene expression|response to estradiol stimulus|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity	g.chr10:102242208C>T	X91940	CCDS7494.1	10q24	2003-11-12			ENSG00000075290	ENSG00000075290		"""Wingless-type MMTV integration sites"""	12789	protein-coding gene	gene with protein product		601396				8661156	Standard	NM_003393		Approved		uc001krb.3	Q93098	OTTHUMG00000018912	ENST00000343737.5:c.691C>T	10.37:g.102242208C>T	ENSP00000340677:p.Arg231Cys		Somatic	OREG0020440	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1365		p.R231C	NM_003393	NP_003384	WXS	Illumina HiSeq	Unspecified	Q93098	WNT8B_HUMAN		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)	6	805	+		Colorectal(252;0.117)	231					O00771|Q5VX55|Q8WYK9	Missense_Mutation	SNP	ENST00000343737.5	37	c.691C>T	CCDS7494.1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.835273	0.50951	.	.	ENSG00000075290	ENST00000343737	T	0.76578	-1.03	5.0	4.07	0.47477	.	0.617290	0.17131	N	0.185813	D	0.90082	0.6902	M	0.93678	3.445	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	D	0.91047	0.4875	10	0.72032	D	0.01	.	12.3763	0.55281	0.3066:0.6934:0.0:0.0	.	231	Q93098	WNT8B_HUMAN	C	231	ENSP00000340677:R231C	ENSP00000340677:R231C	R	+	1	0	WNT8B	102232198	1.000000	0.71417	1.000000	0.80357	0.420000	0.31355	3.125000	0.50469	1.050000	0.40346	0.313000	0.20887	CGC		0.667	WNT8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049867.1	NM_003393		3	24	0	0	0	0.009096	0	3	24				
NEURL1	9148	broad.mit.edu	37	10	105330655	105330655	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:105330655A>G	ENST00000369780.4	+	2	521	c.112A>G	c.(112-114)Act>Gct	p.T38A	NEURL_ENST00000369777.2_Missense_Mutation_p.T21A	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		38					brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T38A(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CTTCCCCGTCACTTCTCACCG	0.652																																							uc001kxh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(112-114)ACT>GCT		neuralized-like							103.0	121.0	115.0					10																	105330655		2203	4300	6503	SO:0001583	missense	9148				nervous system development	perinuclear region of cytoplasm	zinc ion binding	g.chr10:105330655A>G																												ENST00000369780.4:c.112A>G	10.37:g.105330655A>G	ENSP00000358795:p.Thr38Ala		Somatic					p.T38A	NM_004210	NP_004201	WXS	Illumina HiSeq	Unspecified	O76050	NEU1A_HUMAN		Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)	2	522	+			38					Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	ENST00000369780.4	37	c.112A>G	CCDS7551.1	.	.	.	.	.	.	.	.	.	.	A	11.24	1.580191	0.28180	.	.	ENSG00000107954	ENST00000369780;ENST00000437579;ENST00000369777	.	.	.	4.51	-6.0	0.02206	.	0.659654	0.15641	N	0.251891	T	0.14356	0.0347	N	0.24115	0.695	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.21211	-1.0252	9	0.16896	T	0.51	-21.1514	2.548	0.04742	0.2118:0.4188:0.0938:0.2756	.	38	O76050	NEU1A_HUMAN	A	38;21;21	.	ENSP00000358792:T21A	T	+	1	0	NEURL	105320645	0.000000	0.05858	0.109000	0.21407	0.546000	0.35178	-0.961000	0.03845	-0.743000	0.04784	0.459000	0.35465	ACT		0.652	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1			48	234	0	0	0	0.00361	0	48	234				
VAX1	11023	broad.mit.edu	37	10	118896116	118896116	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:118896116C>A	ENST00000369206.5	-	2	295	c.296G>T	c.(295-297)cGg>cTg	p.R99L	VAX1_ENST00000277905.2_Missense_Mutation_p.R99L	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	99					axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R99L(2)		endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		CCTCTTAGGCCGGTCCAAGTC	0.657																																							uc009xyx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(295-297)CGG>CTG		ventral anterior homeobox 1 isoform a							53.0	47.0	49.0					10																	118896116		2203	4300	6503	SO:0001583	missense	11023					nucleus	sequence-specific DNA binding	g.chr10:118896116C>A	AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.296G>T	10.37:g.118896116C>A	ENSP00000358207:p.Arg99Leu		Somatic				VAX1_uc001ldb.1_Missense_Mutation_p.R99L	p.R99L	NM_001112704	NP_001106175	WXS	Illumina HiSeq	Unspecified	Q5SQQ9	VAX1_HUMAN		all cancers(201;0.0108)	2	541	-			99					B1AVW5|Q6ZSX0	Missense_Mutation	SNP	ENST00000369206.5	37	c.296G>T	CCDS44483.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158843	0.78226	.	.	ENSG00000148704	ENST00000277905;ENST00000369206	D;D	0.95918	-3.85;-3.85	4.03	4.03	0.46877	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000001	D	0.96846	0.8970	L	0.60455	1.87	0.80722	D	1	D;D	0.76494	0.999;0.999	P;D	0.72982	0.9;0.979	D	0.97626	1.0139	10	0.87932	D	0	-15.033	16.3358	0.83060	0.0:1.0:0.0:0.0	.	99;99	Q5SQQ9;Q5SQQ9-2	VAX1_HUMAN;.	L	99	ENSP00000277905:R99L;ENSP00000358207:R99L	ENSP00000277905:R99L	R	-	2	0	VAX1	118886106	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.228000	0.78079	2.083000	0.62718	0.455000	0.32223	CGG		0.657	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050559.3	XM_301242		10	22	1	0	0.00621372	0.006214	0.00661825	10	22				
CPXM2	119587	broad.mit.edu	37	10	125521558	125521558	+	Missense_Mutation	SNP	G	G	A	rs181886504	byFrequency	TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:125521558G>A	ENST00000241305.3	-	11	1761	c.1607C>T	c.(1606-1608)aCg>aTg	p.T536M	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	536					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.T536M(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		GTGTTCCTGCGTCTTCCAGGG	0.657													G|||	5	0.000998403	0.0	0.0	5008	,	,		16107	0.004		0.0	False		,,,				2504	0.001						uc001lhk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1606-1608)ACG>ATG		carboxypeptidase X (M14 family), member 2							70.0	71.0	71.0					10																	125521558		2203	4300	6503	SO:0001583	missense	119587				cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding	g.chr10:125521558G>A	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.1607C>T	10.37:g.125521558G>A	ENSP00000241305:p.Thr536Met		Somatic				CPXM2_uc001lhj.2_RNA	p.T536M	NM_198148	NP_937791	WXS	Illumina HiSeq	Unspecified	Q8N436	CPXM2_HUMAN		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)	11	1932	-		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)	536					B4E3Q2	Missense_Mutation	SNP	ENST00000241305.3	37	c.1607C>T	CCDS7637.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	12.13	1.844773	0.32606	.	.	ENSG00000121898	ENST00000368854;ENST00000241305;ENST00000540123;ENST00000418782	D	0.96427	-4.01	5.25	4.35	0.52113	Peptidase M14, carboxypeptidase A (2);	0.104536	0.64402	D	0.000005	D	0.90865	0.7130	L	0.37850	1.14	0.44395	D	0.997304	B	0.31209	0.313	B	0.29942	0.109	D	0.89963	0.4088	10	0.41790	T	0.15	-17.8099	14.3479	0.66680	0.0715:0.0:0.9285:0.0	.	536	Q8N436	CPXM2_HUMAN	M	32;536;369;511	ENSP00000241305:T536M	ENSP00000241305:T536M	T	-	2	0	CPXM2	125511548	1.000000	0.71417	0.976000	0.42696	0.150000	0.21749	3.189000	0.50965	1.439000	0.47511	0.609000	0.83330	ACG		0.657	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148		10	74	0	0	0	0.000978	0	10	74				
KRTAP5-2	440021	broad.mit.edu	37	11	1618918	1618918	+	3'UTR	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:1618918G>T	ENST00000412090.1	-	0	606				KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2							keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CACCAAACAGGAGAAACCTGA	0.547																																							uc009ycx.1		NA																	0					0						c.(16-18)AGG>AGT		SubName: Full=cDNA FLJ30579 fis, clone BRAWH2006989, weakly similar to DNA-DIRECTED RNA POLYMERASE II LARGEST SUBUNIT;          EC=2.7.7.6;							65.0	65.0	65.0					11																	1618918		2202	4299	6501	SO:0001624	3_prime_UTR_variant	338651							g.chr11:1618918G>T	AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.*29C>A	11.37:g.1618918G>T			Somatic				LOC338651_uc001ltt.1_RNA|KRTAP5-2_uc001ltv.2_3'UTR	p.R6S	NR_021489		WXS	Illumina HiSeq	Unspecified					2	769	+								A9JTZ1	Missense_Mutation	SNP	ENST00000412090.1	37	c.18G>T	CCDS31331.1																																																																																				0.547	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384775.1	NM_001004325		6	50	1	0	0.00198382	0.001984	0.00214651	6	50				
KRTAP5-5	439915	broad.mit.edu	37	11	1651183	1651183	+	Missense_Mutation	SNP	G	G	T	rs559020569		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:1651183G>T	ENST00000399676.2	+	1	151	c.113G>T	c.(112-114)tGt>tTt	p.C38F		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	38						keratin filament (GO:0045095)		p.C38F(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		tgtgggggctgtggctccggc	0.726													-|||	1	0.000199681	0.0	0.0	5008	,	,		6683	0.0		0.001	False		,,,				2504	0.0						uc001lty.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(112-114)TGT>TTT		keratin associated protein 5-5							18.0	28.0	25.0					11																	1651183		1850	3796	5646	SO:0001583	missense	439915					keratin filament		g.chr11:1651183G>T	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.113G>T	11.37:g.1651183G>T	ENSP00000382584:p.Cys38Phe		Somatic					p.C38F	NM_001001480	NP_001001480	WXS	Illumina HiSeq	Unspecified	Q701N2	KRA55_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	1	151	+		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	38					A8MWN2	Missense_Mutation	SNP	ENST00000399676.2	37	c.113G>T	CCDS41592.1	.	.	.	.	.	.	.	.	.	.	G	3.649	-0.071911	0.07228	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01323	5.01	2.47	2.47	0.30058	.	.	.	.	.	T	0.02494	0.0076	M	0.83603	2.65	0.24481	N	0.994345	P	0.45902	0.868	B	0.36922	0.236	T	0.40979	-0.9534	9	0.87932	D	0	.	5.8265	0.18556	0.1695:0.0:0.8305:0.0	.	38	Q701N2	KRA55_HUMAN	F	38;36	ENSP00000382584:C38F	ENSP00000382584:C38F	C	+	2	0	KRTAP5-5	1607759	0.819000	0.29175	0.978000	0.43139	0.118000	0.20060	2.257000	0.43240	1.342000	0.45619	0.380000	0.24917	TGT		0.726	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1			4	25	1	0	1.23904e-05	0.000602	1.48612e-05	4	25				
OSBPL5	114879	broad.mit.edu	37	11	3121425	3121425	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:3121425C>T	ENST00000263650.7	-	14	1743	c.1584G>A	c.(1582-1584)gaG>gaA	p.E528E	OSBPL5_ENST00000542243.1_Silent_p.E159E|OSBPL5_ENST00000389989.3_Silent_p.E460E|OSBPL5_ENST00000525498.1_Silent_p.E439E|OSBPL5_ENST00000348039.5_Silent_p.E460E	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	528					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)	p.E528E(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		GGGTGTAATCCTCGGCTCGGT	0.607																																							uc001lxk.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|central_nervous_system(1)	3						c.(1582-1584)GAG>GAA		oxysterol-binding protein-like protein 5 isoform							145.0	114.0	125.0					11																	3121425		2202	4298	6500	SO:0001819	synonymous_variant	114879				cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding	g.chr11:3121425C>T	AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.1584G>A	11.37:g.3121425C>T			Somatic				OSBPL5_uc010qxq.1_Silent_p.E439E|OSBPL5_uc009ydw.2_Silent_p.E460E|OSBPL5_uc001lxl.2_Silent_p.E460E|OSBPL5_uc009ydx.2_Silent_p.E552E	p.E528E	NM_020896	NP_065947	WXS	Illumina HiSeq	Unspecified	Q9H0X9	OSBL5_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)	14	1742	-		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)	528					A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Silent	SNP	ENST00000263650.7	37	c.1584G>A	CCDS31344.1																																																																																				0.607	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2			3	18	0	0	0	0.009096	0	3	18				
TEAD1	7003	broad.mit.edu	37	11	12886397	12886397	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:12886397A>G	ENST00000527575.1	+	4	393	c.280A>G	c.(280-282)Att>Gtt	p.I94V	TEAD1_ENST00000527636.1_Missense_Mutation_p.I94V|TEAD1_ENST00000334310.6_Missense_Mutation_p.I79V|TEAD1_ENST00000361985.2_Missense_Mutation_p.I94V|TEAD1_ENST00000361905.4_Missense_Mutation_p.I79V			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)	94					gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I79V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GTCTAGTCACATTCAGGTTCT	0.473																																							uc001mkj.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(235-237)ATT>GTT		TEA domain family member 1							244.0	211.0	222.0					11																	12886397		2200	4294	6494	SO:0001583	missense	7003				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr11:12886397A>G	X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000527575.1:c.280A>G	11.37:g.12886397A>G	ENSP00000435977:p.Ile94Val		Somatic				TEAD1_uc009ygk.2_RNA	p.I79V	NM_021961	NP_068780	WXS	Illumina HiSeq	Unspecified	P28347	TEAD1_HUMAN		Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)	5	900	+			94			TEA.		A4FUP2|E7EV65	Missense_Mutation	SNP	ENST00000527575.1	37	c.235A>G		.	.	.	.	.	.	.	.	.	.	A	19.02	3.744990	0.69418	.	.	ENSG00000187079	ENST00000361905;ENST00000527636;ENST00000527575;ENST00000334310;ENST00000361985	T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.61887	0.2383	M	0.93420	3.415	0.80722	D	1	P	0.36837	0.571	P	0.46208	0.507	T	0.70223	-0.4931	10	0.87932	D	0	-2.1217	16.0486	0.80740	1.0:0.0:0.0:0.0	.	94	P28347	TEAD1_HUMAN	V	79;94;94;79;94	ENSP00000355332:I79V;ENSP00000435233:I94V;ENSP00000435977:I94V;ENSP00000334754:I79V;ENSP00000354588:I94V	ENSP00000334754:I79V	I	+	1	0	TEAD1	12842973	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.270000	0.75569	0.482000	0.46254	ATT		0.473	TEAD1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000386888.1	NM_021961		25	110	0	0	0	0.007291	0	25	110				
DGKZ	8525	broad.mit.edu	37	11	46389247	46389247	+	Missense_Mutation	SNP	T	T	G	rs34470543|rs533662070		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:46389247T>G	ENST00000454345.1	+	4	1008	c.883T>G	c.(883-885)Tcc>Gcc	p.S295A	DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000343674.6_Missense_Mutation_p.S123A|DGKZ_ENST00000456247.2_Missense_Mutation_p.S106A|DGKZ_ENST00000527911.1_Missense_Mutation_p.S106A|DGKZ_ENST00000528615.1_Intron|DGKZ_ENST00000421244.2_Missense_Mutation_p.S106A|DGKZ_ENST00000318201.8_Missense_Mutation_p.S106A|DGKZ_ENST00000532868.2_Missense_Mutation_p.S110A|DGKZ_ENST00000395574.3_Missense_Mutation_p.S72A	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	295					blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)	p.S106A(1)|p.S123A(1)|p.S295A(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		GACCAACGTGTCCGGGGACTT	0.647											OREG0020942	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	T|||	1	0.000199681	0.0	0.0014	5008	,	,		11133	0.0		0.0	False		,,,				2504	0.0						uc001ncn.1		NA																	3	Substitution - Missense(3)		lung(3)	pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(883-885)TCC>GCC		diacylglycerol kinase zeta isoform 4							130.0	104.0	113.0					11																	46389247		2202	4297	6499	SO:0001583	missense	8525				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding	g.chr11:46389247T>G	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.883T>G	11.37:g.46389247T>G	ENSP00000412178:p.Ser295Ala		Somatic	OREG0020942	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	938	DGKZ_uc001nch.1_Missense_Mutation_p.S123A|DGKZ_uc010rgq.1_Missense_Mutation_p.S72A|DGKZ_uc001ncj.1_Missense_Mutation_p.S72A|DGKZ_uc010rgr.1_Missense_Mutation_p.S71A|DGKZ_uc001nck.1_5'UTR|DGKZ_uc001ncl.2_Missense_Mutation_p.S106A|DGKZ_uc001ncm.2_Missense_Mutation_p.S106A|DGKZ_uc009yky.1_Missense_Mutation_p.S106A|DGKZ_uc010rgs.1_Missense_Mutation_p.S106A|DGKZ_uc001nci.1_Missense_Mutation_p.S72A	p.S295A	NM_001105540	NP_001099010	WXS	Illumina HiSeq	Unspecified	Q13574	DGKZ_HUMAN		GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)	4	1008	+			295			Phorbol-ester/DAG-type 1.		B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	c.883T>G	CCDS41640.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.661283	0.88154	.	.	ENSG00000149091	ENST00000343674;ENST00000395574;ENST00000532868;ENST00000527911;ENST00000456247;ENST00000421244;ENST00000318201;ENST00000454345;ENST00000524448	D;T;T;T;D;T;T;T;T	0.84442	-1.85;2.48;2.53;3.47;-1.85;2.36;2.41;1.72;2.57	5.16	5.16	0.70880	Protein kinase C-like, phorbol ester/diacylglycerol binding (1);	0.105230	0.64402	D	0.000002	D	0.89012	0.6594	L	0.58810	1.83	0.80722	D	1	B;P;P;B;P;B;B;P;D;P	0.55605	0.064;0.864;0.546;0.104;0.928;0.314;0.166;0.736;0.972;0.864	B;B;B;B;P;B;B;B;P;B	0.57720	0.033;0.38;0.13;0.056;0.533;0.248;0.119;0.255;0.826;0.38	D	0.89383	0.3683	10	0.51188	T	0.08	.	15.345	0.74330	0.0:0.0:0.0:1.0	.	106;71;72;106;295;106;106;72;72;123	B7Z2M9;B7Z6M3;B7Z8F6;E9PPW4;Q13574;Q13574-2;G3V0F6;A8MVN1;Q6ZWA5;Q6ZVG7	.;.;.;.;DGKZ_HUMAN;.;.;.;.;.	A	123;72;71;106;106;106;106;295;16	ENSP00000343065:S123A;ENSP00000378941:S72A;ENSP00000436273:S71A;ENSP00000436291:S106A;ENSP00000395684:S106A;ENSP00000391021:S106A;ENSP00000320340:S106A;ENSP00000412178:S295A;ENSP00000435763:S16A	ENSP00000320340:S106A	S	+	1	0	DGKZ	46345823	1.000000	0.71417	0.996000	0.52242	0.911000	0.54048	7.919000	0.87513	2.092000	0.63282	0.454000	0.30748	TCC		0.647	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540		6	30	0	0	0	0.001984	0	6	30				
LOC440040	440040	broad.mit.edu	37	11	49598269	49598269	+	RNA	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:49598269G>A	ENST00000527477.1	+	0	873																											AGCCATTCAGGTCCAGAATTT	0.488																																							uc010rhy.1		NA																	0					0						c.(382-384)GTC>ATC		SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;																																						440040							g.chr11:49598269G>A																													11.37:g.49598269G>A			Somatic				LOC440040_uc009ymb.2_Missense_Mutation_p.V128I	p.V128I	NR_027044		WXS	Illumina HiSeq	Unspecified					2	860	+									Missense_Mutation	SNP	ENST00000527477.1	37	c.382G>A																																																																																					0.488	RP11-707M1.1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000391378.2			6	18	0	0	0	0.00308	0	6	18				
OR4A16	81327	broad.mit.edu	37	11	55111517	55111517	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:55111517A>G	ENST00000314721.2	+	1	891	c.841A>G	c.(841-843)Aat>Gat	p.N281D		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N281D(1)		NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						ACTCATGTTGAATCCTTTAAT	0.318																																							uc010rie.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|pancreas(1)	3						c.(841-843)AAT>GAT		olfactory receptor, family 4, subfamily A,							76.0	72.0	74.0					11																	55111517		2201	4296	6497	SO:0001583	missense	81327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55111517A>G	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.841A>G	11.37:g.55111517A>G	ENSP00000325128:p.Asn281Asp		Somatic					p.N281D	NM_001005274	NP_001005274	WXS	Illumina HiSeq	Unspecified	Q8NH70	O4A16_HUMAN			1	841	+			281			Helical; Name=7; (Potential).		Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	37	c.841A>G	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	a	12.19	1.863755	0.32884	.	.	ENSG00000181961	ENST00000314721	T	0.56444	0.46	2.86	2.86	0.33363	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.67832	0.2935	M	0.82132	2.575	0.29883	N	0.825887	D	0.57899	0.981	P	0.60949	0.881	T	0.64698	-0.6346	9	0.87932	D	0	.	9.1065	0.36701	1.0:0.0:0.0:0.0	.	281	Q8NH70	O4A16_HUMAN	D	281	ENSP00000325128:N281D	ENSP00000325128:N281D	N	+	1	0	OR4A16	54868093	1.000000	0.71417	1.000000	0.80357	0.378000	0.30076	7.186000	0.77722	1.312000	0.45043	0.346000	0.21813	AAT		0.318	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		12	62	0	0	0	0.000978	0	12	62				
OR8H1	219469	broad.mit.edu	37	11	56057612	56057612	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:56057612G>T	ENST00000313022.2	-	1	954	c.927C>A	c.(925-927)gaC>gaA	p.D309E		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D309E(1)		NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					ATTACCTGGAGTCCTGTCTTC	0.328																																							uc010rje.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(925-927)GAC>GAA		olfactory receptor, family 8, subfamily H,							83.0	94.0	91.0					11																	56057612		2201	4294	6495	SO:0001583	missense	219469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56057612G>T	AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.927C>A	11.37:g.56057612G>T	ENSP00000323595:p.Asp309Glu		Somatic					p.D309E	NM_001005199	NP_001005199	WXS	Illumina HiSeq	Unspecified	Q8NGG4	OR8H1_HUMAN			1	927	-	Esophageal squamous(21;0.00448)		309			Cytoplasmic (Potential).		B2RNI7|Q6IFC5	Missense_Mutation	SNP	ENST00000313022.2	37	c.927C>A	CCDS31526.1	.	.	.	.	.	.	.	.	.	.	G	2.690	-0.273433	0.05679	.	.	ENSG00000181693	ENST00000313022	T	0.00478	7.13	3.05	-4.07	0.03975	.	2.056100	0.02087	N	0.052877	T	0.00300	0.0009	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.42849	-0.9427	10	0.30854	T	0.27	.	4.5488	0.12098	0.4972:0.0:0.3532:0.1496	.	309	Q8NGG4	OR8H1_HUMAN	E	309	ENSP00000323595:D309E	ENSP00000323595:D309E	D	-	3	2	OR8H1	55814188	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.852000	0.04308	-0.985000	0.03503	0.446000	0.29264	GAC		0.328	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370019.1	NM_001005199		22	162	1	0	3.83957e-06	0.00278	4.71587e-06	22	162				
OR5M8	219484	broad.mit.edu	37	11	56258326	56258326	+	Missense_Mutation	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:56258326T>A	ENST00000327216.2	-	1	545	c.521A>T	c.(520-522)aAt>aTt	p.N174I		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N174I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					GTAGAAGTGATTAATTTCATT	0.493																																							uc001nix.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(520-522)AAT>ATT		olfactory receptor, family 5, subfamily M,							92.0	92.0	92.0					11																	56258326		2201	4296	6497	SO:0001583	missense	219484				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56258326T>A	AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.521A>T	11.37:g.56258326T>A	ENSP00000323354:p.Asn174Ile		Somatic					p.N174I	NM_001005282	NP_001005282	WXS	Illumina HiSeq	Unspecified	Q8NGP6	OR5M8_HUMAN			1	521	-	Esophageal squamous(21;0.00352)		174			Extracellular (Potential).		B2RNM5|Q6IEW3|Q96RB8	Missense_Mutation	SNP	ENST00000327216.2	37	c.521A>T	CCDS31533.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.294204	0.40594	.	.	ENSG00000181371	ENST00000327216	T	0.00179	8.61	4.21	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.162835	0.28393	N	0.015510	T	0.00608	0.0020	M	0.87971	2.92	0.09310	N	0.999994	D	0.89917	1.0	D	0.97110	1.0	T	0.28554	-1.0040	10	0.87932	D	0	-18.7555	11.6823	0.51466	0.0:0.0:0.0:1.0	.	174	Q8NGP6	OR5M8_HUMAN	I	174	ENSP00000323354:N174I	ENSP00000323354:N174I	N	-	2	0	OR5M8	56014902	0.006000	0.16342	0.954000	0.39281	0.574000	0.36063	1.663000	0.37429	1.693000	0.51124	0.438000	0.28831	AAT		0.493	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1	NM_001005282		14	64	0	0	0	0.00245	0	14	64				
OR4D6	219983	broad.mit.edu	37	11	59225048	59225048	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:59225048G>T	ENST00000300127.2	+	1	638	c.615G>T	c.(613-615)ctG>ctT	p.L205L		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	205						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L205L(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						ACAACGGACTGGTGACCCTGC	0.542																																							uc010rku.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(613-615)CTG>CTT		olfactory receptor, family 4, subfamily D,							182.0	151.0	161.0					11																	59225048		2201	4295	6496	SO:0001819	synonymous_variant	219983				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59225048G>T	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.615G>T	11.37:g.59225048G>T			Somatic					p.L205L	NM_001004708	NP_001004708	WXS	Illumina HiSeq	Unspecified	Q8NGJ1	OR4D6_HUMAN			1	615	+			205			Helical; Name=5; (Potential).		B2RNP7|Q6IFF5|Q96R74	Silent	SNP	ENST00000300127.2	37	c.615G>T	CCDS31562.1																																																																																				0.542	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708		28	63	1	0	4.87955e-14	0.005443	7.36435e-14	28	63				
MS4A1	931	broad.mit.edu	37	11	60235910	60235910	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:60235910C>A	ENST00000534668.1	+	7	1152	c.863C>A	c.(862-864)tCc>tAc	p.S288Y	MS4A1_ENST00000528313.1_Missense_Mutation_p.S121Y|MS4A1_ENST00000345732.4_Missense_Mutation_p.S288Y|MS4A1_ENST00000532073.1_Missense_Mutation_p.S275Y|MS4A1_ENST00000389939.2_Missense_Mutation_p.S288Y	NM_152866.2	NP_690605.1	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member 1	288					B cell proliferation (GO:0042100)|humoral immune response (GO:0006959)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	MHC class II protein complex binding (GO:0023026)	p.S288Y(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)	GATCAGGAATCCTCACCAATA	0.378																																							uc001npp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)	5						c.(862-864)TCC>TAC		membrane-spanning 4-domains, subfamily A, member	Ibritumomab(DB00078)|Rituximab(DB00073)|Tositumomab(DB00081)						112.0	108.0	109.0					11																	60235910		2203	4300	6503	SO:0001583	missense	931				B cell activation|immune response	integral to plasma membrane		g.chr11:60235910C>A	M27394	CCDS31570.1	11q12-q13.1	2014-09-17				ENSG00000156738		"""CD molecules"""	7315	protein-coding gene	gene with protein product		112210		CD20		2448768	Standard	NM_152866		Approved	B1, Bp35, MS4A2	uc001npq.3	P11836		ENST00000534668.1:c.863C>A	11.37:g.60235910C>A	ENSP00000433277:p.Ser288Tyr		Somatic				MS4A1_uc001npq.2_Missense_Mutation_p.S288Y|MS4A1_uc009yna.2_Missense_Mutation_p.S288Y|MS4A1_uc009ymz.2_Missense_Mutation_p.S275Y|MS4A1_uc010rlc.1_Missense_Mutation_p.S121Y	p.S288Y	NM_152866	NP_690605	WXS	Illumina HiSeq	Unspecified	P11836	CD20_HUMAN			8	1279	+			288			Cytoplasmic (Potential).		A6NMS4|B4DT24|P08984|Q13963	Missense_Mutation	SNP	ENST00000534668.1	37	c.863C>A	CCDS31570.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.456644	0.43634	.	.	ENSG00000156738	ENST00000345732;ENST00000532073;ENST00000534668;ENST00000528313;ENST00000389939	T;T;T;T	0.33654	2.08;1.4;2.08;2.08	4.79	0.503	0.16940	.	22.983300	0.00166	N	0.000001	T	0.29817	0.0745	L	0.29908	0.895	0.09310	N	1	P;P;P	0.43701	0.815;0.718;0.718	B;B;B	0.43701	0.428;0.246;0.316	T	0.18272	-1.0342	10	0.72032	D	0.01	-5.8594	1.3465	0.02165	0.1772:0.4569:0.1722:0.1937	.	121;275;288	B4DT24;E9PKH8;P11836	.;.;CD20_HUMAN	Y	288;275;288;121;288	ENSP00000314620:S288Y;ENSP00000433519:S275Y;ENSP00000433277:S288Y;ENSP00000374589:S288Y	ENSP00000314620:S288Y	S	+	2	0	MS4A1	59992486	0.007000	0.16637	0.095000	0.20976	0.930000	0.56654	0.373000	0.20484	0.315000	0.23110	0.655000	0.94253	TCC		0.378	MS4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395402.1			4	68	1	0	3.59834e-05	0.001168	4.26585e-05	4	68				
MYRF	745	broad.mit.edu	37	11	61541490	61541490	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:61541490G>T	ENST00000278836.5	+	8	1263	c.1167G>T	c.(1165-1167)gtG>gtT	p.V389V	MYRF_ENST00000265460.5_Silent_p.V380V|MYRF_ENST00000327797.1_Silent_p.V16V|TMEM258_ENST00000535042.1_5'UTR	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	389					central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V380V(1)									ACTTTTCGGTGGGCGACGACG	0.652																																							uc001nsc.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1165-1167)GTG>GTT		myelin gene regulatory factor isoform 2							78.0	65.0	70.0					11																	61541490		2202	4299	6501	SO:0001819	synonymous_variant	745				central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:61541490G>T		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.1167G>T	11.37:g.61541490G>T			Somatic				C11orf9_uc001nse.1_Silent_p.V380V	p.V389V	NM_001127392	NP_001120864	WXS	Illumina HiSeq	Unspecified	Q9Y2G1	MRF_HUMAN			8	1263	+			389			NDT80.		O43582|Q9P1Q6	Silent	SNP	ENST00000278836.5	37	c.1167G>T	CCDS44622.1																																																																																				0.652	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398519.2	NM_013279		6	28	1	0	0.00116845	0.001168	0.00128122	6	28				
HNRNPUL2	221092	broad.mit.edu	37	11	62488849	62488849	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:62488849A>T	ENST00000301785.5	-	9	1721	c.1529T>A	c.(1528-1530)cTt>cAt	p.L510H	HNRNPUL2-BSCL2_ENST00000403734.2_Missense_Mutation_p.L510H	NM_001079559.2	NP_001073027.1	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 2	510						membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L510H(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						CTGAACTAAAAGGTCTCGGCT	0.413																																							uc001nuw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1528-1530)CTT>CAT		heterogeneous nuclear ribonucleoprotein U-like							171.0	177.0	175.0					11																	62488849		1853	4094	5947	SO:0001583	missense	221092				cell killing	nucleus	ATP binding|nucleic acid binding	g.chr11:62488849A>T		CCDS41659.1	11q12	2013-07-16		2008-04-18	ENSG00000214753	ENSG00000214753			25451	protein-coding gene	gene with protein product				HNRPUL2			Standard	NM_001079559		Approved	DKFZp762N1910	uc001nuw.3	Q1KMD3	OTTHUMG00000167773	ENST00000301785.5:c.1529T>A	11.37:g.62488849A>T	ENSP00000301785:p.Leu510His		Somatic				HNRNPUL2_uc001nuu.1_RNA	p.L510H	NM_001079559	NP_001073027	WXS	Illumina HiSeq	Unspecified	Q1KMD3	HNRL2_HUMAN			9	1722	-			510					Q8N3B3	Missense_Mutation	SNP	ENST00000301785.5	37	c.1529T>A	CCDS41659.1	.	.	.	.	.	.	.	.	.	.	A	16.41	3.115035	0.56505	.	.	ENSG00000214753	ENST00000301785	T	0.40476	1.03	6.17	6.17	0.99709	Zeta toxin domain (1);	0.543240	0.19521	N	0.112267	T	0.46171	0.1379	L	0.36672	1.1	0.37238	D	0.905983	P	0.51449	0.945	P	0.54499	0.754	T	0.50583	-0.8811	10	0.45353	T	0.12	-4.6177	10.7671	0.46299	0.8411:0.1589:0.0:0.0	.	510	Q1KMD3	HNRL2_HUMAN	H	510	ENSP00000301785:L510H	ENSP00000301785:L510H	L	-	2	0	HNRNPUL2	62245425	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.368000	0.66133	2.371000	0.80710	0.533000	0.62120	CTT		0.413	HNRNPUL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396208.2	XM_495877		27	291	0	0	0	0.002445	0	27	291				
ATG2A	23130	broad.mit.edu	37	11	64678617	64678617	+	Silent	SNP	C	C	A	rs151243555		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:64678617C>A	ENST00000377264.3	-	10	1471	c.1359G>T	c.(1357-1359)acG>acT	p.T453T	ATG2A_ENST00000421419.2_Silent_p.T453T	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	453					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)		p.T453T(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						TGAAAAAGTGCGTGGCGAGGT	0.607																																							uc001obx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1357-1359)ACG>ACT		autophagy related 2A							115.0	105.0	108.0					11																	64678617		2201	4297	6498	SO:0001819	synonymous_variant	23130						protein binding	g.chr11:64678617C>A		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.1359G>T	11.37:g.64678617C>A			Somatic					p.T453T	NM_015104	NP_055919	WXS	Illumina HiSeq	Unspecified	Q2TAZ0	ATG2A_HUMAN			10	1474	-			453					O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Silent	SNP	ENST00000377264.3	37	c.1359G>T	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	C	8.612	0.889417	0.17540	.	.	ENSG00000110046	ENST00000418259	.	.	.	4.82	2.94	0.34122	.	.	.	.	.	T	0.46737	0.1408	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	T	0.34104	-0.9842	4	.	.	.	.	3.6373	0.08154	0.092:0.175:0.5683:0.1647	.	.	.	.	S	255	.	.	A	-	1	0	ATG2A	64435193	0.998000	0.40836	0.815000	0.32552	0.924000	0.55760	0.420000	0.21263	0.756000	0.33013	-1.083000	0.02208	GCA		0.607	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104		4	52	1	0	0.00024832	0.009096	0.000279019	4	52				
MMP27	64066	broad.mit.edu	37	11	102565698	102565698	+	Splice_Site	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:102565698C>T	ENST00000260229.4	-	7	1124	c.1033G>A	c.(1033-1035)Gat>Aat	p.D345N		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	345					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D345N(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	GCCAGGTTACCTTTAAAAACC	0.448																																							uc001phd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1033-1035)GAT>AAT		matrix metalloproteinase 27 precursor							86.0	84.0	85.0					11																	102565698		2203	4299	6502	SO:0001630	splice_region_variant	64066				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102565698C>T	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.1033+1G>A	11.37:g.102565698C>T			Somatic					p.D345N	NM_022122	NP_071405	WXS	Illumina HiSeq	Unspecified	Q9H306	MMP27_HUMAN	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	7	1056	-	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	345			Hemopexin-like 2.		Q6UWK6	Missense_Mutation	SNP	ENST00000260229.4	37	c.1033G>A	CCDS8319.1	.	.	.	.	.	.	.	.	.	.	C	32	5.121510	0.94385	.	.	ENSG00000137675	ENST00000260229	T	0.03065	4.06	5.6	5.6	0.85130	Hemopexin/matrixin (2);	0.440207	0.21277	N	0.077213	T	0.12944	0.0314	M	0.70787	2.145	0.45594	D	0.998538	P	0.51653	0.947	P	0.52909	0.713	T	0.00436	-1.1740	9	.	.	.	.	17.8008	0.88586	0.0:1.0:0.0:0.0	.	345	Q9H306	MMP27_HUMAN	N	345	ENSP00000260229:D345N	.	D	-	1	0	MMP27	102070908	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	4.432000	0.59922	2.649000	0.89929	0.655000	0.94253	GAT		0.448	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122	Missense_Mutation	15	23	0	0	0	0.004007	0	15	23				
DDI1	414301	broad.mit.edu	37	11	103907640	103907640	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:103907640C>A	ENST00000302259.3	+	1	333	c.90C>A	c.(88-90)ttC>ttA	p.F30L	PDGFD_ENST00000393158.2_Intron|PDGFD_ENST00000302251.5_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	30	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.						aspartic-type endopeptidase activity (GO:0004190)	p.F30L(2)		central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		TCCGAAACTTCAAGGTCCTCT	0.612																																							uc001phr.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5						c.(88-90)TTC>TTA		DDI1, DNA-damage inducible 1, homolog 1							90.0	97.0	95.0					11																	103907640		2202	4299	6501	SO:0001583	missense	414301				proteolysis		aspartic-type endopeptidase activity	g.chr11:103907640C>A		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.90C>A	11.37:g.103907640C>A	ENSP00000302805:p.Phe30Leu		Somatic				PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	p.F30L	NM_001001711	NP_001001711	WXS	Illumina HiSeq	Unspecified	Q8WTU0	DDI1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)	1	333	+		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)	30			Ubiquitin-like.		Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	ENST00000302259.3	37	c.90C>A	CCDS31660.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.57|16.57	3.160734|3.160734	0.57368|0.57368	.|.	.|.	ENSG00000170962|ENSG00000170967	ENST00000529268|ENST00000302259	.|T	.|0.24538	.|1.85	4.97|4.97	3.12|3.12	0.35913|0.35913	.|Ubiquitin supergroup (1);Ubiquitin (2);	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.20536	.|0.0494	M|M	0.62723|0.62723	1.935|1.935	0.37543|0.37543	D|D	0.918401|0.918401	.|B	.|0.30326	.|0.276	.|B	.|0.31869	.|0.137	.|T	.|0.10132	.|-1.0643	.|10	0.56958|0.02654	D|T	0.05|1	-14.3044|-14.3044	7.7779|7.7779	0.29048|0.29048	0.0:0.8114:0.0:0.1886|0.0:0.8114:0.0:0.1886	.|.	.|30	.|Q8WTU0	.|DDI1_HUMAN	X|L	39|30	.|ENSP00000302805:F30L	ENSP00000432909:E39X|ENSP00000302805:F30L	E|F	-|+	1|3	0|2	PDGFD|DDI1	103412850|103412850	1.000000|1.000000	0.71417|0.71417	0.840000|0.840000	0.33206|0.33206	0.189000|0.189000	0.23516|0.23516	1.624000|1.624000	0.37018|0.37018	0.825000|0.825000	0.34637|0.34637	-0.140000|-0.140000	0.14226|0.14226	GAA|TTC		0.612	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711		36	95	1	0	3.09479e-21	0.006999	5.02289e-21	36	95				
CADM1	23705	broad.mit.edu	37	11	115080337	115080337	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:115080337G>A	ENST00000452722.3	-	8	1055	c.1035C>T	c.(1033-1035)acC>acT	p.T345T	CADM1_ENST00000537140.1_Intron|CADM1_ENST00000542447.2_Intron|CADM1_ENST00000536727.1_Intron|CADM1_ENST00000331581.6_Silent_p.T345T|CADM1_ENST00000537058.1_Silent_p.T345T	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.T345T(1)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		tggtggtggtggtggtggttg	0.433																																							uc001ppi.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1033-1035)ACC>ACT		immunoglobulin superfamily, member 4D isoform 1							44.0	49.0	47.0					11																	115080337		2201	4296	6497	SO:0001819	synonymous_variant	23705				adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding	g.chr11:115080337G>A	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1035C>T	11.37:g.115080337G>A			Somatic				CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Intron|CADM1_uc001ppj.3_Intron|CADM1_uc001pph.3_Silent_p.T97T	p.T345T	NM_014333	NP_055148	WXS	Illumina HiSeq	Unspecified	Q9BY67	CADM1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)	8	1164	-	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)	345	PPTTIPPPTTTTTTTTTTTTTILTIIT -> TTATTEPAVH GLTQLPNSAEELDSEDLS (in Ref. 3; BAC11657).		Extracellular (Potential).			Silent	SNP	ENST00000452722.3	37	c.1035C>T	CCDS8373.1																																																																																				0.433	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333		5	44	0	0	0	0.000602	0	5	44				
OAF	220323	broad.mit.edu	37	11	120097542	120097542	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:120097542G>A	ENST00000328965.4	+	3	897	c.384G>A	c.(382-384)gtG>gtA	p.V128V	OAF_ENST00000531220.1_Silent_p.V12V	NM_178507.2	NP_848602.1	Q86UD1	OAF_HUMAN	OAF homolog (Drosophila)	128						extracellular vesicular exosome (GO:0070062)		p.V128V(1)		kidney(1)|lung(5)	6		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)		CCCGGGCAGTGCGGCAGGCGG	0.607																																							uc001pxb.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(382-384)GTG>GTA		OAF homolog precursor							67.0	62.0	64.0					11																	120097542		2203	4300	6503	SO:0001819	synonymous_variant	220323							g.chr11:120097542G>A	BC047726	CCDS8430.1	11q23.3	2010-11-23			ENSG00000184232	ENSG00000184232			28752	protein-coding gene	gene with protein product						12477932	Standard	NM_178507		Approved	MGC52117	uc001pxb.3	Q86UD1	OTTHUMG00000166139	ENST00000328965.4:c.384G>A	11.37:g.120097542G>A			Somatic					p.V128V	NM_178507	NP_848602	WXS	Illumina HiSeq	Unspecified	Q86UD1	OAF_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)	3	625	+		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)	128						Silent	SNP	ENST00000328965.4	37	c.384G>A	CCDS8430.1																																																																																				0.607	OAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388036.2	NM_178507		6	54	0	0	0	0.004482	0	6	54				
OR10G9	219870	broad.mit.edu	37	11	123894188	123894188	+	Missense_Mutation	SNP	G	G	T	rs144713433		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:123894188G>T	ENST00000375024.1	+	1	469	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V157F(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GCACTCTGCTGTCCAGACCAT	0.557																																							uc010sad.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(469-471)GTC>TTC		olfactory receptor, family 10, subfamily G,							167.0	144.0	152.0					11																	123894188		2201	4297	6498	SO:0001583	missense	219870				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123894188G>T	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.469G>T	11.37:g.123894188G>T	ENSP00000364164:p.Val157Phe		Somatic					p.V157F	NM_001001953	NP_001001953	WXS	Illumina HiSeq	Unspecified	Q8NGN4	O10G9_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	469	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	157			Helical; Name=4; (Potential).			Missense_Mutation	SNP	ENST00000375024.1	37	c.469G>T	CCDS31703.1	.	.	.	.	.	.	.	.	.	.	G	2.845	-0.239517	0.05944	.	.	ENSG00000236981	ENST00000375024	T	0.38240	1.15	3.48	-0.838	0.10762	GPCR, rhodopsin-like superfamily (1);	0.552340	0.14950	N	0.288963	T	0.17195	0.0413	N	0.12569	0.235	0.22656	N	0.998886	B	0.13145	0.007	B	0.23852	0.049	T	0.16778	-1.0391	10	0.36615	T	0.2	.	4.7003	0.12823	0.3548:0.1498:0.4954:0.0	.	157	Q8NGN4	O10G9_HUMAN	F	157	ENSP00000364164:V157F	ENSP00000364164:V157F	V	+	1	0	OR10G9	123399398	0.000000	0.05858	0.848000	0.33437	0.420000	0.31355	-1.058000	0.03482	-0.273000	0.09246	-0.119000	0.15052	GTC		0.557	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953		64	93	1	0	5.00163e-47	0.00361	8.45317e-47	64	93				
CCDC15	80071	broad.mit.edu	37	11	124857203	124857203	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:124857203C>T	ENST00000344762.5	+	8	1340	c.1081C>T	c.(1081-1083)Cag>Tag	p.Q361*	CCDC15_ENST00000529051.1_Nonsense_Mutation_p.Q361*	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	361						centrosome (GO:0005813)		p.Q361*(2)		central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		GCCAGATACCCAGGCTGTTGA	0.473																																							uc001qbm.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(1081-1083)CAG>TAG		coiled-coil domain containing 15							124.0	119.0	121.0					11																	124857203		1844	4100	5944	SO:0001587	stop_gained	80071					centrosome		g.chr11:124857203C>T	BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.1081C>T	11.37:g.124857203C>T	ENSP00000341684:p.Gln361*		Somatic					p.Q361*	NM_025004	NP_079280	WXS	Illumina HiSeq	Unspecified	Q0P6D6	CCD15_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)	8	1340	+	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	361					Q9H8U7	Nonsense_Mutation	SNP	ENST00000344762.5	37	c.1081C>T	CCDS44756.1	.	.	.	.	.	.	.	.	.	.	C	32	5.147816	0.94603	.	.	ENSG00000149548	ENST00000529051;ENST00000344762	.	.	.	3.68	1.77	0.24775	.	0.534630	0.17577	N	0.169249	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	0.0951	5.4093	0.16339	0.0:0.6286:0.0:0.3714	.	.	.	.	X	361	.	ENSP00000341684:Q361X	Q	+	1	0	CCDC15	124362413	0.014000	0.17966	0.001000	0.08648	0.005000	0.04900	2.001000	0.40825	0.523000	0.28482	0.462000	0.41574	CAG		0.473	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387131.1	NM_025004		43	101	0	0	0	0.002522	0	43	101				
ST14	6768	broad.mit.edu	37	11	130064043	130064043	+	Splice_Site	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr11:130064043G>T	ENST00000278742.5	+	8	1293		c.e8-1			NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)						keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.?(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	TGCCCCCACAGGTTGTGTGGC	0.602																																							uc001qfw.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|skin(2)|central_nervous_system(1)	5						c.e8-1		matriptase	Urokinase(DB00013)						128.0	114.0	119.0					11																	130064043		2201	4297	6498	SO:0001630	splice_region_variant	6768				proteolysis	integral to plasma membrane	serine-type endopeptidase activity	g.chr11:130064043G>T	AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.876-1G>T	11.37:g.130064043G>T			Somatic				ST14_uc010sca.1_Splice_Site_p.Q102_splice	p.Q292_splice	NM_021978	NP_068813	WXS	Illumina HiSeq	Unspecified	Q9Y5Y6	ST14_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	8	1069	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)						Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Splice_Site	SNP	ENST00000278742.5	37	c.876_splice	CCDS8487.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604846	0.46423	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3256	0.90252	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ST14	129569253	1.000000	0.71417	1.000000	0.80357	0.362000	0.29581	8.797000	0.91882	2.490000	0.84030	0.555000	0.69702	.		0.602	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386119.1		Intron	11	93	1	0	6.40141e-05	0.000978	7.48051e-05	11	93				
GALNT8	26290	broad.mit.edu	37	12	4873146	4873146	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:4873146G>C	ENST00000252318.2	+	9	1863	c.1526G>C	c.(1525-1527)tGc>tCc	p.C509S		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	509	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.C509S(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						GAAAATGTCTGCTTGGATCAG	0.512																																					Colon(108;631 1558 7270 20097 39846)	Colon(108;631 1558 7270 20097 39846)	uc001qne.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(1525-1527)TGC>TCC		polypeptide N-acetylgalactosaminyltransferase 8							189.0	169.0	176.0					12																	4873146		2203	4300	6503	SO:0001583	missense	26290					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:4873146G>C	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1526G>C	12.37:g.4873146G>C	ENSP00000252318:p.Cys509Ser		Somatic					p.C509S	NM_017417	NP_059113	WXS	Illumina HiSeq	Unspecified	Q9NY28	GALT8_HUMAN			9	1618	+			509			Ricin B-type lectin.|Lumenal (Potential).		B2RU02	Missense_Mutation	SNP	ENST00000252318.2	37	c.1526G>C	CCDS8533.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.5|23.5	4.417865|4.417865	0.83449|0.83449	.|.	.|.	ENSG00000130035|ENSG00000130035	ENST00000542998;ENST00000535354|ENST00000252318	.|T	.|0.56103	.|0.48	4.32|4.32	4.32|4.32	0.51571|0.51571	.|Ricin B-related lectin (1);Ricin B lectin (3);	.|0.115199	.|0.64402	.|D	.|0.000012	T|T	0.73613|0.73613	0.3609|0.3609	M|M	0.83774|0.83774	2.66|2.66	0.58432|0.58432	D|D	0.999992|0.999992	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.78792|0.78792	-0.2065|-0.2065	5|10	.|0.87932	.|D	.|0	.|.	14.3406|14.3406	0.66622|0.66622	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|509	.|Q9NY28	.|GALT8_HUMAN	P|S	26;5|509	.|ENSP00000252318:C509S	.|ENSP00000252318:C509S	A|C	+|+	1|2	0|0	GALNT8|GALNT8	4743407|4743407	1.000000|1.000000	0.71417|0.71417	0.745000|0.745000	0.31077|0.31077	0.320000|0.320000	0.28249|0.28249	9.012000|9.012000	0.93624|0.93624	2.219000|2.219000	0.72066|0.72066	0.655000|0.655000	0.94253|0.94253	GCT|TGC		0.512	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417		7	51	0	0	0	0.00308	0	7	51				
SLC2A14	144195	broad.mit.edu	37	12	7967074	7967074	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:7967074C>A	ENST00000543909.1	-	16	2160	c.1401G>T	c.(1399-1401)ttG>ttT	p.L467F	SLC2A14_ENST00000340749.5_Missense_Mutation_p.L444F|SLC2A14_ENST00000431042.2_Missense_Mutation_p.L444F|SLC2A14_ENST00000542505.1_Missense_Mutation_p.L108F|SLC2A14_ENST00000542546.1_Missense_Mutation_p.L358F|SLC2A14_ENST00000539924.1_Missense_Mutation_p.L482F|SLC2A14_ENST00000535295.1_Missense_Mutation_p.L358F|SLC2A14_ENST00000396589.2_Missense_Mutation_p.L467F			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	467					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)	p.L467F(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		AGGTAAAGGCCAAGAAGGTAA	0.453																																							uc001qtk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1399-1401)TTG>TTT		glucose transporter 14							68.0	68.0	68.0					12																	7967074		2203	4300	6503	SO:0001583	missense	144195				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity	g.chr12:7967074C>A	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.1401G>T	12.37:g.7967074C>A	ENSP00000440480:p.Leu467Phe		Somatic				SLC2A14_uc001qtl.2_Missense_Mutation_p.L444F|SLC2A14_uc001qtm.2_Missense_Mutation_p.L444F|SLC2A14_uc010sgg.1_Missense_Mutation_p.L358F|SLC2A14_uc001qtn.2_Missense_Mutation_p.L467F|SLC2A14_uc001qto.2_Missense_Mutation_p.L102F|SLC2A14_uc010sgh.1_Missense_Mutation_p.L482F	p.L467F	NM_153449	NP_703150	WXS	Illumina HiSeq	Unspecified	Q8TDB8	GTR14_HUMAN		Kidney(36;0.0883)	16	2194	-			467			Helical; Name=12; (Potential).		B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	c.1401G>T	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	C	1.069	-0.670352	0.03403	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000542505;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	T;T;T;T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.81;-0.81;-0.81;-0.81	3.63	-7.26	0.01466	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.295502	0.37393	N	0.002104	T	0.31513	0.0799	N	0.01656	-0.775	0.25197	N	0.990084	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.13407	0.009;0.006;0.002;0.004	T	0.51741	-0.8667	10	0.02654	T	1	.	7.2419	0.26102	0.1129:0.1499:0.6333:0.1038	.	482;358;444;467	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	F	444;467;444;108;467;358;358;482	ENSP00000340450:L444F;ENSP00000440480:L467F;ENSP00000407287:L444F;ENSP00000438484:L108F;ENSP00000379834:L467F;ENSP00000440492:L358F;ENSP00000443903:L358F;ENSP00000445929:L482F	ENSP00000340450:L444F	L	-	3	2	SLC2A14	7858341	0.612000	0.27000	0.006000	0.13384	0.202000	0.24057	0.851000	0.27751	-1.063000	0.03177	0.460000	0.39030	TTG		0.453	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449		11	55	1	0	3.86212e-05	0.008291	4.55218e-05	11	55				
ZNF705A	440077	broad.mit.edu	37	12	8329650	8329650	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:8329650G>A	ENST00000359286.4	+	5	463	c.374G>A	c.(373-375)tGc>tAc	p.C125Y		NM_001004328.2|NM_001278713.1	NP_001004328.1|NP_001265642.1	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	125					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C125Y(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(3)|stomach(4)	18				Kidney(36;0.0877)		GGAGAAGATTGCACTCACAGT	0.393																																							uc001qud.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(373-375)TGC>TAC		zinc finger protein 705A							97.0	97.0	97.0					12																	8329650		2202	4290	6492	SO:0001583	missense	440077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr12:8329650G>A	AK131339	CCDS31737.1	12p13.31	2014-02-12	2005-09-22		ENSG00000196946	ENSG00000196946		"""Zinc fingers, C2H2-type"", ""-"""	32281	protein-coding gene	gene with protein product							Standard	NM_001004328		Approved	FLJ16353	uc001qud.1	Q6ZN79	OTTHUMG00000168635	ENST00000359286.4:c.374G>A	12.37:g.8329650G>A	ENSP00000352233:p.Cys125Tyr		Somatic					p.C125Y	NM_001004328	NP_001004328	WXS	Illumina HiSeq	Unspecified	Q6ZN79	Z705A_HUMAN		Kidney(36;0.0877)	5	446	+			125						Missense_Mutation	SNP	ENST00000359286.4	37	c.374G>A	CCDS31737.1	.	.	.	.	.	.	.	.	.	.	.	7.313	0.615474	0.14129	.	.	ENSG00000196946	ENST00000396570;ENST00000359286	T;T	0.01527	4.8;4.8	1.35	-1.94	0.07571	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00666	0.0022	N	0.00801	-1.175	0.19300	N	0.999971	B	0.19583	0.037	B	0.09377	0.004	T	0.46442	-0.9191	9	0.72032	D	0.01	.	2.8599	0.05583	0.2351:0.0:0.2532:0.5117	.	125	Q6ZN79	Z705A_HUMAN	Y	125	ENSP00000379816:C125Y;ENSP00000352233:C125Y	ENSP00000352233:C125Y	C	+	2	0	ZNF705A	8220917	0.128000	0.22383	0.003000	0.11579	0.085000	0.17905	0.327000	0.19663	-0.499000	0.06623	-0.755000	0.03482	TGC		0.393	ZNF705A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400449.1	NM_001004328		28	118	0	0	0	0.002445	0	28	118				
GRIN2B	2904	broad.mit.edu	37	12	13768141	13768141	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:13768141C>T	ENST00000609686.1	-	7	1770	c.1561G>A	c.(1561-1563)Gag>Aag	p.E521K		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	521					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.E521K(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCGACCACCTCCGATCGTTCC	0.502																																							uc001rbt.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(1561-1563)GAG>AAG		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						162.0	128.0	140.0					12																	13768141		2203	4300	6503	SO:0001583	missense	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13768141C>T		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1561G>A	12.37:g.13768141C>T	ENSP00000477455:p.Glu521Lys		Somatic					p.E521K	NM_000834	NP_000825	WXS	Illumina HiSeq	Unspecified	Q13224	NMDE2_HUMAN			7	1740	-			521			Extracellular (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	c.1561G>A	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	C	33	5.252557	0.95336	.	.	ENSG00000150086	ENST00000279593	T	0.25912	1.77	6.17	6.17	0.99709	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.41143	0.1146	L	0.39020	1.185	0.80722	D	1	P	0.42692	0.787	P	0.54815	0.761	T	0.04400	-1.0954	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	521	Q13224	NMDE2_HUMAN	K	521	ENSP00000279593:E521K	ENSP00000279593:E521K	E	-	1	0	GRIN2B	13659408	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	7.813000	0.86123	2.941000	0.99782	0.655000	0.94253	GAG		0.502	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			6	57	0	0	0	0.001984	0	6	57				
SLCO1B3	28234	broad.mit.edu	37	12	21033901	21033901	+	Silent	SNP	C	C	T	rs377513667		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:21033901C>T	ENST00000381545.3	+	12	1663	c.1444C>T	c.(1444-1446)Ctg>Ttg	p.L482L	SLCO1B7_ENST00000554957.1_Intron|SLCO1B3_ENST00000261196.2_Silent_p.L482L|LST3_ENST00000540229.1_Silent_p.L482L|SLCO1B3_ENST00000553473.1_Silent_p.L482L|LST3_ENST00000381541.3_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	482	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.L482L(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	AATAACTTACCTGTCACCTTG	0.393																																							uc001rek.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(1)|skin(1)	4						c.(1444-1446)CTG>TTG		solute carrier organic anion transporter family,		C		1,4405		0,1,2202	195.0	192.0	193.0		1444	-7.6	0.0	12		193	0,8600		0,0,4300	no	coding-synonymous	SLCO1B3	NM_019844.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		482/703	21033901	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	28234				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity	g.chr12:21033901C>T		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1444C>T	12.37:g.21033901C>T			Somatic				SLCO1B3_uc001rel.2_Silent_p.L482L|SLCO1B3_uc010sil.1_Silent_p.L482L|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Silent_p.L307L	p.L482L	NM_019844	NP_062818	WXS	Illumina HiSeq	Unspecified	Q9NPD5	SO1B3_HUMAN			11	1570	+	Esophageal squamous(101;0.149)		482			Extracellular (Potential).|Kazal-like.		E7EMT8|Q5JAR4	Silent	SNP	ENST00000381545.3	37	c.1444C>T	CCDS8684.1																																																																																				0.393	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844		20	122	0	0	0	0.00278	0	20	122				
ABCC9	10060	broad.mit.edu	37	12	21998656	21998656	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:21998656G>T	ENST00000261201.4	-	24	2976	c.2977C>A	c.(2977-2979)Ctg>Atg	p.L993M	ABCC9_ENST00000345162.2_Missense_Mutation_p.L957M|RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000261200.4_Missense_Mutation_p.L993M	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	993					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)	p.L993M(2)		NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	AGGATGAGCAGGAAGAATCCT	0.448																																							uc001rfi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(2977-2979)CTG>ATG		ATP-binding cassette, sub-family C, member 9	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						159.0	128.0	138.0					12																	21998656		2203	4300	6503	SO:0001583	missense	10060				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity	g.chr12:21998656G>T	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2977C>A	12.37:g.21998656G>T	ENSP00000261201:p.Leu993Met		Somatic				ABCC9_uc001rfh.2_Missense_Mutation_p.L993M|ABCC9_uc001rfj.1_Missense_Mutation_p.L957M	p.L993M	NM_005691	NP_005682	WXS	Illumina HiSeq	Unspecified	O60706	ABCC9_HUMAN			24	2997	-			993			Helical; Name=12; (Potential).		O60707	Missense_Mutation	SNP	ENST00000261201.4	37	c.2977C>A	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.943075	0.34283	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.95205	-3.64;-3.64;-3.64;-3.64	5.28	-1.77	0.07982	ABC transporter, transmembrane domain, type 1 (1);	0.114225	0.64402	D	0.000016	D	0.88573	0.6473	L	0.35341	1.055	0.38225	D	0.940873	B;B	0.16603	0.018;0.005	B;B	0.20767	0.031;0.007	T	0.76271	-0.3020	10	0.45353	T	0.12	-10.1937	10.3949	0.44194	0.5409:0.0:0.4591:0.0	.	993;993	O60706;O60706-2	ABCC9_HUMAN;.	M	993;620;993;957	ENSP00000261200:L993M;ENSP00000440521:L620M;ENSP00000261201:L993M;ENSP00000261202:L957M	ENSP00000261200:L993M	L	-	1	2	ABCC9	21889923	1.000000	0.71417	0.932000	0.37286	0.967000	0.64934	0.837000	0.27558	-0.419000	0.07439	-0.302000	0.09304	CTG		0.448	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691		15	55	1	0	1.05317e-09	0.00245	1.45523e-09	15	55				
OR10A7	121364	broad.mit.edu	37	12	55615682	55615682	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:55615682C>A	ENST00000326258.1	+	1	874	c.874C>A	c.(874-876)Ctg>Atg	p.L292M		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L292M(1)		endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						CATCTACGGCCTGAGGAACAA	0.448																																							uc010spf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(874-876)CTG>ATG		olfactory receptor, family 10, subfamily A,							83.0	72.0	76.0					12																	55615682		2203	4300	6503	SO:0001583	missense	121364				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55615682C>A	BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.874C>A	12.37:g.55615682C>A	ENSP00000326718:p.Leu292Met		Somatic					p.L292M	NM_001005280	NP_001005280	WXS	Illumina HiSeq	Unspecified	Q8NGE5	O10A7_HUMAN			1	874	+			292			Helical; Name=7; (Potential).		Q6IFD5|Q96R19	Missense_Mutation	SNP	ENST00000326258.1	37	c.874C>A	CCDS31815.1	.	.	.	.	.	.	.	.	.	.	c	14.78	2.636546	0.47049	.	.	ENSG00000179919	ENST00000326258	T	0.48836	0.8	3.78	1.93	0.25924	.	0.000000	0.32671	N	0.005799	T	0.59622	0.2207	M	0.67700	2.07	0.33484	D	0.587792	D	0.89917	1.0	D	0.81914	0.995	T	0.66508	-0.5906	10	0.87932	D	0	.	5.6283	0.17495	0.1569:0.6617:0.0:0.1814	.	292	Q8NGE5	O10A7_HUMAN	M	292	ENSP00000326718:L292M	ENSP00000326718:L292M	L	+	1	2	OR10A7	53901949	0.033000	0.19621	0.999000	0.59377	0.878000	0.50629	0.346000	0.19997	0.398000	0.25338	0.637000	0.83480	CTG		0.448	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406308.1			7	54	1	0	2.17888e-05	0.006214	2.59814e-05	7	54				
OR6C70	390327	broad.mit.edu	37	12	55863608	55863608	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:55863608C>A	ENST00000327335.4	-	1	314	c.315G>T	c.(313-315)ttG>ttT	p.L105F	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA	NM_001005499.1	NP_001005499.1	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C, member 70	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L105F(1)		autonomic_ganglia(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	18						CTGTAACCCCCAAGAATATGT	0.393																																							uc010spn.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(313-315)TTG>TTT		olfactory receptor, family 6, subfamily C,							68.0	69.0	68.0					12																	55863608		2203	4300	6503	SO:0001583	missense	390327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55863608C>A		CCDS31825.1	12q13.2	2013-09-23			ENSG00000184954	ENSG00000184954		"""GPCR / Class A : Olfactory receptors"""	31299	protein-coding gene	gene with protein product							Standard	NM_001005499		Approved		uc010spn.2	A6NIJ9	OTTHUMG00000171127	ENST00000327335.4:c.315G>T	12.37:g.55863608C>A	ENSP00000329153:p.Leu105Phe		Somatic					p.L105F	NM_001005499	NP_001005499	WXS	Illumina HiSeq	Unspecified	A6NIJ9	O6C70_HUMAN			1	315	-			105			Helical; Name=3; (Potential).			Missense_Mutation	SNP	ENST00000327335.4	37	c.315G>T	CCDS31825.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.567197	0.00895	.	.	ENSG00000184954	ENST00000327335	T	0.00414	7.52	4.06	-3.98	0.04082	GPCR, rhodopsin-like superfamily (1);	0.382752	0.18441	N	0.141137	T	0.00144	0.0004	N	0.16266	0.395	0.09310	N	1	B	0.20671	0.047	B	0.23419	0.046	T	0.41787	-0.9489	10	0.13853	T	0.58	.	0.1296	0.00072	0.2847:0.2546:0.1872:0.2735	.	105	A6NIJ9	O6C70_HUMAN	F	105	ENSP00000329153:L105F	ENSP00000329153:L105F	L	-	3	2	OR6C70	54149875	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.254000	0.00137	-0.736000	0.04831	-1.702000	0.00720	TTG		0.393	OR6C70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411820.1			11	60	1	0	1.36491e-13	0.001855	2.04487e-13	11	60				
LRP1	4035	broad.mit.edu	37	12	57595378	57595378	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:57595378G>A	ENST00000243077.3	+	66	10910	c.10444G>A	c.(10444-10446)Ggc>Agc	p.G3482S		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3482	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.G3482S(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTGTGTGGATGGCAGTGATGA	0.642																																							uc001snd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.(10444-10446)GGC>AGC		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						91.0	79.0	83.0					12																	57595378		2203	4300	6503	SO:0001583	missense	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57595378G>A	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.10444G>A	12.37:g.57595378G>A	ENSP00000243077:p.Gly3482Ser		Somatic					p.G3482S	NM_002332	NP_002323	WXS	Illumina HiSeq	Unspecified	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	66	10910	+			3482			Extracellular (Potential).|LDL-receptor class A 24.		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	c.10444G>A	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954610	0.73902	.	.	ENSG00000123384	ENST00000243077;ENST00000555124	D;D	0.96554	-4.05;-4.05	5.14	5.14	0.70334	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.076970	0.50627	D	0.000118	D	0.96062	0.8717	M	0.80332	2.49	0.80722	D	1	P	0.40000	0.698	B	0.39379	0.298	D	0.96119	0.9083	10	0.48119	T	0.1	.	17.5907	0.87995	0.0:0.0:1.0:0.0	.	3482	Q07954	LRP1_HUMAN	S	3482;49	ENSP00000243077:G3482S;ENSP00000451012:G49S	ENSP00000243077:G3482S	G	+	1	0	LRP1	55881645	1.000000	0.71417	0.996000	0.52242	0.676000	0.39594	9.648000	0.98483	2.684000	0.91462	0.603000	0.83216	GGC		0.642	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		6	37	0	0	0	0.001168	0	6	37				
MON2	23041	broad.mit.edu	37	12	62981934	62981934	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:62981934A>G	ENST00000393632.2	+	34	5379	c.4988A>G	c.(4987-4989)aAt>aGt	p.N1663S	MON2_ENST00000280379.6_Missense_Mutation_p.N1664S|MON2_ENST00000393630.3_Missense_Mutation_p.N1664S|MON2_ENST00000546600.1_Missense_Mutation_p.N1663S|MON2_ENST00000393629.2_Missense_Mutation_p.N1657S|MON2_ENST00000552738.1_Missense_Mutation_p.N1634S|MON2_ENST00000551397.1_Missense_Mutation_p.N37S	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1663					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.N1663S(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		CAGCCTGAGAATGGTAAGTGC	0.299																																							uc001sre.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(4987-4989)AAT>AGT		MON2 homolog							48.0	48.0	48.0					12																	62981934		2200	4293	6493	SO:0001583	missense	23041				Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding	g.chr12:62981934A>G		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.4988A>G	12.37:g.62981934A>G	ENSP00000377252:p.Asn1663Ser		Somatic				MON2_uc009zqj.2_Missense_Mutation_p.N1663S|MON2_uc010ssl.1_Missense_Mutation_p.N1591S|MON2_uc010ssm.1_Missense_Mutation_p.N1634S|MON2_uc010ssn.1_Missense_Mutation_p.N1657S|MON2_uc001srf.2_Missense_Mutation_p.N1426S|MON2_uc001srg.2_Missense_Mutation_p.N532S	p.N1663S	NM_015026	NP_055841	WXS	Illumina HiSeq	Unspecified	Q7Z3U7	MON2_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)	34	5379	+			1664					A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	37	c.4988A>G	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.906301	0.52333	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629;ENST00000551397	T;T;T;T;T;T	0.56444	0.49;0.49;0.46;0.46;0.49;0.49	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.53126	0.1777	L	0.36672	1.1	0.80722	D	1	B;B;D;B;B	0.56035	0.11;0.111;0.974;0.274;0.274	B;B;P;B;B	0.50659	0.024;0.054;0.647;0.135;0.054	T	0.50423	-0.8830	9	.	.	.	-17.5428	15.7245	0.77743	1.0:0.0:0.0:0.0	.	1657;1634;1663;532;1663	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	S	1663;1664;1664;1663;1634;1657;37	ENSP00000377252:N1663S;ENSP00000377250:N1664S;ENSP00000280379:N1664S;ENSP00000447407:N1663S;ENSP00000449215:N1634S;ENSP00000377249:N1657S	.	N	+	2	0	MON2	61268201	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.944000	0.92980	2.109000	0.64355	0.533000	0.62120	AAT		0.299	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026		7	16	0	0	0	0.006214	0	7	16				
POC1B	282809	broad.mit.edu	37	12	89860637	89860637	+	Silent	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:89860637G>C	ENST00000313546.3	-	9	1070	c.942C>G	c.(940-942)ctC>ctG	p.L314L	POC1B_ENST00000393179.4_Silent_p.L184L|POC1B_ENST00000541909.1_Silent_p.L184L|POC1B_ENST00000549035.1_Silent_p.L272L|POC1B_ENST00000549504.1_Nonsense_Mutation_p.S65*|POC1B_ENST00000378528.2_Nonsense_Mutation_p.S101*	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	314					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)		p.L314L(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						GTAATCTTTTGAGATTTCTTT	0.348																																							uc001tbc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(940-942)CTC>CTG		WD repeat domain 51B							195.0	186.0	189.0					12																	89860637		2203	4300	6503	SO:0001819	synonymous_variant	282809				cell projection organization	centriole|microtubule basal body		g.chr12:89860637G>C	AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.942C>G	12.37:g.89860637G>C			Somatic				POC1B_uc001tba.2_Silent_p.L272L|POC1B_uc001tbb.2_Silent_p.L184L|POC1B_uc010sun.1_RNA|POC1B_uc009zsp.2_RNA|POC1B_uc009zsq.2_RNA	p.L314L	NM_172240	NP_758440	WXS	Illumina HiSeq	Unspecified	Q8TC44	POC1B_HUMAN			9	1047	-			314					G3V1X0	Silent	SNP	ENST00000313546.3	37	c.942C>G	CCDS31869.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865137	0.91511	.	.	ENSG00000139323	ENST00000378528;ENST00000549504	.	.	.	6.03	3.14	0.36123	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	3.9133	0.09213	0.3542:0.1734:0.4723:0.0	.	.	.	.	X	101;65	.	ENSP00000367789:S101X	S	-	2	0	POC1B	88384768	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.655000	0.24933	0.821000	0.34540	0.655000	0.94253	TCA		0.348	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406637.1	NM_172240		21	74	0	0	0	0.008871	0	21	74				
DNAH10	196385	broad.mit.edu	37	12	124298029	124298029	+	Missense_Mutation	SNP	C	C	T	rs138397621	byFrequency	TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:124298029C>T	ENST00000409039.3	+	19	3134	c.3109C>T	c.(3109-3111)Cgc>Tgc	p.R1037C		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1037	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R1037C(1)|p.R855C(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGAGGTTATGCGCCACCCTCT	0.443																																							uc001uft.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(3109-3111)CGC>TGC		dynein, axonemal, heavy chain 10		C	CYS/ARG	0,4406		0,0,2203	93.0	87.0	89.0		3109	5.8	0.1	12	dbSNP_134	89	6,8594	5.0+/-18.6	0,6,4294	yes	missense	DNAH10	NM_207437.3	180	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	benign	1037/4472	124298029	6,13000	2203	4300	6503	SO:0001583	missense	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124298029C>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3109C>T	12.37:g.124298029C>T	ENSP00000386770:p.Arg1037Cys		Somatic				DNAH10_uc010tav.1_Missense_Mutation_p.R579C|DNAH10_uc010taw.1_Missense_Mutation_p.R522C	p.R1037C	NM_207437	NP_997320	WXS	Illumina HiSeq	Unspecified	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	19	3134	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		1037			Stem (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	c.3109C>T	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935330	0.34189	0.0	6.98E-4	ENSG00000197653	ENST00000409039	T	0.22743	1.94	5.83	5.83	0.93111	.	0.186131	0.36200	N	0.002740	T	0.31575	0.0801	L	0.39898	1.24	0.09310	N	0.999991	P;B;P	0.49559	0.925;0.437;0.738	P;B;B	0.50617	0.646;0.276;0.39	T	0.05835	-1.0861	10	0.59425	D	0.04	.	20.1374	0.98035	0.0:1.0:0.0:0.0	.	1037;912;1037	Q8IVF4-2;C4IXU6;Q8IVF4	.;.;DYH10_HUMAN	C	1037	ENSP00000386770:R1037C	ENSP00000386770:R1037C	R	+	1	0	DNAH10	122863982	0.011000	0.17503	0.145000	0.22337	0.004000	0.04260	2.501000	0.45389	2.763000	0.94921	0.563000	0.77884	CGC		0.443	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			3	68	0	0	0	0.004672	0	3	68				
TMEM132B	114795	broad.mit.edu	37	12	126138770	126138770	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:126138770C>G	ENST00000299308.3	+	9	2759	c.2751C>G	c.(2749-2751)atC>atG	p.I917M	TMEM132B_ENST00000535886.1_Missense_Mutation_p.I429M	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	917						integral component of membrane (GO:0016021)		p.I917M(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		TCTTCTTGATCAACTGCGTGG	0.532																																							uc001uhe.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19						c.(2749-2751)ATC>ATG		transmembrane protein 132B							97.0	96.0	96.0					12																	126138770		2034	4223	6257	SO:0001583	missense	114795					integral to membrane		g.chr12:126138770C>G	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.2751C>G	12.37:g.126138770C>G	ENSP00000299308:p.Ile917Met		Somatic				TMEM132B_uc001uhf.1_Missense_Mutation_p.I429M	p.I917M	NM_052907	NP_443139	WXS	Illumina HiSeq	Unspecified	Q14DG7	T132B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)	9	2759	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		917			Helical; (Potential).		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	c.2751C>G	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.743014	0.49151	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.22945	1.93;1.93	5.43	2.57	0.30868	.	0.097154	0.45867	D	0.000324	T	0.40222	0.1108	M	0.70275	2.135	0.58432	D	0.999999	D	0.63046	0.992	P	0.62089	0.898	T	0.18681	-1.0329	10	0.62326	D	0.03	.	5.224	0.15383	0.0:0.5609:0.1524:0.2867	.	917	Q14DG7	T132B_HUMAN	M	917;429	ENSP00000299308:I917M;ENSP00000440436:I429M	ENSP00000299308:I917M	I	+	3	3	TMEM132B	124704723	1.000000	0.71417	0.971000	0.41717	0.981000	0.71138	0.948000	0.29096	0.635000	0.30488	0.655000	0.94253	ATC		0.532	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907		11	64	0	0	0	0.001368	0	11	64				
