#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
TNFRSF4	7293	broad.mit.edu	37	1	1147438	1147438	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:1147438G>C	ENST00000379236.3	-	5	522	c.518C>G	c.(517-519)gCc>gGc	p.A173G	TNFRSF4_ENST00000453580.1_5'UTR	NM_003327.3	NP_003318.1	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily, member 4	173					cellular defense response (GO:0006968)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin secretion (GO:0051024)|regulation of apoptotic process (GO:0042981)|regulation of protein kinase activity (GO:0045859)|T cell proliferation (GO:0042098)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)			large_intestine(1)|lung(2)|urinary_tract(1)	4	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGGCTGCGTGGCTGGGGGGTC	0.687																																							uc001ade.2		NA																	0					0						c.(517-519)GCC>GGC		tumor necrosis factor receptor superfamily,							22.0	24.0	23.0					1																	1147438		2200	4291	6491	SO:0001583	missense	7293				immune response|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of immunoglobulin secretion|T cell proliferation	integral to plasma membrane	tumor necrosis factor receptor activity	g.chr1:1147438G>C	X75962	CCDS11.1	1p36	2008-02-05			ENSG00000186827	ENSG00000186827		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11918	protein-coding gene	gene with protein product		600315		TXGP1L		7510240, 2828930	Standard	NM_003327		Approved	ACT35, OX40, CD134	uc001ade.3	P43489	OTTHUMG00000001415	ENST00000379236.3:c.518C>G	1.37:g.1147438G>C	ENSP00000368538:p.Ala173Gly		Somatic				TNFRSF4_uc001adf.2_Missense_Mutation_p.A177G	p.A173G	NM_003327	NP_003318	WXS	Illumina HiSeq	Unspecified	P43489	TNR4_HUMAN		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	5	523	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	173			Extracellular (Potential).		Q13663|Q2M312|Q5T7M0	Missense_Mutation	SNP	ENST00000379236.3	37	c.518C>G	CCDS11.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.12|15.12	2.739321|2.739321	0.49045|0.49045	.|.	.|.	ENSG00000186827|ENSG00000186827	ENST00000379236|ENST00000453580	T|.	0.62941|.	-0.01|.	3.79|3.79	1.82|1.82	0.25136|0.25136	.|.	1.948520|.	0.02891|.	N|.	0.134222|.	T|T	0.44371|0.44371	0.1290|0.1290	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	N|N	1|1	D;P|.	0.71674|.	0.998;0.856|.	D;P|.	0.65684|.	0.937;0.594|.	T|T	0.32214|0.32214	-0.9915|-0.9915	10|5	0.28530|.	T|.	0.3|.	-5.2022|-5.2022	7.1543|7.1543	0.25628|0.25628	0.1022:0.173:0.7248:0.0|0.1022:0.173:0.7248:0.0	.|.	118;173|.	B1AME4;P43489|.	.;TNR4_HUMAN|.	G|R	173|118	ENSP00000368538:A173G|.	ENSP00000368538:A173G|.	A|S	-|-	2|3	0|2	TNFRSF4|TNFRSF4	1137301|1137301	0.027000|0.027000	0.19231|0.19231	0.007000|0.007000	0.13788|0.13788	0.002000|0.002000	0.02628|0.02628	0.406000|0.406000	0.21032|0.21032	0.359000|0.359000	0.24239|0.24239	0.491000|0.491000	0.48974|0.48974	GCC|AGC		0.687	TNFRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004086.1			5	16	0	0	0	0.001168	0	5	16				
KIF1B	23095	broad.mit.edu	37	1	10423341	10423341	+	Splice_Site	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:10423341G>T	ENST00000377086.1	+	41	4507	c.4305G>T	c.(4303-4305)tcG>tcT	p.S1435S	KIF1B_ENST00000263934.6_Splice_Site_p.S1389S|KIF1B_ENST00000377081.1_Splice_Site_p.S1435S			O60333	KIF1B_HUMAN	kinesin family member 1B	1435					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CTTCAAATAGGAATCGAGTCA	0.363																																							uc001aqx.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(4303-4305)TCG>TCT		kinesin family member 1B isoform b							154.0	148.0	150.0					1																	10423341		2203	4300	6503	SO:0001630	splice_region_variant	23095				anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding	g.chr1:10423341G>T	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4305-1G>T	1.37:g.10423341G>T			Somatic				KIF1B_uc001aqw.3_Silent_p.S1389S|KIF1B_uc001aqy.2_Silent_p.S1409S|KIF1B_uc001aqz.2_Silent_p.S1435S|KIF1B_uc001ara.2_Silent_p.S1395S|KIF1B_uc001arb.2_Silent_p.S1421S	p.S1435S	NM_015074	NP_055889	WXS	Illumina HiSeq	Unspecified	O60333	KIF1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)	41	4507	+	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	1435					A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Silent	SNP	ENST00000377086.1	37	c.4305G>T																																																																																					0.363	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		Silent	7	29	1	0	0.000442599	0.006214	0.000490831	7	29				
Unknown	0	broad.mit.edu	37	1	13183522	13183522	+	IGR	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:13183522C>A								RP13-221M14.3 (19054 upstream) : PRAMEF26 (32833 downstream)																							CATAATAATCCCGTTGAAAGC	0.522																																							uc010obg.1		NA																	0					0						c.(349-351)CGG>CGT		heterogeneous nuclear ribonucleoprotein C-like							95.0	75.0	81.0					1																	13183522		692	1591	2283	SO:0001628	intergenic_variant	440563					ribonucleoprotein complex	nucleic acid binding|nucleotide binding	g.chr1:13183522C>A																													1.37:g.13183522C>A			Somatic					p.R117R	NM_001136561	NP_001130033	WXS	Illumina HiSeq	Unspecified	B2RXH8	B2RXH8_HUMAN			1	446	-			117						Silent	SNP		37	c.351G>T																																																																																				0	0.522									17	75	1	0	3.45872e-05	0.004007	4.04296e-05	17	75				
TAS1R2	80834	broad.mit.edu	37	1	19186125	19186125	+	Silent	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:19186125G>A	ENST00000375371.3	-	1	51	c.30C>T	c.(28-30)tcC>tcT	p.S10S	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	10					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GGAAGAACAGGGAGGAGATGG	0.587																																							uc001bba.1		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(28-30)TCC>TCT		taste receptor, type 1, member 2 precursor	Aspartame(DB00168)						113.0	105.0	108.0					1																	19186125		2203	4300	6503	SO:0001819	synonymous_variant	80834				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:19186125G>A		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.30C>T	1.37:g.19186125G>A			Somatic					p.S10S	NM_152232	NP_689418	WXS	Illumina HiSeq	Unspecified	Q8TE23	TS1R2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	1	31	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	10					Q5TZ19	Silent	SNP	ENST00000375371.3	37	c.30C>T	CCDS187.1																																																																																				0.587	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			6	48	0	0	0	0.001984	0	6	48				
ALDH4A1	8659	broad.mit.edu	37	1	19199453	19199453	+	Splice_Site	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:19199453T>A	ENST00000375341.3	-	15	1837		c.e15-2		ALDH4A1_ENST00000290597.5_Splice_Site|ALDH4A1_ENST00000538839.1_Splice_Site|RP13-279N23.2_ENST00000494072.3_Intron|ALDH4A1_ENST00000538309.1_Splice_Site	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1						4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)			cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CATTGGTTCCTGCGGAAAAGA	0.567																																							uc001bbb.2		NA																	0					0						c.e15-1		aldehyde dehydrogenase 4A1 isoform a precursor	NADH(DB00157)						87.0	79.0	82.0					1																	19199453		2203	4300	6503	SO:0001630	splice_region_variant	8659				proline biosynthetic process|proline catabolic process	mitochondrial matrix	1-pyrroline-5-carboxylate dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|electron carrier activity	g.chr1:19199453T>A	U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.1580-2A>T	1.37:g.19199453T>A			Somatic				ALDH4A1_uc010ocu.1_Intron|ALDH4A1_uc001bbc.2_Intron	p.G527_splice	NM_170726	NP_733844	WXS	Illumina HiSeq	Unspecified	P30038	AL4A1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	15	1856	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)						A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Splice_Site	SNP	ENST00000375341.3	37	c.1580_splice	CCDS188.1	.	.	.	.	.	.	.	.	.	.	T	14.37	2.514159	0.44763	.	.	ENSG00000159423	ENST00000290597;ENST00000375341;ENST00000538839;ENST00000538309	.	.	.	4.68	4.68	0.58851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9325	0.58294	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALDH4A1	19072040	1.000000	0.71417	0.974000	0.42286	0.313000	0.28021	7.709000	0.84645	1.746000	0.51805	0.460000	0.39030	.		0.567	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006954.1		Intron	8	46	0	0	0	0.00308	0	8	46				
SERINC2	347735	broad.mit.edu	37	1	31898638	31898638	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:31898638G>C	ENST00000373709.3	+	5	638	c.488G>C	c.(487-489)gGc>gCc	p.G163A	SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000536859.1_Missense_Mutation_p.G167A|SERINC2_ENST00000373710.1_Missense_Mutation_p.G172A|SERINC2_ENST00000536384.1_Missense_Mutation_p.G167A	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	163					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		TTCTACTTCGGCGTCGTGGGC	0.602																																							uc010ogh.1		NA																	0					0						c.(499-501)GGC>GCC		tumor differentially expressed 2-like							213.0	178.0	190.0					1																	31898638		2203	4300	6503	SO:0001583	missense	347735					integral to membrane		g.chr1:31898638G>C	AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.488G>C	1.37:g.31898638G>C	ENSP00000362813:p.Gly163Ala		Somatic				SERINC2_uc010ogg.1_Missense_Mutation_p.G164A|SERINC2_uc009vtw.1_Silent_p.R136R|SERINC2_uc001bst.2_Missense_Mutation_p.G163A|SERINC2_uc001bsu.2_Missense_Mutation_p.G108A|SERINC2_uc001bsv.2_Missense_Mutation_p.G108A	p.G167A	NM_178865	NP_849196	WXS	Illumina HiSeq	Unspecified	Q96SA4	SERC2_HUMAN		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)	5	701	+		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)	163			Helical; (Potential).		A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Missense_Mutation	SNP	ENST00000373709.3	37	c.500G>C	CCDS30662.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757268	0.69648	.	.	ENSG00000168528	ENST00000373710;ENST00000536859;ENST00000373709;ENST00000536384	T;T;T;T	0.15256	2.44;2.44;2.44;2.44	4.01	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.34221	0.0890	L	0.42487	1.325	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.994	D;D;D	0.75484	0.986;0.979;0.947	T	0.15492	-1.0435	10	0.87932	D	0	-28.2786	16.2466	0.82448	0.0:0.0:1.0:0.0	.	167;172;163	B4DJK5;E7EUZ9;Q96SA4	.;.;SERC2_HUMAN	A	172;167;163;167	ENSP00000362814:G172A;ENSP00000444307:G167A;ENSP00000362813:G163A;ENSP00000439048:G167A	ENSP00000362813:G163A	G	+	2	0	SERINC2	31671225	1.000000	0.71417	0.991000	0.47740	0.369000	0.29798	9.547000	0.98100	2.233000	0.73108	0.491000	0.48974	GGC		0.602	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010680.1	NM_018565		34	115	0	0	0	0.003271	0	34	115				
LRRC42	115353	broad.mit.edu	37	1	54427706	54427706	+	Splice_Site	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:54427706G>T	ENST00000371370.3	+	6	1245		c.e6-1		LRRC42_ENST00000319223.4_Splice_Site|LRRC42_ENST00000477905.1_3'UTR	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42											breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						TTGACATCTAGGTAACCCTGA	0.378																																							uc001cwj.1		NA																	0					0						c.e5-1		leucine rich repeat containing 42							133.0	127.0	129.0					1																	54427706		2203	4300	6503	SO:0001630	splice_region_variant	115353							g.chr1:54427706G>T	AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.725-1G>T	1.37:g.54427706G>T			Somatic				LRRC42_uc001cwl.1_Splice_Site_p.C242_splice|LRRC42_uc001cwk.1_Splice_Site_p.C242_splice|LRRC42_uc009vzm.1_Splice_Site_p.C242_splice	p.C242_splice	NM_052940	NP_443172	WXS	Illumina HiSeq	Unspecified	Q9Y546	LRC42_HUMAN			5	925	+								D3DQ46|Q8N2Q8	Splice_Site	SNP	ENST00000371370.3	37	c.725_splice	CCDS585.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843585	0.71488	.	.	ENSG00000116212	ENST00000371370;ENST00000319223	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7371	0.96210	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRRC42	54200294	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.178000	0.89690	2.758000	0.94735	0.563000	0.77884	.		0.378	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023250.1	NM_052940	Intron	9	24	1	0	2.17888e-05	0.006214	2.56426e-05	9	24				
LHX8	431707	broad.mit.edu	37	1	75596413	75596413	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:75596413G>C	ENST00000294638.5	+	2	678	c.14G>C	c.(13-15)aGc>aCc	p.S5T	RP11-510C10.3_ENST00000427892.1_RNA|RP11-510C10.2_ENST00000446238.1_RNA	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	5					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						CAGATTCTGAGCAGGGTAAGT	0.448																																							uc001dgo.2		NA																	0				ovary(3)	3						c.(13-15)AGC>ACC		LIM homeobox 8							135.0	143.0	140.0					1																	75596413		2203	4300	6503	SO:0001583	missense	431707					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:75596413G>C	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.14G>C	1.37:g.75596413G>C	ENSP00000294638:p.Ser5Thr		Somatic				uc001dgp.1_RNA	p.S5T	NM_001001933	NP_001001933	WXS	Illumina HiSeq	Unspecified	Q68G74	LHX8_HUMAN			2	678	+			5					E9PGE3	Missense_Mutation	SNP	ENST00000294638.5	37	c.14G>C	CCDS30756.1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.243243	0.22796	.	.	ENSG00000162624	ENST00000294638	D	0.86769	-2.17	4.03	-0.196	0.13232	.	2.771140	0.02279	N	0.069243	T	0.54111	0.1838	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.51576	-0.8688	10	0.44086	T	0.13	.	3.855	0.08971	0.3086:0.1822:0.5092:0.0	.	5	Q68G74	LHX8_HUMAN	T	5	ENSP00000294638:S5T	ENSP00000294638:S5T	S	+	2	0	LHX8	75369001	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	0.189000	0.17037	-0.019000	0.14055	0.561000	0.74099	AGC		0.448	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933		14	67	0	0	0	0.004007	0	14	67				
AK5	26289	broad.mit.edu	37	1	77806129	77806129	+	Missense_Mutation	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:77806129A>G	ENST00000354567.2	+	6	1030	c.767A>G	c.(766-768)aAg>aGg	p.K256R	AK5_ENST00000344720.5_Missense_Mutation_p.K230R	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	256	Adenylate kinase 1.|LID 1. {ECO:0000250}.				ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						AGATTACTGAAGCGTGCAGAA	0.453																																							uc001dhn.2		NA																	0				skin(1)	1						c.(766-768)AAG>AGG		adenylate kinase 5 isoform 1							158.0	148.0	151.0					1																	77806129		2203	4300	6503	SO:0001583	missense	26289				ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity	g.chr1:77806129A>G	AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.767A>G	1.37:g.77806129A>G	ENSP00000346577:p.Lys256Arg		Somatic				AK5_uc001dho.2_Missense_Mutation_p.K230R	p.K256R	NM_174858	NP_777283	WXS	Illumina HiSeq	Unspecified	Q9Y6K8	KAD5_HUMAN			6	1024	+			256					Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	ENST00000354567.2	37	c.767A>G	CCDS675.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.165766	0.78339	.	.	ENSG00000154027	ENST00000354567;ENST00000344720	T;T	0.77489	-1.1;-1.1	5.1	2.74	0.32292	.	0.048805	0.85682	N	0.000000	T	0.71143	0.3305	L	0.28054	0.825	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73636	-0.3920	10	0.59425	D	0.04	-24.298	9.751	0.40475	0.8568:0.0:0.1432:0.0	.	256	Q9Y6K8	KAD5_HUMAN	R	256;230	ENSP00000346577:K256R;ENSP00000341430:K230R	ENSP00000341430:K230R	K	+	2	0	AK5	77578717	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	2.865000	0.48412	0.350000	0.24002	0.533000	0.62120	AAG		0.453	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026993.4	NM_174858		17	60	0	0	0	0.007413	0	17	60				
PTGFR	5737	broad.mit.edu	37	1	79002247	79002247	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:79002247G>T	ENST00000370757.3	+	3	1192	c.955G>T	c.(955-957)Gcc>Tcc	p.A319S	PTGFR_ENST00000370756.3_3'UTR|PTGFR_ENST00000370758.1_Missense_Mutation_p.A319S	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	319					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	CTATAAGCTTGCCAGTCAATG	0.393																																							uc001din.2		NA																	0				ovary(3)|breast(2)|skin(1)	6						c.(955-957)GCC>TCC		prostaglandin F receptor isoform a precursor	Bimatoprost(DB00905)|Latanoprost(DB00654)|Travoprost(DB00287)						129.0	128.0	129.0					1																	79002247		2203	4300	6503	SO:0001583	missense	5737				parturition	extracellular region|integral to plasma membrane	prostaglandin F receptor activity	g.chr1:79002247G>T	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.955G>T	1.37:g.79002247G>T	ENSP00000359793:p.Ala319Ser		Somatic				PTGFR_uc001dim.2_3'UTR	p.A319S	NM_000959	NP_000950	WXS	Illumina HiSeq	Unspecified	P43088	PF2R_HUMAN		Colorectal(170;0.248)	3	1221	+			319			Cytoplasmic (Potential).		A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	37	c.955G>T	CCDS686.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.278735	0.40294	.	.	ENSG00000122420	ENST00000370758;ENST00000370757	T;T	0.37235	1.21;1.21	5.85	3.85	0.44370	.	0.547984	0.19836	N	0.104970	T	0.17450	0.0419	L	0.50333	1.59	0.80722	D	1	B	0.28713	0.22	B	0.23852	0.049	T	0.04767	-1.0928	10	0.38643	T	0.18	-8.8364	11.8827	0.52583	0.2102:0.0:0.7898:0.0	.	319	P43088	PF2R_HUMAN	S	319	ENSP00000359794:A319S;ENSP00000359793:A319S	ENSP00000359793:A319S	A	+	1	0	PTGFR	78774835	0.990000	0.36364	0.933000	0.37362	0.679000	0.39708	0.912000	0.28597	1.515000	0.48885	0.655000	0.94253	GCC		0.393	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959		9	40	1	0	2.17888e-05	0.006214	2.56426e-05	9	40				
GBP3	2635	broad.mit.edu	37	1	89477519	89477519	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:89477519G>T	ENST00000370481.4	-	7	1280	c.1060C>A	c.(1060-1062)Ctg>Atg	p.L354M		NM_018284.2	NP_060754.2	Q8WXF7	ATLA1_HUMAN	guanylate binding protein 3	405					axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		ACCCTGTGCAGGTCCAGCAGC	0.502																																							uc001dmt.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1060-1062)CTG>ATG		guanylate binding protein 3							69.0	54.0	59.0					1																	89477519		2189	3947	6136	SO:0001583	missense	2635					integral to membrane	GTP binding|GTPase activity	g.chr1:89477519G>T	BC063819	CCDS717.2	1p22.2	2008-02-05			ENSG00000117226	ENSG00000117226			4184	protein-coding gene	gene with protein product		600413				7518790	Standard	NM_018284		Approved	FLJ10961	uc001dmt.3	Q9H0R5	OTTHUMG00000010616	ENST00000370481.4:c.1060C>A	1.37:g.89477519G>T	ENSP00000359512:p.Leu354Met		Somatic				GBP3_uc010oss.1_Missense_Mutation_p.L275M|GBP3_uc001dmu.2_Missense_Mutation_p.L220M|GBP3_uc001dmv.2_Intron	p.L354M	NM_018284	NP_060754	WXS	Illumina HiSeq	Unspecified	Q9H0R5	GBP3_HUMAN		all cancers(265;0.0103)|Epithelial(280;0.0293)	7	1265	-		Lung NSC(277;0.123)	354					A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	ENST00000370481.4	37	c.1060C>A	CCDS717.2	.	.	.	.	.	.	.	.	.	.	G	3.119	-0.181037	0.06380	.	.	ENSG00000117226	ENST00000370482;ENST00000370481;ENST00000235878	T	0.02345	4.33	3.84	0.559	0.17272	Guanylate-binding protein, C-terminal (3);	0.258279	0.31709	N	0.007191	T	0.02193	0.0068	M	0.65320	2	0.09310	N	1	P;P	0.36874	0.516;0.572	B;P	0.47430	0.389;0.547	T	0.40117	-0.9580	10	0.45353	T	0.12	.	6.5565	0.22464	0.0:0.3209:0.3507:0.3284	.	220;354	F6X827;Q9H0R5	.;GBP3_HUMAN	M	322;354;354	ENSP00000359512:L354M	ENSP00000235878:L354M	L	-	1	2	GBP3	89250107	0.020000	0.18652	0.798000	0.32154	0.012000	0.07955	-0.163000	0.09997	0.400000	0.25396	-0.293000	0.09583	CTG		0.502	GBP3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313541.3	NM_018284		24	54	1	0	5.35356e-11	0.00278	7.5298e-11	24	54				
GFI1	2672	broad.mit.edu	37	1	92948583	92948583	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:92948583C>A	ENST00000370332.1	-	3	454	c.136G>T	c.(136-138)Ggg>Tgg	p.G46W	GFI1_ENST00000294702.5_Missense_Mutation_p.G46W|GFI1_ENST00000483490.1_5'UTR|GFI1_ENST00000427103.1_Missense_Mutation_p.G46W	NM_001127215.1	NP_001120687.1	Q99684	GFI1_HUMAN	growth factor independent 1 transcription repressor	46					auditory receptor cell differentiation (GO:0042491)|cell fate commitment (GO:0045165)|cellular response to lipopolysaccharide (GO:0071222)|inner ear morphogenesis (GO:0042472)|mechanosensory behavior (GO:0007638)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell fate specification (GO:0009996)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vitamin D biosynthetic process (GO:0010957)|positive regulation of cell fate specification (GO:0042660)|positive regulation of interleukin-6-mediated signaling pathway (GO:0070105)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|viral process (GO:0016032)	nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		GCCTTCGCCCCGCCTGCATTT	0.657																																							uc001dou.3		NA																	0				large_intestine(1)	1						c.(136-138)GGG>TGG		growth factor independent 1							29.0	37.0	34.0					1																	92948583		2197	4296	6493	SO:0001583	missense	2672				negative regulation of calcidiol 1-monooxygenase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1/S phase of mitotic cell cycle|transcription, DNA-dependent|viral reproduction	nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr1:92948583C>A	U67369	CCDS30773.1	1p22	2014-09-17	2007-10-04		ENSG00000162676	ENSG00000162676		"""Zinc fingers, C2H2-type"""	4237	protein-coding gene	gene with protein product		600871	"""growth factor independent 1"""	ZNF163		7789186	Standard	NM_005263		Approved	GFI1A, GFI-1	uc001dov.4	Q99684	OTTHUMG00000010897	ENST00000370332.1:c.136G>T	1.37:g.92948583C>A	ENSP00000359357:p.Gly46Trp		Somatic				GFI1_uc001dov.3_Missense_Mutation_p.G46W|GFI1_uc001dow.3_Missense_Mutation_p.G46W	p.G46W	NM_001127215	NP_001120687	WXS	Illumina HiSeq	Unspecified	Q99684	GFI1_HUMAN		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)	3	300	-		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)	46					Q8N564	Missense_Mutation	SNP	ENST00000370332.1	37	c.136G>T	CCDS30773.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.759186	0.31137	.	.	ENSG00000162676	ENST00000370332;ENST00000427103;ENST00000294702	T;T;T	0.09255	3.0;3.0;3.0	5.18	3.13	0.36017	.	0.831695	0.11247	N	0.584065	T	0.03220	0.0094	L	0.36672	1.1	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.39231	-0.9624	10	0.66056	D	0.02	-17.5341	6.6761	0.23095	0.1333:0.6627:0.1294:0.0746	.	46	Q99684	GFI1_HUMAN	W	46	ENSP00000359357:G46W;ENSP00000399719:G46W;ENSP00000294702:G46W	ENSP00000294702:G46W	G	-	1	0	GFI1	92721171	0.002000	0.14202	0.985000	0.45067	0.317000	0.28152	1.601000	0.36773	1.265000	0.44215	0.561000	0.74099	GGG		0.657	GFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030054.1	NM_005263		3	45	1	0	1.23904e-05	0.000602	1.47322e-05	3	45				
PIFO	128344	broad.mit.edu	37	1	111892810	111892810	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:111892810G>C	ENST00000369738.4	+	5	837	c.472G>C	c.(472-474)Gtt>Ctt	p.V158L	PIFO_ENST00000484512.1_3'UTR|PIFO_ENST00000369737.4_Missense_Mutation_p.V125L	NM_181643.4	NP_857594.2	Q8TCI5	PIFO_HUMAN	primary cilia formation	158					cell projection organization (GO:0030030)|positive regulation of kinase activity (GO:0033674)|regulation of cell projection organization (GO:0031344)	ciliary basal body (GO:0036064)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-tubulin binding (GO:0048487)|gamma-tubulin binding (GO:0043015)|kinesin binding (GO:0019894)|protein kinase binding (GO:0019901)|Rab GTPase binding (GO:0017137)										CTGGGCTCAGGTTCCATGTCT	0.413																																							uc001eaw.2		NA																	0				ovary(1)|skin(1)	2						c.(472-474)GTT>CTT		hypothetical protein LOC128344							124.0	134.0	131.0					1																	111892810		2203	4300	6503	SO:0001583	missense	128344							g.chr1:111892810G>C	BC050319	CCDS833.1, CCDS72836.1	1p13.2	2012-10-10	2012-10-10	2012-10-10	ENSG00000173947	ENSG00000173947			27009	protein-coding gene	gene with protein product		614234	"""chromosome 1 open reading frame 88"""	C1orf88		20643351	Standard	XM_005270472		Approved	FLJ23853, pitchfork	uc001eaw.2	Q8TCI5	OTTHUMG00000011168	ENST00000369738.4:c.472G>C	1.37:g.111892810G>C	ENSP00000358753:p.Val158Leu		Somatic				C1orf88_uc001eax.2_Missense_Mutation_p.V125L|C1orf88_uc009wge.1_Missense_Mutation_p.G81A|C1orf88_uc001eay.2_Missense_Mutation_p.V71L	p.V158L	NM_181643	NP_857594	WXS	Illumina HiSeq	Unspecified	Q8TCI5	CA088_HUMAN		Lung(183;0.0239)|Colorectal(144;0.0301)|all cancers(265;0.0677)|Epithelial(280;0.0897)|COAD - Colon adenocarcinoma(174;0.116)|LUSC - Lung squamous cell carcinoma(189;0.135)	5	552	+		all_cancers(81;3.21e-05)|all_epithelial(167;1.19e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)	158					D9J0A2|D9J0A3|Q4G0K4|Q52LJ6|Q5T5D5|Q5T5D6|Q8N310	Missense_Mutation	SNP	ENST00000369738.4	37	c.472G>C	CCDS833.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.507499	0.44558	.	.	ENSG00000173947	ENST00000369738;ENST00000369737	T;T	0.34072	1.8;1.38	5.87	4.02	0.46733	.	0.093210	0.46758	D	0.000267	T	0.21387	0.0515	M	0.76574	2.34	0.33571	D	0.598654	P;P	0.40431	0.717;0.717	B;B	0.37198	0.243;0.243	T	0.10291	-1.0636	10	0.59425	D	0.04	-9.1201	9.0629	0.36444	0.1676:0.0:0.8324:0.0	.	125;158	Q8TCI5-3;Q8TCI5	.;PIFO_HUMAN	L	158;125	ENSP00000358753:V158L;ENSP00000358752:V125L	ENSP00000358752:V125L	V	+	1	0	C1orf88	111694333	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	0.808000	0.27154	0.840000	0.34995	0.655000	0.94253	GTT		0.413	PIFO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030718.1	NM_181643		24	101	0	0	0	0.00278	0	24	101				
TBX15	6913	broad.mit.edu	37	1	119427921	119427921	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:119427921C>A	ENST00000369429.3	-	8	1252	c.1243G>T	c.(1243-1245)Ggg>Tgg	p.G415W	TBX15_ENST00000207157.3_Missense_Mutation_p.G309W			Q96SF7	TBX15_HUMAN	T-box 15	415					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		TCACTCAGCCCTGGGTAGCTC	0.537																																							uc001ehl.1		NA																	0				large_intestine(1)|pancreas(1)	2						c.(925-927)GGG>TGG		T-box 15							47.0	45.0	46.0					1																	119427921		2203	4300	6503	SO:0001583	missense	6913					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:119427921C>A	AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.1243G>T	1.37:g.119427921C>A	ENSP00000358437:p.Gly415Trp		Somatic				TBX15_uc009whj.1_Missense_Mutation_p.G133W	p.G309W	NM_152380	NP_689593	WXS	Illumina HiSeq	Unspecified	Q96SF7	TBX15_HUMAN		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)	8	1240	-	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)	415					Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	ENST00000369429.3	37	c.925G>T		.	.	.	.	.	.	.	.	.	.	C	16.96	3.266007	0.59540	.	.	ENSG00000092607	ENST00000344218;ENST00000207157;ENST00000369429;ENST00000449873;ENST00000393149	D;D;T	0.88124	-2.34;-2.22;-1.15	5.31	5.31	0.75309	.	0.055469	0.64402	D	0.000001	D	0.89079	0.6613	L	0.36672	1.1	0.58432	D	0.999999	D;D	0.76494	0.999;0.996	D;D	0.74023	0.982;0.924	D	0.88642	0.3176	10	0.49607	T	0.09	.	19.1626	0.93539	0.0:1.0:0.0:0.0	.	212;415	E9PCG3;Q96SF7	.;TBX15_HUMAN	W	212;309;415;143;142	ENSP00000207157:G309W;ENSP00000358437:G415W;ENSP00000398625:G143W	ENSP00000207157:G309W	G	-	1	0	TBX15	119229444	0.999000	0.42202	0.992000	0.48379	0.995000	0.86356	4.334000	0.59291	2.768000	0.95171	0.561000	0.74099	GGG		0.537	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000034351.1	NM_152380		19	32	1	0	1.56452e-12	0.007413	2.30351e-12	19	32				
LCE1B	353132	broad.mit.edu	37	1	152785055	152785055	+	Missense_Mutation	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:152785055A>G	ENST00000360090.3	+	1	609	c.133A>G	c.(133-135)Agt>Ggt	p.S45G		NM_178349.1	NP_848126.1	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	45					keratinization (GO:0031424)					breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|skin(2)	18	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCCTGCTGCAGTGTCAGCTC	0.647																																							uc001faq.2		NA																	0					0						c.(133-135)AGT>GGT		late cornified envelope 1B							83.0	87.0	86.0					1																	152785055		2203	4300	6503	SO:0001583	missense	353132				keratinization			g.chr1:152785055A>G	BI670515	CCDS1027.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000196734	ENSG00000196734		"""Late cornified envelopes"""	16611	protein-coding gene	gene with protein product		612604	"""small proline rich-like (epidermal differentiation complex) 2A"""	SPRL2A		11698679	Standard	NM_178349		Approved	LEP2	uc001faq.3	Q5T7P3	OTTHUMG00000014402	ENST00000360090.3:c.133A>G	1.37:g.152785055A>G	ENSP00000353203:p.Ser45Gly		Somatic					p.S45G	NM_178349	NP_848126	WXS	Illumina HiSeq	Unspecified	Q5T7P3	LCE1B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		1	609	+	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		45					A4IF40	Missense_Mutation	SNP	ENST00000360090.3	37	c.133A>G	CCDS1027.1	.	.	.	.	.	.	.	.	.	.	A	8.832	0.940225	0.18281	.	.	ENSG00000196734	ENST00000360090;ENST00000439693	T	0.03689	3.84	4.26	-0.754	0.11065	.	0.520434	0.16245	N	0.222965	T	0.00637	0.0021	N	0.05124	-0.11	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47235	-0.9133	10	0.87932	D	0	.	7.2676	0.26237	0.5463:0.0:0.4537:0.0	.	45	Q5T7P3	LCE1B_HUMAN	G	45	ENSP00000353203:S45G	ENSP00000353203:S45G	S	+	1	0	LCE1B	151051679	0.001000	0.12720	0.003000	0.11579	0.996000	0.88848	0.051000	0.14141	-0.033000	0.13736	0.528000	0.53228	AGT		0.647	LCE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040060.1	NM_178349		29	198	0	0	0	0.008361	0	29	198				
S100A8	6279	broad.mit.edu	37	1	153362715	153362715	+	Missense_Mutation	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:153362715T>C	ENST00000368733.3	-	3	315	c.146A>G	c.(145-147)aAg>aGg	p.K49R	S100A8_ENST00000368732.1_Missense_Mutation_p.K49R|S100A8_ENST00000477801.1_5'UTR	NM_002964.4	NP_002955.2	P05109	S10A8_HUMAN	S100 calcium binding protein A8	49	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|acute inflammatory response (GO:0002526)|autophagy (GO:0006914)|chemokine production (GO:0032602)|chronic inflammatory response (GO:0002544)|cytokine production (GO:0001816)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|neutrophil aggregation (GO:0070488)|neutrophil chemotaxis (GO:0030593)|positive regulation of cell growth (GO:0030307)|positive regulation of inflammatory response (GO:0050729)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of cytoskeleton organization (GO:0051493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to zinc ion (GO:0010043)|sequestering of zinc ion (GO:0032119)|wound healing (GO:0042060)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonic acid binding (GO:0050544)|calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|RAGE receptor binding (GO:0050786)|Toll-like receptor 4 binding (GO:0035662)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(1)|urinary_tract(1)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTCTGCACCCTTTTTCTGTCA	0.507																																							uc001fbs.2		NA																	0					0						c.(145-147)AAG>AGG		S100 calcium-binding protein A8							115.0	115.0	115.0					1																	153362715		2203	4300	6503	SO:0001583	missense	6279				chemotaxis	cytoplasm|cytoskeleton|plasma membrane	calcium ion binding|protein binding	g.chr1:153362715T>C	BC005928	CCDS1038.1	1q12-q22	2013-01-10	2006-09-11		ENSG00000143546	ENSG00000143546		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10498	protein-coding gene	gene with protein product		123885	"""S100 calcium-binding protein A8 (calgranulin A)"", ""S100 calcium binding protein A8 (calgranulin A)"""	CAGA, CFAG			Standard	NM_002964		Approved	P8, MRP8, 60B8AG, CGLA	uc001fbs.3	P05109	OTTHUMG00000013124	ENST00000368733.3:c.146A>G	1.37:g.153362715T>C	ENSP00000357722:p.Lys49Arg		Somatic					p.K49R	NM_002964	NP_002955	WXS	Illumina HiSeq	Unspecified	P05109	S10A8_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		3	201	-	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		49			EF-hand 2.		A8K5L3|D3DV37|Q5SY70|Q9UC84|Q9UC92|Q9UCJ0|Q9UCM6	Missense_Mutation	SNP	ENST00000368733.3	37	c.146A>G	CCDS1038.1	.	.	.	.	.	.	.	.	.	.	.	11.89	1.773606	0.31411	.	.	ENSG00000143546	ENST00000368733;ENST00000368732	T;T	0.07021	3.23;3.23	4.37	2.01	0.26516	EF-hand-like domain (1);	0.146302	0.64402	N	0.000011	T	0.01523	0.0049	.	.	.	0.09310	N	1	B	0.18741	0.03	B	0.17098	0.017	T	0.45877	-0.9231	9	0.36615	T	0.2	.	3.8238	0.08846	0.1858:0.1009:0.0:0.7134	.	49	P05109	S10A8_HUMAN	R	49	ENSP00000357722:K49R;ENSP00000357721:K49R	ENSP00000357721:K49R	K	-	2	0	S100A8	151629339	0.137000	0.22531	0.024000	0.17045	0.196000	0.23810	1.062000	0.30555	0.437000	0.26423	0.524000	0.50904	AAG		0.507	S100A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036791.1	NM_002964		4	169	0	0	0	0.000602	0	4	169				
SHC1	6464	broad.mit.edu	37	1	154942963	154942963	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:154942963G>A	ENST00000368445.5	-	1	254	c.40C>T	c.(40-42)Cgg>Tgg	p.R14W	SHC1_ENST00000368450.1_Intron|SHC1_ENST00000606391.1_Missense_Mutation_p.R14W|SHC1_ENST00000448116.2_Missense_Mutation_p.R14W|SHC1_ENST00000368449.4_5'UTR|SHC1_ENST00000368453.4_Intron	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	14					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GACTCATTCCGGAGTGGATTG	0.642																																					NSCLC(4;32 234 1864 2492 3259 13747 17376)	NSCLC(4;32 234 1864 2492 3259 13747 17376)	uc001ffv.2		NA																	0				lung(1)|skin(1)	2						c.(40-42)CGG>TGG		SHC-transforming protein 1 isoform 1							33.0	37.0	36.0					1																	154942963		2042	4038	6080	SO:0001583	missense	6464				activation of MAPK activity|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|positive regulation of DNA replication|Ras protein signal transduction|regulation of epidermal growth factor receptor activity|regulation of growth	cytosol|mitochondrial matrix|Shc-EGFR complex	epidermal growth factor receptor binding|insulin receptor binding|insulin-like growth factor receptor binding|phospholipid binding|protein binding|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr1:154942963G>A	U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.40C>T	1.37:g.154942963G>A	ENSP00000357430:p.Arg14Trp		Somatic				SHC1_uc001ffz.1_5'Flank|SHC1_uc001ffw.2_Missense_Mutation_p.R14W|SHC1_uc001ffx.2_Intron|SHC1_uc001ffy.2_Intron	p.R14W	NM_183001	NP_892113	WXS	Illumina HiSeq	Unspecified	P29353	SHC1_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		1	261	-	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		14					B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Missense_Mutation	SNP	ENST00000368445.5	37	c.40C>T	CCDS30881.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.257312	0.80246	.	.	ENSG00000160691	ENST00000368445;ENST00000448116;ENST00000368449	T;T;T	0.57907	0.37;0.37;2.5	4.27	4.27	0.50696	.	0.000000	0.64402	D	0.000002	T	0.66992	0.2846	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.985	T	0.71377	-0.4611	10	0.62326	D	0.03	-10.3233	16.8789	0.86058	0.0:0.0:1.0:0.0	.	14;14	P29353-6;P29353	.;SHC1_HUMAN	W	14	ENSP00000357430:R14W;ENSP00000401303:R14W;ENSP00000357434:R14W	ENSP00000357430:R14W	R	-	1	2	SHC1	153209587	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.439000	0.44846	2.371000	0.80710	0.555000	0.69702	CGG		0.642	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2	NM_183001		10	144	0	0	0	0.008291	0	10	144				
MROH9	80133	broad.mit.edu	37	1	170931105	170931105	+	Silent	SNP	A	A	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:170931105A>C	ENST00000367758.3	+	6	462	c.363A>C	c.(361-363)ctA>ctC	p.L121L	MROH9_ENST00000367759.4_Silent_p.L121L	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	121																	TCTACAAACTACAGATCTTAA	0.308																																							uc001ghg.2		NA																	0				pancreas(1)	1						c.(361-363)CTA>CTC		hypothetical protein LOC80133 isoform 2							40.0	39.0	39.0					1																	170931105		1806	4076	5882	SO:0001819	synonymous_variant	80133						binding	g.chr1:170931105A>C	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.363A>C	1.37:g.170931105A>C			Somatic				C1orf129_uc009wvy.2_5'UTR|C1orf129_uc010plz.1_Silent_p.L121L	p.L121L	NM_025063	NP_079339	WXS	Illumina HiSeq	Unspecified	Q5TGP6	CA129_HUMAN			6	493	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		121					A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Silent	SNP	ENST00000367758.3	37	c.363A>C	CCDS41436.1																																																																																				0.308	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063		4	16	0	0	0	0.000602	0	4	16				
CRB1	23418	broad.mit.edu	37	1	197396748	197396748	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:197396748G>T	ENST00000367400.3	+	7	2428	c.2293G>T	c.(2293-2295)Gtc>Ttc	p.V765F	CRB1_ENST00000367397.1_Missense_Mutation_p.V146F|CRB1_ENST00000544212.1_Missense_Mutation_p.V246F|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000543483.1_3'UTR|CRB1_ENST00000535699.1_Missense_Mutation_p.V696F|CRB1_ENST00000367399.2_Missense_Mutation_p.V653F	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	765	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ATATATCCGTGTCTGGCTAGA	0.428																																							uc001gtz.2		NA																	0				ovary(5)|skin(3)|large_intestine(1)	9						c.(2293-2295)GTC>TTC		crumbs homolog 1 precursor							60.0	57.0	58.0					1																	197396748		2203	4300	6503	SO:0001583	missense	23418				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding	g.chr1:197396748G>T		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2293G>T	1.37:g.197396748G>T	ENSP00000356370:p.Val765Phe		Somatic				CRB1_uc010poz.1_Missense_Mutation_p.V696F|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.V653F|CRB1_uc010ppb.1_Intron|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_Missense_Mutation_p.V246F|CRB1_uc001gub.1_Missense_Mutation_p.V414F	p.V765F	NM_201253	NP_957705	WXS	Illumina HiSeq	Unspecified	P82279	CRUM1_HUMAN			7	2428	+			765			Extracellular (Potential).|Laminin G-like 2.		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	c.2293G>T	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	11.60	1.688028	0.29962	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49	5.75	2.85	0.33270	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.88876	0.6556	M	0.86651	2.83	0.27640	N	0.947738	D;D;D;D	0.89917	1.0;1.0;0.977;1.0	D;D;P;D	0.91635	0.999;0.997;0.803;0.999	T	0.79001	-0.1981	9	0.56958	D	0.05	.	6.6453	0.22931	0.1954:0.1313:0.6733:0.0	.	696;653;414;765	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	F	696;765;653;246;146;414	ENSP00000438786:V696F;ENSP00000356370:V765F;ENSP00000356369:V653F;ENSP00000444556:V246F;ENSP00000356367:V146F	ENSP00000356367:V146F	V	+	1	0	CRB1	195663371	0.096000	0.21769	0.223000	0.23860	0.033000	0.12548	0.410000	0.21098	0.339000	0.23719	0.650000	0.86243	GTC		0.428	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		10	25	1	0	9.70103e-10	0.008291	1.33727e-09	10	25				