EP400	57634	broad.mit.edu	37	12	132498101	132498101	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:132498101G>T	ENST00000333577.4	+	19	3895	c.3786G>T	c.(3784-3786)gtG>gtT	p.V1262V	EP400_ENST00000389561.2_Silent_p.V1226V|EP400_ENST00000389562.2_Silent_p.V1225V|EP400_ENST00000332482.4_Silent_p.V1189V|EP400_ENST00000330386.6_Silent_p.V1226V			Q96L91	EP400_HUMAN	E1A binding protein p400	1262	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Interactions with RUVBL1 and RUVBL2.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.V1225V(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GGACCATGGTGCACTTCCTGG	0.552																																							uc001ujn.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12						c.(3676-3678)GTG>GTT		E1A binding protein p400							85.0	84.0	84.0					12																	132498101		2203	4300	6503	SO:0001819	synonymous_variant	57634				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity	g.chr12:132498101G>T	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.3786G>T	12.37:g.132498101G>T			Somatic				EP400_uc001ujl.2_Silent_p.V1225V|EP400_uc001ujm.2_Silent_p.V1226V	p.V1226V	NM_015409	NP_056224	WXS	Illumina HiSeq	Unspecified	Q96L91	EP400_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)	17	3713	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)	1262			Interactions with RUVBL1 and RUVBL2.|Helicase ATP-binding.		O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37	c.3678G>T																																																																																					0.552	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409		17	63	1	0	2.35188e-11	0.006122	3.39901e-11	17	63				
EP400	57634	broad.mit.edu	37	12	132539519	132539519	+	Splice_Site	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr12:132539519G>C	ENST00000333577.4	+	45	7946	c.7837G>C	c.(7837-7839)Gca>Cca	p.A2613P	EP400_ENST00000389561.2_Splice_Site_p.A2577P|EP400_ENST00000389562.2_Splice_Site_p.A2576P|EP400_ENST00000332482.4_Splice_Site_p.A2540P|EP400_ENST00000330386.6_Splice_Site_p.A2496P			Q96L91	EP400_HUMAN	E1A binding protein p400	2613	Interaction with ZNF42. {ECO:0000250}.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.A2576P(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TTTTAAATAGGCAGGAACCAT	0.428																																							uc001ujn.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12						c.(7729-7731)GCA>CCA		E1A binding protein p400							103.0	98.0	100.0					12																	132539519		2203	4300	6503	SO:0001630	splice_region_variant	57634				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity	g.chr12:132539519G>C	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.7837-1G>C	12.37:g.132539519G>C			Somatic				EP400_uc001ujl.2_Missense_Mutation_p.A2576P|EP400_uc001ujm.2_Missense_Mutation_p.A2496P	p.A2577P	NM_015409	NP_056224	WXS	Illumina HiSeq	Unspecified	Q96L91	EP400_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)	43	7764	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)	2613			Interaction with ZNF42 (By similarity).		O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37	c.7729G>C		.	.	.	.	.	.	.	.	.	.	G	15.01	2.705307	0.48412	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.91295	-2.81;-2.8;-2.82;-2.81;-2.8	5.61	5.61	0.85477	.	0.051236	0.85682	D	0.000000	D	0.90755	0.7098	N	0.24115	0.695	0.47547	D	0.999457	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.81914	0.995;0.995;0.992	D	0.89273	0.3606	9	.	.	.	.	12.9189	0.58220	0.0743:0.0:0.9257:0.0	.	2577;2496;2576	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	P	2613;2577;2576;2540;2496;2577	ENSP00000333602:A2613P;ENSP00000374212:A2577P;ENSP00000374213:A2576P;ENSP00000331737:A2540P;ENSP00000330620:A2496P	.	A	+	1	0	EP400	131105472	1.000000	0.71417	1.000000	0.80357	0.498000	0.33706	8.858000	0.92256	2.647000	0.89833	0.557000	0.71058	GCA		0.428	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	Missense_Mutation	5	45	0	0	0	0.001984	0	5	45				
IFT88	8100	broad.mit.edu	37	13	21166510	21166510	+	Missense_Mutation	SNP	C	C	T	rs546356595		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr13:21166510C>T	ENST00000319980.6	+	9	719	c.392C>T	c.(391-393)cCt>cTt	p.P131L	IFT88_ENST00000382778.4_Missense_Mutation_p.P131L|IFT88_ENST00000537103.1_Missense_Mutation_p.P103L|IFT88_ENST00000351808.5_Missense_Mutation_p.P122L	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	131					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)		p.P131L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		TCAAGGGGCCCTGCTTCCCCT	0.353																																							uc001unh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(391-393)CCT>CTT		intraflagellar transport 88 homolog isoform 1							59.0	57.0	58.0					13																	21166510		2203	4300	6503	SO:0001583	missense	8100				cilium morphogenesis	centriole|intraflagellar transport particle B|microtubule basal body|microtubule-based flagellum	protein binding	g.chr13:21166510C>T	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.392C>T	13.37:g.21166510C>T	ENSP00000323580:p.Pro131Leu		Somatic				IFT88_uc001uni.2_Missense_Mutation_p.P122L|IFT88_uc001unj.2_Missense_Mutation_p.P121L|IFT88_uc010tcq.1_Missense_Mutation_p.P102L	p.P131L	NM_175605	NP_783195	WXS	Illumina HiSeq	Unspecified	Q13099	IFT88_HUMAN		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)	9	788	+		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)	131					A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	c.392C>T	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260904	0.59431	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.86686	0.5992	M	0.78049	2.395	0.80722	D	1	B;D	0.89917	0.029;1.0	B;D	0.85130	0.049;0.997	D	0.86763	0.1968	10	0.54805	T	0.06	-16.32	17.849	0.88739	0.0:1.0:0.0:0.0	.	103;131	F5H6C2;Q13099	.;IFT88_HUMAN	L	131;28;122;131;103	ENSP00000372228:P131L;ENSP00000261632:P122L;ENSP00000323580:P131L;ENSP00000437719:P103L	ENSP00000323580:P131L	P	+	2	0	IFT88	20064510	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	6.393000	0.73217	2.733000	0.93635	0.650000	0.86243	CCT		0.353	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531		21	57	0	0	0	0.00278	0	21	57				
N4BP2L2	10443	broad.mit.edu	37	13	33018246	33018246	+	Missense_Mutation	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr13:33018246T>A	ENST00000504114.1	-	6	474	c.383A>T	c.(382-384)aAa>aTa	p.K128I	N4BP2L2_ENST00000446957.2_Intron|N4BP2L2_ENST00000399396.3_Missense_Mutation_p.K143I|N4BP2L2_ENST00000380121.3_5'UTR|N4BP2L2_ENST00000357505.6_Missense_Mutation_p.K128I			Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	0					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.K143I(1)		kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		ATGCCCAGTTTTCTTCAAAAC	0.313																																							uc010abe.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(427-429)AAA>ATA		phosphonoformate immuno-associated protein 5							27.0	27.0	27.0					13																	33018246		1813	4068	5881	SO:0001583	missense	10443							g.chr13:33018246T>A	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000504114.1:c.383A>T	13.37:g.33018246T>A	ENSP00000427477:p.Lys128Ile		Somatic				N4BP2L2_uc001uug.2_Missense_Mutation_p.K26I|N4BP2L2_uc010abd.1_Missense_Mutation_p.K56I|N4BP2L2_uc001uuh.2_5'UTR|N4BP2L2_uc001uuj.2_Intron|N4BP2L2_uc010tdz.1_Missense_Mutation_p.K128I	p.K143I	NM_033111	NP_149102	WXS	Illumina HiSeq	Unspecified	Q92802	N42L2_HUMAN		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)	7	450	-		Lung SC(185;0.0262)	Error:Variant_position_missing_in_Q92802_after_alignment					A3KME8	Missense_Mutation	SNP	ENST00000504114.1	37	c.428A>T		.	.	.	.	.	.	.	.	.	.	T	14.72	2.619937	0.46736	.	.	ENSG00000139617;ENSG00000139617;ENSG00000244754;ENSG00000244754;ENSG00000244754;ENSG00000244754	ENST00000380121;ENST00000503296;ENST00000504114;ENST00000357505;ENST00000399396;ENST00000505213	T	0.52057	0.68	5.03	2.56	0.30785	.	0.337134	0.25272	N	0.031880	T	0.55832	0.1945	M	0.64997	1.995	0.22185	N	0.999308	D;D;D;D	0.64830	0.979;0.979;0.979;0.994	P;P;P;P	0.59424	0.857;0.857;0.857;0.852	T	0.47873	-0.9083	10	0.72032	D	0.01	-13.331	6.3674	0.21463	0.0:0.0821:0.1588:0.7591	.	128;143;26;26	B4DPY1;Q92802-3;Q96KV2;Q9Y3H6	.;.;.;.	I	26;55;128;128;143;572	ENSP00000423362:K572I	ENSP00000350104:K128I	K	-	2	0	N4BP2L2;RP11-298P3.4	31916246	0.994000	0.37717	0.044000	0.18714	0.533000	0.34776	2.227000	0.42972	0.251000	0.21505	-0.313000	0.08912	AAA		0.313	N4BP2L2-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000361380.1	NM_014887		6	33	0	0	0	0.001168	0	6	33				
SETDB2	83852	broad.mit.edu	37	13	50042023	50042023	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr13:50042023G>C	ENST00000317257.8	+	6	1093	c.268G>C	c.(268-270)Gaa>Caa	p.E90Q	SETDB2_ENST00000258672.5_Missense_Mutation_p.E78Q|SETDB2_ENST00000354234.4_Missense_Mutation_p.E78Q	NM_031915.2	NP_114121.2	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2	90					chromosome segregation (GO:0007059)|heart looping (GO:0001947)|histone H3-K9 methylation (GO:0051567)|left/right axis specification (GO:0070986)|mitotic nuclear division (GO:0007067)|negative regulation of transcription, DNA-templated (GO:0045892)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|zinc ion binding (GO:0008270)	p.E90Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	15		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		GACTCAGAAGGAACAGGAAAA	0.323																																							uc001vcz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(268-270)GAA>CAA		SET domain, bifurcated 2 isoform a							104.0	99.0	101.0					13																	50042023		2203	4299	6502	SO:0001583	missense	83852				cell division|chromosome segregation|heart looping|left/right axis specification|mitosis|negative regulation of transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone methyltransferase activity (H3-K9 specific)|zinc ion binding	g.chr13:50042023G>C	AF334407	CCDS9417.1, CCDS53868.1	13q14	2011-07-01	2003-05-06	2003-05-09	ENSG00000136169	ENSG00000136169		"""Chromatin-modifying enzymes / K-methyltransferases"""	20263	protein-coding gene	gene with protein product		607865	"""chromosome 13 open reading frame 4"""	C13orf4		11306461	Standard	NM_031915		Approved	CLLD8, CLLL8, KMT1F	uc001vda.3	Q96T68	OTTHUMG00000016918	ENST00000317257.8:c.268G>C	13.37:g.50042023G>C	ENSP00000326477:p.Glu90Gln		Somatic				SETDB2_uc010adg.2_Missense_Mutation_p.E66Q|SETDB2_uc001vcy.3_Missense_Mutation_p.E78Q|SETDB2_uc010adh.2_Missense_Mutation_p.E78Q|SETDB2_uc001vda.2_Missense_Mutation_p.E78Q	p.E90Q	NM_031915	NP_114121	WXS	Illumina HiSeq	Unspecified	Q96T68	SETB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)	6	1174	+		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	90					Q5TC65|Q5TC66|Q5W0A7|Q659A7|Q86UD6|Q96AI6	Missense_Mutation	SNP	ENST00000317257.8	37	c.268G>C	CCDS9417.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666793	0.47677	.	.	ENSG00000136169	ENST00000354234;ENST00000317257;ENST00000258672	D;D;T	0.87650	-2.17;-2.28;1.14	4.96	4.12	0.48240	.	0.546751	0.20953	N	0.082705	T	0.81616	0.4860	L	0.55481	1.735	0.18873	N	0.999987	P;P;P	0.46142	0.873;0.682;0.839	B;B;B	0.39419	0.295;0.299;0.157	T	0.71434	-0.4594	10	0.24483	T	0.36	.	9.6866	0.40103	0.0952:0.0:0.9048:0.0	.	90;78;90	Q96T68-3;Q96T68-2;Q96T68	.;.;SETB2_HUMAN	Q	78;90;78	ENSP00000346175:E78Q;ENSP00000326477:E90Q;ENSP00000258672:E78Q	ENSP00000258672:E78Q	E	+	1	0	SETDB2	48940024	0.986000	0.35501	0.034000	0.17996	0.930000	0.56654	1.804000	0.38873	1.426000	0.47256	0.655000	0.94253	GAA		0.323	SETDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044925.1	NM_031915		6	46	0	0	0	0.001168	0	6	46				
PCDH17	27253	broad.mit.edu	37	13	58240807	58240807	+	Missense_Mutation	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr13:58240807T>A	ENST00000377918.3	+	3	2663	c.2637T>A	c.(2635-2637)ttT>ttA	p.F879L		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	879					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F879L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GCTCCACGTTTAAGGACCCAG	0.443																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(2635-2637)TTT>TTA		protocadherin 17 precursor							75.0	75.0	75.0					13																	58240807		2203	4300	6503	SO:0001583	missense	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58240807T>A	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2637T>A	13.37:g.58240807T>A	ENSP00000367151:p.Phe879Leu		Somatic				PCDH17_uc010aec.1_Missense_Mutation_p.F878L|PCDH17_uc001vhr.1_5'UTR	p.F879L	NM_001040429	NP_001035519	WXS	Illumina HiSeq	Unspecified	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	3	3529	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	879			Cytoplasmic (Potential).		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	c.2637T>A	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	T	46	12.374038	0.99662	.	.	ENSG00000118946	ENST00000377918	T	0.51325	0.71	5.83	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.53867	0.1823	L	0.42245	1.32	0.47476	D	0.999439	D	0.69078	0.997	D	0.79784	0.993	T	0.53885	-0.8375	9	.	.	.	.	5.4356	0.16480	0.0:0.1905:0.0:0.8095	.	879	O14917	PCD17_HUMAN	L	879	ENSP00000367151:F879L	.	F	+	3	2	PCDH17	57138808	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.486000	0.45259	2.228000	0.72767	0.528000	0.53228	TTT		0.443	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		12	29	0	0	0	0.001855	0	12	29				
SLITRK1	114798	broad.mit.edu	37	13	84454106	84454106	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr13:84454106C>T	ENST00000377084.2	-	1	2422	c.1537G>A	c.(1537-1539)Ggg>Agg	p.G513R		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	513					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.G513R(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TCCAGCACCCCTGCCACCGGG	0.562																																							uc001vlk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(1537-1539)GGG>AGG		slit and trk like 1 protein precursor							50.0	52.0	51.0					13																	84454106		2203	4300	6503	SO:0001583	missense	114798					integral to membrane		g.chr13:84454106C>T	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1537G>A	13.37:g.84454106C>T	ENSP00000366288:p.Gly513Arg		Somatic					p.G513R	NM_052910	NP_443142	WXS	Illumina HiSeq	Unspecified	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	2423	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	513			Extracellular (Potential).|LRR 12.		Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	c.1537G>A	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.796142	0.70567	.	.	ENSG00000178235	ENST00000377084	T	0.55234	0.53	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.71341	0.3328	M	0.79123	2.44	0.80722	D	1	D	0.65815	0.995	P	0.61003	0.882	T	0.75286	-0.3371	10	0.72032	D	0.01	-10.3005	17.693	0.88273	0.0:1.0:0.0:0.0	.	513	Q96PX8	SLIK1_HUMAN	R	513	ENSP00000366288:G513R	ENSP00000366288:G513R	G	-	1	0	SLITRK1	83352107	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.603000	0.88011	0.655000	0.94253	GGG		0.562	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		8	43	0	0	0	0.004482	0	8	43				
DNAJC3	5611	broad.mit.edu	37	13	96443247	96443247	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr13:96443247C>T	ENST00000602402.1	+	12	1595	c.1478C>T	c.(1477-1479)tCa>tTa	p.S493L	DNAJC3_ENST00000376795.6_Missense_Mutation_p.S442L	NM_006260.4	NP_006251.1	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	493					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of protein kinase activity (GO:0006469)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum Sec complex (GO:0031205)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	protein kinase inhibitor activity (GO:0004860)	p.S493L(1)		NS(1)|breast(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			CCCTTCAGCTCAGGCGGACCA	0.428																																							uc001vmq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1477-1479)TCA>TTA		DnaJ (Hsp40) homolog, subfamily C, member 3							101.0	106.0	104.0					13																	96443247		2203	4300	6503	SO:0001583	missense	5611				protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding	g.chr13:96443247C>T	U28424	CCDS9479.1	13q32	2013-01-10			ENSG00000102580	ENSG00000102580		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	9439	protein-coding gene	gene with protein product		601184		PRKRI		7511204, 8824806	Standard	NM_006260		Approved	P58, P58IPK, HP58	uc001vmq.3	Q13217	OTTHUMG00000017227	ENST00000602402.1:c.1478C>T	13.37:g.96443247C>T	ENSP00000473631:p.Ser493Leu		Somatic				DNAJC3_uc001vmr.2_Missense_Mutation_p.S442L	p.S493L	NM_006260	NP_006251	WXS	Illumina HiSeq	Unspecified	Q13217	DNJC3_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.126)		12	1586	+	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		493					Q86WT9|Q8N4N2	Missense_Mutation	SNP	ENST00000602402.1	37	c.1478C>T	CCDS9479.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066513	0.76187	.	.	ENSG00000102580	ENST00000376795	.	.	.	5.63	5.63	0.86233	.	0.407552	0.26658	N	0.023172	T	0.53190	0.1781	L	0.29908	0.895	0.80722	D	1	B;B	0.29862	0.259;0.259	B;B	0.21546	0.035;0.035	T	0.51772	-0.8663	9	0.51188	T	0.08	-24.1183	20.0499	0.97621	0.0:1.0:0.0:0.0	.	493;493	A8KA82;Q13217	.;DNJC3_HUMAN	L	493	.	ENSP00000365991:S493L	S	+	2	0	DNAJC3	95241248	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.445000	0.80570	2.798000	0.96311	0.655000	0.94253	TCA		0.428	DNAJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045504.3			12	91	0	0	0	0.001855	0	12	91				
OR4N5	390437	broad.mit.edu	37	14	20612416	20612416	+	Silent	SNP	C	C	A	rs76001619	byFrequency	TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:20612416C>A	ENST00000333629.1	+	1	522	c.522C>A	c.(520-522)ctC>ctA	p.L174L	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L174L(1)		endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		CAAACCAGCTCGATAACTTCT	0.507													C|||	6	0.00119808	0.0	0.0	5008	,	,		20746	0.001		0.0	False		,,,				2504	0.0051						uc010tla.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(520-522)CTC>CTA		olfactory receptor, family 4, subfamily N,							122.0	113.0	116.0					14																	20612416		2203	4300	6503	SO:0001819	synonymous_variant	390437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20612416C>A		CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.522C>A	14.37:g.20612416C>A			Somatic					p.L174L	NM_001004724	NP_001004724	WXS	Illumina HiSeq	Unspecified	Q8IXE1	OR4N5_HUMAN	Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)	1	522	+	all_cancers(95;0.00108)		174			Extracellular (Potential).		Q6IF11	Silent	SNP	ENST00000333629.1	37	c.522C>A	CCDS32031.1																																																																																				0.507	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410347.1			13	86	1	0	1.5842e-08	0.001855	2.11744e-08	13	86				
LRFN5	145581	broad.mit.edu	37	14	42356586	42356586	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:42356586G>A	ENST00000298119.4	+	3	1947	c.758G>A	c.(757-759)cGt>cAt	p.R253H	LRFN5_ENST00000554120.1_Missense_Mutation_p.R253H|LRFN5_ENST00000554171.1_Missense_Mutation_p.R253H	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	253	LRRCT.					integral component of membrane (GO:0016021)		p.R253H(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGGTTGAGGCGTCTGTCCAGA	0.443										HNSCC(30;0.082)																													uc001wvm.2		NA																	2	Substitution - Missense(2)		lung(1)|pancreas(1)	ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(757-759)CGT>CAT		leucine rich repeat and fibronectin type III							175.0	173.0	174.0					14																	42356586		2203	4300	6503	SO:0001583	missense	145581					integral to membrane		g.chr14:42356586G>A	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.758G>A	14.37:g.42356586G>A	ENSP00000298119:p.Arg253His	HNSCC(30;0.082)	Somatic				LRFN5_uc010ana.2_Missense_Mutation_p.R253H	p.R253H	NM_152447	NP_689660	WXS	Illumina HiSeq	Unspecified	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	3	1956	+			253			Extracellular (Potential).|LRRCT.		B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	c.758G>A	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997878	0.74818	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.53423	0.62;0.62;0.62	5.69	5.69	0.88448	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.56097	D	0.000028	T	0.71467	0.3343	M	0.80847	2.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	T	0.74532	-0.3634	10	0.72032	D	0.01	.	17.3157	0.87224	0.0:0.0:1.0:0.0	.	253;253	G3V364;Q96NI6	.;LRFN5_HUMAN	H	253	ENSP00000298119:R253H;ENSP00000451897:R253H;ENSP00000451067:R253H	ENSP00000298119:R253H	R	+	2	0	LRFN5	41426336	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.676000	0.91093	0.557000	0.71058	CGT		0.443	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		39	153	0	0	0	0.00874	0	39	153				
NID2	22795	broad.mit.edu	37	14	52509064	52509064	+	Silent	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:52509064T>A	ENST00000216286.5	-	7	1583	c.1584A>T	c.(1582-1584)gcA>gcT	p.A528A	NID2_ENST00000541773.1_Silent_p.A475A	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	528	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.A528A(1)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					CTCGGTGAGGTGCCCCTAAAA	0.512																																							uc001wzo.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7						c.(1582-1584)GCA>GCT		nidogen 2 precursor							103.0	104.0	104.0					14																	52509064		2203	4300	6503	SO:0001819	synonymous_variant	22795					basement membrane	calcium ion binding|collagen binding	g.chr14:52509064T>A	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1584A>T	14.37:g.52509064T>A			Somatic				NID2_uc010tqs.1_Silent_p.A528A|NID2_uc010tqt.1_Silent_p.A528A|NID2_uc001wzp.2_Silent_p.A528A	p.A528A	NM_007361	NP_031387	WXS	Illumina HiSeq	Unspecified	Q14112	NID2_HUMAN			7	1818	-	Breast(41;0.0639)|all_epithelial(31;0.123)		528			Nidogen G2 beta-barrel.		A8K6I7|B4DU19|O43710	Silent	SNP	ENST00000216286.5	37	c.1584A>T	CCDS9706.1																																																																																				0.512	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1			19	81	0	0	0	0.008871	0	19	81				
PTGER2	5732	broad.mit.edu	37	14	52781374	52781374	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:52781374G>T	ENST00000245457.5	+	1	262	c.108G>T	c.(106-108)gtG>gtT	p.V36V	PTGER2_ENST00000557436.1_Intron	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	36					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)	p.V36V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	CGGCCGGGGTGCTGGGGAACC	0.682																																							uc001wzr.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|breast(1)	2						c.(106-108)GTG>GTT		prostaglandin E receptor 2 (subtype EP2), 53kDa	Alprostadil(DB00770)|Iloprost(DB01088)						19.0	24.0	22.0					14																	52781374		2200	4299	6499	SO:0001819	synonymous_variant	5732					integral to plasma membrane	prostaglandin E receptor activity	g.chr14:52781374G>T		CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.108G>T	14.37:g.52781374G>T			Somatic					p.V36V	NM_000956	NP_000947	WXS	Illumina HiSeq	Unspecified	P43116	PE2R2_HUMAN			1	359	+	Breast(41;0.0639)|all_epithelial(31;0.0729)		36			Helical; Name=1; (Potential).		D3DSC0|Q52LG8	Silent	SNP	ENST00000245457.5	37	c.108G>T	CCDS9708.1																																																																																				0.682	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276890.1			3	29	1	0	6.4e-05	0.004672	7.48051e-05	3	29				
DACT1	51339	broad.mit.edu	37	14	59112610	59112610	+	Silent	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:59112610A>G	ENST00000335867.4	+	4	1293	c.1269A>G	c.(1267-1269)tcA>tcG	p.S423S	DACT1_ENST00000395153.3_Silent_p.S386S|DACT1_ENST00000556859.1_Silent_p.S142S|DACT1_ENST00000541264.2_Silent_p.S142S			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	423					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)	p.S423S(1)		endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CGAAAGAATCAAAGGCCGAAC	0.567																																							uc001xdw.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|lung(2)|ovary(1)	5						c.(1267-1269)TCA>TCG		dapper 1 isoform 1							49.0	55.0	53.0					14																	59112610		2203	4298	6501	SO:0001819	synonymous_variant	51339				multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus		g.chr14:59112610A>G	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1269A>G	14.37:g.59112610A>G			Somatic				DACT1_uc010trv.1_Silent_p.S142S|DACT1_uc001xdx.2_Silent_p.S386S|DACT1_uc010trw.1_Silent_p.S142S	p.S423S	NM_016651	NP_057735	WXS	Illumina HiSeq	Unspecified	Q9NYF0	DACT1_HUMAN			4	1433	+			423					A8MYJ2|Q86TY0	Silent	SNP	ENST00000335867.4	37	c.1269A>G	CCDS9736.1																																																																																				0.567	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651		5	23	0	0	0	0.000602	0	5	23				
DLST	1743	broad.mit.edu	37	14	75360125	75360125	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:75360125C>T	ENST00000334220.4	+	9	731	c.670C>T	c.(670-672)Cgg>Tgg	p.R224W	DLST_ENST00000555190.1_3'UTR|DLST_ENST00000334212.6_Missense_Mutation_p.R138W	NM_001933.4	NP_001924.2	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)	224					cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|generation of precursor metabolites and energy (GO:0006091)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|oxoglutarate dehydrogenase complex (GO:0045252)	dihydrolipoyllysine-residue succinyltransferase activity (GO:0004149)	p.R224W(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00698)		TTCAGAACATCGGGTAAGCCT	0.517																																							uc001xqv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(670-672)CGG>TGG		dihydrolipoamide S-succinyltransferase (E2							85.0	78.0	80.0					14																	75360125		2203	4300	6503	SO:0001583	missense	1743				lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	dihydrolipoyllysine-residue succinyltransferase activity	g.chr14:75360125C>T		CCDS9833.1	14q23.1	2008-08-11			ENSG00000119689	ENSG00000119689	2.3.1.61		2911	protein-coding gene	gene with protein product		126063		DLTS		8009371	Standard	NM_001933		Approved		uc001xqv.2	P36957		ENST00000334220.4:c.670C>T	14.37:g.75360125C>T	ENSP00000335304:p.Arg224Trp		Somatic				DLST_uc001xqu.2_Missense_Mutation_p.R136W|DLST_uc001xqt.2_Missense_Mutation_p.R140W|DLST_uc010tuw.1_Missense_Mutation_p.R138W|DLST_uc001xqs.2_RNA|DLST_uc010tuv.1_Missense_Mutation_p.R224W	p.R224W	NM_001933	NP_001924	WXS	Illumina HiSeq	Unspecified	P36957	ODO2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00698)	9	733	+			224					B7Z5W8|E7ESY5|Q7LDY7|Q9BQ32	Missense_Mutation	SNP	ENST00000334220.4	37	c.670C>T	CCDS9833.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383144	0.82792	.	.	ENSG00000119689	ENST00000334220;ENST00000334212;ENST00000554806	T;T;T	0.38077	1.16;1.16;1.16	5.35	4.4	0.53042	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.72637	0.3485	H	0.98466	4.24	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.997;0.997;0.999;0.998	T	0.80939	-0.1158	10	0.87932	D	0	-23.7581	11.6525	0.51297	0.3265:0.6735:0.0:0.0	.	138;224;224;136;140	B7Z5W8;Q6IBS5;P36957;Q86TQ8;Q86TW7	.;.;ODO2_HUMAN;.;.	W	224;138;207	ENSP00000335304:R224W;ENSP00000335465:R138W;ENSP00000451957:R207W	ENSP00000238671:R207W	R	+	1	2	DLST	74429878	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.863000	0.48396	2.941000	0.99782	0.655000	0.94253	CGG		0.517	DLST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413637.1			7	44	0	0	0	0.00308	0	7	44				
TTC8	123016	broad.mit.edu	37	14	89327606	89327606	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:89327606T>C	ENST00000345383.5	+	9	893	c.809T>C	c.(808-810)cTt>cCt	p.L270P	TTC8_ENST00000354441.6_Intron|TTC8_ENST00000380656.2_Missense_Mutation_p.L280P|TTC8_ENST00000358622.5_Missense_Mutation_p.L82P|TTC8_ENST00000536576.1_Missense_Mutation_p.L41P|TTC8_ENST00000338104.6_Missense_Mutation_p.L296P|TTC8_ENST00000346301.4_Missense_Mutation_p.L240P	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	306					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)	p.L280P(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						GCTTTAAATCTTTTCAAACAA	0.289																																							uc010ath.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(886-888)CTT>CCT		tetratricopeptide repeat domain 8 isoform B							88.0	86.0	87.0					14																	89327606		2203	4300	6503	SO:0001583	missense	123016	Bardet-Biedl_syndrome			cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding	g.chr14:89327606T>C	AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.809T>C	14.37:g.89327606T>C	ENSP00000339486:p.Leu270Pro		Somatic				TTC8_uc001xxl.2_Missense_Mutation_p.L41P|TTC8_uc010ati.2_Missense_Mutation_p.L82P|TTC8_uc001xxm.2_Missense_Mutation_p.L240P|TTC8_uc010atj.2_Intron|TTC8_uc001xxi.2_Missense_Mutation_p.L280P|TTC8_uc001xxj.2_Missense_Mutation_p.L270P|TTC8_uc001xxk.2_Missense_Mutation_p.L240P	p.L296P	NM_198309	NP_938051	WXS	Illumina HiSeq	Unspecified	Q8TAM2	TTC8_HUMAN			10	1021	+			306			TPR 3.		A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Missense_Mutation	SNP	ENST00000345383.5	37	c.887T>C	CCDS9885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.33|18.33	3.599518|3.599518	0.66332|0.66332	.|.	.|.	ENSG00000165533|ENSG00000165533	ENST00000554686|ENST00000345383;ENST00000536576;ENST00000346301;ENST00000338104;ENST00000380656;ENST00000358622	.|T;T;T;T;T;T	.|0.57273	.|0.41;0.51;0.41;0.41;0.41;0.41	5.27|5.27	5.27|5.27	0.74061|0.74061	.|Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.|0.061065	.|0.64402	.|D	.|0.000002	T|T	0.52821|0.52821	0.1758|0.1758	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	.|P;D;P;P	.|0.61080	.|0.836;0.989;0.898;0.594	.|B;P;P;B	.|0.50490	.|0.308;0.642;0.504;0.382	T|T	0.53627|0.53627	-0.8412|-0.8412	5|10	.|0.44086	.|T	.|0.13	-17.2315|-17.2315	15.482|15.482	0.75534|0.75534	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|41;306;250;280	.|B3KSL8;Q8TAM2;Q8TAM2-3;Q8TAM2-4	.|.;TTC8_HUMAN;.;.	L|P	230|270;41;240;296;280;82	.|ENSP00000339486:L270P;ENSP00000445067:L41P;ENSP00000298324:L240P;ENSP00000337653:L296P;ENSP00000370031:L280P;ENSP00000351439:L82P	.|ENSP00000337653:L296P	F|L	+|+	1|2	0|0	TTC8|TTC8	88397359|88397359	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.942000|0.942000	0.58702|0.58702	7.405000|7.405000	0.80007|0.80007	2.124000|2.124000	0.65301|0.65301	0.533000|0.533000	0.62120|0.62120	TTT|CTT		0.289	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1	NM_144596		3	80	0	0	0	0.009096	0	3	80				
CATSPERB	79820	broad.mit.edu	37	14	92074741	92074741	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:92074741T>C	ENST00000256343.3	-	22	2762	c.2606A>G	c.(2605-2607)tAc>tGc	p.Y869C		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	869					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)		p.Y869C(1)		NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TGGAGGCCTGTAGTTTATCTG	0.323																																							uc001xzs.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|skin(2)|ovary(1)	5						c.(2605-2607)TAC>TGC		cation channel, sperm-associated, beta							88.0	89.0	89.0					14																	92074741		2203	4300	6503	SO:0001583	missense	79820				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane		g.chr14:92074741T>C	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.2606A>G	14.37:g.92074741T>C	ENSP00000256343:p.Tyr869Cys		Somatic				CATSPERB_uc010aub.1_Missense_Mutation_p.Y391C	p.Y869C	NM_024764	NP_079040	WXS	Illumina HiSeq	Unspecified	Q9H7T0	CTSRB_HUMAN			22	2746	-		all_cancers(154;0.0663)|all_epithelial(191;0.236)	869					A0AV51	Missense_Mutation	SNP	ENST00000256343.3	37	c.2606A>G	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.457944	0.63401	.	.	ENSG00000133962	ENST00000256343	T	0.70516	-0.49	5.58	5.58	0.84498	.	0.000000	0.50627	D	0.000109	T	0.81602	0.4857	M	0.64404	1.975	0.42964	D	0.994419	D	0.89917	1.0	D	0.91635	0.999	D	0.83784	0.0227	10	0.87932	D	0	-17.7099	13.2609	0.60104	0.0:0.0:0.0:1.0	.	869	Q9H7T0	CTSRB_HUMAN	C	869	ENSP00000256343:Y869C	ENSP00000256343:Y869C	Y	-	2	0	CATSPERB	91144494	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.888000	0.63164	2.126000	0.65437	0.528000	0.53228	TAC		0.323	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764		7	49	0	0	0	0.00308	0	7	49				
RIN3	79890	broad.mit.edu	37	14	93118691	93118691	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:93118691G>T	ENST00000216487.7	+	6	1456	c.1297G>T	c.(1297-1299)Ggc>Tgc	p.G433C	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	433	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.G433C(1)		endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				CACGGAGCAAGGCCAGGACAC	0.657																																							uc001yap.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(1297-1299)GGC>TGC		Ras and Rab interactor 3							79.0	89.0	86.0					14																	93118691		2203	4300	6503	SO:0001583	missense	79890				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding	g.chr14:93118691G>T	BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.1297G>T	14.37:g.93118691G>T	ENSP00000216487:p.Gly433Cys		Somatic				RIN3_uc010auk.2_Missense_Mutation_p.G95C|RIN3_uc001yaq.2_Missense_Mutation_p.G358C|RIN3_uc001yar.1_Missense_Mutation_p.G95C|RIN3_uc001yas.1_Missense_Mutation_p.G95C	p.G433C	NM_024832	NP_079108	WXS	Illumina HiSeq	Unspecified	Q8TB24	RIN3_HUMAN			6	1449	+		all_cancers(154;0.0701)	433			Pro-rich.		Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Missense_Mutation	SNP	ENST00000216487.7	37	c.1297G>T	CCDS32144.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893553	0.33442	.	.	ENSG00000100599	ENST00000216487;ENST00000428147	T	0.06933	3.24	4.22	3.31	0.37934	.	0.669254	0.13448	N	0.387102	T	0.20333	0.0489	L	0.57536	1.79	0.23243	N	0.998055	D;D;D;D	0.89917	1.0;0.992;0.983;0.999	D;P;P;D	0.70935	0.971;0.615;0.635;0.936	T	0.07177	-1.0786	10	0.37606	T	0.19	-14.06	7.4279	0.27109	0.0937:0.0:0.7316:0.1747	.	433;479;358;433	Q8TB24-4;Q86U22;Q6ZRC2;Q8TB24	.;.;.;RIN3_HUMAN	C	433;357	ENSP00000216487:G433C	ENSP00000216487:G433C	G	+	1	0	RIN3	92188444	0.085000	0.21516	0.987000	0.45799	0.331000	0.28603	1.761000	0.38440	0.749000	0.32854	0.313000	0.20887	GGC		0.657	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412269.1			7	33	1	0	0.000157383	0.00308	0.000177817	7	33				
UNC79	57578	broad.mit.edu	37	14	94060029	94060029	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:94060029G>A	ENST00000393151.2	+	23	3036	c.3036G>A	c.(3034-3036)ctG>ctA	p.L1012L	UNC79_ENST00000256339.4_Silent_p.L835L|UNC79_ENST00000553484.1_Silent_p.L1012L|UNC79_ENST00000555664.1_Silent_p.L1012L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1012					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L1012L(1)|p.L835L(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TCCCTAGCCTGTGGAGGGTCG	0.478																																							uc001ybv.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(10)|skin(4)|large_intestine(3)	17						c.(2503-2505)CTG>CTA		hypothetical protein LOC57578							222.0	193.0	203.0					14																	94060029		2203	4300	6503	SO:0001819	synonymous_variant	57578					integral to membrane		g.chr14:94060029G>A	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3036G>A	14.37:g.94060029G>A			Somatic				KIAA1409_uc001ybs.1_Silent_p.L835L	p.L835L	NM_020818	NP_065869	WXS	Illumina HiSeq	Unspecified	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	20	2588	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	1012					B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37	c.2505G>A																																																																																					0.478	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		19	91	0	0	0	0.007413	0	19	91				
UNC79	57578	broad.mit.edu	37	14	94158119	94158119	+	Missense_Mutation	SNP	C	C	G	rs199908820		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:94158119C>G	ENST00000393151.2	+	47	7414	c.7414C>G	c.(7414-7416)Ctc>Gtc	p.L2472V	UNC79_ENST00000256339.4_Missense_Mutation_p.L2295V|UNC79_ENST00000553484.1_Missense_Mutation_p.L2494V|UNC79_ENST00000555664.1_Missense_Mutation_p.L2433V			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2472					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L2295V(1)|p.L2494V(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CATGTGCTCCCTCTTCCACGC	0.542																																							uc001ybv.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|skin(4)|large_intestine(3)	17						c.(6949-6951)CTC>GTC		hypothetical protein LOC57578							135.0	113.0	120.0					14																	94158119		2203	4300	6503	SO:0001583	missense	57578					integral to membrane		g.chr14:94158119C>G	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.7414C>G	14.37:g.94158119C>G	ENSP00000376858:p.Leu2472Val		Somatic				KIAA1409_uc001ybs.1_Missense_Mutation_p.L2295V	p.L2317V	NM_020818	NP_065869	WXS	Illumina HiSeq	Unspecified	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	45	7032	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	2472			Helical; (Potential).		B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37	c.6949C>G		.	.	.	.	.	.	.	.	.	.	C	21.2	4.106291	0.77096	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.44482	0.93;0.98;0.92;0.93	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.54029	0.1833	M	0.74647	2.275	0.80722	D	1	B	0.28233	0.204	B	0.36378	0.223	T	0.55642	-0.8109	10	0.87932	D	0	-7.3201	20.0321	0.97543	0.0:1.0:0.0:0.0	.	2494	C9JQL1	.	V	2295;2433;2494;2472;2494	ENSP00000256339:L2295V;ENSP00000450868:L2433V;ENSP00000451360:L2494V;ENSP00000376858:L2472V	ENSP00000256339:L2295V	L	+	1	0	KIAA1409	93227872	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.773000	0.85462	2.728000	0.93425	0.655000	0.94253	CTC		0.542	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		9	44	0	0	0	0.008291	0	9	44				
DICER1	23405	broad.mit.edu	37	14	95573988	95573988	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:95573988C>A	ENST00000526495.1	-	19	3052	c.2761G>T	c.(2761-2763)Gtt>Ttt	p.V921F	DICER1_ENST00000527414.1_Missense_Mutation_p.V921F|DICER1_ENST00000343455.3_Missense_Mutation_p.V921F|DICER1_ENST00000556045.1_5'Flank|DICER1_ENST00000541352.1_Missense_Mutation_p.V921F|DICER1_ENST00000393063.1_Missense_Mutation_p.V921F			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	921	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)	p.V921F(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AATTTAAAAACAAAGGGTGTT	0.343			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																														uc001ydw.2		NA	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	Mis F|N	"""dicer 1, ribonuclease type III """			"""E, M, O"""		pleuropulmonary blastoma			1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|pancreas(1)|lung(1)	5						c.(2761-2763)GTT>TTT		dicer1							100.0	105.0	103.0					14																	95573988		2202	4298	6500	SO:0001583	missense	23405	DICER_1_syndrome_|Familial_Multinodular_Goiter_	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity	g.chr14:95573988C>A	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.2761G>T	14.37:g.95573988C>A	ENSP00000437256:p.Val921Phe		Somatic				DICER1_uc010avh.1_5'Flank|DICER1_uc001ydv.2_Missense_Mutation_p.V911F|DICER1_uc001ydx.2_Missense_Mutation_p.V921F	p.V921F	NM_030621	NP_085124	WXS	Illumina HiSeq	Unspecified	Q9UPY3	DICER_HUMAN		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)	18	2943	-		all_cancers(154;0.0621)|all_epithelial(191;0.223)	921			PAZ.		A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	37	c.2761G>T	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224130	0.79576	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.64	5.86	4.76	0.60689	Argonaute/Dicer protein, PAZ (3);	0.158581	0.56097	D	0.000035	T	0.43211	0.1237	L	0.39245	1.2	0.40304	D	0.978649	B	0.23540	0.087	B	0.26770	0.073	T	0.41413	-0.9510	10	0.32370	T	0.25	-33.4709	4.3971	0.11369	0.0:0.708:0.0:0.292	.	921	Q9UPY3	DICER_HUMAN	F	921	ENSP00000343745:V921F;ENSP00000437256:V921F;ENSP00000376783:V921F;ENSP00000435681:V921F;ENSP00000444719:V921F	ENSP00000343745:V921F	V	-	1	0	DICER1	94643741	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.908000	0.56355	2.937000	0.99478	0.650000	0.86243	GTT		0.343	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1			12	91	1	0	1.61879e-10	0.001368	2.32311e-10	12	91				
ATG2B	55102	broad.mit.edu	37	14	96756049	96756049	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:96756049G>C	ENST00000359933.4	-	41	6843	c.5950C>G	c.(5950-5952)Cac>Gac	p.H1984D	ATG2B_ENST00000261834.5_5'Flank	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1984					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)		p.H1984D(1)		breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		ACTGGCTGGTGGGCTAACCGG	0.522																																							uc001yfi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|skin(1)	3						c.(5950-5952)CAC>GAC		ATG2 autophagy related 2 homolog B							169.0	157.0	161.0					14																	96756049		2203	4300	6503	SO:0001583	missense	55102							g.chr14:96756049G>C	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.5950C>G	14.37:g.96756049G>C	ENSP00000353010:p.His1984Asp		Somatic					p.H1984D	NM_018036	NP_060506	WXS	Illumina HiSeq	Unspecified	Q96BY7	ATG2B_HUMAN		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)	41	6315	-		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)	1984					Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	c.5950C>G	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089396	0.76756	.	.	ENSG00000066739	ENST00000359933	T	0.07908	3.15	5.4	5.4	0.78164	Autophagy-related, C-terminal (1);	0.207158	0.50627	D	0.000105	T	0.06735	0.0172	N	0.05078	-0.115	0.58432	D	0.999998	B	0.32653	0.379	B	0.42188	0.379	T	0.16424	-1.0403	10	0.05351	T	0.99	.	19.5457	0.95295	0.0:0.0:1.0:0.0	.	1984	Q96BY7	ATG2B_HUMAN	D	1984	ENSP00000353010:H1984D	ENSP00000353010:H1984D	H	-	1	0	ATG2B	95825802	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	9.386000	0.97228	2.673000	0.90976	0.655000	0.94253	CAC		0.522	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036		20	93	0	0	0	0.008871	0	20	93				
TDRD9	122402	broad.mit.edu	37	14	104490907	104490907	+	Splice_Site	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:104490907G>T	ENST00000409874.4	+	25	2656	c.2608G>T	c.(2608-2610)Gtg>Ttg	p.V870L	TDRD9_ENST00000339063.5_Splice_Site_p.V870L	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	870					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.V870L(1)|p.V585L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				ATTATGTAGGGTGAATGTGGA	0.323																																							uc001yom.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(2608-2610)GTG>TTG		tudor domain containing 9							103.0	97.0	99.0					14																	104490907		2203	4300	6503	SO:0001630	splice_region_variant	122402				cell differentiation|DNA methylation involved in gamete generation|fertilization|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	nucleus|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr14:104490907G>T	AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.2607-1G>T	14.37:g.104490907G>T			Somatic				TDRD9_uc001yon.3_Missense_Mutation_p.V608L	p.V870L	NM_153046	NP_694591	WXS	Illumina HiSeq	Unspecified	Q8NDG6	TDRD9_HUMAN			25	2638	+		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)	870					A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	ENST00000409874.4	37	c.2608G>T	CCDS9987.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.71|13.71	2.318493|2.318493	0.40996|0.40996	.|.	.|.	ENSG00000156414|ENSG00000156414	ENST00000557332|ENST00000409874;ENST00000339063	.|T;T	.|0.03413	.|3.94;3.96	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.106289	.|0.41605	.|D	.|0.000853	T|T	0.04724|0.04724	0.0128|0.0128	L|L	0.34521|0.34521	1.04|1.04	0.48975|0.48975	D|D	0.99973|0.99973	.|P;B	.|0.42375	.|0.778;0.282	.|B;B	.|0.42062	.|0.374;0.132	T|T	0.50363|0.50363	-0.8837|-0.8837	5|10	.|0.42905	.|T	.|0.14	.|.	12.9413|12.9413	0.58345|0.58345	0.0741:0.0:0.9259:0.0|0.0741:0.0:0.9259:0.0	.|.	.|870;870	.|Q8NDG6-2;Q8NDG6	.|.;TDRD9_HUMAN	V|L	596|870	.|ENSP00000387303:V870L;ENSP00000343545:V870L	.|ENSP00000343545:V870L	G|V	+|+	2|1	0|0	TDRD9|TDRD9	103560660|103560660	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.828000|0.828000	0.46876|0.46876	3.712000|3.712000	0.54875|0.54875	2.650000|2.650000	0.89964|0.89964	0.563000|0.563000	0.77884|0.77884	GGT|GTG		0.323	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	Missense_Mutation	6	54	1	0	8.12818e-05	0.001984	9.33828e-05	6	54				
AHNAK2	113146	broad.mit.edu	37	14	105418880	105418880	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr14:105418880C>A	ENST00000333244.5	-	7	3027	c.2908G>T	c.(2908-2910)Gcc>Tcc	p.A970S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	970						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.A970S(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCCTTCTGGGCCTGGACATCC	0.607																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2908-2910)GCC>TCC		AHNAK nucleoprotein 2																																				SO:0001583	missense	113146					nucleus		g.chr14:105418880C>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2908G>T	14.37:g.105418880C>A	ENSP00000353114:p.Ala970Ser		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.A870S	p.A970S	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	3028	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	970					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.2908G>T	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	13.75	2.330359	0.41297	.	.	ENSG00000185567	ENST00000333244	T	0.00892	5.57	3.36	-0.36	0.12568	.	.	.	.	.	T	0.00967	0.0032	L	0.45698	1.435	0.09310	N	1	B	0.28713	0.22	B	0.26416	0.069	T	0.45527	-0.9255	9	0.08599	T	0.76	.	9.1944	0.37220	0.0:0.6615:0.0:0.3385	.	970	Q8IVF2	AHNK2_HUMAN	S	970	ENSP00000353114:A970S	ENSP00000353114:A970S	A	-	1	0	AHNAK2	104489925	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.109000	0.15417	0.004000	0.14682	-0.698000	0.03680	GCC		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		38	212	1	0	5.43694e-19	0.005524	8.65256e-19	38	212				
RYR3	6263	broad.mit.edu	37	15	33936678	33936678	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr15:33936678C>T	ENST00000389232.4	+	28	3793	c.3723C>T	c.(3721-3723)ctC>ctT	p.L1241L	RYR3_ENST00000415757.3_Silent_p.L1241L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1241	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.L1241L(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCAAGCGCCTCCCGACGTTTG	0.502																																							uc001zhi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(3721-3723)CTC>CTT		ryanodine receptor 3							79.0	78.0	78.0					15																	33936678		1985	4157	6142	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:33936678C>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.3723C>T	15.37:g.33936678C>T			Somatic				RYR3_uc010bar.2_Silent_p.L1241L	p.L1241L	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	28	3793	+		all_lung(180;7.18e-09)	1241			4 X approximate repeats.|Cytoplasmic (By similarity).		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.3723C>T	CCDS45210.1																																																																																				0.502	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			5	26	0	0	0	0.001168	0	5	26				
MEIS2	4212	broad.mit.edu	37	15	37187407	37187407	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr15:37187407C>A	ENST00000561208.1	-	11	1510	c.1092G>T	c.(1090-1092)caG>caT	p.Q364H	MEIS2_ENST00000444725.1_Missense_Mutation_p.Q357H|MEIS2_ENST00000219869.9_Missense_Mutation_p.Q218H|MEIS2_ENST00000557796.2_Missense_Mutation_p.Q344H|MEIS2_ENST00000382766.2_Missense_Mutation_p.Q357H|MEIS2_ENST00000424352.2_Missense_Mutation_p.Q364H|MEIS2_ENST00000559561.1_Missense_Mutation_p.Q357H|MEIS2_ENST00000559085.1_Missense_Mutation_p.Q351H|MEIS2_ENST00000338564.5_Missense_Mutation_p.Q357H|MEIS2_ENST00000397620.2_Missense_Mutation_p.Q269H|MEIS2_ENST00000397624.3_Missense_Mutation_p.Q269H|MEIS2_ENST00000340545.5_Missense_Mutation_p.Q344H|MEIS2_ENST00000559408.1_5'UTR			O14770	MEIS2_HUMAN	Meis homeobox 2	364	Transcriptional activation domain.				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.Q364H(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		TCCCCATGGGCTGACCCTCTG	0.537																																							uc001zjr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1090-1092)CAG>CAT		Meis homeobox 2 isoform c							108.0	98.0	102.0					15																	37187407		2201	4297	6498	SO:0001583	missense	4212				negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr15:37187407C>A	AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.1092G>T	15.37:g.37187407C>A	ENSP00000453793:p.Gln364His		Somatic				MEIS2_uc001zjl.2_Missense_Mutation_p.Q351H|MEIS2_uc010ucj.1_Missense_Mutation_p.Q344H|MEIS2_uc001zjm.2_Missense_Mutation_p.Q269H|MEIS2_uc001zjn.2_Missense_Mutation_p.Q218H|MEIS2_uc001zjo.2_Missense_Mutation_p.Q364H|MEIS2_uc001zjp.2_Missense_Mutation_p.Q357H|MEIS2_uc001zjs.2_Missense_Mutation_p.Q357H|MEIS2_uc001zju.2_Missense_Mutation_p.Q344H|MEIS2_uc001zjt.2_Missense_Mutation_p.Q357H|MEIS2_uc001zjj.2_Missense_Mutation_p.Q60H|MEIS2_uc001zjk.2_Missense_Mutation_p.Q53H	p.Q364H	NM_170675	NP_733775	WXS	Illumina HiSeq	Unspecified	O14770	MEIS2_HUMAN		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)	11	2129	-		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)	364					A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	ENST00000561208.1	37	c.1092G>T	CCDS10044.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.656097	0.29425	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766;ENST00000424352;ENST00000444725;ENST00000340545;ENST00000397624;ENST00000397620;ENST00000219869	D;D;D;D;D;D;D	0.89415	-2.3;-2.3;-2.17;-2.23;-2.23;-2.21;-2.51	5.77	4.67	0.58626	.	0.246452	0.43416	D	0.000570	D	0.93726	0.7995	M	0.75777	2.31	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	0.985;1.0;0.999;0.991;0.972;0.995;0.996;0.999;0.997;1.0	P;D;D;D;P;D;D;D;D;D	0.87578	0.827;0.987;0.989;0.917;0.693;0.928;0.995;0.947;0.928;0.998	D	0.93181	0.6574	10	0.46703	T	0.11	-1.1557	15.6983	0.77517	0.0:0.9239:0.0:0.0761	.	344;357;364;357;364;218;269;351;344;60	Q96DI2;O14770-4;O14770;O14770-3;O14770-2;B3KP81;B3KPQ6;B3KP98;B7Z6F6;Q6V703	.;.;MEIS2_HUMAN;.;.;.;.;.;.;.	H	364;357;357;364;357;344;351;269;218	ENSP00000341400:Q357H;ENSP00000372216:Q357H;ENSP00000404185:Q364H;ENSP00000391887:Q357H;ENSP00000339549:Q344H;ENSP00000380745:Q269H;ENSP00000219869:Q218H	ENSP00000219869:Q218H	Q	-	3	2	MEIS2	34974699	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.924000	0.63418	2.735000	0.93741	0.655000	0.94253	CAG		0.537	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677		10	71	1	0	3.07112e-06	0.000978	3.79482e-06	10	71				
UNC13C	440279	broad.mit.edu	37	15	54914534	54914534	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr15:54914534C>A	ENST00000260323.11	+	30	6116	c.6116C>A	c.(6115-6117)tCc>tAc	p.S2039Y	UNC13C_ENST00000537900.1_Missense_Mutation_p.S2037Y|UNC13C_ENST00000539562.2_5'UTR|UNC13C_ENST00000545554.1_Missense_Mutation_p.S2039Y	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2039					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.S2039Y(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGTCGTTCCTCCAAAGATGCC	0.408																																							uc002ack.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|pancreas(2)	7						c.(6115-6117)TCC>TAC		unc-13 homolog C							111.0	113.0	112.0					15																	54914534		1971	4165	6136	SO:0001583	missense	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54914534C>A	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6116C>A	15.37:g.54914534C>A	ENSP00000260323:p.Ser2039Tyr		Somatic				UNC13C_uc002acm.2_5'UTR	p.S2039Y	NM_001080534	NP_001074003	WXS	Illumina HiSeq	Unspecified	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	29	6116	+			2039					Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	c.6116C>A	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761796	0.49468	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.80123	-1.34;-1.34;-1.34	5.07	4.1	0.47936	C2 calcium/lipid-binding domain, CaLB (1);	0.373953	0.27478	N	0.019184	T	0.71400	0.3335	L	0.36672	1.1	0.31351	N	0.682466	P	0.48162	0.906	B	0.38378	0.272	T	0.78301	-0.2257	10	0.56958	D	0.05	.	15.2174	0.73281	0.0:0.8593:0.1407:0.0	.	2039	Q8NB66	UN13C_HUMAN	Y	2039;2039;2037	ENSP00000260323:S2039Y;ENSP00000438156:S2039Y;ENSP00000442569:S2037Y	ENSP00000260323:S2039Y	S	+	2	0	UNC13C	52701826	0.973000	0.33851	1.000000	0.80357	0.672000	0.39443	1.631000	0.37092	2.508000	0.84585	0.585000	0.79938	TCC		0.408	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		9	66	1	0	0.00010058	0.001368	0.00011523	9	66				
SMAD3	4088	broad.mit.edu	37	15	67473723	67473723	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr15:67473723G>A	ENST00000327367.4	+	6	1113	c.803G>A	c.(802-804)cGc>cAc	p.R268H	SMAD3_ENST00000540846.2_Missense_Mutation_p.R163H|SMAD3_ENST00000439724.3_Missense_Mutation_p.R224H|SMAD3_ENST00000537194.2_Missense_Mutation_p.R73H	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	268	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R268H(2)|p.R224H(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		AATTCGGAGCGCTTCTGCCTA	0.607																																							uc002aqj.2		NA																	3	Substitution - Missense(3)		lung(2)|large_intestine(1)	large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						c.(802-804)CGC>CAC		mothers against decapentaplegic homolog 3							64.0	61.0	62.0					15																	67473723		2201	4299	6500	SO:0001583	missense	4088				activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding	g.chr15:67473723G>A	BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.803G>A	15.37:g.67473723G>A	ENSP00000332973:p.Arg268His		Somatic				SMAD3_uc010ujr.1_Missense_Mutation_p.R163H|SMAD3_uc010ujs.1_Missense_Mutation_p.R224H|SMAD3_uc010ujt.1_Missense_Mutation_p.R73H	p.R268H	NM_005902	NP_005893	WXS	Illumina HiSeq	Unspecified	P84022	SMAD3_HUMAN		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)	6	1101	+			268			MH2.		A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	ENST00000327367.4	37	c.803G>A	CCDS10222.1	.	.	.	.	.	.	.	.	.	.	G	35	5.513463	0.96402	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724;ENST00000537194	D;D;D;D	0.98120	-4.73;-4.73;-4.73;-4.73	5.1	5.1	0.69264	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99096	0.9689	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99406	1.0929	10	0.87932	D	0	.	18.8753	0.92332	0.0:0.0:1.0:0.0	.	224;268	B7Z4Z5;P84022	.;SMAD3_HUMAN	H	268;268;163;224;73	ENSP00000332973:R268H;ENSP00000437757:R163H;ENSP00000401133:R224H;ENSP00000445348:R73H	ENSP00000332973:R268H	R	+	2	0	SMAD3	65260777	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.682000	0.98655	2.515000	0.84797	0.555000	0.69702	CGC		0.607	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256967.2	NM_005902		5	29	0	0	0	0.001984	0	5	29				
PTPN9	5780	broad.mit.edu	37	15	75816577	75816577	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr15:75816577C>G	ENST00000306726.2	-	3	782	c.270G>C	c.(268-270)gaG>gaC	p.E90D	CTD-2323K18.1_ENST00000568707.1_RNA	NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	90	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)	p.E90D(1)		central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CACTGAGGATCTCAGAACGAA	0.393																																							uc002bal.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|skin(1)	2						c.(268-270)GAG>GAC		protein tyrosine phosphatase, non-receptor type							117.0	109.0	112.0					15																	75816577		2197	4294	6491	SO:0001583	missense	5780					cytoplasmic part	non-membrane spanning protein tyrosine phosphatase activity|protein binding	g.chr15:75816577C>G		CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.270G>C	15.37:g.75816577C>G	ENSP00000303554:p.Glu90Asp		Somatic					p.E90D	NM_002833	NP_002824	WXS	Illumina HiSeq	Unspecified	P43378	PTN9_HUMAN			3	778	-			90			CRAL-TRIO.		Q53XR9	Missense_Mutation	SNP	ENST00000306726.2	37	c.270G>C	CCDS10280.1	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885873	0.72410	.	.	ENSG00000169410	ENST00000306726;ENST00000544966	D	0.85258	-1.96	5.58	2.1	0.27182	Cellular retinaldehyde-binding/triple function, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.90390	0.6992	M	0.76574	2.34	0.47407	D	0.999413	D	0.89917	1.0	D	0.87578	0.998	D	0.89734	0.3928	10	0.72032	D	0.01	.	10.4136	0.44307	0.0:0.724:0.0:0.276	.	90	P43378	PTN9_HUMAN	D	90;80	ENSP00000303554:E90D	ENSP00000303554:E90D	E	-	3	2	PTPN9	73603632	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.329000	0.43876	0.657000	0.30906	-0.339000	0.08088	GAG		0.393	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286474.1			14	77	0	0	0	0.006122	0	14	77				
ADAMTS17	170691	broad.mit.edu	37	15	100801699	100801699	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr15:100801699G>C	ENST00000268070.4	-	6	1121	c.1016C>G	c.(1015-1017)gCc>gGc	p.A339G	ADAMTS17_ENST00000559976.1_5'UTR	NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	339	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A339G(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CACAAACACGGCAGCATCCAC	0.537																																							uc002bvv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1015-1017)GCC>GGC		ADAM metallopeptidase with thrombospondin type 1							76.0	64.0	68.0					15																	100801699		2203	4300	6503	SO:0001583	missense	170691				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:100801699G>C	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1016C>G	15.37:g.100801699G>C	ENSP00000268070:p.Ala339Gly		Somatic				ADAMTS17_uc002bvx.1_Missense_Mutation_p.A96G	p.A339G	NM_139057	NP_620688	WXS	Illumina HiSeq	Unspecified	Q8TE56	ATS17_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)	6	1095	-	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		339			Peptidase M12B.		Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	c.1016C>G	CCDS10383.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.775793	0.90195	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	D	0.90004	-2.6	5.51	5.51	0.81932	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (1);	0.000000	0.85682	D	0.000000	D	0.96355	0.8811	H	0.94306	3.52	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.98;0.996	D	0.97171	0.9844	10	0.87932	D	0	.	19.4394	0.94811	0.0:0.0:1.0:0.0	.	96;339	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	G	339;96	ENSP00000268070:A339G	ENSP00000268070:A339G	A	-	2	0	ADAMTS17	98619222	1.000000	0.71417	0.716000	0.30569	0.935000	0.57460	6.553000	0.73918	2.581000	0.87130	0.655000	0.94253	GCC		0.537	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057		6	23	0	0	0	0.001984	0	6	23				
PARN	5073	broad.mit.edu	37	16	14711498	14711498	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr16:14711498T>C	ENST00000437198.2	-	6	478	c.337A>G	c.(337-339)Att>Gtt	p.I113V	PARN_ENST00000539279.1_Intron|PARN_ENST00000566021.1_Intron|PARN_ENST00000341484.7_Missense_Mutation_p.I52V|PARN_ENST00000420015.2_Missense_Mutation_p.I67V	NM_001134477.2|NM_002582.3	NP_001127949.1|NP_002573.1	O95453	PARN_HUMAN	poly(A)-specific ribonuclease	113					female gamete generation (GO:0007292)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA metabolic process (GO:0016070)|RNA modification (GO:0009451)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|nuclease activity (GO:0004518)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(A)-specific ribonuclease activity (GO:0004535)|protein kinase binding (GO:0019901)	p.I113V(2)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|urinary_tract(1)	21						AGAAAGTCAATGCTGGAGCTC	0.348																																							uc010uzd.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(337-339)ATT>GTT		poly(A)-specific ribonuclease (deadenylation							68.0	65.0	66.0					16																	14711498		1839	4094	5933	SO:0001583	missense	5073				female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding	g.chr16:14711498T>C	AJ005698	CCDS45419.1, CCDS45420.1, CCDS58425.1	16p13	2014-08-08	2011-07-07		ENSG00000140694	ENSG00000140694	3.1.13.4		8609	protein-coding gene	gene with protein product	"""deadenylation nuclease"""	604212	"""poly(A)-specific ribonuclease (deadenylation nuclease)"""			10640832	Standard	NM_002582		Approved	DAN	uc010uzd.2	O95453	OTTHUMG00000173199	ENST00000437198.2:c.337A>G	16.37:g.14711498T>C	ENSP00000387911:p.Ile113Val		Somatic				PARN_uc010uzc.1_Missense_Mutation_p.I52V|PARN_uc010uze.1_Missense_Mutation_p.I67V|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_RNA	p.I113V	NM_002582	NP_002573	WXS	Illumina HiSeq	Unspecified	O95453	PARN_HUMAN			6	479	-			113	I->A: Loss of dimerization. Loss of activity.				B2RCB3|B4DDG8|B4DWR4|B4E1H6	Missense_Mutation	SNP	ENST00000437198.2	37	c.337A>G	CCDS45419.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.266137	0.80358	.	.	ENSG00000140694	ENST00000437198;ENST00000341484;ENST00000420015;ENST00000538472	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	5.95	5.95	0.96441	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.42245	0.1194	L	0.50333	1.59	0.80722	D	1	D;B	0.54964	0.969;0.321	P;B	0.62491	0.903;0.357	T	0.07751	-1.0756	10	0.27785	T	0.31	-20.3353	15.6048	0.76658	0.0:0.0:0.0:1.0	.	67;113	B4DWR4;O95453	.;PARN_HUMAN	V	113;52;67;96	ENSP00000387911:I113V;ENSP00000345456:I52V;ENSP00000410525:I67V;ENSP00000445659:I96V	ENSP00000345456:I52V	I	-	1	0	PARN	14618999	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.920000	0.75799	2.279000	0.76181	0.533000	0.62120	ATT		0.348	PARN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422383.1	NM_002582		8	54	0	0	0	0.006214	0	8	54				
NDE1	54820	broad.mit.edu	37	16	15785148	15785148	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr16:15785148C>T	ENST00000396353.2	+	7	1497	c.671C>T	c.(670-672)tCa>tTa	p.S224L	NDE1_ENST00000396355.1_Missense_Mutation_p.S224L|NDE1_ENST00000396354.1_Missense_Mutation_p.S224L|NDE1_ENST00000342673.5_Missense_Mutation_p.S224L			Q9NXR1	NDE1_HUMAN	nudE neurodevelopment protein 1	224	Interaction with CENPF. {ECO:0000250}.				centrosome duplication (GO:0051298)|cerebral cortex development (GO:0021987)|establishment of chromosome localization (GO:0051303)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuroblast proliferation (GO:0007405)|neuron migration (GO:0001764)|vesicle transport along microtubule (GO:0047496)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole centrosome (GO:0031616)	microtubule binding (GO:0008017)	p.S224L(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						GGACCCAGCTCAAGTTTAAAC	0.572																																							uc002ddt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(670-672)TCA>TTA		nuclear distribution gene E homolog 1							44.0	39.0	41.0					16																	15785148		2197	4300	6497	SO:0001583	missense	54820				cell differentiation|cell division|centrosome duplication|establishment of chromosome localization|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|mitotic prometaphase|nervous system development	cleavage furrow|condensed chromosome kinetochore|cytosol|microtubule|spindle pole centrosome	microtubule binding	g.chr16:15785148C>T	AF124431	CCDS10564.1	16p13.11	2013-08-06	2013-08-06		ENSG00000072864	ENSG00000072864			17619	protein-coding gene	gene with protein product		609449	"""nudE nuclear distribution gene E homolog 1 (A. nidulans)"", ""nudE nuclear distribution E homolog 1 (A. nidulans)"""			10940388, 12427674	Standard	NM_017668		Approved	nudE, FLJ20101, NDE	uc002dds.3	Q9NXR1	OTTHUMG00000129885	ENST00000396353.2:c.671C>T	16.37:g.15785148C>T	ENSP00000379641:p.Ser224Leu		Somatic				NDE1_uc010uzy.1_Missense_Mutation_p.S224L|NDE1_uc002dds.2_Missense_Mutation_p.S224L|NDE1_uc002ddu.1_Missense_Mutation_p.S161L	p.S224L	NM_017668	NP_060138	WXS	Illumina HiSeq	Unspecified	Q9NXR1	NDE1_HUMAN			5	714	+			224			Interaction with CENPF (By similarity).		Q49AQ2	Missense_Mutation	SNP	ENST00000396353.2	37	c.671C>T		.	.	.	.	.	.	.	.	.	.	C	12.85	2.061826	0.36373	.	.	ENSG00000072864	ENST00000396355;ENST00000396353;ENST00000396354;ENST00000342673	.	.	.	5.75	3.77	0.43336	NUDE protein, C-terminal (1);	0.553872	0.20786	N	0.085707	T	0.29588	0.0738	N	0.26042	0.785	0.09310	N	1	B;B	0.15930	0.015;0.0	B;B	0.23419	0.046;0.002	T	0.19160	-1.0314	9	0.34782	T	0.22	-39.666	9.2827	0.37737	0.0:0.6432:0.2789:0.0778	.	224;224	Q9NXR1;Q9NXR1-2	NDE1_HUMAN;.	L	224	.	ENSP00000345892:S224L	S	+	2	0	NDE1	15692649	0.002000	0.14202	0.026000	0.17262	0.589000	0.36550	1.470000	0.35354	0.756000	0.33013	0.655000	0.94253	TCA		0.572	NDE1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017668		6	19	0	0	0	0.001168	0	6	19				
GPR139	124274	broad.mit.edu	37	16	20043936	20043937	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr16:20043936_20043937GG>TT	ENST00000570682.1	-	2	482_483	c.182_183CC>AA	c.(181-183)tCC>tAA	p.S61*		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	61					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)	p.S61*(1)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						AGTTGTAGGAGGACTTCTGTCT	0.45																																							uc002dgu.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(181-183)TCC>TAA		G protein-coupled receptor 139																																				SO:0001587	stop_gained	124274					integral to membrane|plasma membrane		g.chr16:20043936_20043937GG>TT	AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.182_183delinsTT	16.37:g.20043936_20043937delinsTT	ENSP00000458791:p.Ser61*		Somatic				GPR139_uc010vaw.1_5'UTR	p.S61*	NM_001002911	NP_001002911	WXS	Illumina HiSeq	Unspecified	Q6DWJ6	GP139_HUMAN			2	344_345	-			61			Cytoplasmic (Potential).		A8K5R9|Q86SP2|Q8TDU8	Nonsense_Mutation	DNP	ENST00000570682.1	37	c.182_183CC>AA	CCDS32398.1																																																																																				0.450	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438522.1	NM_001002911		10	42	0	0	0	0.004672	0	10	42				
GP2	2813	broad.mit.edu	37	16	20329664	20329664	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr16:20329664C>A	ENST00000381362.4	-	8	1181	c.1105G>T	c.(1105-1107)Ggg>Tgg	p.G369W	GP2_ENST00000573897.1_5'Flank|GP2_ENST00000302555.5_Missense_Mutation_p.G366W|GP2_ENST00000381360.5_Missense_Mutation_p.G222W|GP2_ENST00000341642.5_Missense_Mutation_p.G219W	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	369	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)	p.G366W(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						ACTGCATCCCCTTCGTAAGGA	0.507																																							uc002dgv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1105-1107)GGG>TGG		zymogen granule membrane glycoprotein 2 isoform							304.0	243.0	264.0					16																	20329664		2203	4300	6503	SO:0001583	missense	2813					anchored to membrane|extracellular region|plasma membrane		g.chr16:20329664C>A	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.1105G>T	16.37:g.20329664C>A	ENSP00000370767:p.Gly369Trp		Somatic				GP2_uc002dgw.2_Missense_Mutation_p.G366W|GP2_uc002dgx.2_Missense_Mutation_p.G222W|GP2_uc002dgy.2_Missense_Mutation_p.G219W	p.G369W	NM_001007240	NP_001007241	WXS	Illumina HiSeq	Unspecified	P55259	GP2_HUMAN			8	1188	-			369			ZP.		A6NFM9|A6NJA8|Q13338|Q9UIF1	Missense_Mutation	SNP	ENST00000381362.4	37	c.1105G>T	CCDS42128.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.555975	0.45487	.	.	ENSG00000169347	ENST00000302555;ENST00000381362;ENST00000381360;ENST00000341642;ENST00000537520	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.8	5.8	0.92144	Zona pellucida sperm-binding protein (3);	.	.	.	.	D	0.90841	0.7123	M	0.75777	2.31	0.42167	D	0.991625	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.90442	0.4432	9	0.48119	T	0.1	-20.1621	17.5568	0.87892	0.0:1.0:0.0:0.0	.	219;347;366;369	P55259-4;B7Z1G2;P55259-3;P55259	.;.;.;GP2_HUMAN	W	366;369;222;219;347	ENSP00000304044:G366W;ENSP00000370767:G369W;ENSP00000370765:G222W;ENSP00000343861:G219W	ENSP00000304044:G366W	G	-	1	0	GP2	20237165	0.016000	0.18221	0.699000	0.30290	0.036000	0.12997	1.681000	0.37618	2.741000	0.93983	0.650000	0.86243	GGG		0.507	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295		42	146	1	0	3.43241e-23	0.009718	5.68363e-23	42	146				
ACSM5	54988	broad.mit.edu	37	16	20429494	20429494	+	Silent	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr16:20429494G>C	ENST00000331849.4	+	3	465	c.318G>C	c.(316-318)ctG>ctC	p.L106L	ACSM5_ENST00000575584.1_Silent_p.L106L	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	106					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.L106L(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CCAATGTGCTGGGGGGTGCAT	0.617																																							uc002dhe.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(316-318)CTG>CTC		acyl-CoA synthetase medium-chain family member 5							67.0	57.0	60.0					16																	20429494		2203	4300	6503	SO:0001819	synonymous_variant	54988				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20429494G>C		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.318G>C	16.37:g.20429494G>C			Somatic				ACSM5_uc002dhd.1_Silent_p.L106L	p.L106L	NM_017888	NP_060358	WXS	Illumina HiSeq	Unspecified	Q6NUN0	ACSM5_HUMAN			3	465	+			106					Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	ENST00000331849.4	37	c.318G>C	CCDS10585.1																																																																																				0.617	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		9	33	0	0	0	0.006214	0	9	33				
SLC12A3	6559	broad.mit.edu	37	16	56913484	56913484	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr16:56913484C>T	ENST00000563236.1	+	11	1391	c.1366C>T	c.(1366-1368)Ctg>Ttg	p.L456L	SLC12A3_ENST00000438926.2_Silent_p.L456L|SLC12A3_ENST00000262502.5_Silent_p.L455L|SLC12A3_ENST00000566786.1_Silent_p.L455L			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	456					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)	p.L456L(1)		breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CTTCGCGCCCCTGATCACGGC	0.642																																							uc010ccm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)	3						c.(1366-1368)CTG>TTG		solute carrier family 12, member 3 isoform 3	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)						64.0	53.0	57.0					16																	56913484		2198	4300	6498	SO:0001819	synonymous_variant	6559				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity	g.chr16:56913484C>T		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1366C>T	16.37:g.56913484C>T			Somatic				SLC12A3_uc002ekd.3_Silent_p.L456L|SLC12A3_uc010ccn.2_Silent_p.L455L	p.L456L	NM_001126108	NP_001119580	WXS	Illumina HiSeq	Unspecified	P55017	S12A3_HUMAN			11	1395	+			456			Helical; (Potential).		A8MSJ2|C9JNN9	Silent	SNP	ENST00000563236.1	37	c.1366C>T	CCDS58464.1																																																																																				0.642	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1			14	35	0	0	0	0.004007	0	14	35				