PKP1	5317	broad.mit.edu	37	1	201291167	201291167	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:201291167C>A	ENST00000352845.3	+	9	1472	c.1472C>A	c.(1471-1473)cCc>cAc	p.P491H	PKP1_ENST00000263946.3_Missense_Mutation_p.P491H|PKP1_ENST00000367324.3_Missense_Mutation_p.P470H			Q13835	PKP1_HUMAN	plakophilin 1	491					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						GCCGAGGTGCCCACCCGCTAC	0.607																																							uc001gwd.2		NA																	0				ovary(2)	2						c.(1471-1473)CCC>CAC		plakophilin 1 isoform 1b							124.0	97.0	106.0					1																	201291167		2203	4300	6503	SO:0001583	missense	5317				cell adhesion|cellular component disassembly involved in apoptosis|multicellular organismal development	desmosome|intermediate filament|nucleus	intermediate filament binding|signal transducer activity|structural constituent of epidermis	g.chr1:201291167C>A	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.1472C>A	1.37:g.201291167C>A	ENSP00000295597:p.Pro491His		Somatic				PKP1_uc001gwe.2_Missense_Mutation_p.P470H|PKP1_uc009wzm.2_Missense_Mutation_p.P78H	p.P491H	NM_000299	NP_000290	WXS	Illumina HiSeq	Unspecified	Q13835	PKP1_HUMAN			9	1723	+			491					O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	37	c.1472C>A	CCDS30966.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722497	0.89298	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.79554	-1.28;-1.28;-1.28	5.16	5.16	0.70880	Armadillo-like helical (1);Armadillo-type fold (1);	0.051237	0.85682	D	0.000000	D	0.90263	0.6955	M	0.82823	2.61	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.985;0.996;0.996	D	0.91717	0.5386	10	0.87932	D	0	0.7998	16.4457	0.83928	0.0:1.0:0.0:0.0	.	78;470;491	Q14BN3;Q13835-2;Q13835	.;.;PKP1_HUMAN	H	470;491;491	ENSP00000356293:P470H;ENSP00000263946:P491H;ENSP00000295597:P491H	ENSP00000263946:P491H	P	+	2	0	PKP1	199557790	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.655000	0.61476	2.397000	0.81536	0.655000	0.94253	CCC		0.607	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299		16	39	1	0	0.00316338	0.003163	0.00340975	16	39				
OPTC	26254	broad.mit.edu	37	1	203472092	203472092	+	Silent	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:203472092T>C	ENST00000367222.2	+	6	899	c.783T>C	c.(781-783)tcT>tcC	p.S261S		NM_014359.3	NP_055174.1	Q9UBM4	OPT_HUMAN	opticin	261					negative regulation of angiogenesis (GO:0016525)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			breast(1)|cervix(1)|kidney(5)|large_intestine(3)|lung(8)|pancreas(1)|stomach(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.109)			TGCTGGATTCTATCCCGGGGC	0.557																																							uc001gzu.1		NA																	0					0						c.(781-783)TCT>TCC		opticin precursor							68.0	72.0	70.0					1																	203472092		2203	4300	6503	SO:0001819	synonymous_variant	26254					proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr1:203472092T>C	AF161702	CCDS1439.1	1q31	2008-02-05			ENSG00000188770	ENSG00000188770			8158	protein-coding gene	gene with protein product	"""oculoglycan"""	605127				10636917	Standard	NM_014359		Approved		uc001gzu.1	Q9UBM4	OTTHUMG00000036100	ENST00000367222.2:c.783T>C	1.37:g.203472092T>C			Somatic					p.S261S	NM_014359	NP_055174	WXS	Illumina HiSeq	Unspecified	Q9UBM4	OPT_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		6	899	+			261			LRR 4.		Q5T2G4	Silent	SNP	ENST00000367222.2	37	c.783T>C	CCDS1439.1																																																																																				0.557	OPTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087964.1	NM_014359		12	47	0	0	0	0.000978	0	12	47				
NFASC	23114	broad.mit.edu	37	1	204948500	204948500	+	Silent	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:204948500C>T	ENST00000401399.1	+	18	2188	c.1989C>T	c.(1987-1989)gtC>gtT	p.V663V	NFASC_ENST00000404076.1_Silent_p.V642V|NFASC_ENST00000367171.4_Silent_p.V648V|NFASC_ENST00000338515.6_Silent_p.V663V|NFASC_ENST00000367169.4_Silent_p.V663V|NFASC_ENST00000513543.1_Silent_p.V659V|NFASC_ENST00000360049.4_Silent_p.V659V|NFASC_ENST00000404907.1_Silent_p.V659V|NFASC_ENST00000367172.4_Silent_p.V663V|NFASC_ENST00000539706.1_Silent_p.V659V|NFASC_ENST00000338586.6_Silent_p.V663V|NFASC_ENST00000339876.6_Silent_p.V663V|NFASC_ENST00000367170.4_Silent_p.V663V			O94856	NFASC_HUMAN	neurofascin	663	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ACTACGTCGTCCAGTTTGAAG	0.522																																							uc001hbj.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(1987-1989)GTC>GTT		neurofascin isoform 1 precursor							96.0	94.0	95.0					1																	204948500		2203	4300	6503	SO:0001819	synonymous_variant	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204948500C>T	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1989C>T	1.37:g.204948500C>T			Somatic				NFASC_uc010pra.1_Silent_p.V659V|NFASC_uc001hbi.2_Silent_p.V659V|NFASC_uc010prb.1_Silent_p.V674V|NFASC_uc010prc.1_Silent_p.V230V|NFASC_uc001hbk.1_Silent_p.V469V|NFASC_uc001hbl.1_5'Flank	p.V663V	NM_001005388	NP_001005388	WXS	Illumina HiSeq	Unspecified	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		19	2317	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		663			Extracellular (Potential).|Fibronectin type-III 1.		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Silent	SNP	ENST00000401399.1	37	c.1989C>T	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	C	5.639	0.302548	0.10678	.	.	ENSG00000163531	ENST00000367173	.	.	.	5.17	1.98	0.26296	.	.	.	.	.	T	0.46541	0.1398	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28332	-1.0047	4	.	.	.	.	4.1933	0.10431	0.251:0.43:0.246:0.073	.	.	.	.	F	633	.	.	S	+	2	0	NFASC	203215123	0.045000	0.20229	0.893000	0.35052	0.515000	0.34225	-0.651000	0.05372	0.508000	0.28173	0.655000	0.94253	TCC		0.522	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388		40	68	0	0	0	0.006999	0	40	68				
KCNH1	3756	broad.mit.edu	37	1	210857201	210857201	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:210857201C>T	ENST00000271751.4	-	11	2419	c.2392G>A	c.(2392-2394)Gta>Ata	p.V798I	KCNH1_ENST00000367007.4_Missense_Mutation_p.V771I			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	798					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TGGAAGGATACGGGCGTGGCA	0.662																																							uc001hib.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(2392-2394)GTA>ATA		potassium voltage-gated channel, subfamily H,							56.0	55.0	55.0					1																	210857201		2203	4300	6503	SO:0001583	missense	3756				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity	g.chr1:210857201C>T	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2392G>A	1.37:g.210857201C>T	ENSP00000271751:p.Val798Ile		Somatic				KCNH1_uc001hic.2_Missense_Mutation_p.V771I	p.V798I	NM_172362	NP_758872	WXS	Illumina HiSeq	Unspecified	O95259	KCNH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)	11	2562	-			798			Cytoplasmic (Potential).		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	c.2392G>A	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	C	3.747	-0.052353	0.07362	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98835	-5.13;-5.17	4.57	2.65	0.31530	.	0.364252	0.27778	N	0.017892	D	0.94863	0.8340	L	0.38531	1.155	0.22648	N	0.998895	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	D	0.86181	0.1606	10	0.16420	T	0.52	.	4.4066	0.11413	0.1604:0.5904:0.0:0.2492	.	771;798	Q14CL3;O95259	.;KCNH1_HUMAN	I	798;771	ENSP00000271751:V798I;ENSP00000355974:V771I	ENSP00000271751:V798I	V	-	1	0	KCNH1	208923824	0.156000	0.22821	0.983000	0.44433	0.437000	0.31866	0.846000	0.27682	0.902000	0.36520	0.561000	0.74099	GTA		0.662	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238		12	123	0	0	0	0.001368	0	12	123				
KCNK2	3776	broad.mit.edu	37	1	215342574	215342574	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:215342574G>A	ENST00000444842.2	+	4	658	c.508G>A	c.(508-510)Ggc>Agc	p.G170S	KCNK2_ENST00000391894.2_Missense_Mutation_p.G155S|KCNK2_ENST00000391895.2_Missense_Mutation_p.G166S	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	170					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	CACAGAAGGCGGCAAAATATT	0.363																																							uc001hkq.2		NA																	0					0						c.(508-510)GGC>AGC		potassium channel, subfamily K, member 2 isoform	Dofetilide(DB00204)						151.0	155.0	154.0					1																	215342574		2203	4300	6503	SO:0001583	missense	3776						outward rectifier potassium channel activity	g.chr1:215342574G>A	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.508G>A	1.37:g.215342574G>A	ENSP00000394033:p.Gly170Ser		Somatic				KCNK2_uc001hko.2_Missense_Mutation_p.G166S|KCNK2_uc009xdm.2_RNA|KCNK2_uc001hkp.2_RNA|KCNK2_uc010pua.1_RNA|KCNK2_uc001hkr.3_Missense_Mutation_p.G155S	p.G170S	NM_001017425	NP_001017425	WXS	Illumina HiSeq	Unspecified	O95069	KCNK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	4	677	+			170					A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	c.508G>A	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	G	36	5.613267	0.96637	.	.	ENSG00000082482	ENST00000391895;ENST00000478774;ENST00000391894;ENST00000444842;ENST00000457122	T;T;T;T;T	0.41400	1.33;1.0;1.33;1.33;1.33	6.16	6.16	0.99307	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.73729	0.3624	M	0.89534	3.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.76534	-0.2924	10	0.66056	D	0.02	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	155;170;166	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	S	166;114;155;170;114	ENSP00000375765:G166S;ENSP00000420569:G114S;ENSP00000375764:G155S;ENSP00000394033:G170S;ENSP00000413460:G114S	ENSP00000375764:G155S	G	+	1	0	KCNK2	213409197	1.000000	0.71417	0.460000	0.27093	0.934000	0.57294	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	GGC		0.363	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217		6	44	0	0	0	0.001168	0	6	44				
USH2A	7399	broad.mit.edu	37	1	215813954	215813954	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:215813954G>T	ENST00000307340.3	-	68	15300	c.14914C>A	c.(14914-14916)Cgc>Agc	p.R4972S	USH2A_ENST00000366943.2_Missense_Mutation_p.R4972S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4972					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGTACACGCGTCGCCCTCCG	0.542										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(14914-14916)CGC>AGC		usherin isoform B							135.0	102.0	113.0					1																	215813954		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215813954G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.14914C>A	1.37:g.215813954G>T	ENSP00000305941:p.Arg4972Ser	HNSCC(13;0.011)	Somatic					p.R4972S	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	68	15301	-			4972			Fibronectin type-III 35.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.14914C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.763241	0.49574	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.12465	2.69;2.68	5.6	4.67	0.58626	Fibronectin, type III (1);	0.000000	0.40064	U	0.001190	T	0.32255	0.0823	M	0.73598	2.24	0.49687	D	0.999817	D	0.69078	0.997	P	0.60173	0.87	T	0.09143	-1.0688	10	0.23302	T	0.38	.	15.389	0.74726	0.0:0.0:0.8555:0.1444	.	4972	O75445	USH2A_HUMAN	S	4972	ENSP00000305941:R4972S;ENSP00000355910:R4972S	ENSP00000305941:R4972S	R	-	1	0	USH2A	213880577	1.000000	0.71417	0.022000	0.16811	0.011000	0.07611	2.743000	0.47442	1.300000	0.44818	0.591000	0.81541	CGC		0.542	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		13	38	1	0	7.03913e-09	0.001368	9.40362e-09	13	38				
CDC42BPA	8476	broad.mit.edu	37	1	227268619	227268619	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:227268619C>A	ENST00000366769.3	-	17	3746	c.2455G>T	c.(2455-2457)Gcc>Tcc	p.A819S	CDC42BPA_ENST00000488131.1_5'UTR|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.A819S|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.A738S|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.A819S|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.A819S|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.A819S|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.A819S	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				GTGATTTGGGCTTCCCAATGT	0.388																																							uc001hqr.2		NA																	0				lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11						c.(2455-2457)GCC>TCC		CDC42-binding protein kinase alpha isoform B							227.0	211.0	216.0					1																	227268619		2203	4300	6503	SO:0001583	missense	8476				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr1:227268619C>A	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2455G>T	1.37:g.227268619C>A	ENSP00000355731:p.Ala819Ser		Somatic				CDC42BPA_uc001hqq.2_Missense_Mutation_p.A83S|CDC42BPA_uc001hqs.2_Missense_Mutation_p.A738S|CDC42BPA_uc009xes.2_Missense_Mutation_p.A819S|CDC42BPA_uc010pvs.1_Missense_Mutation_p.A819S|CDC42BPA_uc001hqp.2_5'UTR|CDC42BPA_uc001hqu.1_5'UTR	p.A819S	NM_003607	NP_003598	WXS	Illumina HiSeq	Unspecified	Q5VT25	MRCKA_HUMAN			17	3398	-		all_cancers(173;0.156)|Prostate(94;0.0792)	819			Potential.			Missense_Mutation	SNP	ENST00000366769.3	37	c.2455G>T	CCDS1558.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.170894|5.170894	0.94807|0.94807	.|.	.|.	ENSG00000143776|ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000366762;ENST00000535525;ENST00000366765|ENST00000448940;ENST00000442054	T;T;T;T;T;T;T|.	0.44083|.	0.93;0.93;0.93;0.93;0.93;0.93;0.93|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.107348|.	0.64402|.	D|.	0.000006|.	T|T	0.74313|0.74313	0.3700|0.3700	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D;P;D;P;D|.	0.76494|.	0.999;0.849;0.998;0.911;0.959|.	D;B;D;P;P|.	0.87578|.	0.997;0.382;0.998;0.55;0.749|.	T|T	0.72067|0.72067	-0.4402|-0.4402	10|5	0.31617|.	T|.	0.26|.	.|.	19.3599|19.3599	0.94432|0.94432	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	819;819;738;819;819|.	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5;Q5VT25-2|.	.;.;.;.;.|.	S|I	819;738;819;819;819;83;819;819|21;112	ENSP00000355731:A819S;ENSP00000355729:A738S;ENSP00000335341:A819S;ENSP00000355728:A819S;ENSP00000355726:A819S;ENSP00000443275:A819S;ENSP00000355727:A819S|.	ENSP00000335341:A819S|.	A|S	-|-	1|2	0|0	CDC42BPA|CDC42BPA	225335242|225335242	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.469000|7.469000	0.80959|0.80959	2.569000|2.569000	0.86673|0.86673	0.591000|0.591000	0.81541|0.81541	GCC|AGC		0.388	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826		14	139	1	0	4.36969e-10	0.001855	6.07194e-10	14	139				
CDC42BPA	8476	broad.mit.edu	37	1	227348297	227348297	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:227348297G>C	ENST00000366769.3	-	6	1931	c.640C>G	c.(640-642)Cat>Gat	p.H214D	CDC42BPA_ENST00000535525.1_Missense_Mutation_p.H214D|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.H214D|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.H214D|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.H214D|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.H214D|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.H214D	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)									p.H214Y(3)		NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				AACCGAATATGTCCATTCATA	0.299																																							uc001hqr.2		NA																	3	Substitution - Missense(3)		prostate(3)	lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11						c.(640-642)CAT>GAT		CDC42-binding protein kinase alpha isoform B							137.0	143.0	141.0					1																	227348297		2203	4300	6503	SO:0001583	missense	8476				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr1:227348297G>C	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.640C>G	1.37:g.227348297G>C	ENSP00000355731:p.His214Asp		Somatic				CDC42BPA_uc001hqs.2_Missense_Mutation_p.H214D|CDC42BPA_uc009xes.2_Missense_Mutation_p.H214D|CDC42BPA_uc010pvs.1_Missense_Mutation_p.H214D	p.H214D	NM_003607	NP_003598	WXS	Illumina HiSeq	Unspecified	Q5VT25	MRCKA_HUMAN			6	1583	-		all_cancers(173;0.156)|Prostate(94;0.0792)	214			Protein kinase.			Missense_Mutation	SNP	ENST00000366769.3	37	c.640C>G	CCDS1558.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.683685	0.88639	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	T;T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.79563	0.4467	M	0.76002	2.32	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.82224	-0.0563	10	0.87932	D	0	.	17.4674	0.87637	0.0:0.0:1.0:0.0	.	214;214;214;214	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5	.;.;.;.	D	214	ENSP00000355731:H214D;ENSP00000355729:H214D;ENSP00000335341:H214D;ENSP00000355728:H214D;ENSP00000355726:H214D;ENSP00000443275:H214D;ENSP00000355727:H214D	ENSP00000335341:H214D	H	-	1	0	CDC42BPA	225414920	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.035000	0.93752	2.394000	0.81467	0.585000	0.79938	CAT		0.299	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826		71	56	0	0	0	0.00361	0	71	56				
SIPA1L2	57568	broad.mit.edu	37	1	232534943	232534943	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:232534943G>T	ENST00000366630.1	-	22	5457	c.5099C>A	c.(5098-5100)tCc>tAc	p.S1700Y	SIPA1L2_ENST00000308942.4_Missense_Mutation_p.S756Y|SIPA1L2_ENST00000262861.4_Missense_Mutation_p.S1700Y			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1700					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CGCGGTCTGGGACTCCTCCTG	0.502																																							uc001hvg.2		NA																	0				ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6						c.(5098-5100)TCC>TAC		signal-induced proliferation-associated 1 like							122.0	122.0	122.0					1																	232534943		2096	4257	6353	SO:0001583	missense	57568				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr1:232534943G>T	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.5099C>A	1.37:g.232534943G>T	ENSP00000355589:p.Ser1700Tyr		Somatic				SIPA1L2_uc001hvf.2_Missense_Mutation_p.S756Y	p.S1700Y	NM_020808	NP_065859	WXS	Illumina HiSeq	Unspecified	Q9P2F8	SI1L2_HUMAN			21	5257	-		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)	1700			Potential.		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	c.5099C>A	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989908	0.74589	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	D;D;T	0.87650	-2.28;-2.28;1.58	4.99	4.99	0.66335	.	0.134244	0.50627	D	0.000118	D	0.94208	0.8141	M	0.85197	2.74	0.42605	D	0.993294	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	D	0.95057	0.8192	10	0.87932	D	0	-21.2895	18.4596	0.90734	0.0:0.0:1.0:0.0	.	1700;756	Q9P2F8;Q9P2F8-2	SI1L2_HUMAN;.	Y	1700;1700;756	ENSP00000355589:S1700Y;ENSP00000262861:S1700Y;ENSP00000309102:S756Y	ENSP00000262861:S1700Y	S	-	2	0	SIPA1L2	230601566	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	5.946000	0.70234	2.594000	0.87642	0.460000	0.39030	TCC		0.502	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		4	44	1	0	0.000602214	0.000602	0.000665707	4	44				
RYR2	6262	broad.mit.edu	37	1	237995907	237995907	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:237995907G>T	ENST00000366574.2	+	105	15181	c.14864G>T	c.(14863-14865)gGg>gTg	p.G4955V	RYR2_ENST00000360064.6_Missense_Mutation_p.G4961V|RYR2_ENST00000542537.1_Missense_Mutation_p.G4939V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4955					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTCCCAGCAGGGGATTGCTTC	0.413																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(14863-14865)GGG>GTG		cardiac muscle ryanodine receptor							83.0	80.0	81.0					1																	237995907		1856	4128	5984	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237995907G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14864G>T	1.37:g.237995907G>T	ENSP00000355533:p.Gly4955Val		Somatic				RYR2_uc010pyb.1_3'UTR	p.G4955V	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		105	14984	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4955					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.14864G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047256	0.75846	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97186	-4.28;-4.25;-4.28	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000019	D	0.98745	0.9578	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99624	1.0984	10	0.87932	D	0	-15.1175	18.8364	0.92164	0.0:0.0:1.0:0.0	.	4955	Q92736	RYR2_HUMAN	V	4955;4961;4939	ENSP00000355533:G4955V;ENSP00000353174:G4961V;ENSP00000443798:G4939V	ENSP00000353174:G4961V	G	+	2	0	RYR2	236062530	1.000000	0.71417	0.972000	0.41901	0.982000	0.71751	9.208000	0.95075	2.677000	0.91161	0.655000	0.94253	GGG		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		6	16	1	0	0.00116845	0.001168	0.00127534	6	16				
WDR64	128025	broad.mit.edu	37	1	241901781	241901781	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:241901781G>C	ENST00000366552.2	+	10	1488	c.1281G>C	c.(1279-1281)atG>atC	p.M427I	WDR64_ENST00000437684.2_Missense_Mutation_p.M427I	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	427										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			ATCATGGCATGCTTATTACGG	0.368																																							uc001hze.1		NA																	0				skin(1)	1						c.(1279-1281)ATG>ATC		RecName: Full=WD repeat-containing protein 64;							103.0	95.0	98.0					1																	241901781		2203	4300	6503	SO:0001583	missense	128025							g.chr1:241901781G>C	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1281G>C	1.37:g.241901781G>C	ENSP00000355510:p.Met427Ile		Somatic				WDR64_uc001hzf.1_Missense_Mutation_p.M147I	p.M427I			WXS	Illumina HiSeq	Unspecified	B1ANS9	WDR64_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0116)		10	1488	+	Ovarian(103;0.103)	all_cancers(173;0.0121)	427			WD 5.		B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	37	c.1281G>C		.	.	.	.	.	.	.	.	.	.	G	12.14	1.849712	0.32699	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.38722	1.68;1.12;1.18	6.07	6.07	0.98685	.	0.290613	0.35739	N	0.003011	T	0.22704	0.0548	N	0.08118	0	0.36142	D	0.846833	B	0.19817	0.039	B	0.15870	0.014	T	0.25676	-1.0125	10	0.22109	T	0.4	-21.8672	11.4873	0.50361	0.081:0.0:0.919:0.0	.	147	D1MPS4	.	I	427;427;198	ENSP00000355510:M427I;ENSP00000402446:M427I;ENSP00000406656:M198I	ENSP00000355510:M427I	M	+	3	0	WDR64	239968404	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	2.061000	0.41403	2.885000	0.99019	0.655000	0.94253	ATG		0.368	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625		7	22	0	0	0	0.001984	0	7	22				
WDR64	128025	broad.mit.edu	37	1	241904880	241904880	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:241904880C>A	ENST00000366552.2	+	11	1561	c.1354C>A	c.(1354-1356)Cac>Aac	p.H452N	WDR64_ENST00000437684.2_Missense_Mutation_p.H452N	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	452										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			ACAGGTTCCTCACACTCATGA	0.343																																							uc001hze.1		NA																	0				skin(1)	1						c.(1354-1356)CAC>AAC		RecName: Full=WD repeat-containing protein 64;							140.0	127.0	132.0					1																	241904880		2203	4300	6503	SO:0001583	missense	128025							g.chr1:241904880C>A	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1354C>A	1.37:g.241904880C>A	ENSP00000355510:p.His452Asn		Somatic				WDR64_uc001hzf.1_Missense_Mutation_p.H172N	p.H452N			WXS	Illumina HiSeq	Unspecified	B1ANS9	WDR64_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0116)		11	1561	+	Ovarian(103;0.103)	all_cancers(173;0.0121)	452					B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	37	c.1354C>A		.	.	.	.	.	.	.	.	.	.	C	19.83	3.899783	0.72754	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.40476	1.03;1.1;1.03	5.49	5.49	0.81192	.	0.267685	0.32386	N	0.006161	T	0.43700	0.1259	L	0.43152	1.355	0.36665	D	0.878153	P	0.51791	0.948	P	0.48738	0.588	T	0.39981	-0.9587	10	0.20519	T	0.43	-14.3377	16.2874	0.82727	0.0:1.0:0.0:0.0	.	172	D1MPS4	.	N	452;452;223	ENSP00000355510:H452N;ENSP00000402446:H452N;ENSP00000406656:H223N	ENSP00000355510:H452N	H	+	1	0	WDR64	239971503	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.105000	0.41825	2.584000	0.87258	0.655000	0.94253	CAC		0.343	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625		11	20	1	0	0.00829132	0.008291	0.00879999	11	20				
WDR64	128025	broad.mit.edu	37	1	241907716	241907716	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:241907716C>A	ENST00000366552.2	+	12	1669	c.1462C>A	c.(1462-1464)Ctc>Atc	p.L488I	WDR64_ENST00000437684.2_Missense_Mutation_p.L488I	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	488										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CGAGACTGGGCTCCAAGTATA	0.398																																							uc001hze.1		NA																	0				skin(1)	1						c.(1462-1464)CTC>ATC		RecName: Full=WD repeat-containing protein 64;							108.0	107.0	107.0					1																	241907716		2203	4300	6503	SO:0001583	missense	128025							g.chr1:241907716C>A	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1462C>A	1.37:g.241907716C>A	ENSP00000355510:p.Leu488Ile		Somatic				WDR64_uc001hzf.1_Missense_Mutation_p.L208I	p.L488I			WXS	Illumina HiSeq	Unspecified	B1ANS9	WDR64_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0116)		12	1669	+	Ovarian(103;0.103)	all_cancers(173;0.0121)	488			WD 6.		B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	37	c.1462C>A		.	.	.	.	.	.	.	.	.	.	C	16.13	3.036301	0.54896	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.43688	0.94;0.94;0.94	6.08	4.12	0.48240	.	0.653202	0.14815	N	0.296826	T	0.22085	0.0532	N	0.08118	0	0.28262	N	0.924799	B	0.12630	0.006	B	0.08055	0.003	T	0.13791	-1.0496	10	0.36615	T	0.2	-9.7901	7.6697	0.28451	0.1609:0.7515:0.0:0.0876	.	208	D1MPS4	.	I	488;488;259	ENSP00000355510:L488I;ENSP00000402446:L488I;ENSP00000406656:L259I	ENSP00000355510:L488I	L	+	1	0	WDR64	239974339	0.040000	0.19996	0.995000	0.50966	0.950000	0.60333	0.133000	0.15912	0.806000	0.34183	0.655000	0.94253	CTC		0.398	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625		12	41	1	0	5.50884e-06	0.001368	6.64132e-06	12	41				
OR2C3	81472	broad.mit.edu	37	1	247695565	247695565	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr1:247695565C>A	ENST00000366487.3	-	2	610	c.249G>T	c.(247-249)ctG>ctT	p.L83L	GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000463359.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			AGAGGTTAGCCAGGAGCTGTG	0.542																																							uc009xgy.2		NA																	0				ovary(1)|skin(1)	2						c.(247-249)CTG>CTT		olfactory receptor, family 2, subfamily C,							106.0	100.0	102.0					1																	247695565		2203	4300	6503	SO:0001819	synonymous_variant	81472				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247695565C>A	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.249G>T	1.37:g.247695565C>A			Somatic				C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	p.L83L	NM_198074	NP_932340	WXS	Illumina HiSeq	Unspecified	Q8N628	OR2C3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0241)		2	611	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	83			Extracellular (Potential).		Q5JQS4|Q6IEZ1|Q8NGW7	Silent	SNP	ENST00000366487.3	37	c.249G>T	CCDS1634.2																																																																																				0.542	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074		15	39	1	0	2.32078e-09	0.003163	3.16138e-09	15	39				
ITIH5	80760	broad.mit.edu	37	10	7621754	7621754	+	Missense_Mutation	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:7621754A>T	ENST00000256861.6	-	9	1460	c.1382T>A	c.(1381-1383)gTg>gAg	p.V461E	ITIH5_ENST00000397145.2_Missense_Mutation_p.V461E|ITIH5_ENST00000446830.2_Missense_Mutation_p.V243E|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000298441.6_Missense_Mutation_p.V247E|ITIH5_ENST00000397146.2_Missense_Mutation_p.V461E	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	461	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CTCCTCGTGCACGCGCCGTGT	0.622																																							uc001ijq.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(1381-1383)GTG>GAG		inter-alpha trypsin inhibitor heavy chain							99.0	91.0	94.0					10																	7621754		2203	4300	6503	SO:0001583	missense	80760				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7621754A>T			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1382T>A	10.37:g.7621754A>T	ENSP00000256861:p.Val461Glu		Somatic				ITIH5_uc001ijp.2_Missense_Mutation_p.V247E|ITIH5_uc001ijr.1_Missense_Mutation_p.V461E	p.V461E	NM_030569	NP_085046	WXS	Illumina HiSeq	Unspecified	Q86UX2	ITIH5_HUMAN			9	1461	-			461			VWFA.		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37	c.1382T>A		.	.	.	.	.	.	.	.	.	.	A	22.2	4.262951	0.80358	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	5.2	5.2	0.72013	von Willebrand factor, type A (2);	0.178945	0.48767	D	0.000180	D	0.87184	0.6114	.	.	.	0.21184	N	0.999766	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.72338	0.977;0.958;0.929	T	0.81311	-0.0990	9	0.87932	D	0	-24.0651	15.0399	0.71781	1.0:0.0:0.0:0.0	.	461;461;247	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	E	461;461;247;243;461	ENSP00000256861:V461E;ENSP00000380333:V461E;ENSP00000298441:V247E;ENSP00000387969:V243E;ENSP00000380332:V461E	ENSP00000256861:V461E	V	-	2	0	ITIH5	7661760	0.997000	0.39634	0.012000	0.15200	0.084000	0.17831	8.651000	0.91078	1.960000	0.56953	0.379000	0.24179	GTG		0.622	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		13	95	0	0	0	0.001855	0	13	95				
SLC39A12	221074	broad.mit.edu	37	10	18250582	18250582	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:18250582C>G	ENST00000377369.2	+	3	607	c.334C>G	c.(334-336)Cag>Gag	p.Q112E	SLC39A12_ENST00000377374.4_Missense_Mutation_p.Q112E|SLC39A12_ENST00000539911.1_5'UTR|SLC39A12_ENST00000377371.3_Missense_Mutation_p.Q112E	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	112					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						AGAAGTGGTCCAGAGAGTTTC	0.348																																							uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(334-336)CAG>GAG		solute carrier family 39 (zinc transporter),							96.0	101.0	99.0					10																	18250582		2203	4300	6503	SO:0001583	missense	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18250582C>G		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.334C>G	10.37:g.18250582C>G	ENSP00000366586:p.Gln112Glu		Somatic				SLC39A12_uc001ipn.2_Missense_Mutation_p.Q112E|SLC39A12_uc001ipp.2_Missense_Mutation_p.Q112E|SLC39A12_uc010qck.1_5'UTR	p.Q112E	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			3	607	+			112			Extracellular (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	c.334C>G	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037981	0.35989	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000425219	T;T;T	0.22336	1.96;1.96;1.96	5.43	5.43	0.79202	.	0.234704	0.38381	N	0.001703	T	0.25754	0.0627	L	0.56769	1.78	0.80722	D	1	B;B;B	0.25235	0.121;0.074;0.121	B;B;B	0.28784	0.094;0.043;0.094	T	0.02220	-1.1193	10	0.39692	T	0.17	-5.2651	15.8067	0.78520	0.0:0.8545:0.1455:0.0	.	112;112;112	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	E	112;112;112;32	ENSP00000366586:Q112E;ENSP00000366591:Q112E;ENSP00000366588:Q112E	ENSP00000366586:Q112E	Q	+	1	0	SLC39A12	18290588	1.000000	0.71417	0.978000	0.43139	0.920000	0.55202	3.904000	0.56325	2.537000	0.85549	0.650000	0.86243	CAG		0.348	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		25	51	0	0	0	0.003954	0	25	51				
ARMC3	219681	broad.mit.edu	37	10	23321943	23321943	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:23321943G>T	ENST00000298032.5	+	18	2484	c.2400G>T	c.(2398-2400)ttG>ttT	p.L800F	ARMC3_ENST00000376528.4_Missense_Mutation_p.L537F|ARMC3_ENST00000409983.3_Missense_Mutation_p.L793F	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	800						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ATCGAGCTTTGCTTTTCAAGG	0.363																																							uc001irm.3		NA																	0					0						c.(2398-2400)TTG>TTT		armadillo repeat containing 3							113.0	107.0	109.0					10																	23321943		2203	4300	6503	SO:0001583	missense	219681						binding	g.chr10:23321943G>T	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.2400G>T	10.37:g.23321943G>T	ENSP00000298032:p.Leu800Phe		Somatic				ARMC3_uc010qcv.1_Missense_Mutation_p.L793F|ARMC3_uc010qcw.1_Missense_Mutation_p.L537F	p.L800F	NM_173081	NP_775104	WXS	Illumina HiSeq	Unspecified	Q5W041	ARMC3_HUMAN			18	2483	+			800					A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	c.2400G>T	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.931542	0.52866	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376528	T;T;T	0.64803	-0.12;-0.12;1.1	5.47	3.62	0.41486	.	0.000000	0.64402	D	0.000003	T	0.81235	0.4780	M	0.92507	3.315	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.82265	-0.0543	10	0.87932	D	0	-15.5425	8.7611	0.34676	0.2886:0.0:0.7114:0.0	.	793;800	Q5W041-4;Q5W041	.;ARMC3_HUMAN	F	800;793;537	ENSP00000298032:L800F;ENSP00000386943:L793F;ENSP00000365711:L537F	ENSP00000298032:L800F	L	+	3	2	ARMC3	23361949	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	0.943000	0.29030	0.789000	0.33779	0.555000	0.69702	TTG		0.363	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081		5	53	1	0	0.00198382	0.001984	0.002145	5	53				
LRRC37A6P	387646	broad.mit.edu	37	10	27538184	27538184	+	lincRNA	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:27538184A>T	ENST00000574842.1	+	0	255				LRRC37A6P_ENST00000284414.4_RNA																							CCGTGGTTGGAGACGGTTTAA	0.532																																							uc001its.2		NA																	0					0						c.(1207-1209)TCT>TCA		SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;							122.0	101.0	108.0					10																	27538184		692	1591	2283			387646							g.chr10:27538184A>T																													10.37:g.27538184A>T			Somatic					p.S403S	NR_003525		WXS	Illumina HiSeq	Unspecified					1	3052	-									Silent	SNP	ENST00000574842.1	37	c.1209T>A																																																																																					0.532	RP11-85G18.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000436904.1			51	193	0	0	0	0.00361	0	51	193				
PTCHD3	374308	broad.mit.edu	37	10	27702213	27702213	+	Silent	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:27702213G>T	ENST00000438700.3	-	1	1084	c.967C>A	c.(967-969)Cgg>Agg	p.R323R		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	323					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.R323W(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TACAGCAGCCGCATGGCTTTG	0.562																																							uc001itu.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(967-969)CGG>AGG		patched domain containing 3							90.0	92.0	91.0					10																	27702213		2203	4300	6503	SO:0001819	synonymous_variant	374308				spermatid development	integral to membrane	hedgehog receptor activity	g.chr10:27702213G>T	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.967C>A	10.37:g.27702213G>T			Somatic					p.R323R	NM_001034842	NP_001030014	WXS	Illumina HiSeq	Unspecified	Q3KNS1	PTHD3_HUMAN			1	1085	-			323					I3L499|Q6ZU28	Silent	SNP	ENST00000438700.3	37	c.967C>A	CCDS31173.1																																																																																				0.562	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541		59	116	1	0	1.93748e-29	0.00361	3.1771e-29	59	116				
ITGB1	3688	broad.mit.edu	37	10	33217116	33217116	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:33217116C>A	ENST00000396033.2	-	5	588	c.453G>T	c.(451-453)ctG>ctT	p.L151L	ITGB1_ENST00000374956.4_Silent_p.L151L|ITGB1_ENST00000423113.1_Silent_p.L151L|ITGB1_ENST00000302278.3_Silent_p.L151L|ITGB1_ENST00000484088.1_Intron	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	151	VWFA.				axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	TTGAGTAAGACAGGTCCATAA	0.378																																							uc001iws.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(451-453)CTG>CTT		integrin beta 1 isoform 1A precursor							152.0	151.0	151.0					10																	33217116		2203	4300	6503	SO:0001819	synonymous_variant	3688				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity	g.chr10:33217116C>A	BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.453G>T	10.37:g.33217116C>A			Somatic				ITGB1_uc001iwp.3_Silent_p.L151L|ITGB1_uc001iwq.3_Silent_p.L151L|ITGB1_uc001iwr.3_Silent_p.L151L|ITGB1_uc001iwt.3_Silent_p.L151L|ITGB1_uc001iwu.1_Silent_p.L151L	p.L151L	NM_133376	NP_596867	WXS	Illumina HiSeq	Unspecified	P05556	ITB1_HUMAN			5	589	-		Ovarian(717;1.34e-05)|Breast(68;0.0634)	151			Extracellular (Potential).|VWFA.		A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Silent	SNP	ENST00000396033.2	37	c.453G>T	CCDS7174.1																																																																																				0.378	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1	NM_002211		15	102	1	0	0.000308642	0.003163	0.000344484	15	102				
GDF2	2658	broad.mit.edu	37	10	48413613	48413613	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:48413613C>T	ENST00000249598.1	-	2	1414	c.1255G>A	c.(1255-1257)Gag>Aag	p.E419K		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	419					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						CTCATGCCCTCGTAATGGTAC	0.617																																							uc001jfa.1		NA																	0				ovary(2)|skin(1)	3						c.(1255-1257)GAG>AAG		growth differentiation factor 2 precursor							61.0	54.0	56.0					10																	48413613		2203	4300	6503	SO:0001583	missense	2658				activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity	g.chr10:48413613C>T	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.1255G>A	10.37:g.48413613C>T	ENSP00000249598:p.Glu419Lys		Somatic					p.E419K	NM_016204	NP_057288	WXS	Illumina HiSeq	Unspecified	Q9UK05	GDF2_HUMAN			2	1418	-			419					Q5VSQ9|Q9Y571	Missense_Mutation	SNP	ENST00000249598.1	37	c.1255G>A	CCDS7219.1	.	.	.	.	.	.	.	.	.	.	C	33	5.261951	0.95368	.	.	ENSG00000128802	ENST00000249598	D	0.88896	-2.44	5.52	5.52	0.82312	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.92446	0.7602	L	0.46670	1.46	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90831	0.4716	10	0.32370	T	0.25	.	18.4124	0.90557	0.0:1.0:0.0:0.0	.	419	Q9UK05	GDF2_HUMAN	K	419	ENSP00000249598:E419K	ENSP00000249598:E419K	E	-	1	0	GDF2	48033619	1.000000	0.71417	0.993000	0.49108	0.961000	0.63080	7.696000	0.84270	2.605000	0.88082	0.585000	0.79938	GAG		0.617	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204		9	12	0	0	0	0.006214	0	9	12				
NEUROG3	50674	broad.mit.edu	37	10	71332454	71332454	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:71332454C>A	ENST00000242462.4	-	2	375	c.346G>T	c.(346-348)Gac>Tac	p.D116Y		NM_020999.3	NP_066279.2	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	116	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				central nervous system development (GO:0007417)|endocrine pancreas development (GO:0031018)|epithelial cell differentiation (GO:0030855)|forebrain development (GO:0030900)|hindbrain development (GO:0030902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|peripheral nervous system development (GO:0007422)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of dendrite morphogenesis (GO:0048814)|spinal cord development (GO:0021510)|transdifferentiation (GO:0060290)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription coactivator activity (GO:0003713)			endometrium(4)|large_intestine(2)|lung(6)|prostate(1)	13						AGCTTCGCGTCGTCTGGGAAG	0.622																																							uc001jpp.2		NA																	0					0						c.(346-348)GAC>TAC		neurogenin 3							89.0	68.0	75.0					10																	71332454		2203	4300	6503	SO:0001583	missense	50674				central nervous system development|endocrine pancreas development|peripheral nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	transcription coactivator activity	g.chr10:71332454C>A	AJ133776	CCDS31212.1	10q21.3	2013-05-21			ENSG00000122859	ENSG00000122859		"""Basic helix-loop-helix proteins"""	13806	protein-coding gene	gene with protein product		604882				9000438, 10677506	Standard	NM_020999		Approved	Atoh5, Math4B, ngn3, bHLHa7	uc001jpp.3	Q9Y4Z2	OTTHUMG00000018391	ENST00000242462.4:c.346G>T	10.37:g.71332454C>A	ENSP00000242462:p.Asp116Tyr		Somatic					p.D116Y	NM_020999	NP_066279	WXS	Illumina HiSeq	Unspecified	Q9Y4Z2	NGN3_HUMAN			2	504	-			116			Helix-loop-helix motif.		Q5VVI0|Q6DJX6|Q9BY24	Missense_Mutation	SNP	ENST00000242462.4	37	c.346G>T	CCDS31212.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.917105	0.73098	.	.	ENSG00000122859	ENST00000242462	D	0.98120	-4.73	4.62	4.62	0.57501	Helix-loop-helix DNA-binding (5);	0.000000	0.42964	D	0.000635	D	0.98861	0.9615	M	0.92880	3.355	0.80722	D	1	D	0.64830	0.994	D	0.64144	0.922	D	0.99628	1.0985	10	0.87932	D	0	-21.6992	16.1999	0.82063	0.0:1.0:0.0:0.0	.	116	Q9Y4Z2	NGN3_HUMAN	Y	116	ENSP00000242462:D116Y	ENSP00000242462:D116Y	D	-	1	0	NEUROG3	71002460	1.000000	0.71417	0.934000	0.37439	0.432000	0.31715	4.713000	0.61895	2.355000	0.79922	0.655000	0.94253	GAC		0.622	NEUROG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048464.1	NM_020999		7	43	1	0	8.12818e-05	0.001984	9.22083e-05	7	43				