GINS2	51659	broad.mit.edu	37	16	85712182	85712182	+	Silent	SNP	A	A	G	rs138755140	byFrequency	TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr16:85712182A>G	ENST00000253462.3	-	4	496	c.396T>C	c.(394-396)gcT>gcC	p.A132A		NM_016095.2	NP_057179.1	Q9Y248	PSF2_HUMAN	GINS complex subunit 2 (Psf2 homolog)	132					DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)	nucleoplasm (GO:0005654)		p.A132A(1)		endometrium(2)|large_intestine(2)|lung(2)	6						CAAAGCTGTCAGCAGACACTC	0.557																																							uc002fja.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(394-396)GCT>GCC		DNA replication complex GINS protein PSF2							125.0	107.0	113.0					16																	85712182		2198	4300	6498	SO:0001819	synonymous_variant	51659				DNA strand elongation involved in DNA replication|S phase of mitotic cell cycle	nucleoplasm	protein binding	g.chr16:85712182A>G	BC003186	CCDS10953.1	16q24.1	2008-02-05			ENSG00000131153	ENSG00000131153			24575	protein-coding gene	gene with protein product		610609				11042152, 10810093	Standard	NM_016095		Approved	PSF2, Pfs2	uc002fja.3	Q9Y248	OTTHUMG00000137646	ENST00000253462.3:c.396T>C	16.37:g.85712182A>G			Somatic					p.A132A	NM_016095	NP_057179	WXS	Illumina HiSeq	Unspecified	Q9Y248	PSF2_HUMAN			4	480	-			132					D3DUM5|Q6IAG9	Silent	SNP	ENST00000253462.3	37	c.396T>C	CCDS10953.1																																																																																				0.557	GINS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269098.1	NM_016095		22	54	0	0	0	0.002299	0	22	54				
OR1A2	26189	broad.mit.edu	37	17	3101096	3101096	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:3101096G>A	ENST00000381951.1	+	1	284	c.284G>A	c.(283-285)gGg>gAg	p.G95E		NM_012352.1	NP_036484.1	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A, member 2	95					positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G95E(1)		breast(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(4)|stomach(2)	18						ATCTCCTTTGGGGGATGCCTA	0.517																																							uc002fvd.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(283-285)GGG>GAG		olfactory receptor, family 1, subfamily A,							148.0	126.0	133.0					17																	3101096		2203	4300	6503	SO:0001583	missense	26189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr17:3101096G>A	AF155225	CCDS11021.1	17p13.3	2012-08-09			ENSG00000172150	ENSG00000172150		"""GPCR / Class A : Olfactory receptors"""	8180	protein-coding gene	gene with protein product						10673334	Standard	NM_012352		Approved	OR17-6	uc002fvd.1	Q9Y585	OTTHUMG00000090638	ENST00000381951.1:c.284G>A	17.37:g.3101096G>A	ENSP00000371377:p.Gly95Glu		Somatic					p.G95E	NM_012352	NP_036484	WXS	Illumina HiSeq	Unspecified	Q9Y585	OR1A2_HUMAN			1	284	+			95			Extracellular (Potential).		Q3KPH3|Q6IFM0|Q6NTD8|Q96R86	Missense_Mutation	SNP	ENST00000381951.1	37	c.284G>A	CCDS11021.1	.	.	.	.	.	.	.	.	.	.	G	1.768	-0.485115	0.04352	.	.	ENSG00000172150	ENST00000381951	T	0.00384	7.6	3.86	1.61	0.23674	GPCR, rhodopsin-like superfamily (1);	0.593009	0.15264	N	0.271630	T	0.00178	0.0005	L	0.28014	0.82	0.09310	N	1	B	0.16603	0.018	B	0.16289	0.015	T	0.36792	-0.9733	10	0.32370	T	0.25	.	2.7153	0.05186	0.1071:0.2836:0.4486:0.1607	.	95	Q9Y585	OR1A2_HUMAN	E	95	ENSP00000371377:G95E	ENSP00000371377:G95E	G	+	2	0	OR1A2	3047846	0.000000	0.05858	0.813000	0.32504	0.069000	0.16628	-1.317000	0.02707	0.955000	0.37878	0.603000	0.83216	GGG		0.517	OR1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207293.1	NM_012352		22	82	0	0	0	0.010504	0	22	82				
OR3A3	8392	broad.mit.edu	37	17	3324736	3324737	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:3324736_3324737CC>AA	ENST00000291231.1	+	1	875_876	c.875_876CC>AA	c.(874-876)cCC>cAA	p.P292Q		NM_012373.2	NP_036505.2	P47888	OR3A3_HUMAN	olfactory receptor, family 3, subfamily A, member 3	292					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P292Q(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)	9						GTGATCAACCCCATGCTGAACC	0.495																																							uc010vrd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(874-876)CCC>CAA		olfactory receptor, family 3, subfamily A,																																				SO:0001583	missense	8392				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr17:3324736_3324737CC>AA	U04688	CCDS11025.1	17p13.3	2012-08-09			ENSG00000159961	ENSG00000159961		"""GPCR / Class A : Olfactory receptors"""	8284	protein-coding gene	gene with protein product				OR3A6, OR3A7, OR3A8P		8004088, 9500546	Standard	NM_012373		Approved	OR17-201, OR17-137, OR17-16	uc010vrd.2	P47888	OTTHUMG00000090649	Exception_encountered	17.37:g.3324736_3324737delinsAA	ENSP00000291231:p.Pro292Gln		Somatic					p.P292Q	NM_012373	NP_036505	WXS	Illumina HiSeq	Unspecified	P47888	OR3A3_HUMAN			1	875_876	+			292			Helical; Name=7; (Potential).		Q2VPE4|Q6IFM6|Q9P1Q4|Q9UBE7	Missense_Mutation	DNP	ENST00000291231.1	37	c.875_876CC>AA	CCDS11025.1																																																																																				0.495	OR3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207309.1			34	65	0	0	0	0.004672	0	34	65				
TP53	7157	broad.mit.edu	37	17	7577609	7577609	+	Splice_Site	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:7577609C>G	ENST00000269305.4	-	7	862		c.e7-1		TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(33)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGAGCCAACCTAGGAGATAA	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		43	Unknown(33)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	p.?(12)|p.0?(7)|p.V225fs*24(1)|p.E224_V225insXX(1)	biliary_tract(9)|lung(9)|central_nervous_system(4)|bone(4)|liver(4)|upper_aerodigestive_tract(3)|breast(3)|oesophagus(2)|ovary(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CS011061	TP53	S		c.e7-1	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							89.0	75.0	80.0					17																	7577609		2203	4300	6503	SO:0001630	splice_region_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577609C>G	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.673-1G>C	17.37:g.7577609C>G		HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Splice_Site_p.V225_splice|TP53_uc002gih.2_Splice_Site_p.V225_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Splice_Site_p.V93_splice|TP53_uc010cng.1_Splice_Site_p.V93_splice|TP53_uc002gii.1_Splice_Site_p.V93_splice|TP53_uc010cnh.1_Splice_Site_p.V225_splice|TP53_uc010cni.1_Splice_Site_p.V225_splice|TP53_uc002gij.2_Splice_Site_p.V225_splice|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron	p.V225_splice	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	867	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)						Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	37	c.673_splice	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	18.73	3.685397	0.68157	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	3.35	3.35	0.38373	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.965	0.58480	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518334	1.000000	0.71417	0.321000	0.25320	0.603000	0.37013	7.494000	0.81503	2.158000	0.67659	0.462000	0.41574	.		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	14	17	0	0	0	0.00245	0	14	17				
SHMT1	6470	broad.mit.edu	37	17	18243507	18243507	+	Missense_Mutation	SNP	C	C	A	rs530339034		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:18243507C>A	ENST00000316694.3	-	7	798	c.664G>T	c.(664-666)Ggg>Tgg	p.G222W	SHMT1_ENST00000354098.3_Missense_Mutation_p.G222W|SHMT1_ENST00000539052.1_Missense_Mutation_p.G84W|SHMT1_ENST00000352886.6_Missense_Mutation_p.G222W	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	222					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	AGATACGCCCCGTTCTCATCT	0.582																																							uc002gta.2		NA																	0				ovary(1)	1						c.(664-666)GGG>TGG		serine hydroxymethyltransferase 1 (soluble)	Glycine(DB00145)|Mimosine(DB01055)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)						123.0	111.0	115.0					17																	18243507		2203	4300	6503	SO:0001583	missense	6470				carnitine biosynthetic process|folic acid metabolic process|L-serine catabolic process|one-carbon metabolic process|purine base biosynthetic process	cytosol|nucleus	glycine hydroxymethyltransferase activity|protein homodimerization activity|pyridoxal phosphate binding	g.chr17:18243507C>A		CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.664G>T	17.37:g.18243507C>A	ENSP00000318868:p.Gly222Trp		Somatic				SHMT1_uc002gsz.2_5'UTR|SHMT1_uc002gtb.2_Missense_Mutation_p.G222W|SHMT1_uc010cqb.2_Missense_Mutation_p.G222W|SHMT1_uc010vxt.1_Missense_Mutation_p.G84W|SHMT1_uc002gtd.1_Missense_Mutation_p.G222W	p.G222W	NM_004169	NP_004160	WXS	Illumina HiSeq	Unspecified	P34896	GLYC_HUMAN			7	854	-			222					B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Missense_Mutation	SNP	ENST00000316694.3	37	c.664G>T	CCDS11196.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.491146	0.64074	.	.	ENSG00000176974	ENST00000316694;ENST00000352886;ENST00000539052;ENST00000354098;ENST00000395685	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.65	4.66	0.58398	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.242989	0.48767	D	0.000175	T	0.74099	0.3672	H	0.98466	4.24	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.997	T	0.78497	-0.2181	10	0.87932	D	0	-31.4814	6.3519	0.21381	0.1478:0.676:0.0:0.1762	.	222;222;222	A8MYA6;P34896-2;P34896	.;.;GLYC_HUMAN	W	222;222;84;222;222	ENSP00000318868:G222W;ENSP00000345881:G222W;ENSP00000440089:G84W;ENSP00000318805:G222W	ENSP00000318868:G222W	G	-	1	0	SHMT1	18184232	0.838000	0.29461	0.484000	0.27391	0.710000	0.40934	2.062000	0.41413	1.475000	0.48197	0.655000	0.94253	GGG		0.582	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2	NM_004169		22	94	1	0	1.64293e-13	0.00333	2.45241e-13	22	94				
LGALS9	3965	broad.mit.edu	37	17	25974363	25974363	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:25974363G>T	ENST00000395473.2	+	10	2294	c.826G>T	c.(826-828)Gct>Tct	p.A276S	LGALS9_ENST00000310394.5_Missense_Mutation_p.A232S|LGALS9_ENST00000302228.5_Missense_Mutation_p.A244S|LGALS9_ENST00000413914.2_Intron|LGALS9_ENST00000313648.6_Intron	NM_009587.2	NP_033665.1	O00182	LEG9_HUMAN	lectin, galactoside-binding, soluble, 9	276	Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|galactose binding (GO:0005534)|signal transducer activity (GO:0004871)	p.A276S(1)		endometrium(3)|large_intestine(2)|lung(12)|skin(1)	18	Lung NSC(42;0.0103)		BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		TGATGAGAATGCTGTGGTCCG	0.572																																					Melanoma(106;677 1527 28724 29571 46552)|Ovarian(193;263 2088 2118 29005 43023)	Melanoma(106;677 1527 28724 29571 46552)|Ovarian(193;263 2088 2118 29005 43023)	uc002gzp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(826-828)GCT>TCT		galectin-9 isoform long							95.0	89.0	91.0					17																	25974363		2203	4300	6503	SO:0001583	missense	3965				positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|extracellular region	galactose binding|signal transducer activity	g.chr17:25974363G>T	AB006782	CCDS11222.1, CCDS32592.1	17q11.2	2013-03-28	2008-07-25		ENSG00000168961	ENSG00000168961		"""Lectins, galactoside-binding"""	6570	protein-coding gene	gene with protein product	"""galectin 9"""	601879				9045665	Standard	NM_009587		Approved	LGALS9A	uc002gzp.3	O00182	OTTHUMG00000179831	ENST00000395473.2:c.826G>T	17.37:g.25974363G>T	ENSP00000378856:p.Ala276Ser		Somatic				LGALS9_uc002gzq.2_Missense_Mutation_p.A244S|LGALS9_uc002gzr.2_Missense_Mutation_p.A187S|LGALS9_uc010waa.1_Intron|LGALS9_uc002gzs.2_Intron	p.A276S	NM_009587	NP_033665	WXS	Illumina HiSeq	Unspecified	O00182	LEG9_HUMAN	BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)	10	944	+	Lung NSC(42;0.0103)		276			Galectin 2.		A7VJG6|O14532|O75028|Q3B8N1|Q53FQ0|Q9NQ58	Missense_Mutation	SNP	ENST00000395473.2	37	c.826G>T	CCDS11222.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195292	0.58017	.	.	ENSG00000168961	ENST00000395473;ENST00000302228;ENST00000310394	T;T;T	0.05513	3.43;3.43;3.43	4.36	-2.64	0.06114	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.649619	0.15031	N	0.284468	T	0.08802	0.0218	L	0.31294	0.92	0.09310	N	1	B;B;B	0.32653	0.379;0.097;0.161	P;P;P	0.54856	0.762;0.512;0.568	T	0.47611	-0.9104	10	0.23302	T	0.38	.	3.3554	0.07167	0.4292:0.0:0.2716:0.2992	.	187;244;276	B4DJD7;Q3B8N1;O00182	.;.;LEG9_HUMAN	S	276;244;232	ENSP00000378856:A276S;ENSP00000306228:A244S;ENSP00000312259:A232S	ENSP00000306228:A244S	A	+	1	0	LGALS9	22998490	0.000000	0.05858	0.000000	0.03702	0.875000	0.50365	-0.214000	0.09292	-0.701000	0.05063	-0.518000	0.04402	GCT		0.572	LGALS9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255583.1	NM_009587		7	53	1	0	0.000157383	0.00308	0.000177817	7	53				
NOS2	4843	broad.mit.edu	37	17	26114746	26114746	+	Missense_Mutation	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:26114746T>A	ENST00000313735.6	-	5	658	c.425A>T	c.(424-426)cAa>cTa	p.Q142L		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	142					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)	p.Q142L(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	TTCGATAGCTTGAGGTAGAAG	0.527																																							uc002gzu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.(424-426)CAA>CTA		nitric oxide synthase 2A	Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)						150.0	154.0	153.0					17																	26114746		2203	4300	6503	SO:0001583	missense	4843				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding	g.chr17:26114746T>A	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.425A>T	17.37:g.26114746T>A	ENSP00000327251:p.Gln142Leu		Somatic				NOS2_uc010crh.1_Missense_Mutation_p.Q142L|NOS2_uc010wab.1_Missense_Mutation_p.Q142L	p.Q142L	NM_000625	NP_000616	WXS	Illumina HiSeq	Unspecified	P35228	NOS2_HUMAN			5	689	-			142					A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	c.425A>T	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	T	16.44	3.124653	0.56613	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.23348	1.91	5.64	5.64	0.86602	Nitric oxide synthase, oxygenase domain (3);	0.133249	0.51477	D	0.000100	T	0.38585	0.1046	L	0.41415	1.275	0.42767	D	0.993828	B;D	0.55385	0.008;0.971	B;D	0.64595	0.028;0.927	T	0.07252	-1.0782	10	0.19147	T	0.46	.	15.0451	0.71822	0.0:0.0:0.0:1.0	.	142;142	F8WEM3;P35228	.;NOS2_HUMAN	L	142	ENSP00000327251:Q142L	ENSP00000305638:Q142L	Q	-	2	0	NOS2	23138873	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.672000	0.61597	2.162000	0.67917	0.455000	0.32223	CAA		0.527	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625		20	169	0	0	0	0.010504	0	20	169				
SLC13A2	9058	broad.mit.edu	37	17	26818601	26818601	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:26818601G>A	ENST00000314669.5	+	5	1141	c.721G>A	c.(721-723)Gca>Aca	p.A241T	SLC13A2_ENST00000537681.1_Missense_Mutation_p.A170T|SLC13A2_ENST00000444914.3_Missense_Mutation_p.A290T|SLC13A2_ENST00000545060.1_Missense_Mutation_p.A198T	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	241					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)	p.A241T(1)|p.A290T(1)|p.A241P(1)|p.A290P(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	GACTGGCACCGCACCCAACCT	0.627																																							uc002hbh.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(721-723)GCA>ACA		solute carrier family 13, member 2 isoform b	Succinic acid(DB00139)						59.0	55.0	56.0					17																	26818601		2203	4300	6503	SO:0001583	missense	9058					integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity	g.chr17:26818601G>A	U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.721G>A	17.37:g.26818601G>A	ENSP00000316202:p.Ala241Thr		Somatic				SLC13A2_uc010wal.1_Missense_Mutation_p.A198T|SLC13A2_uc010wam.1_Missense_Mutation_p.A197T|SLC13A2_uc010wan.1_Missense_Mutation_p.A290T|SLC13A2_uc010wao.1_Missense_Mutation_p.A198T|SLC13A2_uc002hbi.2_Missense_Mutation_p.A170T	p.A241T	NM_003984	NP_003975	WXS	Illumina HiSeq	Unspecified	Q13183	S13A2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	5	788	+	all_lung(13;0.000871)|Lung NSC(42;0.0027)		241			Helical; (Potential).		B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	ENST00000314669.5	37	c.721G>A	CCDS11231.1	.	.	.	.	.	.	.	.	.	.	G	9.517	1.107339	0.20714	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000541739;ENST00000537681	T;T;T;T	0.12147	2.71;2.71;2.71;2.71	5.5	-5.97	0.02227	.	0.295443	0.41605	N	0.000856	T	0.03305	0.0096	N	0.02842	-0.48	0.25655	N	0.986069	B;B;B;B;B	0.09022	0.001;0.002;0.0;0.001;0.0	B;B;B;B;B	0.11329	0.001;0.006;0.002;0.001;0.004	T	0.26950	-1.0088	10	0.25106	T	0.35	-16.872	4.1181	0.10092	0.4445:0.0:0.2456:0.3099	.	198;290;197;170;241	F5GWV6;E7ETH5;B4E1M6;G3V1L2;Q13183	.;.;.;.;S13A2_HUMAN	T	241;290;198;197;170	ENSP00000316202:A241T;ENSP00000392411:A290T;ENSP00000441935:A198T;ENSP00000440802:A170T	ENSP00000316202:A241T	A	+	1	0	SLC13A2	23842728	0.576000	0.26700	0.006000	0.13384	0.633000	0.38033	1.138000	0.31491	-0.913000	0.03832	-0.691000	0.03719	GCA		0.627	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255722.1	NM_003984		11	57	0	0	0	0.001368	0	11	57				
TMIGD1	388364	broad.mit.edu	37	17	28656339	28656339	+	Silent	SNP	G	G	A	rs199924056		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:28656339G>A	ENST00000328886.4	-	3	363	c.291C>T	c.(289-291)aaC>aaT	p.N97N	TMIGD1_ENST00000538566.2_Silent_p.N97N	NM_206832.1	NP_996663.1	Q6UXZ0	TMIG1_HUMAN	transmembrane and immunoglobulin domain containing 1	97	Ig-like C2-type 1.					integral component of membrane (GO:0016021)		p.N97N(1)		breast(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	12						AGCTGATTCCGTTGTCATTTT	0.488																																							uc002hfa.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(289-291)AAC>AAT		transmembrane and immunoglobulin domain							134.0	112.0	119.0					17																	28656339		2203	4300	6503	SO:0001819	synonymous_variant	388364					integral to membrane		g.chr17:28656339G>A	AY358153	CCDS32605.1	17q11.2	2013-01-29	2006-07-05	2006-07-05		ENSG00000182271		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32431	protein-coding gene	gene with protein product				TMIGD		12975309	Standard	NM_206832		Approved	UNQ9372	uc002hfa.1	Q6UXZ0		ENST00000328886.4:c.291C>T	17.37:g.28656339G>A			Somatic				TMIGD1_uc010csh.1_Silent_p.N97N	p.N97N	NM_206832	NP_996663	WXS	Illumina HiSeq	Unspecified	Q6UXZ0	TMIG1_HUMAN			3	364	-			97			Extracellular (Potential).|Ig-like C2-type 1.		A8K2K1|Q6ZMC6	Silent	SNP	ENST00000328886.4	37	c.291C>T	CCDS32605.1																																																																																				0.488	TMIGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447955.1	NM_206832		12	76	0	0	0	0.001368	0	12	76				
KRTAP4-9	100132386	broad.mit.edu	37	17	39261693	39261693	+	Missense_Mutation	SNP	A	A	T	rs113059833		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:39261693A>T	ENST00000391415.1	+	1	110	c.53A>T	c.(52-54)gAc>gTc	p.D18V		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	18					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.D18V(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						TGCGGCCAAGACCTCTGTCAG	0.627																																							uc010wfp.1		NA																	1	Substitution - Missense(1)		endometrium(1)		0						c.(52-54)GAC>GTC		keratin associated protein 4-9							18.0	22.0	21.0					17																	39261693		692	1590	2282	SO:0001583	missense	100132386					keratin filament		g.chr17:39261693A>T	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.53A>T	17.37:g.39261693A>T	ENSP00000375234:p.Asp18Val		Somatic					p.D18V	NM_001146041	NP_001139513	WXS	Illumina HiSeq	Unspecified	Q9BYQ8	KRA49_HUMAN			1	53	+			18						Missense_Mutation	SNP	ENST00000391415.1	37	c.53A>T	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	6.082	0.383461	0.11524	.	.	ENSG00000212722	ENST00000391415;ENST00000333994	T	0.32272	1.46	2.51	0.174	0.15040	.	.	.	.	.	T	0.25865	0.0630	M	0.64404	1.975	0.30580	P	0.762648	B	0.17852	0.024	B	0.14023	0.01	T	0.23154	-1.0196	8	0.45353	T	0.12	.	3.5681	0.07907	0.2702:0.2037:0.5261:0.0	.	18	Q9BYQ8	KRA49_HUMAN	V	18	ENSP00000375234:D18V	ENSP00000334461:D18V	D	+	2	0	KRTAP4-9	36515219	0.000000	0.05858	0.388000	0.26195	0.320000	0.28249	0.098000	0.15189	-0.245000	0.09625	0.155000	0.16302	GAC		0.627	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041		5	25	0	0	0	0.000602	0	5	25				
KRT14	3861	broad.mit.edu	37	17	39739908	39739908	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:39739908C>T	ENST00000167586.6	-	5	1034	c.948G>A	c.(946-948)gaG>gaA	p.E316E		NM_000526.4	NP_000517	P02533	K1C14_HUMAN	keratin 14	316	Coil 2.|Rod.				aging (GO:0007568)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|hair cycle (GO:0042633)|hemidesmosome assembly (GO:0031581)|intermediate filament bundle assembly (GO:0045110)|response to ionizing radiation (GO:0010212)|response to zinc ion (GO:0010043)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	keratin filament binding (GO:1990254)|structural constituent of cytoskeleton (GO:0005200)	p.E316E(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|lung(7)|ovary(1)|prostate(5)|skin(1)|stomach(1)	25		Breast(137;0.000307)				TGGTGGCCACCTCGCGGTTCA	0.587																																							uc002hxf.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(946-948)GAG>GAA		keratin 14							102.0	101.0	101.0					17																	39739908		2203	4300	6503	SO:0001819	synonymous_variant	3861				epidermis development|hemidesmosome assembly|intermediate filament bundle assembly	cytosol|keratin filament|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton	g.chr17:39739908C>T	BC002690	CCDS11400.1	17q21.2	2013-06-20	2008-09-19		ENSG00000186847	ENSG00000186847		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6416	protein-coding gene	gene with protein product	"""epidermolysis bullosa simplex, Dowling-Meara, Koebner"""	148066	"""keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)"""	EBS3, EBS4		1717157, 16831889	Standard	NM_000526		Approved		uc002hxf.2	P02533	OTTHUMG00000133426	ENST00000167586.6:c.948G>A	17.37:g.39739908C>T			Somatic				JUP_uc010wfs.1_Intron|KRT14_uc010cxp.1_Silent_p.E316E	p.E316E	NM_000526	NP_000517	WXS	Illumina HiSeq	Unspecified	P02533	K1C14_HUMAN			5	1009	-		Breast(137;0.000307)	316			Rod.|Coil 2.		Q14715|Q53XY3|Q9BUE3|Q9UBN2|Q9UBN3|Q9UCY4	Silent	SNP	ENST00000167586.6	37	c.948G>A	CCDS11400.1																																																																																				0.587	KRT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257289.1	NM_000526		23	102	0	0	0	0.003954	0	23	102				
WNK4	65266	broad.mit.edu	37	17	40933017	40933017	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:40933017A>G	ENST00000246914.5	+	1	322	c.301A>G	c.(301-303)Agc>Ggc	p.S101G		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	101					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)	p.S89G(1)|p.S101G(1)		NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CCCACCGCCTAGCTCCAAAGA	0.726																																					Esophageal Squamous(6;201 374 4964 23855 42828)	Esophageal Squamous(6;201 374 4964 23855 42828)	uc002ibj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(3)|stomach(1)	7						c.(301-303)AGC>GGC		WNK lysine deficient protein kinase 4							10.0	13.0	12.0					17																	40933017		2179	4272	6451	SO:0001583	missense	65266				intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity	g.chr17:40933017A>G	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.301A>G	17.37:g.40933017A>G	ENSP00000246914:p.Ser101Gly		Somatic				WNK4_uc010wgx.1_5'UTR|WNK4_uc002ibk.1_5'Flank	p.S101G	NM_032387	NP_115763	WXS	Illumina HiSeq	Unspecified	Q96J92	WNK4_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0749)	1	322	+		Breast(137;0.000143)	101					B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	ENST00000246914.5	37	c.301A>G	CCDS11439.1	.	.	.	.	.	.	.	.	.	.	A	11.69	1.714561	0.30413	.	.	ENSG00000126562	ENST00000246914	T	0.71698	-0.59	5.37	-1.35	0.09114	.	0.336750	0.25720	N	0.028748	T	0.48732	0.1516	L	0.32530	0.975	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25847	-1.0120	10	0.45353	T	0.12	-0.9007	1.2256	0.01932	0.5017:0.1266:0.1263:0.2454	.	101	Q96J92	WNK4_HUMAN	G	101	ENSP00000246914:S101G	ENSP00000246914:S101G	S	+	1	0	WNK4	38186543	0.000000	0.05858	0.000000	0.03702	0.171000	0.22731	-1.213000	0.02991	-0.218000	0.10018	0.460000	0.39030	AGC		0.726	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1			7	18	0	0	0	0.00308	0	7	18				
BRCA1	672	broad.mit.edu	37	17	41251814	41251814	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:41251814C>A	ENST00000357654.3	-	7	643	c.525G>T	c.(523-525)aaG>aaT	p.K175N	BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_5'UTR|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000352993.3_Missense_Mutation_p.K175N|BRCA1_ENST00000468300.1_Missense_Mutation_p.K175N|BRCA1_ENST00000354071.3_Missense_Mutation_p.K175N|BRCA1_ENST00000493795.1_Missense_Mutation_p.K128N|BRCA1_ENST00000491747.2_Missense_Mutation_p.K175N|BRCA1_ENST00000346315.3_Missense_Mutation_p.K175N|BRCA1_ENST00000471181.2_Missense_Mutation_p.K175N|BRCA1_ENST00000351666.3_Missense_Mutation_p.K175N	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	175					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K175N(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AGACAGACGTCTTTTGAGGTT	0.383			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													uc002icq.2		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	D|Mis|N|F|S	familial breast/ovarian cancer gene 1			E		breast|ovarian	ovarian		1	Substitution - Missense(1)		lung(1)	ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52						c.(523-525)AAG>AAT	Homologous_recombination	breast cancer 1, early onset isoform 1							164.0	157.0	159.0					17																	41251814		2203	4300	6503	SO:0001583	missense	672	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	Familial Cancer Database		androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr17:41251814C>A	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.525G>T	17.37:g.41251814C>A	ENSP00000350283:p.Lys175Asn	TCGA Ovarian(2;0.000030)	Somatic				BRCA1_uc010whp.1_Missense_Mutation_p.K128N|BRCA1_uc010whl.1_Missense_Mutation_p.K175N|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.K104N|BRCA1_uc002icu.2_Missense_Mutation_p.K175N|BRCA1_uc010cyx.2_Missense_Mutation_p.K128N|BRCA1_uc002ict.2_Missense_Mutation_p.K175N|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Missense_Mutation_p.K48N|BRCA1_uc002idc.1_Missense_Mutation_p.K174N|BRCA1_uc010whr.1_Missense_Mutation_p.K128N|BRCA1_uc002idd.2_Missense_Mutation_p.K175N|BRCA1_uc002ide.1_Missense_Mutation_p.K47N|BRCA1_uc010cyy.1_Missense_Mutation_p.K175N|BRCA1_uc010whs.1_Missense_Mutation_p.K175N|BRCA1_uc010cyz.2_Missense_Mutation_p.K128N|BRCA1_uc010cza.2_Missense_Mutation_p.K149N|BRCA1_uc010wht.1_Intron	p.K175N	NM_007294	NP_009225	WXS	Illumina HiSeq	Unspecified	P38398	BRCA1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.126)	7	757	-		Breast(137;0.000717)	175					O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	c.525G>T	CCDS11453.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.193|0.193	-1.051186|-1.051186	0.01981|0.01981	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825;ENST00000470026;ENST00000477152;ENST00000494123;ENST00000476777|ENST00000473961	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.96587|.	-2.06;-2.19;-2.15;-2.18;-2.32;-2.02;-2.44;-2.06;-2.18;-1.9;-1.68;-2.08;-1.57;-2.66;-4.06;-2.34;-1.96|.	5.16|5.16	-3.44|-3.44	0.04796|0.04796	.|.	0.670334|.	0.14402|.	N|.	0.321858|.	T|T	0.07818|0.07818	0.0196|0.0196	N|N	0.00368|0.00368	-1.59|-1.59	0.36378|0.36378	D|D	0.861717|0.861717	B;B;B;B;B;B;B;B;B;B;B|.	0.18013|.	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.025;0.0;0.0;0.0|.	B;B;B;B;B;B;B;B;B;B;B|.	0.15052|.	0.001;0.001;0.001;0.0;0.0;0.0;0.002;0.012;0.001;0.0;0.0|.	T|T	0.31081|0.31081	-0.9956|-0.9956	10|5	0.06365|.	T|.	0.9|.	.|.	1.5722|1.5722	0.02617|0.02617	0.274:0.2683:0.0792:0.3785|0.274:0.2683:0.0792:0.3785	.|.	174;128;174;175;175;175;175;175;175;175;175|.	E7EUM2;B4DES0;E7ETR2;E7EMP0;E7ERL4;Q5YLB2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2|.	.;.;.;.;.;.;.;.;.;BRCA1_HUMAN;.|.	N|I	175;175;175;175;175;175;175;128;175;128;174;174;90;128;91;175;149;175;174|82	ENSP00000350283:K175N;ENSP00000326002:K175N;ENSP00000312236:K175N;ENSP00000246907:K175N;ENSP00000338007:K175N;ENSP00000417148:K175N;ENSP00000377294:K128N;ENSP00000418960:K175N;ENSP00000418775:K128N;ENSP00000420412:K174N;ENSP00000419481:K90N;ENSP00000418819:K128N;ENSP00000418212:K91N;ENSP00000419274:K175N;ENSP00000419988:K149N;ENSP00000419103:K175N;ENSP00000417554:K174N|.	ENSP00000246907:K175N|.	K|R	-|-	3|2	2|0	BRCA1|BRCA1	38505340|38505340	0.870000|0.870000	0.30015|0.30015	0.158000|0.158000	0.22627|0.22627	0.420000|0.420000	0.31355|0.31355	-0.318000|-0.318000	0.08050|0.08050	-0.765000|-0.765000	0.04645|0.04645	-0.362000|-0.362000	0.07510|0.07510	AAG|AGA		0.383	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		31	173	1	0	6.53348e-20	0.003755	1.04792e-19	31	173				
KIF2B	84643	broad.mit.edu	37	17	51901824	51901824	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:51901824C>T	ENST00000268919.4	+	1	1586	c.1430C>T	c.(1429-1431)gCc>gTc	p.A477V		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	477	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A477V(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AGTCTTCTAGCCCTCAAAGAA	0.512																																							uc002iua.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)	8						c.(1429-1431)GCC>GTC		kinesin family member 2B							47.0	43.0	44.0					17																	51901824		2203	4300	6503	SO:0001583	missense	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51901824C>T	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1430C>T	17.37:g.51901824C>T	ENSP00000268919:p.Ala477Val		Somatic				uc010wna.1_RNA	p.A477V	NM_032559	NP_115948	WXS	Illumina HiSeq	Unspecified	Q8N4N8	KIF2B_HUMAN			1	1586	+			477					Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	c.1430C>T	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.254590	0.59212	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.76709	-1.04	5.73	5.73	0.89815	Kinesin, motor domain (3);	0.000000	0.44688	D	0.000437	D	0.87152	0.6106	M	0.75884	2.315	0.29648	N	0.844161	D	0.60575	0.988	P	0.61722	0.893	D	0.83960	0.0321	10	0.62326	D	0.03	.	19.2577	0.93952	0.0:1.0:0.0:0.0	.	477	Q8N4N8	KIF2B_HUMAN	V	477;365	ENSP00000268919:A477V	ENSP00000268919:A477V	A	+	2	0	KIF2B	49256823	1.000000	0.71417	0.144000	0.22314	0.945000	0.59286	4.857000	0.62939	2.854000	0.98071	0.655000	0.94253	GCC		0.512	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		7	37	0	0	0	0.001984	0	7	37				
TBC1D3P2	440452	broad.mit.edu	37	17	60351180	60351180	+	3'UTR	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:60351180G>T	ENST00000602932.1	-	0	349				TBC1D3P2_ENST00000581291.1_RNA																							AGTGATCGATGTTGTTGTTGT	0.557																																							uc002izq.2		NA																	0					0						c.(133-135)AAC>AAA		SubName: Full=Putative uncharacterized protein TBC1D3E;																																				SO:0001624	3_prime_UTR_variant	440452							g.chr17:60351180G>T																												ENST00000602932.1:c.*109C>A	17.37:g.60351180G>T			Somatic				TBC1D3P2_uc010woz.1_RNA	p.N45K			WXS	Illumina HiSeq	Unspecified					3	247	-									Missense_Mutation	SNP	ENST00000602932.1	37	c.135C>A		.	.	.	.	.	.	.	.	.	.	.	0.742	-0.776003	0.02951	.	.	ENSG00000188755	ENST00000339120	.	.	.	.	.	.	.	.	.	.	.	T	0.35219	0.0924	.	.	.	.	.	.	B	0.28178	0.202	B	0.35550	0.205	T	0.41787	-0.9489	4	0.29301	T	0.29	.	.	.	.	.	45	F8WD16	.	K	45	.	ENSP00000339793:N45K	N	-	3	2	AC053481.1	57705962	0.022000	0.18835	0.020000	0.16555	0.020000	0.10135	-0.014000	0.12656	0.064000	0.16427	0.064000	0.15345	AAC		0.557	RP11-51L5.7-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000467667.1			39	133	1	0	3.61848e-18	0.007835	5.73627e-18	39	133				
TBC1D16	125058	broad.mit.edu	37	17	77987181	77987181	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:77987181C>A	ENST00000310924.2	-	2	281	c.166G>T	c.(166-168)Ggg>Tgg	p.G56W		NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	56							Rab GTPase activator activity (GO:0005097)	p.G56W(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			TGGTGCTCCCCCAGCCCCTGC	0.667																																					Ovarian(14;397 562 4850 31922 49378)	Ovarian(14;397 562 4850 31922 49378)	uc002jxj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(166-168)GGG>TGG		TBC1 domain family, member 16							10.0	12.0	11.0					17																	77987181		2195	4292	6487	SO:0001583	missense	125058					intracellular	Rab GTPase activator activity	g.chr17:77987181C>A	AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.166G>T	17.37:g.77987181C>A	ENSP00000309794:p.Gly56Trp		Somatic					p.G56W	NM_019020	NP_061893	WXS	Illumina HiSeq	Unspecified	Q8TBP0	TBC16_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)		2	282	-	all_neural(118;0.167)		56					B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Missense_Mutation	SNP	ENST00000310924.2	37	c.166G>T	CCDS11766.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.545393	0.65198	.	.	ENSG00000167291	ENST00000310924	T	0.08720	3.06	4.89	4.89	0.63831	.	0.084376	0.47093	U	0.000257	T	0.23492	0.0568	L	0.56769	1.78	0.80722	D	1	D	0.64830	0.994	P	0.60117	0.869	T	0.00605	-1.1648	10	0.54805	T	0.06	-46.4832	18.038	0.89311	0.0:1.0:0.0:0.0	.	56	Q8TBP0	TBC16_HUMAN	W	56	ENSP00000309794:G56W	ENSP00000309794:G56W	G	-	1	0	TBC1D16	75601776	0.981000	0.34729	0.999000	0.59377	0.988000	0.76386	3.625000	0.54238	2.233000	0.73108	0.585000	0.79938	GGG		0.667	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437145.1	NM_019020		3	20	1	0	2.56e-06	0.009096	3.1922e-06	3	20				
ANKRD30B	374860	broad.mit.edu	37	18	14852116	14852116	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr18:14852116G>T	ENST00000358984.4	+	36	3996	c.3816G>T	c.(3814-3816)caG>caT	p.Q1272H		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1272								p.Q1272H(1)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GTGAAACACAGTGTCAAATGA	0.368																																							uc010dlo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(3814-3816)CAG>CAT		ankyrin repeat domain 30B							35.0	28.0	30.0					18																	14852116		692	1591	2283	SO:0001583	missense	374860							g.chr18:14852116G>T	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3816G>T	18.37:g.14852116G>T	ENSP00000351875:p.Gln1272His		Somatic				ANKRD30B_uc010xal.1_Missense_Mutation_p.Q414H	p.Q1272H	NM_001145029	NP_001138501	WXS	Illumina HiSeq	Unspecified	Q9BXX2	AN30B_HUMAN			36	3996	+			1357			Potential.		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.3816G>T	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	G	5.248	0.231175	0.09969	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.18174	2.23	1.39	0.463	0.16700	.	.	.	.	.	T	0.18002	0.0432	M	0.69823	2.125	0.30247	N	0.794488	D;D	0.58268	0.969;0.982	B;P	0.44518	0.265;0.452	T	0.26292	-1.0107	9	0.66056	D	0.02	.	1.984	0.03433	0.2158:0.0:0.4681:0.3161	.	1357;1272	Q9BXX2;F8WAG3	AN30B_HUMAN;.	H	1272;666;692	ENSP00000351875:Q1272H	ENSP00000277669:Q692H	Q	+	3	2	ANKRD30B	14842116	0.973000	0.33851	0.201000	0.23476	0.219000	0.24729	0.361000	0.20267	0.147000	0.19030	0.173000	0.16961	CAG		0.368	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		6	20	1	0	0.00198382	0.001984	0.00214651	6	20				
ASXL3	80816	broad.mit.edu	37	18	31323961	31323961	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr18:31323961C>T	ENST00000269197.5	+	12	4149	c.4149C>T	c.(4147-4149)gcC>gcT	p.A1383A		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1383					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A1383A(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AAGAACAGGCCACTGTATCCA	0.507											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010dmg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(4147-4149)GCC>GCT		additional sex combs like 3							96.0	99.0	98.0					18																	31323961		1992	4162	6154	SO:0001819	synonymous_variant	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31323961C>T	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4149C>T	18.37:g.31323961C>T			Somatic	OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	823	ASXL3_uc002kxq.2_Silent_p.A1090A	p.A1383A	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	4204	+			1383					Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	ENST00000269197.5	37	c.4149C>T	CCDS45847.1																																																																																				0.507	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			10	71	0	0	0	0.000978	0	10	71				
FHOD3	80206	broad.mit.edu	37	18	34310681	34310681	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr18:34310681G>T	ENST00000359247.4	+	16	2914	c.2914G>T	c.(2914-2916)Ggt>Tgt	p.G972C	FHOD3_ENST00000257209.4_Missense_Mutation_p.G989C|FHOD3_ENST00000591635.1_Missense_Mutation_p.G185C|FHOD3_ENST00000445677.1_Missense_Mutation_p.G951C|FHOD3_ENST00000590592.1_Missense_Mutation_p.G1164C|FHOD3_ENST00000592128.1_5'UTR	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	972	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.G989C(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CATCAATATTGGTCTGACGGT	0.428																																							uc002kzt.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|large_intestine(2)|breast(2)|ovary(1)	8						c.(2914-2916)GGT>TGT		formin homology 2 domain containing 3							136.0	122.0	127.0					18																	34310681		2203	4300	6503	SO:0001583	missense	80206				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr18:34310681G>T	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2914G>T	18.37:g.34310681G>T	ENSP00000352186:p.Gly972Cys		Somatic				FHOD3_uc002kzs.1_Missense_Mutation_p.G989C|FHOD3_uc010dmz.1_Missense_Mutation_p.G704C|FHOD3_uc010dnb.1_5'UTR	p.G972C	NM_025135	NP_079411	WXS	Illumina HiSeq	Unspecified	Q2V2M9	FHOD3_HUMAN			16	3011	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	972			FH2.		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37	c.2914G>T		.	.	.	.	.	.	.	.	.	.	G	23.5	4.424074	0.83667	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.17213	2.29;2.29;2.29	5.33	5.33	0.75918	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.47414	0.1444	M	0.83483	2.645	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.855	D;D;P	0.97110	1.0;1.0;0.804	T	0.51655	-0.8678	10	0.66056	D	0.02	.	17.6127	0.88059	0.0:0.0:1.0:0.0	.	951;972;989	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	C	989;972;951	ENSP00000257209:G989C;ENSP00000352186:G972C;ENSP00000411430:G951C	ENSP00000257209:G989C	G	+	1	0	FHOD3	32564679	1.000000	0.71417	0.445000	0.26908	0.990000	0.78478	9.756000	0.98918	2.479000	0.83701	0.557000	0.71058	GGT		0.428	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		14	87	1	0	3.27435e-08	0.00245	4.30614e-08	14	87				
LRRC8E	80131	broad.mit.edu	37	19	7965609	7965609	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:7965609G>A	ENST00000306708.6	+	3	2303	c.2202G>A	c.(2200-2202)ctG>ctA	p.L734L	AC010336.1_ENST00000539278.1_5'UTR|RN7SL115P_ENST00000392196.5_RNA	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	734					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L734L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						ACAACCAGCTGAGCCAGCTCT	0.632																																							uc002mir.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|pancreas(1)	2						c.(2200-2202)CTG>CTA		leucine rich repeat containing 8 family, member							52.0	49.0	50.0					19																	7965609		2203	4300	6503	SO:0001819	synonymous_variant	80131					integral to membrane		g.chr19:7965609G>A		CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.2202G>A	19.37:g.7965609G>A			Somatic					p.L734L	NM_025061	NP_079337	WXS	Illumina HiSeq	Unspecified	Q6NSJ5	LRC8E_HUMAN			3	2303	+			734			LRR 10.		B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Silent	SNP	ENST00000306708.6	37	c.2202G>A	CCDS12189.1																																																																																				0.632	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061		8	51	0	0	0	0.004482	0	8	51				
MUC16	94025	broad.mit.edu	37	19	9048033	9048033	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:9048033C>A	ENST00000397910.4	-	5	33801	c.33598G>T	c.(33598-33600)Gtc>Ttc	p.V11200F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11202	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.V6833F(1)|p.V11200F(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTAGGGGAGACAGCTAAAGTT	0.453																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(33598-33600)GTC>TTC		mucin 16							60.0	53.0	55.0					19																	9048033		1955	4154	6109	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9048033C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33598G>T	19.37:g.9048033C>A	ENSP00000381008:p.Val11200Phe		Somatic					p.V11200F	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			5	33802	-			11202			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.33598G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	9.543	1.114000	0.20795	.	.	ENSG00000181143	ENST00000397910	T	0.02837	4.14	2.54	0.239	0.15484	.	.	.	.	.	T	0.03390	0.0098	L	0.47716	1.5	.	.	.	B	0.31383	0.321	B	0.36335	0.222	T	0.35699	-0.9778	8	0.87932	D	0	.	2.7023	0.05152	0.2788:0.5495:0.0:0.1717	.	11200	B5ME49	.	F	11200	ENSP00000381008:V11200F	ENSP00000381008:V11200F	V	-	1	0	MUC16	8909033	0.000000	0.05858	0.001000	0.08648	0.570000	0.35934	-0.545000	0.06069	0.113000	0.18004	0.306000	0.20318	GTC		0.453	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		9	14	1	0	1.12685e-05	0.004482	1.35554e-05	9	14				
MUC16	94025	broad.mit.edu	37	19	9087382	9087382	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:9087382C>T	ENST00000397910.4	-	1	4636	c.4433G>A	c.(4432-4434)aGt>aAt	p.S1478N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1478	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S1478N(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGAACTTGGACTTGAAATATC	0.448																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(4432-4434)AGT>AAT		mucin 16							153.0	149.0	150.0					19																	9087382		1942	4140	6082	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9087382C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4433G>A	19.37:g.9087382C>T	ENSP00000381008:p.Ser1478Asn		Somatic					p.S1478N	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	4637	-			1478			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.4433G>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	4.036	0.004306	0.07866	.	.	ENSG00000181143	ENST00000397910	T	0.02656	4.21	1.01	-0.131	0.13494	.	.	.	.	.	T	0.01661	0.0053	N	0.08118	0	.	.	.	B	0.22800	0.075	B	0.24974	0.057	T	0.43065	-0.9414	8	0.87932	D	0	.	3.4351	0.07442	0.0:0.7056:0.0:0.2944	.	1478	B5ME49	.	N	1478	ENSP00000381008:S1478N	ENSP00000381008:S1478N	S	-	2	0	MUC16	8948382	0.003000	0.15002	0.071000	0.20095	0.293000	0.27360	-0.100000	0.10990	0.002000	0.14630	0.313000	0.20887	AGT		0.448	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		31	155	0	0	0	0.009535	0	31	155				
ZNF439	90594	broad.mit.edu	37	19	11978562	11978562	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:11978562C>T	ENST00000304030.2	+	3	878	c.678C>T	c.(676-678)ctC>ctT	p.L226L	ZNF439_ENST00000592534.1_Intron|ZNF439_ENST00000455282.1_Silent_p.L90L	NM_152262.2	NP_689475.1	Q8NDP4	ZN439_HUMAN	zinc finger protein 439	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L226L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(7)|pancreas(1)|skin(2)	27						TCCATTGTCTCAGTTTATATC	0.358																																							uc002mss.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(676-678)CTC>CTT		zinc finger protein 439							115.0	112.0	113.0					19																	11978562		2203	4300	6503	SO:0001819	synonymous_variant	90594				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:11978562C>T	AL833935	CCDS12268.1	19p13.13	2013-01-08			ENSG00000171291	ENSG00000171291		"""Zinc fingers, C2H2-type"", ""-"""	20873	protein-coding gene	gene with protein product							Standard	NM_152262		Approved	DKFZp571K0837	uc002mss.3	Q8NDP4	OTTHUMG00000156527	ENST00000304030.2:c.678C>T	19.37:g.11978562C>T			Somatic				ZNF439_uc002msr.2_Silent_p.L90L	p.L226L	NM_152262	NP_689475	WXS	Illumina HiSeq	Unspecified	Q8NDP4	ZN439_HUMAN			3	806	+			226			C2H2-type 2.		Q8IYZ7|Q96SU1	Silent	SNP	ENST00000304030.2	37	c.678C>T	CCDS12268.1																																																																																				0.358	ZNF439-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344513.1			23	116	0	0	0	0.002299	0	23	116				
ZNF492	57615	broad.mit.edu	37	19	22847981	22847981	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:22847981C>T	ENST00000456783.2	+	4	1754	c.1510C>T	c.(1510-1512)Ctc>Ttc	p.L504F	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L504F(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				TGGAGAGAAACTCTACAAACC	0.343																																							uc002nqw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1510-1512)CTC>TTC		zinc finger protein 492							13.0	16.0	15.0					19																	22847981		1840	4127	5967	SO:0001583	missense	57615				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22847981C>T	AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.1510C>T	19.37:g.22847981C>T	ENSP00000413660:p.Leu504Phe		Somatic					p.L504F	NM_020855	NP_065906	WXS	Illumina HiSeq	Unspecified	Q9P255	ZN492_HUMAN			4	1754	+		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)	504					Q08EI7|Q08EI8	Missense_Mutation	SNP	ENST00000456783.2	37	c.1510C>T	CCDS46032.1	.	.	.	.	.	.	.	.	.	.	.	4.618	0.114894	0.08831	.	.	ENSG00000229676	ENST00000456783	T	0.15952	2.38	1.06	-0.707	0.11245	Zinc finger, C2H2 (1);	.	.	.	.	T	0.13114	0.0318	L	0.43757	1.38	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31024	-0.9958	9	0.72032	D	0.01	.	5.278	0.15661	0.0:0.743:0.0:0.257	.	504	Q9P255	ZN492_HUMAN	F	504	ENSP00000413660:L504F	ENSP00000413660:L504F	L	+	1	0	ZNF492	22639821	0.598000	0.26882	0.577000	0.28562	0.645000	0.38454	1.610000	0.36869	0.149000	0.19098	0.152000	0.16155	CTC		0.343	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464581.1	NM_020855		8	10	0	0	0	0.000978	0	8	10				
NFKBID	84807	broad.mit.edu	37	19	36380905	36380905	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:36380905C>A	ENST00000396901.1	-	11	1348	c.775G>T	c.(775-777)Gcc>Tcc	p.A259S	NFKBID_ENST00000340950.2_Missense_Mutation_p.A96S|NFKBID_ENST00000606253.1_Missense_Mutation_p.A259S|NFKBID_ENST00000352614.2_Missense_Mutation_p.A411S	NM_139239.1	NP_640332.1	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta	259					inflammatory response (GO:0006954)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|positive regulation of thymocyte apoptotic process (GO:0070245)	nucleus (GO:0005634)		p.A259S(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	14						GCCTCCTGGGCCGGCCCAGGG	0.706																																							uc002oci.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(775-777)GCC>TCC		nuclear factor of kappa light polypeptide gene							13.0	17.0	16.0					19																	36380905		1882	4081	5963	SO:0001583	missense	84807				inflammatory response	nucleus		g.chr19:36380905C>A	AF385434	CCDS42552.1	19q13.12	2013-01-10				ENSG00000167604		"""Ankyrin repeat domain containing"""	15671	protein-coding gene	gene with protein product						12477932	Standard	NM_139239		Approved	TA-NFKBH, IkappaBNS	uc002oci.1	Q8NI38		ENST00000396901.1:c.775G>T	19.37:g.36380905C>A	ENSP00000380109:p.Ala259Ser		Somatic				NFKBID_uc002och.1_Missense_Mutation_p.A96S|NFKBID_uc002ocj.1_Missense_Mutation_p.A274S	p.A259S	NM_139239	NP_640332	WXS	Illumina HiSeq	Unspecified	Q8NI38	IKBD_HUMAN			11	1349	-			259			ANK 6.		Q8NI39|Q9BRG9	Missense_Mutation	SNP	ENST00000396901.1	37	c.775G>T	CCDS42552.1	.	.	.	.	.	.	.	.	.	.	C	6.530	0.466046	0.12402	.	.	ENSG00000167604	ENST00000352614;ENST00000396901;ENST00000340950	T;T;T	0.64085	-0.08;-0.08;-0.08	3.82	0.142	0.14816	Ankyrin repeat-containing domain (4);	0.517311	0.19387	N	0.115507	T	0.31358	0.0794	N	0.12527	0.23	0.09310	N	1	B;B;B	0.15719	0.001;0.001;0.014	B;B;B	0.09377	0.002;0.002;0.004	T	0.12116	-1.0560	10	0.09084	T	0.74	.	2.8929	0.05681	0.1062:0.3882:0.3403:0.1653	.	411;259;96	Q8NI38-2;Q8NI38;Q8NI38-3	.;IKBD_HUMAN;.	S	411;259;96	ENSP00000252985:A411S;ENSP00000380109:A259S;ENSP00000343093:A96S	ENSP00000343093:A96S	A	-	1	0	NFKBID	41072745	0.004000	0.15560	0.322000	0.25334	0.518000	0.34316	-0.082000	0.11304	0.030000	0.15379	0.313000	0.20887	GCC		0.706	NFKBID-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452927.3	NM_032721		7	17	1	0	2.0095e-06	0.001984	2.53668e-06	7	17				
SUPT5H	6829	broad.mit.edu	37	19	39959770	39959770	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:39959770C>T	ENST00000599117.1	+	16	1562	c.1195C>T	c.(1195-1197)Cag>Tag	p.Q399*	SUPT5H_ENST00000402194.2_Nonsense_Mutation_p.Q395*|SUPT5H_ENST00000359191.6_Nonsense_Mutation_p.Q395*|SUPT5H_ENST00000432763.2_Nonsense_Mutation_p.Q399*|SUPT5H_ENST00000598725.1_Nonsense_Mutation_p.Q399*			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	399	Interaction with RNA polymerase II.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.Q399*(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GTTTGAGGACCAGCCAGAGGG	0.577																																							uc002olo.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(1195-1197)CAG>TAG		suppressor of Ty 5 homolog isoform a							77.0	81.0	80.0					19																	39959770		2203	4300	6503	SO:0001587	stop_gained	6829				cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity	g.chr19:39959770C>T	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1195C>T	19.37:g.39959770C>T	ENSP00000470252:p.Gln399*		Somatic				SUPT5H_uc002olp.3_Nonsense_Mutation_p.Q399*|SUPT5H_uc002olq.3_Nonsense_Mutation_p.Q395*|SUPT5H_uc002oln.3_Nonsense_Mutation_p.Q399*|SUPT5H_uc002olr.3_Nonsense_Mutation_p.Q399*|SUPT5H_uc002ols.1_Nonsense_Mutation_p.Q22*|SUPT5H_uc010egp.1_5'Flank	p.Q399*	NM_001111020	NP_001104490	WXS	Illumina HiSeq	Unspecified	O00267	SPT5H_HUMAN	Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)		15	1374	+	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		399			Interaction with RNA polymerase II.		O43279|Q59G52|Q99639	Nonsense_Mutation	SNP	ENST00000599117.1	37	c.1195C>T	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	C	40	8.439196	0.98813	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-19.6557	18.5483	0.91055	0.0:1.0:0.0:0.0	.	.	.	.	X	399;395;377;399	.	.	Q	+	1	0	SUPT5H	44651610	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.630000	0.83225	2.698000	0.92095	0.650000	0.86243	CAG		0.577	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169		13	49	0	0	0	0.001855	0	13	49				
CEACAM19	56971	broad.mit.edu	37	19	45175887	45175887	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:45175887G>T	ENST00000403660.3	+	2	285	c.75G>T	c.(73-75)tgG>tgT	p.W25C	CEACAM19_ENST00000480278.1_3'UTR|CTB-171A8.1_ENST00000590796.1_RNA|CEACAM19_ENST00000358777.4_Missense_Mutation_p.W25C			Q7Z692	CEA19_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 19	25						integral component of membrane (GO:0016021)		p.W25C(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)	11	Lung NSC(12;0.00308)|all_lung(12;0.00806)	Prostate(69;0.0376)				TGGTCCTCTGGATGCTCCAAG	0.552																																							uc002ozo.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(73-75)TGG>TGT		carcinoembryonic antigen-related cell adhesion							62.0	60.0	61.0					19																	45175887		2203	4300	6503	SO:0001583	missense	56971					integral to membrane		g.chr19:45175887G>T	AF406955	CCDS12641.1, CCDS46108.1	19q13.31	2013-01-11			ENSG00000186567	ENSG00000186567		"""Immunoglobulin superfamily / V-set domain containing"""	31951	protein-coding gene	gene with protein product		606691					Standard	NM_020219		Approved	CEAL1	uc002ozo.4	Q7Z692	OTTHUMG00000151528	ENST00000403660.3:c.75G>T	19.37:g.45175887G>T	ENSP00000384887:p.Trp25Cys		Somatic				CEACAM19_uc002ozp.3_Missense_Mutation_p.W25C	p.W25C	NM_020219	NP_064604	WXS	Illumina HiSeq	Unspecified	Q7Z692	CEA19_HUMAN			2	555	+	Lung NSC(12;0.00308)|all_lung(12;0.00806)	Prostate(69;0.0376)	25					Q5XJ15|Q7Z693	Missense_Mutation	SNP	ENST00000403660.3	37	c.75G>T	CCDS12641.1	.	.	.	.	.	.	.	.	.	.	G	5.057	0.196277	0.09599	.	.	ENSG00000186567	ENST00000358777;ENST00000403660	T;T	0.03094	4.05;4.05	3.96	3.96	0.45880	.	0.410177	0.18234	N	0.147472	T	0.03827	0.0108	L	0.29908	0.895	0.21020	N	0.999808	B;B	0.22414	0.069;0.069	B;B	0.19946	0.027;0.027	T	0.32903	-0.9889	10	0.56958	D	0.05	-0.6342	11.4093	0.49917	0.0:0.0:1.0:0.0	.	25;25	Q5XJ15;Q7Z692	.;CEA19_HUMAN	C	25	ENSP00000351627:W25C;ENSP00000384887:W25C	ENSP00000351627:W25C	W	+	3	0	CEACAM19	49867727	0.988000	0.35896	0.565000	0.28409	0.389000	0.30415	2.422000	0.44696	2.051000	0.60960	0.555000	0.69702	TGG		0.552	CEACAM19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323022.1	NM_020219		18	42	1	0	8.00594e-06	0.007413	9.68766e-06	18	42				
C5AR2	27202	broad.mit.edu	37	19	47845055	47845055	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:47845055G>T	ENST00000595464.1	+	2	1217	c.999G>T	c.(997-999)tcG>tcT	p.S333S	C5AR2_ENST00000257267.2_Silent_p.S333S|C5AR2_ENST00000600626.1_Silent_p.S333S	NM_001271749.1	NP_001258678.1	Q9P296	C5AR2_HUMAN	complement component 5a receptor 2	333					chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of interleukin-8 secretion (GO:2000482)	apical part of cell (GO:0045177)|basal plasma membrane (GO:0009925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)	p.S333S(1)									ACCTGGTCTCGGAGATGGAGG	0.557																																							uc010ela.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(997-999)TCG>TCT		G protein-coupled receptor 77							52.0	40.0	44.0					19																	47845055		2194	4289	6483	SO:0001819	synonymous_variant	27202				chemotaxis	integral to membrane|plasma membrane	C5a anaphylatoxin receptor activity	g.chr19:47845055G>T	AB038237	CCDS12699.1	19q13.33	2013-01-28	2013-01-28	2013-01-28		ENSG00000134830		"""GPCR / Class A : Complement component receptors"""	4527	protein-coding gene	gene with protein product		609949	"""G protein-coupled receptor 77"""	GPR77		11165367	Standard	NM_018485		Approved	C5L2	uc010ela.1	Q9P296		ENST00000595464.1:c.999G>T	19.37:g.47845055G>T			Somatic				GPR77_uc002pgk.1_Silent_p.S333S	p.S333S	NM_018485	NP_060955	WXS	Illumina HiSeq	Unspecified	Q9P296	C5ARL_HUMAN		all cancers(93;0.000129)|OV - Ovarian serous cystadenocarcinoma(262;0.000415)|Epithelial(262;0.0109)|GBM - Glioblastoma multiforme(486;0.0138)	2	1217	+		all_cancers(25;1.72e-06)|all_lung(116;2.15e-05)|all_epithelial(76;3.44e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.0652)|Ovarian(192;0.086)	333			Cytoplasmic (Potential).		B2RA09	Silent	SNP	ENST00000595464.1	37	c.999G>T	CCDS12699.1																																																																																				0.557	C5AR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466926.1	NM_018485		3	31	1	0	2.56e-06	0.009096	3.1922e-06	3	31				
TSKS	60385	broad.mit.edu	37	19	50245161	50245161	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:50245161C>A	ENST00000246801.3	-	9	1560	c.1478G>T	c.(1477-1479)aGg>aTg	p.R493M	TSKS_ENST00000358830.3_Missense_Mutation_p.R293M	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	493					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)	p.R493M(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		CTTGTGTAGCCTCTGACAGCT	0.582																																							uc002ppm.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|skin(1)	2						c.(1477-1479)AGG>ATG		testis-specific kinase substrate							144.0	128.0	133.0					19																	50245161		2203	4300	6503	SO:0001583	missense	60385						protein binding	g.chr19:50245161C>A	BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.1478G>T	19.37:g.50245161C>A	ENSP00000246801:p.Arg493Met		Somatic					p.R493M	NM_021733	NP_068379	WXS	Illumina HiSeq	Unspecified	Q9UJT2	TSKS_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)	9	1489	-		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)	493					Q8WXJ0	Missense_Mutation	SNP	ENST00000246801.3	37	c.1478G>T	CCDS12780.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450324	0.63290	.	.	ENSG00000126467	ENST00000246801;ENST00000358830	T;T	0.35236	1.32;1.32	4.72	4.72	0.59763	.	0.000000	0.64402	D	0.000014	T	0.46756	0.1409	L	0.29908	0.895	0.34708	D	0.72748	D	0.76494	0.999	D	0.81914	0.995	T	0.59500	-0.7443	10	0.72032	D	0.01	-29.7641	13.1114	0.59275	0.0:1.0:0.0:0.0	.	493	Q9UJT2	TSKS_HUMAN	M	493;293	ENSP00000246801:R493M;ENSP00000351691:R293M	ENSP00000246801:R493M	R	-	2	0	TSKS	54936973	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.459000	0.53021	2.464000	0.83262	0.556000	0.70494	AGG		0.582	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465795.1	NM_021733		8	78	1	0	2.74318e-10	0.006214	3.86883e-10	8	78				
SIGLEC6	946	broad.mit.edu	37	19	52033116	52033116	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:52033116C>T	ENST00000425629.3	-	5	1028	c.874G>A	c.(874-876)Gcc>Acc	p.A292T	SIGLEC6_ENST00000391797.3_Missense_Mutation_p.A281T|SIGLEC6_ENST00000474054.1_5'Flank|SIGLEC6_ENST00000346477.3_Missense_Mutation_p.A276T|SIGLEC6_ENST00000343300.4_Missense_Mutation_p.A292T|SIGLEC6_ENST00000359982.4_Missense_Mutation_p.A303T|SIGLEC6_ENST00000436458.1_Missense_Mutation_p.A240T	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	292	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.A265T(2)|p.A292T(2)		endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		GCGTTCAGGGCGGGGAAGCCC	0.637																																							uc002pwy.2		NA																	4	Substitution - Missense(4)		large_intestine(2)|lung(2)	ovary(1)	1						c.(874-876)GCC>ACC		sialic acid binding Ig-like lectin 6 isoform 1							62.0	71.0	68.0					19																	52033116		2195	4296	6491	SO:0001583	missense	946				cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus		g.chr19:52033116C>T	D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.874G>A	19.37:g.52033116C>T	ENSP00000401502:p.Ala292Thr		Somatic				SIGLEC6_uc002pwz.2_Missense_Mutation_p.A276T|SIGLEC6_uc002pxa.2_Missense_Mutation_p.A292T|SIGLEC6_uc010ydb.1_Missense_Mutation_p.A229T|SIGLEC6_uc010ydc.1_Missense_Mutation_p.A292T|SIGLEC6_uc010eoz.1_Missense_Mutation_p.A270T|SIGLEC6_uc010epb.1_Missense_Mutation_p.A245T|SIGLEC6_uc010epa.1_Missense_Mutation_p.A281T	p.A292T	NM_001245	NP_001236	WXS	Illumina HiSeq	Unspecified	O43699	SIGL6_HUMAN		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)	5	1036	-		all_neural(266;0.0199)	292			Ig-like C2-type 2.|Extracellular (Potential).		A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Missense_Mutation	SNP	ENST00000425629.3	37	c.874G>A	CCDS12834.3	.	.	.	.	.	.	.	.	.	.	C	0.633	-0.816569	0.02776	.	.	ENSG00000105492	ENST00000346477;ENST00000391797;ENST00000425629;ENST00000359982;ENST00000436458;ENST00000343300	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	3.71	-4.34	0.03666	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.524220	0.04395	N	0.363114	T	0.43523	0.1251	L	0.37850	1.14	0.09310	N	1	B;B;B;B;B;B	0.27997	0.192;0.197;0.076;0.076;0.192;0.137	B;B;B;B;B;B	0.25140	0.014;0.024;0.034;0.034;0.014;0.058	T	0.34601	-0.9822	10	0.02654	T	1	.	1.0154	0.01506	0.1625:0.2509:0.1598:0.4268	.	303;240;281;292;276;292	F8WA78;C9JBE5;O43699-4;O43699-2;O43699-3;O43699	.;.;.;.;.;SIGL6_HUMAN	T	265;276;292;303;240;292	ENSP00000401502:A292T;ENSP00000353071:A303T;ENSP00000410679:A240T;ENSP00000345907:A292T	ENSP00000345907:A292T	A	-	1	0	SIGLEC6	56724928	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.099000	0.03343	-0.577000	0.05967	-0.351000	0.07748	GCC		0.637	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257670.3	NM_001245		11	61	0	0	0	0.001368	0	11	61				
LILRA6	79168	broad.mit.edu	37	19	54745485	54745485	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:54745485G>T	ENST00000396365.2	-	4	664	c.625C>A	c.(625-627)Cac>Aac	p.H209N	LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000419410.2_Missense_Mutation_p.H209N|LILRA6_ENST00000440558.2_Missense_Mutation_p.H209N|LILRA6_ENST00000270464.5_Missense_Mutation_p.H209N|LILRA6_ENST00000245621.5_Missense_Mutation_p.H209N|LILRB3_ENST00000407860.2_Intron	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	209					immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.H209N(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCACTGGGGTGGGACCACACC	0.612																																							uc002qeu.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(625-627)CAC>AAC		leukocyte immunoglobulin-like receptor,							48.0	54.0	52.0					19																	54745485		1956	4019	5975	SO:0001583	missense	79168					integral to membrane	receptor activity	g.chr19:54745485G>T	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.625C>A	19.37:g.54745485G>T	ENSP00000379651:p.His209Asn		Somatic				LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Missense_Mutation_p.H209N|LILRA6_uc002qek.1_Missense_Mutation_p.H209N|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Missense_Mutation_p.H209N|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Missense_Mutation_p.H209N|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Missense_Mutation_p.H209N|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.H209N|LILRA6_uc010yep.1_Missense_Mutation_p.H209N|LILRA6_uc010yeq.1_Missense_Mutation_p.H209N|LILRA6_uc002qet.3_Intron|LILRA6_uc002qev.1_Missense_Mutation_p.H70N	p.H209N	NM_024318	NP_077294	WXS	Illumina HiSeq	Unspecified	Q6PI73	LIRA6_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	4	749	-	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		209			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000396365.2	37	c.625C>A	CCDS42610.1	.	.	.	.	.	.	.	.	.	.	G	2.131	-0.399143	0.04865	.	.	ENSG00000244482	ENST00000440558;ENST00000270464;ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75	2.38	-3.03	0.05429	Immunoglobulin-like fold (1);	7.145290	0.00166	N	0.000001	T	0.10121	0.0248	L	0.52364	1.645	0.09310	N	1	B;B;B;B;B	0.25272	0.003;0.122;0.022;0.003;0.043	B;B;B;B;B	0.22152	0.007;0.037;0.022;0.013;0.038	T	0.28744	-1.0034	10	0.18276	T	0.48	.	5.6405	0.17561	0.15:0.5609:0.289:0.0	.	209;209;209;209;209	C9JFH3;Q6PI73;F8WCY4;D3YTC4;F8W6G6	.;LIRA6_HUMAN;.;.;.	N	209	ENSP00000390120:H209N;ENSP00000270464:H209N;ENSP00000411227:H209N;ENSP00000379651:H209N;ENSP00000245621:H209N	ENSP00000245621:H209N	H	-	1	0	LILRA6	59437297	0.000000	0.05858	0.018000	0.16275	0.193000	0.23685	-2.854000	0.00730	-0.362000	0.08113	0.162000	0.16502	CAC		0.612	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318		19	85	1	0	3.85864e-22	0.00278	6.31274e-22	19	85				
LILRB1	10859	broad.mit.edu	37	19	55143393	55143393	+	Nonsense_Mutation	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:55143393C>G	ENST00000396331.1	+	6	723	c.366C>G	c.(364-366)taC>taG	p.Y122*	LILRB1_ENST00000396317.1_Nonsense_Mutation_p.Y122*|LILRB1_ENST00000396321.2_Nonsense_Mutation_p.Y122*|LILRB1_ENST00000324602.7_Nonsense_Mutation_p.Y122*|LILRB1_ENST00000427581.2_Nonsense_Mutation_p.Y158*|LILRB1_ENST00000434867.2_Nonsense_Mutation_p.Y122*|AC009892.1_ENST00000578908.1_RNA|LILRB1_ENST00000396332.4_Nonsense_Mutation_p.Y122*|LILRB1_ENST00000448689.1_Nonsense_Mutation_p.Y122*|LILRB1_ENST00000396315.1_Nonsense_Mutation_p.Y122*|LILRB1_ENST00000396327.3_Nonsense_Mutation_p.Y122*|LILRB1_ENST00000418536.2_Nonsense_Mutation_p.Y122*	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	122	Ig-like C2-type 2.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.Y122*(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		TAGGAGCCTACATCAAACCCA	0.592										HNSCC(37;0.09)																													uc002qgj.2		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(364-366)TAC>TAG		leukocyte immunoglobulin-like receptor,							72.0	75.0	74.0					19																	55143393		2203	4300	6503	SO:0001587	stop_gained	10859				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity	g.chr19:55143393C>G	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.366C>G	19.37:g.55143393C>G	ENSP00000379622:p.Tyr122*	HNSCC(37;0.09)	Somatic				LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Nonsense_Mutation_p.Y122*|LILRB1_uc002qgk.2_Nonsense_Mutation_p.Y122*|LILRB1_uc002qgm.2_Nonsense_Mutation_p.Y122*|LILRB1_uc010erq.2_Nonsense_Mutation_p.Y122*|LILRB1_uc010err.2_RNA	p.Y122*	NM_006669	NP_006660	WXS	Illumina HiSeq	Unspecified	Q8NHL6	LIRB1_HUMAN		GBM - Glioblastoma multiforme(193;0.0188)	6	706	+			122			Ig-like C2-type 2.|Extracellular (Potential).		A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Nonsense_Mutation	SNP	ENST00000396331.1	37	c.366C>G	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	C	10.44	1.351903	0.24512	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	.	.	.	1.57	0.377	0.16198	.	0.692812	0.12570	N	0.457438	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.4105	0.11431	0.0:0.7774:0.0:0.2226	.	.	.	.	X	122;122;122;122;122;122;122;122;158;122;122	.	ENSP00000315997:Y122X	Y	+	3	2	LILRB1	59835205	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	-0.999000	0.03697	0.193000	0.20303	0.184000	0.17185	TAC		0.592	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4			6	63	0	0	0	0.001984	0	6	63				
PEG3	5178	broad.mit.edu	37	19	57327625	57327625	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:57327625T>C	ENST00000326441.9	-	10	2548	c.2185A>G	c.(2185-2187)Act>Gct	p.T729A	PEG3_ENST00000593695.1_Missense_Mutation_p.T603A|PEG3_ENST00000598410.1_Missense_Mutation_p.T605A|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.T729A|ZIM2_ENST00000221722.5_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	729					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.T729A(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TGAGATTCAGTGAATGGCCCA	0.423																																							uc002qnu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(2185-2187)ACT>GCT		paternally expressed 3 isoform 1							106.0	100.0	102.0					19																	57327625		2203	4300	6503	SO:0001583	missense	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57327625T>C	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2185A>G	19.37:g.57327625T>C	ENSP00000326581:p.Thr729Ala		Somatic				ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.T700A|PEG3_uc002qnv.2_Missense_Mutation_p.T729A|PEG3_uc002qnw.2_Missense_Mutation_p.T605A|PEG3_uc002qnx.2_Missense_Mutation_p.T603A|PEG3_uc010etr.2_Missense_Mutation_p.T729A	p.T729A	NM_001146186	NP_001139658	WXS	Illumina HiSeq	Unspecified	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	2536	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	729					A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	c.2185A>G	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	T	6.053	0.378050	0.11466	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.15256	2.44;2.44	4.05	-2.33	0.06724	.	0.453841	0.18895	N	0.128200	T	0.12050	0.0293	L	0.46157	1.445	.	.	.	B;P;P	0.45428	0.01;0.858;0.518	B;B;B	0.41723	0.008;0.365;0.164	T	0.20438	-1.0275	9	0.32370	T	0.25	-6.8875	5.932	0.19144	0.0:0.1819:0.4405:0.3776	.	605;729;664	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	A	729	ENSP00000326581:T729A;ENSP00000403051:T729A	ENSP00000326581:T729A	T	-	1	0	ZIM2	62019437	0.000000	0.05858	0.000000	0.03702	0.794000	0.44872	0.033000	0.13754	-0.537000	0.06290	0.477000	0.44152	ACT		0.423	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			44	85	0	0	0	0.002522	0	44	85				
ZNF304	57343	broad.mit.edu	37	19	57868358	57868358	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr19:57868358G>C	ENST00000282286.5	+	3	1294	c.1121G>C	c.(1120-1122)cGt>cCt	p.R374P	ZNF304_ENST00000391705.3_Missense_Mutation_p.R374P|ZNF304_ENST00000443917.2_Missense_Mutation_p.R421P|ZNF304_ENST00000598744.1_Missense_Mutation_p.R332P			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R374P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		GCCTTTAGCCGTAAAGACACA	0.448																																							uc010ygw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1120-1122)CGT>CCT		zinc finger protein 304							75.0	78.0	77.0					19																	57868358		2203	4300	6503	SO:0001583	missense	57343				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57868358G>C	AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.1121G>C	19.37:g.57868358G>C	ENSP00000282286:p.Arg374Pro		Somatic				ZNF304_uc010etw.2_Missense_Mutation_p.R421P|ZNF304_uc010etx.2_Missense_Mutation_p.R332P	p.R374P	NM_020657	NP_065708	WXS	Illumina HiSeq	Unspecified	Q9HCX3	ZN304_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)	3	1509	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	374			C2H2-type 7.			Missense_Mutation	SNP	ENST00000282286.5	37	c.1121G>C	CCDS12950.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120706	0.37436	.	.	ENSG00000131845	ENST00000282286;ENST00000391705;ENST00000443917	T;T;T	0.19669	2.13;2.13;2.13	3.94	1.75	0.24633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39784	0.1091	M	0.75085	2.285	0.09310	N	1	D;D	0.76494	0.996;0.999	D;P	0.62955	0.909;0.906	T	0.13308	-1.0514	9	0.39692	T	0.17	.	9.839	0.40987	0.1813:0.0:0.8187:0.0	.	374;421	Q9HCX3;E7EQD3	ZN304_HUMAN;.	P	374;374;421	ENSP00000282286:R374P;ENSP00000375586:R374P;ENSP00000401642:R421P	ENSP00000282286:R374P	R	+	2	0	ZNF304	62560170	0.000000	0.05858	0.008000	0.14137	0.995000	0.86356	-0.112000	0.10791	0.614000	0.30107	0.585000	0.79938	CGT		0.448	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465785.1			15	42	0	0	0	0.004007	0	15	42				
ASAP2	8853	broad.mit.edu	37	2	9540191	9540191	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:9540191G>T	ENST00000281419.3	+	25	3064	c.2724G>T	c.(2722-2724)ccG>ccT	p.P908P	ASAP2_ENST00000315273.4_Silent_p.P863P|ASAP2_ENST00000491413.1_3'UTR	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	908	Pro-rich.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)	p.P908P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AAGGCCAACCGAGAGGACCTG	0.517																																							uc002qzh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2722-2724)CCG>CCT		ArfGAP with SH3 domain, ankyrin repeat and PH							130.0	126.0	127.0					2																	9540191		2199	4298	6497	SO:0001819	synonymous_variant	8853				regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding	g.chr2:9540191G>T	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2724G>T	2.37:g.9540191G>T			Somatic				ASAP2_uc002qzi.2_Silent_p.P863P	p.P908P	NM_003887	NP_003878	WXS	Illumina HiSeq	Unspecified	O43150	ASAP2_HUMAN			25	3064	+			908			Pro-rich.		D6W4Y8	Silent	SNP	ENST00000281419.3	37	c.2724G>T	CCDS1661.1																																																																																				0.517	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887		5	49	1	0	0.000602214	0.000602	0.000665691	5	49				
ATP6V1C2	245973	broad.mit.edu	37	2	10917755	10917755	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:10917755G>A	ENST00000272238.4	+	11	979	c.870G>A	c.(868-870)ccG>ccA	p.P290P	ATP6V1C2_ENST00000381661.3_Intron	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	290					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)	p.P290P(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		CCACCTTCCCGGACCACAAGG	0.483																																					NSCLC(188;1042 2136 10807 16813 47705)	NSCLC(188;1042 2136 10807 16813 47705)	uc002ras.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(868-870)CCG>CCA		vacuolar H+ ATPase C2 isoform a							132.0	128.0	129.0					2																	10917755		1909	4130	6039	SO:0001819	synonymous_variant	245973				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting V-type ATPase, V1 domain		g.chr2:10917755G>A	AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.870G>A	2.37:g.10917755G>A			Somatic				ATP6V1C2_uc002rat.2_Intron	p.P290P	NM_001039362	NP_001034451	WXS	Illumina HiSeq	Unspecified	Q8NEY4	VATC2_HUMAN		Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)	11	979	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		290					Q96EL8	Silent	SNP	ENST00000272238.4	37	c.870G>A	CCDS42653.1																																																																																				0.483	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323555.1	NM_144583		39	88	0	0	0	0.006999	0	39	88				
NBAS	51594	broad.mit.edu	37	2	15427279	15427279	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:15427279C>A	ENST00000281513.5	-	42	5081	c.5056G>T	c.(5056-5058)Gct>Tct	p.A1686S	NBAS_ENST00000441750.1_Missense_Mutation_p.A1566S	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1686					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.A1686S(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						AGAGAAATAGCAATGCTGTAG	0.468																																							uc002rcc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|liver(1)|skin(1)	4						c.(5056-5058)GCT>TCT		neuroblastoma-amplified protein							136.0	129.0	131.0					2																	15427279		2203	4300	6503	SO:0001583	missense	51594							g.chr2:15427279C>A	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5056G>T	2.37:g.15427279C>A	ENSP00000281513:p.Ala1686Ser		Somatic				NBAS_uc010exl.1_Missense_Mutation_p.A758S|NBAS_uc002rcd.1_RNA	p.A1686S	NM_015909	NP_056993	WXS	Illumina HiSeq	Unspecified	A2RRP1	NBAS_HUMAN			42	5082	-			1686					O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	c.5056G>T	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.082495|4.082495	0.76528|0.76528	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000441750;ENST00000281513|ENST00000442506	T;T|.	0.15139|.	2.45;2.62|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.300709|.	0.42053|.	D|.	0.000765|.	T|T	0.67515|0.67515	0.2901|0.2901	L|L	0.45137|0.45137	1.4|1.4	0.58432|0.58432	D|D	0.99999|0.99999	P;B|.	0.48350|.	0.909;0.065|.	P;B|.	0.44623|.	0.455;0.028|.	T|T	0.61898|0.61898	-0.6968|-0.6968	10|5	0.87932|.	D|.	0|.	.|.	17.8672|17.8672	0.88799|0.88799	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1566;1686|.	A2RRP1-2;A2RRP1|.	.;NBAS_HUMAN|.	S|F	1566;1686|733	ENSP00000413201:A1566S;ENSP00000281513:A1686S|.	ENSP00000281513:A1686S|.	A|L	-|-	1|3	0|2	NBAS|NBAS	15344730|15344730	0.997000|0.997000	0.39634|0.39634	0.947000|0.947000	0.38551|0.38551	0.822000|0.822000	0.46500|0.46500	3.707000|3.707000	0.54838|0.54838	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	GCT|TTG		0.468	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		9	54	1	0	2.17888e-05	0.006214	2.59814e-05	9	54				
OTOF	9381	broad.mit.edu	37	2	26683600	26683600	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:26683600C>A	ENST00000272371.2	-	45	5854	c.5728G>T	c.(5728-5730)Gag>Tag	p.E1910*	OTOF_ENST00000403946.3_Nonsense_Mutation_p.E1910*|OTOF_ENST00000402415.3_Nonsense_Mutation_p.E1220*|OTOF_ENST00000339598.3_Nonsense_Mutation_p.E1143*|OTOF_ENST00000338581.6_Nonsense_Mutation_p.E1143*	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1910					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.E1143*(1)|p.E1220*(1)|p.E1910*(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAATGCAGCTCAGCCTCCACC	0.647																																					GBM(102;732 1451 20652 24062 31372)	GBM(102;732 1451 20652 24062 31372)	uc002rhk.2		NA																	3	Substitution - Nonsense(3)		lung(3)	ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7						c.(5728-5730)GAG>TAG		otoferlin isoform a							55.0	55.0	55.0					2																	26683600		2203	4300	6503	SO:0001587	stop_gained	9381				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding	g.chr2:26683600C>A	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.5728G>T	2.37:g.26683600C>A	ENSP00000272371:p.Glu1910*		Somatic				OTOF_uc010yla.1_Nonsense_Mutation_p.E640*|OTOF_uc002rhh.2_Nonsense_Mutation_p.E1143*|OTOF_uc002rhi.2_Nonsense_Mutation_p.E1220*|OTOF_uc002rhj.2_Nonsense_Mutation_p.E1143*	p.E1910*	NM_194248	NP_919224	WXS	Illumina HiSeq	Unspecified	Q9HC10	OTOF_HUMAN			45	5855	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1910			Cytoplasmic (Potential).		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Nonsense_Mutation	SNP	ENST00000272371.2	37	c.5728G>T	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	c	46	12.324365	0.99657	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	.	.	.	5.24	4.36	0.52297	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-30.5278	15.4932	0.75629	0.0:0.8607:0.1393:0.0	.	.	.	.	X	1143;1143;1220;1910;1910	.	ENSP00000272371:E1910X	E	-	1	0	OTOF	26537104	1.000000	0.71417	0.510000	0.27712	0.672000	0.39443	6.063000	0.71162	1.189000	0.43028	0.457000	0.33378	GAG		0.647	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			4	21	1	0	2.56e-06	0.009096	3.1922e-06	4	21				
AGBL5	60509	broad.mit.edu	37	2	27292958	27292958	+	Splice_Site	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:27292958A>T	ENST00000360131.4	+	15	2648		c.e15-1			NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5						protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTCTGTTGCAGGCTGCCTCA	0.547																																							uc002rie.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|breast(1)	2						c.e15-2		ATP/GTP binding protein-like 5 isoform 1							72.0	73.0	73.0					2																	27292958		1904	4112	6016	SO:0001630	splice_region_variant	60509				protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr2:27292958A>T	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.2490-1A>T	2.37:g.27292958A>T			Somatic				AGBL5_uc002rif.2_Splice_Site	p.G830_splice	NM_021831	NP_068603	WXS	Illumina HiSeq	Unspecified	Q8NDL9	CBPC5_HUMAN			15	2707	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Splice_Site	SNP	ENST00000360131.4	37	c.2490_splice	CCDS1732.3	.	.	.	.	.	.	.	.	.	.	A	15.90	2.968889	0.53614	.	.	ENSG00000084693	ENST00000360131	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1977	0.48722	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AGBL5	27146462	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.640000	0.46579	2.148000	0.66965	0.459000	0.35465	.		0.547	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831	Intron	12	73	0	0	0	0.00245	0	12	73				
XDH	7498	broad.mit.edu	37	2	31611101	31611101	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:31611101C>A	ENST00000379416.3	-	7	604	c.556G>T	c.(556-558)Gac>Tac	p.D186Y	XDH_ENST00000491727.1_5'UTR	NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	186					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)	p.D186Y(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	ACTGAGTGGTCTTTCTTCTGG	0.502																																					Colon(66;682 1445 30109 40147)	Colon(66;682 1445 30109 40147)	uc002rnv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8						c.(556-558)GAC>TAC		xanthine dehydrogenase	Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)						148.0	128.0	135.0					2																	31611101		2203	4300	6503	SO:0001583	missense	7498				purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity	g.chr2:31611101C>A	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.556G>T	2.37:g.31611101C>A	ENSP00000368727:p.Asp186Tyr		Somatic					p.D186Y	NM_000379	NP_000370	WXS	Illumina HiSeq	Unspecified	P47989	XDH_HUMAN			7	635	-	Acute lymphoblastic leukemia(172;0.155)		186					Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	c.556G>T	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.253483	0.39797	.	.	ENSG00000158125	ENST00000379416	T	0.54071	0.59	5.4	3.15	0.36227	[2Fe-2S]-binding (2);Xanthine dehydrogenase, small subunit (1);	0.581540	0.20237	N	0.096364	T	0.51635	0.1686	M	0.75615	2.305	0.39049	D	0.960284	P	0.35011	0.48	B	0.39617	0.305	T	0.58842	-0.7565	10	0.72032	D	0.01	.	5.0193	0.14352	0.0:0.6499:0.0:0.3501	.	186	P47989	XDH_HUMAN	Y	186	ENSP00000368727:D186Y	ENSP00000368727:D186Y	D	-	1	0	XDH	31464605	0.986000	0.35501	0.980000	0.43619	0.414000	0.31173	0.272000	0.18644	1.366000	0.46076	0.563000	0.77884	GAC		0.502	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379		7	52	1	0	0.000157383	0.00308	0.000177817	7	52				
HEATR5B	54497	broad.mit.edu	37	2	37227729	37227729	+	Splice_Site	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:37227729C>A	ENST00000233099.5	-	33	5640	c.5545G>T	c.(5545-5547)Gaa>Taa	p.E1849*	HEATR5B_ENST00000354531.2_Splice_Site_p.E1760*	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1849						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.E1849*(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				GATAGGTTACCTGGTTGAGAA	0.388																																							uc002rpp.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)|skin(2)|breast(1)	8						c.(5545-5547)GAA>TAA		HEAT repeat containing 5B							95.0	91.0	93.0					2																	37227729		2203	4300	6503	SO:0001630	splice_region_variant	54497						binding	g.chr2:37227729C>A	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.5545+1G>T	2.37:g.37227729C>A			Somatic				HEATR5B_uc002rpo.1_Missense_Mutation_p.D162Y|HEATR5B_uc010ezy.1_Nonsense_Mutation_p.E344*	p.E1849*	NM_019024	NP_061897	WXS	Illumina HiSeq	Unspecified	Q9P2D3	HTR5B_HUMAN			33	5641	-		all_hematologic(82;0.21)	1849					B5MDU8|Q7Z3B2|Q9NVL7	Nonsense_Mutation	SNP	ENST00000233099.5	37	c.5545G>T	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	C	46	12.463504	0.99670	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	.	.	.	5.17	4.26	0.50523	.	0.256130	0.39341	N	0.001390	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.6538	15.7479	0.77962	0.0:0.8638:0.1362:0.0	.	.	.	.	X	1849;1760	.	.	E	-	1	0	HEATR5B	37081233	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.779000	0.85648	2.409000	0.81822	0.591000	0.81541	GAA		0.388	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	Nonsense_Mutation	6	73	1	0	0.00116845	0.001168	0.00128122	6	73				
PKDCC	91461	broad.mit.edu	37	2	42284449	42284449	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:42284449G>T	ENST00000294964.5	+	6	1491	c.1311G>T	c.(1309-1311)gtG>gtT	p.V437V	PKDCC_ENST00000480099.1_3'UTR	NM_138370.2	NP_612379.2			protein kinase domain containing, cytoplasmic									p.V437V(1)|p.V294V(1)		breast(2)|kidney(1)|lung(5)	8						TCCTTTCAGTGTTCAACCTGG	0.602																																							uc002rsg.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(1)	1						c.(1309-1311)GTG>GTT		protein kinase-like protein SgK493							126.0	116.0	119.0					2																	42284449		2203	4300	6503	SO:0001819	synonymous_variant	91461				cell differentiation|embryonic digestive tract development|lung alveolus development|negative regulation of Golgi to plasma membrane protein transport|ossification|palate development|positive regulation of bone mineralization|positive regulation of chondrocyte differentiation|protein transport	Golgi apparatus	ATP binding|protein kinase activity	g.chr2:42284449G>T		CCDS33186.2	2p21	2014-01-28	2012-12-07		ENSG00000162878	ENSG00000162878			25123	protein-coding gene	gene with protein product	"""vertebrate lonesome kinase"""	614150	"""protein kinase domain containing, cytoplasmic homolog (mouse)"""			19097194, 19465597	Standard	NM_138370		Approved	SgK493, Vlk	uc002rsg.3	Q504Y2	OTTHUMG00000152303	ENST00000294964.5:c.1311G>T	2.37:g.42284449G>T			Somatic					p.V437V	NM_138370	NP_612379	WXS	Illumina HiSeq	Unspecified	Q504Y2	PKDCC_HUMAN			6	1490	+			437			Protein kinase.			Silent	SNP	ENST00000294964.5	37	c.1311G>T	CCDS33186.2																																																																																				0.602	PKDCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325745.3			9	111	1	0	0.000442599	0.006214	0.000491911	9	111				
MTA3	57504	broad.mit.edu	37	2	42883392	42883392	+	Silent	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:42883392A>T	ENST00000405094.1	+	7	552	c.552A>T	c.(550-552)ccA>ccT	p.P184P	MTA3_ENST00000406911.1_Silent_p.P184P|MTA3_ENST00000405592.1_Silent_p.P128P|MTA3_ENST00000406652.1_Silent_p.P128P|MTA3_ENST00000407270.3_Silent_p.P184P			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	184	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.					intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P184P(1)		endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						TTTGGGATCCAAATAGCCCAC	0.353																																							uc002rso.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(382-384)CCA>CCT		metastasis associated 1 family, member 3							124.0	114.0	117.0					2																	42883392		1845	4101	5946	SO:0001819	synonymous_variant	57504					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:42883392A>T	AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.552A>T	2.37:g.42883392A>T			Somatic				MTA3_uc002rsp.1_Silent_p.P128P|MTA3_uc002rsq.2_Silent_p.P184P|MTA3_uc002rsr.2_Silent_p.P184P	p.P128P	NM_020744	NP_065795	WXS	Illumina HiSeq	Unspecified	Q9BTC8	MTA3_HUMAN			8	1054	+			184			ELM2.		Q9NSP2|Q9ULF4	Silent	SNP	ENST00000405094.1	37	c.384A>T																																																																																					0.353	MTA3-017	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000318159.1	NM_020744		20	67	0	0	0	0.004656	0	20	67				
FBXO11	80204	broad.mit.edu	37	2	48066010	48066010	+	Missense_Mutation	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:48066010T>A	ENST00000403359.3	-	4	647	c.575A>T	c.(574-576)gAt>gTt	p.D192V	FBXO11_ENST00000480038.1_5'UTR|FBXO11_ENST00000402508.1_Missense_Mutation_p.D108V|FBXO11_ENST00000316377.4_Missense_Mutation_p.D108V|FBXO11_ENST00000378314.3_Missense_Mutation_p.D74V	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	192	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)|p.D108V(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CAAAATTGGATCATTAGCAAG	0.383			"""Mis, F, D"""		DLBCL																																		uc010fbl.2		NA		Rec	yes		2	2p16.3	80204		F-box protein 11			L					3	Whole gene deletion(2)|Substitution - Missense(1)		haematopoietic_and_lymphoid_tissue(2)|lung(1)	ovary(1)|lung(1)	2						c.(322-324)GAT>GTT		F-box only protein 11 isoform 1							102.0	96.0	98.0					2																	48066010		2203	4300	6503	SO:0001583	missense	80204				ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|ubiquitin ligase complex	protein binding|protein-arginine N-methyltransferase activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr2:48066010T>A	AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.575A>T	2.37:g.48066010T>A	ENSP00000384823:p.Asp192Val		Somatic				FBXO11_uc002rwe.2_Missense_Mutation_p.D108V|FBXO11_uc002rwf.2_Missense_Mutation_p.D108V|FBXO11_uc002rwg.1_Missense_Mutation_p.D108V	p.D108V	NM_025133	NP_079409	WXS	Illumina HiSeq	Unspecified	Q86XK2	FBX11_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		4	437	-		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	192			F-box.		A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	37	c.323A>T	CCDS54357.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.348782	0.82132	.	.	ENSG00000138081	ENST00000402508;ENST00000403359;ENST00000316377;ENST00000424163;ENST00000378314	T;T;T;T;T	0.61980	0.63;0.63;0.63;0.06;0.06	5.5	5.5	0.81552	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.70753	0.3260	M	0.91561	3.22	0.80722	D	1	B	0.27594	0.182	B	0.23574	0.047	T	0.74340	-0.3697	10	0.87932	D	0	-13.4914	15.598	0.76602	0.0:0.0:0.0:1.0	.	192	Q86XK2	FBX11_HUMAN	V	108;192;108;108;74	ENSP00000385398:D108V;ENSP00000384823:D192V;ENSP00000323822:D108V;ENSP00000392272:D108V;ENSP00000367565:D74V	ENSP00000323822:D108V	D	-	2	0	FBXO11	47919514	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.040000	0.89188	2.079000	0.62486	0.460000	0.39030	GAT		0.383	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	NM_012167, NM_018693, NM_025133		12	41	0	0	0	0.001368	0	12	41				
PNPT1	87178	broad.mit.edu	37	2	55894127	55894127	+	Splice_Site	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:55894127T>A	ENST00000447944.2	-	13	1261	c.1175A>T	c.(1174-1176)cAg>cTg	p.Q392L		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	392					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)	p.Q392L(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATAAATTACCTGTGTTTGTCC	0.318																																							uc002rzf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1174-1176)CAG>CTG		polyribonucleotide nucleotidyltransferase 1							75.0	74.0	74.0					2																	55894127		2203	4300	6503	SO:0001630	splice_region_variant	87178				mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding	g.chr2:55894127T>A	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.1176+1A>T	2.37:g.55894127T>A			Somatic				PNPT1_uc002rzg.2_RNA	p.Q392L	NM_033109	NP_149100	WXS	Illumina HiSeq	Unspecified	Q8TCS8	PNPT1_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)		13	1228	-			392					Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	37	c.1175A>T	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.691989	0.88735	.	.	ENSG00000138035	ENST00000447944	T	0.64085	-0.08	5.56	5.56	0.83823	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.000000	0.85682	D	0.000000	D	0.85936	0.5813	H	0.97874	4.095	0.80722	D	1	D	0.60160	0.987	D	0.63381	0.914	D	0.91300	0.5066	10	0.87932	D	0	-10.3681	16.0612	0.80839	0.0:0.0:0.0:1.0	.	392	Q8TCS8	PNPT1_HUMAN	L	392	ENSP00000400646:Q392L	ENSP00000386075:Q392L	Q	-	2	0	PNPT1	55747631	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.768000	0.85345	2.250000	0.74265	0.477000	0.44152	CAG		0.318	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	Missense_Mutation	7	48	0	0	0	0.001984	0	7	48				
DYSF	8291	broad.mit.edu	37	2	71839888	71839888	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:71839888C>T	ENST00000258104.3	+	39	4562	c.4285C>T	c.(4285-4287)Ctg>Ttg	p.L1429L	DYSF_ENST00000409582.3_Silent_p.L1446L|DYSF_ENST00000409651.1_Silent_p.L1461L|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000410041.1_Silent_p.L1447L|DYSF_ENST00000413539.2_Silent_p.L1460L|DYSF_ENST00000409366.1_Silent_p.L1430L|DYSF_ENST00000409744.1_Silent_p.L1416L|DYSF_ENST00000394120.2_Silent_p.L1430L|DYSF_ENST00000409762.1_Silent_p.L1446L|DYSF_ENST00000410020.3_Silent_p.L1447L|DYSF_ENST00000429174.2_Silent_p.L1429L	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1429					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.L1447L(1)|p.L1429L(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GGAGAGCTTCCTGTGTGACCC	0.657																																							uc002sie.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|breast(2)|pancreas(1)|skin(1)	7						c.(4285-4287)CTG>TTG		dysferlin isoform 8							55.0	50.0	52.0					2																	71839888		2203	4300	6503	SO:0001819	synonymous_variant	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71839888C>T	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.4285C>T	2.37:g.71839888C>T			Somatic				DYSF_uc010feg.2_Silent_p.L1460L|DYSF_uc010feh.2_Silent_p.L1415L|DYSF_uc002sig.3_Silent_p.L1415L|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.L1429L|DYSF_uc010fef.2_Silent_p.L1446L|DYSF_uc010fei.2_Silent_p.L1446L|DYSF_uc010fek.2_Silent_p.L1447L|DYSF_uc010fej.2_Silent_p.L1416L|DYSF_uc010fel.2_Silent_p.L1416L|DYSF_uc010feo.2_Silent_p.L1461L|DYSF_uc010fem.2_Silent_p.L1430L|DYSF_uc010fen.2_Silent_p.L1447L|DYSF_uc002sif.2_Silent_p.L1430L|DYSF_uc010yqy.1_Silent_p.L310L|DYSF_uc010yqz.1_Silent_p.L169L	p.L1429L	NM_003494	NP_003485	WXS	Illumina HiSeq	Unspecified	O75923	DYSF_HUMAN			39	4661	+			1429			Cytoplasmic (Potential).		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	ENST00000258104.3	37	c.4285C>T	CCDS1918.1																																																																																				0.657	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		7	21	0	0	0	0.001984	0	7	21				
DNAH6	1768	broad.mit.edu	37	2	84775457	84775457	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:84775457A>G	ENST00000237449.6	+	7	1240	c.1232A>G	c.(1231-1233)cAt>cGt	p.H411R	DNAH6_ENST00000389394.3_Missense_Mutation_p.H411R|DNAH6_ENST00000398278.2_Missense_Mutation_p.H411R			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	411	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.H411R(1)		NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AATACACCACATGAGTTGCCC	0.383																																							uc010fgb.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1231-1233)CAT>CGT		dynein, axonemal, heavy polypeptide 6							114.0	111.0	112.0					2																	84775457		2203	4300	6503	SO:0001583	missense	1768				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr2:84775457A>G	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1232A>G	2.37:g.84775457A>G	ENSP00000237449:p.His411Arg		Somatic				DNAH6_uc002soo.2_5'UTR|DNAH6_uc002sop.2_5'UTR	p.H411R	NM_001370	NP_001361	WXS	Illumina HiSeq	Unspecified	Q9C0G6	DYH6_HUMAN			8	1369	+			411			Stem (By similarity).		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	c.1232A>G	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	2.956	-0.215613	0.06101	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.21361	2.01;2.15;2.01	4.3	-6.47	0.01902	.	.	.	.	.	T	0.06554	0.0168	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.32719	-0.9896	9	0.25106	T	0.35	.	0.1318	0.00074	0.3262:0.1669:0.2205:0.2864	.	411	Q9C0G6	DYH6_HUMAN	R	411	ENSP00000374045:H411R;ENSP00000381326:H411R;ENSP00000237449:H411R	ENSP00000237449:H411R	H	+	2	0	DNAH6	84628968	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	-0.690000	0.05138	-1.149000	0.02843	-2.813000	0.00110	CAT		0.383	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370		8	59	0	0	0	0.00308	0	8	59				
PROM2	150696	broad.mit.edu	37	2	95953996	95953996	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:95953996G>T	ENST00000317620.9	+	21	2415	c.2282G>T	c.(2281-2283)gGa>gTa	p.G761V	PROM2_ENST00000317668.4_Missense_Mutation_p.G761V|PROM2_ENST00000542147.1_Missense_Mutation_p.G712V|PROM2_ENST00000403131.2_Missense_Mutation_p.G761V	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	761					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)	p.G761V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						CCCCTCTCCGGAGCCCTGGAC	0.622																																							uc002suh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2281-2283)GGA>GTA		prominin 2 precursor							110.0	109.0	109.0					2																	95953996		2203	4300	6503	SO:0001583	missense	150696					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane		g.chr2:95953996G>T	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.2282G>T	2.37:g.95953996G>T	ENSP00000318270:p.Gly761Val		Somatic				PROM2_uc002sui.2_Missense_Mutation_p.G761V|PROM2_uc002suj.2_Missense_Mutation_p.G415V|PROM2_uc002suk.2_Missense_Mutation_p.G761V|PROM2_uc002sul.2_Missense_Mutation_p.G287V|PROM2_uc002sum.2_RNA	p.G761V	NM_144707	NP_653308	WXS	Illumina HiSeq	Unspecified	Q8N271	PROM2_HUMAN			21	2415	+			761			Extracellular (Potential).		A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	37	c.2282G>T	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	G	5.755	0.323761	0.10900	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.58	-7.47	0.01365	.	1.356780	0.04605	N	0.399145	T	0.38480	0.1042	L	0.54323	1.7	0.22401	N	0.999132	P	0.36027	0.533	B	0.37451	0.25	T	0.40175	-0.9577	10	0.31617	T	0.26	3.5562	14.313	0.66429	0.1361:0.6264:0.2376:0.0	.	761	Q8N271	PROM2_HUMAN	V	761;761;761;712	ENSP00000385716:G761V;ENSP00000318520:G761V;ENSP00000318270:G761V;ENSP00000442542:G712V	ENSP00000318270:G761V	G	+	2	0	PROM2	95317723	0.000000	0.05858	0.001000	0.08648	0.077000	0.17291	-1.624000	0.02038	-1.383000	0.02106	-0.955000	0.02649	GGA		0.622	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707		11	85	1	0	9.70103e-10	0.008291	1.34499e-09	11	85				
IL36A	27179	broad.mit.edu	37	2	113764288	113764288	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:113764288G>T	ENST00000259211.6	+	3	649	c.238G>T	c.(238-240)Ggg>Tgg	p.G80W		NM_014440.1	NP_055255.1	Q9UHA7	IL36A_HUMAN	interleukin 36, alpha	80					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)	p.G80R(1)|p.G80W(1)		large_intestine(1)|lung(3)|ovary(2)|skin(1)|stomach(2)	9						TGCTAAAGTCGGGGACCAGCC	0.483																																							uc010yxr.1		NA																	2	Substitution - Missense(2)	p.G80R(1)	ovary(1)|lung(1)		0						c.(238-240)GGG>TGG		interleukin 1 family, member 6 (epsilon)							140.0	146.0	144.0					2																	113764288		1964	4133	6097	SO:0001583	missense	27179				immune response|inflammatory response	extracellular space	cytokine activity|interleukin-1 receptor binding	g.chr2:113764288G>T	AF201831	CCDS42734.1	2q12-q14.1	2011-07-14	2011-06-06	2011-06-06	ENSG00000136694	ENSG00000136694		"""Interleukins and interleukin receptors"""	15562	protein-coding gene	gene with protein product		605509	"""interleukin 1 family, member 6 (epsilon)"""	IL1F6		10625660	Standard	XM_005263639		Approved	FIL1, FIL1E, IL-1F6, IL1(EPSILON), MGC129553, MGC129552	uc010yxr.2	Q9UHA7	OTTHUMG00000153320	ENST00000259211.6:c.238G>T	2.37:g.113764288G>T	ENSP00000259211:p.Gly80Trp		Somatic					p.G80W	NM_014440	NP_055255	WXS	Illumina HiSeq	Unspecified	Q9UHA7	IL36A_HUMAN			3	238	+			80					B2RAD9|Q53SR7|Q5BLR4|Q7RTZ8	Missense_Mutation	SNP	ENST00000259211.6	37	c.238G>T	CCDS42734.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.718138	0.48622	.	.	ENSG00000136694	ENST00000259211	T	0.21543	2.0	5.11	-8.41	0.00961	.	0.828332	0.10780	N	0.634986	T	0.19525	0.0469	M	0.82323	2.585	0.09310	N	1	B	0.21905	0.062	B	0.24269	0.052	T	0.39210	-0.9625	10	0.87932	D	0	-5.7903	2.8285	0.05492	0.4451:0.3027:0.1499:0.1023	.	80	Q9UHA7	IL36A_HUMAN	W	80	ENSP00000259211:G80W	ENSP00000259211:G80W	G	+	1	0	IL36A	113480759	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.585000	0.05794	-1.749000	0.01330	0.591000	0.81541	GGG		0.483	IL36A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330711.1	NM_014440		20	131	1	0	8.10497e-08	0.010504	1.06248e-07	20	131				
POTEF	728378	broad.mit.edu	37	2	130832641	130832641	+	Missense_Mutation	SNP	G	G	T	rs372110626		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:130832641G>T	ENST00000409914.2	-	17	2803	c.2404C>A	c.(2404-2406)Ccc>Acc	p.P802T	POTEF_ENST00000357462.5_Missense_Mutation_p.P802T	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	802	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						AGCAGGACGGGGTGCTCCTCG	0.582																																							uc010fmh.2		NA																	0				skin(3)|ovary(2)	5						c.(2404-2406)CCC>ACC		prostate, ovary, testis expressed protein on							108.0	116.0	113.0					2																	130832641		2203	4300	6503	SO:0001583	missense	728378					cell cortex	ATP binding	g.chr2:130832641G>T	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2404C>A	2.37:g.130832641G>T	ENSP00000386786:p.Pro802Thr		Somatic					p.P802T	NM_001099771	NP_001093241	WXS	Illumina HiSeq	Unspecified	A5A3E0	POTEF_HUMAN			17	2804	-			802			Actin-like.		A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	c.2404C>A	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	13.96	2.392456	0.42410	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	D;D	0.97924	-4.61;-4.61	.	.	.	.	.	.	.	.	D	0.98754	0.9581	H	0.98048	4.135	0.80722	D	1	P	0.36010	0.532	P	0.52823	0.71	D	0.98574	1.0647	8	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	802	A5A3E0	POTEF_HUMAN	T	802	ENSP00000350052:P802T;ENSP00000386786:P802T	ENSP00000350052:P802T	P	-	1	0	POTEF	130549111	1.000000	0.71417	0.112000	0.21494	0.114000	0.19823	6.509000	0.73725	0.119000	0.18210	0.121000	0.15741	CCC		0.582	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771		36	93	1	0	2.40579e-17	0.00623	3.77e-17	36	93				
THSD7B	80731	broad.mit.edu	37	2	138163308	138163308	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:138163308G>T	ENST00000409968.1	+	13	2804	c.2626G>T	c.(2626-2628)Gct>Tct	p.A876S	THSD7B_ENST00000272643.3_Missense_Mutation_p.A876S|THSD7B_ENST00000413152.2_Missense_Mutation_p.A845S|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	876	TSP type-1 11. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.A876S(1)|p.A845S(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CACCTTCACTGCTTGGTCCAA	0.507																																							uc002tva.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(2533-2535)GCT>TCT		thrombospondin, type I, domain containing 7B							78.0	80.0	79.0					2																	138163308		2037	4174	6211	SO:0001583	missense	80731							g.chr2:138163308G>T			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2626G>T	2.37:g.138163308G>T	ENSP00000387145:p.Ala876Ser		Somatic				THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.A735S	p.A845S	NM_001080427	NP_001073896	WXS	Illumina HiSeq	Unspecified				BRCA - Breast invasive adenocarcinoma(221;0.19)	12	2533	+									Missense_Mutation	SNP	ENST00000409968.1	37	c.2533G>T		.	.	.	.	.	.	.	.	.	.	G	2.483	-0.319177	0.05386	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.60424	0.19;0.19;0.19	5.53	-1.29	0.09288	.	0.554792	0.20965	N	0.082487	T	0.25975	0.0633	N	0.04880	-0.145	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.14023	0.01;0.01	T	0.31613	-0.9937	10	0.02654	T	1	.	9.5284	0.39178	0.2424:0.5583:0.1992:0.0	.	876;845	Q9C0I4;C9JKN6	THS7B_HUMAN;.	S	876;876;845	ENSP00000387145:A876S;ENSP00000272643:A876S;ENSP00000413841:A845S	ENSP00000272643:A876S	A	+	1	0	THSD7B	137879778	0.000000	0.05858	0.136000	0.22124	0.993000	0.82548	-0.039000	0.12124	-0.202000	0.10268	-0.137000	0.14449	GCT		0.507	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		10	22	1	0	0.00621372	0.006214	0.00661825	10	22				
LRP1B	53353	broad.mit.edu	37	2	140995720	140995720	+	Splice_Site	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:140995720C>G	ENST00000389484.3	-	89	14532		c.e89+1			NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B						protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.?(2)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGACATACTACCTTTGTTGGG	0.373										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	2	Unknown(2)		lung(1)|pancreas(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.e89+1		low density lipoprotein-related protein 1B							158.0	147.0	151.0					2																	140995720		2203	4300	6503	SO:0001630	splice_region_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:140995720C>G	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13560+1G>C	2.37:g.140995720C>G		TSP Lung(27;0.18)	Somatic					p.K4520_splice	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	89	14532	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)						Q8WY29|Q8WY30|Q8WY31	Splice_Site	SNP	ENST00000389484.3	37	c.13560_splice	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708309	0.89018	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000437977	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4895	0.95044	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP1B	140712190	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.294000	0.78760	2.596000	0.87737	0.655000	0.94253	.		0.373	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Intron	12	99	0	0	0	0.001368	0	12	99				
LRP1B	53353	broad.mit.edu	37	2	141641581	141641581	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:141641581G>T	ENST00000389484.3	-	25	4945	c.3974C>A	c.(3973-3975)gCc>gAc	p.A1325D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1325					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.A1325D(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CACTTCAATGGCACTGACACC	0.473										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(3973-3975)GCC>GAC		low density lipoprotein-related protein 1B							102.0	97.0	99.0					2																	141641581		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141641581G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3974C>A	2.37:g.141641581G>T	ENSP00000374135:p.Ala1325Asp	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Missense_Mutation_p.A507D	p.A1325D	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	25	4946	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1325			Extracellular (Potential).|LDL-receptor class B 9.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.3974C>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.517960	0.27211	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.90955	-2.76;-2.76	5.54	5.54	0.83059	Six-bladed beta-propeller, TolB-like (1);	0.071345	0.56097	D	0.000030	D	0.84862	0.5566	N	0.13235	0.315	0.38576	D	0.950064	B;P	0.35433	0.434;0.501	B;B	0.42959	0.403;0.058	T	0.82412	-0.0470	10	0.13470	T	0.59	.	15.3419	0.74303	0.0:0.1392:0.8608:0.0	.	508;1325	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	D	1325;1263;470	ENSP00000374135:A1325D;ENSP00000413239:A470D	ENSP00000374135:A1325D	A	-	2	0	LRP1B	141358051	1.000000	0.71417	0.985000	0.45067	0.966000	0.64601	6.802000	0.75175	2.751000	0.94390	0.591000	0.81541	GCC		0.473	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		19	69	1	0	2.94398e-08	0.007413	3.90938e-08	19	69				
SCN2A	6326	broad.mit.edu	37	2	166164446	166164446	+	Splice_Site	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:166164446G>C	ENST00000375437.2	+	4	765	c.475G>C	c.(475-477)Gag>Cag	p.E159Q	SCN2A_ENST00000283256.6_Splice_Site_p.E159Q|SCN2A_ENST00000357398.3_Splice_Site_p.E159Q|SCN2A_ENST00000375427.2_Splice_Site_p.E159Q	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	159					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.E159Q(2)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAAGAATGTGGAGTAAGTATA	0.338																																							uc002udc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|breast(1)|pancreas(1)	8						c.(475-477)GAG>CAG		sodium channel, voltage-gated, type II, alpha	Lamotrigine(DB00555)						139.0	149.0	146.0					2																	166164446		2203	4300	6503	SO:0001630	splice_region_variant	6326				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166164446G>C	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.476+1G>C	2.37:g.166164446G>C			Somatic				SCN2A_uc002udd.2_Missense_Mutation_p.E159Q|SCN2A_uc002ude.2_Missense_Mutation_p.E159Q	p.E159Q	NM_001040142	NP_001035232	WXS	Illumina HiSeq	Unspecified	Q99250	SCN2A_HUMAN			4	765	+			159			I.|Helical; Name=S2 of repeat I; (Potential).		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	c.475G>C	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	G	34	5.298629	0.95574	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D;D	0.97976	-4.64;-4.64;-4.64;-4.64;-4.64	5.68	5.68	0.88126	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.99245	0.9737	H	0.96365	3.81	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.998;0.999	D	0.98900	1.0776	10	0.87932	D	0	.	20.1467	0.98079	0.0:0.0:1.0:0.0	.	159;159	Q99250-2;Q99250	.;SCN2A_HUMAN	Q	159	ENSP00000406454:E159Q;ENSP00000364586:E159Q;ENSP00000349973:E159Q;ENSP00000283256:E159Q;ENSP00000364576:E159Q	ENSP00000283256:E159Q	E	+	1	0	SCN2A	165872692	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.869000	0.99810	2.838000	0.97847	0.655000	0.94253	GAG		0.338	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	Missense_Mutation	43	196	0	0	0	0.002522	0	43	196				
CSRNP3	80034	broad.mit.edu	37	2	166533101	166533101	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:166533101G>A	ENST00000342316.4	+	4	960	c.688G>A	c.(688-690)Gct>Act	p.A230T	CSRNP3_ENST00000409420.1_Missense_Mutation_p.A262T|CSRNP3_ENST00000314499.7_Missense_Mutation_p.A230T	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	230	Cys-rich.				apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A230T(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						CTGCAGCCTGGCTGGCATTAA	0.537																																							uc002udf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|skin(1)	5						c.(688-690)GCT>ACT		cysteine-serine-rich nuclear protein 3							53.0	49.0	50.0					2																	166533101		2203	4300	6503	SO:0001583	missense	80034				apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:166533101G>A	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.688G>A	2.37:g.166533101G>A	ENSP00000344042:p.Ala230Thr		Somatic				CSRNP3_uc002udg.2_Missense_Mutation_p.A230T	p.A230T	NM_024969	NP_079245	WXS	Illumina HiSeq	Unspecified	Q8WYN3	CSRN3_HUMAN			6	1064	+			230			Cys-rich.		B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	ENST00000342316.4	37	c.688G>A	CCDS2225.1	.	.	.	.	.	.	.	.	.	.	G	35	5.479827	0.96307	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000342316;ENST00000409420	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.77	5.77	0.91146	.	0.117685	0.56097	D	0.000027	T	0.67192	0.2867	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67665	-0.5612	10	0.66056	D	0.02	-15.6403	19.3504	0.94381	0.0:0.0:1.0:0.0	.	230	Q8WYN3	CSRN3_HUMAN	T	230;237;230;230;262	ENSP00000412081:A230T;ENSP00000318258:A230T;ENSP00000344042:A230T;ENSP00000387195:A262T	ENSP00000318258:A230T	A	+	1	0	CSRNP3	166241347	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.841000	0.86834	2.885000	0.99019	0.655000	0.94253	GCT		0.537	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255191.2	NM_024969		5	68	0	0	0	0.000602	0	5	68				
CSRNP3	80034	broad.mit.edu	37	2	166535484	166535484	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:166535484G>A	ENST00000342316.4	+	5	1251	c.979G>A	c.(979-981)Gtg>Atg	p.V327M	CSRNP3_ENST00000409420.1_Missense_Mutation_p.V359M|CSRNP3_ENST00000314499.7_Missense_Mutation_p.V327M	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	327	Glu-rich.				apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V327M(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						CCAGGCTGCAGTGCTGCACCT	0.507																																							uc002udf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|skin(1)	5						c.(979-981)GTG>ATG		cysteine-serine-rich nuclear protein 3							66.0	69.0	68.0					2																	166535484		2203	4300	6503	SO:0001583	missense	80034				apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:166535484G>A	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.979G>A	2.37:g.166535484G>A	ENSP00000344042:p.Val327Met		Somatic				CSRNP3_uc002udg.2_Missense_Mutation_p.V327M	p.V327M	NM_024969	NP_079245	WXS	Illumina HiSeq	Unspecified	Q8WYN3	CSRN3_HUMAN			7	1355	+			327			Glu-rich.		B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	ENST00000342316.4	37	c.979G>A	CCDS2225.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.362562	0.41902	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000342316;ENST00000409420	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.77	5.77	0.91146	.	0.446812	0.25543	N	0.029941	T	0.39358	0.1075	L	0.27053	0.805	0.35091	D	0.764316	P	0.39157	0.662	B	0.40009	0.316	T	0.55379	-0.8150	10	0.62326	D	0.03	-18.3667	13.8918	0.63744	0.0:0.0:0.8478:0.1521	.	327	Q8WYN3	CSRN3_HUMAN	M	327;334;327;327;359	ENSP00000412081:V327M;ENSP00000318258:V327M;ENSP00000344042:V327M;ENSP00000387195:V359M	ENSP00000318258:V327M	V	+	1	0	CSRNP3	166243730	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.839000	0.55835	2.719000	0.93026	0.650000	0.86243	GTG		0.507	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255191.2	NM_024969		29	66	0	0	0	0.007291	0	29	66				
LRP2	4036	broad.mit.edu	37	2	170127535	170127535	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:170127535C>T	ENST00000263816.3	-	16	2484	c.2199G>A	c.(2197-2199)atG>atA	p.M733I	LRP2_ENST00000443831.1_Intron	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	733					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.M733I(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAACTGGAACCATGACATCTT	0.413																																							uc002ues.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(2197-2199)ATG>ATA		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						122.0	104.0	110.0					2																	170127535		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170127535C>T		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2199G>A	2.37:g.170127535C>T	ENSP00000263816:p.Met733Ile		Somatic				LRP2_uc010zdf.1_Intron	p.M733I	NM_004525	NP_004516	WXS	Illumina HiSeq	Unspecified	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	16	2412	-			733			Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.2199G>A	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	5.577	0.291347	0.10567	.	.	ENSG00000081479	ENST00000263816	D	0.90261	-2.64	5.77	-5.59	0.02505	Six-bladed beta-propeller, TolB-like (1);	0.240515	0.47455	N	0.000234	T	0.64080	0.2566	N	0.03154	-0.405	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.60146	-0.7320	10	0.02654	T	1	.	1.7003	0.02871	0.1564:0.166:0.3078:0.3698	.	733	P98164	LRP2_HUMAN	I	733	ENSP00000263816:M733I	ENSP00000263816:M733I	M	-	3	0	LRP2	169835781	0.214000	0.23563	0.680000	0.29994	0.936000	0.57629	-0.444000	0.06854	-0.664000	0.05324	0.655000	0.94253	ATG		0.413	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		8	66	0	0	0	0.004482	0	8	66				
HOXD10	3236	broad.mit.edu	37	2	176981647	176981647	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:176981647C>A	ENST00000249501.4	+	1	341	c.86C>A	c.(85-87)tCc>tAc	p.S29Y	HOXD10_ENST00000490088.2_Intron	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	29					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S29Y(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		AGTTTTTATTCCAGCAGCGCC	0.488																																							uc002ukj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(85-87)TCC>TAC		homeobox D10							110.0	117.0	115.0					2																	176981647		2203	4300	6503	SO:0001583	missense	3236					nucleus	sequence-specific DNA binding	g.chr2:176981647C>A		CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.86C>A	2.37:g.176981647C>A	ENSP00000249501:p.Ser29Tyr		Somatic					p.S29Y	NM_002148	NP_002139	WXS	Illumina HiSeq	Unspecified	P28358	HXD10_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)	1	156	+			29					Q6NT10	Missense_Mutation	SNP	ENST00000249501.4	37	c.86C>A	CCDS2266.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.841595	0.32513	.	.	ENSG00000128710	ENST00000249501	T	0.34275	1.37	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.42966	0.1226	M	0.77406	2.37	0.58432	D	0.999999	B	0.06786	0.001	B	0.10450	0.005	T	0.39722	-0.9600	10	0.15952	T	0.53	.	19.3077	0.94171	0.0:1.0:0.0:0.0	.	29	P28358	HXD10_HUMAN	Y	29	ENSP00000249501:S29Y	ENSP00000249501:S29Y	S	+	2	0	HOXD10	176689893	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.652000	0.90054	0.655000	0.94253	TCC		0.488	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255692.2			34	84	1	0	3.11337e-16	0.002836	4.82337e-16	34	84				
OSBPL6	114880	broad.mit.edu	37	2	179238620	179238620	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:179238620G>T	ENST00000190611.4	+	15	1775	c.1399G>T	c.(1399-1401)Ggt>Tgt	p.G467C	OSBPL6_ENST00000315022.2_Missense_Mutation_p.G471C|OSBPL6_ENST00000357080.4_Missense_Mutation_p.G400C|OSBPL6_ENST00000409045.3_Missense_Mutation_p.G436C|OSBPL6_ENST00000409631.1_Missense_Mutation_p.G431C|OSBPL6_ENST00000392505.2_Missense_Mutation_p.G492C|OSBPL6_ENST00000359685.3_Missense_Mutation_p.G431C	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	467					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.G467C(1)|p.G492C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TCTGCAGGCTGGTGAGCAAAT	0.433																																							uc002ulx.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(1399-1401)GGT>TGT		oxysterol-binding protein-like protein 6 isoform							87.0	76.0	80.0					2																	179238620		2203	4300	6503	SO:0001583	missense	114880				lipid transport		lipid binding	g.chr2:179238620G>T	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.1399G>T	2.37:g.179238620G>T	ENSP00000190611:p.Gly467Cys		Somatic				OSBPL6_uc002ulw.2_Missense_Mutation_p.G400C|OSBPL6_uc002uly.2_Missense_Mutation_p.G492C|OSBPL6_uc010zfe.1_Missense_Mutation_p.G436C|OSBPL6_uc002ulz.2_Missense_Mutation_p.G431C|OSBPL6_uc002uma.2_Missense_Mutation_p.G471C	p.G467C	NM_032523	NP_115912	WXS	Illumina HiSeq	Unspecified	Q9BZF3	OSBL6_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)		15	1777	+			467					B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	c.1399G>T	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	g	13.89	2.371394	0.42003	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.12255	2.73;2.71;2.7;2.74;2.73;2.71;2.73	6.01	5.14	0.70334	.	0.356116	0.27981	N	0.017068	T	0.05273	0.0140	N	0.01352	-0.895	0.39875	D	0.97355	B;B;B;B;B;B	0.15141	0.0;0.004;0.001;0.004;0.0;0.012	B;B;B;B;B;B	0.15870	0.005;0.014;0.003;0.008;0.001;0.011	T	0.29366	-1.0014	10	0.49607	T	0.09	-6.065	10.2692	0.43473	0.0677:0.0:0.7979:0.1344	.	436;471;431;492;467;400	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	C	492;431;400;436;467;431;471	ENSP00000376293:G492C;ENSP00000352713:G431C;ENSP00000349591:G400C;ENSP00000387248:G436C;ENSP00000190611:G467C;ENSP00000386885:G431C;ENSP00000318723:G471C	ENSP00000190611:G467C	G	+	1	0	OSBPL6	178946866	0.999000	0.42202	1.000000	0.80357	0.983000	0.72400	3.004000	0.49513	1.558000	0.49541	0.651000	0.88453	GGT		0.433	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523		3	59	1	0	0.004672	0.004672	0.00500222	3	59				
TTN	7273	broad.mit.edu	37	2	179449532	179449532	+	Silent	SNP	A	A	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:179449532A>C	ENST00000591111.1	-	260	60137	c.59913T>G	c.(59911-59913)gcT>gcG	p.A19971A	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Silent_p.A12739A|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Silent_p.A19044A|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Silent_p.A21612A|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Silent_p.A12672A|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Silent_p.A12547A|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19971	Fibronectin type-III 44. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A12547A(1)|p.A19044A(1)|p.A12739A(1)|p.A12672A(1)|p.A19042A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGTGACTGAAGCTAGAGCCG	0.517																																							uc010zfg.1		NA																	5	Substitution - coding silent(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(57130-57132)GCT>GCG		titin isoform N2-A							171.0	172.0	171.0					2																	179449532		1964	4144	6108	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179449532A>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.59913T>G	2.37:g.179449532A>C			Somatic				uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.A12739A|TTN_uc010zfi.1_Silent_p.A12672A|TTN_uc010zfj.1_Silent_p.A12547A	p.A19044A	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		259	57356	-			19971					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.57132T>G																																																																																					0.517	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		30	229	0	0	0	0.007291	0	30	229				
TTN	7273	broad.mit.edu	37	2	179582535	179582535	+	Missense_Mutation	SNP	G	G	C	rs201810836	byFrequency	TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:179582535G>C	ENST00000591111.1	-	85	24339	c.24115C>G	c.(24115-24117)Cgc>Ggc	p.R8039G	TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.R7112G|TTN_ENST00000589042.1_Missense_Mutation_p.R8356G|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12230					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R7112G(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGAAGTTTGCGCGCTGTAAAG	0.378																																							uc010zfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(21334-21336)CGC>GGC		titin isoform N2-A							34.0	33.0	33.0					2																	179582535		1850	4096	5946	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179582535G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.24115C>G	2.37:g.179582535G>C	ENSP00000465570:p.Arg8039Gly		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R3773G	p.R7112G	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		84	21558	-			8039					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.21334C>G		.	.	.	.	.	.	.	.	.	.	G	13.06	2.124579	0.37533	.	.	ENSG00000155657	ENST00000342992	T	0.63417	-0.04	5.87	5.87	0.94306	Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77585	0.4152	L	0.53249	1.67	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.77236	-0.2662	9	0.87932	D	0	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	8039	Q8WZ42	TITIN_HUMAN	G	7112	ENSP00000343764:R7112G	ENSP00000343764:R7112G	R	-	1	0	TTN	179290780	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.756000	0.55205	2.941000	0.99782	0.655000	0.94253	CGC		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		6	43	0	0	0	0.001168	0	6	43				
SSFA2	6744	broad.mit.edu	37	2	182780208	182780208	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:182780208C>T	ENST00000431877.2	+	11	2020	c.1841C>T	c.(1840-1842)cCa>cTa	p.P614L	SSFA2_ENST00000409001.1_Missense_Mutation_p.P614L|SSFA2_ENST00000409136.1_Missense_Mutation_p.P123L|SSFA2_ENST00000320370.7_Missense_Mutation_p.P614L|SSFA2_ENST00000428267.2_Missense_Mutation_p.P461L	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	614						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P614L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			ACCTGTAGTCCAGGGGATCAT	0.453																																							uc002uoi.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|central_nervous_system(1)	2						c.(1840-1842)CCA>CTA		sperm specific antigen 2 isoform 1							80.0	69.0	72.0					2																	182780208		2203	4300	6503	SO:0001583	missense	6744					cytoplasm|plasma membrane	actin binding	g.chr2:182780208C>T	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.1841C>T	2.37:g.182780208C>T	ENSP00000388731:p.Pro614Leu		Somatic				SSFA2_uc002uoh.2_Missense_Mutation_p.P614L|SSFA2_uc002uoj.2_Missense_Mutation_p.P614L|SSFA2_uc002uok.2_RNA|SSFA2_uc010zfo.1_Missense_Mutation_p.P461L|SSFA2_uc002uol.2_Missense_Mutation_p.P461L|SSFA2_uc002uom.2_Missense_Mutation_p.P82L	p.P614L	NM_001130445	NP_001123917	WXS	Illumina HiSeq	Unspecified	P28290	SSFA2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0856)		11	2163	+			614					A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	ENST00000431877.2	37	c.1841C>T	CCDS46467.1	.	.	.	.	.	.	.	.	.	.	C	4.031	0.003359	0.07866	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267;ENST00000409136	T;T;T;T;T	0.14144	2.76;2.53;2.76;2.76;2.53	5.71	3.72	0.42706	.	1.101740	0.06695	N	0.770272	T	0.11750	0.0286	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.19706	0.038;0.038;0.015;0.015;0.015	B;B;B;B;B	0.13407	0.009;0.006;0.006;0.006;0.006	T	0.34576	-0.9823	10	0.49607	T	0.09	-1.2471	10.1568	0.42827	0.2326:0.5911:0.1764:0.0	.	461;123;614;614;614	E7END2;E7EUL7;E9PHV5;P28290;P28290-3	.;.;.;SSFA2_HUMAN;.	L	614;614;614;461;123	ENSP00000388731:P614L;ENSP00000314669:P614L;ENSP00000387319:P614L;ENSP00000409867:P461L;ENSP00000386916:P123L	ENSP00000314669:P614L	P	+	2	0	SSFA2	182488453	0.000000	0.05858	0.001000	0.08648	0.128000	0.20619	0.430000	0.21428	0.687000	0.31509	0.555000	0.69702	CCA		0.453	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751		12	63	0	0	0	0.001368	0	12	63				
COL3A1	1281	broad.mit.edu	37	2	189870978	189870978	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:189870978G>T	ENST00000304636.3	+	42	3256	c.3086G>T	c.(3085-3087)gGt>gTt	p.G1029V	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1029	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.G1029V(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GGATCTCCTGGTGGCAAGGTA	0.368																																							uc002uqj.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(3085-3087)GGT>GTT		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						101.0	106.0	104.0					2																	189870978		2203	4300	6503	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189870978G>T	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.3086G>T	2.37:g.189870978G>T	ENSP00000304408:p.Gly1029Val		Somatic					p.G1029V	NM_000090	NP_000081	WXS	Illumina HiSeq	Unspecified	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		42	3203	+			1029			Triple-helical region.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.3086G>T	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.521305	0.85600	.	.	ENSG00000168542	ENST00000304636	D	0.98807	-5.15	5.78	5.78	0.91487	.	0.000000	0.52532	D	0.000068	D	0.99594	0.9853	H	0.98883	4.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97690	1.0178	10	0.87932	D	0	.	20.0079	0.97439	0.0:0.0:1.0:0.0	.	1029	P02461	CO3A1_HUMAN	V	1029	ENSP00000304408:G1029V	ENSP00000304408:G1029V	G	+	2	0	COL3A1	189579223	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	9.593000	0.98250	2.722000	0.93159	0.655000	0.94253	GGT		0.368	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		16	91	1	0	1.33834e-09	0.007413	1.8246e-09	16	91				
COL5A2	1290	broad.mit.edu	37	2	189923181	189923181	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:189923181C>G	ENST00000374866.3	-	33	2477	c.2203G>C	c.(2203-2205)Gga>Cga	p.G735R		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	735					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.G735R(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCATGTCCTCCAGCCATTCCC	0.433																																							uc002uqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2203-2205)GGA>CGA		alpha 2 type V collagen preproprotein							119.0	111.0	113.0					2																	189923181		2203	4300	6503	SO:0001583	missense	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189923181C>G	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.2203G>C	2.37:g.189923181C>G	ENSP00000364000:p.Gly735Arg		Somatic				COL5A2_uc010frx.2_Missense_Mutation_p.G311R	p.G735R	NM_000393	NP_000384	WXS	Illumina HiSeq	Unspecified	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		33	2478	-			735					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	c.2203G>C	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.323017	0.81580	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99537	-6.11	5.56	5.56	0.83823	.	0.000000	0.52532	D	0.000070	D	0.99768	0.9905	H	0.94582	3.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97426	1.0012	9	.	.	.	.	19.8965	0.96963	0.0:1.0:0.0:0.0	.	375;735	Q5PR22;P05997	.;CO5A2_HUMAN	R	735;375	ENSP00000364000:G735R	.	G	-	1	0	COL5A2	189631426	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.744000	0.85034	2.771000	0.95319	0.563000	0.77884	GGA		0.433	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		11	40	0	0	0	0.003163	0	11	40				
MFSD6	54842	broad.mit.edu	37	2	191301129	191301129	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:191301129C>T	ENST00000392328.1	+	3	698	c.374C>T	c.(373-375)gCa>gTa	p.A125V	MFSD6_ENST00000281416.7_Missense_Mutation_p.A125V	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	125					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.A125V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						GGTGTAGTTGCAGACCGCTTT	0.428																																							uc002urz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(373-375)GCA>GTA		major facilitator superfamily domain containing							74.0	73.0	73.0					2																	191301129		2203	4300	6503	SO:0001583	missense	54842				transmembrane transport	integral to membrane		g.chr2:191301129C>T		CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.374C>T	2.37:g.191301129C>T	ENSP00000376141:p.Ala125Val		Somatic					p.A125V	NM_017694	NP_060164	WXS	Illumina HiSeq	Unspecified	Q6ZSS7	MFSD6_HUMAN			3	698	+			125			Helical; (Potential).		D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	ENST00000392328.1	37	c.374C>T	CCDS2306.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812934	0.90707	.	.	ENSG00000151690	ENST00000392328;ENST00000445546;ENST00000281416	D;D;D	0.82255	-1.59;-1.54;-1.59	5.39	5.39	0.77823	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.91878	0.7429	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90825	0.4712	10	0.38643	T	0.18	-22.6166	18.3329	0.90276	0.0:1.0:0.0:0.0	.	125	Q6ZSS7	MFSD6_HUMAN	V	125	ENSP00000376141:A125V;ENSP00000403762:A125V;ENSP00000281416:A125V	ENSP00000281416:A125V	A	+	2	0	MFSD6	191009374	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.651000	0.83577	2.810000	0.96702	0.650000	0.86243	GCA		0.428	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1			31	80	0	0	0	0.002445	0	31	80				
DNAH7	56171	broad.mit.edu	37	2	196825191	196825191	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:196825191G>T	ENST00000312428.6	-	18	2784	c.2684C>A	c.(2683-2685)gCt>gAt	p.A895D		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	895	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.A895D(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTCTTTGCTAGCTGCTTCACT	0.403																																							uc002utj.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(10)|ovary(2)	12						c.(2683-2685)GCT>GAT		dynein, axonemal, heavy chain 7							118.0	115.0	116.0					2																	196825191		1879	4110	5989	SO:0001583	missense	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196825191G>T	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2684C>A	2.37:g.196825191G>T	ENSP00000311273:p.Ala895Asp		Somatic					p.A895D	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			18	2785	-			895			Stem (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	c.2684C>A	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.128063	0.77549	.	.	ENSG00000118997	ENST00000312428	T	0.79352	-1.26	5.64	5.64	0.86602	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	D	0.94079	0.8102	H	0.99565	4.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96454	0.9336	10	0.87932	D	0	.	19.7123	0.96100	0.0:0.0:1.0:0.0	.	895	Q8WXX0	DYH7_HUMAN	D	895	ENSP00000311273:A895D	ENSP00000311273:A895D	A	-	2	0	DNAH7	196533436	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	9.750000	0.98875	2.661000	0.90470	0.585000	0.79938	GCT		0.403	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		25	143	1	0	6.21321e-17	0.00278	9.69925e-17	25	143				
C2orf66	401027	broad.mit.edu	37	2	197674027	197674027	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:197674027C>A	ENST00000342506.2	-	1	973	c.85G>T	c.(85-87)Gcc>Tcc	p.A29S		NM_213608.2	NP_998773.1	Q6UXQ4	CB066_HUMAN	chromosome 2 open reading frame 66	29						extracellular region (GO:0005576)		p.A29S(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9						AGCACCAGGGCAACACATAGT	0.498																																							uc002utv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(85-87)GCC>TCC		hypothetical protein LOC401027 precursor							214.0	195.0	201.0					2																	197674027		2203	4300	6503	SO:0001583	missense	401027					extracellular region		g.chr2:197674027C>A		CCDS2317.1	2q33.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000187944	ENSG00000187944			33809	protein-coding gene	gene with protein product							Standard	NM_213608		Approved	UNQ6411	uc002utv.3	Q6UXQ4	OTTHUMG00000132742	ENST00000342506.2:c.85G>T	2.37:g.197674027C>A	ENSP00000339384:p.Ala29Ser		Somatic					p.A29S	NM_213608	NP_998773	WXS	Illumina HiSeq	Unspecified	Q6UXQ4	CB066_HUMAN			1	974	-			29					B2RNW3	Missense_Mutation	SNP	ENST00000342506.2	37	c.85G>T	CCDS2317.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500116	0.44455	.	.	ENSG00000187944	ENST00000342506	.	.	.	4.12	2.28	0.28536	.	0.472859	0.17823	N	0.160793	T	0.25158	0.0611	L	0.27053	0.805	0.09310	N	1	P	0.36909	0.573	B	0.38378	0.272	T	0.10706	-1.0618	9	0.56958	D	0.05	-4.7044	7.8867	0.29655	0.0:0.6588:0.0:0.3412	.	29	Q6UXQ4	CB066_HUMAN	S	29	.	ENSP00000339384:A29S	A	-	1	0	C2orf66	197382272	0.002000	0.14202	0.016000	0.15963	0.004000	0.04260	0.055000	0.14229	0.483000	0.27608	-0.136000	0.14681	GCC		0.498	C2orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256102.1	NM_213608		20	163	1	0	8.00594e-06	0.007413	9.68766e-06	20	163				
PARD3B	117583	broad.mit.edu	37	2	206364739	206364739	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:206364739A>T	ENST00000406610.2	+	21	3371	c.3164A>T	c.(3163-3165)gAg>gTg	p.E1055V	PARD3B_ENST00000358768.2_Missense_Mutation_p.E993V|PARD3B_ENST00000349953.3_Missense_Mutation_p.E954V|PARD3B_ENST00000351153.1_Missense_Mutation_p.E986V|PARD3B_ENST00000488622.1_3'UTR	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	1055					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)		p.E994V(1)|p.E993V(1)|p.E986V(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		AGGCCATCTGAGTATGACCTA	0.438																																							uc002var.1		NA																	3	Substitution - Missense(3)		lung(3)	skin(2)|ovary(1)|breast(1)	4						c.(3163-3165)GAG>GTG		par-3 partitioning defective 3 homolog B isoform							215.0	196.0	202.0					2																	206364739		1926	4126	6052	SO:0001583	missense	117583				cell cycle|cell division	endomembrane system|tight junction		g.chr2:206364739A>T	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.3164A>T	2.37:g.206364739A>T	ENSP00000385848:p.Glu1055Val		Somatic				PARD3B_uc002vao.1_Missense_Mutation_p.E954V|PARD3B_uc002vap.1_Missense_Mutation_p.E993V|PARD3B_uc002vaq.1_Missense_Mutation_p.E986V	p.E1055V	NM_152526	NP_689739	WXS	Illumina HiSeq	Unspecified	Q8TEW8	PAR3L_HUMAN		Epithelial(149;0.0739)	21	3371	+		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)	1055					E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	ENST00000406610.2	37	c.3164A>T		.	.	.	.	.	.	.	.	.	.	A	11.11	1.540884	0.27563	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.14640	2.7;2.49;2.68;2.59	5.59	5.59	0.84812	.	0.228662	0.30791	N	0.008880	T	0.14743	0.0356	L	0.27053	0.805	0.22835	N	0.998671	B;P;P;P	0.40875	0.31;0.612;0.731;0.731	B;B;P;P	0.44359	0.057;0.261;0.447;0.447	T	0.10823	-1.0613	10	0.42905	T	0.14	.	15.2456	0.73504	1.0:0.0:0.0:0.0	.	1055;986;993;954	Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	PAR3L_HUMAN;.;.;.	V	1055;993;986;954	ENSP00000385848:E1055V;ENSP00000351618:E993V;ENSP00000317261:E986V;ENSP00000340280:E954V	ENSP00000340280:E954V	E	+	2	0	PARD3B	206072984	1.000000	0.71417	0.983000	0.44433	0.140000	0.21249	6.361000	0.73070	2.257000	0.74773	0.460000	0.39030	GAG		0.438	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177		45	157	0	0	0	0.00361	0	45	157				
ADAM23	8745	broad.mit.edu	37	2	207452814	207452814	+	Splice_Site	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:207452814G>T	ENST00000264377.3	+	20	2116		c.e20-1		ADAM23_ENST00000374415.3_Splice_Site|ADAM23_ENST00000374416.1_Splice_Site	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.?(2)		NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CCTGTCCCCAGGGCCGCTGCT	0.493																																					Melanoma(194;1127 2130 19620 24042 27855)	Melanoma(194;1127 2130 19620 24042 27855)	uc002vbq.2		NA																	2	Unknown(2)		lung(2)	skin(2)|ovary(1)	3						c.e20-1		ADAM metallopeptidase domain 23 preproprotein							139.0	117.0	124.0					2																	207452814		2203	4300	6503	SO:0001630	splice_region_variant	8745				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr2:207452814G>T	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1789-1G>T	2.37:g.207452814G>T			Somatic				ADAM23_uc010ziv.1_Splice_Site	p.G597_splice	NM_003812	NP_003803	WXS	Illumina HiSeq	Unspecified	O75077	ADA23_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)	20	2012	+								A2RU59	Splice_Site	SNP	ENST00000264377.3	37	c.1789_splice	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327976	0.81690	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8948	0.96954	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAM23	207161059	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	9.837000	0.99465	2.699000	0.92147	0.655000	0.94253	.		0.493	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	Intron	16	48	1	0	2.5808e-16	0.006122	4.01348e-16	16	48				
ASIC4	55515	broad.mit.edu	37	2	220396524	220396524	+	Silent	SNP	G	G	T	rs571235595		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:220396524G>T	ENST00000347842.3	+	2	1022	c.1008G>T	c.(1006-1008)ccG>ccT	p.P336P	ASIC4_ENST00000473709.1_3'UTR|ASIC4_ENST00000358078.4_Silent_p.P336P	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	336					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)	p.P336P(1)									ACGCGGACCCGCGGAGCTCGC	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		18274	0.0		0.0	False		,,,				2504	0.001						uc002vma.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1006-1008)CCG>CCT		amiloride-sensitive cation channel 4 isoform 2							59.0	65.0	63.0					2																	220396524		2203	4300	6503	SO:0001819	synonymous_variant	55515					integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity	g.chr2:220396524G>T	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1008G>T	2.37:g.220396524G>T			Somatic				ACCN4_uc010fwi.1_Silent_p.P336P|ACCN4_uc010fwj.1_Silent_p.P336P|ACCN4_uc002vly.1_Silent_p.P336P|ACCN4_uc002vlz.2_Silent_p.P336P|ACCN4_uc002vmb.2_5'UTR	p.P336P	NM_182847	NP_878267	WXS	Illumina HiSeq	Unspecified	Q96FT7	ACCN4_HUMAN		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)	2	1022	+		Renal(207;0.0183)	336			Extracellular (Potential).		Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Silent	SNP	ENST00000347842.3	37	c.1008G>T	CCDS2442.1																																																																																				0.617	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674		29	85	1	0	2.4375e-19	0.007291	3.89428e-19	29	85				
SIRPB1	10326	broad.mit.edu	37	20	1551451	1551451	+	Splice_Site	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr20:1551451C>A	ENST00000381605.4	-	4	1148	c.1084G>T	c.(1084-1086)Gaa>Taa	p.E362*	RP4-576H24.4_ENST00000564763.1_Intron|SIRPB1_ENST00000381603.3_Intron|SIRPB1_ENST00000262929.5_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	362					cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.E362*(1)		central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						GTAACCGCACCATGGGTGATA	0.413																																							uc010gai.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1084-1086)GAA>TAA		signal-regulatory protein beta 1 isoform 1							141.0	141.0	141.0					20																	1551451		2203	4300	6503	SO:0001630	splice_region_variant	10326				cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding	g.chr20:1551451C>A	Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.1084+1G>T	20.37:g.1551451C>A			Somatic				SIRPB1_uc002wfk.3_Intron	p.E362*	NM_006065	NP_006056	WXS	Illumina HiSeq	Unspecified	O00241	SIRB1_HUMAN			4	1183	-			362			Extracellular (Potential).		A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Nonsense_Mutation	SNP	ENST00000381605.4	37	c.1084G>T	CCDS13019.1	.	.	.	.	.	.	.	.	.	.	.	16.29	3.080537	0.55753	.	.	ENSG00000101307	ENST00000381605	.	.	.	2.28	2.28	0.28536	.	2.180280	0.01968	N	0.043864	.	.	.	.	.	.	0.25085	N	0.990894	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1144	0.30933	0.0:1.0:0.0:0.0	.	.	.	.	X	362	.	.	E	-	1	0	SIRPB1	1499451	0.036000	0.19791	0.181000	0.23098	0.007000	0.05969	1.685000	0.37659	1.584000	0.49913	0.462000	0.41574	GAA		0.413	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	Nonsense_Mutation	38	104	1	0	2.35958e-20	0.009718	3.81451e-20	38	104				
LAMP5	24141	broad.mit.edu	37	20	9496758	9496758	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr20:9496758C>A	ENST00000246070.2	+	3	841	c.349C>A	c.(349-351)Ctc>Atc	p.L117I	LAMP5_ENST00000427562.2_Intron|RP5-1119D9.4_ENST00000443469.1_RNA	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	117						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)		p.L117I(1)									CGCATATGCACTCAAAATGCT	0.617																																							uc002wni.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						c.(349-351)CTC>ATC		chromosome 20 open reading frame 103 precursor							43.0	44.0	44.0					20																	9496758		2203	4300	6503	SO:0001583	missense	24141					integral to membrane		g.chr20:9496758C>A	AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.349C>A	20.37:g.9496758C>A	ENSP00000246070:p.Leu117Ile		Somatic				C20orf103_uc010zrc.1_Intron	p.L117I	NM_012261	NP_036393	WXS	Illumina HiSeq	Unspecified	Q9UJQ1	CT103_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		3	578	+			117			Extracellular (Potential).		B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	ENST00000246070.2	37	c.349C>A	CCDS13106.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654901	0.67472	.	.	ENSG00000125869	ENST00000246070	T	0.50277	0.75	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	T	0.58264	0.2110	L	0.32530	0.975	0.80722	D	1	D	0.67145	0.996	D	0.63381	0.914	T	0.49670	-0.8915	9	.	.	.	-18.4034	20.5182	0.99214	0.0:1.0:0.0:0.0	.	117	Q9UJQ1	CT103_HUMAN	I	117	ENSP00000246070:L117I	.	L	+	1	0	C20orf103	9444758	1.000000	0.71417	0.969000	0.41365	0.448000	0.32197	4.553000	0.60753	2.860000	0.98153	0.655000	0.94253	CTC		0.617	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077946.2	NM_012261		10	14	1	0	4.3838e-07	0.001855	5.63828e-07	10	14				
KIAA1755	85449	broad.mit.edu	37	20	36869019	36869019	+	Missense_Mutation	SNP	G	G	T	rs144867582		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr20:36869019G>T	ENST00000279024.4	-	3	1785	c.1514C>A	c.(1513-1515)tCt>tAt	p.S505Y		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	505								p.S505Y(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GGGTTTAGGAGAGTAGAGGGA	0.502																																							uc002xhy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(1513-1515)TCT>TAT		hypothetical protein LOC85449							132.0	128.0	130.0					20																	36869019		2203	4300	6503	SO:0001583	missense	85449							g.chr20:36869019G>T	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.1514C>A	20.37:g.36869019G>T	ENSP00000279024:p.Ser505Tyr		Somatic				KIAA1755_uc002xhz.1_Missense_Mutation_p.S505Y	p.S505Y	NM_001029864	NP_001025035	WXS	Illumina HiSeq	Unspecified	Q5JYT7	K1755_HUMAN			3	1786	-		Myeloproliferative disorder(115;0.00874)	505					Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	c.1514C>A	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667768	0.47677	.	.	ENSG00000149633	ENST00000279024;ENST00000373398	T	0.11604	2.76	4.85	2.84	0.33178	.	0.145065	0.32328	N	0.006256	T	0.19644	0.0472	M	0.69823	2.125	0.09310	N	0.999999	D	0.55385	0.971	P	0.52710	0.707	T	0.05338	-1.0891	10	0.87932	D	0	.	7.0949	0.25305	0.0872:0.0:0.7434:0.1694	.	505	Q5JYT7	K1755_HUMAN	Y	505;52	ENSP00000279024:S505Y	ENSP00000279024:S505Y	S	-	2	0	KIAA1755	36302433	0.869000	0.29996	0.001000	0.08648	0.041000	0.13682	4.090000	0.57693	0.597000	0.29811	0.655000	0.94253	TCT		0.502	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864		39	83	1	0	7.04047e-22	0.005524	1.14723e-21	39	83				
EYA2	2139	broad.mit.edu	37	20	45702913	45702913	+	Silent	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr20:45702913C>A	ENST00000327619.5	+	7	974	c.600C>A	c.(598-600)tcC>tcA	p.S200S	EYA2_ENST00000317304.6_Silent_p.S200S|EYA2_ENST00000357410.3_Silent_p.S200S	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	200					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)	p.S200S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				TCTCCACGTCCACCTACGTCC	0.617																																					Pancreas(120;56 1725 18501 25218 43520)	Pancreas(120;56 1725 18501 25218 43520)	uc002xsm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(598-600)TCC>TCA		eyes absent 2 isoform a							148.0	119.0	129.0					20																	45702913		2203	4300	6503	SO:0001819	synonymous_variant	2139				DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity	g.chr20:45702913C>A		CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.600C>A	20.37:g.45702913C>A			Somatic				EYA2_uc010ghp.2_Silent_p.S200S|EYA2_uc002xsn.2_Silent_p.S205S|EYA2_uc002xso.2_Silent_p.S200S|EYA2_uc002xsp.2_Silent_p.S200S|EYA2_uc002xsq.2_Silent_p.S200S	p.S200S	NM_005244	NP_005235	WXS	Illumina HiSeq	Unspecified	O00167	EYA2_HUMAN			7	974	+		Myeloproliferative disorder(115;0.0241)	200					Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Silent	SNP	ENST00000327619.5	37	c.600C>A	CCDS13403.1																																																																																				0.617	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080326.2	NM_005244		19	40	1	0	1.96292e-10	0.010504	2.79734e-10	19	40				