NEUROG3	50674	broad.mit.edu	37	10	71332668	71332668	+	Silent	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:71332668C>T	ENST00000242462.4	-	2	161	c.132G>A	c.(130-132)ggG>ggA	p.G44G	RP11-343J3.2_ENST00000428753.1_RNA	NM_020999.3	NP_066279.2	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	44					central nervous system development (GO:0007417)|endocrine pancreas development (GO:0031018)|epithelial cell differentiation (GO:0030855)|forebrain development (GO:0030900)|hindbrain development (GO:0030902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|peripheral nervous system development (GO:0007422)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of dendrite morphogenesis (GO:0048814)|spinal cord development (GO:0021510)|transdifferentiation (GO:0060290)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription coactivator activity (GO:0003713)			endometrium(4)|large_intestine(2)|lung(6)|prostate(1)	13						CTGCGCAGTTCCCCCGTGTGC	0.711																																							uc001jpp.2		NA																	0					0						c.(130-132)GGG>GGA		neurogenin 3							14.0	16.0	15.0					10																	71332668		2198	4288	6486	SO:0001819	synonymous_variant	50674				central nervous system development|endocrine pancreas development|peripheral nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	transcription coactivator activity	g.chr10:71332668C>T	AJ133776	CCDS31212.1	10q21.3	2013-05-21			ENSG00000122859	ENSG00000122859		"""Basic helix-loop-helix proteins"""	13806	protein-coding gene	gene with protein product		604882				9000438, 10677506	Standard	NM_020999		Approved	Atoh5, Math4B, ngn3, bHLHa7	uc001jpp.3	Q9Y4Z2	OTTHUMG00000018391	ENST00000242462.4:c.132G>A	10.37:g.71332668C>T			Somatic					p.G44G	NM_020999	NP_066279	WXS	Illumina HiSeq	Unspecified	Q9Y4Z2	NGN3_HUMAN			2	290	-			44					Q5VVI0|Q6DJX6|Q9BY24	Silent	SNP	ENST00000242462.4	37	c.132G>A	CCDS31212.1																																																																																				0.711	NEUROG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048464.1	NM_020999		14	22	0	0	0	0.00245	0	14	22				
DYDC1	143241	broad.mit.edu	37	10	82102070	82102070	+	Silent	SNP	C	C	T	rs369791751		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:82102070C>T	ENST00000372204.3	-	5	461	c.297G>A	c.(295-297)agG>agA	p.R99R	DYDC2_ENST00000372198.1_5'Flank|DYDC2_ENST00000372199.1_5'Flank|DYDC2_ENST00000372197.1_5'Flank|DYDC1_ENST00000372202.1_Silent_p.R99R|DYDC1_ENST00000421924.2_Silent_p.R99R	NM_138812.3	NP_620167.1	Q8WWB3	DYDC1_HUMAN	DPY30 domain containing 1	99										kidney(1)|large_intestine(3)|skin(1)	5			Colorectal(32;0.229)			GTATTCTCTGCCTCTCCTTTT	0.323																																							uc001kbx.2		NA																	0					0						c.(295-297)AGG>AGA		DPY30 domain containing 1							176.0	163.0	167.0					10																	82102070		2203	4300	6503	SO:0001819	synonymous_variant	143241							g.chr10:82102070C>T	BC019250	CCDS7366.1	10q22.3	2006-02-01			ENSG00000170788	ENSG00000170788			23460	protein-coding gene	gene with protein product		615154					Standard	NM_138812		Approved	bA36D19.5, DPY30D1	uc031pwj.1	Q8WWB3	OTTHUMG00000018609	ENST00000372204.3:c.297G>A	10.37:g.82102070C>T			Somatic				DYDC1_uc001kby.1_Silent_p.R99R|DYDC1_uc009xsr.1_Silent_p.R99R|DYDC2_uc001kbz.1_5'Flank|DYDC2_uc001kca.1_5'Flank	p.R99R	NM_138812	NP_620167	WXS	Illumina HiSeq	Unspecified	Q8WWB3	DYDC1_HUMAN	Colorectal(32;0.229)		5	462	-			99					A8K927|Q5QP03|Q5QP04|Q6WNP4|Q6ZU87	Silent	SNP	ENST00000372204.3	37	c.297G>A	CCDS7366.1																																																																																				0.323	DYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049059.1	NM_138812		12	53	0	0	0	0.000978	0	12	53				
MYOF	26509	broad.mit.edu	37	10	95129512	95129512	+	Missense_Mutation	SNP	C	C	T	rs149848851		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:95129512C>T	ENST00000359263.4	-	25	2478	c.2479G>A	c.(2479-2481)Ggg>Agg	p.G827R	MYOF_ENST00000371502.4_Missense_Mutation_p.G827R|MYOF_ENST00000358334.5_Missense_Mutation_p.G814R|MYOF_ENST00000371501.4_Missense_Mutation_p.G827R	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	827					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						ACCTTTGGCCCGTTGTTTTTC	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		20364	0.001		0.0	False		,,,				2504	0.0						uc001kin.2		NA																	0				ovary(3)|breast(1)	4						c.(2479-2481)GGG>AGG		myoferlin isoform a							96.0	94.0	94.0					10																	95129512		1925	4145	6070	SO:0001583	missense	26509				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding	g.chr10:95129512C>T	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.2479G>A	10.37:g.95129512C>T	ENSP00000352208:p.Gly827Arg		Somatic				MYOF_uc001kio.2_Missense_Mutation_p.G814R|MYOF_uc009xue.2_RNA	p.G827R	NM_013451	NP_038479	WXS	Illumina HiSeq	Unspecified	Q9NZM1	MYOF_HUMAN			25	2602	-			827			Cytoplasmic (Potential).		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	c.2479G>A	CCDS41551.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	17.43	3.387171	0.61956	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	5.65	5.65	0.86999	Ferlin B-domain (1);	0.102525	0.64402	D	0.000003	D	0.86883	0.6040	M	0.87827	2.91	0.80722	D	1	B;B	0.33103	0.103;0.397	B;B	0.35859	0.063;0.212	D	0.84965	0.0879	10	0.34782	T	0.22	-22.2746	19.9142	0.97043	0.0:1.0:0.0:0.0	.	814;827	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	R	814;827;827;827	ENSP00000351094:G814R;ENSP00000352208:G827R;ENSP00000360556:G827R;ENSP00000360557:G827R	ENSP00000351094:G814R	G	-	1	0	MYOF	95119502	1.000000	0.71417	0.330000	0.25442	0.582000	0.36321	7.651000	0.83577	2.941000	0.99782	0.655000	0.94253	GGG		0.443	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451		6	27	0	0	0	0.001168	0	6	27				
TACC2	10579	broad.mit.edu	37	10	123976300	123976300	+	Silent	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:123976300G>C	ENST00000369005.1	+	11	7843	c.7503G>C	c.(7501-7503)ctG>ctC	p.L2501L	TACC2_ENST00000358010.1_Silent_p.L647L|TACC2_ENST00000369004.3_Silent_p.L591L|TACC2_ENST00000453444.2_Silent_p.L2505L|TACC2_ENST00000334433.3_Silent_p.L2501L|TACC2_ENST00000369001.1_Silent_p.L205L|TACC2_ENST00000513429.1_Silent_p.L647L|TACC2_ENST00000369000.1_Silent_p.L201L|TACC2_ENST00000515603.1_Silent_p.L2456L|TACC2_ENST00000360561.3_Silent_p.L579L|TACC2_ENST00000368999.1_Silent_p.L591L|TACC2_ENST00000260733.3_Silent_p.L579L|TACC2_ENST00000515273.1_Silent_p.L2505L	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2501					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CCTCGGACCTGTCCACCTTTG	0.562																																							uc001lfv.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(7501-7503)CTG>CTC		transforming, acidic coiled-coil containing							158.0	135.0	142.0					10																	123976300		2203	4300	6503	SO:0001819	synonymous_variant	10579					microtubule organizing center|nucleus	nuclear hormone receptor binding	g.chr10:123976300G>C	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.7503G>C	10.37:g.123976300G>C			Somatic				TACC2_uc001lfw.2_Silent_p.L647L|TACC2_uc009xzx.2_Silent_p.L2456L|TACC2_uc010qtv.1_Silent_p.L2505L|TACC2_uc001lfx.2_Silent_p.L205L|TACC2_uc001lfy.2_Silent_p.L201L|TACC2_uc001lfz.2_Silent_p.L579L|TACC2_uc001lga.2_Silent_p.L579L|TACC2_uc009xzy.2_Silent_p.L591L|TACC2_uc001lgb.2_Silent_p.L536L|TACC2_uc010qtw.1_Silent_p.L596L	p.L2501L	NM_206862	NP_996744	WXS	Illumina HiSeq	Unspecified	O95359	TACC2_HUMAN			11	7863	+		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)	2501					Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	ENST00000369005.1	37	c.7503G>C	CCDS7626.1																																																																																				0.562	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			25	80	0	0	0	0.00333	0	25	80				
MKI67	4288	broad.mit.edu	37	10	129900995	129900995	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:129900995C>T	ENST00000368654.3	-	13	9484	c.9109G>A	c.(9109-9111)Gca>Aca	p.A3037T	MKI67_ENST00000368653.3_Missense_Mutation_p.A2677T	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	3037					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.A3037T(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTGCCTCTTGCCCTGGGAGCA	0.537																																							uc001lke.2		NA																	1	Substitution - Missense(1)		urinary_tract(1)	ovary(4)|central_nervous_system(2)|skin(1)	7						c.(9109-9111)GCA>ACA		antigen identified by monoclonal antibody Ki-67							134.0	127.0	130.0					10																	129900995		2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129900995C>T	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.9109G>A	10.37:g.129900995C>T	ENSP00000357643:p.Ala3037Thr		Somatic				MKI67_uc001lkf.2_Missense_Mutation_p.A2677T|MKI67_uc009yav.1_Missense_Mutation_p.A2612T|MKI67_uc009yaw.1_Missense_Mutation_p.A2187T	p.A3037T	NM_002417	NP_002408	WXS	Illumina HiSeq	Unspecified	P46013	KI67_HUMAN			13	9304	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	3037			ATP (Potential).		Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.9109G>A	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	6.588	0.476767	0.12521	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01295	5.09;5.04	4.5	-3.06	0.05379	.	0.540328	0.14939	N	0.289659	T	0.00695	0.0023	N	0.08118	0	0.09310	N	1	B;B;B	0.22346	0.068;0.068;0.04	B;B;B	0.17979	0.02;0.02;0.013	T	0.47315	-0.9127	10	0.14656	T	0.56	.	5.6997	0.17875	0.0:0.3183:0.4024:0.2792	.	3036;2677;3037	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	T	3037;2677;3036	ENSP00000357643:A3037T;ENSP00000357642:A2677T	ENSP00000357642:A2677T	A	-	1	0	MKI67	129790985	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.212000	0.09319	-0.419000	0.07439	-0.150000	0.13652	GCA		0.537	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		4	90	0	0	0	0.009096	0	4	90				
TCERG1L	256536	broad.mit.edu	37	10	132965122	132965122	+	Missense_Mutation	SNP	C	C	T	rs202205724		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:132965122C>T	ENST00000368642.4	-	5	968	c.883G>A	c.(883-885)Gcc>Acc	p.A295T		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	295										cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		GGAGGGCGGGCCACTCGGCCC	0.512																																							uc001lkp.2		NA																	0				large_intestine(2)|ovary(2)	4						c.(883-885)GCC>ACC		transcription elongation regulator 1-like							58.0	52.0	54.0					10																	132965122		2203	4300	6503	SO:0001583	missense	256536							g.chr10:132965122C>T	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.883G>A	10.37:g.132965122C>T	ENSP00000357631:p.Ala295Thr		Somatic				TCERG1L_uc009yax.1_RNA	p.A295T	NM_174937	NP_777597	WXS	Illumina HiSeq	Unspecified	Q5VWI1	TCRGL_HUMAN		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)	5	969	-		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)	295					Q5VWI2|Q86XM8	Missense_Mutation	SNP	ENST00000368642.4	37	c.883G>A	CCDS7662.2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	1.597	-0.527601	0.04141	.	.	ENSG00000176769	ENST00000368642	T	0.23950	1.88	2.4	-0.793	0.10922	.	0.593383	0.15120	N	0.279449	T	0.09468	0.0233	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.34576	-0.9823	10	0.15499	T	0.54	-0.5839	5.4694	0.16662	0.0:0.4478:0.3489:0.2034	.	295	Q5VWI1	TCRGL_HUMAN	T	295	ENSP00000357631:A295T	ENSP00000357631:A295T	A	-	1	0	TCERG1L	132855112	0.007000	0.16637	0.001000	0.08648	0.000000	0.00434	0.170000	0.16663	-0.179000	0.10654	-1.087000	0.02190	GCC		0.512	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937		10	29	0	0	0	0.008291	0	10	29				
KRTAP5-3	387266	broad.mit.edu	37	11	1629050	1629050	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:1629050C>A	ENST00000399685.1	-	1	643	c.566G>T	c.(565-567)tGc>tTc	p.C189F		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	189	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		gggtttgcagcagctggactg	0.627																																							uc001ltw.1		NA																	0				ovary(2)	2						c.(565-567)TGC>TTC		keratin associated protein 5-3							153.0	154.0	154.0					11																	1629050		2202	4290	6492	SO:0001583	missense	387266					keratin filament		g.chr11:1629050C>A	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.566G>T	11.37:g.1629050C>A	ENSP00000382592:p.Cys189Phe		Somatic					p.C189F	NM_001012708	NP_001012726	WXS	Illumina HiSeq	Unspecified	Q6L8H2	KRA53_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	1	644	-		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	189			11 X 4 AA repeats of C-C-X-P.|8.		Q6PL44|Q701N3	Missense_Mutation	SNP	ENST00000399685.1	37	c.566G>T	CCDS41591.1	.	.	.	.	.	.	.	.	.	.	C	8.115	0.779656	0.16120	.	.	ENSG00000196224	ENST00000399685	T	0.01152	5.26	3.55	2.61	0.31194	.	.	.	.	.	T	0.05868	0.0153	H	0.95850	3.73	0.29806	N	0.832069	P	0.49090	0.919	P	0.48334	0.574	T	0.03717	-1.1010	9	0.66056	D	0.02	.	9.3929	0.38383	0.0:0.8858:0.0:0.1142	.	189	Q6L8H2	KRA53_HUMAN	F	189	ENSP00000382592:C189F	ENSP00000382592:C189F	C	-	2	0	KRTAP5-3	1585626	0.868000	0.29978	0.500000	0.27589	0.476000	0.33039	0.909000	0.28558	0.614000	0.30107	0.280000	0.19369	TGC		0.627	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1			110	226	1	0	3.35719e-51	0.00361	5.72211e-51	110	226				
OR51A4	401666	broad.mit.edu	37	11	4967817	4967817	+	Nonsense_Mutation	SNP	T	T	A	rs533373608		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:4967817T>A	ENST00000380373.2	-	1	539	c.514A>T	c.(514-516)Aag>Tag	p.K172*	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGTTTTTCTTGCAATATCTC	0.413																																							uc010qys.1		NA																	0				ovary(2)|skin(1)	3						c.(514-516)AAG>TAG		olfactory receptor, family 51, subfamily A,																																				SO:0001587	stop_gained	401666				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4967817T>A	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.514A>T	11.37:g.4967817T>A	ENSP00000369731:p.Lys172*		Somatic					p.K172*	NM_001005329	NP_001005329	WXS	Illumina HiSeq	Unspecified	Q8NGJ6	O51A4_HUMAN		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	514	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	172			Extracellular (Potential).			Nonsense_Mutation	SNP	ENST00000380373.2	37	c.514A>T	CCDS31367.1	.	.	.	.	.	.	.	.	.	.	T	13.85	2.360283	0.41801	.	.	ENSG00000205497	ENST00000380373	.	.	.	3.44	-0.597	0.11653	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	7.3683	0.26787	0.0:0.3153:0.0:0.6847	.	.	.	.	X	172	.	ENSP00000369731:K172X	K	-	1	0	OR51A4	4924393	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-0.683000	0.05179	-0.218000	0.10018	-0.553000	0.04205	AAG		0.413	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329		24	223	0	0	0	0.00278	0	24	223				
OR51A2	401667	broad.mit.edu	37	11	4976042	4976042	+	Missense_Mutation	SNP	C	C	A	rs369414338		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:4976042C>A	ENST00000380371.1	-	1	901	c.902G>T	c.(901-903)aGa>aTa	p.R301I	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AACTCTCACTCTAATCTGTTT	0.353																																							uc010qyt.1		NA																	0					0						c.(901-903)AGA>ATA		olfactory receptor, family 51, subfamily A,							70.0	58.0	62.0					11																	4976042		2017	3668	5685	SO:0001583	missense	401667				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4976042C>A	AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.902G>T	11.37:g.4976042C>A	ENSP00000369729:p.Arg301Ile		Somatic					p.R301I	NM_001004748	NP_001004748	WXS	Illumina HiSeq	Unspecified	Q8NGJ7	O51A2_HUMAN		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	902	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	301			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000380371.1	37	c.902G>T	CCDS31368.1	.	.	.	.	.	.	.	.	.	.	-	14.49	2.549818	0.45383	.	.	ENSG00000205496	ENST00000380371	T	0.57907	0.37	3.45	3.45	0.39498	.	.	.	.	.	T	0.76786	0.4036	M	0.93462	3.42	0.09310	N	1	D	0.60575	0.988	D	0.64687	0.928	T	0.68112	-0.5495	9	0.87932	D	0	.	12.1567	0.54081	0.0:1.0:0.0:0.0	.	301	Q8NGJ7	O51A2_HUMAN	I	301	ENSP00000369729:R301I	ENSP00000369729:R301I	R	-	2	0	OR51A2	4932618	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	0.930000	0.28858	1.935000	0.56089	0.503000	0.49774	AGA		0.353	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142809.1	NM_001004748		50	28	1	0	8.99859e-20	0.00361	1.4348e-19	50	28				
OR52N4	390072	broad.mit.edu	37	11	5776344	5776344	+	Missense_Mutation	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:5776344A>G	ENST00000317254.3	+	1	422	c.374A>G	c.(373-375)tAt>tGt	p.Y125C	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		CTGGATCGCTATGTGGCCATC	0.488																																							uc001mbu.2		NA																	0				ovary(1)|skin(1)	2						c.(373-375)TAT>TGT		olfactory receptor, family 52, subfamily N,							168.0	164.0	165.0					11																	5776344		2201	4297	6498	SO:0001583	missense	390072				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5776344A>G	AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.374A>G	11.37:g.5776344A>G	ENSP00000323224:p.Tyr125Cys		Somatic				TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.Y125C	NM_001005175	NP_001005175	WXS	Illumina HiSeq	Unspecified	Q8NGI2	O52N4_HUMAN		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)	1	422	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	125			Cytoplasmic (Potential).		B2RNP8|Q6IF77	Missense_Mutation	SNP	ENST00000317254.3	37	c.374A>G	CCDS44528.1	.	.	.	.	.	.	.	.	.	.	A	12.84	2.059280	0.36373	.	.	ENSG00000181074	ENST00000317254	T	0.56444	0.46	5.86	3.44	0.39384	GPCR, rhodopsin-like superfamily (1);	0.326094	0.22110	N	0.064494	T	0.53594	0.1806	M	0.75085	2.285	0.32274	N	0.568421	B	0.18610	0.029	B	0.27076	0.076	T	0.60052	-0.7338	10	0.72032	D	0.01	.	9.9386	0.41567	0.611:0.0:0.0:0.389	.	125	Q8NGI2	O52N4_HUMAN	C	125	ENSP00000323224:Y125C	ENSP00000323224:Y125C	Y	+	2	0	OR52N4	5732920	0.955000	0.32602	0.988000	0.46212	0.757000	0.42996	2.331000	0.43894	0.407000	0.25591	0.455000	0.32223	TAT		0.488	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143350.1	NM_001005175		42	84	0	0	0	0.002522	0	42	84				
OR52E6	390078	broad.mit.edu	37	11	5862466	5862466	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:5862466C>A	ENST00000329322.5	-	1	661	c.662G>T	c.(661-663)aGg>aTg	p.R221M	OR52E6_ENST00000379946.2_Missense_Mutation_p.R225M|TRIM5_ENST00000380027.1_Intron	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATAGAGGATCCTGATATGGGA	0.463																																							uc010qzq.1		NA																	0				central_nervous_system(1)	1						c.(661-663)AGG>ATG		olfactory receptor, family 52, subfamily E,							52.0	53.0	52.0					11																	5862466		2197	4296	6493	SO:0001583	missense	390078				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5862466C>A	AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.662G>T	11.37:g.5862466C>A	ENSP00000328878:p.Arg221Met		Somatic				TRIM5_uc001mbq.1_Intron	p.R221M	NM_001005167	NP_001005167	WXS	Illumina HiSeq	Unspecified	Q96RD3	O52E6_HUMAN		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	662	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	221			Cytoplasmic (Potential).		Q6IFF8	Missense_Mutation	SNP	ENST00000329322.5	37	c.662G>T	CCDS53597.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.332399	0.24167	.	.	ENSG00000205409	ENST00000329322;ENST00000379946	T;T	0.00063	8.78;8.78	3.45	-2.38	0.06622	GPCR, rhodopsin-like superfamily (1);	0.226788	0.31233	N	0.008004	T	0.00144	0.0004	L	0.27053	0.805	0.09310	N	1	P	0.44816	0.844	P	0.55345	0.774	T	0.46317	-0.9200	10	0.14252	T	0.57	.	3.6167	0.08079	0.3625:0.2631:0.0:0.3744	.	221	Q96RD3	O52E6_HUMAN	M	221;225	ENSP00000328878:R221M;ENSP00000369279:R225M	ENSP00000328878:R221M	R	-	2	0	OR52E6	5819042	0.000000	0.05858	0.001000	0.08648	0.037000	0.13140	-3.331000	0.00509	-0.456000	0.07043	0.551000	0.68910	AGG		0.463	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401144.1	NM_001005167		10	31	1	0	0.00621372	0.006214	0.00663563	10	31				
PRKCDBP	112464	broad.mit.edu	37	11	6341340	6341340	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:6341340G>A	ENST00000303927.3	-	1	537	c.367C>T	c.(367-369)Cac>Tac	p.H123Y	PRKCDBP_ENST00000530979.1_Missense_Mutation_p.H123Y	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	123					cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGCAGAACGTGGAGCTTCCCG	0.706																																							uc001mcu.1		NA																	0					0						c.(367-369)CAC>TAC		protein kinase C, delta binding protein							11.0	11.0	11.0					11																	6341340		2180	4253	6433	SO:0001583	missense	112464							g.chr11:6341340G>A	AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.367C>T	11.37:g.6341340G>A	ENSP00000307292:p.His123Tyr		Somatic					p.H123Y	NM_145040	NP_659477	WXS	Illumina HiSeq	Unspecified	Q969G5	PRDBP_HUMAN		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	1	401	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	123						Missense_Mutation	SNP	ENST00000303927.3	37	c.367C>T	CCDS7762.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.364314	0.61513	.	.	ENSG00000170955	ENST00000303927;ENST00000530979	T;T	0.59906	0.23;0.23	5.21	5.21	0.72293	.	0.391359	0.28236	N	0.016099	T	0.59004	0.2162	L	0.51422	1.61	0.28065	N	0.932807	D	0.54207	0.965	P	0.47981	0.563	T	0.60845	-0.7182	10	0.66056	D	0.02	-10.9973	14.2523	0.66028	0.0:0.0:1.0:0.0	.	123	Q969G5	PRDBP_HUMAN	Y	123	ENSP00000307292:H123Y;ENSP00000432047:H123Y	ENSP00000307292:H123Y	H	-	1	0	PRKCDBP	6297916	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.598000	0.54038	2.430000	0.82344	0.514000	0.50259	CAC		0.706	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257228.2	NM_145040		3	18	0	0	0	0.009096	0	3	18				
DCHS1	8642	broad.mit.edu	37	11	6648071	6648071	+	Missense_Mutation	SNP	G	G	A	rs368032944		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:6648071G>A	ENST00000299441.3	-	14	6610	c.6199C>T	c.(6199-6201)Cgc>Tgc	p.R2067C		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2067	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGGGGAAAGCGGGGTCCACGC	0.597																																							uc001mem.1		NA																	0				ovary(3)|large_intestine(1)|pancreas(1)	5						c.(6199-6201)CGC>TGC		dachsous 1 precursor		G	CYS/ARG	0,4402		0,0,2201	27.0	28.0	28.0		6199	4.8	1.0	11		28	1,8591	1.2+/-3.3	0,1,4295	no	missense	DCHS1	NM_003737.2	180	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	2067/3299	6648071	1,12993	2201	4296	6497	SO:0001583	missense	8642				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr11:6648071G>A	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.6199C>T	11.37:g.6648071G>A	ENSP00000299441:p.Arg2067Cys		Somatic					p.R2067C	NM_003737	NP_003728	WXS	Illumina HiSeq	Unspecified	Q96JQ0	PCD16_HUMAN		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	14	6609	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	2067			Cadherin 19.|Extracellular (Potential).		O15098	Missense_Mutation	SNP	ENST00000299441.3	37	c.6199C>T	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279450	0.80692	0.0	1.16E-4	ENSG00000166341	ENST00000299441	T	0.39229	1.09	4.79	4.79	0.61399	Cadherin (2);Cadherin-like (1);	0.000000	0.43416	D	0.000567	T	0.62551	0.2437	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.64466	-0.6401	10	0.56958	D	0.05	.	17.0068	0.86395	0.0:0.0:1.0:0.0	.	2067	Q96JQ0	PCD16_HUMAN	C	2067	ENSP00000299441:R2067C	ENSP00000299441:R2067C	R	-	1	0	DCHS1	6604647	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.483000	0.81158	2.504000	0.84457	0.462000	0.41574	CGC		0.597	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		9	25	0	0	0	0.006214	0	9	25				
NLRP14	338323	broad.mit.edu	37	11	7065050	7065050	+	Missense_Mutation	SNP	C	C	A	rs148807230		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:7065050C>A	ENST00000299481.4	+	4	2139	c.1793C>A	c.(1792-1794)gCa>gAa	p.A598E		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	598					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		ATAAGCCAGGCAATGAGATGT	0.408																																							uc001mfb.1		NA																	0				ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(1792-1794)GCA>GAA		NLR family, pyrin domain containing 14							145.0	145.0	145.0					11																	7065050		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7065050C>A	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.1793C>A	11.37:g.7065050C>A	ENSP00000299481:p.Ala598Glu		Somatic					p.A598E	NM_176822	NP_789792	WXS	Illumina HiSeq	Unspecified	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	4	2116	+			598					Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.1793C>A	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027289	0.54683	.	.	ENSG00000158077	ENST00000299481	D	0.88431	-2.38	4.69	3.78	0.43462	.	0.000000	0.51477	D	0.000098	D	0.89220	0.6653	M	0.87547	2.89	0.33775	D	0.623524	P	0.37997	0.614	B	0.38378	0.272	D	0.92278	0.5831	10	0.72032	D	0.01	.	8.8108	0.34965	0.0:0.8971:0.0:0.1029	.	598	Q86W24	NAL14_HUMAN	E	598	ENSP00000299481:A598E	ENSP00000299481:A598E	A	+	2	0	NLRP14	7021626	0.966000	0.33281	1.000000	0.80357	0.603000	0.37013	1.066000	0.30604	1.352000	0.45808	0.655000	0.94253	GCA		0.408	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		28	55	1	0	6.38683e-12	0.008361	9.24621e-12	28	55				
PTPN5	84867	broad.mit.edu	37	11	18764013	18764013	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:18764013G>T	ENST00000358540.2	-	7	951	c.521C>A	c.(520-522)aCc>aAc	p.T174N	PTPN5_ENST00000396168.1_Missense_Mutation_p.T150N|PTPN5_ENST00000477854.1_5'UTR|PTPN5_ENST00000396167.2_Missense_Mutation_p.T142N|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000496201.2_5'UTR|PTPN5_ENST00000396171.4_Missense_Mutation_p.T174N|PTPN5_ENST00000396170.1_Missense_Mutation_p.T142N	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	174					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						GGGCAGTGGGGTGGGTGGCTC	0.632																																							uc001mpd.2		NA																	0				ovary(2)	2						c.(520-522)ACC>AAC		protein-tyrosine-phosphatase non-receptor 5							42.0	45.0	44.0					11																	18764013		2199	4293	6492	SO:0001583	missense	84867					integral to membrane	phosphotyrosine binding|protein tyrosine phosphatase activity	g.chr11:18764013G>T	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.521C>A	11.37:g.18764013G>T	ENSP00000351342:p.Thr174Asn		Somatic				PTPN5_uc001mpb.2_Missense_Mutation_p.T142N|PTPN5_uc001mpc.2_Missense_Mutation_p.T174N|PTPN5_uc001mpe.2_Missense_Mutation_p.T142N|PTPN5_uc010rdj.1_Missense_Mutation_p.T118N|PTPN5_uc001mpf.2_Missense_Mutation_p.T150N|PTPN5_uc010rdk.1_Missense_Mutation_p.T119N	p.T174N	NM_006906	NP_008837	WXS	Illumina HiSeq	Unspecified	P54829	PTN5_HUMAN			7	952	-			174					B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	ENST00000358540.2	37	c.521C>A	CCDS7845.1	.	.	.	.	.	.	.	.	.	.	G	10.01	1.233871	0.22626	.	.	ENSG00000110786	ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T	0.03745	3.82;3.85;3.82;3.85;3.83	5.22	0.943	0.19531	.	1.655710	0.02959	N	0.142917	T	0.02970	0.0088	N	0.14661	0.345	0.09310	N	1	B;B	0.16802	0.019;0.019	B;B	0.14023	0.01;0.006	T	0.42965	-0.9420	10	0.38643	T	0.18	.	4.7132	0.12882	0.3146:0.3091:0.3763:0.0	.	174;142	P54829;B3KXG7	PTN5_HUMAN;.	N	174;142;174;142;150	ENSP00000351342:T174N;ENSP00000379473:T142N;ENSP00000379474:T174N;ENSP00000379470:T142N;ENSP00000379471:T150N	ENSP00000351342:T174N	T	-	2	0	PTPN5	18720589	0.000000	0.05858	0.015000	0.15790	0.886000	0.51366	0.193000	0.17116	-0.072000	0.12864	0.561000	0.74099	ACC		0.632	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970		19	52	1	0	1.10923e-09	0.00278	1.52299e-09	19	52				
E2F8	79733	broad.mit.edu	37	11	19252381	19252381	+	Splice_Site	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:19252381C>A	ENST00000527884.1	-	8	1299	c.1067G>T	c.(1066-1068)gGc>gTc	p.G356V	E2F8_ENST00000250024.4_Splice_Site_p.G356V|RP11-428C19.4_ENST00000527978.1_RNA	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	356					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TGGGCTGGAGCCTGAAACAGA	0.413																																							uc001mpm.2		NA																	0				skin(1)	1						c.(1066-1068)GGC>GTC		E2F family member 8							45.0	45.0	45.0					11																	19252381		2199	4293	6492	SO:0001630	splice_region_variant	79733				cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:19252381C>A		CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.1067-1G>T	11.37:g.19252381C>A			Somatic				E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Missense_Mutation_p.G356V	p.G356V	NM_024680	NP_078956	WXS	Illumina HiSeq	Unspecified	A0AVK6	E2F8_HUMAN			8	1589	-			356					A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Missense_Mutation	SNP	ENST00000527884.1	37	c.1067G>T	CCDS7849.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.242017	0.22796	.	.	ENSG00000129173	ENST00000527884;ENST00000396159;ENST00000250024	T;T	0.18502	2.21;2.21	5.76	1.06	0.20224	.	0.934643	0.09100	N	0.848671	T	0.10423	0.0255	N	0.17674	0.51	0.37833	D	0.928782	B	0.09022	0.002	B	0.12156	0.007	T	0.14727	-1.0462	10	0.44086	T	0.13	.	5.021	0.14361	0.1648:0.4482:0.0:0.387	.	356	A0AVK6	E2F8_HUMAN	V	356	ENSP00000434199:G356V;ENSP00000250024:G356V	ENSP00000250024:G356V	G	-	2	0	E2F8	19208957	0.031000	0.19500	0.300000	0.25030	0.153000	0.21895	0.018000	0.13422	0.261000	0.21753	-0.345000	0.07892	GGC		0.413	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387830.1	NM_024680	Missense_Mutation	11	24	1	0	4.68919e-08	0.008291	6.12249e-08	11	24				
BDNF	627	broad.mit.edu	37	11	27680088	27680088	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:27680088C>T	ENST00000525528.1	-	1	1117	c.24G>A	c.(22-24)atG>atA	p.M8I	BDNF_ENST00000533246.1_Missense_Mutation_p.M8I|BDNF_ENST00000395986.2_Missense_Mutation_p.M23I|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000438929.1_Missense_Mutation_p.M90I|BDNF_ENST00000530861.1_Missense_Mutation_p.M8I|BDNF_ENST00000395978.3_Missense_Mutation_p.M8I|BDNF_ENST00000532997.1_Missense_Mutation_p.M8I|BDNF_ENST00000395983.3_Missense_Mutation_p.M8I|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000395981.3_Missense_Mutation_p.M8I|BDNF-AS_ENST00000500662.2_RNA|BDNF-AS_ENST00000502161.2_RNA|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000525950.1_Missense_Mutation_p.M8I|BDNF-AS_ENST00000499568.2_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000314915.6_Missense_Mutation_p.M16I|BDNF_ENST00000356660.4_Missense_Mutation_p.M8I|BDNF_ENST00000418212.1_Missense_Mutation_p.M8I|BDNF_ENST00000584049.1_5'UTR|BDNF_ENST00000439476.2_Missense_Mutation_p.M8I|BDNF_ENST00000395980.2_Missense_Mutation_p.M8I|BDNF_ENST00000420794.1_Missense_Mutation_p.M8I|BDNF_ENST00000533131.1_Missense_Mutation_p.M8I|BDNF-AS_ENST00000501176.2_RNA	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	8					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						ATGAAATAACCATAGTAAGGA	0.493																																							uc010rdu.1		NA																	0					0						c.(22-24)ATG>ATA		brain-derived neurotrophic factor isoform a							87.0	97.0	93.0					11																	27680088		2202	4299	6501	SO:0001583	missense	627					extracellular region	growth factor activity	g.chr11:27680088C>T	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.24G>A	11.37:g.27680088C>T	ENSP00000437138:p.Met8Ile		Somatic				BDNFOS_uc001mrm.2_Intron|BDNFOS_uc009yij.2_RNA|BDNFOS_uc009yik.2_Intron|BDNFOS_uc009yil.2_RNA|BDNFOS_uc001mrp.2_Intron|BDNFOS_uc009yim.2_RNA|BDNFOS_uc009yin.2_Intron|BDNFOS_uc009yio.2_RNA|BDNFOS_uc009yip.2_RNA|BDNFOS_uc001mrn.2_Intron|BDNFOS_uc009yiq.2_RNA|BDNFOS_uc001mro.2_Intron|BDNFOS_uc009yir.2_RNA|BDNFOS_uc009yis.2_Intron|BDNFOS_uc009yit.2_Intron|BDNFOS_uc009yiu.2_RNA|BDNFOS_uc009yiv.2_Intron|BDNFOS_uc009yiw.2_RNA|BDNFOS_uc009yix.2_Intron|BDNFOS_uc009yiy.2_RNA|BDNFOS_uc009yiz.2_RNA|BDNFOS_uc001mrq.3_Intron|BDNFOS_uc001mrr.3_Intron|BDNFOS_uc009yja.2_Intron|BDNFOS_uc009yjb.2_RNA|BDNF_uc010rdv.1_Missense_Mutation_p.M8I|BDNF_uc001mrt.2_Missense_Mutation_p.M23I|BDNF_uc010rdw.1_Missense_Mutation_p.M8I|BDNF_uc009yjd.2_Missense_Mutation_p.M8I|BDNF_uc001mru.2_Missense_Mutation_p.M8I|BDNF_uc010rdx.1_Missense_Mutation_p.M8I|BDNF_uc010rdy.1_Missense_Mutation_p.M8I|BDNF_uc009yjg.2_Missense_Mutation_p.M8I|BDNF_uc009yje.2_Missense_Mutation_p.M90I|BDNF_uc009yjf.2_Missense_Mutation_p.M37I|BDNF_uc001mrv.2_Missense_Mutation_p.M8I|BDNF_uc001mrw.3_Missense_Mutation_p.M8I|BDNF_uc001mrx.2_Missense_Mutation_p.M8I|BDNF_uc001mry.3_Missense_Mutation_p.M8I|BDNF_uc001mrz.3_Missense_Mutation_p.M8I|BDNF_uc001msa.2_Missense_Mutation_p.M16I	p.M8I	NM_001143816	NP_001137288	WXS	Illumina HiSeq	Unspecified	P23560	BDNF_HUMAN			2	875	-			8					A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Missense_Mutation	SNP	ENST00000525528.1	37	c.24G>A	CCDS7866.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.108730	0.37242	.	.	ENSG00000176697	ENST00000439476;ENST00000525528;ENST00000395986;ENST00000533131;ENST00000356660;ENST00000418212;ENST00000533246;ENST00000530861;ENST00000395983;ENST00000438929;ENST00000395980;ENST00000532997;ENST00000395981;ENST00000395978;ENST00000525950;ENST00000314915;ENST00000420794;ENST00000528035	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.54303	0.1850	L	0.55990	1.75	0.80722	D	1	P;D;P;P;P	0.58268	0.506;0.982;0.908;0.851;0.908	B;D;P;P;P	0.68943	0.344;0.961;0.888;0.775;0.888	T	0.48692	-0.9013	10	0.87932	D	0	-34.8588	20.8794	0.99867	0.0:1.0:0.0:0.0	.	37;90;16;8;23	P23560-5;P23560-4;P23560-2;P23560;P23560-3	.;.;.;BDNF_HUMAN;.	I	8;8;23;8;8;8;8;8;8;90;8;8;8;8;8;16;8;8	ENSP00000389345:M8I;ENSP00000437138:M8I;ENSP00000379309:M23I;ENSP00000432727:M8I;ENSP00000349084:M8I;ENSP00000400502:M8I;ENSP00000432376:M8I;ENSP00000435564:M8I;ENSP00000379307:M8I;ENSP00000414303:M90I;ENSP00000379304:M8I;ENSP00000435805:M8I;ENSP00000379305:M8I;ENSP00000379302:M8I;ENSP00000432035:M8I;ENSP00000320002:M16I;ENSP00000389564:M8I	ENSP00000320002:M16I	M	-	3	0	BDNF	27636664	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	ATG		0.493	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735		31	84	0	0	0	0.002445	0	31	84				
OR5D16	390144	broad.mit.edu	37	11	55607071	55607071	+	Missense_Mutation	SNP	G	G	T	rs375193534		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:55607071G>T	ENST00000378396.1	+	1	844	c.844G>T	c.(844-846)Gtg>Ttg	p.V282L		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V282M(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				GTTTTACACCGTGGTGATCCC	0.413																																							uc010rio.1		NA																	1	Substitution - Missense(1)	p.V282M(1)	ovary(1)	ovary(4)|skin(1)	5						c.(844-846)GTG>TTG		olfactory receptor, family 5, subfamily D,							73.0	69.0	71.0					11																	55607071		2201	4296	6497	SO:0001583	missense	390144				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55607071G>T	AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.844G>T	11.37:g.55607071G>T	ENSP00000367649:p.Val282Leu		Somatic					p.V282L	NM_001005496	NP_001005496	WXS	Illumina HiSeq	Unspecified	Q8NGK9	OR5DG_HUMAN			1	844	+		all_epithelial(135;0.208)	282			Helical; Name=7; (Potential).		Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	37	c.844G>T	CCDS31512.1	.	.	.	.	.	.	.	.	.	.	.	5.342	0.248495	0.10130	.	.	ENSG00000205029	ENST00000378396	T	0.00279	8.33	4.27	4.27	0.50696	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00412	0.0013	M	0.64630	1.985	0.09310	N	1	B	0.28998	0.23	B	0.44133	0.442	T	0.49542	-0.8929	9	0.24483	T	0.36	-15.9636	14.5936	0.68389	0.0:0.0:1.0:0.0	.	282	Q8NGK9	OR5DG_HUMAN	L	282	ENSP00000367649:V282L	ENSP00000367649:V282L	V	+	1	0	OR5D16	55363647	0.000000	0.05858	0.313000	0.25210	0.047000	0.14425	-0.409000	0.07160	2.118000	0.64928	0.537000	0.68136	GTG		0.413	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496		13	52	1	0	0.000151284	0.001855	0.00017106	13	52				
OR8K1	390157	broad.mit.edu	37	11	56113889	56113889	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:56113889C>A	ENST00000279783.2	+	1	469	c.375C>A	c.(373-375)gcC>gcA	p.A125A		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					CAGCAATGGCCTATGATCGCT	0.403										HNSCC(65;0.19)																													uc010rjg.1		NA																	0				ovary(1)|pancreas(1)	2						c.(373-375)GCC>GCA		olfactory receptor, family 8, subfamily K,							203.0	203.0	203.0					11																	56113889		2201	4296	6497	SO:0001819	synonymous_variant	390157				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56113889C>A	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.375C>A	11.37:g.56113889C>A		HNSCC(65;0.19)	Somatic					p.A125A	NM_001002907	NP_001002907	WXS	Illumina HiSeq	Unspecified	Q8NGG5	OR8K1_HUMAN			1	375	+	Esophageal squamous(21;0.00448)		125			Helical; Name=3; (Potential).		B9EJB1|Q6IFC3|Q96RC1	Silent	SNP	ENST00000279783.2	37	c.375C>A	CCDS31528.1																																																																																				0.403	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907		46	116	1	0	5.2432e-18	0.00361	8.32178e-18	46	116				
OR9G1	390174	broad.mit.edu	37	11	56468517	56468517	+	Silent	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:56468517C>T	ENST00000312153.1	+	1	654	c.654C>T	c.(652-654)ctC>ctT	p.L218L		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						CCTCCTACCTCTTTATCATCA	0.527																																							uc010rjn.1		NA																	0					0						c.(652-654)CTC>CTT		olfactory receptor, family 9, subfamily G,							173.0	174.0	174.0					11																	56468517		2201	4296	6497	SO:0001819	synonymous_variant	504191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56468517C>T	AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.654C>T	11.37:g.56468517C>T			Somatic					p.L218L	NM_001013358	NP_001013376	WXS	Illumina HiSeq	Unspecified	P0C7N8	OR9G9_HUMAN			1	654	+			218			Helical; Name=5; (Potential).		Q6IEU9|Q8NGQ0	Silent	SNP	ENST00000312153.1	37	c.654C>T	CCDS31536.1																																																																																				0.527	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393253.1	NM_001005213		9	178	0	0	0	0.004007	0	9	178				