CTCFL	140690	broad.mit.edu	37	20	56099046	56099046	+	Silent	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr20:56099046C>G	ENST00000608263.1	-	1	877	c.216G>C	c.(214-216)tcG>tcC	p.S72S	CTCFL_ENST00000433949.3_Intron|CTCFL_ENST00000608858.1_Intron|CTCFL_ENST00000423479.3_Silent_p.S72S|CTCFL_ENST00000608425.1_Silent_p.S72S|CTCFL_ENST00000422869.2_Silent_p.S72S|CTCFL_ENST00000609232.1_Silent_p.S72S|CTCFL_ENST00000481655.2_Silent_p.S72S|CTCFL_ENST00000432255.2_Silent_p.S72S|CTCFL_ENST00000608903.1_Intron|CTCFL_ENST00000371196.2_Silent_p.S72S|CTCFL_ENST00000429804.3_Silent_p.S72S|CTCFL_ENST00000608158.1_Silent_p.S72S|CTCFL_ENST00000502686.2_Intron|CTCFL_ENST00000608440.1_Silent_p.S72S|CTCFL_ENST00000539382.1_Intron|CTCFL_ENST00000243914.3_Silent_p.S72S	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	72					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)	p.S72S(1)		NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			CGCTCTCCTCCGAGGGGGCCA	0.587																																							uc010gix.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)|skin(1)	4						c.(214-216)TCG>TCC		CCCTC-binding factor-like protein							94.0	94.0	94.0					20																	56099046		2203	4299	6502	SO:0001819	synonymous_variant	140690				cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding	g.chr20:56099046C>G		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.216G>C	20.37:g.56099046C>G			Somatic				CTCFL_uc010giw.1_Silent_p.S72S|CTCFL_uc002xym.2_Silent_p.S72S|CTCFL_uc010giz.1_Intron|CTCFL_uc010giy.1_Intron|CTCFL_uc010gja.1_Silent_p.S72S|CTCFL_uc010gjb.1_Silent_p.S72S|CTCFL_uc010gjc.1_Silent_p.S72S|CTCFL_uc010gjd.1_Silent_p.S72S|CTCFL_uc010gje.2_Silent_p.S72S|CTCFL_uc010gjf.2_Intron|CTCFL_uc010gjg.2_Intron|CTCFL_uc010gjh.1_Silent_p.S72S|CTCFL_uc010gji.1_Intron|CTCFL_uc010gjj.1_Silent_p.S72S|CTCFL_uc010gjk.1_Silent_p.S72S|CTCFL_uc010gjl.1_Silent_p.S72S	p.S72S	NM_080618	NP_542185	WXS	Illumina HiSeq	Unspecified	Q8NI51	CTCFL_HUMAN	BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)		1	878	-	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		72					A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Silent	SNP	ENST00000608263.1	37	c.216G>C	CCDS13459.1																																																																																				0.587	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618		37	63	0	0	0	0.003755	0	37	63				
ARFGAP1	55738	broad.mit.edu	37	20	61910347	61910347	+	Splice_Site	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr20:61910347G>T	ENST00000370283.4	+	7	767	c.627G>T	c.(625-627)tcG>tcT	p.S209S	ARFGAP1_ENST00000519604.1_Splice_Site_p.S156S|ARFGAP1_ENST00000353546.3_Splice_Site_p.S209S|ARFGAP1_ENST00000519273.2_Splice_Site_p.S96S|ARFGAP1_ENST00000370275.4_Splice_Site_p.S209S|ARFGAP1_ENST00000547204.1_Splice_Site_p.S135S	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	209					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)	p.S209S(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					CCCTGTACTCGGTGAGGACTT	0.612																																							uc002yem.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(625-627)TCG>TCT		ADP-ribosylation factor GTPase activating							95.0	79.0	85.0					20																	61910347		2203	4300	6503	SO:0001630	splice_region_variant	55738				COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding	g.chr20:61910347G>T	AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.627+1G>T	20.37:g.61910347G>T			Somatic				ARFGAP1_uc011aas.1_Silent_p.S156S|ARFGAP1_uc011aat.1_Silent_p.S96S|ARFGAP1_uc002yel.2_Silent_p.S209S|ARFGAP1_uc002yen.2_Silent_p.S209S	p.S209S	NM_018209	NP_060679	WXS	Illumina HiSeq	Unspecified	Q8N6T3	ARFG1_HUMAN			7	739	+	all_cancers(38;1.59e-09)		209					B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Silent	SNP	ENST00000370283.4	37	c.627G>T	CCDS13515.1																																																																																				0.612	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080134.3	NM_018209	Silent	8	19	1	0	5.18039e-06	0.00308	6.34365e-06	8	19				
KRTAP11-1	337880	broad.mit.edu	37	21	32253584	32253584	+	Missense_Mutation	SNP	C	C	G	rs368602449		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr21:32253584C>G	ENST00000332378.4	-	1	290	c.260G>C	c.(259-261)cGa>cCa	p.R87P		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	87						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.R87P(3)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						GGTAGTTTGTCGAGAGCAAGT	0.562																																							uc002yov.2		NA																	3	Substitution - Missense(3)		lung(3)	pancreas(1)	1						c.(259-261)CGA>CCA		keratin associated protein 11-1							88.0	83.0	85.0					21																	32253584		2203	4300	6503	SO:0001583	missense	337880					keratin filament	structural molecule activity	g.chr21:32253584C>G	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.260G>C	21.37:g.32253584C>G	ENSP00000330720:p.Arg87Pro		Somatic					p.R87P	NM_175858	NP_787054	WXS	Illumina HiSeq	Unspecified	Q8IUC1	KR111_HUMAN			1	291	-			87					A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	37	c.260G>C	CCDS13608.1	.	.	.	.	.	.	.	.	.	.	C	11.59	1.684452	0.29872	.	.	ENSG00000182591	ENST00000332378	T	0.03496	3.91	5.4	3.44	0.39384	.	0.155844	0.40222	N	0.001147	T	0.05135	0.0137	L	0.49778	1.585	0.09310	N	0.999999	B	0.18166	0.026	B	0.20184	0.028	T	0.30387	-0.9980	10	0.24483	T	0.36	-4.064	14.4357	0.67279	0.0:0.7222:0.2778:0.0	.	87	Q8IUC1	KR111_HUMAN	P	87	ENSP00000330720:R87P	ENSP00000330720:R87P	R	-	2	0	KRTAP11-1	31175455	0.328000	0.24687	0.105000	0.21289	0.909000	0.53808	1.165000	0.31822	1.398000	0.46701	0.650000	0.86243	CGA		0.562	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1			3	31	0	0	0	0.009096	0	3	31				
COL6A1	1291	broad.mit.edu	37	21	47423462	47423462	+	Silent	SNP	G	G	T	rs371763977	byFrequency	TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr21:47423462G>T	ENST00000361866.3	+	35	2736	c.2622G>T	c.(2620-2622)gcG>gcT	p.A874A	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	874	C-terminal globular domain.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)	p.A874A(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		TGCGGGTGGCGGTGGTGCAGT	0.697																																							uc002zhu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2620-2622)GCG>GCT		collagen, type VI, alpha 1 precursor	Palifermin(DB00039)						21.0	24.0	23.0					21																	47423462		2196	4284	6480	SO:0001819	synonymous_variant	1291				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding	g.chr21:47423462G>T	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2622G>T	21.37:g.47423462G>T			Somatic				COL6A1_uc010gqd.1_Silent_p.A205A|COL6A1_uc002zhv.1_Silent_p.A205A|COL6A1_uc002zhw.1_5'UTR	p.A874A	NM_001848	NP_001839	WXS	Illumina HiSeq	Unspecified	P12109	CO6A1_HUMAN		Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	35	2724	+	all_hematologic(128;0.24)		874			C-terminal globular domain.|VWFA 3.		O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Silent	SNP	ENST00000361866.3	37	c.2622G>T	CCDS13727.1																																																																																				0.697	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848		10	25	1	0	1.11149e-13	0.008291	1.67132e-13	10	25				
SEZ6L	23544	broad.mit.edu	37	22	26747161	26747161	+	Missense_Mutation	SNP	C	C	A	rs369993825		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr22:26747161C>A	ENST00000248933.6	+	12	2646	c.2551C>A	c.(2551-2553)Cgt>Agt	p.R851S	SEZ6L_ENST00000402979.1_Missense_Mutation_p.R624S|SEZ6L_ENST00000404234.3_Missense_Mutation_p.R851S|SEZ6L_ENST00000403121.1_Missense_Mutation_p.R624S|SEZ6L_ENST00000360929.3_Intron|SEZ6L_ENST00000411842.2_Missense_Mutation_p.R48S|SEZ6L_ENST00000529632.2_Missense_Mutation_p.R851S|SEZ6L_ENST00000343706.4_Missense_Mutation_p.R851S			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	851	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.R851S(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CTGCTACAGCCGTGAAACAGG	0.532																																							uc003acb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(2551-2553)CGT>AGT		seizure related 6 homolog (mouse)-like							131.0	111.0	118.0					22																	26747161		2203	4300	6503	SO:0001583	missense	23544					endoplasmic reticulum membrane|integral to membrane		g.chr22:26747161C>A	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2551C>A	22.37:g.26747161C>A	ENSP00000248933:p.Arg851Ser		Somatic				SEZ6L_uc003acc.2_Missense_Mutation_p.R851S|SEZ6L_uc011akc.1_Missense_Mutation_p.R851S|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Missense_Mutation_p.R851S|SEZ6L_uc003ace.2_Missense_Mutation_p.R851S|SEZ6L_uc003acf.1_Missense_Mutation_p.R624S|SEZ6L_uc010gvc.1_Missense_Mutation_p.R624S|SEZ6L_uc011ake.1_RNA	p.R851S	NM_021115	NP_066938	WXS	Illumina HiSeq	Unspecified	Q9BYH1	SE6L1_HUMAN			12	2707	+			851			Sushi 4.|Extracellular (Potential).		A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	c.2551C>A	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	c	16.88	3.245613	0.59103	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979;ENST00000411842	T;T;T;T;T;T;T	0.61510	0.1;0.1;0.1;0.1;0.1;0.1;0.1	4.54	4.54	0.55810	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.50627	D	0.000107	T	0.48943	0.1528	L	0.31120	0.905	0.58432	D	0.999997	B;B;B;P;B;B	0.36110	0.399;0.449;0.034;0.537;0.314;0.449	B;B;B;B;B;B	0.40982	0.242;0.331;0.092;0.345;0.135;0.331	T	0.53585	-0.8418	10	0.56958	D	0.05	.	11.711	0.51625	0.1765:0.8235:0.0:0.0	.	851;851;624;851;851;851	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	S	851;851;851;851;624;624;48	ENSP00000384772:R851S;ENSP00000437037:R851S;ENSP00000248933:R851S;ENSP00000342661:R851S;ENSP00000384838:R624S;ENSP00000384733:R624S;ENSP00000397274:R48S	ENSP00000248933:R851S	R	+	1	0	SEZ6L	25077161	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	5.140000	0.64807	2.381000	0.81170	0.539000	0.68188	CGT		0.532	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3			19	43	1	0	1.10923e-09	0.00278	1.5224e-09	19	43				
TTLL8	164714	broad.mit.edu	37	22	50485615	50485615	+	Silent	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr22:50485615T>A	ENST00000266182.6	-	4	374	c.375A>T	c.(373-375)acA>acT	p.T125T	TTLL8_ENST00000477219.1_5'UTR|TTLL8_ENST00000440475.1_Silent_p.T125T			A6PVC2	TTLL8_HUMAN	tubulin tyrosine ligase-like family, member 8	161					cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)	p.T161T(1)|p.T125T(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(4)	12		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		TGAAGGAGGCTGTCTTTGCGT	0.582																																							uc011ark.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(373-375)ACA>ACT		tubulin tyrosine ligase-like family, member 8							176.0	173.0	174.0					22																	50485615		2052	4187	6239	SO:0001819	synonymous_variant	164714							g.chr22:50485615T>A			22q13.33	2013-02-14			ENSG00000138892	ENSG00000138892		"""Tubulin tyrosine ligase-like family"""	34000	protein-coding gene	gene with protein product						15890843	Standard	XM_003403745		Approved			A6PVC2	OTTHUMG00000150241	ENST00000266182.6:c.375A>T	22.37:g.50485615T>A			Somatic					p.T125T	NM_001080447	NP_001073916	WXS	Illumina HiSeq	Unspecified				READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)	4	375	-		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)						B5MDV0	Silent	SNP	ENST00000266182.6	37	c.375A>T																																																																																					0.582	TTLL8-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001080447		5	23	0	0	0	0.000602	0	5	23				
SRGAP3	9901	broad.mit.edu	37	3	9032338	9032338	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:9032338G>A	ENST00000383836.3	-	21	3171	c.2744C>T	c.(2743-2745)gCg>gTg	p.A915V	SRGAP3_ENST00000360413.3_Missense_Mutation_p.A891V	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	915					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.A915V(1)	SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CCCGAACGTCGCCATCCTCCG	0.652			T	RAF1	pilocytic astrocytoma																																		uc003brf.1		NA		Dom	yes		3	3p25.3	9901	T	SLIT-ROBO Rho GTPase activating protein 3			M	RAF1		pilocytic astrocytoma	SRGAP3/RAF1(4)	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9						c.(2743-2745)GCG>GTG		SLIT-ROBO Rho GTPase activating protein 3							23.0	23.0	23.0					3																	9032338		2203	4300	6503	SO:0001583	missense	9901				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding	g.chr3:9032338G>A	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.2744C>T	3.37:g.9032338G>A	ENSP00000373347:p.Ala915Val		Somatic				SRGAP3_uc003brg.1_Missense_Mutation_p.A891V	p.A915V	NM_014850	NP_055665	WXS	Illumina HiSeq	Unspecified	O43295	SRGP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.0563)	21	3420	-			915					Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	37	c.2744C>T	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480766	0.63849	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.25250	1.81;2.23	5.13	5.13	0.70059	.	0.056179	0.64402	D	0.000001	T	0.20861	0.0502	N	0.22421	0.69	0.43714	D	0.99618	P;P	0.48089	0.902;0.905	B;B	0.40256	0.324;0.173	T	0.03433	-1.1037	10	0.59425	D	0.04	.	18.1734	0.89753	0.0:0.0:1.0:0.0	.	891;915	O43295-2;O43295	.;SRGP2_HUMAN	V	915;891	ENSP00000373347:A915V;ENSP00000353587:A891V	ENSP00000353587:A891V	A	-	2	0	SRGAP3	9007338	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.370000	0.66144	2.392000	0.81423	0.655000	0.94253	GCG		0.652	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3			5	12	0	0	0	0.000602	0	5	12				
ATP2B2	491	broad.mit.edu	37	3	10444022	10444022	+	Silent	SNP	C	C	G	rs371793867		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:10444022C>G	ENST00000352432.4	-	3	477	c.408G>C	c.(406-408)acG>acC	p.T136T	ATP2B2_ENST00000360273.2_Silent_p.T136T|ATP2B2_ENST00000343816.4_Silent_p.T136T|ATP2B2_ENST00000397077.1_Silent_p.T136T|ATP2B2_ENST00000383800.4_Silent_p.T136T			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	136					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.T136T(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CACCCTGGGCCGTCGCACATC	0.582																																					Ovarian(125;1619 1709 15675 19819 38835)	Ovarian(125;1619 1709 15675 19819 38835)	uc003bvt.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(406-408)ACG>ACC		plasma membrane calcium ATPase 2 isoform 1							78.0	86.0	83.0					3																	10444022		2203	4300	6503	SO:0001819	synonymous_variant	491				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	g.chr3:10444022C>G	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.408G>C	3.37:g.10444022C>G			Somatic				ATP2B2_uc003bvv.2_Silent_p.T136T|ATP2B2_uc003bvw.2_Silent_p.T136T|ATP2B2_uc010hdp.2_Silent_p.T136T|ATP2B2_uc010hdo.2_5'UTR	p.T136T	NM_001001331	NP_001001331	WXS	Illumina HiSeq	Unspecified	Q01814	AT2B2_HUMAN			4	847	-			136			Extracellular (Potential).		O00766|Q12994|Q16818	Silent	SNP	ENST00000352432.4	37	c.408G>C	CCDS33701.1																																																																																				0.582	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		34	73	0	0	0	0.002836	0	34	73				
ZNF662	389114	broad.mit.edu	37	3	42949613	42949613	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:42949613G>A	ENST00000541208.1	+	2	376	c.7G>A	c.(7-9)Gag>Aag	p.E3K	ZNF662_ENST00000422021.1_Missense_Mutation_p.E3K|ZNF662_ENST00000328199.6_Missense_Mutation_p.E64K|ZNF662_ENST00000440367.2_Missense_Mutation_p.E3K|KRBOX1_ENST00000426937.1_Intron			Q6ZS27	ZN662_HUMAN	zinc finger protein 662	3	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E64K(1)|p.E3K(1)		breast(2)|endometrium(1)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.217)		TGTGATGCTGGAGAATTATGG	0.567																																							uc003cmi.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(7-9)GAG>AAG		zinc finger protein 662 isoform 1							143.0	123.0	130.0					3																	42949613		2203	4300	6503	SO:0001583	missense	389114				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:42949613G>A	AK127779	CCDS2708.1, CCDS46807.1	3p22.1	2013-01-08			ENSG00000182983	ENSG00000182983		"""Zinc fingers, C2H2-type"", ""-"""	31930	protein-coding gene	gene with protein product							Standard	NM_207404		Approved	FLJ45880	uc003cmk.2	Q6ZS27	OTTHUMG00000133041	ENST00000541208.1:c.7G>A	3.37:g.42949613G>A	ENSP00000446208:p.Glu3Lys		Somatic				ZNF662_uc003cmk.2_Missense_Mutation_p.E64K|ZNF662_uc003cmj.2_5'UTR	p.E3K	NM_207404	NP_997287	WXS	Illumina HiSeq	Unspecified	Q6ZS27	ZN662_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.217)	2	359	+			3			KRAB.		A1A4T9|F8W7S8|Q6ZNF8|Q6ZQW8	Missense_Mutation	SNP	ENST00000541208.1	37	c.7G>A	CCDS2708.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263996	0.80358	.	.	ENSG00000182983	ENST00000440367;ENST00000328199;ENST00000541208;ENST00000422021	T;T;T	0.25749	1.78;3.67;1.78	2.97	2.97	0.34412	Krueppel-associated box (2);	.	.	.	.	T	0.50837	0.1639	H	0.98646	4.29	0.27810	N	0.942179	P;P	0.44139	0.827;0.734	B;B	0.43386	0.418;0.187	T	0.60959	-0.7159	8	.	.	.	.	11.7517	0.51852	0.0:0.0:1.0:0.0	.	64;3	F8W7S8;Q6ZS27	.;ZN662_HUMAN	K	3;64;3;3	ENSP00000405047:E3K;ENSP00000329264:E64K;ENSP00000446208:E3K	.	E	+	1	0	ZNF662	42924617	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.495000	0.66912	1.686000	0.51046	0.655000	0.94253	GAG		0.567	ZNF662-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256646.4	NM_207404		7	25	0	0	0	0.00308	0	7	25				
UQCRC1	7384	broad.mit.edu	37	3	48646610	48646610	+	Silent	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:48646610A>G	ENST00000203407.5	-	2	611	c.195T>C	c.(193-195)tcT>tcC	p.S65S	UQCRC1_ENST00000493806.1_5'Flank	NM_003365.2	NP_003356.2	P31930	QCR1_HUMAN	ubiquinol-cytochrome c reductase core protein I	65					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to alkaloid (GO:0043279)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)	p.S65S(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		AAGTGGGCTGAGAGGACTGCT	0.647																																					NSCLC(81;1112 1427 27031 32409 45529)	NSCLC(81;1112 1427 27031 32409 45529)	uc003cub.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(193-195)TCT>TCC		ubiquinol-cytochrome c reductase core protein I	Atovaquone(DB01117)						48.0	42.0	44.0					3																	48646610		2203	4300	6503	SO:0001819	synonymous_variant	7384				aerobic respiration|proteolysis		metalloendopeptidase activity|ubiquinol-cytochrome-c reductase activity|zinc ion binding	g.chr3:48646610A>G	BC009586	CCDS2774.1	3p21	2011-07-04			ENSG00000010256	ENSG00000010256	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12585	protein-coding gene	gene with protein product		191328				8407948	Standard	NM_003365		Approved	D3S3191, QCR1, UQCR1	uc003cub.1	P31930	OTTHUMG00000133539	ENST00000203407.5:c.195T>C	3.37:g.48646610A>G			Somatic				UQCRC1_uc003cuc.1_Silent_p.S65S|UQCRC1_uc003cud.1_Silent_p.S65S	p.S65S	NM_003365	NP_003356	WXS	Illumina HiSeq	Unspecified	P31930	QCR1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)	2	240	-			65					B2R7R8|Q96DD2	Silent	SNP	ENST00000203407.5	37	c.195T>C	CCDS2774.1																																																																																				0.647	UQCRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257517.1	NM_003365		16	21	0	0	0	0.006122	0	16	21				
BSN	8927	broad.mit.edu	37	3	49699759	49699759	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:49699759G>T	ENST00000296452.4	+	6	10595	c.10481G>T	c.(10480-10482)cGa>cTa	p.R3494L		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3494					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.R3494L(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		AGCCGGGTACGACCCCCCATG	0.687																																							uc003cxe.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						c.(10480-10482)CGA>CTA		bassoon protein							30.0	34.0	33.0					3																	49699759		2202	4300	6502	SO:0001583	missense	8927				synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding	g.chr3:49699759G>T	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.10481G>T	3.37:g.49699759G>T	ENSP00000296452:p.Arg3494Leu		Somatic					p.R3494L	NM_003458	NP_003449	WXS	Illumina HiSeq	Unspecified	Q9UPA5	BSN_HUMAN		BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)	6	10595	+			3494					O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	c.10481G>T	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.206402	0.39003	.	.	ENSG00000164061	ENST00000296452	T	0.29142	1.58	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.53417	0.1795	M	0.71206	2.165	0.58432	D	0.999998	D	0.71674	0.998	P	0.58077	0.832	T	0.54675	-0.8258	10	0.87932	D	0	-22.4795	20.0628	0.97684	0.0:0.0:1.0:0.0	.	3494	Q9UPA5	BSN_HUMAN	L	3494	ENSP00000296452:R3494L	ENSP00000296452:R3494L	R	+	2	0	BSN	49674763	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.984000	0.88150	2.745000	0.94114	0.655000	0.94253	CGA		0.687	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458		3	22	1	0	0.004672	0.004672	0.00500222	3	22				
CNTN3	5067	broad.mit.edu	37	3	74350822	74350822	+	Missense_Mutation	SNP	C	C	A	rs187249178		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:74350822C>A	ENST00000263665.6	-	14	1948	c.1921G>T	c.(1921-1923)Gtg>Ttg	p.V641L		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	641	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.V641L(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TGCCAACCCACGGAGAAAGGT	0.448																																							uc003dpm.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(1)|skin(1)	5						c.(1921-1923)GTG>TTG		contactin 3 precursor							162.0	151.0	155.0					3																	74350822		2203	4300	6503	SO:0001583	missense	5067				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr3:74350822C>A	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1921G>T	3.37:g.74350822C>A	ENSP00000263665:p.Val641Leu		Somatic					p.V641L	NM_020872	NP_065923	WXS	Illumina HiSeq	Unspecified	Q9P232	CNTN3_HUMAN		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)	14	2001	-		Lung NSC(201;0.138)|Lung SC(41;0.21)	641			Fibronectin type-III 1.		B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	c.1921G>T	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744670	0.30865	.	.	ENSG00000113805	ENST00000263665	T	0.56776	0.44	5.98	5.98	0.97165	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.39835	0.1093	N	0.11724	0.165	0.42077	D	0.991231	B	0.06786	0.001	B	0.16722	0.016	T	0.14839	-1.0458	10	0.27785	T	0.31	.	20.4366	0.99092	0.0:1.0:0.0:0.0	.	641	Q9P232	CNTN3_HUMAN	L	641	ENSP00000263665:V641L	ENSP00000263665:V641L	V	-	1	0	CNTN3	74433512	0.631000	0.27164	1.000000	0.80357	0.992000	0.81027	1.286000	0.33273	2.837000	0.97791	0.591000	0.81541	GTG		0.448	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872		17	40	1	0	2.94398e-08	0.007413	3.90938e-08	17	40				
CNTN3	5067	broad.mit.edu	37	3	74350861	74350861	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:74350861C>G	ENST00000263665.6	-	14	1909	c.1882G>C	c.(1882-1884)Gtt>Ctt	p.V628L		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	628	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.V628L(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TAGGATATAACTGGGCTATGG	0.463																																							uc003dpm.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(1)|skin(1)	5						c.(1882-1884)GTT>CTT		contactin 3 precursor							259.0	234.0	242.0					3																	74350861		2203	4300	6503	SO:0001583	missense	5067				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr3:74350861C>G	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1882G>C	3.37:g.74350861C>G	ENSP00000263665:p.Val628Leu		Somatic					p.V628L	NM_020872	NP_065923	WXS	Illumina HiSeq	Unspecified	Q9P232	CNTN3_HUMAN		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)	14	1962	-		Lung NSC(201;0.138)|Lung SC(41;0.21)	628			Fibronectin type-III 1.		B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	c.1882G>C	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.382976	0.42207	.	.	ENSG00000113805	ENST00000263665	T	0.57436	0.4	5.83	2.01	0.26516	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.399351	0.28279	N	0.015924	T	0.48429	0.1499	L	0.53671	1.685	0.19300	N	0.999977	B	0.15930	0.015	B	0.31016	0.123	T	0.51694	-0.8673	10	0.66056	D	0.02	.	9.5899	0.39539	0.0:0.6716:0.0:0.3284	.	628	Q9P232	CNTN3_HUMAN	L	628	ENSP00000263665:V628L	ENSP00000263665:V628L	V	-	1	0	CNTN3	74433551	0.201000	0.23410	0.016000	0.15963	0.936000	0.57629	0.709000	0.25734	0.789000	0.33779	0.591000	0.81541	GTT		0.463	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872		10	55	0	0	0	0.008291	0	10	55				
CASR	846	broad.mit.edu	37	3	122003983	122003983	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:122003983G>A	ENST00000490131.1	+	7	3554	c.3182G>A	c.(3181-3183)aGc>aAc	p.S1061N	CASR_ENST00000296154.5_Missense_Mutation_p.S1061N|CASR_ENST00000498619.1_Missense_Mutation_p.S1071N	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	1061					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.S1061N(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	AGTTCACAGAGCTTTGTCATC	0.517																																							uc003eev.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7						c.(3181-3183)AGC>AAC		calcium-sensing receptor precursor	Cinacalcet(DB01012)						91.0	88.0	89.0					3																	122003983		2200	4295	6495	SO:0001583	missense	846				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity	g.chr3:122003983G>A	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.3182G>A	3.37:g.122003983G>A	ENSP00000418685:p.Ser1061Asn		Somatic				CASR_uc003eew.3_Missense_Mutation_p.S1071N	p.S1061N	NM_000388	NP_000379	WXS	Illumina HiSeq	Unspecified	P41180	CASR_HUMAN		GBM - Glioblastoma multiforme(114;0.226)	7	3554	+			1061			Cytoplasmic (Potential).		Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	c.3182G>A	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.664683	0.29604	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.89552	-2.53;-2.53;-2.53	5.48	5.48	0.80851	.	0.254751	0.40302	N	0.001123	T	0.81484	0.4832	L	0.27053	0.805	0.31121	N	0.708868	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.75775	-0.3199	10	0.31617	T	0.26	.	12.0622	0.53568	0.0878:0.0:0.9122:0.0	.	1071;1061	E7ENE0;P41180	.;CASR_HUMAN	N	1061;1071;1061	ENSP00000418685:S1061N;ENSP00000420194:S1071N;ENSP00000296154:S1061N	ENSP00000296154:S1061N	S	+	2	0	CASR	123486673	1.000000	0.71417	0.989000	0.46669	0.962000	0.63368	3.806000	0.55583	2.741000	0.93983	0.555000	0.69702	AGC		0.517	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388		30	70	0	0	0	0.002836	0	30	70				
PLCH1	23007	broad.mit.edu	37	3	155199813	155199813	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:155199813C>A	ENST00000340059.7	-	23	4025	c.4026G>T	c.(4024-4026)gaG>gaT	p.E1342D	PLCH1_ENST00000334686.6_Missense_Mutation_p.E1304D|PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000460012.1_Missense_Mutation_p.E1304D|PLCH1_ENST00000414191.1_Missense_Mutation_p.E1304D|PLCH1_ENST00000447496.2_3'UTR	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1342					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.E1304D(1)|p.E1342D(1)		NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CTATTACATCCTCCAGGGTCA	0.468																																							uc011bok.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(1)	4						c.(4024-4026)GAG>GAT		phospholipase C eta 1 isoform a							48.0	52.0	51.0					3																	155199813		2203	4300	6503	SO:0001583	missense	23007				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr3:155199813C>A	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4026G>T	3.37:g.155199813C>A	ENSP00000345988:p.Glu1342Asp		Somatic				PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.E1304D	p.E1342D	NM_001130960	NP_001124432	WXS	Illumina HiSeq	Unspecified	Q4KWH8	PLCH1_HUMAN	Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		23	4303	-			1342					Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	c.4026G>T	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.033087	0.54896	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.21	-8.19	0.01049	.	2.543170	0.01178	N	0.007024	T	0.63141	0.2486	N	0.20986	0.625	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.001	T	0.52147	-0.8614	10	0.40728	T	0.16	.	11.2412	0.48970	0.0:0.6327:0.2335:0.1339	.	1304;1342	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	D	1304;1342;1304;1304	ENSP00000417502:E1304D;ENSP00000345988:E1342D;ENSP00000335469:E1304D;ENSP00000412977:E1304D	ENSP00000335469:E1304D	E	-	3	2	PLCH1	156682507	0.000000	0.05858	0.002000	0.10522	0.778000	0.44026	-0.696000	0.05104	-1.071000	0.03145	-0.384000	0.06662	GAG		0.468	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996		6	61	1	0	5.9392e-07	0.001168	7.61484e-07	6	61				
ARL14	80117	broad.mit.edu	37	3	160395577	160395577	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:160395577A>G	ENST00000320767.2	+	1	630	c.443A>G	c.(442-444)gAc>gGc	p.D148G		NM_025047.2	NP_079323.1	Q8N4G2	ARL14_HUMAN	ADP-ribosylation factor-like 14	148					small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	GTP binding (GO:0005525)	p.D148G(1)		lung(6)	6			Lung(72;7.02e-05)|LUSC - Lung squamous cell carcinoma(72;7.23e-05)			CTTTGCAGTGACCGGAACTGG	0.498																																							uc003fdq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(442-444)GAC>GGC		ADP-ribosylation factor-like 14							51.0	49.0	50.0					3																	160395577		2203	4300	6503	SO:0001583	missense	80117				small GTPase mediated signal transduction	intracellular	GTP binding	g.chr3:160395577A>G	AK026248	CCDS3192.1	3q25.33	2014-05-09	2005-11-03	2005-11-03	ENSG00000179674	ENSG00000179674		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22974	protein-coding gene	gene with protein product		614439	"""ADP-ribosylation factor 7"""	ARF7		15367757	Standard	NM_025047		Approved	FLJ22595	uc003fdq.3	Q8N4G2	OTTHUMG00000159031	ENST00000320767.2:c.443A>G	3.37:g.160395577A>G	ENSP00000323847:p.Asp148Gly		Somatic					p.D148G	NM_025047	NP_079323	WXS	Illumina HiSeq	Unspecified	Q8N4G2	ARL14_HUMAN	Lung(72;7.02e-05)|LUSC - Lung squamous cell carcinoma(72;7.23e-05)		1	630	+			148					Q9H655	Missense_Mutation	SNP	ENST00000320767.2	37	c.443A>G	CCDS3192.1	.	.	.	.	.	.	.	.	.	.	A	12.52	1.962343	0.34659	.	.	ENSG00000179674	ENST00000320767	T	0.64260	-0.09	5.75	4.6	0.57074	.	0.095905	0.64402	D	0.000001	T	0.49762	0.1576	L	0.33792	1.035	0.44155	D	0.996958	B	0.15719	0.014	B	0.16289	0.015	T	0.40757	-0.9546	10	0.39692	T	0.17	-11.4488	10.8349	0.46681	0.9262:0.0:0.0738:0.0	.	148	Q8N4G2	ARL14_HUMAN	G	148	ENSP00000323847:D148G	ENSP00000323847:D148G	D	+	2	0	ARL14	161878271	1.000000	0.71417	0.986000	0.45419	0.993000	0.82548	3.547000	0.53663	1.009000	0.39289	0.460000	0.39030	GAC		0.498	ARL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352958.1	NM_025047		21	52	0	0	0	0.002299	0	21	52				
SI	6476	broad.mit.edu	37	3	164766917	164766917	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr3:164766917C>A	ENST00000264382.3	-	15	1775	c.1713G>T	c.(1711-1713)gaG>gaT	p.E571D		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	571	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.E571D(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GCACTTACTGCTCTGTGGCTA	0.328										HNSCC(35;0.089)																													uc003fei.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(1711-1713)GAG>GAT		sucrase-isomaltase	Acarbose(DB00284)						91.0	84.0	86.0					3																	164766917		2203	4300	6503	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164766917C>A	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1713G>T	3.37:g.164766917C>A	ENSP00000264382:p.Glu571Asp	HNSCC(35;0.089)	Somatic					p.E571D	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			15	1775	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	571			Lumenal.|Isomaltase.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.1713G>T	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	4.148	0.025805	0.08054	.	.	ENSG00000090402	ENST00000264382	D	0.92699	-3.09	5.24	0.962	0.19643	Glycoside hydrolase, superfamily (1);	0.115659	0.56097	D	0.000031	D	0.83667	0.5304	N	0.25957	0.775	0.29686	N	0.841313	B	0.02656	0.0	B	0.06405	0.002	T	0.73694	-0.3902	10	0.35671	T	0.21	.	8.5402	0.33388	0.0:0.4476:0.0:0.5524	.	571	P14410	SUIS_HUMAN	D	571	ENSP00000264382:E571D	ENSP00000264382:E571D	E	-	3	2	SI	166249611	0.004000	0.15560	0.987000	0.45799	0.048000	0.14542	-0.487000	0.06505	0.263000	0.21812	0.460000	0.39030	GAG		0.328	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		6	53	1	0	8.12818e-05	0.001984	9.33828e-05	6	53				
CPZ	8532	broad.mit.edu	37	4	8616159	8616159	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:8616159C>T	ENST00000360986.4	+	9	1611	c.1437C>T	c.(1435-1437)ccC>ccT	p.P479P	CPZ_ENST00000382480.2_Silent_p.P342P|CPZ_ENST00000429646.2_Silent_p.P87P|CPZ_ENST00000315782.6_Silent_p.P468P	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	479					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.P479P(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TGAAGTTCCCCCCCGAGGAGG	0.572																																							uc003glm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1435-1437)CCC>CCT		carboxypeptidase Z isoform 1							142.0	125.0	131.0					4																	8616159		2203	4300	6503	SO:0001819	synonymous_variant	8532				proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding	g.chr4:8616159C>T	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1437C>T	4.37:g.8616159C>T			Somatic				CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Silent_p.P342P|CPZ_uc003glo.2_Silent_p.P468P|CPZ_uc003glp.2_RNA	p.P479P	NM_001014447	NP_001014447	WXS	Illumina HiSeq	Unspecified	Q66K79	CBPZ_HUMAN			9	1563	+			479					O00520|Q96MX2	Silent	SNP	ENST00000360986.4	37	c.1437C>T	CCDS33953.1																																																																																				0.572	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652		7	27	0	0	0	0.001984	0	7	27				
BOD1L1	259282	broad.mit.edu	37	4	13588025	13588025	+	Missense_Mutation	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:13588025T>A	ENST00000040738.5	-	17	8563	c.8428A>T	c.(8428-8430)Aca>Tca	p.T2810S		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2810						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T2810S(1)									AATACCTTTGTGTCATGTGGC	0.363																																							uc003gmz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(1)	6						c.(8428-8430)ACA>TCA		biorientation of chromosomes in cell division							99.0	96.0	97.0					4																	13588025		2203	4300	6503	SO:0001583	missense	259282						DNA binding	g.chr4:13588025T>A	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.8428A>T	4.37:g.13588025T>A	ENSP00000040738:p.Thr2810Ser		Somatic					p.T2810S	NM_148894	NP_683692	WXS	Illumina HiSeq	Unspecified	Q8NFC6	BOD1L_HUMAN			17	8545	-			2810					Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	c.8428A>T	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	14.21	2.466820	0.43839	.	.	ENSG00000038219	ENST00000040738	T	0.08008	3.14	5.76	-1.26	0.09376	.	0.631605	0.14804	N	0.297459	T	0.04182	0.0116	N	0.24115	0.695	0.09310	N	1	B	0.30406	0.278	B	0.24974	0.057	T	0.38866	-0.9641	10	0.32370	T	0.25	-0.3225	4.5644	0.12175	0.1416:0.3434:0.0:0.515	.	2810	Q8NFC6	BOD1L_HUMAN	S	2810	ENSP00000040738:T2810S	ENSP00000040738:T2810S	T	-	1	0	BOD1L	13197123	0.000000	0.05858	0.064000	0.19789	0.977000	0.68977	-0.894000	0.04123	-0.098000	0.12285	0.528000	0.53228	ACA		0.363	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894		19	47	0	0	0	0.001882	0	19	47				
SLIT2	9353	broad.mit.edu	37	4	20597397	20597397	+	Missense_Mutation	SNP	A	A	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:20597397A>C	ENST00000504154.1	+	31	3512	c.3260A>C	c.(3259-3261)aAc>aCc	p.N1087T	SLIT2_ENST00000503823.1_Missense_Mutation_p.N1079T|SLIT2_ENST00000503837.1_Missense_Mutation_p.N1083T|SLIT2_ENST00000273739.5_Missense_Mutation_p.N1100T	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1087	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.N1087T(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AAGTGTAAAAACGGAGCCCAC	0.468																																							uc003gpr.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|skin(4)|ovary(3)	11						c.(3259-3261)AAC>ACC		slit homolog 2 precursor							187.0	173.0	178.0					4																	20597397		2203	4300	6503	SO:0001583	missense	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20597397A>C	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3260A>C	4.37:g.20597397A>C	ENSP00000422591:p.Asn1087Thr		Somatic				SLIT2_uc003gps.1_Missense_Mutation_p.N1079T	p.N1087T	NM_004787	NP_004778	WXS	Illumina HiSeq	Unspecified	O94813	SLIT2_HUMAN			31	3464	+			1087			EGF-like 5; calcium-binding (Potential).		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	c.3260A>C	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	A	18.59	3.656880	0.67586	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.95069	-3.6;-3.6;-3.6;-3.6	6.17	6.17	0.99709	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.039534	0.85682	D	0.000000	D	0.97876	0.9302	M	0.93550	3.43	0.80722	D	1	D;D	0.59357	0.972;0.985	P;D	0.65233	0.786;0.933	D	0.98727	1.0711	10	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	1079;1087	O94813-3;O94813	.;SLIT2_HUMAN	T	1079;1087;1100;1083;1083	ENSP00000427548:N1079T;ENSP00000422591:N1087T;ENSP00000273739:N1100T;ENSP00000422261:N1083T	ENSP00000273739:N1100T	N	+	2	0	SLIT2	20206495	1.000000	0.71417	0.983000	0.44433	0.989000	0.77384	7.048000	0.76606	2.371000	0.80710	0.533000	0.62120	AAC		0.468	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			11	110	0	0	0	0.000978	0	11	110				
PPARGC1A	10891	broad.mit.edu	37	4	23814445	23814445	+	Missense_Mutation	SNP	T	T	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:23814445T>G	ENST00000264867.2	-	10	2063	c.1944A>C	c.(1942-1944)gaA>gaC	p.E648D	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	648	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.E648D(1)		central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				TGCGATATTCTTCCCTCTTCA	0.463																																					Esophageal Squamous(29;694 744 13796 34866 44181)	Esophageal Squamous(29;694 744 13796 34866 44181)	uc003gqs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|kidney(2)|skin(2)	8						c.(1942-1944)GAA>GAC		peroxisome proliferator-activated receptor							192.0	178.0	183.0					4																	23814445		2203	4300	6503	SO:0001583	missense	10891				androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding	g.chr4:23814445T>G	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1944A>C	4.37:g.23814445T>G	ENSP00000264867:p.Glu648Asp		Somatic				PPARGC1A_uc003gqt.2_RNA	p.E648D	NM_013261	NP_037393	WXS	Illumina HiSeq	Unspecified	Q9UBK2	PRGC1_HUMAN			10	2064	-		Breast(46;0.0503)	648					B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	ENST00000264867.2	37	c.1944A>C	CCDS3429.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.219367	0.39201	.	.	ENSG00000109819	ENST00000264867	T	0.24538	1.85	5.43	0.302	0.15786	.	0.048413	0.85682	N	0.000000	T	0.38957	0.1060	M	0.78801	2.425	0.80722	D	1	D	0.58970	0.984	D	0.65443	0.935	T	0.23904	-1.0175	10	0.45353	T	0.12	-3.7843	1.309	0.02094	0.1344:0.215:0.1401:0.5106	.	648	Q9UBK2	PRGC1_HUMAN	D	648	ENSP00000264867:E648D	ENSP00000264867:E648D	E	-	3	2	PPARGC1A	23423543	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.060000	0.41394	0.049000	0.15920	0.533000	0.62120	GAA		0.463	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261		16	191	0	0	0	0.006122	0	16	191				
PCDH7	5099	broad.mit.edu	37	4	30725632	30725632	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:30725632A>T	ENST00000361762.2	+	1	3596	c.2588A>T	c.(2587-2589)cAg>cTg	p.Q863L	PCDH7_ENST00000543491.1_Missense_Mutation_p.Q863L	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	863					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q816L(1)|p.Q863L(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						CCACTCACCCAGGATATAGCT	0.448																																							uc003gsk.1		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						c.(2587-2589)CAG>CTG		protocadherin 7 isoform a precursor							88.0	87.0	87.0					4																	30725632		2203	4300	6503	SO:0001583	missense	5099				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chr4:30725632A>T	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2588A>T	4.37:g.30725632A>T	ENSP00000355243:p.Gln863Leu		Somatic				PCDH7_uc011bxw.1_Missense_Mutation_p.Q816L|PCDH7_uc011bxx.1_Missense_Mutation_p.Q863L	p.Q863L	NM_002589	NP_002580	WXS	Illumina HiSeq	Unspecified	O60245	PCDH7_HUMAN			1	3596	+			863			Extracellular (Potential).		O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	c.2588A>T	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	A	7.515	0.655501	0.14580	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.28666	1.6;1.6	4.96	3.78	0.43462	Protocadherin (1);	.	.	.	.	T	0.15392	0.0371	N	0.12961	0.28	0.35668	D	0.81305	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.09377	0.002;0.002;0.004	T	0.13818	-1.0495	9	0.06757	T	0.87	.	10.6111	0.45423	0.9245:0.0:0.0755:0.0	.	863;816;863	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	L	863;863;816	ENSP00000355243:Q863L;ENSP00000441802:Q863L	ENSP00000330302:Q816L	Q	+	2	0	PCDH7	30334730	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.517000	0.60503	0.920000	0.36970	-0.256000	0.11100	CAG		0.448	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589		16	50	0	0	0	0.004007	0	16	50				
SLAIN2	57606	broad.mit.edu	37	4	48381723	48381723	+	Silent	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:48381723A>G	ENST00000264313.6	+	4	1138	c.720A>G	c.(718-720)tcA>tcG	p.S240S	SLAIN2_ENST00000506375.1_3'UTR|SLAIN2_ENST00000512093.1_Silent_p.S47S	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	240					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.S240S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						TGAAAAGCTCAGACAGAAATC	0.313																																							uc003gya.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(718-720)TCA>TCG		SLAIN motif family, member 2							74.0	69.0	71.0					4																	48381723		1799	4069	5868	SO:0001819	synonymous_variant	57606					centrosome		g.chr4:48381723A>G	BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.720A>G	4.37:g.48381723A>G			Somatic				SLAIN2_uc003gyb.1_5'Flank	p.S240S	NM_020846	NP_065897	WXS	Illumina HiSeq	Unspecified	Q9P270	SLAI2_HUMAN			4	864	+			240					A8K4P1|Q8N5R3	Silent	SNP	ENST00000264313.6	37	c.720A>G	CCDS47051.1																																																																																				0.313	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365807.4	NM_020846		10	60	0	0	0	0.006214	0	10	60				
TMPRSS11F	389208	broad.mit.edu	37	4	68934421	68934421	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:68934421G>T	ENST00000356291.2	-	7	729	c.670C>A	c.(670-672)Ctc>Atc	p.L224I	UBA6-AS1_ENST00000500538.2_RNA|UBA6-AS1_ENST00000499180.2_RNA|UBA6-AS1_ENST00000511571.1_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	224	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.L224I(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						ATGAGCTGGAGGCTGGCCTGC	0.507																																							uc003hdt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(670-672)CTC>ATC		transmembrane protease, serine 11F							109.0	92.0	98.0					4																	68934421		2203	4300	6503	SO:0001583	missense	389208				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity	g.chr4:68934421G>T	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.670C>A	4.37:g.68934421G>T	ENSP00000348639:p.Leu224Ile		Somatic				LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron	p.L224I	NM_207407	NP_997290	WXS	Illumina HiSeq	Unspecified	Q6ZWK6	TM11F_HUMAN			7	719	-			224			Peptidase S1.|Extracellular (Potential).		A8MXX2	Missense_Mutation	SNP	ENST00000356291.2	37	c.670C>A	CCDS3520.1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822351	0.71028	.	.	ENSG00000198092	ENST00000356291	D	0.94828	-3.53	5.73	4.88	0.63580	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.46442	D	0.000288	D	0.93628	0.7965	N	0.17901	0.54	0.39716	D	0.971401	D	0.65815	0.995	D	0.81914	0.995	D	0.93262	0.6644	10	0.62326	D	0.03	.	9.6591	0.39943	0.0923:0.0:0.9077:0.0	.	224	Q6ZWK6	TM11F_HUMAN	I	224	ENSP00000348639:L224I	ENSP00000348639:L224I	L	-	1	0	TMPRSS11F	68617016	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	1.476000	0.35420	2.713000	0.92767	0.655000	0.94253	CTC		0.507	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407		10	57	1	0	2.74318e-10	0.006214	3.86883e-10	10	57				
YTHDC1	91746	broad.mit.edu	37	4	69197847	69197847	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:69197847C>A	ENST00000344157.4	-	7	1431	c.1096G>T	c.(1096-1098)Gag>Tag	p.E366*	YTHDC1_ENST00000579690.1_Nonsense_Mutation_p.E366*|YTHDC1_ENST00000355665.3_Nonsense_Mutation_p.E348*	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	366	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E366*(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						GACACATTCTCATGGTTGTTA	0.318																																							uc003hdx.2		NA																	1	Substitution - Nonsense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1096-1098)GAG>TAG		splicing factor YT521-B isoform 1							112.0	106.0	108.0					4																	69197847		2203	4300	6503	SO:0001587	stop_gained	91746							g.chr4:69197847C>A	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1096G>T	4.37:g.69197847C>A	ENSP00000339245:p.Glu366*		Somatic				YTHDC1_uc003hdy.2_Nonsense_Mutation_p.E348*	p.E366*	NM_001031732	NP_001026902	WXS	Illumina HiSeq	Unspecified	Q96MU7	YTDC1_HUMAN			7	1449	-			366			YTH.		Q4W5Q3|Q7Z622|Q8TF35	Nonsense_Mutation	SNP	ENST00000344157.4	37	c.1096G>T	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	C	40	8.138556	0.98672	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.4711	0.94963	0.0:1.0:0.0:0.0	.	.	.	.	X	366;348	.	ENSP00000339245:E366X	E	-	1	0	YTHDC1	68880442	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.083000	0.76859	2.668000	0.90789	0.650000	0.86243	GAG		0.318	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370		11	62	1	0	1.15088e-07	0.004007	1.49431e-07	11	62				
UGT2B28	54490	broad.mit.edu	37	4	70160247	70160247	+	Splice_Site	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:70160247G>C	ENST00000335568.5	+	6	1312		c.e6-1		UGT2B28_ENST00000511240.1_Splice_Site	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28						metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.?(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						TTATCCTTCAGATATAAAGAG	0.333																																							uc003hej.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e6-1		UDP glucuronosyltransferase 2 family,	Flunitrazepam(DB01544)						28.0	34.0	32.0					4																	70160247		2072	4249	6321	SO:0001630	splice_region_variant	54490				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70160247G>C	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.1311-1G>C	4.37:g.70160247G>C			Somatic				UGT2B28_uc010ihr.2_Splice_Site_p.I335_splice	p.S437_splice	NM_053039	NP_444267	WXS	Illumina HiSeq	Unspecified	Q9BY64	UDB28_HUMAN			6	1313	+								B5BUM0|Q9BY62|Q9BY63	Splice_Site	SNP	ENST00000335568.5	37	c.1311_splice	CCDS3528.1	.	.	.	.	.	.	.	.	.	.	.	9.860	1.196018	0.22037	.	.	ENSG00000135226	ENST00000335568;ENST00000511240	.	.	.	1.85	1.85	0.25348	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3109	0.37903	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UGT2B28	70194836	1.000000	0.71417	0.169000	0.22859	0.044000	0.14063	7.909000	0.87444	1.023000	0.39654	0.184000	0.17185	.		0.333	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	Intron	12	76	0	0	0	0.003163	0	12	76				
MUC7	4589	broad.mit.edu	37	4	71347269	71347269	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:71347269G>T	ENST00000304887.5	+	3	998	c.808G>T	c.(808-810)Gac>Tac	p.D270Y	MUC7_ENST00000413702.1_Missense_Mutation_p.D270Y|MUC7_ENST00000456088.1_Missense_Mutation_p.D270Y	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	270	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.D270Y(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			AACTACCCTAGACCCATCATC	0.592																																							uc011cat.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(808-810)GAC>TAC		mucin 7, secreted precursor							493.0	433.0	453.0					4																	71347269		2199	4300	6499	SO:0001583	missense	4589					extracellular region	protein binding	g.chr4:71347269G>T	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.808G>T	4.37:g.71347269G>T	ENSP00000302021:p.Asp270Tyr		Somatic				MUC7_uc011cau.1_Missense_Mutation_p.D270Y|MUC7_uc003hfj.2_Missense_Mutation_p.D270Y|uc011cav.1_Intron	p.D270Y	NM_001145006	NP_001138478	WXS	Illumina HiSeq	Unspecified	Q8TAX7	MUC7_HUMAN	Lung(101;0.211)		4	1096	+			270			Thr-rich.|5.		Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	c.808G>T	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	G	5.410	0.260755	0.10239	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.51325	0.71;0.71;0.71	1.09	0.187	0.15109	.	.	.	.	.	T	0.20251	0.0487	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.18272	-1.0342	8	.	.	.	.	1.7408	0.02952	0.2427:0.0:0.4266:0.3307	.	270	Q8TAX7	MUC7_HUMAN	Y	270	ENSP00000407422:D270Y;ENSP00000400585:D270Y;ENSP00000302021:D270Y	.	D	+	1	0	MUC7	71381858	0.004000	0.15560	0.001000	0.08648	0.002000	0.02628	0.438000	0.21559	0.029000	0.15352	0.603000	0.83216	GAC		0.592	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291		15	119	1	0	1.15088e-07	0.004007	1.49431e-07	15	119				
CCDC158	339965	broad.mit.edu	37	4	77305770	77305770	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:77305770T>C	ENST00000388914.3	-	4	489	c.337A>G	c.(337-339)Att>Gtt	p.I113V	CCDC158_ENST00000434846.2_Missense_Mutation_p.I113V	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	113								p.I113V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						TGCAAATCAATGACTGACTGC	0.333																																							uc003hkb.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|pancreas(1)	6						c.(337-339)ATT>GTT		coiled-coil domain containing 158							137.0	130.0	132.0					4																	77305770		1857	4102	5959	SO:0001583	missense	339965							g.chr4:77305770T>C	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.337A>G	4.37:g.77305770T>C	ENSP00000373566:p.Ile113Val		Somatic				CCDC158_uc003hkd.2_Missense_Mutation_p.I113V	p.I113V	NM_001042784	NP_001036249	WXS	Illumina HiSeq	Unspecified	Q5M9N0	CD158_HUMAN			4	490	-			113			Potential.		Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	ENST00000388914.3	37	c.337A>G	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	T	12.67	2.007856	0.35415	.	.	ENSG00000163749	ENST00000388914;ENST00000318586;ENST00000434846	T;T	0.32515	1.49;1.45	5.72	3.15	0.36227	.	0.132974	0.34245	N	0.004132	T	0.16342	0.0393	N	0.19112	0.55	0.22489	N	0.999055	B;B	0.33637	0.0;0.42	B;B	0.36186	0.002;0.219	T	0.08330	-1.0727	10	0.34782	T	0.22	.	2.1934	0.03905	0.1558:0.0856:0.1622:0.5964	.	113;113	Q5M9N0-3;Q5M9N0	.;CD158_HUMAN	V	113	ENSP00000373566:I113V;ENSP00000401742:I113V	ENSP00000316815:I113V	I	-	1	0	CCDC158	77524794	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	0.845000	0.27668	0.998000	0.38996	0.533000	0.62120	ATT		0.333	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784		42	126	0	0	0	0.009718	0	42	126				
FRAS1	80144	broad.mit.edu	37	4	79373507	79373507	+	Splice_Site	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:79373507A>T	ENST00000264895.6	+	47	7202	c.6762A>T	c.(6760-6762)ccA>ccT	p.P2254P		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2254					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.P2255P(1)|p.P2254P(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CAGCATCACCAGGTAAGTCTA	0.463																																							uc003hlb.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(5)	5						c.(6760-6762)CCA>CCT		Fraser syndrome 1							40.0	41.0	41.0					4																	79373507		1990	4177	6167	SO:0001630	splice_region_variant	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79373507A>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.6763+1A>T	4.37:g.79373507A>T			Somatic					p.P2254P	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			47	7202	+			2253			CSPG 10.|Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000264895.6	37	c.6762A>T	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	A	5.346	0.249110	0.10130	.	.	ENSG00000138759	ENST00000512123	.	.	.	5.94	-1.2	0.09554	.	.	.	.	.	T	0.51873	0.1700	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41360	-0.9513	4	.	.	.	.	7.3173	0.26507	0.5355:0.3431:0.1214:0.0	.	.	.	.	W	483	.	.	R	+	1	2	FRAS1	79592531	1.000000	0.71417	0.962000	0.40283	0.158000	0.22134	2.221000	0.42917	-0.382000	0.07870	0.528000	0.53228	AGG		0.463	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			Silent	4	16	0	0	0	0.009096	0	4	16				
WDFY3	23001	broad.mit.edu	37	4	85660237	85660237	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:85660237C>A	ENST00000295888.4	-	40	6907	c.6500G>T	c.(6499-6501)cGc>cTc	p.R2167L	WDFY3_ENST00000322366.6_Missense_Mutation_p.R2167L	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2167					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.R2167L(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGTGGTCATGCGGGCTTCTGC	0.413																																							uc003hpd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(6499-6501)CGC>CTC		WD repeat and FYVE domain containing 3 isoform							150.0	135.0	140.0					4																	85660237		2203	4300	6503	SO:0001583	missense	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85660237C>A	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.6500G>T	4.37:g.85660237C>A	ENSP00000295888:p.Arg2167Leu		Somatic					p.R2167L	NM_014991	NP_055806	WXS	Illumina HiSeq	Unspecified	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	40	6908	-		Hepatocellular(203;0.114)	2167					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	c.6500G>T	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631616	0.87660	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.67171	-0.25;-0.25	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.63534	0.2519	M	0.65975	2.015	0.80722	D	1	P	0.41784	0.762	B	0.36666	0.23	T	0.63256	-0.6678	10	0.09590	T	0.72	.	19.7784	0.96405	0.0:1.0:0.0:0.0	.	2167	Q8IZQ1	WDFY3_HUMAN	L	2167	ENSP00000318466:R2167L;ENSP00000295888:R2167L	ENSP00000295888:R2167L	R	-	2	0	WDFY3	85879261	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.445000	0.80570	2.673000	0.90976	0.557000	0.71058	CGC		0.413	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		12	79	1	0	3.27435e-08	0.00245	4.30614e-08	12	79				
MEPE	56955	broad.mit.edu	37	4	88766342	88766342	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:88766342A>T	ENST00000424957.3	+	4	395	c.322A>T	c.(322-324)Act>Tct	p.T108S	MEPE_ENST00000497649.2_Missense_Mutation_p.T84S|MEPE_ENST00000560249.1_5'UTR|MEPE_ENST00000361056.3_Missense_Mutation_p.T108S|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000511670.1_3'UTR|MEPE_ENST00000540395.1_5'UTR|MEPE_ENST00000395102.4_Missense_Mutation_p.T139S	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	108					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.T108S(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		CAAAGAGAATACTCACAATGG	0.358																																							uc003hqy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(322-324)ACT>TCT		matrix, extracellular phosphoglycoprotein with							71.0	71.0	71.0					4																	88766342		2203	4299	6502	SO:0001583	missense	56955				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr4:88766342A>T	AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.322A>T	4.37:g.88766342A>T	ENSP00000416984:p.Thr108Ser		Somatic				MEPE_uc010ikn.2_5'UTR	p.T108S	NM_020203	NP_064588	WXS	Illumina HiSeq	Unspecified	Q9NQ76	MEPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000432)	4	361	+		Hepatocellular(203;0.114)	108					A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	ENST00000424957.3	37	c.322A>T	CCDS3625.1	.	.	.	.	.	.	.	.	.	.	A	6.853	0.526765	0.13066	.	.	ENSG00000152595	ENST00000535138;ENST00000424957;ENST00000395102;ENST00000497649;ENST00000361056	T;T;T;T	0.39787	4.33;1.06;1.06;4.33	4.84	-1.99	0.07457	.	1.629820	0.03278	N	0.185731	T	0.19287	0.0463	N	0.08118	0	0.09310	N	0.999999	B	0.22746	0.074	B	0.24006	0.05	T	0.07195	-1.0785	10	0.18276	T	0.48	0.0429	0.9631	0.01399	0.4169:0.1489:0.2648:0.1693	.	108	Q9NQ76	MEPE_HUMAN	S	108;108;139;84;108	ENSP00000416984:T108S;ENSP00000378534:T139S;ENSP00000422747:T84S;ENSP00000354341:T108S	ENSP00000354341:T108S	T	+	1	0	MEPE	88985366	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.286000	0.08399	-0.239000	0.09710	-0.242000	0.12053	ACT		0.358	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1			27	72	0	0	0	0.008361	0	27	72				
USP53	54532	broad.mit.edu	37	4	120170028	120170029	+	Nonsense_Mutation	DNP	GG	GG	CT	rs144065914	byFrequency	TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:120170028_120170029GG>CT	ENST00000274030.6	+	7	1542_1543	c.363_364GG>CT	c.(361-366)gcGGag>gcCTag	p.E122*	USP53_ENST00000450251.1_Nonsense_Mutation_p.E122*	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53									p.E122*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						ATGATGCTGCGGAGTGCTTTGT	0.386																																							uc003ics.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|breast(1)|kidney(1)|skin(1)	4						c.(361-366)GCGGAG>GCCTAG		ubiquitin specific protease 53																																				SO:0001587	stop_gained	54532				ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity	g.chr4:120170028_120170029GG>CT	BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	Exception_encountered	4.37:g.120170028_120170029delinsCT	ENSP00000274030:p.Glu122*		Somatic				USP53_uc003icr.3_Nonsense_Mutation_p.E122*|USP53_uc003icu.3_5'UTR	p.E122*	NM_019050	NP_061923	WXS	Illumina HiSeq	Unspecified	Q70EK8	UBP53_HUMAN			6	1429_1430	+			122						Nonsense_Mutation	DNP	ENST00000274030.6	37	c.363_364GG>CT	CCDS43265.1																																																																																				0.386	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364564.2	XM_052597		14	130	0	0	0	0.004672	0	14	130				
INTU	27152	broad.mit.edu	37	4	128584607	128584607	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:128584607G>A	ENST00000335251.6	+	4	943	c.840G>A	c.(838-840)caG>caA	p.Q280Q	INTU_ENST00000296461.5_Silent_p.Q280Q	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	280					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)		p.Q280Q(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						AAAAGACACAGTCCAACACAA	0.393																																							uc003ifk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(838-840)CAG>CAA		PDZ domain containing 6							127.0	126.0	126.0					4																	128584607		2203	4300	6503	SO:0001819	synonymous_variant	27152							g.chr4:128584607G>A	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.840G>A	4.37:g.128584607G>A			Somatic				INTU_uc011cgq.1_RNA	p.Q280Q	NM_015693	NP_056508	WXS	Illumina HiSeq	Unspecified	Q9ULD6	PDZD6_HUMAN			4	910	+			280					A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Silent	SNP	ENST00000335251.6	37	c.840G>A	CCDS34061.1																																																																																				0.393	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707		26	44	0	0	0	0.004656	0	26	44				
DCHS2	54798	broad.mit.edu	37	4	155155900	155155900	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:155155900C>A	ENST00000357232.4	-	25	8538	c.8539G>T	c.(8539-8541)Ggg>Tgg	p.G2847W		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2847					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G2847W(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GGCACCTGCCCCAGGTTTACT	0.498																																							uc003inw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(8539-8541)GGG>TGG		dachsous 2 isoform 1							119.0	120.0	120.0					4																	155155900		2203	4300	6503	SO:0001583	missense	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155155900C>A	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8539G>T	4.37:g.155155900C>A	ENSP00000349768:p.Gly2847Trp		Somatic					p.G2847W	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	25	8539	-	all_hematologic(180;0.208)	Renal(120;0.0854)	2847					B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	c.8539G>T	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.900918	0.52227	.	.	ENSG00000197410	ENST00000357232	T	0.57107	0.42	5.93	3.29	0.37713	.	0.226724	0.38058	N	0.001840	T	0.63710	0.2534	L	0.50333	1.59	0.29243	N	0.872514	D	0.71674	0.998	D	0.71656	0.974	T	0.61412	-0.7068	10	0.59425	D	0.04	.	11.5249	0.50573	0.0:0.8049:0.0:0.1951	.	2847	Q6V1P9	PCD23_HUMAN	W	2847	ENSP00000349768:G2847W	ENSP00000349768:G2847W	G	-	1	0	DCHS2	155375350	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.333000	0.19768	0.401000	0.25424	0.655000	0.94253	GGG		0.498	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		19	177	1	0	5.03518e-11	0.007413	7.25137e-11	19	177				
DCHS2	54798	broad.mit.edu	37	4	155155902	155155902	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:155155902A>G	ENST00000357232.4	-	25	8536	c.8537T>C	c.(8536-8538)cTg>cCg	p.L2846P		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2846					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L2846P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CACCTGCCCCAGGTTTACTGC	0.507																																							uc003inw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(8536-8538)CTG>CCG		dachsous 2 isoform 1							117.0	119.0	119.0					4																	155155902		2203	4300	6503	SO:0001583	missense	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155155902A>G	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8537T>C	4.37:g.155155902A>G	ENSP00000349768:p.Leu2846Pro		Somatic					p.L2846P	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	25	8537	-	all_hematologic(180;0.208)	Renal(120;0.0854)	2846					B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	c.8537T>C	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	A	9.944	1.218344	0.22373	.	.	ENSG00000197410	ENST00000357232	T	0.55052	0.54	5.93	-1.96	0.07525	.	1.099150	0.06847	N	0.796664	T	0.29288	0.0729	N	0.11201	0.11	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15636	-1.0430	10	0.29301	T	0.29	.	6.3519	0.21381	0.3206:0.2116:0.4678:0.0	.	2846	Q6V1P9	PCD23_HUMAN	P	2846	ENSP00000349768:L2846P	ENSP00000349768:L2846P	L	-	2	0	DCHS2	155375352	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	1.581000	0.36558	-0.514000	0.06488	-1.106000	0.02097	CTG		0.507	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		20	188	0	0	0	0.008871	0	20	188				
HPGD	3248	broad.mit.edu	37	4	175443105	175443105	+	Silent	SNP	T	T	C	rs146392763		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:175443105T>C	ENST00000296522.6	-	2	653	c.207A>G	c.(205-207)caA>caG	p.Q69Q	HPGD_ENST00000504433.1_Silent_p.Q69Q|HPGD_ENST00000296521.7_Silent_p.Q69Q|HPGD_ENST00000542498.1_Silent_p.Q69Q|RP11-440I14.2_ENST00000515178.1_lincRNA|HPGD_ENST00000541923.1_5'UTR|HPGD_ENST00000510901.1_5'UTR|HPGD_ENST00000422112.2_Silent_p.Q69Q	NM_000860.5|NM_001145816.2|NM_001256301.1|NM_001256307.1	NP_000851.2|NP_001139288.1|NP_001243230.1|NP_001243236.1	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	69					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|ductus arteriosus closure (GO:0097070)|female pregnancy (GO:0007565)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|ovulation (GO:0030728)|parturition (GO:0007567)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|thrombin receptor signaling pathway (GO:0070493)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|catalytic activity (GO:0003824)|NAD binding (GO:0051287)|NAD+ binding (GO:0070403)|prostaglandin E receptor activity (GO:0004957)|protein homodimerization activity (GO:0042803)	p.Q69Q(1)		kidney(1)|lung(3)|prostate(3)	7		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)		CTCTCAGTTGTTGCTGGTCAG	0.537																																							uc003itu.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(205-207)CAA>CAG		hydroxyprostaglandin dehydrogenase 15-(NAD)	NADH(DB00157)	T	,	0,4406		0,0,2203	176.0	176.0	176.0		207,207	-3.9	0.8	4	dbSNP_134	176	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	HPGD	NM_000860.4,NM_001145816.1	,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,	69/267,69/179	175443105	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3248				female pregnancy|lipoxygenase pathway|negative regulation of cell cycle|parturition|prostaglandin metabolic process|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|NAD+ binding|prostaglandin E receptor activity|protein homodimerization activity	g.chr4:175443105T>C		CCDS3821.1, CCDS54821.1, CCDS58933.1, CCDS58934.1, CCDS58935.1	4q34-q35	2011-09-14			ENSG00000164120	ENSG00000164120	1.1.1.141	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	5154	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 36C, member 1"""	601688				19027726	Standard	NM_000860		Approved	SDR36C1	uc003itu.3	P15428	OTTHUMG00000160772	ENST00000296522.6:c.207A>G	4.37:g.175443105T>C			Somatic				HPGD_uc003itv.2_Silent_p.Q69Q|HPGD_uc011ckf.1_5'UTR|HPGD_uc010irp.2_Intron|HPGD_uc010irq.2_Silent_p.Q69Q|HPGD_uc011ckg.1_Silent_p.Q69Q|HPGD_uc011ckh.1_5'UTR|HPGD_uc003itw.2_Silent_p.Q69Q|HPGD_uc003itx.2_Silent_p.Q69Q	p.Q69Q	NM_000860	NP_000851	WXS	Illumina HiSeq	Unspecified	P15428	PGDH_HUMAN		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)	2	397	-		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)	69					B4DTA4|B4DU74|B4DV57|D3DP43|E7EV11|O00749|Q06F08|Q12998	Silent	SNP	ENST00000296522.6	37	c.207A>G	CCDS3821.1																																																																																				0.537	HPGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362228.3			18	164	0	0	0	0.001882	0	18	164				
WDR17	116966	broad.mit.edu	37	4	177061073	177061073	+	Missense_Mutation	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:177061073T>A	ENST00000280190.4	+	11	1618	c.1462T>A	c.(1462-1464)Tgg>Agg	p.W488R	WDR17_ENST00000508596.1_Missense_Mutation_p.W464R|WDR17_ENST00000507824.2_Missense_Mutation_p.W471R|WDR17_ENST00000393643.2_Missense_Mutation_p.W464R			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	488								p.W488R(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CTGCATTGCCTGGAGTCATAA	0.303																																							uc003iuj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6						c.(1462-1464)TGG>AGG		WD repeat domain 17 isoform 1							170.0	191.0	184.0					4																	177061073		2203	4300	6503	SO:0001583	missense	116966							g.chr4:177061073T>A	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.1462T>A	4.37:g.177061073T>A	ENSP00000280190:p.Trp488Arg		Somatic				WDR17_uc003iuk.2_Missense_Mutation_p.W464R|WDR17_uc003ium.3_Missense_Mutation_p.W464R|WDR17_uc003iul.1_Intron	p.W488R	NM_170710	NP_733828	WXS	Illumina HiSeq	Unspecified	Q8IZU2	WDR17_HUMAN		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)	11	1618	+		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	488			WD 8.		E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	c.1462T>A	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.319215	0.81469	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.66815	-0.23;-0.23;-0.23	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.81597	0.4856	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84044	0.0366	10	0.87932	D	0	-8.8132	15.8008	0.78453	0.0:0.0:0.0:1.0	.	464;488	E7EQX0;Q8IZU2	.;WDR17_HUMAN	R	464;464;488;471	ENSP00000422763:W464R;ENSP00000377258:W464R;ENSP00000280190:W488R	ENSP00000280190:W488R	W	+	1	0	WDR17	177298067	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.452000	0.80683	2.190000	0.69967	0.482000	0.46254	TGG		0.303	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2			23	152	0	0	0	0.008361	0	23	152				
ICE1	23379	broad.mit.edu	37	5	5486895	5486895	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:5486895G>T	ENST00000296564.7	+	18	6804	c.6582G>T	c.(6580-6582)tcG>tcT	p.S2194S		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		2194					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.S2194S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						ATATTAGTTCGGTTATTGGTA	0.328																																							uc003jdm.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(6580-6582)TCG>TCT		hypothetical protein LOC23379							82.0	75.0	77.0					5																	5486895		1844	4102	5946	SO:0001819	synonymous_variant	23379							g.chr5:5486895G>T																												ENST00000296564.7:c.6582G>T	5.37:g.5486895G>T			Somatic					p.S2194S	NM_015325	NP_056140	WXS	Illumina HiSeq	Unspecified	Q9Y2F5	K0947_HUMAN			18	6804	+			2194					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Silent	SNP	ENST00000296564.7	37	c.6582G>T	CCDS47187.1																																																																																				0.328	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			20	7	1	0	1.87028e-06	0.001882	2.36825e-06	20	7				
TRIO	7204	broad.mit.edu	37	5	14364019	14364019	+	Missense_Mutation	SNP	A	A	G	rs199976501		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:14364019A>G	ENST00000344204.4	+	14	2594	c.2570A>G	c.(2569-2571)aAt>aGt	p.N857S	TRIO_ENST00000509967.2_Missense_Mutation_p.N808S|TRIO_ENST00000537187.1_Missense_Mutation_p.N857S	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	857					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N857S(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CAGTATGTCAATGAGGTCCAG	0.507																																							uc003jff.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18						c.(2569-2571)AAT>AGT		triple functional domain (PTPRF interacting)		A	SER/ASN	0,4406		0,0,2203	188.0	135.0	153.0		2570	5.2	1.0	5		153	1,8599	1.2+/-3.3	0,1,4299	yes	missense	TRIO	NM_007118.2	46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	857/3098	14364019	1,13005	2203	4300	6503	SO:0001583	missense	7204				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr5:14364019A>G	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.2570A>G	5.37:g.14364019A>G	ENSP00000339299:p.Asn857Ser		Somatic				TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Missense_Mutation_p.N808S|TRIO_uc003jfh.1_Missense_Mutation_p.N506S	p.N857S	NM_007118	NP_009049	WXS	Illumina HiSeq	Unspecified	O75962	TRIO_HUMAN			14	2576	+	Lung NSC(4;0.000742)		857					D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	c.2570A>G	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	A	4.616	0.114465	0.08831	0.0	1.16E-4	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.35421	1.31;1.31;1.31	5.24	5.24	0.73138	.	0.167750	0.52532	D	0.000077	T	0.22742	0.0549	N	0.14661	0.345	0.42210	D	0.9918	B;B;B	0.24651	0.059;0.108;0.004	B;B;B	0.28385	0.061;0.089;0.003	T	0.07046	-1.0793	10	0.08837	T	0.75	.	15.1616	0.72791	1.0:0.0:0.0:0.0	.	808;857;857	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	S	857;857;808;544	ENSP00000339299:N857S;ENSP00000446348:N857S;ENSP00000445592:N808S	ENSP00000339299:N857S	N	+	2	0	TRIO	14417019	0.926000	0.31397	0.997000	0.53966	0.928000	0.56348	2.061000	0.41403	1.992000	0.58205	0.533000	0.62120	AAT		0.507	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		9	81	0	0	0	0.004482	0	9	81				
PRDM9	56979	broad.mit.edu	37	5	23526524	23526524	+	Missense_Mutation	SNP	G	G	A	rs533413700		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:23526524G>A	ENST00000296682.3	+	11	1509	c.1327G>A	c.(1327-1329)Gat>Aat	p.D443N		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	443					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.D443N(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GCAATATCCAGATCCACACAG	0.473										HNSCC(3;0.000094)			G|||	1	0.000199681	0.0	0.0	5008	,	,		16930	0.0		0.0	False		,,,				2504	0.001						uc003jgo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(1327-1329)GAT>AAT		PR domain containing 9							73.0	72.0	72.0					5																	23526524		2203	4300	6503	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23526524G>A	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1327G>A	5.37:g.23526524G>A	ENSP00000296682:p.Asp443Asn	HNSCC(3;0.000094)	Somatic					p.D443N	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			11	1509	+			443					B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.1327G>A	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.291659	0.23564	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.09255	3.0	2.71	1.78	0.24846	.	0.429826	0.17123	N	0.186130	T	0.10937	0.0267	M	0.64404	1.975	0.09310	N	1	B	0.18310	0.027	B	0.09377	0.004	T	0.29274	-1.0017	10	0.20519	T	0.43	-2.0681	9.4442	0.38688	0.0:0.2208:0.7791:0.0	.	443	Q9NQV7	PRDM9_HUMAN	N	443;237	ENSP00000296682:D443N	ENSP00000253473:D237N	D	+	1	0	PRDM9	23562281	0.011000	0.17503	0.004000	0.12327	0.041000	0.13682	1.487000	0.35540	0.619000	0.30197	0.505000	0.49811	GAT		0.473	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		7	112	0	0	0	0.00308	0	7	112				
PRDM9	56979	broad.mit.edu	37	5	23526569	23526569	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:23526569G>T	ENST00000296682.3	+	11	1554	c.1372G>T	c.(1372-1374)Gaa>Taa	p.E458*		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	458					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.E458*(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGAGATCAAAGAAAGGTCCAA	0.483										HNSCC(3;0.000094)																													uc003jgo.2		NA																	2	Substitution - Nonsense(2)		large_intestine(1)|lung(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(1372-1374)GAA>TAA		PR domain containing 9							45.0	47.0	46.0					5																	23526569		2203	4300	6503	SO:0001587	stop_gained	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23526569G>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1372G>T	5.37:g.23526569G>T	ENSP00000296682:p.Glu458*	HNSCC(3;0.000094)	Somatic					p.E458*	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			11	1554	+			458					B4DX22|Q27Q50	Nonsense_Mutation	SNP	ENST00000296682.3	37	c.1372G>T	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312366	0.81358	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	.	.	.	2.58	-1.97	0.07503	.	1.405680	0.04985	N	0.466386	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	1.8182	4.2772	0.10815	0.3656:0.1739:0.4605:0.0	.	.	.	.	X	458;252	.	ENSP00000253473:E252X	E	+	1	0	PRDM9	23562326	0.000000	0.05858	0.000000	0.03702	0.169000	0.22640	-0.843000	0.04350	-0.531000	0.06340	0.400000	0.26472	GAA		0.483	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		6	59	1	0	8.12818e-05	0.001984	9.33828e-05	6	59				
PRDM9	56979	broad.mit.edu	37	5	23526586	23526586	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:23526586G>A	ENST00000296682.3	+	11	1571	c.1389G>A	c.(1387-1389)ttG>ttA	p.L463L		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	463					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.L463L(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CCAAACTCTTGAATAAAAGGA	0.463										HNSCC(3;0.000094)																													uc003jgo.2		NA																	2	Substitution - coding silent(2)		lung(1)|endometrium(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(1387-1389)TTG>TTA		PR domain containing 9							39.0	40.0	40.0					5																	23526586		2199	4295	6494	SO:0001819	synonymous_variant	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23526586G>A	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1389G>A	5.37:g.23526586G>A		HNSCC(3;0.000094)	Somatic					p.L463L	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			11	1571	+			463					B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	c.1389G>A	CCDS43307.1																																																																																				0.463	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		5	56	0	0	0	0.001168	0	5	56				
PRDM9	56979	broad.mit.edu	37	5	23526601	23526601	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:23526601G>A	ENST00000296682.3	+	11	1586	c.1404G>A	c.(1402-1404)tgG>tgA	p.W468*		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	468					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.W468*(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AAAGGACATGGCAGAGGGAGA	0.453										HNSCC(3;0.000094)																													uc003jgo.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(1402-1404)TGG>TGA		PR domain containing 9							35.0	36.0	36.0					5																	23526601		2188	4281	6469	SO:0001587	stop_gained	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23526601G>A	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1404G>A	5.37:g.23526601G>A	ENSP00000296682:p.Trp468*	HNSCC(3;0.000094)	Somatic					p.W468*	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			11	1586	+			468					B4DX22|Q27Q50	Nonsense_Mutation	SNP	ENST00000296682.3	37	c.1404G>A	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.881315	0.72294	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	.	.	.	2.71	0.804	0.18697	.	1.230150	0.06135	N	0.671366	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	0.1571	6.7887	0.23687	0.2681:0.0:0.7319:0.0	.	.	.	.	X	468;262	.	ENSP00000253473:W262X	W	+	3	0	PRDM9	23562358	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.005000	0.13129	0.170000	0.19704	0.505000	0.49811	TGG		0.453	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		6	64	0	0	0	0.001984	0	6	64				
CDH10	1008	broad.mit.edu	37	5	24487942	24487942	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:24487942G>T	ENST00000264463.4	-	12	2704	c.2197C>A	c.(2197-2199)Ctt>Att	p.L733I	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	733					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L733I(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TAGGTTGCAAGTGAGTCGTAG	0.468										HNSCC(23;0.051)																													uc003jgr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(2197-2199)CTT>ATT		cadherin 10, type 2 preproprotein							114.0	116.0	116.0					5																	24487942		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24487942G>T	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2197C>A	5.37:g.24487942G>T	ENSP00000264463:p.Leu733Ile	HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.L733I	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	12	2529	-			733			Cytoplasmic (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.2197C>A	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415307	0.62511	.	.	ENSG00000040731	ENST00000264463	T	0.81078	-1.45	5.92	5.92	0.95590	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.87985	0.6316	M	0.85462	2.755	0.53005	D	0.999964	D	0.55605	0.972	P	0.52454	0.699	D	0.86852	0.2024	10	0.35671	T	0.21	.	19.3088	0.94175	0.0:0.0:1.0:0.0	.	733	Q9Y6N8	CAD10_HUMAN	I	733	ENSP00000264463:L733I	ENSP00000264463:L733I	L	-	1	0	CDH10	24523699	1.000000	0.71417	0.145000	0.22337	0.841000	0.47740	6.637000	0.74304	2.809000	0.96659	0.655000	0.94253	CTT		0.468	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		21	314	1	0	1.50039e-11	0.001882	2.1761e-11	21	314				
IL7R	3575	broad.mit.edu	37	5	35874576	35874576	+	Silent	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:35874576C>A	ENST00000303115.3	+	6	861	c.732C>A	c.(730-732)acC>acA	p.T244T	IL7R_ENST00000506850.1_Intron|IL7R_ENST00000343305.4_Intron	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	244			T -> I (in dbSNP:rs6897932). {ECO:0000269|PubMed:17660817, ECO:0000269|PubMed:9843216, ECO:0000269|Ref.5}.		B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.T244_I245insPPVCSVT(2)|p.T244>NECS(1)|p.T244_I245insRPCG(1)|p.T244_I245insCPT(1)|p.T244_I245insLPCVY(1)|p.T244T(1)|p.L242_S246>PQGGC(1)|p.T244_I245insCHL(1)|p.P240_S246>LKC(1)|p.P240_S246>LQSC(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TCTTACTAACCATCAGCATTT	0.443			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																uc003jjs.2		NA		Dom	yes		5	5p13	146661		interleukin 7 receptor	yes		L					11	Insertion - In frame(6)|Complex - deletion inframe(2)|Complex - compound substitution(1)|Complex - insertion inframe(1)|Substitution - coding silent(1)		haematopoietic_and_lymphoid_tissue(10)|lung(1)	ovary(3)|breast(1)|skin(1)	5						c.(730-732)ACC>ACA		interleukin 7 receptor precursor							253.0	220.0	231.0					5																	35874576		2203	4300	6503	SO:0001819	synonymous_variant	3575				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity	g.chr5:35874576C>A	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.732C>A	5.37:g.35874576C>A			Somatic				IL7R_uc011coo.1_Intron|IL7R_uc011cop.1_Intron	p.T244T	NM_002185	NP_002176	WXS	Illumina HiSeq	Unspecified	P16871	IL7RA_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)		6	821	+	all_lung(31;0.00015)		244			Helical; (Potential).		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Silent	SNP	ENST00000303115.3	37	c.732C>A	CCDS3911.1																																																																																				0.443	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			12	304	1	0	2.68362e-12	0.001368	3.96246e-12	12	304				
RICTOR	253260	broad.mit.edu	37	5	38949913	38949913	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:38949913G>C	ENST00000357387.3	-	31	4067	c.4037C>G	c.(4036-4038)tCt>tGt	p.S1346C	RICTOR_ENST00000296782.5_Missense_Mutation_p.S1346C	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2									p.S1346C(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TTCAGAGTGAGATAAGGATGG	0.408																																							uc003jlp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10						c.(4036-4038)TCT>TGT		rapamycin-insensitive companion of mTOR							173.0	165.0	168.0					5																	38949913		2203	4300	6503	SO:0001583	missense	253260				actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding	g.chr5:38949913G>C		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4037C>G	5.37:g.38949913G>C	ENSP00000349959:p.Ser1346Cys		Somatic				RICTOR_uc003jlo.2_Missense_Mutation_p.S1346C|RICTOR_uc010ivf.2_Missense_Mutation_p.S1061C	p.S1346C	NM_152756	NP_689969	WXS	Illumina HiSeq	Unspecified	Q6R327	RICTR_HUMAN			31	4061	-	all_lung(31;0.000396)		1346						Missense_Mutation	SNP	ENST00000357387.3	37	c.4037C>G	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809794	0.70797	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.54866	0.56;0.55	6.03	6.03	0.97812	.	0.046518	0.85682	D	0.000000	T	0.73583	0.3605	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.73607	-0.3929	10	0.87932	D	0	-14.3366	20.5752	0.99366	0.0:0.0:1.0:0.0	.	1346;1346	Q6R327;Q6R327-3	RICTR_HUMAN;.	C	1346	ENSP00000349959:S1346C;ENSP00000296782:S1346C	ENSP00000296782:S1346C	S	-	2	0	RICTOR	38985670	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.434000	0.97515	2.868000	0.98415	0.557000	0.71058	TCT		0.408	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756		13	219	0	0	0	0.001368	0	13	219				
C6	729	broad.mit.edu	37	5	41142965	41142965	+	Missense_Mutation	SNP	T	T	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:41142965T>G	ENST00000263413.3	-	18	3031	c.2767A>C	c.(2767-2769)Aag>Cag	p.K923Q	C6_ENST00000337836.5_Missense_Mutation_p.K923Q	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	923	C5b-binding domain.|Factor I module (FIM) 2.|Kazal-like 2. {ECO:0000255|PROSITE- ProRule:PRU00798}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.K923Q(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				ATTTCCATCTTCCTGTTTGCA	0.433																																							uc003jmk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)	7						c.(2767-2769)AAG>CAG		complement component 6 precursor							235.0	193.0	208.0					5																	41142965		2203	4300	6503	SO:0001583	missense	729				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding	g.chr5:41142965T>G	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.2767A>C	5.37:g.41142965T>G	ENSP00000263413:p.Lys923Gln		Somatic				C6_uc003jml.1_Missense_Mutation_p.K923Q	p.K923Q	NM_000065	NP_000056	WXS	Illumina HiSeq	Unspecified	P13671	CO6_HUMAN			18	2977	-		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)	923			Complement control factor I module 2.|C5b-binding domain.|Kazal-like 2.			Missense_Mutation	SNP	ENST00000263413.3	37	c.2767A>C	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	T	7.479	0.648191	0.14516	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.60672	0.17;0.17	5.71	3.37	0.38596	Factor I / membrane attack complex (1);	0.568193	0.20377	N	0.093537	T	0.53045	0.1772	M	0.71581	2.175	0.09310	N	1	B	0.32350	0.366	B	0.30646	0.118	T	0.50816	-0.8783	10	0.51188	T	0.08	-0.0932	8.7977	0.34890	0.0:0.2095:0.0:0.7905	.	923	P13671	CO6_HUMAN	Q	923	ENSP00000338861:K923Q;ENSP00000263413:K923Q	ENSP00000263413:K923Q	K	-	1	0	C6	41178722	0.393000	0.25237	0.165000	0.22776	0.248000	0.25809	1.394000	0.34509	1.010000	0.39314	0.528000	0.53228	AAG		0.433	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1			11	191	0	0	0	0.001855	0	11	191				
SNX18	112574	broad.mit.edu	37	5	53814525	53814525	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:53814525C>T	ENST00000326277.3	+	1	933	c.743C>T	c.(742-744)gCg>gTg	p.A248V	SNX18_ENST00000343017.6_Missense_Mutation_p.A248V|SNX18_ENST00000381410.4_Missense_Mutation_p.A248V	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	248					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.A248V(2)		endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				CTGGGGGAGGCGTCAGGCTTC	0.672																																							uc003jpj.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(742-744)GCG>GTG		sorting nexin 18 isoform b							60.0	67.0	65.0					5																	53814525		2203	4300	6503	SO:0001583	missense	112574				cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding	g.chr5:53814525C>T	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.743C>T	5.37:g.53814525C>T	ENSP00000317332:p.Ala248Val		Somatic				SNX18_uc011cqg.1_Missense_Mutation_p.A248V|SNX18_uc003jpi.3_Missense_Mutation_p.A248V	p.A248V	NM_052870	NP_443102	WXS	Illumina HiSeq	Unspecified	Q96RF0	SNX18_HUMAN			1	933	+		Lung NSC(810;3.46e-05)|Breast(144;0.102)	248					B4E2B3|H7BXX3|Q05BB3|Q0VG02	Missense_Mutation	SNP	ENST00000326277.3	37	c.743C>T	CCDS3962.1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.030531	0.35797	.	.	ENSG00000178996	ENST00000343017;ENST00000381410;ENST00000326277	T;T;T	0.14022	2.74;2.54;2.91	4.7	4.7	0.59300	.	0.120379	0.56097	D	0.000035	T	0.21145	0.0509	N	0.17345	0.48	0.80722	D	1	D;B	0.89917	1.0;0.254	D;B	0.78314	0.991;0.024	T	0.12708	-1.0537	10	0.17832	T	0.49	-25.5011	17.4283	0.87532	0.0:1.0:0.0:0.0	.	248;248	Q96RF0;Q96RF0-2	SNX18_HUMAN;.	V	248	ENSP00000342276:A248V;ENSP00000370817:A248V;ENSP00000317332:A248V	ENSP00000317332:A248V	A	+	2	0	SNX18	53850282	0.983000	0.35010	1.000000	0.80357	0.962000	0.63368	2.618000	0.46393	2.428000	0.82296	0.557000	0.71058	GCG		0.672	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2			11	72	0	0	0	0.001368	0	11	72				
PJA2	9867	broad.mit.edu	37	5	108717348	108717348	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:108717348T>C	ENST00000361189.2	-	3	327	c.88A>G	c.(88-90)Aca>Gca	p.T30A	PJA2_ENST00000361557.3_Missense_Mutation_p.T30A|PJA2_ENST00000511624.1_5'UTR	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	30					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T30A(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		CCTGTAATTGTCTGATACCCT	0.418																																							uc003kos.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(88-90)ACA>GCA		praja 2, RING-H2 motif containing							97.0	93.0	95.0					5																	108717348		2202	4300	6502	SO:0001583	missense	9867				long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding	g.chr5:108717348T>C	AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.88A>G	5.37:g.108717348T>C	ENSP00000354775:p.Thr30Ala		Somatic					p.T30A	NM_014819	NP_055634	WXS	Illumina HiSeq	Unspecified	O43164	PJA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)	3	308	-		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)	30					A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	ENST00000361189.2	37	c.88A>G	CCDS4099.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.482568	0.84747	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.16743	2.32;2.32	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.33644	0.0870	M	0.65498	2.005	0.50467	D	0.999877	D	0.64830	0.994	P	0.53549	0.729	T	0.07888	-1.0749	10	0.87932	D	0	-16.4454	15.9856	0.80151	0.0:0.0:0.0:1.0	.	30	O43164	PJA2_HUMAN	A	30	ENSP00000354775:T30A;ENSP00000355284:T30A	ENSP00000354775:T30A	T	-	1	0	PJA2	108745247	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.170000	0.71920	2.180000	0.69256	0.455000	0.32223	ACA		0.418	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250663.1	NM_014819		10	81	0	0	0	0.000978	0	10	81				
TRPC7	57113	broad.mit.edu	37	5	135692916	135692916	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:135692916C>A	ENST00000513104.1	-	2	442	c.160G>T	c.(160-162)Ggc>Tgc	p.G54C	TRPC7_ENST00000355180.3_Missense_Mutation_p.G54C|TRPC7_ENST00000426057.2_Missense_Mutation_p.G54C	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	54					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.G54C(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGGATGTTGCCATACTCAGCC	0.622																																							uc003lbn.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(157-159)GGC>TGC		transient receptor potential cation channel,							96.0	109.0	104.0					5																	135692916		2149	4271	6420	SO:0001583	missense	57113				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding	g.chr5:135692916C>A	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.160G>T	5.37:g.135692916C>A	ENSP00000426070:p.Gly54Cys		Somatic				TRPC7_uc010jef.1_Missense_Mutation_p.G45C|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.G45C|TRPC7_uc010jei.1_Missense_Mutation_p.G45C|TRPC7_uc010jej.1_5'UTR	p.G53C	NM_020389	NP_065122	WXS	Illumina HiSeq	Unspecified	Q9HCX4	TRPC7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		1	160	-			54			Cytoplasmic (Potential).|ANK 1.		A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	37	c.157G>T	CCDS47267.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.482119|4.482119	0.84747|0.84747	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193|ENST00000352189;ENST00000378459;ENST00000502753	T;T;T|.	0.73469|.	-0.75;-0.75;-0.75|.	5.2|5.2	5.2|5.2	0.72013|0.72013	Ankyrin repeat-containing domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88500|0.88500	0.6453|0.6453	H|H	0.96748|0.96748	3.875|3.875	0.51482|0.51482	D|D	0.999927|0.999927	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.999;1.0;1.0|.	D|D	0.92081|0.92081	0.5672|0.5672	10|5	0.87932|.	D|.	0|.	-21.0534|-21.0534	18.9316|18.9316	0.92568|0.92568	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	54;54;54;54|.	Q8IWP7;F5H5U9;Q70T25;Q9HCX4|.	.;.;.;TRPC7_HUMAN|.	C|L	54|53	ENSP00000347312:G54C;ENSP00000441628:G54C;ENSP00000426070:G54C|.	ENSP00000265193:G54C|.	G|W	-|-	1|2	0|0	TRPC7|TRPC7	135720815|135720815	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.651000|7.651000	0.83577|0.83577	2.691000|2.691000	0.91804|0.91804	0.655000|0.655000	0.94253|0.94253	GGC|TGG		0.622	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389		17	114	1	0	6.94344e-10	0.006122	9.65942e-10	17	114				
SLC23A1	9963	broad.mit.edu	37	5	138718265	138718265	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:138718265C>T	ENST00000348729.3	-	2	112	c.66G>A	c.(64-66)ccG>ccA	p.P22P	SLC23A1_ENST00000503919.1_5'UTR|SLC23A1_ENST00000353963.3_Silent_p.P22P	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	22					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)	p.P22P(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	CTGTGGGTAGCGGGGTCGAGG	0.567																																							uc003leh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(64-66)CCG>CCA		solute carrier family 23 (nucleobase	Vitamin C(DB00126)						117.0	98.0	105.0					5																	138718265		2203	4300	6503	SO:0001819	synonymous_variant	9963				brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity	g.chr5:138718265C>T	AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.66G>A	5.37:g.138718265C>T			Somatic				SLC23A1_uc003leg.2_Silent_p.P22P	p.P22P	NM_005847	NP_005838	WXS	Illumina HiSeq	Unspecified	Q9UHI7	S23A1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		2	163	-			22					O95191|Q8WWB6|Q9UGH4|Q9UI39	Silent	SNP	ENST00000348729.3	37	c.66G>A	CCDS4212.1																																																																																				0.567	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1	NM_152685		3	47	0	0	0	0.004672	0	3	47				
PCDHA7	56141	broad.mit.edu	37	5	140215949	140215949	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:140215949G>A	ENST00000525929.1	+	1	1981	c.1981G>A	c.(1981-1983)Gcc>Acc	p.A661T	PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.A661T|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	661	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A661T(2)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCGCTGACAGCCACAGCCAC	0.657																																					NSCLC(160;258 2013 5070 22440 28951)	NSCLC(160;258 2013 5070 22440 28951)	uc003lhq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(1981-1983)GCC>ACC		protocadherin alpha 7 isoform 1 precursor							61.0	64.0	63.0					5																	140215949		2203	4298	6501	SO:0001583	missense	56141				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140215949G>A	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1981G>A	5.37:g.140215949G>A	ENSP00000436426:p.Ala661Thr		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.A661T	p.A661T	NM_018910	NP_061733	WXS	Illumina HiSeq	Unspecified	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1981	+			661			Cadherin 6.|Extracellular (Potential).		O75282	Missense_Mutation	SNP	ENST00000525929.1	37	c.1981G>A	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.836719	0.50951	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.51071	0.72;0.72	3.57	2.67	0.31697	Cadherin (4);Cadherin-like (1);	0.000000	0.31531	U	0.007491	T	0.48314	0.1493	L	0.37561	1.115	0.29718	N	0.838866	B;B	0.33549	0.417;0.059	P;B	0.46510	0.519;0.086	T	0.54186	-0.8331	10	0.54805	T	0.06	.	12.36	0.55197	0.0:0.0:0.8296:0.1704	.	661;661	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	T	661	ENSP00000436426:A661T;ENSP00000367365:A661T	ENSP00000367365:A661T	A	+	1	0	PCDHA7	140196133	0.905000	0.30787	0.921000	0.36526	0.484000	0.33280	1.298000	0.33412	0.785000	0.33685	0.462000	0.41574	GCC		0.657	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910		11	44	0	0	0	0.000978	0	11	44				
PCDHA12	56137	broad.mit.edu	37	5	140256413	140256413	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:140256413G>T	ENST00000398631.2	+	1	1356	c.1356G>T	c.(1354-1356)gcG>gcT	p.A452A	PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	452	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A452A(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGACAATGCGCCTGCGTTCG	0.662																																					Pancreas(113;759 1672 13322 24104 50104)	Pancreas(113;759 1672 13322 24104 50104)	uc003lic.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1354-1356)GCG>GCT		protocadherin alpha 12 isoform 1 precursor							111.0	112.0	112.0					5																	140256413		2203	4300	6503	SO:0001819	synonymous_variant	56137				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140256413G>T	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1356G>T	5.37:g.140256413G>T			Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.A452A	p.A452A	NM_018903	NP_061726	WXS	Illumina HiSeq	Unspecified	Q9UN75	PCDAC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1483	+			452			Cadherin 4.|Extracellular (Potential).		O75278|Q2M1N8	Silent	SNP	ENST00000398631.2	37	c.1356G>T	CCDS47285.1																																																																																				0.662	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903		14	68	1	0	3.27435e-08	0.00245	4.30614e-08	14	68				
PCDHB1	29930	broad.mit.edu	37	5	140431512	140431512	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:140431512C>T	ENST00000306549.3	+	1	534	c.457C>T	c.(457-459)Cct>Tct	p.P153S		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	153	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P153S(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCACGTTTTCCTCTGCAGAG	0.527																																							uc003lik.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(457-459)CCT>TCT		protocadherin beta 1 precursor							41.0	44.0	43.0					5																	140431512		2203	4300	6503	SO:0001583	missense	29930				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140431512C>T	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.457C>T	5.37:g.140431512C>T	ENSP00000307234:p.Pro153Ser		Somatic					p.P153S	NM_013340	NP_037472	WXS	Illumina HiSeq	Unspecified	Q9Y5F3	PCDB1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	534	+			153			Cadherin 2.|Extracellular (Potential).		Q2M257	Missense_Mutation	SNP	ENST00000306549.3	37	c.457C>T	CCDS4243.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.419152	0.42918	.	.	ENSG00000171815	ENST00000306549	T	0.50001	0.76	5.91	5.03	0.67393	Cadherin (3);Cadherin-like (1);	0.000000	0.47455	D	0.000237	T	0.36908	0.0984	L	0.37630	1.12	0.30216	N	0.797303	P	0.39535	0.677	B	0.40199	0.322	T	0.38243	-0.9670	10	0.38643	T	0.18	.	8.3171	0.32106	0.0:0.7387:0.1294:0.1318	.	153	Q9Y5F3	PCDB1_HUMAN	S	153	ENSP00000307234:P153S	ENSP00000307234:P153S	P	+	1	0	PCDHB1	140411696	0.244000	0.23889	1.000000	0.80357	0.998000	0.95712	1.187000	0.32090	2.813000	0.96785	0.655000	0.94253	CCT		0.527	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340		8	31	0	0	0	0.006214	0	8	31				
PCDHB3	56132	broad.mit.edu	37	5	140482154	140482154	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:140482154G>A	ENST00000231130.2	+	1	1921	c.1921G>A	c.(1921-1923)Gtg>Atg	p.V641M	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	641	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V641M(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCACAGGCTGGTGGTGCTGGT	0.701																																							uc003lio.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1921-1923)GTG>ATG		protocadherin beta 3 precursor							21.0	23.0	22.0					5																	140482154		1718	3508	5226	SO:0001583	missense	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140482154G>A	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1921G>A	5.37:g.140482154G>A	ENSP00000231130:p.Val641Met		Somatic				uc003lin.2_5'Flank	p.V641M	NM_018937	NP_061760	WXS	Illumina HiSeq	Unspecified	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1921	+			641			Extracellular (Potential).|Cadherin 6.		B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	c.1921G>A	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350872	0.41599	.	.	ENSG00000113205	ENST00000231130	T	0.53857	0.6	4.38	-3.64	0.04515	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.60508	0.2274	M	0.82056	2.57	0.09310	N	0.999999	P	0.46064	0.872	P	0.45794	0.493	T	0.66500	-0.5908	9	0.87932	D	0	.	17.9137	0.88942	0.0859:0.1677:0.7464:0.0	.	641	Q9Y5E6	PCDB3_HUMAN	M	641	ENSP00000231130:V641M	ENSP00000231130:V641M	V	+	1	0	PCDHB3	140462338	0.000000	0.05858	0.617000	0.29091	0.667000	0.39255	-2.341000	0.01100	-0.542000	0.06249	-1.334000	0.01262	GTG		0.701	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		6	44	0	0	0	0.001168	0	6	44				
PCDHB13	56123	broad.mit.edu	37	5	140594897	140594897	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:140594897A>G	ENST00000341948.4	+	1	1389	c.1202A>G	c.(1201-1203)tAc>tGc	p.Y401C		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	401	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y401C(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAAACTTTTACACCCTACTA	0.448																																							uc003lja.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1201-1203)TAC>TGC		protocadherin beta 13 precursor							88.0	87.0	87.0					5																	140594897		2203	4300	6503	SO:0001583	missense	56123				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140594897A>G	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1202A>G	5.37:g.140594897A>G	ENSP00000345491:p.Tyr401Cys		Somatic					p.Y401C	NM_018933	NP_061756	WXS	Illumina HiSeq	Unspecified	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1389	+			401			Cadherin 4.|Extracellular (Potential).		A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	c.1202A>G	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	N	14.37	2.514669	0.44763	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.01745	4.66	3.5	2.24	0.28232	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.19644	0.0472	H	0.99435	4.565	0.19575	N	0.999969	D	0.89917	1.0	D	0.91635	0.999	T	0.18429	-1.0337	9	0.87932	D	0	.	8.5589	0.33498	0.8266:0.0:0.0:0.1733	.	401	Q9Y5F0	PCDBD_HUMAN	C	401	ENSP00000345491:Y401C	ENSP00000345491:Y401C	Y	+	2	0	PCDHB13	140575081	0.998000	0.40836	0.002000	0.10522	0.129000	0.20672	3.590000	0.53979	0.314000	0.23086	0.248000	0.18094	TAC		0.448	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		6	48	0	0	0	0.001984	0	6	48				
FAM71B	153745	broad.mit.edu	37	5	156592624	156592624	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:156592624G>T	ENST00000302938.4	-	1	651	c.556C>A	c.(556-558)Cca>Aca	p.P186T		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	186						nucleus (GO:0005634)		p.P186T(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGAAGTGTTGGGGTACTGCAG	0.512																																							uc003lwn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|skin(1)	6						c.(556-558)CCA>ACA		family with sequence similarity 71, member B							185.0	186.0	185.0					5																	156592624		2203	4300	6503	SO:0001583	missense	153745					nucleus		g.chr5:156592624G>T		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.556C>A	5.37:g.156592624G>T	ENSP00000305596:p.Pro186Thr		Somatic					p.P186T	NM_130899	NP_570969	WXS	Illumina HiSeq	Unspecified	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		1	656	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	186					Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	c.556C>A	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	G	6.384	0.438889	0.12104	.	.	ENSG00000170613	ENST00000302938	T	0.17213	2.29	4.46	3.57	0.40892	.	0.727923	0.12304	N	0.480817	T	0.11793	0.0287	N	0.22421	0.69	0.09310	N	1	B	0.26147	0.143	B	0.27170	0.077	T	0.31052	-0.9957	10	0.23302	T	0.38	-7.4493	9.4601	0.38778	0.1037:0.0:0.8963:0.0	.	186	Q8TC56	FA71B_HUMAN	T	186	ENSP00000305596:P186T	ENSP00000305596:P186T	P	-	1	0	FAM71B	156525202	0.660000	0.27420	0.008000	0.14137	0.003000	0.03518	2.172000	0.42463	1.156000	0.42514	0.655000	0.94253	CCA		0.512	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		40	223	1	0	4.92203e-23	0.00623	8.11737e-23	40	223				
ATP10B	23120	broad.mit.edu	37	5	160061467	160061467	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:160061467G>T	ENST00000327245.5	-	12	2121	c.1275C>A	c.(1273-1275)ggC>ggA	p.G425G	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	425					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.G425G(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACTGGATCTGGCCCAAGTCCT	0.502																																							uc003lym.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(1273-1275)GGC>GGA		ATPase, class V, type 10B							157.0	153.0	154.0					5																	160061467		1989	4177	6166	SO:0001819	synonymous_variant	23120				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr5:160061467G>T	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1275C>A	5.37:g.160061467G>T			Somatic				ATP10B_uc003lyp.2_Silent_p.G425G|ATP10B_uc011deg.1_Silent_p.G469G|ATP10B_uc003lyn.2_5'UTR|ATP10B_uc003lyo.2_Silent_p.G397G	p.G425G	NM_025153	NP_079429	WXS	Illumina HiSeq	Unspecified	O94823	AT10B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		12	2122	-	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	425			Cytoplasmic (Potential).		Q9H725	Silent	SNP	ENST00000327245.5	37	c.1275C>A	CCDS43394.1																																																																																				0.502	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		22	94	1	0	2.39556e-15	0.00278	3.68341e-15	22	94				
DOCK2	1794	broad.mit.edu	37	5	169186763	169186763	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:169186763G>C	ENST00000256935.8	+	24	2511	c.2431G>C	c.(2431-2433)Gat>Cat	p.D811H	DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.D303H	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	811					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.D811H(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AATGGTCTTTGATGCGAAGTT	0.468																																							uc003maf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(2)	7						c.(2431-2433)GAT>CAT		dedicator of cytokinesis 2							256.0	233.0	240.0					5																	169186763		2203	4300	6503	SO:0001583	missense	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169186763G>C	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2431G>C	5.37:g.169186763G>C	ENSP00000256935:p.Asp811His		Somatic				DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.D303H	p.D811H	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		24	2511	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	811					Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	c.2431G>C	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263413	0.80358	.	.	ENSG00000134516	ENST00000256935;ENST00000343291;ENST00000520908;ENST00000519628	T;T;T	0.67865	-0.29;-0.29;2.06	5.2	5.2	0.72013	.	0.047332	0.85682	D	0.000000	T	0.81168	0.4766	M	0.77103	2.36	0.80722	D	1	D;D	0.76494	0.994;0.999	P;P	0.62885	0.908;0.888	D	0.83537	0.0094	10	0.72032	D	0.01	.	17.8627	0.88786	0.0:0.0:1.0:0.0	.	303;811	E7ERW7;Q92608	.;DOCK2_HUMAN	H	811;192;303;15	ENSP00000256935:D811H;ENSP00000429283:D303H;ENSP00000428841:D15H	ENSP00000256935:D811H	D	+	1	0	DOCK2	169119341	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.454000	0.73493	2.593000	0.87608	0.655000	0.94253	GAT		0.468	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		13	84	0	0	0	0.003163	0	13	84				
DOCK2	1794	broad.mit.edu	37	5	169446013	169446013	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:169446013G>A	ENST00000256935.8	+	33	3362	c.3282G>A	c.(3280-3282)gaG>gaA	p.E1094E	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Silent_p.E155E|DOCK2_ENST00000520908.1_Silent_p.E586E	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1094	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.E1094E(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTATATTAGAGATGACACTTA	0.453																																							uc003maf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|pancreas(2)	7						c.(3280-3282)GAG>GAA		dedicator of cytokinesis 2							205.0	197.0	200.0					5																	169446013		2203	4300	6503	SO:0001819	synonymous_variant	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169446013G>A	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3282G>A	5.37:g.169446013G>A			Somatic				DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.E586E	p.E1094E	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		33	3362	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	1094			Interaction with CRKL.		Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	c.3282G>A	CCDS4371.1																																																																																				0.453	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		33	210	0	0	0	0.002836	0	33	210				
ADAMTS2	9509	broad.mit.edu	37	5	178541268	178541268	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:178541268T>C	ENST00000251582.7	-	22	3337	c.3236A>G	c.(3235-3237)tAt>tGt	p.Y1079C		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1079	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Y1079C(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GATGGAGCAATAGCGGGACAA	0.502																																							uc003mjw.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(3235-3237)TAT>TGT		ADAM metallopeptidase with thrombospondin type 1							94.0	76.0	82.0					5																	178541268		2203	4300	6503	SO:0001583	missense	9509				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:178541268T>C	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3236A>G	5.37:g.178541268T>C	ENSP00000251582:p.Tyr1079Cys		Somatic				uc003mjv.3_5'Flank	p.Y1079C	NM_014244	NP_055059	WXS	Illumina HiSeq	Unspecified	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)	22	3236	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	1079			PLAC.			Missense_Mutation	SNP	ENST00000251582.7	37	c.3236A>G	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.399481	0.83120	.	.	ENSG00000087116	ENST00000251582	T	0.61627	0.09	5.39	5.39	0.77823	PLAC (1);	0.000000	0.51477	D	0.000097	T	0.74458	0.3719	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.78209	-0.2293	10	0.87932	D	0	.	14.8734	0.70478	0.0:0.0:0.0:1.0	.	1079	O95450	ATS2_HUMAN	C	1079	ENSP00000251582:Y1079C	ENSP00000251582:Y1079C	Y	-	2	0	ADAMTS2	178473874	1.000000	0.71417	0.878000	0.34440	0.968000	0.65278	7.887000	0.87295	2.174000	0.68829	0.459000	0.35465	TAT		0.502	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244		5	22	0	0	0	0.001168	0	5	22				
BTNL3	10917	broad.mit.edu	37	5	180419856	180419856	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:180419856G>T	ENST00000342868.6	+	2	277	c.93G>T	c.(91-93)ttG>ttT	p.L31F		NM_197975.2	NP_932079.1	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3	31						integral component of membrane (GO:0016021)		p.L31F(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(10)|prostate(2)|skin(1)	25	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			TCCAGGCCTTGGTGGGGGAGG	0.542																																							uc003mmr.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(91-93)TTG>TTT		butyrophilin-like 3 precursor							87.0	78.0	81.0					5																	180419856		2099	3922	6021	SO:0001583	missense	10917				lipid metabolic process	integral to membrane		g.chr5:180419856G>T	AB020625	CCDS47358.1	5q35	2014-01-14			ENSG00000168903	ENSG00000168903		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1143	protein-coding gene	gene with protein product	"""butyrophilin-like receptor"""	606192				10429365	Standard	NM_197975		Approved	BTNLR, BTN9.1	uc003mmr.3	Q6UXE8	OTTHUMG00000162091	ENST00000342868.6:c.93G>T	5.37:g.180419856G>T	ENSP00000341787:p.Leu31Phe		Somatic					p.L31F	NM_197975	NP_932079	WXS	Illumina HiSeq	Unspecified	Q6UXE8	BTNL3_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)		2	221	+	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	31			Extracellular (Potential).		Q496L7|Q9Y2C7	Missense_Mutation	SNP	ENST00000342868.6	37	c.93G>T	CCDS47358.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.907357	0.33628	.	.	ENSG00000168903	ENST00000342868;ENST00000376852	T	0.66099	-0.19	2.83	-5.67	0.02444	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60560	0.2278	L	0.52364	1.645	0.09310	N	1	P	0.44380	0.834	P	0.52823	0.71	T	0.59590	-0.7426	9	0.49607	T	0.09	.	6.95	0.24540	0.0:0.3274:0.1947:0.4779	.	31	Q6UXE8	BTNL3_HUMAN	F	31	ENSP00000341787:L31F	ENSP00000341787:L31F	L	+	3	2	BTNL3	180352462	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.188000	0.09642	-1.764000	0.01305	-0.445000	0.05633	TTG		0.542	BTNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367176.2	NM_197975		10	21	1	0	0.00136819	0.001368	0.00149623	10	21				
ATXN1	6310	broad.mit.edu	37	6	16328216	16328216	+	Missense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:16328216G>A	ENST00000244769.4	-	8	1262	c.326C>T	c.(325-327)cCg>cTg	p.P109L	ATXN1_ENST00000436367.1_Missense_Mutation_p.P109L	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	109					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.P109L(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				CCCTGGCTGCGGGGTGGCGTA	0.647																																							uc003nbt.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|central_nervous_system(1)	4						c.(325-327)CCG>CTG		ataxin 1							54.0	58.0	57.0					6																	16328216		2203	4300	6503	SO:0001583	missense	6310				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association	g.chr6:16328216G>A	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.326C>T	6.37:g.16328216G>A	ENSP00000244769:p.Pro109Leu		Somatic				ATXN1_uc010jpi.2_Missense_Mutation_p.P109L|ATXN1_uc010jpj.1_Intron	p.P109L	NM_000332	NP_000323	WXS	Illumina HiSeq	Unspecified	P54253	ATX1_HUMAN			8	1297	-	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)	109					Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	c.326C>T	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454384	0.43634	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.78924	-1.22;-1.22	5.11	5.11	0.69529	.	0.176324	0.51477	D	0.000085	T	0.62660	0.2446	L	0.58101	1.795	0.53688	D	0.999979	P	0.42161	0.772	B	0.29663	0.105	T	0.70270	-0.4918	10	0.44086	T	0.13	-17.1181	18.5424	0.91033	0.0:0.0:1.0:0.0	.	109	P54253	ATX1_HUMAN	L	109	ENSP00000244769:P109L;ENSP00000416360:P109L	ENSP00000244769:P109L	P	-	2	0	ATXN1	16436195	1.000000	0.71417	0.748000	0.31131	0.015000	0.08874	5.104000	0.64584	2.376000	0.81061	0.467000	0.42956	CCG		0.647	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332		14	56	0	0	0	0.00245	0	14	56				
RBM24	221662	broad.mit.edu	37	6	17292081	17292081	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:17292081C>A	ENST00000379052.5	+	4	678	c.442C>A	c.(442-444)Cct>Act	p.P148T	RBM24_ENST00000508508.1_3'UTR|RBM24_ENST00000318204.5_Missense_Mutation_p.P103T|RBM24_ENST00000425446.2_Missense_Mutation_p.P90T	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24	148	Ala-rich.				cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)	p.P103T(2)|p.P148T(1)		endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			CTCCACCACCCCTTACATTGA	0.592																																							uc003nbz.3		NA																	3	Substitution - Missense(3)		lung(2)|prostate(1)	ovary(1)|skin(1)	2						c.(442-444)CCT>ACT		RNA binding motif protein 24 isoform 1							73.0	84.0	80.0					6																	17292081		2182	4298	6480	SO:0001583	missense	221662				cell differentiation|regulation of mRNA stability|regulation of myotube differentiation	cytoplasm|nucleus	mRNA 3'-UTR binding|nucleotide binding	g.chr6:17292081C>A	BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.442C>A	6.37:g.17292081C>A	ENSP00000368341:p.Pro148Thr		Somatic				RBM24_uc003nby.3_3'UTR|RBM24_uc011dix.1_Missense_Mutation_p.P90T|RBM24_uc003nca.2_Missense_Mutation_p.P103T|RBM24_uc011diy.1_Silent_p.P61P|RBM24_uc011diz.1_Silent_p.P46P	p.P148T	NM_001143942	NP_001137414	WXS	Illumina HiSeq	Unspecified	Q9BX46	RBM24_HUMAN	all cancers(50;0.131)|Epithelial(50;0.15)		4	446	+	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	148			Ala-rich.		E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	Missense_Mutation	SNP	ENST00000379052.5	37	c.442C>A	CCDS47378.1	.	.	.	.	.	.	.	.	.	.	C	30	5.052715	0.93793	.	.	ENSG00000112183	ENST00000379052;ENST00000425446;ENST00000318204	T;T;T	0.19250	3.41;2.16;3.41	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.38108	0.1028	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.962	T	0.02345	-1.1173	10	0.23302	T	0.38	-3.7181	19.8414	0.96690	0.0:1.0:0.0:0.0	.	103;148	Q9BX46-2;Q9BX46	.;RBM24_HUMAN	T	148;90;103	ENSP00000368341:P148T;ENSP00000396898:P90T;ENSP00000319551:P103T	ENSP00000319551:P103T	P	+	1	0	RBM24	17400060	1.000000	0.71417	0.982000	0.44146	0.998000	0.95712	5.743000	0.68655	2.695000	0.91970	0.591000	0.81541	CCT		0.592	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039946.2	NM_153020		14	90	1	0	4.36969e-10	0.001855	6.09967e-10	14	90				
TRIM39	56658	broad.mit.edu	37	6	30309955	30309955	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:30309955G>T	ENST00000396547.1	+	8	1636	c.1476G>T	c.(1474-1476)tgG>tgT	p.W492C	TRIM39_ENST00000376659.5_Missense_Mutation_p.W462C|RPP21_ENST00000428040.2_5'Flank|TRIM39-RPP21_ENST00000513556.1_Intron|TRIM39_ENST00000540416.1_Missense_Mutation_p.W462C|TRIM39_ENST00000396548.1_Missense_Mutation_p.W462C|RPP21_ENST00000442966.2_5'Flank|RPP21_ENST00000436442.2_5'Flank|TRIM39_ENST00000396551.3_Missense_Mutation_p.W462C|RPP21_ENST00000433076.2_5'Flank|TRIM39_ENST00000376656.4_Missense_Mutation_p.W492C			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	492	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.W492C(1)		ovary(3)	3						AGAAACTTTGGCCCCTCTTCT	0.507																																							uc010jrz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1474-1476)TGG>TGT		tripartite motif-containing 39 isoform 1							90.0	85.0	86.0					6																	30309955		1511	2709	4220	SO:0001583	missense	56658				apoptosis	cytosol|mitochondrion	identical protein binding|zinc ion binding	g.chr6:30309955G>T	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.1476G>T	6.37:g.30309955G>T	ENSP00000379796:p.Trp492Cys		Somatic				TRIM39_uc003npz.2_Missense_Mutation_p.W462C|TRIM39_uc003nqb.2_Missense_Mutation_p.W462C|TRIM39_uc003nqc.2_Missense_Mutation_p.W462C|TRIM39_uc010jsa.1_Intron|RPP21_uc003nqd.1_5'Flank|RPP21_uc003nqe.1_5'Flank|RPP21_uc003nqf.1_5'Flank	p.W492C	NM_021253	NP_067076	WXS	Illumina HiSeq	Unspecified	Q9HCM9	TRI39_HUMAN			9	1788	+			492			B30.2/SPRY.		Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	ENST00000396547.1	37	c.1476G>T	CCDS34377.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148483	0.57151	.	.	ENSG00000204599	ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000396548;ENST00000376659;ENST00000396547	T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	6.17	6.17	0.99709	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.170073	0.43110	D	0.000611	T	0.49864	0.1582	N	0.02181	-0.65	0.80722	D	1	D;B	0.62365	0.991;0.055	D;B	0.72338	0.977;0.18	T	0.64659	-0.6355	10	0.38643	T	0.18	.	13.8943	0.63761	0.0:0.1522:0.8478:0.0	.	492;462	Q9HCM9;Q9HCM9-2	TRI39_HUMAN;.	C	462;492;492;462;462;462;492	ENSP00000379800:W462C;ENSP00000365844:W492C;ENSP00000439400:W462C;ENSP00000379797:W462C;ENSP00000365847:W462C;ENSP00000379796:W492C	ENSP00000365844:W492C	W	+	3	0	TRIM39	30417934	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.199000	0.32235	2.941000	0.99782	0.655000	0.94253	TGG		0.507	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2	NM_172016		8	34	1	0	3.09899e-07	0.004482	3.99838e-07	8	34				
TMEM217	221468	broad.mit.edu	37	6	37186304	37186304	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:37186304C>G	ENST00000336655.2	-	2	542	c.503G>C	c.(502-504)cGa>cCa	p.R168P	TMEM217_ENST00000356757.2_Missense_Mutation_p.R168P|TMEM217_ENST00000497775.1_Intron	NM_145316.3	NP_660359.2	Q8N7C4	TM217_HUMAN	transmembrane protein 217	168						integral component of membrane (GO:0016021)		p.R168P(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(1)	9						TGTAGAAATTCGTCTCTTGTA	0.438																																							uc003onl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(502-504)CGA>CCA		transmembrane protein 217 isoform 1							112.0	117.0	115.0					6																	37186304		2203	4300	6503	SO:0001583	missense	221468					integral to membrane		g.chr6:37186304C>G		CCDS4831.1, CCDS69102.1	6p21.31-p21.2	2008-10-20	2008-07-07	2008-07-07	ENSG00000172738	ENSG00000172738			21238	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 128"""	C6orf128			Standard	NM_001162900		Approved	dJ355M6.2	uc010jws.3	Q8N7C4	OTTHUMG00000014618	ENST00000336655.2:c.503G>C	6.37:g.37186304C>G	ENSP00000338164:p.Arg168Pro		Somatic				TMEM217_uc010jwr.2_Missense_Mutation_p.R168P|TMEM217_uc010jws.2_Intron|TMEM217_uc003onm.3_Missense_Mutation_p.R168P	p.R168P	NM_145316	NP_660359	WXS	Illumina HiSeq	Unspecified	Q8N7C4	TM217_HUMAN			2	584	-			168					Q8TC54	Missense_Mutation	SNP	ENST00000336655.2	37	c.503G>C	CCDS4831.1	.	.	.	.	.	.	.	.	.	.	C	11.81	1.749895	0.30955	.	.	ENSG00000172738	ENST00000356757;ENST00000336655	.	.	.	4.53	3.59	0.41128	.	.	.	.	.	T	0.32734	0.0839	L	0.50333	1.59	0.09310	N	0.999996	P;P	0.41848	0.763;0.763	P;P	0.49502	0.477;0.613	T	0.06698	-1.0812	8	0.52906	T	0.07	-17.5448	9.9566	0.41671	0.0:0.7934:0.2066:0.0	.	168;168	Q8N7C4-2;Q8N7C4	.;TM217_HUMAN	P	168	.	ENSP00000338164:R168P	R	-	2	0	TMEM217	37294282	0.014000	0.17966	0.326000	0.25389	0.009000	0.06853	0.382000	0.20635	2.499000	0.84300	0.603000	0.83216	CGA		0.438	TMEM217-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357542.1	NM_145316		25	138	0	0	0	0.007291	0	25	138				
CUL7	9820	broad.mit.edu	37	6	43018826	43018826	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:43018826C>G	ENST00000265348.3	-	4	1198	c.1113G>C	c.(1111-1113)ttG>ttC	p.L371F	CUL7_ENST00000478630.1_5'Flank|CUL7_ENST00000535468.1_Missense_Mutation_p.L455F			Q14999	CUL7_HUMAN	cullin 7	371	Interaction with TP53.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.L371F(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CCCGCACATACAAAGCATAGG	0.592																																							uc003otq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)	4						c.(1111-1113)TTG>TTC		cullin 7							107.0	96.0	100.0					6																	43018826		2203	4300	6503	SO:0001583	missense	9820				interspecies interaction between organisms|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding	g.chr6:43018826C>G	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.1113G>C	6.37:g.43018826C>G	ENSP00000265348:p.Leu371Phe		Somatic				CUL7_uc011dvb.1_Missense_Mutation_p.L455F|CUL7_uc010jyh.2_Intron|KLC4_uc003otr.1_Intron	p.L371F	NM_014780	NP_055595	WXS	Illumina HiSeq	Unspecified	Q14999	CUL7_HUMAN	all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)		4	1416	-			371			Interaction with TP53.		B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	c.1113G>C	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.716565	0.48622	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.79940	-1.31;-1.32	5.39	0.00435	0.14058	CPH domain (1);Translation protein SH3-like, subgroup (1);	0.239086	0.41001	D	0.000961	T	0.73521	0.3597	L	0.46157	1.445	0.80722	D	1	D;D	0.71674	0.998;0.998	P;D	0.71656	0.904;0.974	T	0.70945	-0.4734	10	0.40728	T	0.16	-5.2473	4.2948	0.10895	0.0851:0.5183:0.1375:0.2591	.	455;371	F5H0L1;Q14999	.;CUL7_HUMAN	F	371;455	ENSP00000265348:L371F;ENSP00000438788:L455F	ENSP00000265348:L371F	L	-	3	2	CUL7	43126804	0.998000	0.40836	0.996000	0.52242	0.990000	0.78478	0.642000	0.24735	0.022000	0.15160	0.563000	0.77884	TTG		0.592	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780		26	49	0	0	0	0.003954	0	26	49				
ZNF318	24149	broad.mit.edu	37	6	43307502	43307502	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:43307502C>T	ENST00000361428.2	-	10	4311	c.4234G>A	c.(4234-4236)Ggg>Agg	p.G1412R	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1412					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.G1412R(2)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			ACCTCTTCCCCTCCAAATGCT	0.458																																							uc003oux.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7						c.(4234-4236)GGG>AGG		zinc finger protein 318							63.0	62.0	62.0					6																	43307502		2203	4300	6503	SO:0001583	missense	24149				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding	g.chr6:43307502C>T	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.4234G>A	6.37:g.43307502C>T	ENSP00000354964:p.Gly1412Arg		Somatic				ZNF318_uc003ouw.2_Intron	p.G1412R	NM_014345	NP_055160	WXS	Illumina HiSeq	Unspecified	Q5VUA4	ZN318_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)		10	4312	-			1412					O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	c.4234G>A	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671215	0.67814	.	.	ENSG00000171467	ENST00000361428	T	0.44881	0.91	5.45	5.45	0.79879	.	0.160214	0.43579	D	0.000541	T	0.46833	0.1413	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51888	-0.8648	10	0.66056	D	0.02	-14.5425	19.2881	0.94087	0.0:1.0:0.0:0.0	.	1412	Q5VUA4	ZN318_HUMAN	R	1412	ENSP00000354964:G1412R	ENSP00000354964:G1412R	G	-	1	0	ZNF318	43415480	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.978000	0.56881	2.567000	0.86603	0.655000	0.94253	GGG		0.458	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		13	64	0	0	0	0.001368	0	13	64				
TDRD6	221400	broad.mit.edu	37	6	46660740	46660740	+	Silent	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:46660740G>C	ENST00000316081.6	+	1	4875	c.4875G>C	c.(4873-4875)ctG>ctC	p.L1625L	TDRD6_ENST00000544460.1_Silent_p.L1625L	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1625	Tudor 7. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)		p.L1625L(1)		NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			CTGAACTTCTGTCGGTTCCCA	0.408																																							uc003oyj.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)|ovary(2)|skin(1)	6						c.(4873-4875)CTG>CTC		tudor domain containing 6							108.0	113.0	111.0					6																	46660740		2203	4300	6503	SO:0001819	synonymous_variant	221400				cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding	g.chr6:46660740G>C	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.4875G>C	6.37:g.46660740G>C			Somatic				TDRD6_uc010jze.2_Silent_p.L1619L	p.L1625L	NM_001010870	NP_001010870	WXS	Illumina HiSeq	Unspecified	O60522	TDRD6_HUMAN	Lung(136;0.192)		1	4875	+			1625			Tudor 7.		B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Silent	SNP	ENST00000316081.6	37	c.4875G>C	CCDS34470.1																																																																																				0.408	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443		28	117	0	0	0	0.002445	0	28	117				
PRIM2	5558	broad.mit.edu	37	6	57398139	57398139	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:57398139C>T	ENST00000607273.1	+	10	929	c.842C>T	c.(841-843)aCc>aTc	p.T281I	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	281					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.T281I(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TAGCTTTCTACCAAATCCTTC	0.368																																							uc003pdx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(841-843)ACC>ATC		DNA primase polypeptide 2							245.0	223.0	230.0					6																	57398139		1905	4134	6039	SO:0001583	missense	5558				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding	g.chr6:57398139C>T		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.842C>T	6.37:g.57398139C>T	ENSP00000475738:p.Thr281Ile		Somatic					p.T281I	NM_000947	NP_000938	WXS	Illumina HiSeq	Unspecified	P49643	PRI2_HUMAN		Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)	10	929	+			281					Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	ENST00000607273.1	37	c.842C>T																																																																																					0.368	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947		21	113	0	0	0	0.001882	0	21	113				
BCKDHB	594	broad.mit.edu	37	6	80838877	80838877	+	Splice_Site	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:80838877G>T	ENST00000320393.6	+	3	321		c.e3-1		BCKDHB_ENST00000369760.4_Splice_Site|BCKDHB_ENST00000356489.5_Splice_Site|BCKDHB_ENST00000545529.1_Splice_Site|BCKDHB_ENST00000486968.1_Splice_Site	NM_183050.2	NP_898871.1	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1, beta polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)	p.?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(1)	15		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		CTGTTTTTCAGTAATATTTGG	0.259																																							uc003pjd.2		NA																	1	Unknown(1)		lung(1)		0						c.e3-1		branched chain keto acid dehydrogenase E1 beta							93.0	96.0	95.0					6																	80838877		2201	4299	6500	SO:0001630	splice_region_variant	594				branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding	g.chr6:80838877G>T	M55575	CCDS4994.1	6q14.1	2008-07-31	2008-07-31		ENSG00000083123	ENSG00000083123			987	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	248611					Standard	NM_183050		Approved		uc003pje.2	P21953	OTTHUMG00000016430	ENST00000320393.6:c.275-1G>T	6.37:g.80838877G>T			Somatic				BCKDHB_uc003pje.2_Splice_Site_p.V92_splice	p.V92_splice	NM_000056	NP_000047	WXS	Illumina HiSeq	Unspecified	P21953	ODBB_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0291)	3	342	+		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)						Q5T2J3|Q9BQL0	Splice_Site	SNP	ENST00000320393.6	37	c.275_splice	CCDS4994.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.528049	0.64860	.	.	ENSG00000083123	ENST00000369760;ENST00000320393;ENST00000356489;ENST00000545529;ENST00000541767	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5419	0.76057	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BCKDHB	80895596	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.611000	0.82962	2.737000	0.93849	0.643000	0.83706	.		0.259	BCKDHB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043911.2	NM_000056	Intron	16	56	1	0	1.15088e-07	0.004007	1.49431e-07	16	56				
MED23	9439	broad.mit.edu	37	6	131943063	131943063	+	Silent	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:131943063T>A	ENST00000368068.3	-	6	632	c.453A>T	c.(451-453)acA>acT	p.T151T	MED23_ENST00000403834.3_Silent_p.T151T|MED23_ENST00000354577.4_Silent_p.T151T|MED23_ENST00000368053.4_Silent_p.T151T|MED23_ENST00000539158.1_Silent_p.T151T|MED23_ENST00000540546.1_Silent_p.T151T|MED23_ENST00000368060.3_Silent_p.T151T|MED23_ENST00000368058.1_Silent_p.T151T	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	151					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)	p.T151T(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		CAGAGCTCACTGTATTAGGAA	0.358																																							uc003qcs.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(451-453)ACA>ACT		mediator complex subunit 23 isoform a							103.0	108.0	106.0					6																	131943063		2203	4300	6503	SO:0001819	synonymous_variant	9439				regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity	g.chr6:131943063T>A	AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.453A>T	6.37:g.131943063T>A			Somatic				MED23_uc003qcq.2_Silent_p.T151T|MED23_uc003qct.1_Silent_p.T151T|MED23_uc011ecb.1_RNA	p.T151T	NM_004830	NP_004821	WXS	Illumina HiSeq	Unspecified	Q9ULK4	MED23_HUMAN		GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)	6	627	-	Breast(56;0.0753)		151					B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Silent	SNP	ENST00000368068.3	37	c.453A>T	CCDS5147.1																																																																																				0.358	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1			24	107	0	0	0	0.004656	0	24	107				
VNN2	8875	broad.mit.edu	37	6	133073886	133073886	+	Nonsense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:133073886G>C	ENST00000326499.6	-	4	664	c.540C>G	c.(538-540)taC>taG	p.Y180*	VNN2_ENST00000525289.1_Intron|RP1-55C23.7_ENST00000430895.1_RNA|VNN2_ENST00000526192.1_5'Flank|VNN2_ENST00000525270.1_Nonsense_Mutation_p.Y127*	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	180	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)	p.Y180*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		AGTACAGGTGGTACTACAACA	0.403																																							uc003qdt.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(538-540)TAC>TAG		vanin 2 isoform 1 precursor							81.0	79.0	80.0					6																	133073886		2203	4300	6503	SO:0001587	stop_gained	8875				cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity	g.chr6:133073886G>C	AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.540C>G	6.37:g.133073886G>C	ENSP00000322276:p.Tyr180*		Somatic				VNN2_uc003qds.2_5'UTR|VNN2_uc010kgb.2_Intron|VNN2_uc003qdv.2_Nonsense_Mutation_p.Y127*	p.Y180*	NM_004665	NP_004656	WXS	Illumina HiSeq	Unspecified	O95498	VNN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)	4	551	-			180			CN hydrolase.		A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Nonsense_Mutation	SNP	ENST00000326499.6	37	c.540C>G	CCDS5161.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.577021	0.65878	.	.	ENSG00000112303	ENST00000326499;ENST00000525270	.	.	.	4.8	1.88	0.25563	.	0.579435	0.16274	N	0.221654	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4645	8.6907	0.34264	0.0702:0.0:0.4296:0.5002	.	.	.	.	X	180;127	.	ENSP00000322276:Y180X	Y	-	3	2	VNN2	133115579	0.441000	0.25626	0.859000	0.33776	0.882000	0.50991	-0.580000	0.05827	0.142000	0.18901	0.514000	0.50259	TAC		0.403	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042264.2			11	92	0	0	0	0.000978	0	11	92				
TXLNB	167838	broad.mit.edu	37	6	139598001	139598001	+	Missense_Mutation	SNP	T	T	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:139598001T>A	ENST00000358430.3	-	3	714	c.482A>T	c.(481-483)aAg>aTg	p.K161M	RP11-445F6.2_ENST00000441249.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	161						cytoplasm (GO:0005737)		p.K161M(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		AAAATCAAACTTTTCTTCCGG	0.348																																							uc011eds.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(481-483)AAG>ATG		taxilin beta							102.0	100.0	101.0					6																	139598001		2201	4298	6499	SO:0001583	missense	167838					cytoplasm		g.chr6:139598001T>A		CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.482A>T	6.37:g.139598001T>A	ENSP00000351206:p.Lys161Met		Somatic					p.K161M	NM_153235	NP_694967	WXS	Illumina HiSeq	Unspecified	Q8N3L3	TXLNB_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)	3	647	-			161			Potential.		Q5VTF3|Q76L25|Q86T52|Q8N3S2	Missense_Mutation	SNP	ENST00000358430.3	37	c.482A>T	CCDS34545.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.322446	0.81580	.	.	ENSG00000164440	ENST00000358430	T	0.40476	1.03	5.14	5.14	0.70334	.	0.090247	0.85682	D	0.000000	T	0.61489	0.2351	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67987	-0.5528	9	.	.	.	-30.7071	15.2497	0.73536	0.0:0.0:0.0:1.0	.	161	Q8N3L3	TXLNB_HUMAN	M	161	ENSP00000351206:K161M	.	K	-	2	0	TXLNB	139639694	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.651000	0.83577	2.059000	0.61396	0.454000	0.30748	AAG		0.348	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042458.1	NM_153235		6	43	0	0	0	0.001168	0	6	43				
GRM1	2911	broad.mit.edu	37	6	146480615	146480615	+	Silent	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr6:146480615C>A	ENST00000282753.1	+	2	1067	c.832C>A	c.(832-834)Cga>Aga	p.R278R	GRM1_ENST00000507907.1_Silent_p.R278R|GRM1_ENST00000355289.4_Silent_p.R278R|GRM1_ENST00000392299.2_Silent_p.R278R|GRM1_ENST00000361719.2_Silent_p.R278R|GRM1_ENST00000492807.2_Silent_p.R278R			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	278					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.R278R(2)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GCGCAAACTCCGAGAGAGGCT	0.587																																							uc010khw.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(832-834)CGA>AGA		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						90.0	81.0	84.0					6																	146480615		2203	4300	6503	SO:0001819	synonymous_variant	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146480615C>A	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.832C>A	6.37:g.146480615C>A			Somatic				GRM1_uc010khu.1_Silent_p.R278R|GRM1_uc010khv.1_Silent_p.R278R|GRM1_uc003qll.2_Silent_p.R278R|GRM1_uc011edz.1_Silent_p.R278R|GRM1_uc011eea.1_Silent_p.R278R	p.R278R	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	3	1302	+		Ovarian(120;0.0387)	278			Extracellular (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Silent	SNP	ENST00000282753.1	37	c.832C>A	CCDS5209.1																																																																																				0.587	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		7	44	1	0	8.12818e-05	0.001984	9.33828e-05	7	44				
MMD2	221938	broad.mit.edu	37	7	4965100	4965100	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:4965100G>T	ENST00000404774.3	-	2	305	c.111C>A	c.(109-111)gcC>gcA	p.A37A	MMD2_ENST00000401401.3_Silent_p.A37A|MMD2_ENST00000406755.1_Silent_p.A37A	NM_001100600.1	NP_001094070.1	Q8IY49	PAQRA_HUMAN	monocyte to macrophage differentiation-associated 2	37						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.A37A(2)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(11)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		TGGCACAGTTGGCCGCATGTT	0.602																																							uc003sno.3		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)	1						c.(109-111)GCC>GCA		monocyte to macrophage							145.0	144.0	144.0					7																	4965100		1941	4132	6073	SO:0001819	synonymous_variant	221938					integral to membrane	receptor activity	g.chr7:4965100G>T	BC037881	CCDS47529.1, CCDS47530.1, CCDS59047.1	7p22	2004-06-23			ENSG00000136297	ENSG00000136297			30133	protein-coding gene	gene with protein product		614581				12477932	Standard	NM_198403		Approved	PAQR10	uc003sno.4	Q8IY49	OTTHUMG00000151844	ENST00000404774.3:c.111C>A	7.37:g.4965100G>T			Somatic				MMD2_uc003snl.1_RNA|MMD2_uc003snn.3_Silent_p.A37A|MMD2_uc010ksq.2_Silent_p.A37A	p.A37A	NM_001100600	NP_001094070	WXS	Illumina HiSeq	Unspecified	Q8IY49	PAQRA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)	2	307	-		Ovarian(82;0.0175)	37			Cytoplasmic (Potential).		B5MBW4|Q6NVU5|Q6TCH0	Silent	SNP	ENST00000404774.3	37	c.111C>A	CCDS47529.1																																																																																				0.602	MMD2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324136.1	NM_198403		11	126	1	0	5.50884e-06	0.001368	6.7057e-06	11	126				
NOD1	10392	broad.mit.edu	37	7	30492353	30492353	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:30492353C>A	ENST00000222823.4	-	6	1205	c.680G>T	c.(679-681)gGg>gTg	p.G227V	NOD1_ENST00000423334.2_Intron	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	227	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)	p.G227V(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						GAATTTGACCCCTGCGTCTAG	0.582																																							uc003tav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(679-681)GGG>GTG		nucleotide-binding oligomerization domain							69.0	73.0	71.0					7																	30492353		2203	4300	6503	SO:0001583	missense	10392				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity	g.chr7:30492353C>A	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.680G>T	7.37:g.30492353C>A	ENSP00000222823:p.Gly227Val		Somatic				NOD1_uc010kvs.2_Intron	p.G227V	NM_006092	NP_006083	WXS	Illumina HiSeq	Unspecified	Q9Y239	NOD1_HUMAN			6	1203	-			227			NACHT.		B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	ENST00000222823.4	37	c.680G>T	CCDS5427.1	.	.	.	.	.	.	.	.	.	.	C	3.528	-0.096388	0.07010	.	.	ENSG00000106100	ENST00000222823	T	0.78481	-1.18	5.49	-1.93	0.07594	NACHT nucleoside triphosphatase (1);	0.638880	0.17777	N	0.162389	T	0.74816	0.3766	M	0.65498	2.005	0.23598	N	0.997321	B	0.29805	0.257	B	0.40199	0.322	T	0.69154	-0.5220	10	0.66056	D	0.02	.	6.7893	0.23692	0.0:0.3492:0.1267:0.5241	.	227	Q9Y239	NOD1_HUMAN	V	227	ENSP00000222823:G227V	ENSP00000222823:G227V	G	-	2	0	NOD1	30458878	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	0.572000	0.23684	-0.476000	0.06842	0.655000	0.94253	GGG		0.582	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2			7	86	1	0	0.00198382	0.001984	0.00214651	7	86				
TBX20	57057	broad.mit.edu	37	7	35242211	35242211	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:35242211C>T	ENST00000408931.3	-	8	1701	c.1175G>A	c.(1174-1176)cGa>cAa	p.R392Q		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	392					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R392Q(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						CATTCCCAGTCGGCTATATGG	0.552																																							uc011kas.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1174-1176)CGA>CAA		T-box transcription factor TBX20							97.0	95.0	96.0					7																	35242211		2021	4179	6200	SO:0001583	missense	57057					nucleus	DNA binding	g.chr7:35242211C>T	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.1175G>A	7.37:g.35242211C>T	ENSP00000386170:p.Arg392Gln		Somatic					p.R392Q	NM_001077653	NP_001071121	WXS	Illumina HiSeq	Unspecified	Q9UMR3	TBX20_HUMAN			8	1186	-			392					A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	ENST00000408931.3	37	c.1175G>A	CCDS43568.1	.	.	.	.	.	.	.	.	.	.	C	31	5.075865	0.94000	.	.	ENSG00000164532	ENST00000408931	D	0.87412	-2.25	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.87977	0.6314	N	0.24115	0.695	0.80722	D	1	D	0.64830	0.994	D	0.64042	0.921	D	0.84164	0.0430	10	0.15499	T	0.54	.	19.7407	0.96230	0.0:1.0:0.0:0.0	.	392	Q9UMR3	TBX20_HUMAN	Q	392	ENSP00000386170:R392Q	ENSP00000386170:R392Q	R	-	2	0	TBX20	35208736	1.000000	0.71417	0.964000	0.40570	0.685000	0.39939	7.487000	0.81328	2.654000	0.90174	0.609000	0.83330	CGA		0.552	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417		9	34	0	0	0	0.008291	0	9	34				