SYT7	9066	broad.mit.edu	37	11	61300564	61300564	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:61300564G>C	ENST00000263846.4	-	4	575	c.248C>G	c.(247-249)gCc>gGc	p.A83G	SYT7_ENST00000542670.1_Missense_Mutation_p.A291G|SYT7_ENST00000540831.1_5'UTR|SYT7_ENST00000540677.1_Missense_Mutation_p.A158G|SYT7_ENST00000542836.1_Missense_Mutation_p.A127G|SYT7_ENST00000539008.1_Missense_Mutation_p.A366G|SYT7_ENST00000535826.1_Missense_Mutation_p.A202G	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	83					exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGGCACGGGGGCTGTGTTCAC	0.662																																							uc001nrv.2		NA																	0				ovary(3)|pancreas(1)	4						c.(247-249)GCC>GGC		synaptotagmin VII							88.0	82.0	84.0					11																	61300564		2202	4299	6501	SO:0001583	missense	9066					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity	g.chr11:61300564G>C	AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.248C>G	11.37:g.61300564G>C	ENSP00000263846:p.Ala83Gly		Somatic				SYT7_uc009ynr.2_Missense_Mutation_p.A158G	p.A83G	NM_004200	NP_004191	WXS	Illumina HiSeq	Unspecified	O43581	SYT7_HUMAN			4	254	-			83			Cytoplasmic (Potential).		F5GZU9|Q08AH6	Missense_Mutation	SNP	ENST00000263846.4	37	c.248C>G	CCDS31577.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.754852	0.49362	.	.	ENSG00000011347	ENST00000263846;ENST00000540677;ENST00000539008;ENST00000542836;ENST00000542670;ENST00000535826;ENST00000545053	T;T;T;T;T;T;T	0.58652	0.43;0.46;0.63;0.32;0.48;0.48;1.75	4.62	4.62	0.57501	.	0.276731	0.35151	N	0.003415	T	0.37156	0.0993	N	0.08118	0	0.40292	D	0.978518	P;B	0.36535	0.557;0.421	B;B	0.35353	0.201;0.099	T	0.33777	-0.9855	10	0.23302	T	0.38	.	16.0286	0.80560	0.0:0.0:1.0:0.0	.	158;83	F5GZU9;O43581	.;SYT7_HUMAN	G	83;158;366;127;291;202;83	ENSP00000263846:A83G;ENSP00000444201:A158G;ENSP00000439694:A366G;ENSP00000444568:A127G;ENSP00000444019:A291G;ENSP00000437720:A202G;ENSP00000443576:A83G	ENSP00000263846:A83G	A	-	2	0	SYT7	61057140	1.000000	0.71417	0.984000	0.44739	0.794000	0.44872	4.917000	0.63369	2.276000	0.75962	0.462000	0.41574	GCC		0.662	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200		12	51	0	0	0	0.00245	0	12	51				
SCGB1D4	404552	broad.mit.edu	37	11	62065047	62065047	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:62065047C>T	ENST00000358585.1	-	2	192	c.139G>A	c.(139-141)Gcc>Acc	p.A47T		NM_206998.1	NP_996881.1	Q6XE38	SG1D4_HUMAN	secretoglobin, family 1D, member 4	47						extracellular region (GO:0005576)				lung(1)|prostate(1)	2						TTAAGTTTGGCAACTTGGAGG	0.448																																							uc001ntd.1		NA																	0					0						c.(139-141)GCC>ACC		secretoglobin family 1D member 4 precursor							155.0	162.0	160.0					11																	62065047		2202	4299	6501	SO:0001583	missense	404552					extracellular region	binding	g.chr11:62065047C>T	AY236538	CCDS31583.1	11q12.3	2011-12-14			ENSG00000197745	ENSG00000197745		"""Secretoglobins"""	31748	protein-coding gene	gene with protein product		615062				15034037, 15340161, 22155607	Standard	NM_206998		Approved	IIS	uc001ntd.1	Q6XE38	OTTHUMG00000167510	ENST00000358585.1:c.139G>A	11.37:g.62065047C>T	ENSP00000351395:p.Ala47Thr		Somatic					p.A47T	NM_206998	NP_996881	WXS	Illumina HiSeq	Unspecified	Q6XE38	SG1D4_HUMAN			2	193	-			47					A1L4Q8	Missense_Mutation	SNP	ENST00000358585.1	37	c.139G>A	CCDS31583.1	.	.	.	.	.	.	.	.	.	.	C	6.549	0.469552	0.12461	.	.	ENSG00000197745	ENST00000358585	T	0.15139	2.45	1.65	-0.811	0.10857	.	7.298260	0.00909	N	0.002454	T	0.23611	0.0571	.	.	.	0.09310	N	1	P	0.52170	0.951	P	0.54499	0.754	T	0.09314	-1.0680	9	0.41790	T	0.15	.	2.4177	0.04440	0.285:0.5187:0.0:0.1964	.	47	Q6XE38	SG1D4_HUMAN	T	47	ENSP00000351395:A47T	ENSP00000351395:A47T	A	-	1	0	SCGB1D4	61821623	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-4.274000	0.00262	-0.199000	0.10317	0.479000	0.44913	GCC		0.448	SCGB1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394862.1	NM_206998		29	147	0	0	0	0.005443	0	29	147				
TSGA10IP	254187	broad.mit.edu	37	11	65721153	65721153	+	RNA	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:65721153G>A	ENST00000532620.1	+	0	1498				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						GGCAGCCTACGCACCCAGAGG	0.741																																							uc001ogk.1		NA																	0					0						c.(1267-1269)GCA>ACA		testis specific, 10 interacting protein							12.0	16.0	15.0					11																	65721153		1811	3891	5702			254187							g.chr11:65721153G>A	AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65721153G>A			Somatic				TSGA10IP_uc009yqw.1_RNA|TSGA10IP_uc009yqx.1_RNA	p.A423T	NM_152762	NP_689975	WXS	Illumina HiSeq	Unspecified	Q3SY00	T10IP_HUMAN			7	1299	+			423			Potential.		Q3SXZ9|Q3SY01|Q96M26	Missense_Mutation	SNP	ENST00000532620.1	37	c.1267G>A																																																																																					0.741	TSGA10IP-001	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000391373.2	NM_152762		21	28	0	0	0	0.008871	0	21	28				
NUDT8	254552	broad.mit.edu	37	11	67396390	67396390	+	Splice_Site	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:67396390C>T	ENST00000376693.2	-	2	336	c.327G>A	c.(325-327)ccG>ccA	p.P109P	NUDT8_ENST00000301490.4_Splice_Site_p.P109P|RP11-655M14.13_ENST00000533311.1_lincRNA	NM_001243750.1	NP_001230679.1	Q8WV74	NUDT8_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 8	109	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(1)|prostate(1)|skin(1)	4						AGTGGCTTACCGGATCATACA	0.662																																							uc001omo.1		NA																	0					0						c.(325-327)CCG>CCA		nudix-type motif 8							53.0	57.0	56.0					11																	67396390		2200	4294	6494	SO:0001630	splice_region_variant	254552					mitochondrion	hydrolase activity|metal ion binding	g.chr11:67396390C>T	AI743601	CCDS8174.1, CCDS58151.1	11q13.2	2008-07-21			ENSG00000167799	ENSG00000167799		"""Nudix motif containing"""	8055	protein-coding gene	gene with protein product						11415433	Standard	NM_181843		Approved	FLJ41567	uc001omo.2	Q8WV74	OTTHUMG00000167292	ENST00000376693.2:c.327+1G>A	11.37:g.67396390C>T			Somatic				NUDT8_uc001omn.2_Silent_p.P109P	p.P109P	NM_181843	NP_862826	WXS	Illumina HiSeq	Unspecified	Q8WV74	NUDT8_HUMAN			2	346	-			109			Nudix hydrolase.		Q6ZW59	Silent	SNP	ENST00000376693.2	37	c.327G>A	CCDS58151.1																																																																																				0.662	NUDT8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394036.1	NM_181843	Silent	18	54	0	0	0	0.007413	0	18	54				
LRRC32	2615	broad.mit.edu	37	11	76371795	76371795	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:76371795G>T	ENST00000407242.2	-	3	1084	c.842C>A	c.(841-843)aCa>aAa	p.T281K	LRRC32_ENST00000404995.1_Missense_Mutation_p.T281K|LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000260061.5_Missense_Mutation_p.T281K|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	281					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GGGTGGCCCTGTGGGGAGCCG	0.657																																							uc001oxq.3		NA																	0					0						c.(841-843)ACA>AAA		leucine rich repeat containing 32 precursor							47.0	46.0	46.0					11																	76371795		2200	4292	6492	SO:0001583	missense	2615					integral to plasma membrane		g.chr11:76371795G>T	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.842C>A	11.37:g.76371795G>T	ENSP00000384126:p.Thr281Lys		Somatic				LRRC32_uc001oxr.3_Missense_Mutation_p.T281K|LRRC32_uc010rsf.1_Missense_Mutation_p.T281K	p.T281K	NM_005512	NP_005503	WXS	Illumina HiSeq	Unspecified	Q14392	LRC32_HUMAN			3	1085	-			281			LRR 10.|Extracellular (Potential).		Q86V06	Missense_Mutation	SNP	ENST00000407242.2	37	c.842C>A	CCDS8245.1	.	.	.	.	.	.	.	.	.	.	G	2.710	-0.269073	0.05716	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.36157	1.27;1.27;1.27	4.55	0.453	0.16639	.	1.109740	0.06807	N	0.789762	T	0.19967	0.0480	N	0.10837	0.055	0.09310	N	1	B	0.18610	0.029	B	0.16722	0.016	T	0.29243	-1.0018	10	0.22109	T	0.4	.	8.7449	0.34580	0.4075:0.0:0.5925:0.0	.	281	Q14392	LRC32_HUMAN	K	281	ENSP00000260061:T281K;ENSP00000384126:T281K;ENSP00000385766:T281K	ENSP00000260061:T281K	T	-	2	0	LRRC32	76049443	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	0.419000	0.21247	-0.056000	0.13221	0.555000	0.69702	ACA		0.657	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512		27	25	1	0	4.72057e-08	0.003954	6.14029e-08	27	25				
ME3	10873	broad.mit.edu	37	11	86209034	86209034	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:86209034C>T	ENST00000393324.3	-	5	929	c.676G>A	c.(676-678)Gtg>Atg	p.V226M	ME3_ENST00000525957.1_5'UTR|ME3_ENST00000359636.2_Missense_Mutation_p.V226M|ME3_ENST00000543262.1_Missense_Mutation_p.V226M|ME3_ENST00000323418.6_Missense_Mutation_p.V164M|RP11-317J19.1_ENST00000524610.1_RNA	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	226					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				TCCAGCAGCACAGGGAGGCAC	0.647																																							uc001pbz.2		NA																	0				ovary(1)	1						c.(676-678)GTG>ATG		mitochondrial malic enzyme 3 precursor	NADH(DB00157)						96.0	85.0	89.0					11																	86209034		2202	4299	6501	SO:0001583	missense	10873				aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding	g.chr11:86209034C>T	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.676G>A	11.37:g.86209034C>T	ENSP00000376998:p.Val226Met		Somatic				ME3_uc001pca.2_Missense_Mutation_p.V226M|ME3_uc009yvk.2_Missense_Mutation_p.V226M|ME3_uc010rtr.1_RNA	p.V226M	NM_001014811	NP_001014811	WXS	Illumina HiSeq	Unspecified	Q16798	MAON_HUMAN			5	930	-		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)	226					B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	c.676G>A	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.877868	0.72294	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826;ENST00000545395;ENST00000323418	T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09	5.47	5.47	0.80525	Malic enzyme, N-terminal (2);	0.237215	0.41500	D	0.000874	T	0.73590	0.3606	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.80223	-0.1471	9	.	.	.	.	18.9526	0.92645	0.0:1.0:0.0:0.0	.	226	Q16798	MAON_HUMAN	M	226;226;226;226;164;164	ENSP00000352657:V226M;ENSP00000440246:V226M;ENSP00000376998:V226M;ENSP00000431182:V226M;ENSP00000315255:V164M	.	V	-	1	0	ME3	85886682	1.000000	0.71417	0.995000	0.50966	0.229000	0.25112	5.905000	0.69893	2.567000	0.86603	0.655000	0.94253	GTG		0.647	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2			60	48	0	0	0	0.00361	0	60	48				
ZBTB16	7704	broad.mit.edu	37	11	113935030	113935030	+	Silent	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:113935030G>C	ENST00000335953.4	+	2	1388	c.1008G>C	c.(1006-1008)gtG>gtC	p.V336V	ZBTB16_ENST00000392996.2_Silent_p.V336V	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	336					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		TCTACTCCGTGTTGCCCAACC	0.652																																							uc001pop.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1006-1008)GTG>GTC		promyelocytic leukemia zinc finger protein							66.0	63.0	64.0					11																	113935030		2201	4296	6497	SO:0001819	synonymous_variant	7704				apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding	g.chr11:113935030G>C	Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1008G>C	11.37:g.113935030G>C			Somatic				ZBTB16_uc001poo.1_Silent_p.V336V|ZBTB16_uc001poq.2_Silent_p.V336V	p.V336V	NM_006006	NP_005997	WXS	Illumina HiSeq	Unspecified	Q05516	ZBT16_HUMAN		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)	2	1272	+		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)	336					Q8TAL4	Silent	SNP	ENST00000335953.4	37	c.1008G>C	CCDS8367.1																																																																																				0.652	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006		34	35	0	0	0	0.002836	0	34	35				
NXPE1	120400	broad.mit.edu	37	11	114393211	114393211	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:114393211C>G	ENST00000424269.1	-	5	1122	c.1123G>C	c.(1123-1125)Gat>Cat	p.D375H	NXPE1_ENST00000251921.2_Missense_Mutation_p.D233H|NXPE1_ENST00000536271.1_Missense_Mutation_p.D91H			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	375						extracellular region (GO:0005576)											TCATGAAGATCAAAAAACTTC	0.303																																							uc001ppa.2		NA																	0					0						c.(697-699)GAT>CAT		hypothetical protein LOC120400							54.0	57.0	56.0					11																	114393211		2201	4294	6495	SO:0001583	missense	120400					extracellular region		g.chr11:114393211C>G	BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.1123G>C	11.37:g.114393211C>G	ENSP00000411690:p.Asp375His		Somatic				FAM55A_uc010rxd.1_Missense_Mutation_p.D82H	p.D233H	NM_152315	NP_689528	WXS	Illumina HiSeq	Unspecified	Q8N323	FA55A_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.02e-06)|Epithelial(105;0.000144)|all cancers(92;0.00106)	6	1114	-		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)	375					B0YJ13	Missense_Mutation	SNP	ENST00000424269.1	37	c.697G>C		.	.	.	.	.	.	.	.	.	.	C	15.79	2.936924	0.52972	.	.	ENSG00000095110	ENST00000536271;ENST00000251921;ENST00000424269	T;T;T	0.17691	2.26;2.26;2.26	4.19	3.27	0.37495	.	0.247697	0.33938	N	0.004401	T	0.38401	0.1039	M	0.83384	2.64	0.26851	N	0.968156	D	0.89917	1.0	D	0.79108	0.992	T	0.08432	-1.0722	10	0.44086	T	0.13	.	7.4166	0.27048	0.0:0.8:0.0:0.2	.	375	Q8N323	FA55A_HUMAN	H	91;233;375	ENSP00000445200:D91H;ENSP00000251921:D233H;ENSP00000411690:D375H	ENSP00000251921:D233H	D	-	1	0	FAM55A	113898421	0.932000	0.31603	0.993000	0.49108	0.872000	0.50106	0.203000	0.17315	2.275000	0.75901	0.650000	0.86243	GAT		0.303	NXPE1-201	KNOWN	basic	protein_coding	protein_coding		NM_152315		23	9	0	0	0	0.001882	0	23	9				
MCAM	4162	broad.mit.edu	37	11	119181596	119181596	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:119181596G>A	ENST00000264036.4	-	14	1677	c.1663C>T	c.(1663-1665)Ccg>Tcg	p.P555S	MCAM_ENST00000392814.1_3'UTR	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	555					anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CGGCTCTCCGGCTCCGGCAGC	0.622																																							uc001pwf.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(1663-1665)CCG>TCG		melanoma cell adhesion molecule							73.0	85.0	81.0					11																	119181596		2199	4295	6494	SO:0001583	missense	4162				anatomical structure morphogenesis|cell adhesion	integral to membrane|plasma membrane		g.chr11:119181596G>A	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1663C>T	11.37:g.119181596G>A	ENSP00000264036:p.Pro555Ser		Somatic				MCAM_uc001pwg.1_RNA	p.P555S	NM_006500	NP_006491	WXS	Illumina HiSeq	Unspecified	P43121	MUC18_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)	14	1692	-		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	555			Extracellular (Potential).		O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	ENST00000264036.4	37	c.1663C>T	CCDS31690.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.351608	0.24512	.	.	ENSG00000076706	ENST00000264036	T	0.50277	0.75	4.96	4.05	0.47172	.	.	.	.	.	T	0.24547	0.0595	N	0.08118	0	0.80722	D	1	B	0.23316	0.083	B	0.18871	0.023	T	0.06197	-1.0840	9	0.12103	T	0.63	-5.4876	11.1654	0.48539	0.0895:0.0:0.9105:0.0	.	555	P43121	MUC18_HUMAN	S	555	ENSP00000264036:P555S	ENSP00000264036:P555S	P	-	1	0	MCAM	118686806	0.997000	0.39634	0.466000	0.27168	0.755000	0.42902	3.659000	0.54489	1.420000	0.47138	0.561000	0.74099	CCG		0.622	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2			14	112	0	0	0	0.004007	0	14	112				
MCAM	4162	broad.mit.edu	37	11	119185575	119185575	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:119185575G>T	ENST00000264036.4	-	3	382	c.368C>A	c.(367-369)tCc>tAc	p.S123Y	MCAM_ENST00000530144.2_5'Flank|MCAM_ENST00000392814.1_5'Flank	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	123	Ig-like V-type 1.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		GTACTCCTGGGACCGAGGGCG	0.642																																							uc001pwf.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(367-369)TCC>TAC		melanoma cell adhesion molecule							52.0	58.0	56.0					11																	119185575		2199	4295	6494	SO:0001583	missense	4162				anatomical structure morphogenesis|cell adhesion	integral to membrane|plasma membrane		g.chr11:119185575G>T	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.368C>A	11.37:g.119185575G>T	ENSP00000264036:p.Ser123Tyr		Somatic					p.S123Y	NM_006500	NP_006491	WXS	Illumina HiSeq	Unspecified	P43121	MUC18_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)	3	397	-		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	123			Extracellular (Potential).|Ig-like V-type 1.		O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	ENST00000264036.4	37	c.368C>A	CCDS31690.1	.	.	.	.	.	.	.	.	.	.	G	17.65	3.442426	0.63067	.	.	ENSG00000076706	ENST00000264036	T	0.29397	1.57	5.19	3.29	0.37713	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.37100	0.0991	L	0.50333	1.59	0.09310	N	0.999993	P	0.52463	0.953	P	0.57009	0.811	T	0.14117	-1.0484	9	0.12430	T	0.62	-1.1216	7.854	0.29472	0.2577:0.0:0.7423:0.0	.	123	P43121	MUC18_HUMAN	Y	123	ENSP00000264036:S123Y	ENSP00000264036:S123Y	S	-	2	0	MCAM	118690785	0.404000	0.25328	0.743000	0.31040	0.989000	0.77384	0.756000	0.26419	0.547000	0.28938	0.561000	0.74099	TCC		0.642	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2			34	37	1	0	4.31634e-10	0.002445	6.02199e-10	34	37				
OR8D2	283160	broad.mit.edu	37	11	124189266	124189266	+	Silent	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:124189266C>T	ENST00000357438.2	-	1	918	c.828G>A	c.(826-828)gtG>gtA	p.V276V		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		TGATGTAGAACACAGAAGACA	0.433																																							uc010sah.1		NA																	0				breast(1)|central_nervous_system(1)|pancreas(1)	3						c.(826-828)GTG>GTA		olfactory receptor, family 8, subfamily D,							157.0	162.0	161.0					11																	124189266		2201	4299	6500	SO:0001819	synonymous_variant	283160				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124189266C>T	AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.828G>A	11.37:g.124189266C>T			Somatic					p.V276V	NM_001002918	NP_001002918	WXS	Illumina HiSeq	Unspecified	Q9GZM6	OR8D2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)	1	828	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	276			Helical; Name=7; (Potential).		B9EH49|Q6IFR0	Silent	SNP	ENST00000357438.2	37	c.828G>A	CCDS31707.1																																																																																				0.433	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387286.1	NM_001002918		18	101	0	0	0	0.006122	0	18	101				
NTM	50863	broad.mit.edu	37	11	132016251	132016251	+	Silent	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr11:132016251G>A	ENST00000374786.1	+	2	722	c.243G>A	c.(241-243)aaG>aaA	p.K81K	NTM_ENST00000374784.1_Silent_p.K81K|NTM_ENST00000374791.3_Silent_p.K81K|NTM_ENST00000427481.2_Silent_p.K72K|NTM_ENST00000539799.1_Silent_p.K81K|NTM_ENST00000425719.2_Silent_p.K81K	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	81	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GGAATGACAAGTGGTGCCTGG	0.567																																							uc001qgp.2		NA																	0				ovary(4)|central_nervous_system(1)|skin(1)	6						c.(241-243)AAG>AAA		neurotrimin isoform 1							184.0	135.0	151.0					11																	132016251		2201	4297	6498	SO:0001819	synonymous_variant	50863				cell adhesion|neuron recognition	anchored to membrane|plasma membrane		g.chr11:132016251G>A	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.243G>A	11.37:g.132016251G>A			Somatic				NTM_uc001qgm.2_Silent_p.K81K|NTM_uc010sch.1_Silent_p.K72K|NTM_uc010sci.1_Silent_p.K81K|NTM_uc010scj.1_Silent_p.K40K|NTM_uc001qgo.2_Silent_p.K81K|NTM_uc001qgq.2_Silent_p.K81K	p.K81K	NM_016522	NP_057606	WXS	Illumina HiSeq	Unspecified	Q9P121	NTRI_HUMAN			2	907	+			81			Ig-like C2-type 1.		A0MTT2|Q6UXJ3|Q86VJ9	Silent	SNP	ENST00000374786.1	37	c.243G>A	CCDS8491.1																																																																																				0.567	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522		42	39	0	0	0	0.00874	0	42	39				
IQSEC3	440073	broad.mit.edu	37	12	283807	283807	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:283807G>T	ENST00000538872.1	+	14	3275	c.3157G>T	c.(3157-3159)Ggg>Tgg	p.G1053W	IQSEC3_ENST00000537151.1_3'UTR|RP11-598F7.6_ENST00000537295.1_lincRNA|IQSEC3_ENST00000326261.4_Missense_Mutation_p.G1053W			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	1053					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		GCACAACTCCGGGCTGGGGGC	0.617																																							uc001qhw.1		NA																	0				central_nervous_system(2)|large_intestine(1)|skin(1)	4						c.(2248-2250)GGG>TGG		IQ motif and Sec7 domain 3							23.0	24.0	24.0					12																	283807		1564	3577	5141	SO:0001583	missense	440073				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity	g.chr12:283807G>T	AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.3157G>T	12.37:g.283807G>T	ENSP00000437554:p.Gly1053Trp		Somatic					p.G750W	NM_015232	NP_056047	WXS	Illumina HiSeq	Unspecified	Q9UPP2	IQEC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)	11	2254	+	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		1053					A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	ENST00000538872.1	37	c.2248G>T	CCDS53728.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939765	0.52972	.	.	ENSG00000120645	ENST00000538872;ENST00000326261	T;T	0.10099	2.91;2.91	3.91	0.708	0.18144	.	10.526900	0.00166	N	0.000000	T	0.08268	0.0206	N	0.08118	0	0.21762	N	0.999555	P	0.46987	0.888	P	0.44990	0.466	T	0.17077	-1.0381	10	0.66056	D	0.02	.	5.394	0.16259	0.2976:0.1536:0.5488:0.0	.	1053	Q9UPP2	IQEC3_HUMAN	W	1053	ENSP00000437554:G1053W;ENSP00000315662:G1053W	ENSP00000315662:G1053W	G	+	1	0	IQSEC3	154068	1.000000	0.71417	0.950000	0.38849	0.832000	0.47134	1.532000	0.36029	0.320000	0.23234	0.305000	0.20034	GGG		0.617	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3	XM_495902		14	12	1	0	4.14922e-12	0.004007	6.03206e-12	14	12				
NOP2	4839	broad.mit.edu	37	12	6672656	6672656	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:6672656C>T	ENST00000322166.5	-	8	834	c.713G>A	c.(712-714)cGa>cAa	p.R238Q	NOP2_ENST00000382421.3_Missense_Mutation_p.R271Q|NOP2_ENST00000545200.1_Missense_Mutation_p.R234Q|NOP2_ENST00000537442.1_Missense_Mutation_p.R238Q|NOP2_ENST00000542015.1_Intron|NOP2_ENST00000541778.1_Missense_Mutation_p.R234Q|NOP2_ENST00000399466.2_Missense_Mutation_p.R234Q	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	238					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						CTTGTGAACTCGTTGCAGGTC	0.547											OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001qph.1		NA																	0				ovary(2)	2						c.(700-702)CGA>CAA		nucleolar protein 1, 120kDa							39.0	41.0	40.0					12																	6672656		2002	4167	6169	SO:0001583	missense	4839				positive regulation of cell proliferation|rRNA processing	nucleolus	protein binding|RNA binding|S-adenosylmethionine-dependent methyltransferase activity	g.chr12:6672656C>T		CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.713G>A	12.37:g.6672656C>T	ENSP00000313272:p.Arg238Gln		Somatic	OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	635	NOP2_uc009zeq.1_5'UTR|NOP2_uc001qpi.1_Missense_Mutation_p.R234Q|NOP2_uc001qpj.1_Intron	p.R234Q	NM_001033714	NP_001028886	WXS	Illumina HiSeq	Unspecified	P46087	NOP2_HUMAN			8	881	-			238					A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	ENST00000322166.5	37	c.701G>A	CCDS58203.1	.	.	.	.	.	.	.	.	.	.	C	5.209	0.223994	0.09863	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000545200;ENST00000399466;ENST00000322166;ENST00000541778;ENST00000542944;ENST00000542867	T;T;T;T;T;T;T;T	0.43688	2.53;2.52;2.57;2.54;2.53;2.54;0.98;0.94	5.52	2.54	0.30619	.	0.488920	0.21187	N	0.078712	T	0.23094	0.0558	L	0.38175	1.15	0.19300	N	0.999978	B	0.22683	0.073	B	0.15052	0.012	T	0.06917	-1.0800	10	0.14252	T	0.57	-6.064	1.4139	0.02297	0.1838:0.407:0.2327:0.1765	.	234	P46087-2	.	Q	238;271;234;234;238;234;114;234	ENSP00000444437:R238Q;ENSP00000371858:R271Q;ENSP00000439422:R234Q;ENSP00000382392:R234Q;ENSP00000313272:R238Q;ENSP00000443150:R234Q;ENSP00000440754:R114Q;ENSP00000443035:R234Q	ENSP00000313272:R238Q	R	-	2	0	NOP2	6542917	0.007000	0.16637	0.775000	0.31657	0.117000	0.20001	0.938000	0.28965	1.347000	0.45714	0.655000	0.94253	CGA		0.547	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1	NM_006170		3	17	0	0	0	0.009096	0	3	17				
FAM90A1	55138	broad.mit.edu	37	12	8374735	8374735	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:8374735C>T	ENST00000538603.1	-	7	1636	c.1078G>A	c.(1078-1080)Gac>Aac	p.D360N	FAM90A1_ENST00000307435.6_Missense_Mutation_p.D360N	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	360							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		GGCTGCCGGTCGCCGCTAAGC	0.677																																							uc001qui.2		NA																	0				ovary(1)	1						c.(1078-1080)GAC>AAC		hypothetical protein LOC55138							26.0	27.0	27.0					12																	8374735		2203	4298	6501	SO:0001583	missense	55138						nucleic acid binding|zinc ion binding	g.chr12:8374735C>T	AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.1078G>A	12.37:g.8374735C>T	ENSP00000445418:p.Asp360Asn		Somatic				FAM90A1_uc001quh.2_Missense_Mutation_p.D360N	p.D360N	NM_018088	NP_060558	WXS	Illumina HiSeq	Unspecified	Q86YD7	F90A1_HUMAN		Kidney(36;0.0866)	7	1637	-			360					D3DUU9|Q9NVZ6	Missense_Mutation	SNP	ENST00000538603.1	37	c.1078G>A	CCDS31738.1	.	.	.	.	.	.	.	.	.	.	.	6.909	0.537381	0.13188	.	.	ENSG00000171847	ENST00000307435;ENST00000538603	T;T	0.14391	2.51;2.51	1.02	-2.04	0.07343	.	.	.	.	.	T	0.07773	0.0195	N	0.25647	0.755	0.09310	N	1	P	0.50443	0.935	P	0.44623	0.455	T	0.17137	-1.0379	9	0.10636	T	0.68	-0.8115	3.6917	0.08348	0.0:0.3159:0.4624:0.2217	.	360	Q86YD7	F90A1_HUMAN	N	360	ENSP00000307798:D360N;ENSP00000445418:D360N	ENSP00000307798:D360N	D	-	1	0	FAM90A1	8266002	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	-0.779000	0.04659	-1.851000	0.01168	-1.031000	0.02408	GAC		0.677	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400468.1	NM_018088		5	57	0	0	0	0.001168	0	5	57				
IPO8	10526	broad.mit.edu	37	12	30792602	30792602	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:30792602C>A	ENST00000256079.4	-	21	2674	c.2336G>T	c.(2335-2337)cGt>cTt	p.R779L	IPO8_ENST00000544829.1_Missense_Mutation_p.R574L	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	779					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ACACATAGTACGAAGCTCACT	0.433																																							uc001rjd.2		NA																	0				skin(2)|central_nervous_system(1)	3						c.(2335-2337)CGT>CTT		importin 8							167.0	155.0	159.0					12																	30792602		2203	4300	6503	SO:0001583	missense	10526				intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding	g.chr12:30792602C>A	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2336G>T	12.37:g.30792602C>A	ENSP00000256079:p.Arg779Leu		Somatic				IPO8_uc001rje.1_Missense_Mutation_p.R268L|IPO8_uc010sjt.1_Missense_Mutation_p.R574L	p.R779L	NM_006390	NP_006381	WXS	Illumina HiSeq	Unspecified	O15397	IPO8_HUMAN			21	2506	-	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)		779					B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	37	c.2336G>T	CCDS8719.1	.	.	.	.	.	.	.	.	.	.	C	35	5.423616	0.96111	.	.	ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829	T;T	0.49720	0.77;0.77	5.27	5.27	0.74061	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71945	0.3400	M	0.80508	2.5	0.80722	D	1	D;D;D	0.89917	0.995;1.0;0.989	P;D;P	0.87578	0.906;0.998;0.853	T	0.75456	-0.3311	10	0.62326	D	0.03	-9.6984	18.8707	0.92313	0.0:1.0:0.0:0.0	.	574;255;779	B7Z7M3;Q59F59;O15397	.;.;IPO8_HUMAN	L	779;255;574	ENSP00000256079:R779L;ENSP00000444520:R574L	ENSP00000256079:R779L	R	-	2	0	IPO8	30683869	1.000000	0.71417	0.707000	0.30419	0.956000	0.61745	7.532000	0.81985	2.471000	0.83476	0.563000	0.77884	CGT		0.433	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390		7	54	1	0	5.18039e-06	0.00308	6.28918e-06	7	54				
GLIPR1L1	256710	broad.mit.edu	37	12	75763886	75763886	+	Missense_Mutation	SNP	C	C	T	rs533449405		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:75763886C>T	ENST00000378695.4	+	6	749	c.659C>T	c.(658-660)aCg>aTg	p.T220M	GLIPR1L1_ENST00000312442.2_Missense_Mutation_p.T211M|CAPS2_ENST00000442339.2_Intron|GLIPR1L1_ENST00000548623.1_3'UTR			Q6UWM5	GPRL1_HUMAN	GLI pathogenesis-related 1 like 1	220					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|sperm connecting piece (GO:0097224)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10						CTGAAGCCAACGGGGAGAGCA	0.323													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13994	0.0		0.0	False		,,,				2504	0.0						uc001sxo.2		NA																	0					0						c.(658-660)ACG>ATG		GLI pathogenesis-related 1 like 1							76.0	82.0	80.0					12																	75763886		2203	4300	6503	SO:0001583	missense	256710					extracellular region		g.chr12:75763886C>T	BC014603	CCDS9009.1	12q21.1	2014-06-03				ENSG00000173401			28392	protein-coding gene	gene with protein product		610395				12477932	Standard	NM_152779		Approved	MGC26856	uc001sxn.3	Q6UWM5	OTTHUMG00000169755	ENST00000378695.4:c.659C>T	12.37:g.75763886C>T	ENSP00000367967:p.Thr220Met		Somatic				CAPS2_uc001sxm.3_Intron|CAPS2_uc009zsa.2_Intron|GLIPR1L1_uc001sxn.2_Missense_Mutation_p.T211M	p.T220M	NM_152779	NP_689992	WXS	Illumina HiSeq	Unspecified	Q6UWM5	GPRL1_HUMAN			6	705	+			220					Q96L06	Missense_Mutation	SNP	ENST00000378695.4	37	c.659C>T		.	.	.	.	.	.	.	.	.	.	C	7.036	0.561583	0.13498	.	.	ENSG00000173401	ENST00000378695;ENST00000312442	T;T	0.08546	3.09;3.08	3.48	-6.97	0.01616	.	2.095630	0.02643	N	0.105616	T	0.03220	0.0094	N	0.02011	-0.69	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.43310	-0.9399	10	0.42905	T	0.14	.	8.8216	0.35030	0.2132:0.6444:0.0:0.1424	.	220;211	Q6UWM5;Q6UWM5-2	GPRL1_HUMAN;.	M	220;211	ENSP00000367967:T220M;ENSP00000310770:T211M	ENSP00000310770:T211M	T	+	2	0	GLIPR1L1	74050153	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.863000	0.04259	-1.066000	0.03164	-0.351000	0.07748	ACG		0.323	GLIPR1L1-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000405714.1	NM_152779		4	33	0	0	0	0.000602	0	4	33				
NAV3	89795	broad.mit.edu	37	12	78562599	78562599	+	Missense_Mutation	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:78562599A>G	ENST00000397909.2	+	24	5107	c.4934A>G	c.(4933-4935)cAg>cGg	p.Q1645R	NAV3_ENST00000266692.7_Missense_Mutation_p.Q1468R|NAV3_ENST00000228327.6_Missense_Mutation_p.Q1645R|NAV3_ENST00000536525.2_Missense_Mutation_p.Q1645R			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1645						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCTGCTGCCCAGGCGGCTATT	0.398										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(4933-4935)CAG>CGG		neuron navigator 3							80.0	81.0	81.0					12																	78562599		1819	4076	5895	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78562599A>G	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4934A>G	12.37:g.78562599A>G	ENSP00000381007:p.Gln1645Arg	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.Q1645R|NAV3_uc010sub.1_Missense_Mutation_p.Q1131R|NAV3_uc009zsf.2_Missense_Mutation_p.Q476R	p.Q1645R	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			24	5107	+			1645			Potential.		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.4934A>G		.	.	.	.	.	.	.	.	.	.	A	28.0	4.881599	0.91740	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	D;D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36;-3.36	5.41	5.41	0.78517	.	0.000000	0.38005	U	0.001858	D	0.96134	0.8740	M	0.72353	2.195	0.80722	D	1	B;D;B;D	0.67145	0.042;0.981;0.009;0.996	B;D;B;D	0.75484	0.033;0.969;0.004;0.986	D	0.96155	0.9111	10	0.52906	T	0.07	-13.8324	15.7378	0.77859	1.0:0.0:0.0:0.0	.	1645;1468;1645;1645	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.;.;NAV3_HUMAN;.	R	1645;1645;1645;1468;266;274	ENSP00000446132:Q1645R;ENSP00000381007:Q1645R;ENSP00000228327:Q1645R;ENSP00000266692:Q1468R;ENSP00000448303:Q274R	ENSP00000228327:Q1645R	Q	+	2	0	NAV3	77086730	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.287000	0.95975	2.185000	0.69588	0.528000	0.53228	CAG		0.398	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		36	55	0	0	0	0.007835	0	36	55				
RASSF9	9182	broad.mit.edu	37	12	86199250	86199250	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:86199250G>C	ENST00000361228.3	-	2	906	c.538C>G	c.(538-540)Cga>Gga	p.R180G		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	180					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)			endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATATTATCTCGATCATGAGAA	0.363																																							uc001taf.1		NA																	0				ovary(1)	1						c.(538-540)CGA>GGA		Ras association (RalGDS/AF-6) domain family							165.0	155.0	158.0					12																	86199250		1836	4097	5933	SO:0001583	missense	9182				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity	g.chr12:86199250G>C		CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.538C>G	12.37:g.86199250G>C	ENSP00000354884:p.Arg180Gly		Somatic					p.R180G	NM_005447	NP_005438	WXS	Illumina HiSeq	Unspecified	O75901	RASF9_HUMAN			2	877	-			180					B3KMQ4|Q8N5U8	Missense_Mutation	SNP	ENST00000361228.3	37	c.538C>G	CCDS44950.1	.	.	.	.	.	.	.	.	.	.	G	6.804	0.517486	0.13005	.	.	ENSG00000198774	ENST00000361228	T	0.46063	0.88	4.91	4.02	0.46733	.	0.000000	0.51477	D	0.000094	T	0.32496	0.0831	L	0.39898	1.24	0.09310	N	1	P	0.40302	0.712	B	0.38378	0.272	T	0.11227	-1.0596	10	0.21540	T	0.41	-8.9896	12.2718	0.54710	0.0:0.0:0.5328:0.4672	.	180	O75901	RASF9_HUMAN	G	180	ENSP00000354884:R180G	ENSP00000354884:R180G	R	-	1	2	RASSF9	84723381	0.005000	0.15991	0.795000	0.32087	0.322000	0.28314	0.876000	0.28092	1.202000	0.43218	-0.152000	0.13540	CGA		0.363	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1			46	84	0	0	0	0.00361	0	46	84				
WSCD2	9671	broad.mit.edu	37	12	108589931	108589931	+	Missense_Mutation	SNP	G	G	T	rs371652885		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:108589931G>T	ENST00000332082.4	+	3	1140	c.322G>T	c.(322-324)Ggt>Tgt	p.G108C	WSCD2_ENST00000549903.1_Missense_Mutation_p.G108C|WSCD2_ENST00000261400.3_Missense_Mutation_p.G108C|WSCD2_ENST00000547525.1_Missense_Mutation_p.G108C			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	108						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						TGGCGACTACGGTGGAGCCTG	0.607																																							uc001tms.2		NA																	0				ovary(1)|large_intestine(1)|breast(1)	3						c.(322-324)GGT>TGT		WSC domain containing 2							52.0	54.0	54.0					12																	108589931		2004	4170	6174	SO:0001583	missense	9671					integral to membrane		g.chr12:108589931G>T		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.322G>T	12.37:g.108589931G>T	ENSP00000331933:p.Gly108Cys		Somatic				WSCD2_uc001tmt.2_Missense_Mutation_p.G108C	p.G108C	NM_014653	NP_055468	WXS	Illumina HiSeq	Unspecified	Q2TBF2	WSCD2_HUMAN			2	1066	+			108					B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	c.322G>T	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030779	0.75504	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.31247	1.51;1.5;1.51;1.5	5.74	5.74	0.90152	.	0.161882	0.56097	D	0.000038	T	0.51618	0.1685	L	0.60455	1.87	0.45690	D	0.998609	D	0.76494	0.999	D	0.65010	0.931	T	0.36187	-0.9758	10	0.38643	T	0.18	-3.7818	18.8897	0.92395	0.0:0.0:1.0:0.0	.	108	Q2TBF2	WSCD2_HUMAN	C	108	ENSP00000448047:G108C;ENSP00000261400:G108C;ENSP00000331933:G108C;ENSP00000447272:G108C	ENSP00000261400:G108C	G	+	1	0	WSCD2	107114061	1.000000	0.71417	0.992000	0.48379	0.767000	0.43475	4.027000	0.57239	2.704000	0.92352	0.655000	0.94253	GGT		0.607	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653		15	59	1	0	2.61681e-11	0.00245	3.726e-11	15	59				
WSCD2	9671	broad.mit.edu	37	12	108604067	108604067	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:108604067G>T	ENST00000332082.4	+	5	1485	c.667G>T	c.(667-669)Gag>Tag	p.E223*	WSCD2_ENST00000549903.1_Nonsense_Mutation_p.E223*|WSCD2_ENST00000261400.3_Nonsense_Mutation_p.E223*|WSCD2_ENST00000547525.1_Nonsense_Mutation_p.E223*			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	223						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						GCTGGCCCAGGAGTCGGCCCG	0.677																																							uc001tms.2		NA																	0				ovary(1)|large_intestine(1)|breast(1)	3						c.(667-669)GAG>TAG		WSC domain containing 2							12.0	17.0	15.0					12																	108604067		2168	4258	6426	SO:0001587	stop_gained	9671					integral to membrane		g.chr12:108604067G>T		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.667G>T	12.37:g.108604067G>T	ENSP00000331933:p.Glu223*		Somatic				WSCD2_uc001tmt.2_Nonsense_Mutation_p.E223*	p.E223*	NM_014653	NP_055468	WXS	Illumina HiSeq	Unspecified	Q2TBF2	WSCD2_HUMAN			4	1411	+			223					B2RN48|B4DES1|Q8IY35|Q9Y4B7	Nonsense_Mutation	SNP	ENST00000332082.4	37	c.667G>T	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	G	38	7.164296	0.98107	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000551638;ENST00000332082;ENST00000549903	.	.	.	5.12	5.12	0.69794	.	0.108661	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-26.3225	17.1039	0.86657	0.0:0.0:1.0:0.0	.	.	.	.	X	223;223;70;223;223	.	ENSP00000261400:E223X	E	+	1	0	WSCD2	107128197	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.968000	0.93407	2.379000	0.81126	0.555000	0.69702	GAG		0.677	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653		4	6	1	0	0.00024832	0.009096	0.000278054	4	6				
WSCD2	9671	broad.mit.edu	37	12	108634285	108634285	+	Missense_Mutation	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:108634285A>G	ENST00000332082.4	+	9	2127	c.1309A>G	c.(1309-1311)Ata>Gta	p.I437V	WSCD2_ENST00000549903.1_Missense_Mutation_p.I437V|WSCD2_ENST00000261400.3_Missense_Mutation_p.I437V|WSCD2_ENST00000547525.1_Missense_Mutation_p.I437V			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	437						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						CGGCGGCCACATAGGCTTTGC	0.652																																							uc001tms.2		NA																	0				ovary(1)|large_intestine(1)|breast(1)	3						c.(1309-1311)ATA>GTA		WSC domain containing 2							73.0	76.0	75.0					12																	108634285		1945	4134	6079	SO:0001583	missense	9671					integral to membrane		g.chr12:108634285A>G		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.1309A>G	12.37:g.108634285A>G	ENSP00000331933:p.Ile437Val		Somatic				WSCD2_uc001tmt.2_Missense_Mutation_p.I437V|WSCD2_uc001tmu.2_Missense_Mutation_p.I185V	p.I437V	NM_014653	NP_055468	WXS	Illumina HiSeq	Unspecified	Q2TBF2	WSCD2_HUMAN			8	2053	+			437					B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	c.1309A>G	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	A	9.560	1.118262	0.20877	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.28454	1.67;1.61;1.67;1.61	4.77	2.41	0.29592	.	0.225583	0.46145	N	0.000307	T	0.12305	0.0299	N	0.10760	0.04	0.46279	D	0.998967	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.13019	-1.0525	10	0.10636	T	0.68	-26.0992	7.0894	0.25275	0.7445:0.0:0.2555:0.0	.	437;437	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	V	437	ENSP00000448047:I437V;ENSP00000261400:I437V;ENSP00000331933:I437V;ENSP00000447272:I437V	ENSP00000261400:I437V	I	+	1	0	WSCD2	107158415	1.000000	0.71417	0.994000	0.49952	0.791000	0.44710	2.293000	0.43558	0.340000	0.23745	0.449000	0.29647	ATA		0.652	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653		17	73	0	0	0	0.006122	0	17	73				
TRPV4	59341	broad.mit.edu	37	12	110222182	110222182	+	Silent	SNP	C	C	A	rs141301107		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:110222182C>A	ENST00000418703.2	-	14	2491	c.2397G>T	c.(2395-2397)ccG>ccT	p.P799P	TRPV4_ENST00000544971.1_Silent_p.P692P|TRPV4_ENST00000537083.1_Silent_p.P739P|TRPV4_ENST00000346520.2_Silent_p.P739P|TRPV4_ENST00000261740.2_Silent_p.P799P|TRPV4_ENST00000541794.1_Silent_p.P752P|TRPV4_ENST00000536838.1_Silent_p.P765P|TRPV4_ENST00000392719.2_Silent_p.P752P	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	799			P -> A (in MTD). {ECO:0000269|PubMed:20577006}.|P -> L (in MTD; also found in a patient with spondyloepiphyseal dysplasia Maroteaux type). {ECO:0000269|PubMed:19232556, ECO:0000269|PubMed:20425821, ECO:0000269|PubMed:20503319, ECO:0000269|PubMed:20577006}.|P -> R (in MTD). {ECO:0000269|PubMed:20577006}.|P -> S (in MTD). {ECO:0000269|PubMed:20577006}.		actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						CATTCTTGCCCGGGTCCTCGT	0.627																																							uc001tpj.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(2395-2397)CCG>CCT		transient receptor potential cation channel,							165.0	141.0	149.0					12																	110222182		2203	4300	6503	SO:0001819	synonymous_variant	59341				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding	g.chr12:110222182C>A	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.2397G>T	12.37:g.110222182C>A			Somatic				TRPV4_uc001tpg.1_Silent_p.P765P|TRPV4_uc001tph.1_Silent_p.P752P|TRPV4_uc001tpi.1_Silent_p.P692P|TRPV4_uc001tpk.1_Silent_p.P799P|TRPV4_uc001tpl.1_Silent_p.P739P	p.P799P	NM_021625	NP_067638	WXS	Illumina HiSeq	Unspecified	Q9HBA0	TRPV4_HUMAN			14	2492	-			799		P -> R (in MTD).|P -> S (in MTD).|P -> L (in MTD; also found in a patient with spondyloepiphyseal dysplasia Maroteaux type).|P -> A (in MTD).	Cytoplasmic (Potential).		B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Silent	SNP	ENST00000418703.2	37	c.2397G>T	CCDS9134.1																																																																																				0.627	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625		39	81	1	0	9.62906e-15	0.00623	1.48074e-14	39	81				
HVCN1	84329	broad.mit.edu	37	12	111099086	111099086	+	Silent	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:111099086T>C	ENST00000356742.5	-	3	942	c.189A>G	c.(187-189)tcA>tcG	p.S63S	HVCN1_ENST00000439744.2_Silent_p.S43S|HVCN1_ENST00000548312.1_Silent_p.S63S|HVCN1_ENST00000242607.8_Silent_p.S63S			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	63					cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						CTTCCTCGCCTGAGACTGGTG	0.607																																							uc001trs.1		NA																	0				skin(1)	1						c.(187-189)TCA>TCG		hydrogen voltage-gated channel 1							62.0	65.0	64.0					12																	111099086		2203	4300	6503	SO:0001819	synonymous_variant	84329				response to pH|response to zinc ion	integral to membrane	voltage-gated proton channel activity	g.chr12:111099086T>C	BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.189A>G	12.37:g.111099086T>C			Somatic				HVCN1_uc001trq.1_Silent_p.S63S|HVCN1_uc001trt.1_Silent_p.S63S|HVCN1_uc010syd.1_Silent_p.S43S	p.S63S	NM_032369	NP_115745	WXS	Illumina HiSeq	Unspecified	Q96D96	HVCN1_HUMAN			4	354	-			63			Cytoplasmic (Potential).		A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	Silent	SNP	ENST00000356742.5	37	c.189A>G	CCDS31900.1																																																																																				0.607	HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404653.1	NM_032369		3	60	0	0	0	0.004672	0	3	60				
MED13L	23389	broad.mit.edu	37	12	116452946	116452947	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:116452946_116452947CC>AG	ENST00000281928.3	-	8	1348_1349	c.1142_1143GG>CT	c.(1141-1143)tGG>tCT	p.W381S		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	381						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TGCATTCCTTCCAGACTCGATG	0.441																																							uc001tvw.2		NA																	0				skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8						c.(1141-1143)TGG>TCT		mediator complex subunit 13-like																																				SO:0001583	missense	23389				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent			g.chr12:116452946_116452947CC>AG	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.1142_1143delinsAG	12.37:g.116452946_116452947delinsAG	ENSP00000281928:p.Trp381Ser		Somatic					p.W381S	NM_015335	NP_056150	WXS	Illumina HiSeq	Unspecified	Q71F56	MD13L_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0407)	8	1197_1198	-	all_neural(191;0.117)|Medulloblastoma(191;0.163)		381					A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	DNP	ENST00000281928.3	37	c.1142_1143GG>CT	CCDS9177.1																																																																																				0.441	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			8	61	0	0	0	0.004672	0	8	61				
FLT1	2321	broad.mit.edu	37	13	29008234	29008234	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr13:29008234C>A	ENST00000282397.4	-	5	888	c.637G>T	c.(637-639)Ggg>Tgg	p.G213W	FLT1_ENST00000539099.1_Missense_Mutation_p.G213W|FLT1_ENST00000541932.1_Missense_Mutation_p.G213W	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	213	Ig-like C2-type 2.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TACAAATGCCCATTGACTGTT	0.393																																							uc001usb.3		NA																	0				lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24						c.(637-639)GGG>TGG		fms-related tyrosine kinase 1 isoform 1	Sunitinib(DB01268)						154.0	128.0	137.0					13																	29008234		2203	4300	6503	SO:0001583	missense	2321				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity	g.chr13:29008234C>A	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.637G>T	13.37:g.29008234C>A	ENSP00000282397:p.Gly213Trp		Somatic				FLT1_uc010aar.1_Missense_Mutation_p.G213W|FLT1_uc001usc.3_Missense_Mutation_p.G213W|FLT1_uc010tdp.1_Missense_Mutation_p.G213W	p.G213W	NM_002019	NP_002010	WXS	Illumina HiSeq	Unspecified	P17948	VGFR1_HUMAN	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	5	922	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	213			Ig-like C2-type 2.|Extracellular (Potential).		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	c.637G>T	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.868310	0.72065	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000539099	T;T;T	0.12569	2.67;2.67;2.67	5.78	5.78	0.91487	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.46833	0.1413	M	0.87180	2.865	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.998;0.999;0.999;0.998	T	0.50923	-0.8770	10	0.87932	D	0	.	20.0118	0.97458	0.0:1.0:0.0:0.0	.	213;213;213;213	P17948-4;P17948-3;P17948-2;P17948	.;.;.;VGFR1_HUMAN	W	213	ENSP00000282397:G213W;ENSP00000437631:G213W;ENSP00000442630:G213W	ENSP00000282397:G213W	G	-	1	0	FLT1	27906234	0.997000	0.39634	0.805000	0.32314	0.906000	0.53458	3.845000	0.55880	2.742000	0.94016	0.650000	0.86243	GGG		0.393	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1			16	20	1	0	4.7546e-09	0.004007	6.37633e-09	16	20				
TRPC4	7223	broad.mit.edu	37	13	38237769	38237769	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr13:38237769C>T	ENST00000379705.3	-	6	2329	c.1472G>A	c.(1471-1473)cGt>cAt	p.R491H	TRPC4_ENST00000379681.3_Missense_Mutation_p.R491H|TRPC4_ENST00000494529.1_5'UTR|TRPC4_ENST00000355779.2_Missense_Mutation_p.R491H|TRPC4_ENST00000358477.2_Missense_Mutation_p.R491H|TRPC4_ENST00000379673.2_Missense_Mutation_p.R491H|TRPC4_ENST00000426868.2_Intron|TRPC4_ENST00000338947.5_Missense_Mutation_p.R318H|TRPC4_ENST00000447043.1_Missense_Mutation_p.R491H|TRPC4_ENST00000379679.1_Missense_Mutation_p.R318H			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	491					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.R491H(1)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TGAGATCAGACGCAGAGAACT	0.448																																							uc001uws.2		NA																	1	Substitution - Missense(1)		haematopoietic_and_lymphoid_tissue(1)	ovary(3)|skin(2)|breast(1)	6						c.(1471-1473)CGT>CAT		transient receptor potential cation channel,							82.0	81.0	81.0					13																	38237769		2203	4300	6503	SO:0001583	missense	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38237769C>T	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1472G>A	13.37:g.38237769C>T	ENSP00000369027:p.Arg491His		Somatic				TRPC4_uc010abv.2_Missense_Mutation_p.R71H|TRPC4_uc001uwt.2_Missense_Mutation_p.R491H|TRPC4_uc010tey.1_Missense_Mutation_p.R491H|TRPC4_uc010abw.2_Missense_Mutation_p.R318H|TRPC4_uc010abx.2_Missense_Mutation_p.R491H|TRPC4_uc010aby.2_Missense_Mutation_p.R491H	p.R491H	NM_016179	NP_057263	WXS	Illumina HiSeq	Unspecified	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	6	1707	-			491			Cytoplasmic (Potential).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	c.1472G>A	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	C	34	5.401162	0.96030	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D;D	0.99591	-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24	6.08	6.08	0.98989	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99648	0.9870	M	0.83012	2.62	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.995;0.999;0.999;0.995;0.999	D;D;D;D;D;D	0.80764	0.918;0.917;0.994;0.975;0.943;0.957	D	0.98450	1.0591	10	0.87932	D	0	-11.6098	20.6634	0.99662	0.0:1.0:0.0:0.0	.	491;491;491;318;491;491	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	H	491;491;318;318;491;491;491;491	ENSP00000369027:R491H;ENSP00000369003:R491H;ENSP00000342580:R318H;ENSP00000369001:R318H;ENSP00000348025:R491H;ENSP00000351264:R491H;ENSP00000368995:R491H;ENSP00000414316:R491H	ENSP00000342580:R318H	R	-	2	0	TRPC4	37135769	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.811000	0.86092	2.894000	0.99253	0.655000	0.94253	CGT		0.448	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		7	13	0	0	0	0.001984	0	7	13				
SLITRK5	26050	broad.mit.edu	37	13	88327901	88327901	+	Silent	SNP	C	C	T	rs373342343		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr13:88327901C>T	ENST00000325089.6	+	2	477	c.258C>T	c.(256-258)ctC>ctT	p.L86L	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	86					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TCTACCACCTCTTGTTGTCCG	0.458																																							uc001vln.2		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)	5						c.(256-258)CTC>CTT		SLIT and NTRK-like family, member 5 precursor		C		0,4406		0,0,2203	164.0	168.0	166.0		258	4.9	1.0	13		166	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLITRK5	NM_015567.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		86/959	88327901	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	26050					integral to membrane		g.chr13:88327901C>T	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.258C>T	13.37:g.88327901C>T			Somatic				SLITRK5_uc010tic.1_Intron	p.L86L	NM_015567	NP_056382	WXS	Illumina HiSeq	Unspecified	O94991	SLIK5_HUMAN			2	477	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		86			LRR 1.|Extracellular (Potential).		B3KNB8|B4DSH5|Q5VT81	Silent	SNP	ENST00000325089.6	37	c.258C>T	CCDS9465.1																																																																																				0.458	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			32	79	0	0	0	0.009535	0	32	79				
PABPN1	8106	broad.mit.edu	37	14	23792633	23792633	+	Silent	SNP	C	C	G	rs150035782		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr14:23792633C>G	ENST00000216727.4	+	4	763	c.582C>G	c.(580-582)ggC>ggG	p.G194G	AL049829.1_ENST00000594872.1_5'Flank|BCL2L2-PABPN1_ENST00000557008.1_Silent_p.G221G|PABPN1_ENST00000556821.1_Silent_p.G66G|PABPN1_ENST00000397276.2_Silent_p.G194G|PABPN1_ENST00000557702.1_Silent_p.G66G|BCL2L2-PABPN1_ENST00000553781.1_Silent_p.G221G	NM_004643.3	NP_004634.1	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	194	Necessary for homooligomerization.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|muscle contraction (GO:0006936)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			large_intestine(1)|lung(1)|ovary(2)	4	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		ACTTTCATGGCTGTGGTTCAG	0.433																																							uc001wjk.2		NA																	0				ovary(2)	2						c.(580-582)GGC>GGG		poly(A) binding protein, nuclear 1		C	,	1,4405	2.1+/-5.4	0,1,2202	99.0	97.0	97.0		663,582	4.0	1.0	14	dbSNP_134	97	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PABPN1,BCL2L2-PABPN1	NM_001199864.1,NM_004643.3	,	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	,	221/334,194/307	23792633	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8106				modification by virus of host mRNA processing|mRNA 3'-end processing|muscle contraction|nuclear mRNA splicing, via spliceosome|poly(A)+ mRNA export from nucleus|termination of RNA polymerase II transcription|viral infectious cycle	cytoplasm|nucleoplasm|ribonucleoprotein complex	nucleotide binding|protein binding|RNA binding	g.chr14:23792633C>G	AF026029	CCDS9592.1	14q11.2	2013-02-12	2001-11-28		ENSG00000100836	ENSG00000100836		"""RNA binding motif (RRM) containing"""	8565	protein-coding gene	gene with protein product		602279	"""poly(A)-binding protein, nuclear 1"""	OPMD, PABP2		7795598	Standard	NM_004643		Approved	PAB2		Q86U42	OTTHUMG00000028739	ENST00000216727.4:c.582C>G	14.37:g.23792633C>G			Somatic				PABPN1_uc001wjh.3_Silent_p.G221G|PABPN1_uc001wjj.2_Silent_p.G194G	p.G194G	NM_004643	NP_004634	WXS	Illumina HiSeq	Unspecified	Q86U42	PABP2_HUMAN		GBM - Glioblastoma multiforme(265;0.00643)	4	1864	+	all_cancers(95;6.69e-06)		194			Necessary for homooligomerization.|RRM.		D3DS49|O43484	Silent	SNP	ENST00000216727.4	37	c.582C>G	CCDS9592.1																																																																																				0.433	PABPN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071767.4	NM_004643		10	86	0	0	0	0.001855	0	10	86				
NOVA1	4857	broad.mit.edu	37	14	26917552	26917552	+	Silent	SNP	C	C	A	rs144344947		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr14:26917552C>A	ENST00000539517.2	-	5	1454	c.1137G>T	c.(1135-1137)acG>acT	p.T379T	NOVA1_ENST00000465357.2_Silent_p.T355T|NOVA1_ENST00000267422.7_Silent_p.T257T	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	382	Ala-rich.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		ATGTCCCCGCCGTACCACCAG	0.567																																							uc001wpy.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5						c.(1135-1137)ACG>ACT		neuro-oncological ventral antigen 1 isoform 1							23.0	28.0	26.0					14																	26917552		2200	4298	6498	SO:0001819	synonymous_variant	4857				locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding	g.chr14:26917552C>A	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.1137G>T	14.37:g.26917552C>A			Somatic				NOVA1_uc001wpz.2_Silent_p.T355T|NOVA1_uc001wqa.2_Silent_p.T257T	p.T379T	NM_002515	NP_002506	WXS	Illumina HiSeq	Unspecified	P51513	NOVA1_HUMAN		GBM - Glioblastoma multiforme(265;0.0135)	5	1455	-			382			Ala-rich.		A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Silent	SNP	ENST00000539517.2	37	c.1137G>T	CCDS32061.1																																																																																				0.567	NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000073261.3	NM_006491		11	30	1	0	0.00136819	0.001368	0.00148866	11	30				
NOVA1	4857	broad.mit.edu	37	14	26917570	26917570	+	Silent	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr14:26917570G>A	ENST00000539517.2	-	5	1436	c.1119C>T	c.(1117-1119)ggC>ggT	p.G373G	NOVA1_ENST00000465357.2_Silent_p.G349G|NOVA1_ENST00000267422.7_Silent_p.G251G	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	376	Ala-rich.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		CAGCTGTGCTGCCACTGGCTG	0.577																																							uc001wpy.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5						c.(1117-1119)GGC>GGT		neuro-oncological ventral antigen 1 isoform 1							24.0	28.0	27.0					14																	26917570		2202	4298	6500	SO:0001819	synonymous_variant	4857				locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding	g.chr14:26917570G>A	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.1119C>T	14.37:g.26917570G>A			Somatic				NOVA1_uc001wpz.2_Silent_p.G349G|NOVA1_uc001wqa.2_Silent_p.G251G	p.G373G	NM_002515	NP_002506	WXS	Illumina HiSeq	Unspecified	P51513	NOVA1_HUMAN		GBM - Glioblastoma multiforme(265;0.0135)	5	1437	-			376			Ala-rich.		A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Silent	SNP	ENST00000539517.2	37	c.1119C>T	CCDS32061.1																																																																																				0.577	NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000073261.3	NM_006491		7	27	0	0	0	0.00308	0	7	27				
ASB2	51676	broad.mit.edu	37	14	94413696	94413696	+	Splice_Site	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr14:94413696T>C	ENST00000315988.4	-	5	1395	c.907A>G	c.(907-909)Agg>Ggg	p.R303G	ASB2_ENST00000555019.1_Splice_Site_p.R351G|ASB2_ENST00000556337.1_Intron|MIR4506_ENST00000584693.1_RNA	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	303					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		TGGGCTGACCTGTAGTTGCCC	0.642																																							uc001ycc.1		NA																	0				ovary(1)|pancreas(1)	2						c.(907-909)AGG>GGG		ankyrin repeat and SOCS box-containing protein							127.0	108.0	114.0					14																	94413696		2203	4300	6503	SO:0001630	splice_region_variant	51676				intracellular signal transduction			g.chr14:94413696T>C	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.908+1A>G	14.37:g.94413696T>C			Somatic				ASB2_uc001ycd.2_Missense_Mutation_p.R351G|ASB2_uc001yce.1_Missense_Mutation_p.R249G	p.R303G	NM_016150	NP_057234	WXS	Illumina HiSeq	Unspecified	Q96Q27	ASB2_HUMAN		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)	5	1396	-		all_cancers(154;0.13)	303			ANK 8.		B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	c.907A>G	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	T	11.29	1.594830	0.28445	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.64991	2.42;-0.13;-0.09	5.19	5.19	0.71726	Ankyrin repeat-containing domain (4);	0.438351	0.26867	N	0.022084	T	0.34193	0.0889	N	0.04320	-0.23	0.32938	D	0.518067	B;B;B	0.33777	0.009;0.425;0.009	B;B;B	0.28916	0.006;0.096;0.009	T	0.47598	-0.9105	10	0.32370	T	0.25	-5.6258	7.4996	0.27509	0.0:0.1686:0.0:0.8314	.	319;351;303	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	G	351;319;303;249;249	ENSP00000451575:R351G;ENSP00000320675:R303G;ENSP00000450940:R249G	ENSP00000320675:R303G	R	-	1	2	ASB2	93483449	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	0.828000	0.27435	1.957000	0.56846	0.379000	0.24179	AGG		0.642	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		Missense_Mutation	20	51	0	0	0	0.002299	0	20	51				
TNFAIP2	7127	broad.mit.edu	37	14	103601623	103601623	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr14:103601623C>T	ENST00000560869.1	+	12	2530	c.1891C>T	c.(1891-1893)Cgg>Tgg	p.R631W	TNFAIP2_ENST00000538222.1_Missense_Mutation_p.R114W|TNFAIP2_ENST00000451723.2_Missense_Mutation_p.R300W|TNFAIP2_ENST00000333007.1_Missense_Mutation_p.R631W			Q03169	TNAP2_HUMAN	tumor necrosis factor, alpha-induced protein 2	631					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|exocytosis (GO:0006887)	exocyst (GO:0000145)|extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	11		Melanoma(154;0.155)	Epithelial(46;0.191)			CAAGCGCATCCGGAGCATCTT	0.582																																							uc001ymm.1		NA																	0				central_nervous_system(1)	1						c.(1891-1893)CGG>TGG		tumor necrosis factor, alpha-induced protein 2							163.0	164.0	164.0					14																	103601623		2203	4300	6503	SO:0001583	missense	7127				angiogenesis|cell differentiation	extracellular space		g.chr14:103601623C>T		CCDS9979.1	14q32	2011-01-31				ENSG00000185215			11895	protein-coding gene	gene with protein product	"""exocyst complex component 3-like 3"""	603300				1374453	Standard	NM_006291		Approved	B94, EXOC3L3	uc001ymm.1	Q03169		ENST00000560869.1:c.1891C>T	14.37:g.103601623C>T	ENSP00000452634:p.Arg631Trp		Somatic				TNFAIP2_uc010awo.1_Missense_Mutation_p.R291W|TNFAIP2_uc010txz.1_Missense_Mutation_p.R300W|TNFAIP2_uc010tya.1_Missense_Mutation_p.R114W	p.R631W	NM_006291	NP_006282	WXS	Illumina HiSeq	Unspecified	Q03169	TNAP2_HUMAN	Epithelial(46;0.191)		11	2022	+		Melanoma(154;0.155)	631					Q86VI0	Missense_Mutation	SNP	ENST00000560869.1	37	c.1891C>T	CCDS9979.1	.	.	.	.	.	.	.	.	.	.	c	14.81	2.647402	0.47258	.	.	ENSG00000185215	ENST00000333007;ENST00000451723;ENST00000538222	T;T;T	0.06687	3.27;3.27;3.27	4.6	3.56	0.40772	.	0.567867	0.17271	N	0.180362	T	0.21145	0.0509	L	0.57536	1.79	0.29036	N	0.885391	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73708	0.944;0.965;0.981	T	0.00948	-1.1504	10	0.66056	D	0.02	-24.3518	8.7367	0.34532	0.2856:0.7144:0.0:0.0	.	114;408;631	F6RNL3;A1A584;Q03169	.;.;TNAP2_HUMAN	W	631;300;114	ENSP00000332326:R631W;ENSP00000393256:R300W;ENSP00000446171:R114W	ENSP00000332326:R631W	R	+	1	2	TNFAIP2	102671376	0.986000	0.35501	1.000000	0.80357	0.310000	0.27922	0.609000	0.24238	2.287000	0.76781	0.444000	0.29173	CGG		0.582	TNFAIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415674.1	NM_006291		20	286	0	0	0	0.008871	0	20	286				
Unknown	0	broad.mit.edu	37	15	22440691	22440691	+	IGR	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr15:22440691G>C								RP11-2F9.4 (4514 upstream) : IGHV1OR15-1 (7690 downstream)																							AGTATTTCTTGTTACCTCCCC	0.532																																							uc001yug.2		NA																	0					NA						c.(154-156)AAC>AAG		full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).																																				SO:0001628	intergenic_variant	0							g.chr15:22440691G>C																													15.37:g.22440691G>C			Somatic					p.N52K			WXS	Illumina HiSeq	Unspecified					1	175	-									Missense_Mutation	SNP		37	c.156C>G																																																																																				0	0.532									3	16	0	0	0	0.004672	0	3	16				
NPAP1	23742	broad.mit.edu	37	15	24923001	24923001	+	Missense_Mutation	SNP	A	A	T	rs375914427		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr15:24923001A>T	ENST00000329468.2	+	1	2461	c.1987A>T	c.(1987-1989)Agt>Tgt	p.S663C		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	663					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TTCTCTCCCCAGTGCCTGTGT	0.507																																							uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(1987-1989)AGT>TGT		hypothetical protein LOC23742							144.0	136.0	139.0					15																	24923001		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24923001A>T	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1987A>T	15.37:g.24923001A>T	ENSP00000333735:p.Ser663Cys		Somatic					p.S663C	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	2461	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	663						Missense_Mutation	SNP	ENST00000329468.2	37	c.1987A>T	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	7.454	0.643320	0.14451	.	.	ENSG00000185823	ENST00000329468	T	0.06933	3.24	1.73	-3.47	0.04753	.	1.355470	0.05179	N	0.500996	T	0.04907	0.0132	L	0.27053	0.805	0.09310	N	1	P	0.44006	0.824	B	0.31016	0.123	T	0.34650	-0.9820	10	0.66056	D	0.02	.	7.2934	0.26378	0.6322:0.0:0.3678:0.0	.	663	Q9NZP6	CO002_HUMAN	C	663	ENSP00000333735:S663C	ENSP00000333735:S663C	S	+	1	0	C15orf2	22474094	0.000000	0.05858	0.000000	0.03702	0.105000	0.19272	-1.166000	0.03129	-1.378000	0.02120	-1.073000	0.02249	AGT		0.507	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		18	91	0	0	0	0.001882	0	18	91				
GABRG3	2567	broad.mit.edu	37	15	27573971	27573971	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr15:27573971G>C	ENST00000333743.6	+	5	764	c.510G>C	c.(508-510)gaG>gaC	p.E170D	GABRG3_ENST00000555083.1_Missense_Mutation_p.E170D	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	170					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCAATGCTGAGTGCCAGCTGC	0.597																																					NSCLC(114;800 1656 7410 37729 45293)	NSCLC(114;800 1656 7410 37729 45293)	uc001zbg.1		NA																	0					0						c.(508-510)GAG>GAC		gamma-aminobutyric acid (GABA) A receptor, gamma							79.0	80.0	80.0					15																	27573971		2142	4253	6395	SO:0001583	missense	2567				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27573971G>C		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.510G>C	15.37:g.27573971G>C	ENSP00000331912:p.Glu170Asp		Somatic				GABRG3_uc001zbf.2_Missense_Mutation_p.E170D	p.E170D	NM_033223	NP_150092	WXS	Illumina HiSeq	Unspecified	Q99928	GBRG3_HUMAN		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	5	676	+		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)	170			Extracellular (Probable).		G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	c.510G>C	CCDS45195.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.75|16.75	3.209918|3.209918	0.58343|0.58343	.|.	.|.	ENSG00000182256|ENSG00000182256	ENST00000333743;ENST00000555083;ENST00000554696|ENST00000557596	T;T;T|.	0.79352|.	-1.26;-1.26;-1.26|.	5.35|5.35	2.94|2.94	0.34122|0.34122	Neurotransmitter-gated ion-channel ligand-binding (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72977|0.72977	0.3528|0.3528	M|M	0.84683|0.84683	2.71|2.71	0.41929|0.41929	D|D	0.990559|0.990559	D;D|.	0.76494|.	0.986;0.999|.	D;D|.	0.77004|.	0.957;0.989|.	T|T	0.74003|0.74003	-0.3804|-0.3804	10|5	0.42905|.	T|.	0.14|.	.|.	7.8875|7.8875	0.29659|0.29659	0.3136:0.0:0.6864:0.0|0.3136:0.0:0.6864:0.0	.|.	170;170|.	Q99928;G3V594|.	GBRG3_HUMAN;.|.	D|T	170;170;112|3	ENSP00000331912:E170D;ENSP00000452244:E170D;ENSP00000451862:E112D|.	ENSP00000331912:E170D|.	E|S	+|+	3|2	2|0	GABRG3|GABRG3	25156717|25156717	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.872000|0.872000	0.50106|0.50106	0.466000|0.466000	0.22019|0.22019	1.294000|1.294000	0.44707|0.44707	0.563000|0.563000	0.77884|0.77884	GAG|AGT		0.597	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2			8	30	0	0	0	0.00308	0	8	30				
FAN1	22909	broad.mit.edu	37	15	31197996	31197997	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr15:31197996_31197997GG>TT	ENST00000362065.4	+	2	1421_1422	c.1130_1131GG>TT	c.(1129-1131)cGG>cTT	p.R377L	FAN1_ENST00000561594.1_Missense_Mutation_p.R377L|FAN1_ENST00000565466.1_Missense_Mutation_p.R377L|FAN1_ENST00000561607.1_Missense_Mutation_p.R377L	NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	377					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)	p.R377L(1)		autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						TACTACCTTCGGAGTTTCCTTG	0.426								Direct reversal of damage																															uc001zff.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1129-1131)CGG>CTT	Direct_reversal_of_damage|Editing_and_processing_nucleases	myotubularin related protein 15 isoform a																																				SO:0001583	missense	22909				double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding	g.chr15:31197996_31197997GG>TT		CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		Exception_encountered	15.37:g.31197996_31197997delinsTT	ENSP00000354497:p.Arg377Leu		Somatic				MTMR15_uc001zfc.3_Missense_Mutation_p.R377L|MTMR15_uc010azw.2_Missense_Mutation_p.R377L|MTMR15_uc001zfd.3_Missense_Mutation_p.R377L|MTMR15_uc001zfe.2_5'UTR	p.R377L	NM_014967	NP_055782	WXS	Illumina HiSeq	Unspecified	Q9Y2M0	FAN1_HUMAN		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)	2	1421_1422	+		all_lung(180;2.23e-09)	377					A8K4M2|Q86WU8	Missense_Mutation	DNP	ENST00000362065.4	37	c.1130_1131GG>TT	CCDS32186.1																																																																																				0.426	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430740.1	NM_014967		23	90	0	0	0	0.004672	0	23	90				
RYR3	6263	broad.mit.edu	37	15	34016317	34016317	+	Silent	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr15:34016317A>T	ENST00000389232.4	+	45	6922	c.6852A>T	c.(6850-6852)gcA>gcT	p.A2284A	RYR3_ENST00000415757.3_Silent_p.A2284A|Y_RNA_ENST00000363138.1_RNA	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2284	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGGGCAATGCAATTATGTCAT	0.498																																							uc001zhi.2		NA																	0				ovary(5)|central_nervous_system(4)|lung(1)	10						c.(6850-6852)GCA>GCT		ryanodine receptor 3							116.0	120.0	118.0					15																	34016317		1977	4163	6140	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34016317A>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.6852A>T	15.37:g.34016317A>T			Somatic				RYR3_uc010bar.2_Silent_p.A2284A	p.A2284A	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	45	6922	+		all_lung(180;7.18e-09)	2284			4 X approximate repeats.|Cytoplasmic (By similarity).		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.6852A>T	CCDS45210.1																																																																																				0.498	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			10	11	0	0	0	0.008291	0	10	11				
LPCAT4	254531	broad.mit.edu	37	15	34651440	34651440	+	Missense_Mutation	SNP	C	C	A	rs575211382		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr15:34651440C>A	ENST00000314891.6	-	14	1640	c.1463G>T	c.(1462-1464)cGc>cTc	p.R488L		NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	488					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)			NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						GTGTGGGGGGCGCAGGTAGGT	0.552																																							uc001zig.2		NA																	0					0						c.(1462-1464)CGC>CTC		lysophosphatidylcholine acyltransferase 4							88.0	88.0	88.0					15																	34651440		2201	4298	6499	SO:0001583	missense	254531				phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding	g.chr15:34651440C>A	AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.1463G>T	15.37:g.34651440C>A	ENSP00000317300:p.Arg488Leu		Somatic					p.R488L	NM_153613	NP_705841	WXS	Illumina HiSeq	Unspecified	Q643R3	LPCT4_HUMAN			14	1557	-			488					A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Missense_Mutation	SNP	ENST00000314891.6	37	c.1463G>T	CCDS32191.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212228	0.58452	.	.	ENSG00000176454	ENST00000314891	T	0.81078	-1.45	5.44	3.56	0.40772	.	0.476915	0.24174	N	0.040873	T	0.70360	0.3215	L	0.50333	1.59	0.39116	D	0.961565	B	0.32203	0.36	B	0.24848	0.056	T	0.67821	-0.5571	10	0.30078	T	0.28	-6.8709	8.6897	0.34260	0.0:0.8228:0.0:0.1772	.	488	Q643R3	LPCT4_HUMAN	L	488	ENSP00000317300:R488L	ENSP00000317300:R488L	R	-	2	0	LPCAT4	32438732	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.795000	0.38784	1.296000	0.44742	0.491000	0.48974	CGC		0.552	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418028.2	NM_153613		2	3	1	0	0.0016	0.004672	0.00173542	2	3				
TCF12	6938	broad.mit.edu	37	15	57524917	57524917	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr15:57524917C>T	ENST00000267811.5	+	11	1137	c.833C>T	c.(832-834)cCt>cTt	p.P278L	TCF12_ENST00000452095.2_Missense_Mutation_p.P274L|TCF12_ENST00000333725.5_Missense_Mutation_p.P278L|TCF12_ENST00000557843.1_Missense_Mutation_p.P278L|TCF12_ENST00000537840.1_Missense_Mutation_p.P42L|TCF12_ENST00000343827.3_Missense_Mutation_p.P108L|TCF12_ENST00000438423.2_Missense_Mutation_p.P278L|TCF12_ENST00000560764.1_3'UTR|TCF12_ENST00000543579.1_Missense_Mutation_p.P108L	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	278					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		TAGAGTTATCCTCCACACTCA	0.383			T	TEC	extraskeletal myxoid chondrosarcoma																																		uc002aec.2		NA		Dom	yes		15	15q21	6938	T	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""			M	TEC		extraskeletal myxoid chondrosarcoma		0				central_nervous_system(5)|ovary(2)|lung(1)	8						c.(832-834)CCT>CTT		transcription factor 12 isoform b							136.0	109.0	118.0					15																	57524917		2192	4292	6484	SO:0001583	missense	6938				immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr15:57524917C>T	BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.833C>T	15.37:g.57524917C>T	ENSP00000267811:p.Pro278Leu		Somatic				TCF12_uc010ugm.1_Missense_Mutation_p.P330L|TCF12_uc010ugn.1_Missense_Mutation_p.P274L|TCF12_uc002aea.2_Missense_Mutation_p.P278L|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Missense_Mutation_p.P278L|TCF12_uc002aed.2_Missense_Mutation_p.P278L|TCF12_uc002aee.2_Missense_Mutation_p.P108L|TCF12_uc010bft.2_Missense_Mutation_p.P108L|TCF12_uc010ugo.1_Missense_Mutation_p.P42L	p.P278L	NM_207038	NP_996921	WXS	Illumina HiSeq	Unspecified	Q99081	HTF4_HUMAN		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)	11	1117	+		Colorectal(260;0.0907)	278					Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	ENST00000267811.5	37	c.833C>T	CCDS10159.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964566	0.74131	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725;ENST00000543579;ENST00000537840;ENST00000343827	T;T;T;T;T;T;T	0.77620	1.06;1.06;1.06;1.06;1.06;-1.11;1.06	5.62	5.62	0.85841	.	0.047810	0.85682	D	0.000000	D	0.87172	0.6111	M	0.64170	1.965	0.80722	D	1	P;D;D;D;D;P;D	0.89917	0.671;0.999;0.999;1.0;1.0;0.92;1.0	B;D;D;D;D;B;D	0.91635	0.302;0.994;0.962;0.999;0.998;0.438;0.998	D	0.86157	0.1591	10	0.46703	T	0.11	-24.9445	19.6555	0.95837	0.0:1.0:0.0:0.0	.	42;274;330;108;108;278;278	B4E1W1;E9PGY0;F5H6Z6;F5GY10;Q99081-2;Q99081;Q99081-3	.;.;.;.;.;HTF4_HUMAN;.	L	330;278;278;274;278;108;42;108	ENSP00000267811:P278L;ENSP00000388940:P278L;ENSP00000396881:P274L;ENSP00000331057:P278L;ENSP00000440017:P108L;ENSP00000444696:P42L;ENSP00000342459:P108L	ENSP00000267811:P278L	P	+	2	0	TCF12	55312209	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.000000	0.70678	2.653000	0.90120	0.557000	0.71058	CCT		0.383	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255069.3	NM_003205		4	23	0	0	0	0.009096	0	4	23				
ANKDD1A	348094	broad.mit.edu	37	15	65219162	65219162	+	Silent	SNP	C	C	T	rs200097861		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr15:65219162C>T	ENST00000380230.3	+	6	563	c.534C>T	c.(532-534)ctC>ctT	p.L178L	ANKDD1A_ENST00000395720.1_Silent_p.L178L|ANKDD1A_ENST00000357698.3_Silent_p.L178L|ANKDD1A_ENST00000395723.1_Silent_p.L87L|ANKDD1A_ENST00000496660.1_Silent_p.L87L|AC069368.3_ENST00000437723.1_Intron|ANKDD1A_ENST00000319580.8_3'UTR|ANKDD1A_ENST00000491145.1_3'UTR	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	178					signal transduction (GO:0007165)			p.L178L(1)		NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						TGGACTTCCTCGTGGGCTCTG	0.612																																							uc002aoa.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(532-534)CTC>CTT		ankyrin repeat and death domain containing 1A		C		0,4404		0,0,2202	132.0	112.0	119.0		534	-6.1	1.0	15		119	3,8595	3.0+/-9.4	0,3,4296	no	coding-synonymous	ANKDD1A	NM_182703.3		0,3,6498	TT,TC,CC		0.0349,0.0,0.0231		178/523	65219162	3,12999	2202	4299	6501	SO:0001819	synonymous_variant	348094				signal transduction			g.chr15:65219162C>T		CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.534C>T	15.37:g.65219162C>T			Somatic				ANKDD1A_uc002anx.1_Silent_p.L174L|ANKDD1A_uc002any.2_Silent_p.L87L|ANKDD1A_uc002anz.2_Silent_p.L87L|ANKDD1A_uc002aob.2_Intron|ANKDD1A_uc002aoc.2_RNA|ANKDD1A_uc010bha.2_Silent_p.L87L	p.L178L	NM_182703	NP_874362	WXS	Illumina HiSeq	Unspecified	Q495B1	AKD1A_HUMAN			6	563	+			178			ANK 5.		Q495B2|Q495B3|Q8N7A0|Q8NBS5	Silent	SNP	ENST00000380230.3	37	c.534C>T	CCDS10197.2																																																																																				0.612	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256705.2	NM_182703		11	45	0	0	0	0.001368	0	11	45				
KIAA1024	23251	broad.mit.edu	37	15	79760677	79760677	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr15:79760677G>T	ENST00000305428.3	+	4	2777	c.2702G>T	c.(2701-2703)tGc>tTc	p.C901F		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	901						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						GCTGCGGCATGCACCGTCATC	0.458																																							uc002bew.1		NA																	0				pancreas(2)|ovary(1)|central_nervous_system(1)	4						c.(2701-2703)TGC>TTC		hypothetical protein LOC23251							79.0	68.0	72.0					15																	79760677		2196	4293	6489	SO:0001583	missense	23251					integral to membrane		g.chr15:79760677G>T	AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.2702G>T	15.37:g.79760677G>T	ENSP00000307461:p.Cys901Phe		Somatic				KIAA1024_uc010unk.1_3'UTR	p.C901F	NM_015206	NP_056021	WXS	Illumina HiSeq	Unspecified	Q9UPX6	K1024_HUMAN			4	2777	+			901			Helical; (Potential).		A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	c.2702G>T	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109840	0.56398	.	.	ENSG00000169330	ENST00000305428	T	0.47528	0.84	5.67	5.67	0.87782	.	0.211920	0.49305	D	0.000160	T	0.67116	0.2859	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63382	-0.6650	9	.	.	.	.	19.7863	0.96440	0.0:0.0:1.0:0.0	.	901	Q9UPX6	K1024_HUMAN	F	901	ENSP00000307461:C901F	.	C	+	2	0	KIAA1024	77547732	1.000000	0.71417	0.995000	0.50966	0.016000	0.09150	8.451000	0.90343	2.665000	0.90641	0.655000	0.94253	TGC		0.458	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206		4	19	1	0	0.00909568	0.009096	0.00962418	4	19				
ZNF598	90850	broad.mit.edu	37	16	2050050	2050050	+	Silent	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr16:2050050G>A	ENST00000563630.1	-	9	1577	c.1335C>T	c.(1333-1335)ccC>ccT	p.P445P	ZNF598_ENST00000431526.1_Silent_p.P500P|AC005606.15_ENST00000567515.1_lincRNA|ZNF598_ENST00000562103.1_Silent_p.P445P			Q86UK7	ZN598_HUMAN	zinc finger protein 598	500							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						CAAGGCTGGTGGGGGCGGTGC	0.682																																							uc002cof.1		NA																	0				lung(1)|breast(1)	2						c.(1498-1500)CCC>CCT		zinc finger protein 598							9.0	12.0	11.0					16																	2050050		1990	4124	6114	SO:0001819	synonymous_variant	90850					intracellular	zinc ion binding	g.chr16:2050050G>A	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.1335C>T	16.37:g.2050050G>A			Somatic				ZNF598_uc002coe.1_5'UTR	p.P500P	NM_178167	NP_835461	WXS	Illumina HiSeq	Unspecified	Q86UK7	ZN598_HUMAN			11	1515	-			500					Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Silent	SNP	ENST00000563630.1	37	c.1500C>T																																																																																					0.682	ZNF598-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000434439.1	NM_178167		5	16	0	0	0	0.001168	0	5	16				
MYLK3	91807	broad.mit.edu	37	16	46766575	46766575	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr16:46766575G>T	ENST00000394809.4	-	4	1122	c.1007C>A	c.(1006-1008)tCc>tAc	p.S336Y	MYLK3_ENST00000536476.1_5'UTR	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	336					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TATGTGGATGGAGATCCTGGG	0.572																																							uc002eei.3		NA																	0				stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7						c.(1006-1008)TCC>TAC		myosin light chain kinase 3							14.0	10.0	11.0					16																	46766575		2000	3979	5979	SO:0001583	missense	91807				cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity	g.chr16:46766575G>T	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.1007C>A	16.37:g.46766575G>T	ENSP00000378288:p.Ser336Tyr		Somatic				MYLK3_uc010vge.1_5'UTR|MYLK3_uc002eej.1_5'UTR	p.S336Y	NM_182493	NP_872299	WXS	Illumina HiSeq	Unspecified	Q32MK0	MYLK3_HUMAN			4	1123	-		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)	336					B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	37	c.1007C>A	CCDS10723.2	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705794	0.48412	.	.	ENSG00000140795	ENST00000394809	T	0.70045	-0.45	5.51	5.51	0.81932	.	0.484861	0.15496	N	0.259283	T	0.71676	0.3368	L	0.32530	0.975	0.80722	D	1	D	0.64830	0.994	P	0.60173	0.87	T	0.72023	-0.4415	10	0.59425	D	0.04	.	14.9278	0.70893	0.0:0.0:1.0:0.0	.	336	Q32MK0	MYLK3_HUMAN	Y	336	ENSP00000378288:S336Y	ENSP00000378288:S336Y	S	-	2	0	MYLK3	45324076	1.000000	0.71417	0.783000	0.31826	0.032000	0.12392	4.388000	0.59633	2.568000	0.86640	0.655000	0.94253	TCC		0.572	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493		6	10	1	0	3.59834e-05	0.001168	4.16396e-05	6	10				