VPS41	27072	broad.mit.edu	37	7	38937702	38937702	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:38937702C>T	ENST00000310301.4	-	2	103	c.49G>A	c.(49-51)Gat>Aat	p.D17N	VPS41_ENST00000395969.2_Missense_Mutation_p.D17N	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	17					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)	p.D17N(1)|p.D17H(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						TCAGACTCATCTGTAGATTCT	0.428																																							uc003tgy.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(49-51)GAT>AAT		vacuolar protein sorting 41 isoform 1							95.0	87.0	90.0					7																	38937702		2203	4300	6503	SO:0001583	missense	27072				Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding	g.chr7:38937702C>T	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.49G>A	7.37:g.38937702C>T	ENSP00000309457:p.Asp17Asn		Somatic				VPS41_uc003tgz.2_Missense_Mutation_p.D17N|VPS41_uc010kxn.2_Missense_Mutation_p.D17N	p.D17N	NM_014396	NP_055211	WXS	Illumina HiSeq	Unspecified	P49754	VPS41_HUMAN			2	75	-			17					E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	ENST00000310301.4	37	c.49G>A	CCDS5457.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657941	0.88154	.	.	ENSG00000006715	ENST00000310301;ENST00000395969	T;T	0.45668	0.89;0.89	5.01	5.01	0.66863	.	0.104701	0.64402	D	0.000006	T	0.43144	0.1234	M	0.73962	2.25	0.42425	D	0.992656	P;P;P	0.37525	0.598;0.455;0.455	B;B;B	0.31751	0.135;0.135;0.135	T	0.45906	-0.9229	10	0.31617	T	0.26	-14.1591	16.8904	0.86085	0.0:1.0:0.0:0.0	.	17;17;17	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	N	17	ENSP00000309457:D17N;ENSP00000379297:D17N	ENSP00000265745:D17N	D	-	1	0	VPS41	38904227	0.998000	0.40836	1.000000	0.80357	0.977000	0.68977	4.692000	0.61746	2.495000	0.84180	0.655000	0.94253	GAT		0.428	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3			4	77	0	0	0	0.009096	0	4	77				
RALA	5898	broad.mit.edu	37	7	39736360	39736360	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:39736360A>G	ENST00000005257.2	+	4	780	c.400A>G	c.(400-402)Aaa>Gaa	p.K134E	RALA_ENST00000468201.1_3'UTR	NM_005402.3	NP_005393.2	P11233	RALA_HUMAN	v-ral simian leukemia viral oncogene homolog A (ras related)	134					actin cytoskeleton reorganization (GO:0031532)|chemotaxis (GO:0006935)|cytokinesis (GO:0000910)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|membrane raft localization (GO:0051665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of filopodium assembly (GO:0051491)|Ras protein signal transduction (GO:0007265)|regulation of exocytosis (GO:0017157)|signal transduction (GO:0007165)|viral process (GO:0016032)	cell surface (GO:0009986)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.K134E(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(9)|skin(3)	16						TTTAGAAGATAAAAGACAGGT	0.363																																							uc003thd.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|skin(1)	2						c.(400-402)AAA>GAA		ras related v-ral simian leukemia viral oncogene							76.0	75.0	76.0					7																	39736360		2203	4300	6503	SO:0001583	missense	5898				actin cytoskeleton reorganization|cell cycle|chemotaxis|cytokinesis|exocytosis|interspecies interaction between organisms|membrane raft localization|nerve growth factor receptor signaling pathway|positive regulation of filopodium assembly|Ras protein signal transduction|regulation of exocytosis	cell surface|cleavage furrow|cytosol|midbody|plasma membrane	Edg-2 lysophosphatidic acid receptor binding|GTP binding|GTPase activity	g.chr7:39736360A>G		CCDS5460.1	7p22-p15	2014-05-09			ENSG00000006451	ENSG00000006451			9839	protein-coding gene	gene with protein product	"""RAS-like protein A"", ""Ras-related protein Ral-A"", ""Ras family small GTP binding protein RALA"", ""ras related GTP binding protein A"""	179550		RAL		3292391	Standard	NM_005402		Approved		uc003thd.3	P11233	OTTHUMG00000128775	ENST00000005257.2:c.400A>G	7.37:g.39736360A>G	ENSP00000005257:p.Lys134Glu		Somatic					p.K134E	NM_005402	NP_005393	WXS	Illumina HiSeq	Unspecified	P11233	RALA_HUMAN			4	700	+			134					A4D1W3	Missense_Mutation	SNP	ENST00000005257.2	37	c.400A>G	CCDS5460.1	.	.	.	.	.	.	.	.	.	.	A	4.699	0.130035	0.08981	.	.	ENSG00000006451	ENST00000005257	T	0.77098	-1.07	4.84	4.84	0.62591	Small GTP-binding protein domain (1);	0.043658	0.85682	D	0.000000	T	0.42832	0.1220	N	0.00422	-1.515	0.53688	D	0.999976	B	0.02656	0.0	B	0.06405	0.002	T	0.55860	-0.8074	10	0.02654	T	1	.	14.739	0.69440	1.0:0.0:0.0:0.0	.	134	P11233	RALA_HUMAN	E	134	ENSP00000005257:K134E	ENSP00000005257:K134E	K	+	1	0	RALA	39702885	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.158000	0.50723	1.942000	0.56320	0.460000	0.39030	AAA		0.363	RALA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250696.2	NM_005402		22	66	0	0	0	0.00278	0	22	66				
CCM2	83605	broad.mit.edu	37	7	45104118	45104118	+	Silent	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:45104118G>C	ENST00000258781.6	+	4	494	c.345G>C	c.(343-345)ctG>ctC	p.L115L	CCM2_ENST00000461377.1_3'UTR|CCM2_ENST00000475551.1_Silent_p.L109L|CCM2_ENST00000544363.1_Silent_p.L115L|CCM2_ENST00000381112.3_Silent_p.L136L|CCM2_ENST00000541586.1_Silent_p.L57L|CCM2_ENST00000474617.1_Silent_p.L109L	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2	115	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)		p.L136L(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						TGCTCAGCCTGTCTGCGTACA	0.582																																							uc003tmo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(343-345)CTG>CTC		cerebral cavernous malformation 2 isoform 2							75.0	52.0	60.0					7																	45104118		2203	4300	6503	SO:0001819	synonymous_variant	83605	Familial_Cerebral_Cavernous_Angioma			endothelial tube morphogenesis|integrin-mediated signaling pathway|stress-activated MAPK cascade|vasculogenesis	cytoplasm	protein binding	g.chr7:45104118G>C	BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.345G>C	7.37:g.45104118G>C			Somatic				CCM2_uc003tmn.2_RNA|CCM2_uc003tmp.2_Silent_p.L57L|CCM2_uc003tmq.2_RNA|CCM2_uc003tmr.2_Silent_p.L115L|CCM2_uc011kcb.1_Silent_p.L78L|CCM2_uc011kcc.1_Silent_p.L108L|CCM2_uc003tms.2_Silent_p.L136L	p.L115L	NM_031443	NP_113631	WXS	Illumina HiSeq	Unspecified	Q9BSQ5	CCM2_HUMAN			4	491	+			115			PID.		A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	Silent	SNP	ENST00000258781.6	37	c.345G>C	CCDS5500.1																																																																																				0.582	CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251348.1	NM_031443		6	24	0	0	0	0.001168	0	6	24				
UPP1	7378	broad.mit.edu	37	7	48146550	48146550	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:48146550G>T	ENST00000331803.4	+	8	1140	c.517G>T	c.(517-519)Ggg>Tgg	p.G173W	UPP1_ENST00000429491.2_Missense_Mutation_p.G36W|UPP1_ENST00000395564.4_Missense_Mutation_p.G173W|UPP1_ENST00000482015.1_3'UTR|UPP1_ENST00000341253.4_Missense_Mutation_p.G173W			Q16831	UPP1_HUMAN	uridine phosphorylase 1	173					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)	p.G173W(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	GATTGTCCTGGGGAAGCGGGT	0.542																																							uc003toj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(517-519)GGG>TGG		uridine phosphorylase 1							101.0	100.0	100.0					7																	48146550		2203	4300	6503	SO:0001583	missense	7378				nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage	cytosol	uridine phosphorylase activity	g.chr7:48146550G>T	AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.517G>T	7.37:g.48146550G>T	ENSP00000330032:p.Gly173Trp		Somatic				UPP1_uc003tok.2_Missense_Mutation_p.G173W|UPP1_uc003tol.2_Missense_Mutation_p.G173W|UPP1_uc011kch.1_5'UTR|UPP1_uc003ton.2_Missense_Mutation_p.G36W|UPP1_uc003too.2_Missense_Mutation_p.G36W	p.G173W	NM_181597	NP_853628	WXS	Illumina HiSeq	Unspecified	Q16831	UPP1_HUMAN			8	1046	+			173					D3DVM4|Q15362	Missense_Mutation	SNP	ENST00000331803.4	37	c.517G>T	CCDS5507.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333548	0.81801	.	.	ENSG00000183696	ENST00000331803;ENST00000341253;ENST00000395564;ENST00000429491	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.9	5.9	0.94986	Nucleoside phosphorylase domain (1);	0.000000	0.85682	D	0.000000	T	0.78375	0.4273	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.83253	-0.0052	10	0.87932	D	0	-39.1882	19.2671	0.93993	0.0:0.0:1.0:0.0	.	36;173	Q86Y75;Q16831	.;UPP1_HUMAN	W	173;173;173;36	ENSP00000330032:G173W;ENSP00000342878:G173W;ENSP00000378931:G173W;ENSP00000406224:G36W	ENSP00000330032:G173W	G	+	1	0	UPP1	48113075	1.000000	0.71417	0.976000	0.42696	0.485000	0.33311	7.802000	0.85969	2.788000	0.95919	0.650000	0.86243	GGG		0.542	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251360.1	NM_003364		12	82	1	0	3.07112e-06	0.000978	3.79482e-06	12	82				
ZNF107	51427	broad.mit.edu	37	7	64167304	64167304	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:64167304A>T	ENST00000395391.1	+	4	1997	c.622A>T	c.(622-624)Ata>Tta	p.I208L	ZNF107_ENST00000344930.3_Missense_Mutation_p.I208L|ZNF107_ENST00000423627.1_Missense_Mutation_p.I208L			Q9UII5	ZN107_HUMAN	zinc finger protein 107	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I208L(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				TATACATAAAATAATTCATAC	0.368																																							uc003ttd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(622-624)ATA>TTA		zinc finger protein 107							39.0	44.0	42.0					7																	64167304		2201	4295	6496	SO:0001583	missense	51427				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:64167304A>T	AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.622A>T	7.37:g.64167304A>T	ENSP00000378789:p.Ile208Leu		Somatic				ZNF107_uc003tte.2_Missense_Mutation_p.I208L	p.I208L	NM_016220	NP_057304	WXS	Illumina HiSeq	Unspecified	Q9UII5	ZN107_HUMAN			7	1408	+		Lung NSC(55;0.00948)|all_lung(88;0.0249)	208			C2H2-type 5.			Missense_Mutation	SNP	ENST00000395391.1	37	c.622A>T	CCDS5527.1	.	.	.	.	.	.	.	.	.	.	.	12.59	1.984959	0.35036	.	.	ENSG00000196247	ENST00000344930;ENST00000423627;ENST00000395391	T;T;T	0.18016	2.24;2.24;2.24	1.4	1.4	0.22301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06371	0.0164	N	0.03154	-0.405	0.23107	N	0.998286	B	0.06786	0.001	B	0.04013	0.001	T	0.42327	-0.9458	8	.	.	.	.	6.4762	0.22037	1.0:0.0:0.0:0.0	.	208	Q9UII5	ZN107_HUMAN	L	208	ENSP00000343443:I208L;ENSP00000400037:I208L;ENSP00000378789:I208L	.	I	+	1	0	ZNF107	63804739	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-2.263000	0.01174	0.603000	0.29913	0.379000	0.24179	ATA		0.368	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1	NM_016220		10	72	0	0	0	0.006214	0	10	72				
CRCP	27297	broad.mit.edu	37	7	65610483	65610483	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:65610483A>T	ENST00000395326.3	+	5	651	c.293A>T	c.(292-294)cAg>cTg	p.Q98L	CRCP_ENST00000431089.2_Missense_Mutation_p.Q91L|AC068533.7_ENST00000450043.1_Silent_p.P280P|CRCP_ENST00000338592.5_Missense_Mutation_p.Q65L|CRCP_ENST00000398684.2_Missense_Mutation_p.Q21L|CRCP_ENST00000415001.2_Missense_Mutation_p.Q65L|RP5-1132H15.1_ENST00000435524.2_RNA	NM_014478.4	NP_055293.1	O75575	RPC9_HUMAN	CGRP receptor component	98					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|neuropeptide signaling pathway (GO:0007218)|transcription from RNA polymerase III promoter (GO:0006383)	acrosomal vesicle (GO:0001669)|DNA polymerase III complex (GO:0009360)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcitonin gene-related polypeptide receptor activity (GO:0001635)|DNA-directed RNA polymerase activity (GO:0003899)|nucleotide binding (GO:0000166)	p.Q98L(2)|p.Q91L(1)		cervix(1)|kidney(1)|lung(4)	6						GTGGAGATCCAGCTGGTGAGT	0.562																																							uc003tus.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(292-294)CAG>CTG		calcitonin gene-related peptide-receptor							95.0	90.0	92.0					7																	65610483		2203	4300	6503	SO:0001583	missense	27297				acrosome reaction|innate immune response|response to virus|transcription from RNA polymerase III promoter	DNA polymerase III complex|nucleus|plasma membrane	calcitonin receptor activity|DNA-directed RNA polymerase activity|nucleotide binding	g.chr7:65610483A>T	AF073792	CCDS5532.1, CCDS47599.1, CCDS47600.1, CCDS55116.1	7q11.1	2009-01-14			ENSG00000241258	ENSG00000241258			17888	protein-coding gene	gene with protein product	"""calcitonin gene-related peptide-receptor component protein"""	606121				8622957, 10067875, 12482973	Standard	NM_014478		Approved	CGRP-RCP, RCP, RCP9	uc011kdw.2	O75575	OTTHUMG00000129519	ENST00000395326.3:c.293A>T	7.37:g.65610483A>T	ENSP00000378736:p.Gln98Leu		Somatic				CRCP_uc003tuv.2_RNA|CRCP_uc011kdw.1_Missense_Mutation_p.Q91L|CRCP_uc003tut.2_Missense_Mutation_p.Q65L|CRCP_uc003tuu.2_Missense_Mutation_p.Q21L	p.Q98L	NM_014478	NP_055293	WXS	Illumina HiSeq	Unspecified	O75575	RPC9_HUMAN			5	438	+			98					A8MUZ4|A8MW23|B2R4H4|B4E198|Q3KRA3|Q5HYF1|Q8IXL4	Missense_Mutation	SNP	ENST00000395326.3	37	c.293A>T	CCDS5532.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.362850	0.61403	.	.	ENSG00000241258	ENST00000395326;ENST00000431089;ENST00000398684;ENST00000338592;ENST00000415001	.	.	.	5.0	5.0	0.66597	HRDC-like (1);RNA polymerase II, Rpb4, core (1);	0.000000	0.85682	D	0.000000	T	0.80076	0.4557	M	0.91140	3.18	0.80722	D	1	D;D;D;D	0.62365	0.975;0.991;0.982;0.986	P;D;P;D	0.78314	0.871;0.991;0.891;0.934	T	0.79725	-0.1683	9	0.17369	T	0.5	-21.4541	11.2611	0.49083	1.0:0.0:0.0:0.0	.	91;21;65;98	B4E198;A8MUZ4;O75575-2;O75575	.;.;.;RPC9_HUMAN	L	98;91;21;65;65	.	ENSP00000340044:Q65L	Q	+	2	0	CRCP	65247918	1.000000	0.71417	1.000000	0.80357	0.316000	0.28119	5.838000	0.69388	2.228000	0.72767	0.533000	0.62120	CAG		0.562	CRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251697.2	NM_014478		12	96	0	0	0	0.001368	0	12	96				
ABCB1	5243	broad.mit.edu	37	7	87133638	87133638	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:87133638C>A	ENST00000265724.3	-	29	4181	c.3764G>T	c.(3763-3765)gGc>gTc	p.G1255V	ABCB1_ENST00000488737.2_5'UTR|ABCB1_ENST00000543898.1_Missense_Mutation_p.G1191V	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	1255	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)	p.G1255V(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CTGATGCGTGCCATGCTCCTT	0.502																																							uc003uiz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(3763-3765)GGC>GTC		ATP-binding cassette, subfamily B, member 1	Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)						166.0	151.0	156.0					7																	87133638		2203	4300	6503	SO:0001583	missense	5243				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity	g.chr7:87133638C>A	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.3764G>T	7.37:g.87133638C>A	ENSP00000265724:p.Gly1255Val		Somatic				ABCB1_uc011khc.1_Missense_Mutation_p.G1191V	p.G1255V	NM_000927	NP_000918	WXS	Illumina HiSeq	Unspecified	P08183	MDR1_HUMAN			29	4182	-	Esophageal squamous(14;0.00164)		1255			Cytoplasmic (Potential).|ABC transporter 2.		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	c.3764G>T	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630940	0.67015	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.91351	-2.83;-2.83	5.8	5.8	0.92144	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.96670	0.8913	M	0.92412	3.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97117	0.9808	10	0.87932	D	0	-18.3643	19.0588	0.93078	0.0:1.0:0.0:0.0	.	1191;1255	B5AK60;P08183	.;MDR1_HUMAN	V	1036;1255;1191	ENSP00000265724:G1255V;ENSP00000444095:G1191V	ENSP00000265724:G1255V	G	-	2	0	ABCB1	86971574	1.000000	0.71417	0.998000	0.56505	0.108000	0.19459	7.780000	0.85658	2.744000	0.94065	0.655000	0.94253	GGC		0.502	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927		16	84	1	0	3.52763e-06	0.00499	4.34579e-06	16	84				
DLX5	1749	broad.mit.edu	37	7	96650229	96650229	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:96650229G>C	ENST00000222598.4	-	3	1162	c.689C>G	c.(688-690)tCc>tGc	p.S230C	DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	230					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)	p.S230C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					GAGCGAGCGGGACGAGCCCTG	0.647																																							uc003uon.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(688-690)TCC>TGC		distal-less homeobox 5							69.0	61.0	64.0					7																	96650229		2203	4300	6503	SO:0001583	missense	1749				cell proliferation|endochondral ossification|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr7:96650229G>C		CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.689C>G	7.37:g.96650229G>C	ENSP00000222598:p.Ser230Cys		Somatic					p.S230C	NM_005221	NP_005212	WXS	Illumina HiSeq	Unspecified	P56178	DLX5_HUMAN			3	897	-	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)		230					B7Z4P3|Q9UPL1	Missense_Mutation	SNP	ENST00000222598.4	37	c.689C>G	CCDS5647.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.944739	0.53079	.	.	ENSG00000105880	ENST00000222598	D	0.90197	-2.63	5.08	5.08	0.68730	.	0.060474	0.64402	D	0.000002	D	0.88876	0.6556	M	0.63843	1.955	0.58432	D	0.999999	P	0.35527	0.507	B	0.34038	0.174	D	0.89551	0.3799	10	0.66056	D	0.02	-12.4272	15.0984	0.72253	0.0:0.1418:0.8582:0.0	.	230	P56178	DLX5_HUMAN	C	230	ENSP00000222598:S230C	ENSP00000222598:S230C	S	-	2	0	DLX5	96488165	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.959000	0.63666	2.640000	0.89533	0.655000	0.94253	TCC		0.647	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334371.2			10	41	0	0	0	0.008291	0	10	41				
MUC17	140453	broad.mit.edu	37	7	100683669	100683669	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:100683669G>C	ENST00000306151.4	+	3	9036	c.8972G>C	c.(8971-8973)aGt>aCt	p.S2991T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2991	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S2991T(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCATTAACAAGTATGTCTGTC	0.512																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(8971-8973)AGT>ACT		mucin 17 precursor							243.0	253.0	250.0					7																	100683669		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100683669G>C	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8972G>C	7.37:g.100683669G>C	ENSP00000302716:p.Ser2991Thr		Somatic				MUC17_uc010lho.1_RNA	p.S2991T	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	9025	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2991			Extracellular (Potential).|Ser-rich.|48.|59 X approximate tandem repeats.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.8972G>C	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.117285	0.00349	.	.	ENSG00000169876	ENST00000306151	T	0.01787	4.64	0.513	-1.03	0.10102	.	.	.	.	.	T	0.00608	0.0020	N	0.04508	-0.205	0.09310	N	1	P	0.42584	0.784	B	0.28638	0.092	T	0.42548	-0.9445	9	0.08179	T	0.78	.	2.0421	0.03553	0.4351:0.0:0.3109:0.2539	.	2991	Q685J3	MUC17_HUMAN	T	2991	ENSP00000302716:S2991T	ENSP00000302716:S2991T	S	+	2	0	MUC17	100470389	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-2.481000	0.00982	-1.910000	0.01083	-1.767000	0.00664	AGT		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		41	220	0	0	0	0.002522	0	41	220				
DOCK4	9732	broad.mit.edu	37	7	111535708	111535708	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:111535708C>T	ENST00000437633.1	-	16	1803	c.1547G>A	c.(1546-1548)aGg>aAg	p.R516K	DOCK4_ENST00000476846.1_5'UTR|DOCK4_ENST00000428084.1_Missense_Mutation_p.R516K	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	516	DHR-1.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.R516K(1)|p.R504K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TGGAAGAGTCCTACCATCTTC	0.413																																							uc003vfx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4						c.(1546-1548)AGG>AAG		dedicator of cytokinesis 4							229.0	210.0	216.0					7																	111535708		2000	4179	6179	SO:0001583	missense	9732				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding	g.chr7:111535708C>T		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.1547G>A	7.37:g.111535708C>T	ENSP00000404179:p.Arg516Lys		Somatic				DOCK4_uc003vfy.2_Missense_Mutation_p.R516K|DOCK4_uc003vga.1_Missense_Mutation_p.R121K	p.R516K	NM_014705	NP_055520	WXS	Illumina HiSeq	Unspecified	Q8N1I0	DOCK4_HUMAN			16	1816	-		Acute lymphoblastic leukemia(1;0.0441)	516			DHR-1.		O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	c.1547G>A	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.3|29.3	4.991763|4.991763	0.93106|0.93106	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000445943|ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	.|T;T	.|0.13089	.|2.62;2.62	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.31482|0.31482	0.0798|0.0798	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.50272	.|0.933;0.933;0.933	.|P;P;P	.|0.53988	.|0.636;0.739;0.636	T|T	0.00252|0.00252	-1.1876|-1.1876	5|10	.|0.56958	.|D	.|0.05	.|.	20.2166|20.2166	0.98299|0.98299	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|516;516;516	.|Q149N2;Q149N5;Q8N1I0	.|.;.;DOCK4_HUMAN	R|K	504|504;516;516;504;515	.|ENSP00000410746:R516K;ENSP00000404179:R516K	.|ENSP00000345432:R504K	G|R	-|-	1|2	0|0	DOCK4|DOCK4	111322944|111322944	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.994000|0.994000	0.84299|0.84299	5.999000|5.999000	0.70665|0.70665	2.781000|2.781000	0.95711|0.95711	0.591000|0.591000	0.81541|0.81541	GGA|AGG		0.413	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705		67	236	0	0	0	0.00361	0	67	236				
CTTNBP2	83992	broad.mit.edu	37	7	117417770	117417770	+	Missense_Mutation	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:117417770C>G	ENST00000160373.3	-	8	2664	c.2573G>C	c.(2572-2574)aGc>aCc	p.S858T		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	858					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.S858N(1)|p.S858T(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AAGCTTGAGGCTGTCCACATT	0.448																																							uc003vjf.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(4)|central_nervous_system(1)	5						c.(2572-2574)AGC>ACC		cortactin binding protein 2							72.0	73.0	73.0					7																	117417770		2203	4300	6503	SO:0001583	missense	83992							g.chr7:117417770C>G		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.2573G>C	7.37:g.117417770C>G	ENSP00000160373:p.Ser858Thr		Somatic					p.S858T	NM_033427	NP_219499	WXS	Illumina HiSeq	Unspecified	Q8WZ74	CTTB2_HUMAN		LUSC - Lung squamous cell carcinoma(290;0.133)	8	2665	-	Lung NSC(10;0.0018)|all_lung(10;0.002)		858			ANK 5.		O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	c.2573G>C	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.680|9.680	1.149056|1.149056	0.21288|0.21288	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000446636|ENST00000160373	.|T	.|0.51325	.|0.71	5.46|5.46	4.57|4.57	0.56435|0.56435	.|Ankyrin repeat-containing domain (3);	.|0.314292	.|0.41294	.|D	.|0.000903	T|T	0.26048|0.26048	0.0635|0.0635	N|N	0.04260|0.04260	-0.245|-0.245	0.27601|0.27601	N|N	0.948974|0.948974	.|P	.|0.42161	.|0.772	.|B	.|0.40410	.|0.328	T|T	0.11275|0.11275	-1.0594|-1.0594	5|10	.|0.13108	.|T	.|0.6	-19.3366|-19.3366	14.4114|14.4114	0.67117|0.67117	0.0:0.9285:0.0:0.0715|0.0:0.9285:0.0:0.0715	.|.	.|858	.|Q8WZ74	.|CTTB2_HUMAN	H|T	345|858	.|ENSP00000160373:S858T	.|ENSP00000160373:S858T	Q|S	-|-	3|2	2|0	CTTNBP2|CTTNBP2	117205006|117205006	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	3.354000|3.354000	0.52254|0.52254	1.427000|1.427000	0.47276|0.47276	0.650000|0.650000	0.86243|0.86243	CAG|AGC		0.448	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		10	73	0	0	0	0.006214	0	10	73				
CTTNBP2	83992	broad.mit.edu	37	7	117432194	117432194	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:117432194G>T	ENST00000160373.3	-	4	1147	c.1056C>A	c.(1054-1056)gcC>gcA	p.A352A	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	352					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.A352A(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TACCTGGTCTGGCCATGGTGG	0.498																																							uc003vjf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(1054-1056)GCC>GCA		cortactin binding protein 2							116.0	107.0	110.0					7																	117432194		2203	4300	6503	SO:0001819	synonymous_variant	83992							g.chr7:117432194G>T		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1056C>A	7.37:g.117432194G>T			Somatic					p.A352A	NM_033427	NP_219499	WXS	Illumina HiSeq	Unspecified	Q8WZ74	CTTB2_HUMAN		LUSC - Lung squamous cell carcinoma(290;0.133)	4	1148	-	Lung NSC(10;0.0018)|all_lung(10;0.002)		352					O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	37	c.1056C>A	CCDS5774.1																																																																																				0.498	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		13	115	1	0	1.5842e-08	0.001855	2.11744e-08	13	115				
CPED1	79974	broad.mit.edu	37	7	120765938	120765938	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:120765938G>T	ENST00000310396.5	+	9	1593	c.1126G>T	c.(1126-1128)Gtg>Ttg	p.V376L	CPED1_ENST00000450913.2_Missense_Mutation_p.V376L|CPED1_ENST00000423795.1_Missense_Mutation_p.V156L	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	376						endoplasmic reticulum (GO:0005783)		p.V376L(1)									GTACCCTGTAGTGCTCCAGGT	0.393																																							uc003vjq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(1126-1128)GTG>TTG		hypothetical protein LOC79974 isoform 1							182.0	155.0	164.0					7																	120765938		2203	4300	6503	SO:0001583	missense	79974					endoplasmic reticulum		g.chr7:120765938G>T		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.1126G>T	7.37:g.120765938G>T	ENSP00000309772:p.Val376Leu		Somatic				C7orf58_uc003vjr.1_Missense_Mutation_p.V376L|C7orf58_uc003vjs.3_Missense_Mutation_p.V376L|C7orf58_uc003vjt.3_Missense_Mutation_p.V156L|C7orf58_uc010lkk.1_Missense_Mutation_p.V156L	p.V376L	NM_024913	NP_079189	WXS	Illumina HiSeq	Unspecified	A4D0V7	CG058_HUMAN			9	1573	+	all_neural(327;0.117)		376					A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	c.1126G>T	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.437147	0.25900	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000423795;ENST00000443817	T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18	5.33	3.5	0.40072	.	0.289127	0.31507	N	0.007540	T	0.34513	0.0900	L	0.58669	1.825	0.80722	D	1	B;B;B	0.28783	0.005;0.222;0.003	B;B;B	0.25987	0.006;0.065;0.004	T	0.31696	-0.9934	10	0.56958	D	0.05	.	12.5617	0.56286	0.1453:0.0:0.8547:0.0	.	156;376;376	G5E9U2;A4D0V7-2;A4D0V7	.;.;CG058_HUMAN	L	376;376;376;156;156	ENSP00000309772:V376L;ENSP00000398082:V376L;ENSP00000406122:V376L;ENSP00000415573:V156L;ENSP00000391952:V156L	ENSP00000309772:V376L	V	+	1	0	C7orf58	120553174	0.964000	0.33143	0.681000	0.30009	0.059000	0.15707	1.533000	0.36040	1.390000	0.46547	-0.137000	0.14449	GTG		0.393	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		10	56	1	0	0.000442599	0.006214	0.000491911	10	56				
RNF133	168433	broad.mit.edu	37	7	122338345	122338345	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:122338345T>C	ENST00000340112.2	-	1	865	c.628A>G	c.(628-630)Att>Gtt	p.I210V	CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000412584.2_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	210					protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.I210V(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						AGTCTATGAATGTGATAAAAG	0.398																																					Colon(198;1778 2057 7449 19869 45985)	Colon(198;1778 2057 7449 19869 45985)	uc003vkj.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(628-630)ATT>GTT		ring finger protein 133							99.0	91.0	93.0					7																	122338345		2203	4299	6502	SO:0001583	missense	168433					endoplasmic reticulum membrane|integral to membrane	ligase activity|zinc ion binding	g.chr7:122338345T>C	AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.628A>G	7.37:g.122338345T>C	ENSP00000344489:p.Ile210Val		Somatic				CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron	p.I210V	NM_139175	NP_631914	WXS	Illumina HiSeq	Unspecified	Q8WVZ7	RN133_HUMAN			1	864	-			210			Helical; (Potential).		A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	37	c.628A>G	CCDS5784.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.554769	0.00138	.	.	ENSG00000188050	ENST00000340112	T	0.15952	2.38	5.62	3.13	0.36017	.	0.155469	0.42548	D	0.000681	T	0.12008	0.0292	L	0.43152	1.355	0.41010	D	0.984991	B	0.18968	0.032	B	0.20184	0.028	T	0.13282	-1.0515	10	0.26408	T	0.33	.	3.6243	0.08108	0.0:0.283:0.1892:0.5278	.	210	Q8WVZ7	RN133_HUMAN	V	210	ENSP00000344489:I210V	ENSP00000344489:I210V	I	-	1	0	RNF133	122125581	0.927000	0.31430	0.166000	0.22797	0.027000	0.11550	2.857000	0.48349	0.967000	0.38186	0.459000	0.35465	ATT		0.398	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175		16	103	0	0	0	0.003163	0	16	103				
OR2A1	346528	broad.mit.edu	37	7	144015559	144015559	+	Silent	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:144015559G>A	ENST00000408951.1	+	1	342	c.342G>A	c.(340-342)ctG>ctA	p.L114L	OR2A1-AS1_ENST00000478925.1_RNA|OR2A1-AS1_ENST00000467944.1_RNA|OR2A1-AS1_ENST00000493539.1_RNA|OR2A1-AS1_ENST00000463561.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000486094.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA|OR2A1-AS1_ENST00000488041.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|OR2A1-AS1_ENST00000476560.1_RNA|OR2A1-AS1_ENST00000475089.1_RNA|OR2A1-AS1_ENST00000487102.1_RNA|OR2A1-AS1_ENST00000496968.1_RNA	NM_001005287.1	NP_001005287.1	Q8NGT9	OR2A1_HUMAN	olfactory receptor, family 2, subfamily A, member 1	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L114L(1)		large_intestine(1)|lung(3)|skin(2)	6	Melanoma(164;0.14)					GTCTCCTGCTGGTGCTGATGT	0.557																																							uc011kud.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(322-324)CTG>CTA		olfactory receptor, family 2, subfamily A,							76.0	87.0	83.0					7																	144015559		2195	4294	6489	SO:0001819	synonymous_variant	346528				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:144015559G>A		CCDS43673.1	7q35	2013-09-20			ENSG00000221970	ENSG00000221970		"""GPCR / Class A : Olfactory receptors"""	8229	protein-coding gene	gene with protein product							Standard	NM_001005287		Approved		uc011kub.2	Q8NGT9	OTTHUMG00000158005	ENST00000408951.1:c.342G>A	7.37:g.144015559G>A			Somatic				OR2A9P_uc003wec.1_Intron	p.L108L	NM_001001802	NP_001001802	WXS	Illumina HiSeq	Unspecified	Q8NGT9	OR2A1_HUMAN			1	324	+	Melanoma(164;0.14)		114			Helical; Name=3; (Potential).		Q6IF44|Q96R46	Silent	SNP	ENST00000408951.1	37	c.324G>A	CCDS43673.1																																																																																				0.557	OR2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349985.1			10	76	0	0	0	0.00499	0	10	76				
GIMAP6	474344	broad.mit.edu	37	7	150325428	150325428	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:150325428C>A	ENST00000328902.5	-	3	474	c.258G>T	c.(256-258)tgG>tgT	p.W86C	GIMAP6_ENST00000493969.1_Intron	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	86	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)	p.W86C(1)		endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCTTCCCAGCCCACTCTCGGC	0.582																																							uc003whn.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(256-258)TGG>TGT		GTPase, IMAP family member 6							119.0	122.0	121.0					7																	150325428		2203	4300	6503	SO:0001583	missense	474344						GTP binding	g.chr7:150325428C>A	AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.258G>T	7.37:g.150325428C>A	ENSP00000330374:p.Trp86Cys		Somatic				GIMAP6_uc003whm.2_Intron	p.W86C	NM_024711	NP_078987	WXS	Illumina HiSeq	Unspecified	Q6P9H5	GIMA6_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	682	-			86					C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Missense_Mutation	SNP	ENST00000328902.5	37	c.258G>T	CCDS34778.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243147	0.39697	.	.	ENSG00000133561	ENST00000328902;ENST00000392862	T	0.06218	3.33	4.29	3.4	0.38934	AIG1 (1);	0.486114	0.22172	N	0.063638	T	0.23926	0.0579	M	0.86268	2.805	0.09310	N	0.99999	D	0.89917	1.0	D	0.76071	0.987	T	0.03910	-1.0993	10	0.38643	T	0.18	.	9.5068	0.39051	0.2091:0.7909:0.0:0.0	.	86	Q6P9H5	GIMA6_HUMAN	C	86;147	ENSP00000330374:W86C	ENSP00000330374:W86C	W	-	3	0	GIMAP6	149956361	0.018000	0.18449	0.052000	0.19188	0.012000	0.07955	0.935000	0.28924	1.011000	0.39340	0.561000	0.74099	TGG		0.582	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353457.1	NM_024711		24	150	1	0	1.66031e-10	0.003954	2.37435e-10	24	150				
GIMAP5	55340	broad.mit.edu	37	7	150439764	150439764	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:150439764G>T	ENST00000358647.3	+	3	904	c.537G>T	c.(535-537)gaG>gaT	p.E179D	GIMAP5_ENST00000479556.1_3'UTR	NM_018384.4	NP_060854.2	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5	179	AIG1-type G.				myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of T cell activation (GO:0050868)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of membrane potential (GO:0045838)|positive regulation of natural killer cell cytokine production (GO:0002729)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of mitochondrial membrane permeability (GO:0046902)|T cell differentiation (GO:0030217)|T cell homeostasis (GO:0043029)|temperature homeostasis (GO:0001659)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)	p.E179D(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|urinary_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGTGCGGGAGTGTGAGAGAA	0.582																																							uc003whr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(535-537)GAG>GAT		GTPase, IMAP family member 5							105.0	99.0	101.0					7																	150439764		2203	4300	6503	SO:0001583	missense	55340					integral to membrane|mitochondrial outer membrane	GTP binding	g.chr7:150439764G>T	AK002158	CCDS5907.1	7q36.1	2014-04-04	2004-10-29	2004-10-30	ENSG00000196329	ENSG00000196329		"""GTPases, IMAP"""	18005	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 5"""	608086	"""immune associated nucleotide 4 like 1 (mouse)"""	IAN4L1			Standard	NM_018384		Approved	HIMAP3, IAN5		Q96F15	OTTHUMG00000157542	ENST00000358647.3:c.537G>T	7.37:g.150439764G>T	ENSP00000351473:p.Glu179Asp		Somatic				GIMAP5_uc010lpu.2_Missense_Mutation_p.E37D	p.E179D	NM_018384	NP_060854	WXS	Illumina HiSeq	Unspecified	Q96F15	GIMA5_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	889	+			179			Cytoplasmic (Potential).		D3DWZ5|Q6IA75|Q96NE4|Q9NUK9	Missense_Mutation	SNP	ENST00000358647.3	37	c.537G>T	CCDS5907.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.863629	0.32884	.	.	ENSG00000196329	ENST00000358647;ENST00000447239	T	0.06142	3.34	4.15	3.24	0.37175	AIG1 (1);	0.361567	0.29015	N	0.013418	T	0.13500	0.0327	L	0.52011	1.625	0.24864	N	0.992323	D	0.69078	0.997	D	0.67900	0.954	T	0.08166	-1.0735	10	0.22706	T	0.39	.	7.9216	0.29850	0.1176:0.0:0.8824:0.0	.	179	Q96F15	GIMA5_HUMAN	D	179;215	ENSP00000351473:E179D	ENSP00000351473:E179D	E	+	3	2	GIMAP5	150070697	0.001000	0.12720	0.996000	0.52242	0.104000	0.19210	-0.037000	0.12164	2.143000	0.66587	0.655000	0.94253	GAG		0.582	GIMAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349108.2	NM_018384		8	106	1	0	5.4927e-09	0.004482	7.38985e-09	8	106				
XPO7	23039	broad.mit.edu	37	8	21860812	21860812	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:21860812T>C	ENST00000252512.9	+	26	3126	c.3026T>C	c.(3025-3027)aTa>aCa	p.I1009T	XPO7_ENST00000433566.4_Missense_Mutation_p.I1010T|XPO7_ENST00000434536.1_Missense_Mutation_p.I1018T	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	1009					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)	p.I1009T(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		CTTGGCTTGATATTGCTTAAT	0.493																																							uc003xaa.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5						c.(3025-3027)ATA>ACA		exportin 7 isoform b							73.0	69.0	71.0					8																	21860812		1937	4146	6083	SO:0001583	missense	23039				mRNA transport|protein export from nucleus|transmembrane transport	cytoplasm|nuclear pore	nuclear export signal receptor activity|protein transporter activity	g.chr8:21860812T>C	AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.3026T>C	8.37:g.21860812T>C	ENSP00000252512:p.Ile1009Thr		Somatic				XPO7_uc010lti.2_Missense_Mutation_p.I1018T|XPO7_uc010ltk.2_Missense_Mutation_p.I1010T	p.I1009T	NM_015024	NP_055839	WXS	Illumina HiSeq	Unspecified	Q9UIA9	XPO7_HUMAN		Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)	26	3128	+			1009					O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	ENST00000252512.9	37	c.3026T>C	CCDS47818.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.545125	0.86022	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.35236	1.32;1.32;1.32	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.53769	0.1817	M	0.85462	2.755	0.80722	D	1	P;P;P	0.51933	0.949;0.899;0.762	P;B;B	0.49012	0.598;0.411;0.285	T	0.63148	-0.6702	10	0.66056	D	0.02	-18.7151	15.6675	0.77242	0.0:0.0:0.0:1.0	.	1010;1018;1009	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	T	1018;1009;1010	ENSP00000404853:I1018T;ENSP00000252512:I1009T;ENSP00000410249:I1010T	ENSP00000252512:I1009T	I	+	2	0	XPO7	21916758	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.851000	0.86920	2.185000	0.69588	0.533000	0.62120	ATA		0.493	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1	NM_015024		2	13	0	0	0	0.004672	0	2	13				
ADAM7	8756	broad.mit.edu	37	8	24342845	24342845	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:24342845C>A	ENST00000175238.6	+	10	1014	c.931C>A	c.(931-933)Ctg>Atg	p.L311M	ADAM7_ENST00000380789.1_Missense_Mutation_p.L311M|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000520720.1_Missense_Mutation_p.L83M|RP11-624C23.1_ENST00000523578.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	311	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L311M(1)		NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		GGGTATGTGCCTGCCCTATTA	0.368																																							uc003xeb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|kidney(1)	5						c.(931-933)CTG>ATG		a disintegrin and metalloproteinase domain 7							145.0	140.0	142.0					8																	24342845		2203	4300	6503	SO:0001583	missense	8756				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr8:24342845C>A	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.931C>A	8.37:g.24342845C>A	ENSP00000175238:p.Leu311Met		Somatic				ADAM7_uc003xec.2_Missense_Mutation_p.L83M	p.L311M	NM_003817	NP_003808	WXS	Illumina HiSeq	Unspecified	Q9H2U9	ADAM7_HUMAN		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)	10	1044	+		Prostate(55;0.0181)	311			Peptidase M12B.|Extracellular (Potential).		A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	ENST00000175238.6	37	c.931C>A	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634848	0.47049	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	T;T;T	0.63255	-0.03;-0.03;-0.03	5.44	1.47	0.22746	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.694506	0.12581	N	0.456413	T	0.61261	0.2333	L	0.42686	1.345	0.09310	N	0.999991	D;D	0.54397	0.966;0.966	P;P	0.58331	0.837;0.837	T	0.51196	-0.8736	10	0.62326	D	0.03	.	1.5105	0.02495	0.1617:0.4677:0.1772:0.1933	.	83;311	E5RK87;Q9H2U9	.;ADAM7_HUMAN	M	311;311;83;126	ENSP00000175238:L311M;ENSP00000370166:L311M;ENSP00000430400:L83M	ENSP00000175238:L311M	L	+	1	2	ADAM7	24398735	0.167000	0.22975	1.000000	0.80357	0.645000	0.38454	0.523000	0.22925	0.681000	0.31386	-0.147000	0.13772	CTG		0.368	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817		17	89	1	0	2.4624e-09	0.008871	3.33483e-09	17	89				
DPYSL2	1808	broad.mit.edu	37	8	26513217	26513217	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:26513217G>T	ENST00000311151.5	+	14	2126	c.1714G>T	c.(1714-1716)Ggc>Tgc	p.G572C	DPYSL2_ENST00000523027.1_Missense_Mutation_p.G536C|DPYSL2_ENST00000521913.1_Missense_Mutation_p.G536C	NM_001386.5	NP_001377.1	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	572					axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|olfactory bulb development (GO:0021772)|positive regulation of glutamate secretion (GO:0014049)|pyrimidine nucleobase catabolic process (GO:0006208)|regulation of neuron differentiation (GO:0045664)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|synaptic vesicle transport (GO:0048489)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	dihydropyrimidinase activity (GO:0004157)	p.G572C(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(3)|prostate(1)|skin(1)|stomach(1)	20		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		CACCAGCCTGGGCTAGAGCTC	0.572											OREG0018659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003xfb.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1714-1716)GGC>TGC		dihydropyrimidinase-like 2							51.0	50.0	51.0					8																	26513217		2202	4300	6502	SO:0001583	missense	1808				axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding	g.chr8:26513217G>T	D78013	CCDS6051.1, CCDS59096.1	8p22-p21	2011-09-28			ENSG00000092964	ENSG00000092964			3014	protein-coding gene	gene with protein product		602463				8973361	Standard	NM_001197293		Approved	DRP-2, DHPRP2, CRMP2, DRP2	uc003xfa.3	Q16555	OTTHUMG00000099439	ENST00000311151.5:c.1714G>T	8.37:g.26513217G>T	ENSP00000309539:p.Gly572Cys		Somatic	OREG0018659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	787	DPYSL2_uc003xfa.2_Missense_Mutation_p.G677C|DPYSL2_uc010luk.1_RNA|DPYSL2_uc011lah.1_Missense_Mutation_p.G536C	p.G572C	NM_001386	NP_001377	WXS	Illumina HiSeq	Unspecified	Q16555	DPYL2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)	14	2064	+		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)	572					A8K5H2|B4DR31|D3DSS7|O00424	Missense_Mutation	SNP	ENST00000311151.5	37	c.1714G>T	CCDS6051.1	.	.	.	.	.	.	.	.	.	.	G	34	5.322351	0.95708	.	.	ENSG00000092964	ENST00000545637;ENST00000521913;ENST00000311151;ENST00000522745;ENST00000523027	D;D;D;D	0.87029	-2.19;-2.2;-2.2;-2.19	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.92648	0.7664	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.92858	0.6303	10	0.87932	D	0	.	19.7664	0.96346	0.0:0.0:1.0:0.0	.	572;628	Q16555;Q59GB4	DPYL2_HUMAN;.	C	198;536;572;572;536	ENSP00000427985:G536C;ENSP00000309539:G572C;ENSP00000428909:G572C;ENSP00000431117:G536C	ENSP00000309539:G572C	G	+	1	0	DPYSL2	26569134	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.813000	0.99286	2.735000	0.93741	0.655000	0.94253	GGC		0.572	DPYSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216904.3	NM_001386		6	48	1	0	0.000442599	0.006214	0.000491911	6	48				
TEX15	56154	broad.mit.edu	37	8	30694594	30694594	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:30694594A>T	ENST00000256246.2	-	3	8131	c.8057T>A	c.(8056-8058)gTa>gAa	p.V2686E		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	2686					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.V2686E(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AGATGGCTGTACTTCATATGA	0.438																																							uc003xil.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(8056-8058)GTA>GAA		testis expressed 15							146.0	141.0	143.0					8																	30694594		2203	4300	6503	SO:0001583	missense	56154							g.chr8:30694594A>T	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.8057T>A	8.37:g.30694594A>T	ENSP00000256246:p.Val2686Glu		Somatic					p.V2686E	NM_031271	NP_112561	WXS	Illumina HiSeq	Unspecified	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	3	8057	-			2686						Missense_Mutation	SNP	ENST00000256246.2	37	c.8057T>A	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	A	9.330	1.060336	0.19987	.	.	ENSG00000133863	ENST00000256246	T	0.11063	2.81	5.6	0.503	0.16940	.	1.450550	0.04273	N	0.342481	T	0.08268	0.0206	N	0.24115	0.695	0.09310	N	1	P	0.40875	0.731	B	0.38616	0.277	T	0.27571	-1.0070	10	0.87932	D	0	.	4.2524	0.10702	0.3016:0.3783:0.3201:0.0	.	2686	Q9BXT5	TEX15_HUMAN	E	2686	ENSP00000256246:V2686E	ENSP00000256246:V2686E	V	-	2	0	TEX15	30814136	0.000000	0.05858	0.000000	0.03702	0.170000	0.22686	-0.762000	0.04745	0.176000	0.19873	0.528000	0.53228	GTA		0.438	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			19	88	0	0	0	0.001882	0	19	88				
DNAJC5B	85479	broad.mit.edu	37	8	66963858	66963858	+	Silent	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:66963858C>T	ENST00000276570.5	+	3	363	c.76C>T	c.(76-78)Ctg>Ttg	p.L26L	DNAJC5B_ENST00000519330.1_3'UTR	NM_033105.4	NP_149096.2	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 beta	26	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					membrane (GO:0016020)		p.L26L(1)		endometrium(3)|large_intestine(6)|liver(1)|lung(6)|prostate(1)|skin(3)	20		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)			AATTCTTGGTCTGCATAAGGG	0.403																																							uc003xvs.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(76-78)CTG>TTG		DnaJ (Hsp40) homolog, subfamily C, member 5							128.0	121.0	123.0					8																	66963858		2203	4300	6503	SO:0001819	synonymous_variant	85479				protein folding	membrane	heat shock protein binding|unfolded protein binding	g.chr8:66963858C>T	AF368276	CCDS6183.1	8q13.1	2012-10-02			ENSG00000147570	ENSG00000147570		"""Heat shock proteins / DNAJ (HSP40)"""	24138	protein-coding gene	gene with protein product		613945				12477932	Standard	NM_033105		Approved	MGC26226, CSP-beta	uc003xvs.1	Q9UF47	OTTHUMG00000164470	ENST00000276570.5:c.76C>T	8.37:g.66963858C>T			Somatic				DNAJC5B_uc003xvt.1_RNA	p.L26L	NM_033105	NP_149096	WXS	Illumina HiSeq	Unspecified	Q9UF47	DNJ5B_HUMAN	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)		3	367	+		Lung NSC(129;0.114)|all_lung(136;0.188)	26			J.		Q969Y8	Silent	SNP	ENST00000276570.5	37	c.76C>T	CCDS6183.1																																																																																				0.403	DNAJC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378915.1	NM_033105		16	162	0	0	0	0.004007	0	16	162				
TRPA1	8989	broad.mit.edu	37	8	72973915	72973915	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:72973915C>A	ENST00000262209.4	-	7	1096	c.889G>T	c.(889-891)Ggt>Tgt	p.G297C		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	297					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.G297C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TCCACGCTACCAGAATAGGAC	0.428																																							uc003xza.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(1)|kidney(1)	6						c.(889-891)GGT>TGT		ankyrin-like protein 1	Menthol(DB00825)						231.0	184.0	200.0					8																	72973915		2203	4300	6503	SO:0001583	missense	8989					integral to plasma membrane		g.chr8:72973915C>A	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.889G>T	8.37:g.72973915C>A	ENSP00000262209:p.Gly297Cys		Somatic					p.G297C	NM_007332	NP_015628	WXS	Illumina HiSeq	Unspecified	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		7	1064	-			297			Cytoplasmic (Potential).|ANK 7.		A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	c.889G>T	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760905	0.49468	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.53206	0.63;2.34	4.94	4.06	0.47325	Ankyrin repeat-containing domain (3);	0.297566	0.38058	N	0.001821	T	0.67552	0.2905	M	0.78223	2.4	0.09310	N	1	D	0.89917	1.0	D	0.74023	0.982	T	0.62215	-0.6901	10	0.59425	D	0.04	-13.2821	13.7254	0.62754	0.0:0.9253:0.0:0.0747	.	297	O75762	TRPA1_HUMAN	C	149;297	ENSP00000428151:G149C;ENSP00000262209:G297C	ENSP00000262209:G297C	G	-	1	0	TRPA1	73136469	0.238000	0.23825	0.118000	0.21660	0.697000	0.40408	3.023000	0.49666	1.298000	0.44778	0.655000	0.94253	GGT		0.428	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		23	117	1	0	2.44723e-14	0.004656	3.72088e-14	23	117				
FABP12	646486	broad.mit.edu	37	8	82437306	82437306	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:82437306G>T	ENST00000360464.4	-	4	460	c.398C>A	c.(397-399)tCa>tAa	p.S133*	RP11-257P3.3_ENST00000518637.1_RNA|RP11-257P3.3_ENST00000523380.1_RNA	NM_001105281.1	NP_001098751.1	A6NFH5	FBP12_HUMAN	fatty acid binding protein 12	133							lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.S133*(1)		large_intestine(1)|lung(3)	4						TGAGTTTGATGATACTTTCTC	0.323																																							uc011lfp.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(397-399)TCA>TAA		fatty acid binding protein 12							92.0	84.0	86.0					8																	82437306		1847	4095	5942	SO:0001587	stop_gained	646486						lipid binding|transporter activity	g.chr8:82437306G>T		CCDS47882.1	8q21.13	2013-03-01			ENSG00000197416	ENSG00000197416		"""Fatty acid binding protein family"""	34524	protein-coding gene	gene with protein product						18786628	Standard	NM_001105281		Approved		uc011lfp.2	A6NFH5	OTTHUMG00000164679	ENST00000360464.4:c.398C>A	8.37:g.82437306G>T	ENSP00000353650:p.Ser133*		Somatic				FABP12_uc003ycg.3_RNA	p.S133*	NM_001105281	NP_001098751	WXS	Illumina HiSeq	Unspecified	A6NFH5	FBP12_HUMAN			4	398	-			133					B7SUN0	Nonsense_Mutation	SNP	ENST00000360464.4	37	c.398C>A	CCDS47882.1	.	.	.	.	.	.	.	.	.	.	G	8.988	0.977110	0.18812	.	.	ENSG00000197416	ENST00000360464	.	.	.	3.2	-1.28	0.09318	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999972	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	5.5746	0.17216	0.0:0.1517:0.5863:0.262	.	.	.	.	X	133	.	ENSP00000353650:S133X	S	-	2	0	FABP12	82599861	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.714000	0.05002	-0.202000	0.10268	0.655000	0.94253	TCA		0.323	FABP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379720.1	NM_001105281		4	15	1	0	0.00024832	0.009096	0.000279019	4	15				
CA2	760	broad.mit.edu	37	8	86385979	86385979	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:86385979G>T	ENST00000285379.5	+	3	520	c.290G>T	c.(289-291)tGg>tTg	p.W97L		NM_000067.2	NP_000058.1	P00918	CAH2_HUMAN	carbonic anhydrase II	97					angiotensin-activated signaling pathway (GO:0038166)|bicarbonate transport (GO:0015701)|kidney development (GO:0001822)|morphogenesis of an epithelium (GO:0002009)|odontogenesis of dentin-containing tooth (GO:0042475)|one-carbon metabolic process (GO:0006730)|positive regulation of bone resorption (GO:0045780)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of dipeptide transmembrane transport (GO:2001150)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of anion transport (GO:0044070)|regulation of chloride transport (GO:2001225)|regulation of intracellular pH (GO:0051453)|response to estrogen (GO:0043627)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.W97L(1)		central_nervous_system(2)|cervix(1)|large_intestine(2)|lung(5)|prostate(1)	11					Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Furosemide(DB00695)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	CACTTTCACTGGGGTTCACTT	0.343																																							uc003ydk.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1	GRCh37	CM042313	CA2	M		c.(289-291)TGG>TTG		carbonic anhydrase II	Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)						93.0	99.0	97.0					8																	86385979		2203	4300	6503	SO:0001583	missense	760				one-carbon metabolic process	apical part of cell	carbonate dehydratase activity|zinc ion binding	g.chr8:86385979G>T	J03037	CCDS6239.1	8q21.2	2012-10-02			ENSG00000104267	ENSG00000104267	4.2.1.1	"""Carbonic anhydrases"""	1373	protein-coding gene	gene with protein product		611492				3107918	Standard	NM_000067		Approved	Car2, CA-II, CAII	uc003ydk.2	P00918	OTTHUMG00000164944	ENST00000285379.5:c.290G>T	8.37:g.86385979G>T	ENSP00000285379:p.Trp97Leu		Somatic					p.W97L	NM_000067	NP_000058	WXS	Illumina HiSeq	Unspecified	P00918	CAH2_HUMAN			3	470	+			97					B2R7G8|Q6FI12|Q96ET9	Missense_Mutation	SNP	ENST00000285379.5	37	c.290G>T	CCDS6239.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.021766	0.93462	.	.	ENSG00000104267	ENST00000285379	D	0.82255	-1.59	5.56	5.56	0.83823	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.94258	0.8156	H	0.96460	3.825	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	D	0.95716	0.8762	10	0.87932	D	0	-1.5082	18.5162	0.90936	0.0:0.0:1.0:0.0	.	97	P00918	CAH2_HUMAN	L	97	ENSP00000285379:W97L	ENSP00000285379:W97L	W	+	2	0	CA2	86573231	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.837000	0.99465	2.625000	0.88918	0.555000	0.69702	TGG		0.343	CA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381097.2	NM_000067		18	131	1	0	7.45023e-12	0.010504	1.08439e-11	18	131				
MMP16	4325	broad.mit.edu	37	8	89209452	89209452	+	Silent	SNP	G	G	T	rs200088411		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:89209452G>T	ENST00000286614.6	-	2	497	c.216C>A	c.(214-216)gcC>gcA	p.A72A	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	72					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A72A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TGGCAGCTAGGGCAGACTGCA	0.473																																							uc003yeb.3		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						c.(214-216)GCC>GCA		matrix metalloproteinase 16 isoform 1							111.0	89.0	96.0					8																	89209452		2203	4300	6503	SO:0001819	synonymous_variant	4325				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding	g.chr8:89209452G>T	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.216C>A	8.37:g.89209452G>T			Somatic				MMP16_uc003yec.2_Silent_p.A72A	p.A72A	NM_005941	NP_005932	WXS	Illumina HiSeq	Unspecified	P51512	MMP16_HUMAN			2	498	-			72					B2RAN7|Q14824|Q52H48	Silent	SNP	ENST00000286614.6	37	c.216C>A	CCDS6246.1																																																																																				0.473	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941		9	71	1	0	7.48243e-07	0.006214	9.50408e-07	9	71				
RUNX1T1	862	broad.mit.edu	37	8	92999139	92999139	+	Silent	SNP	T	T	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:92999139T>G	ENST00000523629.1	-	8	1507	c.1053A>C	c.(1051-1053)gcA>gcC	p.A351A	RUNX1T1_ENST00000265814.3_Silent_p.A351A|RUNX1T1_ENST00000360348.2_Silent_p.A314A|RUNX1T1_ENST00000422361.2_Silent_p.A314A|RUNX1T1_ENST00000520724.1_Silent_p.A314A|RUNX1T1_ENST00000396218.1_Silent_p.A324A|RUNX1T1_ENST00000518844.1_Silent_p.A324A|RUNX1T1_ENST00000436581.2_Silent_p.A362A	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	351	Important for oligomerization.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A362A(1)|p.A314A(1)|p.A351A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TCCACTCTTCTGCCCATTCTC	0.368																																							uc003yfd.2		NA																	3	Substitution - coding silent(3)		lung(3)	lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16						c.(1051-1053)GCA>GCC		acute myelogenous leukemia 1 translocation 1							267.0	232.0	244.0					8																	92999139		2202	4300	6502	SO:0001819	synonymous_variant	862				generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:92999139T>G	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1053A>C	8.37:g.92999139T>G			Somatic				RUNX1T1_uc003yfc.1_Silent_p.A324A|RUNX1T1_uc003yfe.1_Silent_p.A314A|RUNX1T1_uc010mao.2_Silent_p.A324A|RUNX1T1_uc011lgi.1_Silent_p.A362A|RUNX1T1_uc010man.1_5'UTR|RUNX1T1_uc003yfb.1_Silent_p.A314A	p.A351A	NM_175634	NP_783552	WXS	Illumina HiSeq	Unspecified	Q06455	MTG8_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0141)		7	1137	-			351			Important for oligomerization.		B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Silent	SNP	ENST00000523629.1	37	c.1053A>C	CCDS6256.1																																																																																				0.368	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635		16	237	0	0	0	0.00499	0	16	237				
KIAA1429	25962	broad.mit.edu	37	8	95531312	95531312	+	Missense_Mutation	SNP	T	T	A	rs199860687		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:95531312T>A	ENST00000297591.5	-	9	2489	c.2414A>T	c.(2413-2415)aAt>aTt	p.N805I	KIAA1429_ENST00000437199.1_Missense_Mutation_p.N805I|KIAA1429_ENST00000421249.2_Missense_Mutation_p.N805I	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	805					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.N805I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TCCCACAGGATTAAAAGTAAT	0.408																																							uc003ygo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2413-2415)AAT>ATT		hypothetical protein LOC25962 isoform 1							70.0	73.0	72.0					8																	95531312		2203	4300	6503	SO:0001583	missense	25962				mRNA processing|RNA splicing	nucleus		g.chr8:95531312T>A	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.2414A>T	8.37:g.95531312T>A	ENSP00000297591:p.Asn805Ile		Somatic				KIAA1429_uc003ygp.2_Missense_Mutation_p.N805I|KIAA1429_uc010maz.1_RNA	p.N805I	NM_015496	NP_056311	WXS	Illumina HiSeq	Unspecified	Q69YN4	VIR_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00185)		9	2427	-	Breast(36;3.29e-05)		805					Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	c.2414A>T	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	T	18.03	3.533276	0.64972	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.44881	0.92;0.92;0.91	5.24	5.24	0.73138	.	0.048815	0.85682	D	0.000000	T	0.39172	0.1068	N	0.24115	0.695	0.47407	D	0.999416	D;D	0.53745	0.962;0.962	P;P	0.48454	0.578;0.578	T	0.38436	-0.9661	10	0.72032	D	0.01	-22.9247	15.4431	0.75204	0.0:0.0:0.0:1.0	.	805;805	Q69YN4-4;Q69YN4	.;VIR_HUMAN	I	805	ENSP00000297591:N805I;ENSP00000395600:N805I;ENSP00000398390:N805I	ENSP00000297591:N805I	N	-	2	0	KIAA1429	95600488	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.422000	0.59854	2.102000	0.63906	0.455000	0.32223	AAT		0.408	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496		56	81	0	0	0	0.00361	0	56	81				
RIMS2	9699	broad.mit.edu	37	8	104897787	104897787	+	Nonsense_Mutation	SNP	C	C	G	rs200152573		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:104897787C>G	ENST00000436393.2	+	2	535	c.294C>G	c.(292-294)taC>taG	p.Y98*	RIMS2_ENST00000507740.1_Nonsense_Mutation_p.Y128*|RIMS2_ENST00000522174.1_3'UTR|RIMS2_ENST00000262231.10_Nonsense_Mutation_p.Y128*|RIMS2_ENST00000406091.3_Nonsense_Mutation_p.Y320*			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	351	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.Y128*(2)|p.Y356*(1)|p.Y320*(1)|p.Y98*(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GAGATGAATACGAAAGGCAAA	0.428										HNSCC(12;0.0054)																													uc003yls.2		NA																	5	Substitution - Nonsense(5)		lung(5)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(292-294)TAC>TAG		regulating synaptic membrane exocytosis 2							99.0	96.0	97.0					8																	104897787		2001	4156	6157	SO:0001587	stop_gained	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104897787C>G	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.294C>G	8.37:g.104897787C>G	ENSP00000390665:p.Tyr98*	HNSCC(12;0.0054)	Somatic				RIMS2_uc003ylp.2_Nonsense_Mutation_p.Y320*|RIMS2_uc003ylw.2_Nonsense_Mutation_p.Y128*|RIMS2_uc003ylq.2_Nonsense_Mutation_p.Y128*|RIMS2_uc003ylr.2_Nonsense_Mutation_p.Y128*	p.Y98*	NM_014677	NP_055492	WXS	Illumina HiSeq	Unspecified	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		2	535	+			351					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Nonsense_Mutation	SNP	ENST00000436393.2	37	c.294C>G		.	.	.	.	.	.	.	.	.	.	C	16.67	3.186914	0.57909	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	.	.	.	5.32	-1.31	0.09230	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	10.669	0.45747	0.0:0.2704:0.0:0.7296	.	.	.	.	X	320;351;320;351;128;128;128;128;98	.	ENSP00000262231:Y128X	Y	+	3	2	RIMS2	104966963	1.000000	0.71417	0.996000	0.52242	0.847000	0.48162	0.849000	0.27723	-0.194000	0.10399	-1.740000	0.00687	TAC		0.428	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		14	37	0	0	0	0.001855	0	14	37				
CSMD3	114788	broad.mit.edu	37	8	114326964	114326964	+	Silent	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:114326964A>T	ENST00000297405.5	-	2	481	c.237T>A	c.(235-237)ccT>ccA	p.P79P	CSMD3_ENST00000343508.3_Silent_p.P39P|CSMD3_ENST00000352409.3_Silent_p.P79P|CSMD3_ENST00000455883.2_Silent_p.P79P	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	79	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P79P(1)|p.P39P(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATGGAAAACCAGGGCTTTCTA	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(235-237)CCT>CCA		CUB and Sushi multiple domains 3 isoform 1							140.0	140.0	140.0					8																	114326964		2203	4300	6503	SO:0001819	synonymous_variant	114788					integral to membrane|plasma membrane		g.chr8:114326964A>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.237T>A	8.37:g.114326964A>T		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003ynt.2_Silent_p.P39P|CSMD3_uc011lhx.1_Silent_p.P79P|CSMD3_uc010mcx.1_Silent_p.P79P|CSMD3_uc003ynx.3_Silent_p.P79P	p.P79P	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			2	396	-			79			Extracellular (Potential).|CUB 1.		Q96PZ3	Silent	SNP	ENST00000297405.5	37	c.237T>A	CCDS6315.1																																																																																				0.318	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		18	181	0	0	0	0.001882	0	18	181				
CSMD3	114788	broad.mit.edu	37	8	114448956	114448956	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:114448956C>A	ENST00000297405.5	-	1	372	c.128G>T	c.(127-129)gGa>gTa	p.G43V	CSMD3_ENST00000352409.3_Missense_Mutation_p.G43V|CSMD3_ENST00000455883.2_Missense_Mutation_p.G43V	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G43V(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AAACGTAAATCCACTTTTAAT	0.502										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(127-129)GGA>GTA		CUB and Sushi multiple domains 3 isoform 1							185.0	188.0	187.0					8																	114448956		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:114448956C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.128G>T	8.37:g.114448956C>A	ENSP00000297405:p.Gly43Val	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc011lhx.1_Missense_Mutation_p.G43V|CSMD3_uc010mcx.1_Missense_Mutation_p.G43V|CSMD3_uc003ynx.3_Missense_Mutation_p.G43V	p.G43V	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			1	287	-			43			Helical; (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.128G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.663360	0.47572	.	.	ENSG00000164796	ENST00000297405;ENST00000455883;ENST00000352409	T;T;T	0.28069	2.03;1.63;2.03	5.82	5.82	0.92795	.	0.000000	0.37393	U	0.002113	T	0.38772	0.1053	N	0.08118	0	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;1.0;0.996	T	0.49409	-0.8943	10	0.59425	D	0.04	.	19.0738	0.93151	0.0:1.0:0.0:0.0	.	43;43;43;43	Q7Z407-3;Q7Z407-4;Q7Z407-5;Q7Z407	.;.;.;CSMD3_HUMAN	V	43	ENSP00000297405:G43V;ENSP00000412263:G43V;ENSP00000343124:G43V	ENSP00000297405:G43V	G	-	2	0	CSMD3	114518132	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.113000	0.77095	2.734000	0.93682	0.655000	0.94253	GGA		0.502	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		23	199	1	0	1.10923e-09	0.00278	1.5224e-09	23	199				
TNFRSF11B	4982	broad.mit.edu	37	8	119936780	119936780	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:119936780G>T	ENST00000297350.4	-	5	1417	c.1039C>A	c.(1039-1041)Cac>Aac	p.H347N		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	347	Death 2.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)	p.H347N(2)		breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			TTTAGTGCGTGCATTAGGCCC	0.438																																							uc003yon.3		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)	2						c.(1039-1041)CAC>AAC		osteoprotegerin precursor							262.0	241.0	248.0					8																	119936780		2203	4300	6503	SO:0001583	missense	4982				apoptosis|skeletal system development		cytokine activity|receptor activity	g.chr8:119936780G>T	U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.1039C>A	8.37:g.119936780G>T	ENSP00000297350:p.His347Asn		Somatic					p.H347N	NM_002546	NP_002537	WXS	Illumina HiSeq	Unspecified	O00300	TR11B_HUMAN	STAD - Stomach adenocarcinoma(47;0.00193)		5	1362	-	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		347			Death 2.		B2R9A8|O60236|Q53FX6|Q9UHP4	Missense_Mutation	SNP	ENST00000297350.4	37	c.1039C>A	CCDS6326.1	.	.	.	.	.	.	.	.	.	.	G	3.455	-0.111099	0.06881	.	.	ENSG00000164761	ENST00000297350	D	0.84944	-1.92	5.43	2.54	0.30619	Death (1);	0.576740	0.19598	N	0.110460	T	0.75213	0.3819	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.58696	-0.7591	9	.	.	.	-5.9719	4.221	0.10558	0.3262:0.1692:0.5046:0.0	.	347	O00300	TR11B_HUMAN	N	347	ENSP00000297350:H347N	.	H	-	1	0	TNFRSF11B	120005961	0.998000	0.40836	0.118000	0.21660	0.330000	0.28571	2.180000	0.42537	0.308000	0.22923	-0.253000	0.11424	CAC		0.438	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381220.1			53	217	1	0	6.3008e-33	0.00361	1.05616e-32	53	217				
FER1L6	654463	broad.mit.edu	37	8	125052164	125052164	+	Silent	SNP	C	C	A	rs200479041		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:125052164C>A	ENST00000522917.1	+	20	2712	c.2506C>A	c.(2506-2508)Cgg>Agg	p.R836R	FER1L6_ENST00000399018.1_Silent_p.R836R|FER1L6-AS1_ENST00000518567.1_RNA|RP11-959I15.4_ENST00000522005.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	836	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)		p.R836R(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GTACCAAGCCCGGGGCCTCAT	0.507																																							uc003yqw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(5)|central_nervous_system(1)	11						c.(2506-2508)CGG>AGG		fer-1-like 6							108.0	114.0	112.0					8																	125052164		2022	4195	6217	SO:0001819	synonymous_variant	654463					integral to membrane		g.chr8:125052164C>A	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2506C>A	8.37:g.125052164C>A			Somatic				uc003yqx.1_Intron	p.R836R	NM_001039112	NP_001034201	WXS	Illumina HiSeq	Unspecified	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		20	2712	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		836			Cytoplasmic (Potential).|C2 3.			Silent	SNP	ENST00000522917.1	37	c.2506C>A	CCDS43767.1																																																																																				0.507	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		22	90	1	0	2.79863e-10	0.004656	3.93347e-10	22	90				
OC90	729330	broad.mit.edu	37	8	133053357	133053357	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:133053357C>A	ENST00000443356.2	-	6	477	c.391G>T	c.(391-393)Gac>Tac	p.D131Y	OC90_ENST00000262283.5_Missense_Mutation_p.D327Y|OC90_ENST00000603859.1_Missense_Mutation_p.D131Y|OC90_ENST00000254627.3_Missense_Mutation_p.D131Y			Q02509	OC90_HUMAN	otoconin 90	131	Phospholipase A2-like 1.				lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.D327Y(1)|p.D137Y(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			TGGAGACAGTCCATCTCAGCG	0.587																																							uc003ytg.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(343-345)GAC>TAC		otoconin 90																																				SO:0001583	missense	729330				lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity	g.chr8:133053357C>A	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.391G>T	8.37:g.133053357C>A	ENSP00000390050:p.Asp131Tyr		Somatic				OC90_uc011lix.1_Missense_Mutation_p.D131Y	p.D115Y	NM_001080399	NP_001073868	WXS	Illumina HiSeq	Unspecified	Q02509	OC90_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000805)		4	343	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		131			Phospholipase A2-like 1.		B4DNG8	Missense_Mutation	SNP	ENST00000443356.2	37	c.343G>T		.	.	.	.	.	.	.	.	.	.	C	22.5	4.296925	0.81025	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	T;T;T	0.27720	1.65;1.65;1.65	5.61	5.61	0.85477	Phospholipase A2 (3);	0.301734	0.32204	N	0.006432	T	0.54367	0.1854	M	0.62723	1.935	0.40781	D	0.983174	D;D	0.63880	0.991;0.993	D;D	0.68192	0.927;0.956	T	0.55296	-0.8163	10	0.66056	D	0.02	-23.2906	18.6744	0.91524	0.0:1.0:0.0:0.0	.	131;131	Q02509-2;Q02509	.;OC90_HUMAN	Y	131;131;327	ENSP00000254627:D131Y;ENSP00000390050:D131Y;ENSP00000262283:D327Y	ENSP00000254627:D131Y	D	-	1	0	RP11-240B13.2;OC90	133122539	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	5.457000	0.66672	2.669000	0.90835	0.585000	0.79938	GAC		0.587	OC90-201	KNOWN	basic	protein_coding	protein_coding		NM_001080399		27	114	1	0	4.31634e-10	0.002445	6.04583e-10	27	114				
FAM135B	51059	broad.mit.edu	37	8	139180172	139180172	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:139180172G>C	ENST00000395297.1	-	12	1394	c.1224C>G	c.(1222-1224)atC>atG	p.I408M		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	408								p.I408M(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGTCCTCAAAGATCACCGGCA	0.542										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)	9						c.(1222-1224)ATC>ATG		hypothetical protein LOC51059							102.0	104.0	103.0					8																	139180172		2011	4187	6198	SO:0001583	missense	51059							g.chr8:139180172G>C	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1224C>G	8.37:g.139180172G>C	ENSP00000378710:p.Ile408Met	HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Missense_Mutation_p.I309M|FAM135B_uc003yuz.2_RNA	p.I408M	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		12	1395	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		408					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.1224C>G	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497268	0.64186	.	.	ENSG00000147724	ENST00000395297	D	0.87729	-2.29	5.78	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.93035	0.7783	M	0.83118	2.625	0.46774	D	0.999192	D	0.89917	1.0	D	0.87578	0.998	D	0.93089	0.6498	10	0.87932	D	0	-27.5869	11.9542	0.52973	0.1251:0.0:0.8749:0.0	.	408	Q49AJ0	F135B_HUMAN	M	408	ENSP00000378710:I408M	ENSP00000276737:I408M	I	-	3	3	FAM135B	139249354	1.000000	0.71417	1.000000	0.80357	0.628000	0.37860	2.699000	0.47077	2.894000	0.99253	0.655000	0.94253	ATC		0.542	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		25	152	0	0	0	0.003954	0	25	152				
FAM135B	51059	broad.mit.edu	37	8	139209829	139209829	+	Silent	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:139209829A>T	ENST00000395297.1	-	8	923	c.753T>A	c.(751-753)gcT>gcA	p.A251A		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	251								p.A251A(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GACCCCGGTAAGCGTGGAGGA	0.597										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(7)|skin(2)	9						c.(751-753)GCT>GCA		hypothetical protein LOC51059							79.0	92.0	87.0					8																	139209829		2157	4277	6434	SO:0001819	synonymous_variant	51059							g.chr8:139209829A>T	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.753T>A	8.37:g.139209829A>T		HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Silent_p.A152A|FAM135B_uc003yuz.2_RNA	p.A251A	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		8	924	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		251					B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	c.753T>A	CCDS6375.2																																																																																				0.597	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		7	65	0	0	0	0.001984	0	7	65				