NFATC3	4775	broad.mit.edu	37	16	68156767	68156767	+	Silent	SNP	A	A	T	rs545598471		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr16:68156767A>T	ENST00000346183.3	+	2	1005	c.981A>T	c.(979-981)ccA>ccT	p.P327P	NFATC3_ENST00000329524.4_Silent_p.P327P|NFATC3_ENST00000349223.5_Silent_p.P327P|RP11-67A1.2_ENST00000548144.1_RNA|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Silent_p.P327P	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	327					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CAGTTTTTCCATTTCAGTACT	0.483																																							uc002evo.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3						c.(979-981)CCA>CCT		nuclear factor of activated T-cells,							123.0	117.0	119.0					16																	68156767		2198	4300	6498	SO:0001819	synonymous_variant	4775				inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding	g.chr16:68156767A>T	L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.981A>T	16.37:g.68156767A>T			Somatic				NFATC3_uc010vkl.1_5'UTR|NFATC3_uc010vkm.1_5'UTR|NFATC3_uc010vkn.1_5'UTR|NFATC3_uc010vko.1_5'UTR|NFATC3_uc010vkp.1_5'UTR|NFATC3_uc010vkq.1_5'UTR|NFATC3_uc002evl.2_Intron|NFATC3_uc002evk.2_Silent_p.P327P|NFATC3_uc002evm.1_Silent_p.P327P|NFATC3_uc002evn.1_Silent_p.P327P|NFATC3_uc010vkr.1_5'UTR|NFATC3_uc010vks.1_5'UTR|NFATC3_uc010vkt.1_5'UTR|NFATC3_uc010vku.1_5'UTR|NFATC3_uc010vkv.1_5'UTR|NFATC3_uc010vkw.1_5'UTR|NFATC3_uc010vkx.1_5'UTR|NFATC3_uc010vky.1_5'UTR|NFATC3_uc010vkz.1_5'UTR|NFATC3_uc010vla.1_5'UTR|NFATC3_uc010vlb.1_5'UTR|NFATC3_uc010vlc.1_5'UTR	p.P327P	NM_173165	NP_775188	WXS	Illumina HiSeq	Unspecified	Q12968	NFAC3_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)	2	1191	+		Ovarian(137;0.0563)	327					O75211|Q14516|Q99840|Q99841|Q99842	Silent	SNP	ENST00000346183.3	37	c.981A>T	CCDS10860.1																																																																																				0.483	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555		19	94	0	0	0	0.006122	0	19	94				
HYDIN	54768	broad.mit.edu	37	16	70913523	70913523	+	Missense_Mutation	SNP	A	A	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr16:70913523A>C	ENST00000393567.2	-	61	10502	c.10352T>G	c.(10351-10353)tTg>tGg	p.L3451W		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3451					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CAAGCCATCCAAGGTAGCCTC	0.577																																							uc002ezr.2		NA																	0				ovary(1)|skin(1)	2						c.(10348-10350)TTG>TGG		hydrocephalus inducing isoform a							50.0	55.0	53.0					16																	70913523		1960	4171	6131	SO:0001583	missense	54768							g.chr16:70913523A>C	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.10352T>G	16.37:g.70913523A>C	ENSP00000377197:p.Leu3451Trp		Somatic					p.L3450W	NM_032821	NP_116210	WXS	Illumina HiSeq	Unspecified	Q4G0P3	HYDIN_HUMAN			61	10477	-		Ovarian(137;0.0654)	3451					A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	c.10349T>G	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.388899	0.82902	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01068	5.38	5.19	5.19	0.71726	.	0.000000	0.24436	U	0.038556	T	0.05823	0.0152	M	0.67953	2.075	0.80722	D	1	D	0.71674	0.998	D	0.68943	0.961	T	0.13098	-1.0522	10	0.87932	D	0	.	14.7274	0.69354	1.0:0.0:0.0:0.0	.	3450	F8WD23	.	W	3451;3450	ENSP00000377197:L3451W	ENSP00000313052:L3450W	L	-	2	0	HYDIN	69471024	1.000000	0.71417	0.951000	0.38953	0.972000	0.66771	8.518000	0.90559	1.955000	0.56771	0.418000	0.28097	TTG		0.577	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			6	51	0	0	0	0.001984	0	6	51				
PLCG2	5336	broad.mit.edu	37	16	81965179	81965179	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr16:81965179G>T	ENST00000359376.3	+	25	2873	c.2659G>T	c.(2659-2661)Gag>Tag	p.E887*		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	887					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.E887*(2)		NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						TCCTCCGGTGGAGTTTGCCAC	0.532																																							uc002fgt.2		NA																	2	Substitution - Nonsense(2)		lung(2)	large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						c.(2659-2661)GAG>TAG		phospholipase C, gamma 2							80.0	85.0	84.0					16																	81965179		1935	4128	6063	SO:0001587	stop_gained	5336				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity	g.chr16:81965179G>T		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.2659G>T	16.37:g.81965179G>T	ENSP00000352336:p.Glu887*		Somatic					p.E887*	NM_002661	NP_002652	WXS	Illumina HiSeq	Unspecified	P16885	PLCG2_HUMAN			25	2811	+			887					D3DUL3|Q3ZTS2|Q59H45|Q969T5	Nonsense_Mutation	SNP	ENST00000359376.3	37	c.2659G>T	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	G	45	11.318025	0.99546	.	.	ENSG00000197943	ENST00000359376	.	.	.	5.54	5.54	0.83059	.	0.096387	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	19.4893	0.95044	0.0:0.0:1.0:0.0	.	.	.	.	X	887	.	ENSP00000352336:E887X	E	+	1	0	PLCG2	80522680	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.922000	0.92789	2.584000	0.87258	0.655000	0.94253	GAG		0.532	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1			16	59	1	0	2.32078e-09	0.003163	3.16138e-09	16	59				
OSGIN1	29948	broad.mit.edu	37	16	83999018	83999018	+	Silent	SNP	G	G	T	rs532832620		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr16:83999018G>T	ENST00000343939.2	+	7	1472	c.1089G>T	c.(1087-1089)gcG>gcT	p.A363A	OSGIN1_ENST00000361711.3_Silent_p.A280A|OSGIN1_ENST00000393306.1_Silent_p.A280A			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	363					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						GGGTGGGTGCGGTGACCCCGG	0.697																																							uc002fha.2		NA																	0					0						c.(1087-1089)GCG>GCT		oxidative stress induced growth inhibitor 1							20.0	25.0	23.0					16																	83999018		2183	4250	6433	SO:0001819	synonymous_variant	29948				cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity	g.chr16:83999018G>T	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.1089G>T	16.37:g.83999018G>T			Somatic				OSGIN1_uc002fhb.2_Silent_p.A280A|OSGIN1_uc002fhc.2_Silent_p.A280A	p.A363A	NM_013370	NP_037502	WXS	Illumina HiSeq	Unspecified	Q9UJX0	OSGI1_HUMAN			7	1472	+			363					Q52M33|Q86UQ1|Q96S88|Q9BZ70	Silent	SNP	ENST00000343939.2	37	c.1089G>T																																																																																					0.697	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	NM_013370		8	47	1	0	7.48243e-07	0.006214	9.34628e-07	8	47				
ZCCHC14	23174	broad.mit.edu	37	16	87525384	87525384	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr16:87525384C>A	ENST00000268616.4	-	1	267	c.50G>T	c.(49-51)cGc>cTc	p.R17L	RP11-482M8.1_ENST00000565824.1_lincRNA	NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	17							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GAGCTCCTGGCGCAGCACCTG	0.711																																							uc002fjz.1		NA																	0				upper_aerodigestive_tract(1)|breast(1)	2						c.(49-51)CGC>CTC		zinc finger, CCHC domain containing 14							22.0	24.0	23.0					16																	87525384		2196	4293	6489	SO:0001583	missense	23174				cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding	g.chr16:87525384C>A	AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.50G>T	16.37:g.87525384C>A	ENSP00000268616:p.Arg17Leu		Somatic				ZCCHC14_uc002fka.1_RNA|uc002fkc.1_5'Flank	p.R17L	NM_015144	NP_055959	WXS	Illumina HiSeq	Unspecified	Q8WYQ9	ZCH14_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0285)	1	77	-			17					D3DUN1|O60324|Q3MJD8|Q9UFP0	Missense_Mutation	SNP	ENST00000268616.4	37	c.50G>T	CCDS10961.1	.	.	.	.	.	.	.	.	.	.	c	14.88	2.665990	0.47677	.	.	ENSG00000140948	ENST00000268616	T	0.53423	0.62	3.5	1.44	0.22558	.	0.077720	0.43919	U	0.000506	T	0.40145	0.1105	L	0.49126	1.545	0.41058	D	0.985357	P	0.39601	0.68	B	0.39738	0.308	T	0.26395	-1.0104	10	0.87932	D	0	-19.1672	8.2331	0.31610	0.0:0.7514:0.158:0.0906	.	17	Q8WYQ9	ZCH14_HUMAN	L	17	ENSP00000268616:R17L	ENSP00000268616:R17L	R	-	2	0	ZCCHC14	86082885	1.000000	0.71417	0.998000	0.56505	0.004000	0.04260	7.126000	0.77201	0.116000	0.18110	-1.128000	0.01989	CGC		0.711	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144		6	25	1	0	3.59834e-05	0.001168	4.16396e-05	6	25				
BANP	54971	broad.mit.edu	37	16	88061220	88061220	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr16:88061220C>T	ENST00000393207.1	+	8	1224	c.1003C>T	c.(1003-1005)Cgg>Tgg	p.R335W	BANP_ENST00000479780.2_Missense_Mutation_p.R304W|BANP_ENST00000355163.5_Missense_Mutation_p.R310W|BANP_ENST00000355022.4_Missense_Mutation_p.R304W|BANP_ENST00000393208.2_Missense_Mutation_p.R304W|BANP_ENST00000538234.1_Missense_Mutation_p.R343W|BANP_ENST00000286122.7_Missense_Mutation_p.R335W	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	335	Interaction with CUX1 and HDAC1. {ECO:0000250}.|Necessary and sufficient for TP53 activation. {ECO:0000250}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		GAGCTTCTCGCGGAGAACGCC	0.682																																							uc002fkr.2		NA																	0					0						c.(1000-1002)CGG>TGG		BTG3 associated nuclear protein isoform b							57.0	62.0	60.0					16																	88061220		2198	4300	6498	SO:0001583	missense	54971				cell cycle|chromatin modification|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr16:88061220C>T	AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.1003C>T	16.37:g.88061220C>T	ENSP00000376902:p.Arg335Trp		Somatic				BANP_uc002fkp.2_Missense_Mutation_p.R304W|BANP_uc002fkq.2_Missense_Mutation_p.R304W|BANP_uc010vow.1_Missense_Mutation_p.R342W|BANP_uc002fks.3_Missense_Mutation_p.R303W|BANP_uc002fko.1_Missense_Mutation_p.R240W|BANP_uc010vov.1_Missense_Mutation_p.R309W	p.R334W	NM_079837	NP_524576	WXS	Illumina HiSeq	Unspecified	Q8N9N5	BANP_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.00551)	8	1224	+			335			Necessary and sufficient for TP53 activation (By similarity).|Interaction with CUX1 and HDAC1 (By similarity).		A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Missense_Mutation	SNP	ENST00000393207.1	37	c.1000C>T	CCDS54054.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.467715	0.63625	.	.	ENSG00000172530	ENST00000286122;ENST00000355163;ENST00000289484;ENST00000479780;ENST00000393208;ENST00000540932;ENST00000355022;ENST00000538234;ENST00000393207	T;T;T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73;1.73;1.73	5.14	1.45	0.22620	.	0.052063	0.64402	D	0.000002	T	0.40094	0.1103	L	0.36672	1.1	0.29856	N	0.827996	P;P;D;D;D;D	0.89917	0.499;0.812;0.999;1.0;0.999;1.0	B;B;P;D;D;D	0.91635	0.07;0.168;0.825;0.994;0.916;0.999	T	0.47235	-0.9133	10	0.87932	D	0	.	15.878	0.79180	0.3195:0.6805:0.0:0.0	.	343;310;304;335;304;304	B4DE54;B4DNJ9;B2RCF7;Q8N9N5;Q8N9N5-2;Q8N9N5-4	.;.;.;BANP_HUMAN;.;.	W	335;310;300;304;304;304;304;343;335	ENSP00000286122:R335W;ENSP00000347290:R310W;ENSP00000432508:R304W;ENSP00000376903:R304W;ENSP00000347125:R304W;ENSP00000444352:R343W;ENSP00000376902:R335W	ENSP00000286122:R335W	R	+	1	2	BANP	86618721	0.135000	0.22499	0.506000	0.27664	0.953000	0.61014	0.671000	0.25172	0.432000	0.26286	0.462000	0.41574	CGG		0.682	BANP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269166.1	NM_017869		13	54	0	0	0	0.001368	0	13	54				
KDM6B	23135	broad.mit.edu	37	17	7754426	7754426	+	Missense_Mutation	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:7754426A>G	ENST00000448097.2	+	14	4092	c.3761A>G	c.(3760-3762)gAt>gGt	p.D1254G	KDM6B_ENST00000254846.5_Missense_Mutation_p.D1254G			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1254					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CAGCCCTCAGATGAGAACTGG	0.602																																							uc002giw.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(3760-3762)GAT>GGT		lysine (K)-specific demethylase 6B							80.0	68.0	72.0					17																	7754426		2203	4299	6502	SO:0001583	missense	23135				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr17:7754426A>G	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.3761A>G	17.37:g.7754426A>G	ENSP00000412513:p.Asp1254Gly		Somatic				KDM6B_uc002gix.2_Missense_Mutation_p.D556G	p.D1254G	NM_001080424	NP_001073893	WXS	Illumina HiSeq	Unspecified	O15054	KDM6B_HUMAN			14	4137	+			1254					C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37	c.3761A>G		.	.	.	.	.	.	.	.	.	.	A	14.45	2.539536	0.45176	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.79033	-1.23;-1.23	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.86997	0.6068	M	0.74467	2.265	0.80722	D	1	B;D	0.89917	0.243;1.0	B;D	0.87578	0.168;0.998	D	0.88589	0.3142	10	0.87932	D	0	-5.5516	13.7851	0.63105	1.0:0.0:0.0:0.0	.	1254;1254	O15054;O15054-1	KDM6B_HUMAN;.	G	1254	ENSP00000254846:D1254G;ENSP00000412513:D1254G	ENSP00000254846:D1254G	D	+	2	0	KDM6B	7695151	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.965000	0.76067	2.167000	0.68274	0.528000	0.53228	GAT		0.602	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272		8	48	0	0	0	0.00308	0	8	48				
WDR16	146845	broad.mit.edu	37	17	9489141	9489141	+	Missense_Mutation	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:9489141A>T	ENST00000576499.1	+	2	136	c.122A>T	c.(121-123)tAt>tTt	p.Y41F	WDR16_ENST00000396219.3_Intron|WDR16_ENST00000352665.5_Missense_Mutation_p.Y41F|WDR16_ENST00000299764.5_Missense_Mutation_p.Y51F					WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						CATATGATTTATCCTCTTGGT	0.463																																							uc002gly.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(121-123)TAT>TTT		WD40-repeat protein upregulated in HCC isoform							191.0	175.0	180.0					17																	9489141		2203	4300	6503	SO:0001583	missense	146845					cytoplasm|intracellular membrane-bounded organelle	protein binding	g.chr17:9489141A>T	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000576499.1:c.122A>T	17.37:g.9489141A>T	ENSP00000476293:p.Tyr41Phe		Somatic				WDR16_uc002glz.2_Intron|WDR16_uc010coc.2_Missense_Mutation_p.Y51F	p.Y41F	NM_145054	NP_659491	WXS	Illumina HiSeq	Unspecified	Q8N1V2	WDR16_HUMAN			2	191	+			41						Missense_Mutation	SNP	ENST00000576499.1	37	c.122A>T		.	.	.	.	.	.	.	.	.	.	A	11.93	1.785005	0.31593	.	.	ENSG00000166596	ENST00000352665;ENST00000299764	T;T	0.49432	0.78;4.97	5.86	4.78	0.61160	WD40 repeat-like-containing domain (1);	0.052966	0.85682	N	0.000000	T	0.36138	0.0956	N	0.16743	0.435	0.43719	D	0.996197	B;B	0.27192	0.171;0.116	B;B	0.33521	0.165;0.082	T	0.06058	-1.0848	10	0.34782	T	0.22	-17.9708	13.7156	0.62693	0.8824:0.0:0.0:0.1176	.	51;41	Q8N1V2-2;Q8N1V2	.;WDR16_HUMAN	F	41;51	ENSP00000339449:Y41F;ENSP00000299764:Y51F	ENSP00000299764:Y51F	Y	+	2	0	WDR16	9429866	1.000000	0.71417	0.426000	0.26672	0.538000	0.34931	5.861000	0.69553	0.459000	0.27016	-2.086000	0.00376	TAT		0.463	WDR16-009	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000439850.2	NM_145054		22	83	0	0	0	0.001882	0	22	83				
WDR16	146845	broad.mit.edu	37	17	9489143	9489143	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:9489143C>T	ENST00000576499.1	+	2	138	c.124C>T	c.(124-126)Cct>Tct	p.P42S	WDR16_ENST00000396219.3_Intron|WDR16_ENST00000352665.5_Missense_Mutation_p.P42S|WDR16_ENST00000299764.5_Missense_Mutation_p.P52S					WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						TATGATTTATCCTCTTGGTTG	0.463																																							uc002gly.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(124-126)CCT>TCT		WD40-repeat protein upregulated in HCC isoform							191.0	175.0	180.0					17																	9489143		2203	4300	6503	SO:0001583	missense	146845					cytoplasm|intracellular membrane-bounded organelle	protein binding	g.chr17:9489143C>T	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000576499.1:c.124C>T	17.37:g.9489143C>T	ENSP00000476293:p.Pro42Ser		Somatic				WDR16_uc002glz.2_Intron|WDR16_uc010coc.2_Missense_Mutation_p.P52S	p.P42S	NM_145054	NP_659491	WXS	Illumina HiSeq	Unspecified	Q8N1V2	WDR16_HUMAN			2	193	+			42						Missense_Mutation	SNP	ENST00000576499.1	37	c.124C>T		.	.	.	.	.	.	.	.	.	.	C	23.5	4.421641	0.83559	.	.	ENSG00000166596	ENST00000352665;ENST00000299764	T;T	0.34072	1.38;5.04	5.86	5.86	0.93980	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.49150	0.1540	L	0.45581	1.43	0.80722	D	1	D;P	0.62365	0.991;0.948	P;P	0.58130	0.833;0.539	T	0.14392	-1.0474	10	0.23302	T	0.38	-15.8425	18.9528	0.92646	0.0:1.0:0.0:0.0	.	52;42	Q8N1V2-2;Q8N1V2	.;WDR16_HUMAN	S	42;52	ENSP00000339449:P42S;ENSP00000299764:P52S	ENSP00000299764:P52S	P	+	1	0	WDR16	9429868	1.000000	0.71417	0.976000	0.42696	0.592000	0.36648	7.428000	0.80296	2.763000	0.94921	0.585000	0.79938	CCT		0.463	WDR16-009	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000439850.2	NM_145054		21	82	0	0	0	0.010504	0	21	82				
MYH13	8735	broad.mit.edu	37	17	10265755	10265755	+	Silent	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:10265755G>A	ENST00000418404.3	-	3	433	c.270C>T	c.(268-270)gaC>gaT	p.D90D	MYH13_ENST00000252172.4_Silent_p.D90D			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	90	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TCATGGCCATGTCCTCGATCT	0.468																																							uc002gmk.1		NA																	0				ovary(4)|skin(2)	6						c.(268-270)GAC>GAT		myosin, heavy polypeptide 13, skeletal muscle							299.0	271.0	281.0					17																	10265755		2203	4300	6503	SO:0001819	synonymous_variant	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10265755G>A	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.270C>T	17.37:g.10265755G>A			Somatic					p.D90D	NM_003802	NP_003793	WXS	Illumina HiSeq	Unspecified	Q9UKX3	MYH13_HUMAN			4	360	-			90			Myosin head-like.		O95252|Q9P0U8	Silent	SNP	ENST00000418404.3	37	c.270C>T	CCDS45613.1																																																																																				0.468	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		34	104	0	0	0	0.003271	0	34	104				
MYH4	4622	broad.mit.edu	37	17	10346844	10346844	+	Splice_Site	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:10346844C>A	ENST00000255381.2	-	40	5778	c.5668G>T	c.(5668-5670)Gag>Tag	p.E1890*	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1890					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GATTGTTCCTCCTGAGAACAG	0.443																																							uc002gmn.2		NA																	0				ovary(10)|skin(2)|central_nervous_system(1)	13						c.(5668-5670)GAG>TAG		myosin, heavy polypeptide 4, skeletal muscle							92.0	83.0	86.0					17																	10346844		2203	4300	6503	SO:0001630	splice_region_variant	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10346844C>A		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5668-1G>T	17.37:g.10346844C>A			Somatic				uc002gml.1_Intron	p.E1890*	NM_017533	NP_060003	WXS	Illumina HiSeq	Unspecified	Q9Y623	MYH4_HUMAN			40	5779	-			1890			Potential.			Nonsense_Mutation	SNP	ENST00000255381.2	37	c.5668G>T	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	C	44	11.207976	0.99531	.	.	ENSG00000141048	ENST00000255381	.	.	.	5.0	5.0	0.66597	.	0.000000	0.37761	U	0.001944	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.8349	0.92157	0.0:1.0:0.0:0.0	.	.	.	.	X	1890	.	ENSP00000255381:E1890X	E	-	1	0	MYH4	10287569	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	7.609000	0.82925	2.760000	0.94817	0.655000	0.94253	GAG		0.443	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	Nonsense_Mutation	12	43	1	0	9.05144e-12	0.001855	1.2995e-11	12	43				
VTN	7448	broad.mit.edu	37	17	26695911	26695911	+	Silent	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:26695911G>T	ENST00000226218.4	-	5	1426	c.808C>A	c.(808-810)Cgg>Agg	p.R270R	CTB-96E2.2_ENST00000555059.2_5'Flank|SARM1_ENST00000379061.4_Intron|SARM1_ENST00000457710.3_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA|VTN_ENST00000438614.1_5'Flank|VTN_ENST00000536498.1_5'UTR|TMEM199_ENST00000509083.1_Intron	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	270					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.R270W(1)		kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	AAGTAGACCCGCTCCCGGCCA	0.587																																							uc002hbc.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)|kidney(1)	2						c.(808-810)CGG>AGG		vitronectin precursor	Urokinase(DB00013)						71.0	65.0	67.0					17																	26695911		2203	4300	6503	SO:0001819	synonymous_variant	7448				cell adhesion mediated by integrin|immune response|negative regulation of endopeptidase activity|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein binding|positive regulation of receptor-mediated endocytosis|positive regulation of smooth muscle cell migration|positive regulation of vascular endothelial growth factor receptor signaling pathway|smooth muscle cell-matrix adhesion	alphav-beta3 integrin-vitronectin complex|extracellular space	heparin binding|integrin binding|scavenger receptor activity	g.chr17:26695911G>T	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.808C>A	17.37:g.26695911G>T			Somatic				SARM1_uc010wah.1_Intron|SEBOX_uc010crk.1_5'Flank|SARM1_uc010waj.1_Intron	p.R270R	NM_000638	NP_000629	WXS	Illumina HiSeq	Unspecified	P04004	VTNC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	5	957	-	all_lung(13;0.000533)|Lung NSC(42;0.00171)		270			Hemopexin-like 3.		B2R7G0|P01141|Q9BSH7	Silent	SNP	ENST00000226218.4	37	c.808C>A	CCDS11229.1																																																																																				0.587	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638		56	62	1	0	4.46115e-38	0.00361	7.52955e-38	56	62				
SSH2	85464	broad.mit.edu	37	17	27958980	27958980	+	Missense_Mutation	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:27958980T>A	ENST00000269033.3	-	15	3302	c.3151A>T	c.(3151-3153)Act>Tct	p.T1051S	SSH2_ENST00000540801.1_Missense_Mutation_p.T1078S|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	1051					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAGAGCACAGTGACAGATTTT	0.517																																							uc002heo.1		NA																	0				skin(2)	2						c.(3151-3153)ACT>TCT		slingshot 2							129.0	117.0	121.0					17																	27958980		2203	4300	6503	SO:0001583	missense	85464				actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr17:27958980T>A	AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.3151A>T	17.37:g.27958980T>A	ENSP00000269033:p.Thr1051Ser		Somatic				SSH2_uc010wbh.1_Missense_Mutation_p.T1078S	p.T1051S	NM_033389	NP_203747	WXS	Illumina HiSeq	Unspecified	Q76I76	SSH2_HUMAN			15	3151	-			1051					Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	37	c.3151A>T	CCDS11253.1	.	.	.	.	.	.	.	.	.	.	T	9.008	0.981896	0.18812	.	.	ENSG00000141298	ENST00000269033;ENST00000540801	T;T	0.08896	3.05;3.04	6.08	0.996	0.19844	.	0.498628	0.21007	N	0.081751	T	0.07279	0.0184	L	0.57536	1.79	0.18873	N	0.999985	B;B	0.25904	0.137;0.104	B;B	0.28011	0.085;0.039	T	0.40459	-0.9562	10	0.08179	T	0.78	-1.8538	6.1963	0.20552	0.0:0.2176:0.2301:0.5523	.	1078;1051	F5H527;Q76I76	.;SSH2_HUMAN	S	1051;1078	ENSP00000269033:T1051S;ENSP00000444743:T1078S	ENSP00000269033:T1051S	T	-	1	0	SSH2	24983106	0.000000	0.05858	0.811000	0.32455	0.833000	0.47200	-1.047000	0.03521	0.511000	0.28236	0.533000	0.62120	ACT		0.517	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1	NM_033389		53	48	0	0	0	0.00361	0	53	48				
UTP6	55813	broad.mit.edu	37	17	30202318	30202318	+	Missense_Mutation	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:30202318T>C	ENST00000261708.4	-	14	1377	c.1240A>G	c.(1240-1242)Atc>Gtc	p.I414V	CTC-542B22.2_ENST00000583236.1_lincRNA	NM_018428.2	NP_060898.2	Q9NYH9	UTP6_HUMAN	UTP6, small subunit (SSU) processome component, homolog (yeast)	414					rRNA processing (GO:0006364)	nucleolus (GO:0005730)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)	21		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				TTTGACTCGATCAGCACCTGC	0.463																																							uc002hgr.2		NA																	0				ovary(1)	1						c.(1240-1242)ATC>GTC		hepatocellular carcinoma-associated antigen 66							87.0	85.0	86.0					17																	30202318		2203	4300	6503	SO:0001583	missense	55813				rRNA processing	nucleolus	binding	g.chr17:30202318T>C	AF116631	CCDS11269.1	17q11.2	2010-06-24	2006-05-16	2006-05-16	ENSG00000108651	ENSG00000108651			18279	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated antigen 66"""		"""chromosome 17 open reading frame 40"""	C17orf40		10843809, 16138909	Standard	NM_018428		Approved	HCA66	uc002hgr.3	Q9NYH9	OTTHUMG00000132815	ENST00000261708.4:c.1240A>G	17.37:g.30202318T>C	ENSP00000261708:p.Ile414Val		Somatic				UTP6_uc002hgq.2_Missense_Mutation_p.I230V|UTP6_uc010cst.2_Missense_Mutation_p.I263V	p.I414V	NM_018428	NP_060898	WXS	Illumina HiSeq	Unspecified	Q9NYH9	UTP6_HUMAN			14	1323	-		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)	414					Q8IX96|Q96BL2|Q9NQ91	Missense_Mutation	SNP	ENST00000261708.4	37	c.1240A>G	CCDS11269.1	.	.	.	.	.	.	.	.	.	.	T	3.529	-0.096190	0.07010	.	.	ENSG00000108651	ENST00000261708	T	0.34072	1.38	5.42	5.42	0.78866	Tetratricopeptide-like helical (1);	0.236387	0.48767	D	0.000172	T	0.28896	0.0717	L	0.41079	1.255	0.39905	D	0.973954	B;B	0.19445	0.036;0.036	B;B	0.14023	0.01;0.01	T	0.10382	-1.0632	10	0.33940	T	0.23	-14.8463	10.5176	0.44898	0.0:0.0:0.162:0.838	.	414;414	B3KQ21;Q9NYH9	.;UTP6_HUMAN	V	414	ENSP00000261708:I414V	ENSP00000261708:I414V	I	-	1	0	UTP6	27226431	1.000000	0.71417	0.977000	0.42913	0.059000	0.15707	2.630000	0.46494	2.073000	0.62155	0.379000	0.24179	ATC		0.463	UTP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256265.2	NM_018428		35	65	0	0	0	0.004289	0	35	65				
TMEM98	26022	broad.mit.edu	37	17	31258565	31258565	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:31258565G>T	ENST00000579849.1	+	3	450	c.19G>T	c.(19-21)Gtt>Ttt	p.V7F	TMEM98_ENST00000394642.3_Missense_Mutation_p.V7F|TMEM98_ENST00000578289.1_Missense_Mutation_p.V7F	NM_015544.2	NP_056359.2	Q9Y2Y6	TMM98_HUMAN	transmembrane protein 98	7						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(2)|large_intestine(1)	3		Ovarian(249;0.182)|Breast(31;0.244)	BRCA - Breast invasive adenocarcinoma(9;0.0769)			TGTGGTGATTGTTGCCATAGG	0.572																																							uc002hhq.2		NA																	0					0						c.(19-21)GTT>TTT		transmembrane protein 98							146.0	117.0	127.0					17																	31258565		2202	4300	6502	SO:0001583	missense	26022					endoplasmic reticulum|integral to membrane		g.chr17:31258565G>T	CR605381	CCDS11274.1	17q11.2	2005-12-16			ENSG00000006042	ENSG00000006042			24529	protein-coding gene	gene with protein product		615949				11230166	Standard	NM_001301746		Approved	DKFZP564K1964	uc002hhr.3	Q9Y2Y6	OTTHUMG00000132882	ENST00000579849.1:c.19G>T	17.37:g.31258565G>T	ENSP00000463245:p.Val7Phe		Somatic				TMEM98_uc002hhr.2_Missense_Mutation_p.V7F	p.V7F	NM_015544	NP_056359	WXS	Illumina HiSeq	Unspecified	Q9Y2Y6	TMM98_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0769)		3	477	+		Ovarian(249;0.182)|Breast(31;0.244)	7			Helical; (Potential).		E1P631|Q9UFK2	Missense_Mutation	SNP	ENST00000579849.1	37	c.19G>T	CCDS11274.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.257494	0.80246	.	.	ENSG00000006042	ENST00000394642;ENST00000261713;ENST00000395149;ENST00000439138	T;T;T;T	0.57907	0.37;0.47;0.49;0.39	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.56307	0.1976	N	0.20986	0.625	0.80722	D	1	D	0.69078	0.997	P	0.61397	0.888	T	0.59279	-0.7484	10	0.46703	T	0.11	-4.2348	15.6462	0.77055	0.0:0.0:1.0:0.0	.	7	Q9Y2Y6	TMM98_HUMAN	F	7	ENSP00000378138:V7F;ENSP00000261713:V7F;ENSP00000398446:V7F;ENSP00000406394:V7F	ENSP00000261713:V7F	V	+	1	0	TMEM98	28282678	1.000000	0.71417	0.965000	0.40720	0.990000	0.78478	8.853000	0.92222	2.055000	0.61198	0.529000	0.55759	GTT		0.572	TMEM98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256372.2	NM_015544		6	5	1	0	1.58986e-06	0.008291	1.95763e-06	6	5				
TMEM98	26022	broad.mit.edu	37	17	31258574	31258575	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:31258574_31258575GG>TT	ENST00000579849.1	+	3	459_460	c.28_29GG>TT	c.(28-30)GGt>TTt	p.G10F	TMEM98_ENST00000394642.3_Missense_Mutation_p.G10F|TMEM98_ENST00000578289.1_Missense_Mutation_p.G10F	NM_015544.2	NP_056359.2	Q9Y2Y6	TMM98_HUMAN	transmembrane protein 98	10						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(2)|large_intestine(1)	3		Ovarian(249;0.182)|Breast(31;0.244)	BRCA - Breast invasive adenocarcinoma(9;0.0769)			TGTTGCCATAGGTGTGCTGGCC	0.564																																							uc002hhq.2		NA																	0					0						c.(28-30)GGT>TTT		transmembrane protein 98																																				SO:0001583	missense	26022					endoplasmic reticulum|integral to membrane		g.chr17:31258574_31258575GG>TT	CR605381	CCDS11274.1	17q11.2	2005-12-16			ENSG00000006042	ENSG00000006042			24529	protein-coding gene	gene with protein product		615949				11230166	Standard	NM_001301746		Approved	DKFZP564K1964	uc002hhr.3	Q9Y2Y6	OTTHUMG00000132882	Exception_encountered	17.37:g.31258574_31258575delinsTT	ENSP00000463245:p.Gly10Phe		Somatic				TMEM98_uc002hhr.2_Missense_Mutation_p.G10F	p.G10F	NM_015544	NP_056359	WXS	Illumina HiSeq	Unspecified	Q9Y2Y6	TMM98_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0769)		3	486_487	+		Ovarian(249;0.182)|Breast(31;0.244)	10			Helical; (Potential).		E1P631|Q9UFK2	Missense_Mutation	DNP	ENST00000579849.1	37	c.28_29GG>TT	CCDS11274.1																																																																																				0.564	TMEM98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256372.2	NM_015544		7	7	0	0	0	0.004672	0	7	7				
MIEN1	84299	broad.mit.edu	37	17	37886456	37886456	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:37886456C>T	ENST00000394231.3	-	2	469	c.178G>A	c.(178-180)Ggg>Agg	p.G60R	MIEN1_ENST00000474210.1_Intron|ERBB2_ENST00000584888.1_3'UTR|MIEN1_ENST00000577810.1_Missense_Mutation_p.G60R			Q9BRT3	MIEN1_HUMAN	migration and invasion enhancer 1	60					apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell migration (GO:0030335)|positive regulation of filopodium assembly (GO:0051491)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	selenium binding (GO:0008430)										CCTGTGCCCCCGAGGCGCGAC	0.587																																							uc002hsq.2		NA																	0					0						c.(178-180)GGG>AGG		hypothetical protein LOC84299							24.0	27.0	26.0					17																	37886456		2203	4299	6502	SO:0001583	missense	84299				cell redox homeostasis	cytosol|membrane	selenium binding	g.chr17:37886456C>T	AJ308025	CCDS11344.1	17q12	2011-09-21	2011-09-21	2011-09-21	ENSG00000141741	ENSG00000141741			28230	protein-coding gene	gene with protein product		611802	"""chromosome 17 open reading frame 37"""	C17orf37		17121940, 12739007, 17503775, 21628459	Standard	NM_032339		Approved	MGC14832, ORB3, XTP4, C35, Rdx12	uc002hsq.3	Q9BRT3	OTTHUMG00000133252	ENST00000394231.3:c.178G>A	17.37:g.37886456C>T	ENSP00000377778:p.Gly60Arg		Somatic					p.G60R	NM_032339	NP_115715	WXS	Illumina HiSeq	Unspecified	Q9BRT3	CQ037_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;3.72e-63)|all cancers(3;1.87e-56)|BRCA - Breast invasive adenocarcinoma(8;6.8e-45)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)		2	218	-	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		60						Missense_Mutation	SNP	ENST00000394231.3	37	c.178G>A	CCDS11344.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597517	0.66332	.	.	ENSG00000141741	ENST00000394231	T	0.48836	0.8	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.70325	0.3211	M	0.78049	2.395	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.74290	-0.3713	10	0.87932	D	0	-16.9296	17.3215	0.87238	0.0:1.0:0.0:0.0	.	60	Q9BRT3	MIEN1_HUMAN	R	60	ENSP00000377778:G60R	ENSP00000377778:G60R	G	-	1	0	C17orf37	35139982	0.999000	0.42202	0.997000	0.53966	0.983000	0.72400	5.102000	0.64572	2.629000	0.89072	0.591000	0.81541	GGG		0.587	MIEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257020.3	NM_032339		4	20	0	0	0	0.000602	0	4	20				
STAT5B	6777	broad.mit.edu	37	17	40384145	40384145	+	Start_Codon_SNP	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:40384145T>C	ENST00000293328.3	-	2	169	c.1A>G	c.(1-3)Atg>Gtg	p.M1V		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	1					2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	CACACAGCCATGGTTTACAAT	0.423																																							uc002hzh.2		NA																	0				ovary(3)|lung(2)|skin(1)	6						c.(1-3)ATG>GTG		signal transducer and activator of transcription	Dasatinib(DB01254)						117.0	104.0	109.0					17																	40384145		2203	4300	6503	SO:0001582	initiator_codon_variant	6777				2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|JAK-STAT cascade involved in growth hormone signaling pathway|oxaloacetate metabolic process|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|glucocorticoid receptor binding|sequence-specific DNA binding transcription factor activity	g.chr17:40384145T>C	BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.1A>G	17.37:g.40384145T>C	ENSP00000293328:p.Met1Val		Somatic				STAT5B_uc002hzi.3_Missense_Mutation_p.M1V	p.M1V	NM_012448	NP_036580	WXS	Illumina HiSeq	Unspecified	P51692	STA5B_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.135)	2	170	-		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)	1					Q8WWS8	Missense_Mutation	SNP	ENST00000293328.3	37	c.1A>G	CCDS11423.1	.	.	.	.	.	.	.	.	.	.	T	18.94	3.730148	0.69074	.	.	ENSG00000173757	ENST00000293328;ENST00000415845	T;T	0.57107	0.42;0.42	5.03	5.03	0.67393	STAT transcription factor, protein interaction (2);	0.078880	0.85682	D	0.000000	T	0.66896	0.2836	.	.	.	0.80722	D	1	D;P	0.59357	0.985;0.942	P;P	0.58013	0.831;0.562	T	0.70781	-0.4779	9	0.59425	D	0.04	.	14.5941	0.68392	0.0:0.0:0.0:1.0	.	1;1	Q8WW55;P51692	.;STA5B_HUMAN	V	1	ENSP00000293328:M1V;ENSP00000398379:M1V	ENSP00000293328:M1V	M	-	1	0	STAT5B	37637671	1.000000	0.71417	0.993000	0.49108	0.757000	0.42996	7.722000	0.84778	2.126000	0.65437	0.459000	0.35465	ATG		0.423	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319797.1	NM_012448	Missense_Mutation	10	38	0	0	0	0.008291	0	10	38				
SLC4A1	6521	broad.mit.edu	37	17	42336641	42336641	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:42336641C>A	ENST00000262418.6	-	9	921	c.766G>T	c.(766-768)Gtg>Ttg	p.V256L	AC003043.1_ENST00000597382.1_Intron|SLC4A1_ENST00000471005.1_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	256	Globular.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GGCAGCTCCACCGCCTCCAGC	0.652																																							uc002igf.3		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(766-768)GTG>TTG		solute carrier family 4, anion exchanger, member							28.0	30.0	29.0					17																	42336641		2203	4300	6503	SO:0001583	missense	6521				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity	g.chr17:42336641C>A		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.766G>T	17.37:g.42336641C>A	ENSP00000262418:p.Val256Leu		Somatic				SLC4A1_uc002igg.3_Missense_Mutation_p.V256L	p.V256L	NM_000342	NP_000333	WXS	Illumina HiSeq	Unspecified	P02730	B3AT_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.115)	9	915	-		Breast(137;0.014)|Prostate(33;0.0181)	256			Cytoplasmic.		G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	ENST00000262418.6	37	c.766G>T	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	c	1.199	-0.633037	0.03584	.	.	ENSG00000004939	ENST00000262418	T	0.65916	-0.18	4.81	-2.4	0.06583	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.743369	0.12495	N	0.463862	T	0.27798	0.0684	N	0.05199	-0.095	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.28554	-1.0040	10	0.02654	T	1	.	4.6154	0.12424	0.1092:0.1717:0.525:0.1941	.	256;256	E2RVJ0;P02730	.;B3AT_HUMAN	L	256	ENSP00000262418:V256L	ENSP00000262418:V256L	V	-	1	0	SLC4A1	39692167	0.013000	0.17824	0.000000	0.03702	0.009000	0.06853	0.105000	0.15333	-0.572000	0.06006	0.456000	0.33151	GTG		0.652	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342		16	29	1	0	0.000422831	0.004007	0.000470417	16	29				
SAMD14	201191	broad.mit.edu	37	17	48190269	48190269	+	Silent	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:48190269G>T	ENST00000330175.4	-	10	1559	c.1242C>A	c.(1240-1242)gcC>gcA	p.A414A	SAMD14_ENST00000503131.1_Silent_p.A442A	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	414										breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						AGCTCTTCTTGGCCTCCTGCT	0.701																																							uc002iqg.2		NA																	0					0						c.(1240-1242)GCC>GCA		sterile alpha motif domain containing 14							39.0	42.0	41.0					17																	48190269		2203	4300	6503	SO:0001819	synonymous_variant	201191							g.chr17:48190269G>T		CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.1242C>A	17.37:g.48190269G>T			Somatic				SAMD14_uc002iqd.2_Silent_p.A197A|SAMD14_uc002iqe.2_Silent_p.A197A|SAMD14_uc002iqf.2_Silent_p.A442A	p.A414A	NM_174920	NP_777580	WXS	Illumina HiSeq	Unspecified	Q8IZD0	SAM14_HUMAN			10	1541	-			414			Potential.		A5D8V1|Q8N2X0	Silent	SNP	ENST00000330175.4	37	c.1242C>A	CCDS58562.1																																																																																				0.701	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366661.1	NM_174920		21	48	1	0	1.96292e-10	0.010504	2.74968e-10	21	48				
WFIKKN2	124857	broad.mit.edu	37	17	48917105	48917105	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:48917105C>A	ENST00000311378.4	+	2	984	c.456C>A	c.(454-456)acC>acA	p.T152T	WFIKKN2_ENST00000426127.1_Silent_p.T59T|RP11-506D12.5_ENST00000572491.2_RNA	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	152	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			ACGGCCTCACCTACTATAACC	0.592																																							uc002isv.3		NA																	0				ovary(2)|skin(1)	3						c.(454-456)ACC>ACA		WFIKKN2 protein							106.0	97.0	100.0					17																	48917105		2203	4300	6503	SO:0001819	synonymous_variant	124857					extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity	g.chr17:48917105C>A	AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.456C>A	17.37:g.48917105C>A			Somatic				WFIKKN2_uc010dbu.2_Silent_p.T59T	p.T152T	NM_175575	NP_783165	WXS	Illumina HiSeq	Unspecified	Q8TEU8	WFKN2_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.09e-08)		2	1150	+			152			Kazal-like.		Q6UXZ9	Silent	SNP	ENST00000311378.4	37	c.456C>A	CCDS11575.1																																																																																				0.592	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	NM_175575		24	41	1	0	5.35356e-11	0.00278	7.5298e-11	24	41				
BPTF	2186	broad.mit.edu	37	17	65944403	65944403	+	Missense_Mutation	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:65944403A>T	ENST00000321892.4	+	25	8346	c.8285A>T	c.(8284-8286)gAt>gTt	p.D2762V	RP11-855A2.3_ENST00000577385.1_RNA|BPTF_ENST00000335221.5_Missense_Mutation_p.D2619V|BPTF_ENST00000306378.6_Missense_Mutation_p.D2636V|BPTF_ENST00000424123.3_Missense_Mutation_p.D2480V			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2762					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTGGACAAGGATCTGCAAATT	0.463																																							uc002jgf.2		NA																	0				ovary(2)|skin(2)	4						c.(7906-7908)GAT>GTT		bromodomain PHD finger transcription factor							76.0	57.0	64.0					17																	65944403		2203	4300	6503	SO:0001583	missense	2186				brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding	g.chr17:65944403A>T	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.8285A>T	17.37:g.65944403A>T	ENSP00000315454:p.Asp2762Val		Somatic				BPTF_uc002jge.2_Missense_Mutation_p.D2619V|BPTF_uc002jgg.2_Missense_Mutation_p.D293V|BPTF_uc002jgh.2_Missense_Mutation_p.D95V	p.D2636V	NM_182641	NP_872579	WXS	Illumina HiSeq	Unspecified	Q12830	BPTF_HUMAN	BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)		23	7968	+	all_cancers(12;6e-11)		2762					Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37	c.7907A>T		.	.	.	.	.	.	.	.	.	.	A	13.35	2.210026	0.39003	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892;ENST00000424123	T;T;T	0.62498	2.0;0.02;2.0	5.75	5.75	0.90469	.	.	.	.	.	T	0.71913	0.3396	L	0.47716	1.5	0.80722	D	1	D;D;D	0.71674	0.998;0.979;0.979	P;P;P	0.61722	0.893;0.79;0.79	T	0.74876	-0.3515	9	0.87932	D	0	-4.5048	16.0455	0.80717	1.0:0.0:0.0:0.0	.	440;2636;2619	B4DJV8;Q12830-2;Q12830-4	.;.;.	V	2636;2619;2762;290	ENSP00000307208:D2636V;ENSP00000334351:D2619V;ENSP00000315454:D2762V	ENSP00000307208:D2636V	D	+	2	0	BPTF	63374865	1.000000	0.71417	0.901000	0.35422	0.281000	0.26958	7.472000	0.80996	2.189000	0.69895	0.460000	0.39030	GAT		0.463	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459		10	28	0	0	0	0.000978	0	10	28				