TOP1MT	116447	broad.mit.edu	37	8	144407573	144407573	+	Missense_Mutation	SNP	T	T	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:144407573T>G	ENST00000329245.4	-	5	648	c.614A>C	c.(613-615)aAg>aCg	p.K205T	TOP1MT_ENST00000519148.1_Missense_Mutation_p.K107T|TOP1MT_ENST00000523676.1_Missense_Mutation_p.K107T|TOP1MT_ENST00000521193.1_Missense_Mutation_p.K107T	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	205					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)	p.K205T(1)		endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	CATCCCCATCTTGGGATGGTC	0.577																																							uc003yxz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(613-615)AAG>ACG		mitochondrial topoisomerase I precursor	Irinotecan(DB00762)|Topotecan(DB01030)						82.0	77.0	79.0					8																	144407573		2203	4300	6503	SO:0001583	missense	116447				DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity	g.chr8:144407573T>G	AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.614A>C	8.37:g.144407573T>G	ENSP00000328835:p.Lys205Thr		Somatic				TOP1MT_uc011lkd.1_Missense_Mutation_p.K107T|TOP1MT_uc011lke.1_Missense_Mutation_p.K107T|TOP1MT_uc010mfb.2_Missense_Mutation_p.K107T|TOP1MT_uc011lkf.1_5'UTR|TOP1MT_uc010mfd.1_5'UTR	p.K205T	NM_052963	NP_443195	WXS	Illumina HiSeq	Unspecified	Q969P6	TOP1M_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		5	633	-	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		205					B7ZAR5|E7ES89|Q86ST4|Q86V82	Missense_Mutation	SNP	ENST00000329245.4	37	c.614A>C	CCDS6400.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.128960	0.77549	.	.	ENSG00000184428	ENST00000329245;ENST00000521193;ENST00000519148;ENST00000523676;ENST00000522041;ENST00000519591	T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53	3.48	3.48	0.39840	DNA topoisomerase I, C-terminal, eukaryotic-type (1);DNA topoisomerase I, DNA binding, mixed alpha/beta motif, eukaryotic-type (1);DNA topoisomerase I, C-terminal (1);DNA topoisomerase I, DNA binding, eukaryotic-type (2);	0.000000	0.48767	U	0.000177	T	0.74943	0.3783	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79480	-0.1786	10	0.87932	D	0	-28.6467	11.1717	0.48575	0.0:0.0:0.0:1.0	.	205	Q969P6	TOP1M_HUMAN	T	205;107;107;107;107;107	ENSP00000328835:K205T;ENSP00000428369:K107T;ENSP00000429169:K107T;ENSP00000429181:K107T;ENSP00000427998:K107T;ENSP00000429177:K107T	ENSP00000328835:K205T	K	-	2	0	TOP1MT	144478948	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	4.995000	0.63908	1.197000	0.43143	0.496000	0.49642	AAG		0.577	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381247.3	NM_052963		6	72	0	0	0	0.001984	0	6	72				
ZC3H3	23144	broad.mit.edu	37	8	144620288	144620288	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:144620288C>A	ENST00000262577.5	-	2	1280	c.1249G>T	c.(1249-1251)Ggg>Tgg	p.G417W		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	417					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.G417W(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			GGTCTGTCCCCCGACGGGGAC	0.632																																							uc003yyd.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1249-1251)GGG>TGG		zinc finger CCCH-type containing 3							45.0	50.0	48.0					8																	144620288		2203	4298	6501	SO:0001583	missense	23144				mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding	g.chr8:144620288C>A	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.1249G>T	8.37:g.144620288C>A	ENSP00000262577:p.Gly417Trp		Somatic					p.G417W	NM_015117	NP_055932	WXS	Illumina HiSeq	Unspecified	Q8IXZ2	ZC3H3_HUMAN	Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)		2	1278	-	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		417					Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	37	c.1249G>T	CCDS6402.1	.	.	.	.	.	.	.	.	.	.	C	9.560	1.118347	0.20877	.	.	ENSG00000014164	ENST00000262577	T	0.03124	4.04	4.76	2.89	0.33648	.	0.915948	0.09234	N	0.830209	T	0.10423	0.0255	M	0.63428	1.95	0.09310	N	1	D	0.59357	0.985	P	0.52823	0.71	T	0.24548	-1.0157	10	0.72032	D	0.01	-9.0797	10.01	0.41981	0.0:0.5963:0.322:0.0817	.	417	Q8IXZ2	ZC3H3_HUMAN	W	417	ENSP00000262577:G417W	ENSP00000262577:G417W	G	-	1	0	ZC3H3	144691431	0.000000	0.05858	0.234000	0.24042	0.061000	0.15899	0.361000	0.20267	0.993000	0.38866	0.561000	0.74099	GGG		0.632	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117		6	70	1	0	0.00116845	0.001168	0.00128122	6	70				
ZC3H3	23144	broad.mit.edu	37	8	144621362	144621362	+	Missense_Mutation	SNP	G	G	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:144621362G>C	ENST00000262577.5	-	2	206	c.175C>G	c.(175-177)Cgg>Ggg	p.R59G	RP11-661A12.5_ENST00000530600.1_RNA|7SK_ENST00000517300.1_RNA	NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	59					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.R59G(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			TAGCCCCTCCGGCTTGGACGA	0.652																																							uc003yyd.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(175-177)CGG>GGG		zinc finger CCCH-type containing 3							64.0	61.0	62.0					8																	144621362		2201	4290	6491	SO:0001583	missense	23144				mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding	g.chr8:144621362G>C	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.175C>G	8.37:g.144621362G>C	ENSP00000262577:p.Arg59Gly		Somatic					p.R59G	NM_015117	NP_055932	WXS	Illumina HiSeq	Unspecified	Q8IXZ2	ZC3H3_HUMAN	Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)		2	204	-	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		59					Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	37	c.175C>G	CCDS6402.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.568208	0.45798	.	.	ENSG00000014164	ENST00000262577	T	0.02944	4.1	4.7	2.81	0.32909	.	0.105597	0.41294	D	0.000907	T	0.08626	0.0214	M	0.67953	2.075	0.30689	N	0.751518	D	0.63880	0.993	P	0.58820	0.846	T	0.05582	-1.0876	10	0.12103	T	0.63	.	13.0005	0.58672	0.0:0.0:0.7052:0.2948	.	59	Q8IXZ2	ZC3H3_HUMAN	G	59	ENSP00000262577:R59G	ENSP00000262577:R59G	R	-	1	2	ZC3H3	144692505	0.954000	0.32549	0.803000	0.32268	0.745000	0.42441	3.841000	0.55850	0.359000	0.24239	-0.181000	0.13052	CGG		0.652	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117		40	76	0	0	0	0.002522	0	40	76				
GRINA	2907	broad.mit.edu	37	8	145065687	145065687	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr8:145065687A>T	ENST00000313269.5	+	2	574	c.296A>T	c.(295-297)tAc>tTc	p.Y99F	GRINA_ENST00000395068.4_Missense_Mutation_p.Y99F	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	99	Pro-rich.					integral component of membrane (GO:0016021)		p.Y99F(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAAGGGGGCTACCCCCAGGGG	0.667																																							uc003zan.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(295-297)TAC>TTC		glutamate receptor, ionotropic, N-methyl							5.0	7.0	6.0					8																	145065687		2045	4038	6083	SO:0001583	missense	2907					integral to membrane		g.chr8:145065687A>T	NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.296A>T	8.37:g.145065687A>T	ENSP00000314380:p.Tyr99Phe		Somatic				GRINA_uc003zao.1_Missense_Mutation_p.Y99F|GRINA_uc003zap.1_Missense_Mutation_p.Y99F	p.Y99F	NM_001009184	NP_001009184	WXS	Illumina HiSeq	Unspecified	Q7Z429	GRINA_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		2	462	+	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		99			Pro-rich.		B3KXM7|O43836|Q8IVW7	Missense_Mutation	SNP	ENST00000313269.5	37	c.296A>T	CCDS34961.1	.	.	.	.	.	.	.	.	.	.	A	11.05	1.523558	0.27299	.	.	ENSG00000178719	ENST00000313269;ENST00000529301;ENST00000395068;ENST00000530898;ENST00000537637	T;T;T	0.30981	1.56;1.51;1.56	1.91	0.709	0.18150	.	0.292616	0.27715	N	0.018148	T	0.16085	0.0387	L	0.37697	1.125	0.27596	N	0.949132	P	0.37663	0.604	B	0.35240	0.198	T	0.15694	-1.0428	10	0.12103	T	0.63	-11.8331	4.2018	0.10469	0.6387:0.0:0.3613:0.0	.	99	Q7Z429	GRINA_HUMAN	F	99;99;99;99;80	ENSP00000314380:Y99F;ENSP00000432706:Y99F;ENSP00000378507:Y99F	ENSP00000314380:Y99F	Y	+	2	0	GRINA	145137675	0.084000	0.21492	0.957000	0.39632	0.756000	0.42949	1.881000	0.39638	0.234000	0.21139	0.381000	0.24937	TAC		0.667	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384048.1	NM_001009184		4	10	0	0	0	0.009096	0	4	10				
RIC1	57589	broad.mit.edu	37	9	5772720	5772720	+	Missense_Mutation	SNP	A	A	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:5772720A>C	ENST00000414202.2	+	24	3964	c.3773A>C	c.(3772-3774)cAt>cCt	p.H1258P	KIAA1432_ENST00000449720.2_Missense_Mutation_p.H1142P|KIAA1432_ENST00000418622.3_Missense_Mutation_p.H1179P	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.H1179P(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		AAAGGGCCTCATAAATCCCAG	0.458																																							uc003zji.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3535-3537)CAT>CCT		connexin 43-interacting protein 150 isoform a							63.0	60.0	61.0					9																	5772720		2203	4300	6503	SO:0001583	missense	57589					integral to membrane		g.chr9:5772720A>C																												ENST00000414202.2:c.3773A>C	9.37:g.5772720A>C	ENSP00000416696:p.His1258Pro		Somatic				KIAA1432_uc003zjl.3_Missense_Mutation_p.H1142P|ERMP1_uc011lme.1_Intron	p.H1179P	NM_020829	NP_065880	WXS	Illumina HiSeq	Unspecified	Q4ADV7	RIC1_HUMAN		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)	23	3629	+		Acute lymphoblastic leukemia(23;0.154)	1258						Missense_Mutation	SNP	ENST00000414202.2	37	c.3536A>C	CCDS34982.2	.	.	.	.	.	.	.	.	.	.	A	14.05	2.419537	0.42918	.	.	ENSG00000107036	ENST00000414202;ENST00000418622;ENST00000449720;ENST00000490816	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.60274	0.2256	M	0.63428	1.95	0.80722	D	1	B;B	0.15719	0.014;0.014	B;B	0.13407	0.009;0.009	T	0.56092	-0.8036	9	0.25751	T	0.34	-16.4812	15.8895	0.79286	1.0:0.0:0.0:0.0	.	1142;1258	B7ZM67;Q4ADV7	.;RIC1_HUMAN	P	1258;1179;1142;77	.	ENSP00000416696:H1258P	H	+	2	0	KIAA1432	5762720	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.959000	0.93110	2.153000	0.67306	0.459000	0.35465	CAT		0.458	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3			5	18	0	0	0	0.001168	0	5	18				
PTPRD	5789	broad.mit.edu	37	9	8449818	8449818	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:8449818A>T	ENST00000381196.4	-	31	4438	c.3895T>A	c.(3895-3897)Tct>Act	p.S1299T	PTPRD_ENST00000397617.3_Missense_Mutation_p.S878T|PTPRD_ENST00000540109.1_Missense_Mutation_p.S1299T|PTPRD_ENST00000356435.5_Missense_Mutation_p.S1299T|PTPRD_ENST00000397606.3_Missense_Mutation_p.S878T|PTPRD_ENST00000397611.3_Missense_Mutation_p.S889T|PTPRD_ENST00000537002.1_Missense_Mutation_p.S889T|PTPRD_ENST00000360074.4_Missense_Mutation_p.S1286T|PTPRD_ENST00000358503.5_Missense_Mutation_p.S1277T|PTPRD_ENST00000486161.1_Missense_Mutation_p.S892T|PTPRD_ENST00000355233.5_Missense_Mutation_p.S893T	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1299					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.S1299T(2)|p.S770T(1)|p.S893T(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CTTTTTCTAGAGTCGGACTCT	0.423										TSP Lung(15;0.13)																													uc003zkk.2		NA																	4	Substitution - Missense(4)		lung(4)	lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(3895-3897)TCT>ACT		protein tyrosine phosphatase, receptor type, D							298.0	279.0	285.0					9																	8449818		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8449818A>T	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3895T>A	9.37:g.8449818A>T	ENSP00000370593:p.Ser1299Thr	TSP Lung(15;0.13)	Somatic				PTPRD_uc003zkp.2_Missense_Mutation_p.S893T|PTPRD_uc003zkq.2_Missense_Mutation_p.S892T|PTPRD_uc003zkr.2_Missense_Mutation_p.S883T|PTPRD_uc003zks.2_Missense_Mutation_p.S878T|PTPRD_uc003zkl.2_Missense_Mutation_p.S1290T|PTPRD_uc003zkm.2_Missense_Mutation_p.S1286T|PTPRD_uc003zkn.2_Missense_Mutation_p.S888T|PTPRD_uc003zko.2_Missense_Mutation_p.S889T	p.S1299T	NM_002839	NP_002830	WXS	Illumina HiSeq	Unspecified	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	33	4606	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	1299			Cytoplasmic (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.3895T>A	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	A	12.67	2.007811	0.35415	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.54279	0.64;0.64;0.67;0.71;0.78;0.94;0.68;0.58;0.64;0.8;0.94	5.58	5.58	0.84498	.	0.166361	0.52532	D	0.000063	T	0.31389	0.0795	N	0.04508	-0.205	0.41569	D	0.988672	B;B;B;B;B;B;B;B;B	0.22146	0.039;0.039;0.039;0.039;0.041;0.065;0.0;0.02;0.001	B;B;B;B;B;B;B;B;B	0.21708	0.012;0.012;0.012;0.012;0.036;0.027;0.004;0.008;0.011	T	0.19192	-1.0313	9	.	.	.	.	16.0538	0.80779	1.0:0.0:0.0:0.0	.	878;883;892;893;889;889;1286;1299;1299	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	T	1299;1299;1286;1277;893;878;889;889;770;1299;892;878	ENSP00000370593:S1299T;ENSP00000348812:S1299T;ENSP00000353187:S1286T;ENSP00000351293:S1277T;ENSP00000347373:S893T;ENSP00000380741:S878T;ENSP00000380735:S889T;ENSP00000440515:S889T;ENSP00000438164:S1299T;ENSP00000417093:S892T;ENSP00000380731:S878T	.	S	-	1	0	PTPRD	8439818	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.282000	0.58971	2.250000	0.74265	0.528000	0.53228	TCT		0.423	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			22	145	0	0	0	0.001882	0	22	145				
TAF1L	138474	broad.mit.edu	37	9	32635336	32635336	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:32635336G>T	ENST00000242310.4	-	1	331	c.242C>A	c.(241-243)aCg>aAg	p.T81K	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	81					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.T81K(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTCATTTGCCGTGAGTTCAGT	0.522																																							uc003zrg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(241-243)ACG>AAG		TBP-associated factor RNA polymerase 1-like							161.0	156.0	158.0					9																	32635336		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32635336G>T	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.242C>A	9.37:g.32635336G>T	ENSP00000418379:p.Thr81Lys		Somatic				uc003zrh.1_Intron	p.T81K	NM_153809	NP_722516	WXS	Illumina HiSeq	Unspecified	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	332	-			81					Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.242C>A	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.809419	0.50421	.	.	ENSG00000122728	ENST00000242310	T	0.09350	2.99	1.04	1.04	0.20106	TAFII-230 TBP-binding (2);	0.000000	0.85682	D	0.000000	T	0.18215	0.0437	L	0.59436	1.845	0.45554	D	0.998507	P	0.43973	0.823	P	0.56700	0.804	T	0.05146	-1.0903	10	0.22706	T	0.39	.	7.4859	0.27432	0.0:0.0:1.0:0.0	.	81	Q8IZX4	TAF1L_HUMAN	K	81	ENSP00000418379:T81K	ENSP00000418379:T81K	T	-	2	0	TAF1L	32625336	1.000000	0.71417	0.753000	0.31225	0.104000	0.19210	4.161000	0.58170	0.507000	0.28148	0.195000	0.17529	ACG		0.522	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			20	93	1	0	3.7963e-18	0.00333	5.99494e-18	20	93				
PIP5K1B	8395	broad.mit.edu	37	9	71509280	71509280	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:71509280T>C	ENST00000265382.3	+	8	802	c.497T>C	c.(496-498)cTt>cCt	p.L166P	PIP5K1B_ENST00000541509.1_Missense_Mutation_p.L166P	NM_003558.2	NP_003549.1	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, beta	166	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)	p.L166P(1)		breast(1)|large_intestine(2)|stomach(1)	4				Lung(182;0.133)		CCAAGGACTCTTTTGCCAAAA	0.338																																							uc004agu.2		NA																	1	Substitution - Missense(1)		lung(1)	stomach(1)	1						c.(496-498)CTT>CCT		phosphatidylinositol-4-phosphate 5-kinase, type							63.0	65.0	65.0					9																	71509280		2203	4300	6503	SO:0001583	missense	8395					endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding	g.chr9:71509280T>C	U78579	CCDS6624.1, CCDS65063.1	9q13	2008-02-05			ENSG00000107242	ENSG00000107242			8995	protein-coding gene	gene with protein product		602745				9177790, 8841185	Standard	NM_003558		Approved	STM7, MSS4	uc004agu.4	O14986	OTTHUMG00000019976	ENST00000265382.3:c.497T>C	9.37:g.71509280T>C	ENSP00000265382:p.Leu166Pro		Somatic				PIP5K1B_uc011lrq.1_Missense_Mutation_p.L166P|PIP5K1B_uc004agv.2_RNA	p.L166P	NM_003558	NP_003549	WXS	Illumina HiSeq	Unspecified	O14986	PI51B_HUMAN		Lung(182;0.133)	8	802	+			166			PIPK.		A8K9L9|B4DIG7|P78518|P78519|Q5T5K6|Q5T5K8|Q5T5K9|Q5VZ00|Q7KYT5|Q8NHQ5|Q92749	Missense_Mutation	SNP	ENST00000265382.3	37	c.497T>C	CCDS6624.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.585428	0.86748	.	.	ENSG00000107242	ENST00000541509;ENST00000377290;ENST00000265382;ENST00000419747	T;T	0.43294	0.95;0.95	5.62	5.62	0.85841	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.79287	0.4420	H	0.98936	4.375	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88038	0.2779	10	0.87932	D	0	-2.063	15.8228	0.78673	0.0:0.0:0.0:1.0	.	166	O14986	PI51B_HUMAN	P	166;166;166;113	ENSP00000438082:L166P;ENSP00000265382:L166P	ENSP00000265382:L166P	L	+	2	0	PIP5K1B	70699100	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.895000	0.87343	2.146000	0.66826	0.528000	0.53228	CTT		0.338	PIP5K1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052561.2	NM_003558		18	100	0	0	0	0.007413	0	18	100				
TRPM6	140803	broad.mit.edu	37	9	77436681	77436681	+	Missense_Mutation	SNP	T	T	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:77436681T>G	ENST00000360774.1	-	8	1151	c.914A>C	c.(913-915)gAg>gCg	p.E305A	TRPM6_ENST00000361255.3_Missense_Mutation_p.E300A|TRPM6_ENST00000449912.2_Missense_Mutation_p.E300A|TRPM6_ENST00000451710.3_Missense_Mutation_p.E305A|TRPM6_ENST00000376872.3_Missense_Mutation_p.E305A|TRPM6_ENST00000376871.3_Missense_Mutation_p.E305A|TRPM6_ENST00000376864.4_Missense_Mutation_p.E305A|TRPM6_ENST00000483186.1_5'UTR	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	305					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.E305A(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CTTGACAGTCTCCCACACTGA	0.587																																							uc004ajl.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(913-915)GAG>GCG		transient receptor potential cation channel,							154.0	108.0	124.0					9																	77436681		2203	4300	6503	SO:0001583	missense	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77436681T>G	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.914A>C	9.37:g.77436681T>G	ENSP00000354006:p.Glu305Ala		Somatic				TRPM6_uc004ajk.1_Missense_Mutation_p.E300A|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.E305A|TRPM6_uc010mpd.1_Missense_Mutation_p.E305A|TRPM6_uc010mpe.1_Intron	p.E305A	NM_017662	NP_060132	WXS	Illumina HiSeq	Unspecified	Q9BX84	TRPM6_HUMAN			8	1152	-			305			Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	c.914A>C	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	T	31	5.099897	0.94197	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376864	T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.47	5.47	0.80525	.	0.045752	0.85682	D	0.000000	T	0.63698	0.2533	M	0.86097	2.795	0.58432	D	0.999998	D;D;P;B	0.69078	0.997;0.997;0.632;0.449	D;D;P;B	0.68353	0.957;0.957;0.493;0.255	T	0.69914	-0.5016	10	0.62326	D	0.03	.	15.5435	0.76074	0.0:0.0:0.0:1.0	.	305;305;305;300	Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3	.;.;TRPM6_HUMAN;.	A	305;305;305;305;300;300;305	ENSP00000354006:E305A;ENSP00000407341:E305A;ENSP00000366068:E305A;ENSP00000366067:E305A;ENSP00000396672:E300A;ENSP00000354962:E300A;ENSP00000366060:E305A	ENSP00000354006:E305A	E	-	2	0	TRPM6	76626501	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	7.925000	0.87563	2.075000	0.62263	0.459000	0.35465	GAG		0.587	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		4	39	0	0	0	0.009096	0	4	39				
VPS13A	23230	broad.mit.edu	37	9	79890421	79890422	+	Nonsense_Mutation	DNP	GG	GG	CT			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:79890421_79890422GG>CT	ENST00000360280.3	+	25	2780_2781	c.2520_2521GG>CT	c.(2518-2523)gaGGag>gaCTag	p.840_841EE>D*	VPS13A_ENST00000376634.4_Nonsense_Mutation_p.840_841EE>D*|VPS13A_ENST00000376636.3_Nonsense_Mutation_p.840_841EE>D*|VPS13A_ENST00000357409.5_Nonsense_Mutation_p.840_841EE>D*	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	840					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)		p.E840_E841>D*(3)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TAGATTCAGAGGAGGAATTTTT	0.312																																							uc004akr.2		NA																	3	Complex - compound substitution(3)		lung(3)	pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						c.(2518-2523)GAGGAG>GACTAG		vacuolar protein sorting 13A isoform A																																				SO:0001587	stop_gained	23230				Golgi to endosome transport|protein transport	intracellular	protein binding	g.chr9:79890421_79890422GG>CT	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	Exception_encountered	9.37:g.79890421_79890422delinsCT	ENSP00000353422:p.E840_E841delinsD*		Somatic				VPS13A_uc004akp.3_Nonsense_Mutation_p.840_841EE>D*|VPS13A_uc004akq.3_Nonsense_Mutation_p.840_841EE>D*|VPS13A_uc004aks.2_Nonsense_Mutation_p.840_841EE>D*	p.840_841EE>D*	NM_033305	NP_150648	WXS	Illumina HiSeq	Unspecified	Q96RL7	VP13A_HUMAN			25	2780_2781	+			840_841					Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Nonsense_Mutation	DNP	ENST00000360280.3	37	c.2520_2521GG>CT	CCDS6655.1																																																																																				0.312	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186		10	88	0	0	0	0.004672	0	10	88				
VPS13A	23230	broad.mit.edu	37	9	79908412	79908412	+	Silent	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:79908412A>G	ENST00000360280.3	+	32	3755	c.3495A>G	c.(3493-3495)ctA>ctG	p.L1165L	VPS13A_ENST00000376634.4_Silent_p.L1165L|VPS13A_ENST00000376636.3_Silent_p.L1126L|VPS13A_ENST00000357409.5_Silent_p.L1165L|VPS13A_ENST00000423463.2_3'UTR	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1165					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)		p.L1165L(3)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CGAAATTTCTATATTCTATAT	0.274																																							uc004akr.2		NA																	3	Substitution - coding silent(3)		lung(3)	pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						c.(3493-3495)CTA>CTG		vacuolar protein sorting 13A isoform A							57.0	56.0	56.0					9																	79908412		2203	4299	6502	SO:0001819	synonymous_variant	23230				Golgi to endosome transport|protein transport	intracellular	protein binding	g.chr9:79908412A>G	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.3495A>G	9.37:g.79908412A>G			Somatic				VPS13A_uc004akp.3_Silent_p.L1165L|VPS13A_uc004akq.3_Silent_p.L1165L|VPS13A_uc004aks.2_Silent_p.L1126L|VPS13A_uc010mpo.1_5'UTR	p.L1165L	NM_033305	NP_150648	WXS	Illumina HiSeq	Unspecified	Q96RL7	VP13A_HUMAN			32	3755	+			1165					Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	ENST00000360280.3	37	c.3495A>G	CCDS6655.1																																																																																				0.274	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186		19	49	0	0	0	0.007413	0	19	49				
SPATA31D1	389763	broad.mit.edu	37	9	84606402	84606402	+	Silent	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:84606402T>C	ENST00000344803.2	+	4	1064	c.1017T>C	c.(1015-1017)tcT>tcC	p.S339S		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	339					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.S339S(2)									CATCCACCTCTGCCCCAACAA	0.468																																							uc004amn.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1015-1017)TCT>TCC		hypothetical protein LOC389763							147.0	135.0	139.0					9																	84606402		1938	4129	6067	SO:0001819	synonymous_variant	389763					integral to membrane		g.chr9:84606402T>C		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.1017T>C	9.37:g.84606402T>C			Somatic					p.S339S	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	1064	+			339						Silent	SNP	ENST00000344803.2	37	c.1017T>C	CCDS47986.1																																																																																				0.468	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		19	107	0	0	0	0.006122	0	19	107				
C9orf3	84909	broad.mit.edu	37	9	97823056	97823056	+	Silent	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:97823056C>A	ENST00000375315.2	+	13	2196	c.2196C>A	c.(2194-2196)ctC>ctA	p.L732L	C9orf3_ENST00000425634.2_Silent_p.L94L|C9orf3_ENST00000297979.5_Silent_p.L633L|C9orf3_ENST00000433691.2_Silent_p.L73L	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	732					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L633L(1)|p.L732L(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		TGCAAAGCCTCCAGAGGACAT	0.517																																							uc004ava.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2194-2196)CTC>CTA		aminopeptidase O							87.0	82.0	84.0					9																	97823056		2203	4300	6503	SO:0001819	synonymous_variant	84909				leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding	g.chr9:97823056C>A	AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.2196C>A	9.37:g.97823056C>A			Somatic				C9orf3_uc004auy.2_Silent_p.L633L|C9orf3_uc004auz.1_Silent_p.L633L|C9orf3_uc004avc.2_Silent_p.L187L|C9orf3_uc011luj.1_Silent_p.L94L|C9orf3_uc011luk.1_Silent_p.L73L|C9orf3_uc004avd.2_Silent_p.L94L	p.L732L	NM_032823	NP_116212	WXS	Illumina HiSeq	Unspecified	Q8N6M6	AMPO_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;0.000275)	13	2331	+			732					Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Silent	SNP	ENST00000375315.2	37	c.2196C>A	CCDS55328.1	.	.	.	.	.	.	.	.	.	.	C	8.458	0.854708	0.17106	.	.	ENSG00000148120	ENST00000445181	.	.	.	5.34	-5.6	0.02497	.	.	.	.	.	T	0.35770	0.0943	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39742	-0.9599	4	.	.	.	-14.69	1.5452	0.02563	0.1467:0.3617:0.1599:0.3317	.	.	.	.	T	97	.	.	P	+	1	0	C9orf3	96862877	0.844000	0.29557	0.106000	0.21319	0.970000	0.65996	-0.230000	0.09083	-0.772000	0.04602	0.650000	0.86243	CCA		0.517	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032823		9	36	1	0	0.000274275	0.004482	0.000307338	9	36				
ASTN2	23245	broad.mit.edu	37	9	119976834	119976834	+	Missense_Mutation	SNP	A	A	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:119976834A>T	ENST00000313400.4	-	3	918	c.818T>A	c.(817-819)cTg>cAg	p.L273Q	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.L273Q|ASTN2_ENST00000361209.2_Missense_Mutation_p.L273Q			O75129	ASTN2_HUMAN	astrotactin 2	273					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.L273Q(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GTGGGTTTGCAGCCGGGATGA	0.602																																							uc004bjs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(817-819)CTG>CAG		astrotactin 2 isoform c							94.0	83.0	87.0					9																	119976834		2203	4300	6503	SO:0001583	missense	23245					integral to membrane		g.chr9:119976834A>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.818T>A	9.37:g.119976834A>T	ENSP00000314038:p.Leu273Gln		Somatic				ASTN2_uc004bjr.1_Missense_Mutation_p.L273Q|ASTN2_uc004bjt.1_Missense_Mutation_p.L273Q	p.L273Q	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			3	919	-			273			Cytoplasmic (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.818T>A		.	.	.	.	.	.	.	.	.	.	A	18.50	3.638063	0.67130	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.11495	2.81;2.81;2.77	5.34	5.34	0.76211	.	0.335609	0.25238	N	0.032109	T	0.10937	0.0267	N	0.14661	0.345	0.40276	D	0.97834	P;D;P	0.56035	0.804;0.974;0.939	B;P;P	0.49637	0.272;0.521;0.617	T	0.34054	-0.9844	9	.	.	.	-11.9129	14.9976	0.71446	1.0:0.0:0.0:0.0	.	273;273;273	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	Q	273	ENSP00000314038:L273Q;ENSP00000363108:L273Q;ENSP00000354504:L273Q	.	L	-	2	0	ASTN2	119016655	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.376000	0.66178	2.016000	0.59253	0.533000	0.62120	CTG		0.602	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		6	38	0	0	0	0.001168	0	6	38				
ENG	2022	broad.mit.edu	37	9	130586661	130586661	+	Silent	SNP	C	C	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:130586661C>G	ENST00000373203.4	-	8	1456	c.1056G>C	c.(1054-1056)ccG>ccC	p.P352P	RP11-228B15.4_ENST00000439298.1_RNA|RP11-228B15.4_ENST00000425991.1_RNA|ENG_ENST00000344849.3_Silent_p.P352P|ENG_ENST00000480266.1_5'UTR	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	352	Ser/Thr-rich.				artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)	p.P352P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						TGAGCAGCTCCGGGCTACAAG	0.597									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia																														uc004bsj.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1054-1056)CCG>CCC		endoglin isoform 1 precursor							142.0	116.0	125.0					9																	130586661		2203	4300	6503	SO:0001819	synonymous_variant	2022	Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	artery morphogenesis|BMP signaling pathway|cell adhesion|cell chemotaxis|central nervous system vasculogenesis|chronological cell aging|detection of hypoxia|extracellular matrix disassembly|heart looping|negative regulation of endothelial cell proliferation|negative regulation of nitric-oxide synthase activity|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of protein autophosphorylation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|patterning of blood vessels|positive regulation of BMP signaling pathway|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of systemic arterial blood pressure|positive regulation of transcription from RNA polymerase II promoter|regulation of cell adhesion|regulation of cell proliferation|regulation of transcription, DNA-dependent|regulation of transforming growth factor beta receptor signaling pathway|smooth muscle tissue development|transforming growth factor beta receptor signaling pathway|venous blood vessel morphogenesis|wound healing	cell surface|external side of plasma membrane|extracellular space|membrane fraction	activin binding|galactose binding|glycosaminoglycan binding|protein homodimerization activity|transforming growth factor beta binding|transforming growth factor beta receptor activity|transforming growth factor beta receptor, cytoplasmic mediator activity|transmembrane receptor activity|type I transforming growth factor beta receptor binding|type II transforming growth factor beta receptor binding	g.chr9:130586661C>G	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.1056G>C	9.37:g.130586661C>G			Somatic				ENG_uc011mam.1_Silent_p.P163P|ENG_uc004bsk.3_Silent_p.P352P	p.P352P	NM_001114753	NP_001108225	WXS	Illumina HiSeq	Unspecified	P17813	EGLN_HUMAN			8	1469	-			352			Ser/Thr-rich.|Extracellular (Potential).		Q14248|Q14926|Q5T9C0	Silent	SNP	ENST00000373203.4	37	c.1056G>C	CCDS48029.1																																																																																				0.597	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054313.1			12	37	0	0	0	0.001368	0	12	37				
LRRC8A	56262	broad.mit.edu	37	9	131670205	131670205	+	Silent	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr9:131670205G>T	ENST00000259324.5	+	3	1285	c.762G>T	c.(760-762)gtG>gtT	p.V254V	LRRC8A_ENST00000372600.4_Silent_p.V254V|LRRC8A_ENST00000372599.3_Silent_p.V254V	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	254					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.V254V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						GGACCCATGTGGAGGAGGGGG	0.557																																							uc004bwl.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(760-762)GTG>GTT		leucine rich repeat containing 8 family, member							180.0	160.0	167.0					9																	131670205		2203	4300	6503	SO:0001819	synonymous_variant	56262				pre-B cell differentiation	integral to membrane		g.chr9:131670205G>T	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.762G>T	9.37:g.131670205G>T			Somatic				LRRC8A_uc010myp.2_Silent_p.V254V|LRRC8A_uc010myq.2_Silent_p.V254V	p.V254V	NM_019594	NP_062540	WXS	Illumina HiSeq	Unspecified	Q8IWT6	LRC8A_HUMAN			3	1016	+			254					Q6UXM2|Q8NCI0|Q9P2B1	Silent	SNP	ENST00000259324.5	37	c.762G>T	CCDS35155.1																																																																																				0.557	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594		11	55	1	0	3.86212e-05	0.008291	4.55218e-05	11	55				
ZBED1	9189	broad.mit.edu	37	X	2406876	2406877	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:2406876_2406877CC>AA	ENST00000381223.4	-	2	2087_2088	c.1884_1885GG>TT	c.(1882-1887)gtGGtc>gtTTtc	p.V629F	ZBED1_ENST00000381222.2_Missense_Mutation_p.V629F|ZBED1_ENST00000381218.3_Missense_Mutation_p.V629F|ZBED1_ENST00000515319.1_5'UTR|DHRSX_ENST00000334651.5_Intron	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	629					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)	p.V629F(1)		endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTGGCGCTGACCACGTTGGCGG	0.673																																							uc004cqg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1882-1887)GTGGTC>GTTTTC		zinc finger, BED-type containing 1																																				SO:0001583	missense	9189					nuclear chromosome	DNA binding|metal ion binding|protein dimerization activity|transposase activity	g.chrX:2406876_2406877CC>AA	AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.1884_1885delinsAA	X.37:g.2406876_2406877delinsAA	ENSP00000370621:p.Val629Phe		Somatic				DHRSX_uc004cqf.3_Intron|ZBED1_uc004cqh.1_Missense_Mutation_p.V629F	p.V629F	NM_004729	NP_004720	WXS	Illumina HiSeq	Unspecified	O96006	ZBED1_HUMAN			2	2085_2086	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	629					Q96BY4	Missense_Mutation	DNP	ENST00000381223.4	37	c.1884_1885GG>TT	CCDS14118.1																																																																																				0.673	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144310.3	NM_004729		34	96	0	0	0	0.004672	0	34	96				
ZBED1	9189	broad.mit.edu	37	X	2407791	2407791	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:2407791G>A	ENST00000381223.4	-	2	1173	c.970C>T	c.(970-972)Cag>Tag	p.Q324*	ZBED1_ENST00000381222.2_Nonsense_Mutation_p.Q324*|ZBED1_ENST00000381218.3_Nonsense_Mutation_p.Q324*|ZBED1_ENST00000515319.1_5'Flank|DHRSX_ENST00000334651.5_Intron	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	324					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)	p.Q324*(1)		endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACGGCAGACTGCTGGAAGTAC	0.632																																							uc004cqg.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(970-972)CAG>TAG		zinc finger, BED-type containing 1							69.0	61.0	63.0					X																	2407791		2203	4296	6499	SO:0001587	stop_gained	9189					nuclear chromosome	DNA binding|metal ion binding|protein dimerization activity|transposase activity	g.chrX:2407791G>A	AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.970C>T	X.37:g.2407791G>A	ENSP00000370621:p.Gln324*		Somatic				DHRSX_uc004cqf.3_Intron|ZBED1_uc004cqh.1_Nonsense_Mutation_p.Q324*	p.Q324*	NM_004729	NP_004720	WXS	Illumina HiSeq	Unspecified	O96006	ZBED1_HUMAN			2	1171	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	324					Q96BY4	Nonsense_Mutation	SNP	ENST00000381223.4	37	c.970C>T	CCDS14118.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096914	0.56075	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218	.	.	.	3.06	2.12	0.27331	.	0.206931	0.31041	N	0.008361	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-29.7468	10.4119	0.44299	0.0:0.0:0.8023:0.1977	.	.	.	.	X	324	.	ENSP00000370616:Q324X	Q	-	1	0	ZBED1	2417791	1.000000	0.71417	0.871000	0.34182	0.240000	0.25518	2.547000	0.45786	0.158000	0.19367	0.519000	0.50382	CAG		0.632	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144310.3	NM_004729		15	28	0	0	0	0.00245	0	15	28				
ARSF	416	broad.mit.edu	37	X	3030325	3030325	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:3030325C>A	ENST00000381127.1	+	11	1722	c.1501C>A	c.(1501-1503)Cac>Aac	p.H501N	ARSF_ENST00000537104.1_Missense_Mutation_p.H501N|ARSF_ENST00000359361.2_Missense_Mutation_p.H501N	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	501					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGTTACCTACCACAACCCCCC	0.532																																							uc004cre.1		NA																	0				ovary(2)	2						c.(1501-1503)CAC>AAC		arylsulfatase F precursor							119.0	109.0	112.0					X																	3030325		2203	4300	6503	SO:0001583	missense	416					extracellular region	arylsulfatase activity|metal ion binding	g.chrX:3030325C>A	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.1501C>A	X.37:g.3030325C>A	ENSP00000370519:p.His501Asn		Somatic				ARSF_uc004crf.1_Missense_Mutation_p.H501N	p.H501N	NM_004042	NP_004033	WXS	Illumina HiSeq	Unspecified	P54793	ARSF_HUMAN			11	1722	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	501					Q8TCC5	Missense_Mutation	SNP	ENST00000381127.1	37	c.1501C>A	CCDS14123.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120546	0.56613	.	.	ENSG00000062096	ENST00000381127;ENST00000537104;ENST00000359361	D;D;D	0.91894	-2.93;-2.93;-2.93	3.0	3.0	0.34707	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.057093	0.64402	U	0.000001	D	0.93579	0.7950	M	0.73753	2.245	0.51012	D	0.999905	D	0.57257	0.979	P	0.53490	0.727	D	0.93671	0.6990	10	0.54805	T	0.06	.	13.7653	0.62990	0.0:1.0:0.0:0.0	.	501	P54793	ARSF_HUMAN	N	501	ENSP00000370519:H501N;ENSP00000445594:H501N;ENSP00000352319:H501N	ENSP00000352319:H501N	H	+	1	0	ARSF	3040325	1.000000	0.71417	0.003000	0.11579	0.009000	0.06853	6.359000	0.73060	1.281000	0.44480	0.411000	0.27672	CAC		0.532	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1			16	91	1	0	8.28177e-16	0.007413	1.27821e-15	16	91				
SMS	6611	broad.mit.edu	37	X	22010739	22010739	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:22010739G>T	ENST00000404933.2	+	10	1222	c.970G>T	c.(970-972)Gca>Tca	p.A324S	SMS_ENST00000415881.2_Missense_Mutation_p.A228S|SMS_ENST00000379404.1_Missense_Mutation_p.A271S	NM_004595.4	NP_004586.2	P52788	SPSY_HUMAN	spermine synthase	324	PABS. {ECO:0000255|PROSITE- ProRule:PRU00354}.				cellular nitrogen compound metabolic process (GO:0034641)|methionine metabolic process (GO:0006555)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	spermidine synthase activity (GO:0004766)|spermine synthase activity (GO:0016768)	p.A324S(1)|p.A228S(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(2)	14					Spermine(DB00127)	TCTGACAGAAGCACTGTCGCT	0.443																																							uc004dag.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(970-972)GCA>TCA		spermine synthase	Spermine(DB00127)						116.0	90.0	99.0					X																	22010739		2203	4300	6503	SO:0001583	missense	6611				methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity	g.chrX:22010739G>T	AD001528	CCDS14203.1, CCDS59161.1	Xp22.1	2014-05-16			ENSG00000102172	ENSG00000102172			11123	protein-coding gene	gene with protein product		300105	"""Snyder-Robinson X-linked mental retardation syndrome"""	SRS		7546290, 9299240, 14508504	Standard	NM_004595		Approved	SPMSY, SpS, MRSR	uc004dag.4	P52788	OTTHUMG00000021239	ENST00000404933.2:c.970G>T	X.37:g.22010739G>T	ENSP00000385746:p.Ala324Ser		Somatic				SMS_uc010nfs.2_RNA|SMS_uc010nft.2_Intron	p.A324S	NM_004595	NP_004586	WXS	Illumina HiSeq	Unspecified	P52788	SPSY_HUMAN			10	1071	+			324					A6NHA7|A6NI34|B2R9M0|O00544|Q9UQS1	Missense_Mutation	SNP	ENST00000404933.2	37	c.970G>T	CCDS14203.1	.	.	.	.	.	.	.	.	.	.	G	12.75	2.031899	0.35893	.	.	ENSG00000102172	ENST00000404933;ENST00000379404;ENST00000415881	T;T;T	0.76709	-1.04;-1.04;-1.04	5.57	5.57	0.84162	.	0.047243	0.85682	D	0.000000	T	0.69788	0.3150	L	0.31065	0.9	0.58432	D	0.999996	B	0.31009	0.303	B	0.36666	0.23	T	0.65315	-0.6198	10	0.07482	T	0.82	-15.4324	18.5542	0.91077	0.0:0.0:1.0:0.0	.	324	P52788	SPSY_HUMAN	S	324;271;228	ENSP00000385746:A324S;ENSP00000368714:A271S;ENSP00000388906:A228S	ENSP00000368714:A271S	A	+	1	0	SMS	21920660	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	5.730000	0.68546	2.324000	0.78689	0.415000	0.27848	GCA		0.443	SMS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056032.1	NM_004595		7	54	1	0	2.74318e-10	0.006214	3.86883e-10	7	54				
FAM47A	158724	broad.mit.edu	37	X	34149722	34149722	+	Missense_Mutation	SNP	G	G	C	rs201141025		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:34149722G>C	ENST00000346193.3	-	1	725	c.674C>G	c.(673-675)cCg>cGg	p.P225R		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	225	Pro-rich.							p.P225R(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AGGAGGCTCCGGGCGGAGACT	0.662																																							uc004ddg.2		NA																	1	Substitution - Missense(1)	p.P225P(1)	lung(1)	ovary(4)|central_nervous_system(1)	5						c.(673-675)CCG>CGG		hypothetical protein LOC158724							30.0	33.0	32.0					X																	34149722		2201	4298	6499	SO:0001583	missense	158724							g.chrX:34149722G>C	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.674C>G	X.37:g.34149722G>C	ENSP00000345029:p.Pro225Arg		Somatic					p.P225R	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	707	-			225			Pro-rich.		A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.674C>G	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	G	0.038	-1.296913	0.01364	.	.	ENSG00000185448	ENST00000346193	T	0.22945	1.93	0.235	-0.47	0.12131	.	.	.	.	.	T	0.38374	0.1038	L	0.59436	1.845	0.09310	N	1	D	0.89917	1.0	D	0.75484	0.986	T	0.20940	-1.0260	8	0.38643	T	0.18	.	.	.	.	.	225	Q5JRC9	FA47A_HUMAN	R	225	ENSP00000345029:P225R	ENSP00000345029:P225R	P	-	2	0	FAM47A	34059643	0.008000	0.16893	0.001000	0.08648	0.001000	0.01503	-1.688000	0.01925	-0.704000	0.05042	-0.698000	0.03680	CCG		0.662	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		7	41	0	0	0	0.001984	0	7	41				
FAM47C	442444	broad.mit.edu	37	X	37028384	37028384	+	Missense_Mutation	SNP	C	C	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:37028384C>T	ENST00000358047.3	+	1	1953	c.1901C>T	c.(1900-1902)cCt>cTt	p.P634L		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	634								p.P634L(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CGCCCAGAGCCTCCCAAGACT	0.627																																							uc004ddl.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1900-1902)CCT>CTT		hypothetical protein LOC442444							32.0	36.0	35.0					X																	37028384		2196	4275	6471	SO:0001583	missense	442444							g.chrX:37028384C>T	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1901C>T	X.37:g.37028384C>T	ENSP00000367913:p.Pro634Leu		Somatic					p.P634L	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	1915	+			634					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.1901C>T	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	11.70	1.716372	0.30413	.	.	ENSG00000198173	ENST00000358047	T	0.12147	2.71	1.67	1.67	0.24075	.	.	.	.	.	T	0.26304	0.0642	M	0.79926	2.475	0.09310	N	1	P	0.50710	0.938	P	0.54238	0.746	T	0.08207	-1.0733	9	0.49607	T	0.09	.	4.6012	0.12354	0.0:0.764:0.0:0.236	.	634	Q5HY64	FA47C_HUMAN	L	634	ENSP00000367913:P634L	ENSP00000367913:P634L	P	+	2	0	FAM47C	36938305	0.007000	0.16637	0.003000	0.11579	0.004000	0.04260	0.371000	0.20450	0.793000	0.33875	0.414000	0.27820	CCT		0.627	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		10	94	0	0	0	0.001368	0	10	94				
SYTL5	94122	broad.mit.edu	37	X	37984682	37984682	+	Missense_Mutation	SNP	T	T	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:37984682T>C	ENST00000357972.5	+	16	2519	c.1973T>C	c.(1972-1974)cTa>cCa	p.L658P	SYTL5_ENST00000297875.2_Missense_Mutation_p.L658P|TM4SF2_ENST00000465127.1_Intron|SYTL5_ENST00000456733.2_Missense_Mutation_p.L680P			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	658	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)	p.L658P(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						AATGTTTGCCTAGAACTTACT	0.438																																							uc004ddu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1972-1974)CTA>CCA		synaptotagmin-like 5 isoform 1							140.0	124.0	129.0					X																	37984682		2202	4300	6502	SO:0001583	missense	94122				intracellular protein transport	membrane	metal ion binding|Rab GTPase binding	g.chrX:37984682T>C		CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.1973T>C	X.37:g.37984682T>C	ENSP00000350657:p.Leu658Pro		Somatic				SYTL5_uc004ddv.2_Missense_Mutation_p.L658P|SYTL5_uc004ddx.2_Missense_Mutation_p.L680P	p.L658P	NM_001163335	NP_001156807	WXS	Illumina HiSeq	Unspecified	Q8TDW5	SYTL5_HUMAN			17	2507	+			658			C2 2.		A2RRF2	Missense_Mutation	SNP	ENST00000357972.5	37	c.1973T>C	CCDS14244.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.339018	0.81911	.	.	ENSG00000147041	ENST00000297875;ENST00000357972;ENST00000456733	T;T;T	0.23950	1.88;1.88;1.88	5.76	5.76	0.90799	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.071074	0.64402	D	0.000018	T	0.70527	0.3234	H	0.99507	4.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.987	D	0.84465	0.0596	10	0.87932	D	0	-9.3774	15.0473	0.71838	0.0:0.0:0.0:1.0	.	680;658	A2RRF2;Q8TDW5	.;SYTL5_HUMAN	P	658;658;680	ENSP00000297875:L658P;ENSP00000350657:L658P;ENSP00000395220:L680P	ENSP00000297875:L658P	L	+	2	0	SYTL5	37869626	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.005000	0.88553	1.936000	0.56123	0.417000	0.27973	CTA		0.438	SYTL5-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080883.1	NM_138780		12	101	0	0	0	0.000978	0	12	101				
TBX22	50945	broad.mit.edu	37	X	79286020	79286020	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:79286020G>T	ENST00000373294.5	+	8	1001	c.973G>T	c.(973-975)Gtg>Ttg	p.V325L	TBX22_ENST00000373291.1_Missense_Mutation_p.V205L|TBX22_ENST00000442340.1_Missense_Mutation_p.V205L|TBX22_ENST00000373296.3_Missense_Mutation_p.V325L	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	325					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V325L(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CTCATCTCCAGTGACCTCTAG	0.433																																							uc010nmg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						c.(973-975)GTG>TTG		T-box 22 isoform 1							98.0	93.0	95.0					X																	79286020		2203	4300	6503	SO:0001583	missense	50945				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:79286020G>T	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.973G>T	X.37:g.79286020G>T	ENSP00000362390:p.Val325Leu		Somatic				TBX22_uc004edi.1_Missense_Mutation_p.V205L|TBX22_uc004edj.1_Missense_Mutation_p.V325L	p.V325L	NM_001109878	NP_001103348	WXS	Illumina HiSeq	Unspecified	Q9Y458	TBX22_HUMAN			9	1107	+			325					Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	ENST00000373294.5	37	c.973G>T	CCDS14445.1	.	.	.	.	.	.	.	.	.	.	G	8.891	0.954012	0.18431	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	4.34	4.34	0.51931	.	0.412557	0.22362	N	0.061062	T	0.73210	0.3558	L	0.50333	1.59	0.35795	D	0.822739	B	0.28512	0.214	B	0.20767	0.031	T	0.70178	-0.4943	10	0.11485	T	0.65	.	8.9149	0.35576	0.1084:0.0:0.8916:0.0	.	325	Q9Y458	TBX22_HUMAN	L	325;205;325;205	ENSP00000362393:V325L;ENSP00000396394:V205L;ENSP00000362390:V325L;ENSP00000362388:V205L	ENSP00000362388:V205L	V	+	1	0	TBX22	79172676	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.508000	0.45450	1.885000	0.54596	0.513000	0.50165	GTG		0.433	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954		16	67	1	0	2.32078e-09	0.003163	3.15349e-09	16	67				
COL4A5	1287	broad.mit.edu	37	X	107858176	107858177	+	Missense_Mutation	DNP	GG	GG	TT	rs104886182|rs104886183		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:107858176_107858177GG>TT	ENST00000361603.2	+	30	2675_2676	c.2431_2432GG>TT	c.(2431-2433)GGa>TTa	p.G811L	COL4A5_ENST00000328300.6_Missense_Mutation_p.G811L	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	811	Triple-helical region.		G -> V (in APSX; juvenile type).		axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.G811L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TGGACCAATGGGACCTCCTGGG	0.46									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4	GRCh37	CM072963|CM960375	COL4A5	M	rs104886182|rs104886183	c.(2431-2433)GGA>TTA		type IV collagen alpha 5 isoform 2 precursor																																				SO:0001583	missense	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107858176_107858177GG>TT	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	Exception_encountered	X.37:g.107858176_107858177delinsTT	ENSP00000354505:p.Gly811Leu		Somatic				COL4A5_uc011mso.1_Missense_Mutation_p.G811L|COL4A5_uc004eob.1_Missense_Mutation_p.G419L	p.G811L	NM_033380	NP_203699	WXS	Illumina HiSeq	Unspecified	P29400	CO4A5_HUMAN			30	2633_2634	+			811		G -> V (in APSX; juvenile type).	Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	DNP	ENST00000361603.2	37	c.2431_2432GG>TT	CCDS14543.1																																																																																				0.460	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			10	30	0	0	0	0.004672	0	10	30				
DOCK11	139818	broad.mit.edu	37	X	117758564	117758564	+	Missense_Mutation	SNP	A	A	G			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:117758564A>G	ENST00000276202.7	+	32	3597	c.3534A>G	c.(3532-3534)atA>atG	p.I1178M	DOCK11_ENST00000276204.6_Missense_Mutation_p.I1178M	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1178					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I1178M(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TGGAAAATATACAGCGATTAG	0.338																																							uc004eqp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(3532-3534)ATA>ATG		dedicator of cytokinesis 11							180.0	167.0	171.0					X																	117758564		2203	4300	6503	SO:0001583	missense	139818				blood coagulation	cytosol	GTP binding	g.chrX:117758564A>G	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3534A>G	X.37:g.117758564A>G	ENSP00000276202:p.Ile1178Met		Somatic				DOCK11_uc004eqq.2_Missense_Mutation_p.I957M	p.I1178M	NM_144658	NP_653259	WXS	Illumina HiSeq	Unspecified	Q5JSL3	DOC11_HUMAN			32	3597	+			1178					A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	c.3534A>G	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	A	4.865	0.160706	0.09287	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.68624	-0.34;-0.34	5.53	-3.13	0.05266	.	0.169780	0.56097	D	0.000039	T	0.38772	0.1053	N	0.19112	0.55	0.37348	D	0.910685	P;P	0.37158	0.585;0.585	B;B	0.34652	0.187;0.187	T	0.27706	-1.0066	10	0.16420	T	0.52	-7.9804	6.4143	0.21708	0.1687:0.5969:0.14:0.0944	.	1178;1178	A6NIW2;Q5JSL3	.;DOC11_HUMAN	M	1178	ENSP00000276204:I1178M;ENSP00000276202:I1178M	ENSP00000276202:I1178M	I	+	3	3	DOCK11	117642592	0.964000	0.33143	0.996000	0.52242	0.993000	0.82548	-0.008000	0.12788	-0.317000	0.08677	-0.362000	0.07510	ATA		0.338	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658		83	186	0	0	0	0.00361	0	83	186				
ZDHHC9	51114	broad.mit.edu	37	X	128975781	128975781	+	Silent	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:128975781C>A	ENST00000357166.6	-	3	532	c.141G>T	c.(139-141)ggG>ggT	p.G47G	ZDHHC9_ENST00000371064.3_Silent_p.G47G	NM_016032.3	NP_057116.2	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC-type containing 9	47					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|Ras palmitoyltransferase activity (GO:0043849)|zinc ion binding (GO:0008270)	p.G47G(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	19						GTGTACATGTCCCCAGGATGA	0.517																																							uc004euv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(139-141)GGG>GGT		zinc finger, DHHC domain containing 9							152.0	124.0	133.0					X																	128975781		2203	4300	6503	SO:0001819	synonymous_variant	51114					endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding	g.chrX:128975781C>A	AF151847	CCDS35395.1	Xq26.1	2008-02-05			ENSG00000188706	ENSG00000188706		"""Zinc fingers, DHHC-type"""	18475	protein-coding gene	gene with protein product		300646	"""zinc finger, DHHC-type containing 10"", ""chromosome X open reading frame 11"""	ZDHHC10, CXorf11		10810093	Standard	NM_001008222		Approved	ZNF379, CGI-89, ZNF380	uc004euw.3	Q9Y397	OTTHUMG00000022375	ENST00000357166.6:c.141G>T	X.37:g.128975781C>A			Somatic				ZDHHC9_uc004euw.2_Silent_p.G47G|ZDHHC9_uc004eux.1_Silent_p.G47G|ZDHHC9_uc004euy.1_Intron	p.G47G	NM_001008222	NP_001008223	WXS	Illumina HiSeq	Unspecified	Q9Y397	ZDHC9_HUMAN			2	510	-			47			Helical; (Potential).		B4F6G2|D3DTF9|Q59EK4|Q5JSW5|Q8WWS7|Q9BPY4|Q9NSP0|Q9NVL0|Q9NVR6	Silent	SNP	ENST00000357166.6	37	c.141G>T	CCDS35395.1	.	.	.	.	.	.	.	.	.	.	C	9.480	1.097943	0.20552	.	.	ENSG00000188706	ENST00000433917	T	0.71461	-0.57	5.51	2.69	0.31865	.	0.051738	0.85682	D	0.000000	T	0.43523	0.1251	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35151	-0.9800	7	0.02654	T	1	-13.1575	6.0345	0.19699	0.0:0.3974:0.3704:0.2322	.	.	.	.	V	7	ENSP00000406165:G7V	ENSP00000406165:G7V	G	-	2	0	ZDHHC9	128803462	0.509000	0.26163	0.995000	0.50966	0.993000	0.82548	-0.341000	0.07811	0.488000	0.27723	-0.199000	0.12753	GGA		0.517	ZDHHC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058213.1	NM_016032		33	82	1	0	6.02846e-25	0.003271	1.00229e-24	33	82				
STK26	51765	broad.mit.edu	37	X	131206387	131206387	+	Missense_Mutation	SNP	G	G	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:131206387G>T	ENST00000354719.6	+	9	1240	c.1024G>T	c.(1024-1026)Gca>Tca	p.A342S	MST4_ENST00000496850.1_Missense_Mutation_p.A280S|MST4_ENST00000481105.1_Missense_Mutation_p.A364S|MST4_ENST00000394335.2_Missense_Mutation_p.A265S|MST4_ENST00000394334.2_Missense_Mutation_p.A342S														p.A342S(1)		endometrium(2)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(192;0.000127)					ACAGAATGGGGCAGTATGTAT	0.388																																							uc004ewk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)|stomach(2)|upper_aerodigestive_tract(1)	9						c.(1024-1026)GCA>TCA		serine/threonine protein kinase MST4 isoform 1							96.0	74.0	82.0					X																	131206387		2203	4300	6503	SO:0001583	missense	51765				cellular component disassembly involved in apoptosis|regulation of apoptosis	cytosol|Golgi membrane	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity	g.chrX:131206387G>T																												ENST00000354719.6:c.1024G>T	X.37:g.131206387G>T	ENSP00000346755:p.Ala342Ser		Somatic				MST4_uc004ewl.1_Missense_Mutation_p.A265S|MST4_uc011mux.1_Missense_Mutation_p.A364S|MST4_uc010nrj.1_Missense_Mutation_p.A342S|MST4_uc004ewm.1_Missense_Mutation_p.A280S	p.A342S	NM_016542	NP_057626	WXS	Illumina HiSeq	Unspecified	Q9P289	MST4_HUMAN			9	1325	+	Acute lymphoblastic leukemia(192;0.000127)		342						Missense_Mutation	SNP	ENST00000354719.6	37	c.1024G>T		.	.	.	.	.	.	.	.	.	.	G	16.80	3.221837	0.58560	.	.	ENSG00000134602	ENST00000394334;ENST00000481105;ENST00000354719;ENST00000394335;ENST00000496850	T;T;T;T;T	0.75821	-0.57;-0.72;-0.58;-0.68;-0.97	6.03	5.06	0.68205	.	0.183245	0.36374	N	0.002625	T	0.52208	0.1720	N	0.20986	0.625	0.27520	N	0.951419	B;B;B;B;B	0.11235	0.0;0.001;0.001;0.004;0.001	B;B;B;B;B	0.13407	0.002;0.001;0.003;0.009;0.001	T	0.34329	-0.9833	10	0.10636	T	0.68	.	3.3814	0.07256	0.3968:0.0:0.6032:0.0	.	364;342;280;265;342	B4E0Y9;Q8NBY1;Q9P289-3;Q9P289-2;Q9P289	.;.;.;.;MST4_HUMAN	S	342;364;342;265;280	ENSP00000377867:A342S;ENSP00000418753:A364S;ENSP00000346755:A342S;ENSP00000377868:A265S;ENSP00000419702:A280S	ENSP00000346755:A342S	A	+	1	0	AL109749.1	131034068	1.000000	0.71417	0.955000	0.39395	0.946000	0.59487	6.517000	0.73759	2.551000	0.86045	0.600000	0.82982	GCA		0.388	MST4-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000058308.2			17	29	1	0	3.99206e-14	0.007413	6.04723e-14	17	29				
MAGEC1	9947	broad.mit.edu	37	X	140995890	140995890	+	Missense_Mutation	SNP	C	C	A			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:140995890C>A	ENST00000285879.4	+	4	2986	c.2700C>A	c.(2698-2700)agC>agA	p.S900R	MAGEC1_ENST00000406005.2_5'UTR	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	900								p.S900R(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TGATAGAGAGCGAGCCCTTGT	0.473										HNSCC(15;0.026)																													uc004fbt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2698-2700)AGC>AGA		melanoma antigen family C, 1							171.0	173.0	172.0					X																	140995890		2203	4300	6503	SO:0001583	missense	9947						protein binding	g.chrX:140995890C>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2700C>A	X.37:g.140995890C>A	ENSP00000285879:p.Ser900Arg	HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_5'UTR	p.S900R	NM_005462	NP_005453	WXS	Illumina HiSeq	Unspecified	O60732	MAGC1_HUMAN			4	2986	+	Acute lymphoblastic leukemia(192;6.56e-05)		900					A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	c.2700C>A	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	4.904	0.168046	0.09339	.	.	ENSG00000155495	ENST00000285879	T	0.02140	4.43	1.38	-2.75	0.05914	.	.	.	.	.	T	0.01320	0.0043	L	0.34521	1.04	0.09310	N	0.999999	P	0.48350	0.909	B	0.33254	0.16	T	0.34551	-0.9824	9	0.72032	D	0.01	.	0.08	0.00030	0.2353:0.2113:0.2354:0.318	.	900	O60732	MAGC1_HUMAN	R	900	ENSP00000285879:S900R	ENSP00000285879:S900R	S	+	3	2	MAGEC1	140823556	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.981000	0.00662	-1.790000	0.01263	-0.761000	0.03458	AGC		0.473	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		87	171	1	0	1.52795e-29	0.00361	2.55073e-29	87	171				
AFF2	2334	broad.mit.edu	37	X	148038041	148038041	+	Silent	SNP	A	A	C			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chrX:148038041A>C	ENST00000370460.2	+	11	2945	c.2466A>C	c.(2464-2466)gcA>gcC	p.A822A	AFF2_ENST00000370457.5_Silent_p.A789A|AFF2_ENST00000286437.5_Silent_p.A463A|AFF2_ENST00000342251.3_Silent_p.A789A	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	822					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.A822A(2)|p.A463A(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TCCATGCAGCACCTGCCAAGC	0.532																																							uc004fcp.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(3)|pancreas(2)	5						c.(2464-2466)GCA>GCC		fragile X mental retardation 2							71.0	71.0	71.0					X																	148038041		2203	4300	6503	SO:0001819	synonymous_variant	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:148038041A>C	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2466A>C	X.37:g.148038041A>C			Somatic				AFF2_uc004fcq.2_Silent_p.A812A|AFF2_uc004fcr.2_Silent_p.A783A|AFF2_uc011mxb.1_Silent_p.A787A|AFF2_uc004fcs.2_Silent_p.A789A|AFF2_uc011mxc.1_Silent_p.A463A	p.A822A	NM_002025	NP_002016	WXS	Illumina HiSeq	Unspecified	P51816	AFF2_HUMAN			11	2945	+	Acute lymphoblastic leukemia(192;6.56e-05)		822					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	ENST00000370460.2	37	c.2466A>C	CCDS14684.1																																																																																				0.532	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		7	32	0	0	0	0.000978	0	7	32				
PKLR	5313	broad.mit.edu	37	1	155261655	155261655	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr1:155261655delG	ENST00000342741.4	-	10	1548	c.1510delC	c.(1510-1512)cgcfs	p.R504fs	PKLR_ENST00000392414.3_Frame_Shift_Del_p.R473fs	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	504			R -> L (in PKRD; instability of the protein; dbSNP:rs185753709).		ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)	p.R504S(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	TGGACCTGGCGGGCAGCCTGG	0.602																																							uc001fkb.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(1)	5						c.(1510-1512)CGCfs		pyruvate kinase, liver and RBC isoform 1	Pyruvic acid(DB00119)						72.0	71.0	71.0					1																	155261655		2203	4300	6503	SO:0001589	frameshift_variant	5313				endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity	g.chr1:155261655delG	BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.1510delC	1.37:g.155261655delG	ENSP00000339933:p.Arg504fs		Somatic				RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Frame_Shift_Del_p.R473fs	p.R504fs	NM_000298	NP_000289	WXS	Illumina HiSeq	Unspecified	P30613	KPYR_HUMAN	Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		10	1549	-	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		504		R -> L (in PKRD; unstability of the protein).			O75758|P11973	Frame_Shift_Del	DEL	ENST00000342741.4	37	c.1510delC	CCDS1109.1																																																																																				0.602	PKLR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087407.2	NM_000298		18	92	NA	NA	NA	NA	NA	18	92	---	---	---	---
C10orf82	143379	broad.mit.edu	37	10	118424338	118424338	+	Frame_Shift_Del	DEL	T	T	-			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr10:118424338delT	ENST00000369210.3	-	4	449	c.395delA	c.(394-396)aacfs	p.N132fs	C10orf82_ENST00000588184.1_Frame_Shift_Del_p.N132fs	NM_144661.2	NP_653262.1	Q8WW14	CJ082_HUMAN	chromosome 10 open reading frame 82	132										endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7				all cancers(201;0.0143)		CTTGTAGCAGTTTTTGGCCAT	0.567																																							uc001lcr.2		NA																	0					0						c.(394-396)AACfs		hypothetical protein LOC143379							158.0	140.0	146.0					10																	118424338		2203	4300	6503	SO:0001589	frameshift_variant	143379							g.chr10:118424338delT	BC021737	CCDS7596.1	10q26.12	2012-05-31			ENSG00000165863	ENSG00000165863			28500	protein-coding gene	gene with protein product						12477932	Standard	NM_144661		Approved	MGC33547, Em:AC016825.4	uc001lcr.3	Q8WW14	OTTHUMG00000019105	ENST00000369210.3:c.395delA	10.37:g.118424338delT	ENSP00000358212:p.Asn132fs		Somatic				C10orf82_uc001lcs.1_3'UTR	p.N132fs	NM_144661	NP_653262	WXS	Illumina HiSeq	Unspecified	Q8WW14	CJ082_HUMAN		all cancers(201;0.0143)	4	450	-			132					B3KUM9|D3DRC3	Frame_Shift_Del	DEL	ENST00000369210.3	37	c.395delA	CCDS7596.1																																																																																				0.567	C10orf82-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000050527.1	NM_144661		8	204	NA	NA	NA	NA	NA	8	204	---	---	---	---
MKRN3	7681	broad.mit.edu	37	15	23811300	23811300	+	Frame_Shift_Del	DEL	G	G	-	rs200032750		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr15:23811300delG	ENST00000314520.3	+	1	847	c.371delG	c.(370-372)cggfs	p.R124fs	MKRN3_ENST00000564592.1_Intron|MKRN3_ENST00000568252.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	124					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		CTTTCTGGTCGGAAGATGGCC	0.602																																							uc001ywh.3		NA																	0				lung(6)|large_intestine(2)|ovary(2)	10						c.(370-372)CGGfs		makorin ring finger protein 3							51.0	54.0	53.0					15																	23811300		2203	4300	6503	SO:0001589	frameshift_variant	7681					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding	g.chr15:23811300delG	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.371delG	15.37:g.23811300delG	ENSP00000313881:p.Arg124fs		Somatic				MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Frame_Shift_Del_p.R124fs	p.R124fs	NM_005664	NP_005655	WXS	Illumina HiSeq	Unspecified	Q13064	MKRN3_HUMAN		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)	1	847	+		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)	124						Frame_Shift_Del	DEL	ENST00000314520.3	37	c.371delG	CCDS10013.1																																																																																				0.602	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	NM_005664		11	65	NA	NA	NA	NA	NA	11	65	---	---	---	---
NF1	4763	broad.mit.edu	37	17	29562721	29562721	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:29562721delG	ENST00000358273.4	+	28	4184	c.3801delG	c.(3799-3801)ttgfs	p.L1267fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.L1267fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1267	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAGTAGAATTGGCAGACTCCA	0.413			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		12	Whole gene deletion(8)|Unknown(4)	p.?(2)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(3799-3801)TTGfs		neurofibromin isoform 1							192.0	187.0	189.0					17																	29562721		2203	4300	6503	SO:0001589	frameshift_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29562721delG		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.3801delG	17.37:g.29562721delG	ENSP00000351015:p.Leu1267fs	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)	Somatic				NF1_uc002hgh.2_Frame_Shift_Del_p.L1267fs|NF1_uc010csn.1_Frame_Shift_Del_p.L1127fs|NF1_uc002hgi.1_Frame_Shift_Del_p.L300fs	p.L1267fs	NM_001042492	NP_001035957	WXS	Illumina HiSeq	Unspecified	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	28	4134	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	1267			Ras-GAP.		O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	c.3801delG	CCDS42292.1																																																																																				0.413	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		88	321	NA	NA	NA	NA	NA	88	321	---	---	---	---
NF1	4763	broad.mit.edu	37	17	29679430	29679430	+	Frame_Shift_Del	DEL	T	T	-			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr17:29679430delT	ENST00000358273.4	+	51	7996	c.7613delT	c.(7612-7614)cttfs	p.L2538fs	NF1_ENST00000444181.2_Frame_Shift_Del_p.L331fs|NF1_ENST00000356175.3_Frame_Shift_Del_p.L2517fs|NF1_ENST00000417592.2_Intron	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2538					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAGAAGTTGCTTGGTTAGTTT	0.368			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		11	Whole gene deletion(8)|Unknown(3)		soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(7612-7614)CTTfs		neurofibromin isoform 1							43.0	41.0	42.0					17																	29679430		2203	4300	6503	SO:0001589	frameshift_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29679430delT		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7613delT	17.37:g.29679430delT	ENSP00000351015:p.Leu2538fs	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)	Somatic				NF1_uc002hgh.2_Frame_Shift_Del_p.L2517fs|NF1_uc010cso.2_Frame_Shift_Del_p.L726fs|NF1_uc010wbt.1_Intron|NF1_uc010wbu.1_RNA	p.L2538fs	NM_001042492	NP_001035957	WXS	Illumina HiSeq	Unspecified	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	51	7946	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	2538					O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	c.7613delT	CCDS42292.1																																																																																				0.368	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		10	26	NA	NA	NA	NA	NA	10	26	---	---	---	---
GALNT14	79623	broad.mit.edu	37	2	31178519	31178519	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr2:31178519delC	ENST00000349752.5	-	6	1258	c.619delG	c.(619-621)gacfs	p.D207fs	GALNT14_ENST00000420311.2_Frame_Shift_Del_p.D172fs|GALNT14_ENST00000356174.3_Frame_Shift_Del_p.D174fs|GALNT14_ENST00000324589.5_Frame_Shift_Del_p.D212fs|GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000406653.1_Frame_Shift_Del_p.D187fs	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	207	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					TGGAGCCAGTCCCTGTTCACC	0.632																																							uc002rnr.2		NA																	0				upper_aerodigestive_tract(2)|skin(1)	3						c.(619-621)GACfs		N-acetylgalactosaminyltransferase 14							54.0	54.0	54.0					2																	31178519		2203	4300	6503	SO:0001589	frameshift_variant	79623					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:31178519delC	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.619delG	2.37:g.31178519delC	ENSP00000288988:p.Asp207fs		Somatic				GALNT14_uc002rnq.2_Frame_Shift_Del_p.D187fs|GALNT14_uc002rns.2_Frame_Shift_Del_p.D212fs|GALNT14_uc010ymr.1_Frame_Shift_Del_p.D172fs|GALNT14_uc010ezo.1_Frame_Shift_Del_p.D174fs|GALNT14_uc010ezp.1_Frame_Shift_Del_p.D178fs	p.D207fs	NM_024572	NP_078848	WXS	Illumina HiSeq	Unspecified	Q96FL9	GLT14_HUMAN			6	1238	-	Acute lymphoblastic leukemia(172;0.155)		207			Lumenal (Potential).|Catalytic subdomain A.		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Frame_Shift_Del	DEL	ENST00000349752.5	37	c.619delG	CCDS1773.2																																																																																				0.632	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		18	43	NA	NA	NA	NA	NA	18	43	---	---	---	---
ARHGEF38	54848	broad.mit.edu	37	4	106534548	106534549	+	Frame_Shift_Ins	INS	-	-	TATC			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr4:106534548_106534549insTATC	ENST00000420470.2	+	3	536_537	c.392_393insTATC	c.(391-396)aggctgfs	p.RL131fs	ARHGEF38_ENST00000265154.2_Frame_Shift_Ins_p.RL131fs	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	131	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						CAGACTGATAGGCTGGATGTGG	0.441																																							uc003hxu.2		NA																	0				ovary(2)|breast(1)	3						c.(391-393)AGGfs		hypothetical protein LOC54848																																				SO:0001589	frameshift_variant	54848				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr4:106534548_106534549insTATC	AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	Exception_encountered	4.37:g.106534548_106534549insTATC	ENSP00000416125:p.Arg131fs		Somatic					p.R131fs	NM_017700	NP_060170	WXS	Illumina HiSeq	Unspecified	Q9NXL2	ARH38_HUMAN			3	538_539	+			131			DH.		C9JIB4	Frame_Shift_Ins	INS	ENST00000420470.2	37	c.392_393insTATC	CCDS56338.1																																																																																				0.441	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000336934.3	NM_017700		15	221	NA	NA	NA	NA	NA	15	221	---	---	---	---
ZFR	51663	broad.mit.edu	37	5	32419951	32419953	+	In_Frame_Del	DEL	GGT	GGT	-	rs376016449		TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	GGT	GGT	-	-	GGT	GGT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr5:32419951_32419953delGGT	ENST00000265069.8	-	3	495_497	c.393_395delACC	c.(391-396)ccaccc>ccc	p.131_132PP>P		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	131	Ala-rich.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		AGTAGCTGGGGGTGGTGGTGGTG	0.483																																							uc003jhr.1		NA																	0					0						c.(391-396)CCACCC>CCC		zinc finger RNA binding protein																																				SO:0001651	inframe_deletion	51663				multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding	g.chr5:32419951_32419953delGGT	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.393_395delACC	5.37:g.32419960_32419962delGGT	ENSP00000265069:p.Pro133del		Somatic				ZFR_uc010iun.1_In_Frame_Del_p.131_132PP>P	p.131_132PP>P	NM_016107	NP_057191	WXS	Illumina HiSeq	Unspecified	Q96KR1	ZFR_HUMAN		STAD - Stomach adenocarcinoma(35;0.19)	3	473_475	-			131_132			Ala-rich.		B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	In_Frame_Del	DEL	ENST00000265069.8	37	c.393_395delACC	CCDS34139.1																																																																																				0.483	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1			7	498	NA	NA	NA	NA	NA	7	498	---	---	---	---
PTPRZ1	5803	broad.mit.edu	37	7	121651908	121651909	+	Frame_Shift_Ins	INS	-	-	T			TCGA-50-6593-01A-11D-1753-08	TCGA-50-6593-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	10e03053-f6e3-42b7-8638-ce58c6e7dfaa	acd8a6fc-5145-499f-9d88-9bd6082a0d9b	g.chr7:121651908_121651909insT	ENST00000393386.2	+	12	3219_3220	c.2808_2809insT	c.(2809-2811)caafs	p.Q937fs	PTPRZ1_ENST00000449182.1_Intron|PTPRZ1_ENST00000483028.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	937					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ATGAGGGCTCCCAACACATCTT	0.455																																							uc003vjy.2		NA																	0				ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						c.(2806-2811)TCCCAAfs		protein tyrosine phosphatase, receptor-type,																																				SO:0001589	frameshift_variant	5803				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:121651908_121651909insT	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	Exception_encountered	7.37:g.121651908_121651909insT	ENSP00000377047:p.Gln937fs		Somatic				PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	p.S936fs	NM_002851	NP_002842	WXS	Illumina HiSeq	Unspecified	P23471	PTPRZ_HUMAN			12	3203_3204	+			936_937			Extracellular (Potential).		A4D0W5|C9JFM0|O76043|Q9UDR6	Frame_Shift_Ins	INS	ENST00000393386.2	37	c.2808_2809insT	CCDS34740.1																																																																																				0.455	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		22	106	NA	NA	NA	NA	NA	22	106	---	---	---	---