RNF157	114804	broad.mit.edu	37	17	74163145	74163145	+	Missense_Mutation	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:74163145T>A	ENST00000269391.6	-	5	638	c.506A>T	c.(505-507)cAg>cTg	p.Q169L	RNF157_ENST00000319945.6_Missense_Mutation_p.Q169L	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	169							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			GCAGAACTGCTGACACACTCC	0.562																																					GBM(186;507 2120 27388 27773 52994)	GBM(186;507 2120 27388 27773 52994)	uc002jqz.2		NA																	0				ovary(1)	1						c.(505-507)CAG>CTG		ring finger protein 157							128.0	114.0	119.0					17																	74163145		2203	4300	6503	SO:0001583	missense	114804						zinc ion binding	g.chr17:74163145T>A	AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.506A>T	17.37:g.74163145T>A	ENSP00000269391:p.Gln169Leu		Somatic				RNF157_uc002jra.2_Missense_Mutation_p.Q169L	p.Q169L	NM_052916	NP_443148	WXS	Illumina HiSeq	Unspecified	Q96PX1	RN157_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.187)		5	575	-			169					Q8NB72|Q96N56	Missense_Mutation	SNP	ENST00000269391.6	37	c.506A>T	CCDS32740.1	.	.	.	.	.	.	.	.	.	.	T	33	5.222845	0.95139	.	.	ENSG00000141576	ENST00000269391;ENST00000319945;ENST00000301610	T;T	0.29655	1.56;1.56	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.64260	0.2582	M	0.91196	3.185	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77557	0.986;0.99	T	0.73341	-0.4013	10	0.72032	D	0.01	-29.2594	15.4555	0.75311	0.0:0.0:0.0:1.0	.	169;169	Q96PX1-2;Q96PX1	.;RN157_HUMAN	L	169;169;131	ENSP00000269391:Q169L;ENSP00000321837:Q169L	ENSP00000269391:Q169L	Q	-	2	0	RNF157	71674740	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.018000	0.88722	2.123000	0.65237	0.533000	0.62120	CAG		0.562	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	XM_290732		14	117	0	0	0	0.00245	0	14	117				
USP36	57602	broad.mit.edu	37	17	76831489	76831489	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:76831489C>A	ENST00000542802.3	-	4	791	c.348G>T	c.(346-348)cgG>cgT	p.R116R	USP36_ENST00000312010.6_Silent_p.R116R|USP36_ENST00000590546.2_Silent_p.R116R|USP36_ENST00000589424.1_Silent_p.R116R			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	116					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			CGCGGAAGACCCGCTCCCACC	0.597																																							uc002jvz.1		NA																	0				lung(2)|ovary(1)|breast(1)|kidney(1)	5						c.(346-348)CGG>CGT		ubiquitin specific peptidase 36							142.0	96.0	111.0					17																	76831489		2203	4300	6503	SO:0001819	synonymous_variant	57602				ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr17:76831489C>A	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.348G>T	17.37:g.76831489C>A			Somatic				USP36_uc002jwa.1_Silent_p.R116R|USP36_uc002jwd.1_Silent_p.R116R	p.R116R	NM_025090	NP_079366	WXS	Illumina HiSeq	Unspecified	Q9P275	UBP36_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)		4	673	-			116					Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Silent	SNP	ENST00000542802.3	37	c.348G>T	CCDS32755.1																																																																																				0.597	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090		11	34	1	0	3.86212e-05	0.008291	4.41021e-05	11	34				
CBX2	84733	broad.mit.edu	37	17	77757821	77757821	+	Silent	SNP	G	G	T	rs144185230		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:77757821G>T	ENST00000310942.4	+	5	683	c.579G>T	c.(577-579)ctG>ctT	p.L193L		NM_005189.2	NP_005180.1	Q14781	CBX2_HUMAN	chromobox homolog 2	193					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|development of primary sexual characteristics (GO:0045137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GGAAGGATCTGGGGGCCCCGG	0.697																																							uc002jxc.2		NA																	0					0						c.(577-579)CTG>CTT		chromobox homolog 2 isoform 1							23.0	30.0	27.0					17																	77757821		2195	4297	6492	SO:0001819	synonymous_variant	84733				cell differentiation|chromatin modification|development of primary sexual characteristics|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	PcG protein complex	DNA binding	g.chr17:77757821G>T	BC004252, BG354579	CCDS11764.1, CCDS32757.1	17q25.3	2010-07-06	2010-06-24		ENSG00000173894	ENSG00000173894			1552	protein-coding gene	gene with protein product	"""Pc class homolog (Drosophila)"""	602770	"""chromobox homolog 2 (Drosophila Pc class)"", ""cell division cycle associated 6"""	CDCA6		7782071, 2477932	Standard	NM_005189		Approved	MGC10561	uc002jxc.3	Q14781		ENST00000310942.4:c.579G>T	17.37:g.77757821G>T			Somatic					p.L193L	NM_005189	NP_005180	WXS	Illumina HiSeq	Unspecified	Q14781	CBX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		5	621	+			193					Q0VDA5|Q9BTB1	Silent	SNP	ENST00000310942.4	37	c.579G>T	CCDS32757.1																																																																																				0.697	CBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437040.1	NM_032647		25	40	1	0	3.28513e-13	0.003954	4.89937e-13	25	40				
LAMA1	284217	broad.mit.edu	37	18	6978269	6978269	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr18:6978269G>C	ENST00000389658.3	-	43	6209	c.6116C>G	c.(6115-6117)aCa>aGa	p.T2039R		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2039	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GCTGGCAGATGTGTTCAGCAG	0.607																																							uc002knm.2		NA																	0				ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(6115-6117)ACA>AGA		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						179.0	153.0	162.0					18																	6978269		2203	4300	6503	SO:0001583	missense	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:6978269G>C	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.6116C>G	18.37:g.6978269G>C	ENSP00000374309:p.Thr2039Arg		Somatic				LAMA1_uc010wzj.1_Missense_Mutation_p.T1515R	p.T2039R	NM_005559	NP_005550	WXS	Illumina HiSeq	Unspecified	P25391	LAMA1_HUMAN			43	6210	-		Colorectal(10;0.172)	2039			Domain II and I.			Missense_Mutation	SNP	ENST00000389658.3	37	c.6116C>G	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095474	0.76870	.	.	ENSG00000101680	ENST00000389658	T	0.48836	0.8	5.64	5.64	0.86602	Laminin II (1);	0.058091	0.64402	D	0.000004	T	0.67674	0.2918	M	0.72479	2.2	0.48395	D	0.999647	D	0.71674	0.998	D	0.71184	0.972	T	0.60031	-0.7342	10	0.21540	T	0.41	.	20.0804	0.97772	0.0:0.0:1.0:0.0	.	2039	P25391	LAMA1_HUMAN	R	2039	ENSP00000374309:T2039R	ENSP00000374309:T2039R	T	-	2	0	LAMA1	6968269	1.000000	0.71417	0.128000	0.21923	0.006000	0.05464	6.595000	0.74109	2.824000	0.97209	0.650000	0.86243	ACA		0.607	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		22	110	0	0	0	0.001882	0	22	110				
LRRC30	339291	broad.mit.edu	37	18	7231236	7231236	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr18:7231236C>G	ENST00000383467.2	+	1	114	c.100C>G	c.(100-102)Ctg>Gtg	p.L34V		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	34										central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GGACGATGCCCTGCTCTCGGG	0.612																																							uc010wzk.1		NA																	0				ovary(1)|liver(1)	2						c.(100-102)CTG>GTG		leucine rich repeat containing 30							70.0	75.0	73.0					18																	7231236		1986	4157	6143	SO:0001583	missense	339291							g.chr18:7231236C>G		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.100C>G	18.37:g.7231236C>G	ENSP00000372959:p.Leu34Val		Somatic					p.L34V	NM_001105581	NP_001099051	WXS	Illumina HiSeq	Unspecified	A6NM36	LRC30_HUMAN			1	100	+			34						Missense_Mutation	SNP	ENST00000383467.2	37	c.100C>G	CCDS42409.1	.	.	.	.	.	.	.	.	.	.	C	8.391	0.839788	0.16891	.	.	ENSG00000206422	ENST00000383467	T	0.44482	0.92	5.66	1.86	0.25419	.	0.348665	0.26571	N	0.023629	T	0.26919	0.0659	L	0.32530	0.975	0.23030	N	0.998409	B	0.13145	0.007	B	0.09377	0.004	T	0.15065	-1.0450	10	0.30078	T	0.28	.	6.8136	0.23819	0.0:0.6683:0.1255:0.2061	.	34	A6NM36	LRC30_HUMAN	V	34	ENSP00000372959:L34V	ENSP00000372959:L34V	L	+	1	2	LRRC30	7221236	0.991000	0.36638	0.040000	0.18447	0.530000	0.34684	2.920000	0.48844	0.123000	0.18342	0.655000	0.94253	CTG		0.612	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442140.1	XM_292678		29	90	0	0	0	0.00632	0	29	90				
RAB31	11031	broad.mit.edu	37	18	9792205	9792205	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr18:9792205C>A	ENST00000578921.1	+	3	415	c.174C>A	c.(172-174)ctC>ctA	p.L58L		NM_006868.3	NP_006859.2	Q13636	RAB31_HUMAN	RAB31, member RAS oncogene family	57					cellular response to insulin stimulus (GO:0032869)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|phagosome maturation (GO:0090382)|receptor internalization (GO:0031623)|regulated secretory pathway (GO:0045055)|small GTPase mediated signal transduction (GO:0007264)	early endosome (GO:0005769)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(2)|large_intestine(2)|lung(3)|skin(1)	10						ACAAGTTCCTCATCTGGGACA	0.408																																							uc002kog.2		NA																	0				skin(1)	1						c.(172-174)CTC>CTA		RAB31, member RAS oncogene family							80.0	73.0	76.0					18																	9792205		1918	4142	6060	SO:0001819	synonymous_variant	11031				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	g.chr18:9792205C>A	U59877	CCDS45826.1	18p11.22	2014-03-18			ENSG00000168461	ENSG00000168461		"""RAB, member RAS oncogene"""	9771	protein-coding gene	gene with protein product		605694				8863739	Standard	NM_006868		Approved	Rab22B	uc002kog.2	Q13636	OTTHUMG00000178513	ENST00000578921.1:c.174C>A	18.37:g.9792205C>A			Somatic					p.L58L	NM_006868	NP_006859	WXS	Illumina HiSeq	Unspecified	Q13636	RAB31_HUMAN			3	349	+			57					B2RBT7|Q15770|Q9HC00	Silent	SNP	ENST00000578921.1	37	c.174C>A	CCDS45826.1																																																																																				0.408	RAB31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442280.3			9	16	1	0	5.16669e-11	0.000978	7.32653e-11	9	16				
MC5R	4161	broad.mit.edu	37	18	13825772	13825772	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr18:13825772C>A	ENST00000324750.3	+	1	230	c.8C>A	c.(7-9)tCc>tAc	p.S3Y	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	3					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						GCAATGAATTCCTCATTTCAC	0.408																																							uc010xaf.1		NA																	0				ovary(3)|lung(2)|breast(1)	6						c.(7-9)TCC>TAC		melanocortin 5 receptor							89.0	86.0	87.0					18																	13825772		2203	4300	6503	SO:0001583	missense	4161				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding	g.chr18:13825772C>A	AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.8C>A	18.37:g.13825772C>A	ENSP00000318077:p.Ser3Tyr		Somatic					p.S3Y	NM_005913	NP_005904	WXS	Illumina HiSeq	Unspecified	P33032	MC5R_HUMAN			1	8	+			3			Extracellular (Potential).		B0YJ34|Q502V1	Missense_Mutation	SNP	ENST00000324750.3	37	c.8C>A	CCDS11868.1	.	.	.	.	.	.	.	.	.	.	C	9.390	1.075214	0.20227	.	.	ENSG00000176136	ENST00000324750	T	0.38560	1.13	5.54	4.66	0.58398	.	0.471083	0.21251	N	0.077652	T	0.22589	0.0545	N	0.08118	0	0.28528	N	0.91272	B	0.31054	0.306	B	0.27500	0.08	T	0.14868	-1.0457	10	0.66056	D	0.02	.	9.5533	0.39324	0.0:0.8413:0.0:0.1587	.	3	P33032	MC5R_HUMAN	Y	3	ENSP00000318077:S3Y	ENSP00000318077:S3Y	S	+	2	0	MC5R	13815772	0.001000	0.12720	0.995000	0.50966	0.236000	0.25371	0.698000	0.25571	1.343000	0.45638	0.455000	0.32223	TCC		0.408	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254638.1	NM_005913		18	61	1	0	1.67942e-08	0.006122	2.23491e-08	18	61				
POTEC	388468	broad.mit.edu	37	18	14542825	14542825	+	Silent	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr18:14542825G>A	ENST00000358970.5	-	1	320	c.321C>T	c.(319-321)ccC>ccT	p.P107P	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	107										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CCCTGCAGCAGGGGAAGCAGT	0.607																																							uc010dln.2		NA																	0				skin(3)	3						c.(319-321)CCC>CCT		ANKRD26-like family B, member 2							20.0	30.0	27.0					18																	14542825		692	1590	2282	SO:0001819	synonymous_variant	388468							g.chr18:14542825G>A	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.321C>T	18.37:g.14542825G>A			Somatic				POTEC_uc010xaj.1_RNA	p.P107P	NM_001137671	NP_001131143	WXS	Illumina HiSeq	Unspecified	B2RU33	POTEC_HUMAN			1	775	-			107						Silent	SNP	ENST00000358970.5	37	c.321C>T	CCDS45835.1																																																																																				0.607	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269		12	343	0	0	0	0.004007	0	12	343				
ZNF521	25925	broad.mit.edu	37	18	22806904	22806904	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr18:22806904G>T	ENST00000361524.3	-	4	1126	c.978C>A	c.(976-978)taC>taA	p.Y326*	ZNF521_ENST00000538137.2_Nonsense_Mutation_p.Y326*|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Nonsense_Mutation_p.Y106*	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	326					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CCATGTGGCTGTACAGTTCCT	0.537			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(976-978)TAC>TAA		zinc finger protein 521							105.0	95.0	98.0					18																	22806904		2203	4300	6503	SO:0001587	stop_gained	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22806904G>T	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.978C>A	18.37:g.22806904G>T	ENSP00000354794:p.Tyr326*		Somatic				ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Nonsense_Mutation_p.Y326*|ZNF521_uc002kvl.2_Nonsense_Mutation_p.Y106*	p.Y326*	NM_015461	NP_056276	WXS	Illumina HiSeq	Unspecified	Q96K83	ZN521_HUMAN			4	1225	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		326			C2H2-type 8.		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Nonsense_Mutation	SNP	ENST00000361524.3	37	c.978C>A	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963118	0.74016	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	.	.	.	6.02	-0.75	0.11080	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-41.7155	10.753	0.46219	0.5081:0.0:0.4919:0.0	.	.	.	.	X	326;360;326	.	ENSP00000354794:Y326X	Y	-	3	2	ZNF521	21060902	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	1.862000	0.39448	-0.177000	0.10690	0.655000	0.94253	TAC		0.537	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		11	53	1	0	4.68919e-08	0.008291	6.12249e-08	11	53				
ACAA2	10449	broad.mit.edu	37	18	47317871	47317871	+	Silent	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr18:47317871T>A	ENST00000285093.10	-	7	1327	c.852A>T	c.(850-852)gtA>gtT	p.V284V	ACAA2_ENST00000587994.1_Silent_p.V281V|ACAA2_ENST00000589432.1_Silent_p.V229V	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	284					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(7)|ovary(1)	10						CACATCCAGATACAAAGTAGC	0.398																																							uc002ldw.3		NA																	0				ovary(1)	1						c.(850-852)GTA>GTT		acetyl-coenzyme A acyltransferase 2							128.0	118.0	121.0					18																	47317871		2203	4300	6503	SO:0001819	synonymous_variant	10449				anti-apoptosis|cholesterol biosynthetic process		acetyl-CoA C-acyltransferase activity|protein binding	g.chr18:47317871T>A	D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.852A>T	18.37:g.47317871T>A			Somatic				ACAA2_uc002ldx.3_Silent_p.V281V	p.V284V	NM_006111	NP_006102	WXS	Illumina HiSeq	Unspecified	P42765	THIM_HUMAN			7	1249	-			284					Q9BUT6	Silent	SNP	ENST00000285093.10	37	c.852A>T	CCDS11939.1																																																																																				0.398	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255921.2	NM_006111		19	41	0	0	0	0.006122	0	19	41				
SOCS6	9306	broad.mit.edu	37	18	67992499	67992499	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr18:67992499G>T	ENST00000397942.3	+	2	911	c.595G>T	c.(595-597)Gga>Tga	p.G199*	SOCS6_ENST00000582322.1_Nonsense_Mutation_p.G199*	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	199					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				TTCTCATAATGGAGACCTGCA	0.507																																					Melanoma(84;1024 1361 24382 36583 42651)	Melanoma(84;1024 1361 24382 36583 42651)	uc002lkr.1		NA																	0				large_intestine(1)|lung(1)	2						c.(595-597)GGA>TGA		suppressor of cytokine signaling 6							112.0	96.0	102.0					18																	67992499		2203	4300	6503	SO:0001587	stop_gained	9306				defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm		g.chr18:67992499G>T	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.595G>T	18.37:g.67992499G>T	ENSP00000381034:p.Gly199*		Somatic				SOCS6_uc010dqq.2_Nonsense_Mutation_p.G199*	p.G199*	NM_004232	NP_004223	WXS	Illumina HiSeq	Unspecified	O14544	SOCS6_HUMAN			2	911	+		Esophageal squamous(42;0.129)|Colorectal(73;0.152)	199					Q8WUM3	Nonsense_Mutation	SNP	ENST00000397942.3	37	c.595G>T	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243664	0.79912	.	.	ENSG00000170677	ENST00000397942	.	.	.	5.12	4.24	0.50183	.	0.302038	0.30003	N	0.010651	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.443	15.5362	0.76004	0.0:0.1387:0.8613:0.0	.	.	.	.	X	199	.	ENSP00000381034:G199X	G	+	1	0	SOCS6	66143479	1.000000	0.71417	0.060000	0.19600	0.057000	0.15508	6.344000	0.72991	1.127000	0.42034	0.561000	0.74099	GGA		0.507	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2			15	92	1	0	4.7546e-09	0.004007	6.37633e-09	15	92				
STK11	6794	broad.mit.edu	37	19	1220486	1220487	+	Missense_Mutation	DNP	CG	CG	AT	rs121913315		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:1220486_1220487CG>AT	ENST00000326873.7	+	4	1752_1753	c.579_580CG>AT	c.(577-582)tcCGac>tcATac	p.D194Y		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	194	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> N (in PJS). {ECO:0000269|PubMed:10408777}.|D -> V (in lung cancer; somatic mutation). {ECO:0000269|PubMed:10079245}.|D -> Y (in melanoma; sporadic malignant; somatic mutation). {ECO:0000269|PubMed:10208439}.		activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.D194Y(6)|p.Y156fs*87(4)|p.?(3)|p.D194N(3)|p.D194fs*93(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		TCAAAATCTCCGACCTGGGCGT	0.673	D194N(ALEXANDERCELLS_LIVER)|D194N(PLCPRF5_LIVER)	14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1	D194N(ALEXANDERCELLS_LIVER)|D194N(PLCPRF5_LIVER)	14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		37	Whole gene deletion(20)|Substitution - Missense(9)|Deletion - Frameshift(5)|Unknown(3)	p.0?(19)|p.D194Y(6)|p.Y156fs*87(4)|p.?(3)|p.D194N(3)|p.D194fs*93(1)|p.D194V(1)	cervix(15)|lung(15)|skin(2)|liver(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CM991156	STK11	M	rs121913315	c.(577-582)TCCGAC>TCATAC		serine/threonine protein kinase 11																																				SO:0001583	missense	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1220486_1220487CG>AT	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		Exception_encountered	19.37:g.1220486_1220487delinsAT	ENSP00000324856:p.Asp194Tyr	TSP Lung(3;<1E-08)	Somatic					p.D194Y	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	4	1694_1695	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	194	D->A: Loss of kinase activity.	D -> V (in lung cancer; somatic mutation).|D -> Y (in melanoma; sporadic malignant; somatic mutation).|D -> N (in PJS).	Protein kinase.		B2RBX7|E7EW76	Missense_Mutation	DNP	ENST00000326873.7	37	c.579_580CG>AT	CCDS45896.1																																																																																				0.673	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		7	6	0	0	0	0.004672	0	7	6				
MUM1	84939	broad.mit.edu	37	19	1360189	1360189	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:1360189C>T	ENST00000415183.3	+	4	298	c.272C>T	c.(271-273)tCg>tTg	p.S91L	MUM1_ENST00000311401.5_Missense_Mutation_p.S22L|MUM1_ENST00000591806.1_Missense_Mutation_p.S91L|MUM1_ENST00000344663.3_Missense_Mutation_p.S91L			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	90					chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TACAGACGGTCGCTTCGCGTG	0.587											OREG0025088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010xgm.1		NA																	0					0						c.(268-270)TCG>TTG		SubName: Full=MUM1 protein;							72.0	68.0	69.0					19																	1360189		2203	4300	6503	SO:0001583	missense	84939				chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding	g.chr19:1360189C>T	AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.272C>T	19.37:g.1360189C>T	ENSP00000394925:p.Ser91Leu		Somatic	OREG0025088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	595	MUM1_uc010dsi.2_Missense_Mutation_p.S22L|MUM1_uc002lrz.2_Missense_Mutation_p.S91L|MUM1_uc002lsb.2_Missense_Mutation_p.S22L|MUM1_uc002lsc.1_Missense_Mutation_p.S22L	p.S90L			WXS	Illumina HiSeq	Unspecified	Q2TAK8	MUM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	4	338	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)	90					A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	ENST00000415183.3	37	c.269C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.99|15.99	2.996605|2.996605	0.54147|0.54147	.|.	.|.	ENSG00000160953|ENSG00000160953	ENST00000542512|ENST00000344663;ENST00000311401;ENST00000415183	.|T;T;T	.|0.46063	.|0.88;0.88;0.88	4.7|4.7	4.7|4.7	0.59300|0.59300	.|.	.|0.114289	.|0.36854	.|N	.|0.002374	.|T	.|0.60741	.|0.2292	M|M	0.68317|0.68317	2.08|2.08	0.30080|0.30080	N|N	0.809304|0.809304	.|D;D;D;D	.|0.89917	.|0.999;0.999;1.0;1.0	.|P;D;D;P	.|0.74674	.|0.893;0.92;0.984;0.9	.|T	.|0.62215	.|-0.6901	.|10	.|0.87932	.|D	.|0	.|.	13.0197|13.0197	0.58779|0.58779	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|91;91;22;90	.|B7ZLY8;D6W5Y8;Q2TAK8-2;Q2TAK8	.|.;.;.;MUM1_HUMAN	.|L	-1|91;22;91	.|ENSP00000345789:S91L;ENSP00000309135:S22L;ENSP00000394925:S91L	.|ENSP00000309135:S22L	.|S	+|+	.|2	.|0	MUM1|MUM1	1311189|1311189	0.089000|0.089000	0.21612|0.21612	0.454000|0.454000	0.27019|0.27019	0.055000|0.055000	0.15305|0.15305	3.226000|3.226000	0.51254|0.51254	2.427000|2.427000	0.82271|0.82271	0.655000|0.655000	0.94253|0.94253	.|TCG		0.587	MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1	NM_032853		16	52	0	0	0	0.003163	0	16	52				
FCER2	2208	broad.mit.edu	37	19	7764626	7764626	+	Splice_Site	SNP	T	T	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:7764626T>G	ENST00000346664.5	-	2	233	c.21A>C	c.(19-21)tcA>tcC	p.S7S	FCER2_ENST00000360067.4_5'Flank|FCER2_ENST00000597921.1_Splice_Site_p.S7S	NM_001220500.1|NM_002002.4	NP_001207429.1|NP_001993.2	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor for (CD23)	7					Notch signaling pathway (GO:0007219)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10						TCCTCCTACCTGAATATTGAC	0.562																																							uc002mhn.2		NA																	0					0						c.(19-21)TCA>TCC		Fc fragment of IgE, low affinity II, receptor							197.0	141.0	160.0					19																	7764626		2203	4300	6503	SO:0001630	splice_region_variant	2208				positive regulation of killing of cells of other organism|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of nitric-oxide synthase activity	extracellular region|integral to plasma membrane	IgE binding|integrin binding|receptor activity|sugar binding	g.chr19:7764626T>G	M15059	CCDS12184.1	19p13.3	2011-08-30	2006-03-09			ENSG00000104921		"""C-type lectin domain containing"", ""CD molecules"""	3612	protein-coding gene	gene with protein product		151445	"""Fc fragment of IgE, low affinity II, receptor for (CD23A)"""	CD23A, FCE2			Standard	NM_002002		Approved	CLEC4J, CD23	uc002mhm.2	P06734		ENST00000346664.5:c.22+1A>C	19.37:g.7764626T>G			Somatic				FCER2_uc010xjs.1_5'UTR|FCER2_uc010xjt.1_5'UTR|FCER2_uc002mhm.2_Silent_p.S7S|FCER2_uc010dvo.2_Silent_p.S7S	p.S7S	NM_002002	NP_001993	WXS	Illumina HiSeq	Unspecified	P06734	FCER2_HUMAN			2	205	-			7			Cytoplasmic (Potential).			Silent	SNP	ENST00000346664.5	37	c.21A>C	CCDS12184.1																																																																																				0.562	FCER2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461832.1	NM_002002	Silent	16	20	0	0	0	0.007413	0	16	20				
CCL25	6370	broad.mit.edu	37	19	8121118	8121118	+	Silent	SNP	G	G	A	rs369217231		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:8121118G>A	ENST00000390669.3	+	2	206	c.156G>A	c.(154-156)caG>caA	p.Q52Q	CCL25_ENST00000315626.4_Silent_p.Q52Q|CCL25_ENST00000253451.4_Silent_p.Q52Q			O15444	CCL25_HUMAN	chemokine (C-C motif) ligand 25	52					cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|negative regulation of leukocyte tethering or rolling (GO:1903237)|positive regulation of cell-matrix adhesion (GO:0001954)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR10 chemokine receptor binding (GO:0031735)|chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|hormone activity (GO:0005179)			NS(1)|endometrium(1)|lung(1)|skin(1)|urinary_tract(1)	5						ACCGGATCCAGGAGGTGAGCG	0.667																																							uc002mjd.2		NA																	0					0						c.(154-156)CAG>CAA		small inducible cytokine A25 precursor		G	,	1,4077		0,1,2038	41.0	45.0	44.0		156,156	2.1	1.0	19		44	0,8370		0,0,4185	no	coding-synonymous,coding-synonymous	CCL25	NM_001201359.1,NM_005624.3	,	0,1,6223	AA,AG,GG		0.0,0.0245,0.0080	,	52/150,52/151	8121118	1,12447	2039	4185	6224	SO:0001819	synonymous_variant	6370				chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response	extracellular space|soluble fraction	CCR10 chemokine receptor binding|chemokine activity|hormone activity	g.chr19:8121118G>A	U86358	CCDS12194.1, CCDS56080.1	19p13.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000131142	ENSG00000131142		"""Chemokine ligands"", ""Endogenous ligands"""	10624	protein-coding gene	gene with protein product	"""Ck beta-15"", ""thymus expressed chemokine"", ""TECKvar"""	602565	"""small inducible cytokine subfamily A (Cys-Cys), member 25"""	SCYA25		9285413, 9722960	Standard	NM_005624		Approved	TECK, Ckb15	uc002mjd.3	O15444	OTTHUMG00000141287	ENST00000390669.3:c.156G>A	19.37:g.8121118G>A			Somatic				CCL25_uc002mjc.3_Silent_p.Q52Q|CCL25_uc010dvy.1_Silent_p.Q52Q	p.Q52Q	NM_005624	NP_005615	WXS	Illumina HiSeq	Unspecified	O15444	CCL25_HUMAN			2	156	+			52					A1L4J4|A6NI52|A8K9E7|B5MCA5|Q96KJ7	Silent	SNP	ENST00000390669.3	37	c.156G>A	CCDS12194.1																																																																																				0.667	CCL25-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280522.1	NM_005624		30	18	0	0	0	0.002096	0	30	18				
MUC16	94025	broad.mit.edu	37	19	9024194	9024194	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:9024194C>A	ENST00000397910.4	-	18	37281	c.37078G>T	c.(37078-37080)Ggg>Tgg	p.G12360W		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12362					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGGAGGTCCCAGGAGCTGAG	0.488																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(37078-37080)GGG>TGG		mucin 16							69.0	65.0	66.0					19																	9024194		1900	4118	6018	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9024194C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37078G>T	19.37:g.9024194C>A	ENSP00000381008:p.Gly12360Trp		Somatic					p.G12360W	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			18	37282	-			12362			Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.37078G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	7.298	0.612471	0.14066	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.58	0.332	0.15938	.	.	.	.	.	T	0.06234	0.0161	L	0.41236	1.265	.	.	.	D	0.76494	0.999	P	0.62740	0.906	T	0.32241	-0.9914	8	0.87932	D	0	.	4.6204	0.12447	0.3735:0.6265:0.0:0.0	.	12360	B5ME49	.	W	12360	ENSP00000381008:G12360W	ENSP00000381008:G12360W	G	-	1	0	MUC16	8885194	0.004000	0.15560	0.006000	0.13384	0.063000	0.16089	0.187000	0.16998	0.146000	0.19002	0.205000	0.17691	GGG		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		10	15	1	0	2.80697e-09	0.000978	3.80868e-09	10	15				
MAP4K1	11184	broad.mit.edu	37	19	39104688	39104688	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:39104688C>T	ENST00000591517.1	-	7	483	c.455G>A	c.(454-456)aGa>aAa	p.R152K	MAP4K1_ENST00000396857.2_Missense_Mutation_p.R152K|MAP4K1_ENST00000423454.2_5'Flank|MAP4K1_ENST00000589002.1_5'Flank|MAP4K1_ENST00000589130.1_Missense_Mutation_p.R148K|MAP4K1_ENST00000586296.1_Missense_Mutation_p.R152K	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	152	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CTCACCCAATCTGACCTCCCC	0.607																																							uc002oix.1		NA																	0				skin(4)|lung(3)|ovary(1)	8						c.(454-456)AGA>AAA		mitogen-activated protein kinase kinase kinase							64.0	69.0	67.0					19																	39104688		1972	4152	6124	SO:0001583	missense	11184				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity	g.chr19:39104688C>T	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.455G>A	19.37:g.39104688C>T	ENSP00000465039:p.Arg152Lys		Somatic				MAP4K1_uc002oiy.1_Missense_Mutation_p.R152K|MAP4K1_uc010xug.1_5'Flank	p.R152K	NM_007181	NP_009112	WXS	Illumina HiSeq	Unspecified	Q92918	M4K1_HUMAN	Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)		7	563	-	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		152			Protein kinase.			Missense_Mutation	SNP	ENST00000591517.1	37	c.455G>A	CCDS59385.1	.	.	.	.	.	.	.	.	.	.	C	0.161	-1.081270	0.01888	.	.	ENSG00000104814	ENST00000396857;ENST00000221409	T	0.13538	2.58	4.72	-0.916	0.10489	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.287586	0.30464	N	0.009561	T	0.01695	0.0054	N	0.00069	-2.28	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.49560	-0.8927	10	0.02654	T	1	.	8.5192	0.33264	0.0:0.2445:0.0:0.7555	.	152;152	Q92918-2;Q92918	.;M4K1_HUMAN	K	152	ENSP00000380066:R152K	ENSP00000221409:R152K	R	-	2	0	MAP4K1	43796528	0.998000	0.40836	0.293000	0.24932	0.258000	0.26162	0.974000	0.29436	-0.034000	0.13713	-0.471000	0.05019	AGA		0.607	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	NM_001042600		5	101	0	0	0	0.000602	0	5	101				
PLEKHG2	64857	broad.mit.edu	37	19	39915411	39915411	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:39915411C>G	ENST00000409794.3	+	19	4488	c.3638C>G	c.(3637-3639)cCt>cGt	p.P1213R	PLEKHG2_ENST00000378550.1_Intron|CTB-60E11.4_ENST00000601124.1_lincRNA|PLEKHG2_ENST00000409797.2_Intron|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.P1184R|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.P1154R	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	1213					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCTGCCACACCTTTACCTGAG	0.537																																							uc010xuz.1		NA																	0				skin(2)|pancreas(1)|breast(1)	4						c.(3637-3639)CCT>CGT		common-site lymphoma/leukemia guanine nucleotide							187.0	184.0	185.0					19																	39915411		2203	4300	6503	SO:0001583	missense	64857				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity	g.chr19:39915411C>G	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.3638C>G	19.37:g.39915411C>G	ENSP00000386733:p.Pro1213Arg		Somatic				PLEKHG2_uc010xuy.1_Missense_Mutation_p.P1154R|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Missense_Mutation_p.P991R	p.P1213R	NM_022835	NP_073746	WXS	Illumina HiSeq	Unspecified	Q9H7P9	PKHG2_HUMAN	Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)		19	3963	+	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		1213					B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	ENST00000409794.3	37	c.3638C>G	CCDS33022.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.82|13.82	2.349779|2.349779	0.41599|0.41599	.|.	.|.	ENSG00000090924|ENSG00000090924	ENST00000205135|ENST00000409794;ENST00000425673;ENST00000458508	.|T;T;T	.|0.79940	.|-1.12;-1.24;-1.32	4.21|4.21	2.07|2.07	0.26955|0.26955	.|.	.|0.593934	.|0.14148	.|N	.|0.338238	T|T	0.78953|0.78953	0.4365|0.4365	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	N|N	0.999994|0.999994	.|P;P;P	.|0.48911	.|0.911;0.856;0.917	.|P;B;P	.|0.48400	.|0.576;0.372;0.548	T|T	0.67933|0.67933	-0.5542|-0.5542	5|9	.|.	.|.	.|.	.|.	5.8925|5.8925	0.18921|0.18921	0.0:0.7633:0.0:0.2367|0.0:0.7633:0.0:0.2367	.|.	.|1184;1213;1154	.|Q9H7P9-3;Q9H7P9;E7ESZ3	.|.;PKHG2_HUMAN;.	V|R	1081|1213;1184;1154	.|ENSP00000386733:P1213R;ENSP00000392906:P1184R;ENSP00000408857:P1154R	.|.	L|P	+|+	1|2	0|0	PLEKHG2|PLEKHG2	44607251|44607251	0.000000|0.000000	0.05858|0.05858	0.013000|0.013000	0.15412|0.15412	0.018000|0.018000	0.09664|0.09664	0.326000|0.326000	0.19646|0.19646	1.088000|1.088000	0.41272|0.41272	0.561000|0.561000	0.74099|0.74099	CTT|CCT		0.537	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	NM_022835		15	252	0	0	0	0.00499	0	15	252				
CEACAM5	1048	broad.mit.edu	37	19	42219069	42219069	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:42219069C>A	ENST00000221992.6	+	3	718	c.604C>A	c.(604-606)Cta>Ata	p.L202I	CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000398599.4_Missense_Mutation_p.L202I|CEACAM5_ENST00000405816.1_Missense_Mutation_p.L202I	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	202	Ig-like 2.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		GACCCTCACTCTATTCAATGT	0.522																																							uc002ork.2		NA																	0				skin(2)	2						c.(604-606)CTA>ATA		carcinoembryonic antigen-related cell adhesion							186.0	168.0	174.0					19																	42219069		2203	4300	6503	SO:0001583	missense	1048					anchored to membrane|basolateral plasma membrane|integral to plasma membrane		g.chr19:42219069C>A	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.604C>A	19.37:g.42219069C>A	ENSP00000221992:p.Leu202Ile		Somatic				CEACAM5_uc010ehz.1_Missense_Mutation_p.L202I|CEACAM5_uc002orj.1_Missense_Mutation_p.L202I|CEACAM5_uc002orl.2_Missense_Mutation_p.L202I	p.L202I	NM_004363	NP_004354	WXS	Illumina HiSeq	Unspecified	P06731	CEAM5_HUMAN		OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)	3	725	+			202			Ig-like 2.		H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	c.604C>A	CCDS12584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	0.043|0.043	-1.276903|-1.276903	0.01410|0.01410	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000221992;ENST00000405816|ENST00000398599	T;T|.	0.02812|.	4.15;4.15|.	2.94|2.94	-5.89|-5.89	0.02282|0.02282	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.18800|0.18800	0.0451|0.0451	L|L	0.28776|0.28776	0.89|0.89	0.09310|0.09310	N|N	1|1	B;B;P|.	0.44877|.	0.001;0.038;0.845|.	B;B;P|.	0.58820|.	0.028;0.078;0.846|.	T|T	0.15492|0.15492	-1.0435|-1.0435	9|5	0.44086|.	T|.	0.13|.	.|.	1.6278|1.6278	0.02727|0.02727	0.2993:0.1239:0.3971:0.1797|0.2993:0.1239:0.3971:0.1797	.|.	202;202;202|.	Q8N4D0;P06731;Q53G30|.	.;CEAM5_HUMAN;.|.	I|Y	202|198	ENSP00000221992:L202I;ENSP00000385072:L202I|.	ENSP00000221992:L202I|.	L|S	+|+	1|2	2|0	CEACAM5|CEACAM5	46910909|46910909	0.039000|0.039000	0.19947|0.19947	0.043000|0.043000	0.18650|0.18650	0.025000|0.025000	0.11179|0.11179	-1.288000|-1.288000	0.02783|0.02783	-2.487000|-2.487000	0.00519|0.00519	-1.098000|-1.098000	0.02139|0.02139	CTA|TCT		0.522	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363		89	77	1	0	4.78148e-37	0.00361	7.99224e-37	89	77				
CCDC155	147872	broad.mit.edu	37	19	49920437	49920437	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:49920437G>C	ENST00000447857.3	+	19	1666	c.1461G>C	c.(1459-1461)caG>caC	p.Q487H		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	487						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						GGGAACTCCAGCAAGCCCTGG	0.647																																							uc002pnm.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1459-1461)CAG>CAC		coiled-coil domain containing 155							22.0	25.0	24.0					19																	49920437		1936	4124	6060	SO:0001583	missense	147872					integral to membrane	calcium ion binding	g.chr19:49920437G>C		CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.1461G>C	19.37:g.49920437G>C	ENSP00000404220:p.Gln487His		Somatic				CCDC155_uc010emx.1_Missense_Mutation_p.Q458H	p.Q487H	NM_144688	NP_653289	WXS	Illumina HiSeq	Unspecified	Q8N6L0	CC155_HUMAN			19	1635	+			487					Q96MC3	Missense_Mutation	SNP	ENST00000447857.3	37	c.1461G>C	CCDS46140.1	.	.	.	.	.	.	.	.	.	.	g	7.083	0.570653	0.13560	.	.	ENSG00000161609	ENST00000447857	T	0.33654	1.4	3.88	-0.789	0.10935	.	0.501146	0.16735	N	0.201655	T	0.21387	0.0515	L	0.36672	1.1	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.14008	-1.0488	10	0.27785	T	0.31	-33.8491	4.484	0.11781	0.221:0.3072:0.4718:0.0	.	487;487	C9JGW3;Q8N6L0	.;CC155_HUMAN	H	487	ENSP00000404220:Q487H	ENSP00000404220:Q487H	Q	+	3	2	CCDC155	54612249	0.000000	0.05858	0.002000	0.10522	0.102000	0.19082	-0.258000	0.08733	-0.112000	0.11979	0.444000	0.29173	CAG		0.647	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465436.2	NM_144688		14	8	0	0	0	0.00245	0	14	8				
LILRA2	11027	broad.mit.edu	37	19	55086759	55086759	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:55086759G>T	ENST00000251377.3	+	6	825	c.692G>T	c.(691-693)gGt>gTt	p.G231V	LILRA2_ENST00000391738.3_Missense_Mutation_p.G231V|LILRA2_ENST00000391737.1_Missense_Mutation_p.G219V|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000251376.3_Missense_Mutation_p.G231V|LILRB1_ENST00000396321.2_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	231	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		GTGCAGCCAGGTCCTATGGTG	0.557																																							uc002qgg.3		NA																	0				ovary(1)	1						c.(691-693)GGT>GTT		leukocyte immunoglobulin-like receptor,							102.0	106.0	105.0					19																	55086759		2203	4300	6503	SO:0001583	missense	11027				defense response	integral to membrane	antigen binding|receptor activity	g.chr19:55086759G>T	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.692G>T	19.37:g.55086759G>T	ENSP00000251377:p.Gly231Val		Somatic				LILRA2_uc010ern.2_Missense_Mutation_p.G231V|LILRA2_uc002qgf.2_Missense_Mutation_p.G231V|LILRA2_uc010yfe.1_Missense_Mutation_p.G231V|LILRA2_uc010yff.1_Missense_Mutation_p.G219V|LILRA2_uc010ero.2_Missense_Mutation_p.G219V|LILRA2_uc010yfg.1_Intron	p.G231V	NM_001130917	NP_001124389	WXS	Illumina HiSeq	Unspecified	Q8N149	LIRA2_HUMAN		GBM - Glioblastoma multiforme(193;0.0963)	5	781	+			231			Ig-like C2-type 3.|Extracellular (Potential).		O75020	Missense_Mutation	SNP	ENST00000251377.3	37	c.692G>T	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	G	12.85	2.061013	0.36373	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.00856	5.61;5.61;5.61;5.61;5.61	2.8	-2.97	0.05530	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.453599	0.18901	N	0.128028	T	0.04227	0.0117	M	0.93106	3.38	0.09310	N	1	D;D;D;P	0.65815	0.995;0.99;0.97;0.914	D;P;P;P	0.68765	0.96;0.872;0.903;0.868	T	0.18903	-1.0322	10	0.87932	D	0	.	2.4119	0.04427	0.2716:0.0:0.3188:0.4095	.	231;219;231;231	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	V	231;231;231;231;219	ENSP00000388131:G231V;ENSP00000251377:G231V;ENSP00000375618:G231V;ENSP00000251376:G231V;ENSP00000375617:G219V	ENSP00000251376:G231V	G	+	2	0	LILRA2	59778571	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.420000	0.21263	-0.242000	0.09667	0.400000	0.26472	GGT		0.557	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2			15	86	1	0	3.99206e-14	0.007413	6.03167e-14	15	86				
LILRB1	10859	broad.mit.edu	37	19	55146111	55146111	+	Silent	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:55146111G>T	ENST00000396331.1	+	11	1737	c.1380G>T	c.(1378-1380)ggG>ggT	p.G460G	LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000448689.1_Silent_p.G460G|LILRB1_ENST00000427581.2_Silent_p.G510G|LILRB1_ENST00000396317.1_Silent_p.G444G|LILRB1_ENST00000418536.2_Silent_p.G444G|LILRB1_ENST00000396327.3_Silent_p.G461G|LILRB1_ENST00000434867.2_Silent_p.G460G|LILRB1_ENST00000396315.1_Silent_p.G461G|LILRB1_ENST00000396321.2_Silent_p.G460G|LILRB1_ENST00000396332.4_Silent_p.G460G|LILRB1_ENST00000324602.7_Silent_p.G461G	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	460					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GGCACCTGGGGGTTGTGATCG	0.567										HNSCC(37;0.09)																													uc002qgj.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(1378-1380)GGG>GGT		leukocyte immunoglobulin-like receptor,							118.0	91.0	100.0					19																	55146111		2203	4300	6503	SO:0001819	synonymous_variant	10859				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity	g.chr19:55146111G>T	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1380G>T	19.37:g.55146111G>T		HNSCC(37;0.09)	Somatic				LILRB1_uc010erp.1_Silent_p.G75G|LILRB1_uc002qgl.2_Silent_p.G460G|LILRB1_uc002qgk.2_Silent_p.G461G|LILRB1_uc002qgm.2_Silent_p.G461G|LILRB1_uc010erq.2_Silent_p.G444G|LILRB1_uc010err.2_RNA	p.G460G	NM_006669	NP_006660	WXS	Illumina HiSeq	Unspecified	Q8NHL6	LIRB1_HUMAN		GBM - Glioblastoma multiforme(193;0.0188)	11	1720	+			460			Extracellular (Potential).		A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	ENST00000396331.1	37	c.1380G>T	CCDS42617.1																																																																																				0.567	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4			24	17	1	0	1.10513e-12	0.002299	1.63409e-12	24	17				
NLRP4	147945	broad.mit.edu	37	19	56369436	56369436	+	Missense_Mutation	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr19:56369436T>C	ENST00000301295.6	+	3	1099	c.677T>C	c.(676-678)cTc>cCc	p.L226P	NLRP4_ENST00000587891.1_Missense_Mutation_p.L151P|NLRP4_ENST00000346986.5_Missense_Mutation_p.L226P	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	226	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CCGGAGAGACTCTTGTTCGTC	0.562																																							uc002qmd.3		NA																	0				ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15						c.(676-678)CTC>CCC		NLR family, pyrin domain containing 4							81.0	80.0	81.0					19																	56369436		2203	4300	6503	SO:0001583	missense	147945						ATP binding	g.chr19:56369436T>C	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.677T>C	19.37:g.56369436T>C	ENSP00000301295:p.Leu226Pro		Somatic				NLRP4_uc002qmf.2_Missense_Mutation_p.L151P|NLRP4_uc010etf.2_Missense_Mutation_p.L57P	p.L226P	NM_134444	NP_604393	WXS	Illumina HiSeq	Unspecified	Q96MN2	NALP4_HUMAN		GBM - Glioblastoma multiforme(193;0.0606)	3	1099	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	226			NACHT.		Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	c.677T>C	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.155112	0.38021	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.81499	-1.5;-1.5	4.1	4.1	0.47936	NACHT nucleoside triphosphatase (1);	.	.	.	.	D	0.89760	0.6808	M	0.87682	2.9	0.36458	D	0.866495	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.996;0.997	D	0.92867	0.6311	9	0.87932	D	0	.	11.3715	0.49702	0.0:0.0:0.0:1.0	.	226;151;226	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	P	226	ENSP00000301295:L226P;ENSP00000344787:L226P	ENSP00000301295:L226P	L	+	2	0	NLRP4	61061248	0.018000	0.18449	0.038000	0.18304	0.129000	0.20672	2.174000	0.42482	1.847000	0.53656	0.533000	0.62120	CTC		0.562	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444		24	71	0	0	0	0.00278	0	24	71				
NBAS	51594	broad.mit.edu	37	2	15651350	15651350	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:15651350C>A	ENST00000281513.5	-	10	896	c.871G>T	c.(871-873)Gac>Tac	p.D291Y	NBAS_ENST00000441750.1_Missense_Mutation_p.D291Y	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	291					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GTAACCCCGTCTCCACCATTA	0.413																																							uc002rcc.1		NA																	0				ovary(2)|liver(1)|skin(1)	4						c.(871-873)GAC>TAC		neuroblastoma-amplified protein							182.0	184.0	183.0					2																	15651350		2203	4300	6503	SO:0001583	missense	51594							g.chr2:15651350C>A	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.871G>T	2.37:g.15651350C>A	ENSP00000281513:p.Asp291Tyr		Somatic				NBAS_uc002rcd.1_RNA	p.D291Y	NM_015909	NP_056993	WXS	Illumina HiSeq	Unspecified	A2RRP1	NBAS_HUMAN			10	897	-			291					O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	c.871G>T	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.913470	0.33815	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.53640	0.61;0.61	5.42	5.42	0.78866	Quinoprotein amine dehydrogenase, beta chain-like (1);	0.151002	0.56097	D	0.000022	T	0.64000	0.2559	M	0.66939	2.045	0.36941	D	0.892384	D	0.69078	0.997	P	0.57283	0.817	T	0.71669	-0.4523	10	0.87932	D	0	.	18.3482	0.90329	0.0:1.0:0.0:0.0	.	291	A2RRP1	NBAS_HUMAN	Y	291	ENSP00000413201:D291Y;ENSP00000281513:D291Y	ENSP00000281513:D291Y	D	-	1	0	NBAS	15568801	1.000000	0.71417	0.990000	0.47175	0.036000	0.12997	6.015000	0.70791	2.704000	0.92352	0.467000	0.42956	GAC		0.413	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		32	137	1	0	1.62565e-12	0.002445	2.38336e-12	32	137				
TMEM214	54867	broad.mit.edu	37	2	27260556	27260556	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:27260556G>C	ENST00000238788.9	+	9	1200	c.1138G>C	c.(1138-1140)Gag>Cag	p.E380Q	TMEM214_ENST00000404032.3_Missense_Mutation_p.E335Q	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	380					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CTGTCCCCCTGAGATGAAGAA	0.557																																							uc002ria.3		NA																	0					0						c.(1138-1140)GAG>CAG		transmembrane protein 214 isoform 1							94.0	94.0	94.0					2																	27260556		1889	4115	6004	SO:0001583	missense	54867					integral to membrane	protein binding	g.chr2:27260556G>C		CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.1138G>C	2.37:g.27260556G>C	ENSP00000238788:p.Glu380Gln		Somatic				TMEM214_uc010yle.1_RNA|TMEM214_uc002rib.3_Missense_Mutation_p.E335Q	p.E380Q	NM_017727	NP_060197	WXS	Illumina HiSeq	Unspecified	Q6NUQ4	TM214_HUMAN			9	1248	+			380					A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Missense_Mutation	SNP	ENST00000238788.9	37	c.1138G>C	CCDS42664.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.997482	0.35226	.	.	ENSG00000119777	ENST00000238788;ENST00000404032;ENST00000537397	T;T	0.51325	0.71;0.71	5.69	4.82	0.62117	.	0.470907	0.25430	N	0.030727	T	0.45397	0.1340	L	0.56769	1.78	0.21553	N	0.999641	P;P	0.40970	0.682;0.734	B;B	0.40199	0.299;0.322	T	0.36890	-0.9729	10	0.33141	T	0.24	-5.6445	12.6396	0.56702	0.077:0.0:0.923:0.0	.	335;380	Q6NUQ4-2;Q6NUQ4	.;TM214_HUMAN	Q	380;335;120	ENSP00000238788:E380Q;ENSP00000384417:E335Q	ENSP00000238788:E380Q	E	+	1	0	TMEM214	27114060	1.000000	0.71417	0.268000	0.24571	0.906000	0.53458	5.289000	0.65656	1.421000	0.47157	0.561000	0.74099	GAG		0.557	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727		19	58	0	0	0	0.010504	0	19	58				
EIF2AK2	5610	broad.mit.edu	37	2	37349800	37349801	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:37349800_37349801CC>AA	ENST00000233057.4	-	12	1237_1238	c.915_916GG>TT	c.(913-918)gcGGag>gcTTag	p.E306*	EIF2AK2_ENST00000405334.1_Nonsense_Mutation_p.E265*|EIF2AK2_ENST00000395127.2_Nonsense_Mutation_p.E306*	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	306	Interaction with TRAF5.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				ACTTCACGCTCCGCCTTCCTAG	0.411																																							uc010ynh.1		NA																	0				ovary(2)|lung(2)|pancreas(1)	5						c.(913-918)GCGGAG>GCTTAG		eukaryotic translation initiation factor 2-alpha																																				SO:0001587	stop_gained	5610				evasion by virus of host immune response|modulation by virus of host cellular process|negative regulation of osteoblast proliferation|protein autophosphorylation|response to virus|viral infectious cycle	cytosol	ATP binding|double-stranded RNA binding|eukaryotic translation initiation factor 2alpha kinase activity|protein binding|protein phosphatase type 2A regulator activity	g.chr2:37349800_37349801CC>AA	BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.915_916delinsAA	2.37:g.37349800_37349801delinsAA	ENSP00000233057:p.Glu306*		Somatic				EIF2AK2_uc010fab.1_Nonsense_Mutation_p.E265*|EIF2AK2_uc010yng.1_Nonsense_Mutation_p.E306*|EIF2AK2_uc010fac.2_Nonsense_Mutation_p.E306*|EIF2AK2_uc010fad.2_Intron	p.E306*	NM_002759	NP_002750	WXS	Illumina HiSeq	Unspecified	P19525	E2AK2_HUMAN			12	1472_1473	-		all_hematologic(82;0.248)	306			Protein kinase.		A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Nonsense_Mutation	DNP	ENST00000233057.4	37	c.915_916GG>TT	CCDS1786.1																																																																																				0.411	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218571.2	NM_002759		9	44	0	0	0	0.004672	0	9	44				
SLC8A1	6546	broad.mit.edu	37	2	40655869	40655869	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:40655869G>A	ENST00000403092.1	-	2	1585	c.1552C>T	c.(1552-1554)Ctt>Ttt	p.L518F	SLC8A1_ENST00000406391.2_Missense_Mutation_p.L518F|SLC8A1_ENST00000402441.1_Missense_Mutation_p.L518F|SLC8A1_ENST00000405901.3_Missense_Mutation_p.L518F|SLC8A1_ENST00000542756.1_Missense_Mutation_p.L518F|SLC8A1_ENST00000332839.4_Missense_Mutation_p.L518F|SLC8A1_ENST00000542024.1_Missense_Mutation_p.L518F|SLC8A1_ENST00000406785.2_Missense_Mutation_p.L518F|SLC8A1_ENST00000408028.2_Missense_Mutation_p.L518F|SLC8A1_ENST00000405269.1_Missense_Mutation_p.L518F			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	518					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AGGCAAGCAAGTGTAGAAACA	0.433																																							uc002rrx.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1552-1554)CTT>TTT		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						104.0	103.0	103.0					2																	40655869		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40655869G>A		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1552C>T	2.37:g.40655869G>A	ENSP00000384763:p.Leu518Phe		Somatic				SLC8A1_uc002rry.2_Missense_Mutation_p.L518F|SLC8A1_uc002rrz.2_Missense_Mutation_p.L518F|SLC8A1_uc002rsa.2_Missense_Mutation_p.L518F|SLC8A1_uc002rsd.3_Missense_Mutation_p.L518F|SLC8A1_uc002rsb.1_Missense_Mutation_p.L518F|SLC8A1_uc010fan.1_Missense_Mutation_p.L518F|SLC8A1_uc002rsc.1_Missense_Mutation_p.L518F	p.L518F	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			1	1576	-			518			Cytoplasmic (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.1552C>T	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	G	7.879	0.729817	0.15507	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26	6.17	4.34	0.51931	.	0.217889	0.49305	N	0.000157	T	0.22360	0.0539	N	0.14661	0.345	0.32815	D	0.501905	B;B;B;B;B	0.30406	0.023;0.009;0.038;0.278;0.022	B;B;B;B;B	0.31245	0.03;0.008;0.048;0.126;0.03	T	0.26503	-1.0101	10	0.56958	D	0.05	.	9.2951	0.37811	0.0757:0.0:0.7748:0.1495	.	518;518;518;518;518	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	F	518	ENSP00000383886:L518F;ENSP00000440727:L518F;ENSP00000384763:L518F;ENSP00000385678:L518F;ENSP00000385188:L518F;ENSP00000385535:L518F;ENSP00000332931:L518F;ENSP00000384908:L518F;ENSP00000385811:L518F;ENSP00000443515:L518F	ENSP00000332931:L518F	L	-	1	0	SLC8A1	40509373	0.937000	0.31787	0.053000	0.19242	0.990000	0.78478	1.513000	0.35823	0.886000	0.36113	0.655000	0.94253	CTT		0.433	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		12	37	0	0	0	0.000978	0	12	37				
GFPT1	2673	broad.mit.edu	37	2	69575396	69575396	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:69575396G>A	ENST00000357308.4	-	11	1094	c.916C>T	c.(916-918)Cgt>Tgt	p.R306C	GFPT1_ENST00000361060.5_Missense_Mutation_p.R288C	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	306					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						ATAGAAAGACGTCCATCCACT	0.448																																							uc002sfh.2		NA																	0				skin(1)	1						c.(862-864)CGT>TGT		glucosamine-fructose-6-phosphate							158.0	145.0	150.0					2																	69575396		2203	4300	6503	SO:0001583	missense	2673				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding	g.chr2:69575396G>A		CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.916C>T	2.37:g.69575396G>A	ENSP00000349860:p.Arg306Cys		Somatic					p.R288C	NM_002056	NP_002047	WXS	Illumina HiSeq	Unspecified	Q06210	GFPT1_HUMAN			10	1041	-			306					Q53QE6|Q9BXF8	Missense_Mutation	SNP	ENST00000357308.4	37	c.862C>T	CCDS58713.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153816	0.78114	.	.	ENSG00000198380	ENST00000357308;ENST00000361060	T;T	0.77098	-1.07;-1.07	5.5	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.74997	0.3790	L	0.27053	0.805	0.80722	D	1	D	0.69078	0.997	P	0.52856	0.711	T	0.78013	-0.2370	10	0.59425	D	0.04	-14.4853	13.6999	0.62602	0.0735:0.0:0.9265:0.0	.	288	Q06210-2	.	C	306;288	ENSP00000349860:R306C;ENSP00000354347:R288C	ENSP00000349860:R306C	R	-	1	0	GFPT1	69428900	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.431000	0.59915	1.560000	0.49568	-0.150000	0.13652	CGT		0.448	GFPT1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				20	60	0	0	0	0.007413	0	20	60				
CTNNA2	1496	broad.mit.edu	37	2	80773180	80773180	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:80773180C>G	ENST00000402739.4	+	10	1537	c.1532C>G	c.(1531-1533)tCt>tGt	p.S511C	CTNNA2_ENST00000496558.1_Missense_Mutation_p.S511C|CTNNA2_ENST00000466387.1_Missense_Mutation_p.S511C|CTNNA2_ENST00000343114.3_Missense_Mutation_p.S190C|CTNNA2_ENST00000541047.1_Missense_Mutation_p.S511C|CTNNA2_ENST00000361291.4_Missense_Mutation_p.S545C|CTNNA2_ENST00000540488.1_Missense_Mutation_p.S511C	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	511					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GACTTCCTCTCTGTCTCAGGT	0.498																																							uc010ysh.1		NA																	0				pancreas(4)|lung(3)|breast(1)|skin(1)	9						c.(1531-1533)TCT>TGT		catenin, alpha 2 isoform 1							57.0	65.0	62.0					2																	80773180		2046	4200	6246	SO:0001583	missense	1496				axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	g.chr2:80773180C>G		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1532C>G	2.37:g.80773180C>G	ENSP00000384638:p.Ser511Cys		Somatic				CTNNA2_uc010yse.1_Missense_Mutation_p.S511C|CTNNA2_uc010ysf.1_Missense_Mutation_p.S511C|CTNNA2_uc010ysg.1_Missense_Mutation_p.S511C|CTNNA2_uc010ysi.1_Missense_Mutation_p.S143C	p.S511C	NM_004389	NP_004380	WXS	Illumina HiSeq	Unspecified	P26232	CTNA2_HUMAN			10	1537	+			511					B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37	c.1532C>G		.	.	.	.	.	.	.	.	.	.	C	16.71	3.197928	0.58126	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114;ENST00000409550	T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.27866	0.0686	L	0.29908	0.895	0.54753	D	0.999985	B;B;B;B	0.17038	0.007;0.02;0.009;0.009	B;B;B;B	0.23716	0.012;0.048;0.019;0.019	T	0.05435	-1.0885	9	.	.	.	.	20.2664	0.98460	0.0:1.0:0.0:0.0	.	143;511;511;511	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	C	511;511;545;511;511;511;190;176	ENSP00000418191:S511C;ENSP00000419295:S511C;ENSP00000355398:S545C;ENSP00000384638:S511C;ENSP00000444675:S511C;ENSP00000441705:S511C;ENSP00000341500:S190C;ENSP00000386587:S176C	.	S	+	2	0	CTNNA2	80626691	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.178000	0.50879	2.786000	0.95864	0.561000	0.74099	TCT		0.498	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389		5	12	0	0	0	0.000602	0	5	12				
IWS1	55677	broad.mit.edu	37	2	128262314	128262314	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:128262314C>A	ENST00000295321.4	-	3	1424	c.1165G>T	c.(1165-1167)Gta>Tta	p.V389L	IWS1_ENST00000455721.2_Missense_Mutation_p.V396L|IWS1_ENST00000486662.1_5'Flank|AC010976.2_ENST00000599001.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	389	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CTCTTCGCTACTTTCTCCTCC	0.398																																							uc002ton.2		NA																	0				ovary(1)	1						c.(1165-1167)GTA>TTA		IWS1 homolog							300.0	302.0	301.0					2																	128262314		2203	4300	6503	SO:0001583	missense	55677				transcription, DNA-dependent	nucleus	DNA binding	g.chr2:128262314C>A	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1165G>T	2.37:g.128262314C>A	ENSP00000295321:p.Val389Leu		Somatic				IWS1_uc010yzl.1_RNA|uc002too.1_5'Flank|IWS1_uc010fma.2_RNA	p.V389L	NM_017969	NP_060439	WXS	Illumina HiSeq	Unspecified	Q96ST2	IWS1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0735)	3	1468	-	Colorectal(110;0.1)		389			Glu-rich.		Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	ENST00000295321.4	37	c.1165G>T	CCDS2146.1	.	.	.	.	.	.	.	.	.	.	C	6.140	0.394065	0.11638	.	.	ENSG00000163166	ENST00000295321;ENST00000433551;ENST00000455721	T;T	0.32988	1.51;1.43	5.79	4.91	0.64330	.	0.533493	0.18284	N	0.145928	T	0.24314	0.0589	L	0.47716	1.5	0.25432	N	0.988171	B	0.21381	0.055	B	0.21151	0.033	T	0.17561	-1.0365	10	0.23891	T	0.37	-8.7302	6.7524	0.23495	0.1459:0.6967:0.0:0.1574	.	389	Q96ST2	IWS1_HUMAN	L	389;342;396	ENSP00000295321:V389L;ENSP00000399245:V396L	ENSP00000295321:V389L	V	-	1	0	IWS1	127978784	0.282000	0.24268	0.519000	0.27824	0.343000	0.28985	0.777000	0.26718	1.446000	0.47643	0.563000	0.77884	GTA		0.398	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969		66	114	1	0	3.12118e-38	0.00361	5.29377e-38	66	114				
NCKAP5	344148	broad.mit.edu	37	2	133543054	133543054	+	Missense_Mutation	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:133543054T>C	ENST00000409261.1	-	14	1703	c.1330A>G	c.(1330-1332)Agc>Ggc	p.S444G	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.S444G	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	444										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TTGAGGCTGCTACTTTTAATT	0.448																																							uc002ttp.2		NA																	0					0						c.(1330-1332)AGC>GGC		Nck-associated protein 5 isoform 1							62.0	59.0	60.0					2																	133543054		1846	4095	5941	SO:0001583	missense	344148						protein binding	g.chr2:133543054T>C	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1330A>G	2.37:g.133543054T>C	ENSP00000387128:p.Ser444Gly		Somatic				NCKAP5_uc002ttq.2_Intron	p.S444G	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			14	1704	-			444					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.1330A>G	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	t	3.745	-0.052806	0.07362	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.12569	2.67;2.67	5.38	3.02	0.34903	.	0.594569	0.13600	U	0.375911	T	0.06508	0.0167	N	0.14661	0.345	0.80722	D	1	B	0.14012	0.009	B	0.11329	0.006	T	0.17107	-1.0380	10	0.07644	T	0.81	.	6.6481	0.22947	0.0:0.2454:0.0:0.7546	.	444	O14513	NCKP5_HUMAN	G	444	ENSP00000387128:S444G;ENSP00000380603:S444G	ENSP00000380603:S444G	S	-	1	0	NCKAP5	133259524	1.000000	0.71417	0.306000	0.25113	0.892000	0.51952	2.239000	0.43079	1.063000	0.40649	0.524000	0.50904	AGC		0.448	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		8	38	0	0	0	0.00308	0	8	38				
RAB3GAP1	22930	broad.mit.edu	37	2	135892886	135892886	+	Silent	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:135892886A>T	ENST00000264158.8	+	16	1594	c.1551A>T	c.(1549-1551)ctA>ctT	p.L517L	RAB3GAP1_ENST00000539493.1_Silent_p.L473L|RAB3GAP1_ENST00000487003.1_3'UTR|RAB3GAP1_ENST00000442034.1_Silent_p.L517L|ZRANB3_ENST00000412849.1_5'Flank|SNORA40_ENST00000385573.1_RNA	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	517					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		ATCAGAAACTACAGGTAAAGA	0.333																																							uc002tuj.2		NA																	0				ovary(1)|skin(1)	2						c.(1549-1551)CTA>CTT		RAB3 GTPase-activating protein							82.0	83.0	83.0					2																	135892886		2203	4300	6503	SO:0001819	synonymous_variant	22930					centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding	g.chr2:135892886A>T	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.1551A>T	2.37:g.135892886A>T			Somatic				RAB3GAP1_uc010fnf.2_Silent_p.L517L|RAB3GAP1_uc010fng.2_Silent_p.L342L|RAB3GAP1_uc010fnh.1_RNA	p.L517L	NM_012233	NP_036365	WXS	Illumina HiSeq	Unspecified	Q15042	RB3GP_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.117)	16	1576	+			517					A6H8Z3|C9J837|Q659F5|Q8TBB4	Silent	SNP	ENST00000264158.8	37	c.1551A>T	CCDS33294.1																																																																																				0.333	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337514.2	NM_012233		4	17	0	0	0	0.009096	0	4	17				
LCT	3938	broad.mit.edu	37	2	136570242	136570242	+	Silent	SNP	G	G	C	rs374703772		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:136570242G>C	ENST00000264162.2	-	7	2002	c.1992C>G	c.(1990-1992)ccC>ccG	p.P664P	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	664	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CTGTGAACTCGGGGAGTTGAG	0.557																																							uc002tuu.1		NA																	0				ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(1990-1992)CCC>CCG		lactase-phlorizin hydrolase preproprotein							118.0	107.0	111.0					2																	136570242		2203	4300	6503	SO:0001819	synonymous_variant	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136570242G>C	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1992C>G	2.37:g.136570242G>C			Somatic					p.P664P	NM_002299	NP_002290	WXS	Illumina HiSeq	Unspecified	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	7	2003	-			664			Extracellular (Potential).|4 X approximate repeats.|2.		Q4ZG58	Silent	SNP	ENST00000264162.2	37	c.1992C>G	CCDS2178.1																																																																																				0.557	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		30	58	0	0	0	0.002445	0	30	58				
LRP1B	53353	broad.mit.edu	37	2	141457912	141457912	+	Missense_Mutation	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:141457912T>C	ENST00000389484.3	-	41	7677	c.6706A>G	c.(6706-6708)Aaa>Gaa	p.K2236E		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2236					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTGGTACCTTTTCTTCTTTGA	0.343										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(6706-6708)AAA>GAA		low density lipoprotein-related protein 1B							125.0	130.0	128.0					2																	141457912		2203	4299	6502	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141457912T>C	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6706A>G	2.37:g.141457912T>C	ENSP00000374135:p.Lys2236Glu	TSP Lung(27;0.18)	Somatic					p.K2236E	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	41	7678	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	2236			Extracellular (Potential).		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.6706A>G	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	4.367	0.067716	0.08436	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.89681	-2.55	4.2	3.04	0.35103	Six-bladed beta-propeller, TolB-like (1);	0.559228	0.17554	N	0.170045	T	0.76593	0.4009	N	0.22421	0.69	0.19300	N	0.999977	B	0.02656	0.0	B	0.01281	0.0	T	0.57294	-0.7836	10	0.06757	T	0.87	.	7.4434	0.27196	0.0:0.1871:0.0:0.8129	.	2236	Q9NZR2	LRP1B_HUMAN	E	2236;2174	ENSP00000374135:K2236E	ENSP00000374135:K2236E	K	-	1	0	LRP1B	141174382	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	1.802000	0.38853	0.591000	0.29711	0.477000	0.44152	AAA		0.343	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		14	72	0	0	0	0.001855	0	14	72				
SLC4A10	57282	broad.mit.edu	37	2	162719564	162719564	+	Missense_Mutation	SNP	A	A	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:162719564A>C	ENST00000446997.1	+	6	851	c.758A>C	c.(757-759)gAc>gCc	p.D253A	SLC4A10_ENST00000375514.5_Missense_Mutation_p.D264A|SLC4A10_ENST00000272716.5_Missense_Mutation_p.D253A|SLC4A10_ENST00000493021.1_3'UTR|SLC4A10_ENST00000421911.1_Missense_Mutation_p.D253A|SLC4A10_ENST00000415876.2_Missense_Mutation_p.D253A|SLC4A10_ENST00000535165.1_Missense_Mutation_p.D253A	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	253					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	AATTCCATGGACAAAAATGGT	0.338																																							uc002ubx.3		NA																	0				ovary(2)|lung(2)|pancreas(1)	5						c.(757-759)GAC>GCC		solute carrier family 4, sodium bicarbonate							71.0	77.0	75.0					2																	162719564		1862	4121	5983	SO:0001583	missense	57282				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity	g.chr2:162719564A>C		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.758A>C	2.37:g.162719564A>C	ENSP00000393066:p.Asp253Ala		Somatic				SLC4A10_uc010fpa.1_Missense_Mutation_p.D265A|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.D253A|SLC4A10_uc010zcs.1_Missense_Mutation_p.D264A	p.D253A	NM_022058	NP_071341	WXS	Illumina HiSeq	Unspecified	Q6U841	S4A10_HUMAN			6	942	+			253			Cytoplasmic (Potential).		B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	c.758A>C	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	A	13.68	2.308566	0.40895	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000535165;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.81	5.81	0.92471	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.087086	0.85682	D	0.000000	T	0.58652	0.2137	L	0.47016	1.485	0.80722	D	1	B;B;B;B	0.10296	0.001;0.003;0.001;0.0	B;B;B;B	0.16722	0.003;0.016;0.005;0.008	T	0.55302	-0.8162	10	0.08381	T	0.77	.	15.8341	0.78787	1.0:0.0:0.0:0.0	.	264;253;253;253	F8W675;E7EW28;Q6U841-2;Q6U841	.;.;.;S4A10_HUMAN	A	264;253;253;253;253;253;253;253	ENSP00000364664:D264A;ENSP00000395797:D253A;ENSP00000437527:D253A;ENSP00000272716:D253A;ENSP00000393066:D253A;ENSP00000404486:D253A	ENSP00000272716:D253A	D	+	2	0	SLC4A10	162427810	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.229000	0.95273	2.226000	0.72624	0.482000	0.46254	GAC		0.338	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058		5	35	0	0	0	0.001168	0	5	35				
SCN3A	6328	broad.mit.edu	37	2	166003311	166003311	+	Missense_Mutation	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:166003311A>T	ENST00000360093.3	-	12	2100	c.1609T>A	c.(1609-1611)Ttc>Atc	p.F537I	RN7SL455P_ENST00000580629.1_RNA|SCN3A_ENST00000409101.3_Missense_Mutation_p.F537I|SCN3A_ENST00000283254.7_Missense_Mutation_p.F537I	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	537					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GAGAAAAGGAAGCTGCTTCTT	0.428																																							uc002ucx.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(1609-1611)TTC>ATC		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						194.0	196.0	195.0					2																	166003311		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166003311A>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1609T>A	2.37:g.166003311A>T	ENSP00000353206:p.Phe537Ile		Somatic				SCN3A_uc002ucy.2_Missense_Mutation_p.F537I|SCN3A_uc002ucz.2_Missense_Mutation_p.F537I|SCN3A_uc002uda.1_Missense_Mutation_p.F406I|SCN3A_uc002udb.1_Missense_Mutation_p.F406I	p.F537I	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			12	2101	-			537					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.1609T>A		.	.	.	.	.	.	.	.	.	.	A	18.89	3.720444	0.68959	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9	5.67	4.51	0.55191	Domain of unknown function DUF3451 (1);	0.085117	0.51477	D	0.000085	D	0.92538	0.7630	M	0.88310	2.945	0.80722	D	1	B;P;B;B;B	0.43578	0.23;0.811;0.042;0.042;0.193	B;B;B;B;B	0.40477	0.159;0.33;0.028;0.028;0.142	D	0.91965	0.5582	10	0.66056	D	0.02	.	10.9805	0.47490	0.9269:0.0:0.0731:0.0	.	537;537;537;537;537	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	I	537	ENSP00000353206:F537I;ENSP00000283254:F537I;ENSP00000386726:F537I;ENSP00000403348:F537I	ENSP00000283254:F537I	F	-	1	0	SCN3A	165711557	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.889000	0.75627	1.080000	0.41073	0.533000	0.62120	TTC		0.428	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		19	91	0	0	0	0.006122	0	19	91				
SCN2A	6326	broad.mit.edu	37	2	166172258	166172258	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:166172258C>T	ENST00000375437.2	+	11	1951	c.1661C>T	c.(1660-1662)tCt>tTt	p.S554F	SCN2A_ENST00000283256.6_Missense_Mutation_p.S554F|SCN2A_ENST00000357398.3_Missense_Mutation_p.S554F|SCN2A_ENST00000375427.2_Missense_Mutation_p.S554F	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	554					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGATTTTCTTCTCCACACCAG	0.348																																							uc002udc.2		NA																	0				ovary(6)|breast(1)|pancreas(1)	8						c.(1660-1662)TCT>TTT		sodium channel, voltage-gated, type II, alpha	Lamotrigine(DB00555)						63.0	70.0	68.0					2																	166172258		2203	4298	6501	SO:0001583	missense	6326				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166172258C>T	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1661C>T	2.37:g.166172258C>T	ENSP00000364586:p.Ser554Phe		Somatic				SCN2A_uc002udd.2_Missense_Mutation_p.S554F|SCN2A_uc002ude.2_Missense_Mutation_p.S554F	p.S554F	NM_001040142	NP_001035232	WXS	Illumina HiSeq	Unspecified	Q99250	SCN2A_HUMAN			11	1951	+			554					A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	c.1661C>T	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	C	19.06	3.754542	0.69648	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.96365	-3.99;-3.99;-3.99;-3.99	5.9	5.9	0.94986	Domain of unknown function DUF3451 (1);	0.800036	0.10608	N	0.654757	D	0.98090	0.9370	M	0.84082	2.675	0.44092	D	0.996859	B;P	0.50369	0.073;0.934	B;D	0.66602	0.034;0.945	D	0.96268	0.9196	9	.	.	.	.	13.4661	0.61254	0.0:0.9291:0.0:0.0709	.	554;554	Q99250-2;Q99250	.;SCN2A_HUMAN	F	554	ENSP00000364586:S554F;ENSP00000349973:S554F;ENSP00000283256:S554F;ENSP00000364576:S554F	.	S	+	2	0	SCN2A	165880504	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.779000	0.55379	2.788000	0.95919	0.650000	0.86243	TCT		0.348	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007		18	55	0	0	0	0.001882	0	18	55				
GALNT3	2591	broad.mit.edu	37	2	166626801	166626801	+	Missense_Mutation	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:166626801T>A	ENST00000392701.3	-	2	1185	c.410A>T	c.(409-411)gAg>gTg	p.E137V		NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	137					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						TTCCTTTTGCTCTTCAACACT	0.463																																							uc010fph.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(409-411)GAG>GTG		polypeptide N-acetylgalactosaminyltransferase 3							165.0	154.0	158.0					2																	166626801		2203	4300	6503	SO:0001583	missense	2591				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	Golgi cisterna membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	calcium ion binding|manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:166626801T>A		CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.410A>T	2.37:g.166626801T>A	ENSP00000376465:p.Glu137Val		Somatic				GALNT3_uc010fpi.1_Missense_Mutation_p.E137V|GALNT3_uc002udi.2_Missense_Mutation_p.E137V	p.E137V	NM_004482	NP_004473	WXS	Illumina HiSeq	Unspecified	Q14435	GALT3_HUMAN			2	797	-			137			Lumenal (Potential).		Q53TG9|Q7Z476	Missense_Mutation	SNP	ENST00000392701.3	37	c.410A>T	CCDS2226.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518712	0.64634	.	.	ENSG00000115339	ENST00000392701;ENST00000412248	T;T	0.63417	0.24;-0.04	5.81	5.81	0.92471	.	0.000000	0.85682	U	0.000000	T	0.75488	0.3856	L	0.52823	1.66	0.80722	D	1	B;D	0.89917	0.073;1.0	B;D	0.91635	0.041;0.999	T	0.75274	-0.3375	10	0.45353	T	0.12	.	16.1668	0.81768	0.0:0.0:0.0:1.0	.	137;137	Q14435;Q14435-2	GALT3_HUMAN;.	V	137	ENSP00000376465:E137V;ENSP00000412643:E137V	ENSP00000376465:E137V	E	-	2	0	GALNT3	166335047	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.040000	0.89188	2.210000	0.71456	0.533000	0.62120	GAG		0.463	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255205.2	NM_004482		14	66	0	0	0	0.001855	0	14	66				
XIRP2	129446	broad.mit.edu	37	2	168101680	168101680	+	Missense_Mutation	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:168101680T>A	ENST00000409195.1	+	9	3867	c.3778T>A	c.(3778-3780)Tgt>Agt	p.C1260S	XIRP2_ENST00000409273.1_Missense_Mutation_p.C1038S|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.C1260S|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1085					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGGTGATGAATGTGTTAAGAC	0.338																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(3778-3780)TGT>AGT		xin actin-binding repeat containing 2 isoform 1							142.0	137.0	138.0					2																	168101680		1845	4090	5935	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168101680T>A	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.3778T>A	2.37:g.168101680T>A	ENSP00000386840:p.Cys1260Ser		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.C1085S|XIRP2_uc010fpq.2_Missense_Mutation_p.C1038S|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.C1260S	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	3796	+			1085					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.3778T>A	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.856162	0.00065	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02103	4.45;4.45;4.45	5.78	3.42	0.39159	.	0.686165	0.14246	N	0.331756	T	0.01029	0.0034	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.48210	-0.9055	10	0.09084	T	0.74	-1.3731	8.0205	0.30406	0.0:0.2272:0.0:0.7728	.	1085;1085;1038	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	S	1260;1260;1038	ENSP00000386840:C1260S;ENSP00000295237:C1260S;ENSP00000387255:C1038S	ENSP00000295237:C1260S	C	+	1	0	XIRP2	167809926	0.000000	0.05858	0.007000	0.13788	0.229000	0.25112	0.238000	0.18004	0.469000	0.27268	-0.374000	0.07098	TGT		0.338	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		10	52	0	0	0	0.000978	0	10	52				
XIRP2	129446	broad.mit.edu	37	2	168102400	168102400	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:168102400G>A	ENST00000409195.1	+	9	4587	c.4498G>A	c.(4498-4500)Gat>Aat	p.D1500N	XIRP2_ENST00000409273.1_Missense_Mutation_p.D1278N|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.D1500N|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1325					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TCGAACTTTCGATTCTATTAT	0.388																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(4498-4500)GAT>AAT		xin actin-binding repeat containing 2 isoform 1							85.0	78.0	80.0					2																	168102400		1921	4132	6053	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168102400G>A	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.4498G>A	2.37:g.168102400G>A	ENSP00000386840:p.Asp1500Asn		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.D1325N|XIRP2_uc010fpq.2_Missense_Mutation_p.D1278N|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	p.D1500N	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	4516	+			1325			Xin 27.		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.4498G>A	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195905	0.58126	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.15718	2.43;2.43;2.4	5.56	4.68	0.58851	.	0.050870	0.85682	N	0.000000	T	0.46541	0.1398	M	0.86740	2.835	0.58432	D	0.999999	D;D;P	0.89917	1.0;1.0;0.94	D;D;B	0.87578	0.996;0.998;0.288	T	0.53648	-0.8409	10	0.59425	D	0.04	-16.2175	13.2729	0.60172	0.078:0.0:0.922:0.0	.	1325;1325;1278	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	N	1500;1500;1278	ENSP00000386840:D1500N;ENSP00000295237:D1500N;ENSP00000387255:D1278N	ENSP00000295237:D1500N	D	+	1	0	XIRP2	167810646	1.000000	0.71417	0.982000	0.44146	0.503000	0.33858	9.476000	0.97823	1.352000	0.45808	0.563000	0.77884	GAT		0.388	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		18	27	0	0	0	0.006122	0	18	27				
MYO3B	140469	broad.mit.edu	37	2	171262076	171262076	+	Missense_Mutation	SNP	G	G	A	rs369549992		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:171262076G>A	ENST00000408978.4	+	21	2596	c.2453G>A	c.(2452-2454)cGa>cAa	p.R818Q	MYO3B_ENST00000409044.3_Missense_Mutation_p.R818Q|MYO3B_ENST00000334231.6_Missense_Mutation_p.R827Q|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	818	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						GATAATCTACGATGCAAATAC	0.388																																							uc002ufy.2		NA																	0				lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						c.(2452-2454)CGA>CAA		myosin IIIB isoform 2		G	GLN/ARG,GLN/ARG,GLN/ARG	1,3699		0,1,1849	106.0	99.0	101.0		2453,2453,2453	5.5	0.6	2		101	0,8198		0,0,4099	no	missense,missense,missense	MYO3B	NM_001083615.2,NM_001171642.1,NM_138995.3	43,43,43	0,1,5948	AA,AG,GG		0.0,0.027,0.0084	possibly-damaging,possibly-damaging,possibly-damaging	818/1315,818/1276,818/1342	171262076	1,11897	1850	4099	5949	SO:0001583	missense	140469				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity	g.chr2:171262076G>A		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2453G>A	2.37:g.171262076G>A	ENSP00000386213:p.Arg818Gln		Somatic				MYO3B_uc002ufv.2_Missense_Mutation_p.R805Q|MYO3B_uc010fqb.1_Missense_Mutation_p.R805Q|MYO3B_uc002ufz.2_Missense_Mutation_p.R818Q|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA	p.R818Q	NM_138995	NP_620482	WXS	Illumina HiSeq	Unspecified	Q8WXR4	MYO3B_HUMAN			21	2596	+			818			Myosin head-like.		B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	c.2453G>A	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.817014	0.70912	2.7E-4	0.0	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	5.5	5.5	0.81552	Myosin head, motor domain (2);	0.055915	0.64402	D	0.000001	D	0.89037	0.6601	L	0.36672	1.1	0.47153	D	0.999335	D;P;D	0.60575	0.988;0.797;0.979	P;B;P	0.55965	0.682;0.186;0.788	D	0.89535	0.3788	10	0.62326	D	0.03	.	19.7578	0.96301	0.0:0.0:1.0:0.0	.	818;818;818	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	Q	818;818;817;827;827	ENSP00000386497:R818Q;ENSP00000386213:R818Q;ENSP00000446237:R827Q;ENSP00000335100:R827Q	ENSP00000314213:R817Q	R	+	2	0	MYO3B	170970322	1.000000	0.71417	0.626000	0.29213	0.955000	0.61496	6.714000	0.74692	2.748000	0.94277	0.655000	0.94253	CGA		0.388	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1			17	33	0	0	0	0.004007	0	17	33				
TTN	7273	broad.mit.edu	37	2	179604234	179604234	+	Missense_Mutation	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:179604234T>C	ENST00000591111.1	-	46	12999	c.12775A>G	c.(12775-12777)Aaa>Gaa	p.K4259E	TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K4405E|TTN_ENST00000589042.1_Missense_Mutation_p.K4576E|TTN_ENST00000359218.5_Missense_Mutation_p.K4338E|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K4213E|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACTCCTCTTTTTCCTCTGAT	0.448																																							uc010zfh.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(13213-13215)AAA>GAA		titin isoform novex-2							109.0	104.0	105.0					2																	179604234		1889	4138	6027	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179604234T>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12775A>G	2.37:g.179604234T>C	ENSP00000465570:p.Lys4259Glu		Somatic				TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.K4338E|TTN_uc010zfj.1_Missense_Mutation_p.K4213E|TTN_uc002umz.1_Intron	p.K4405E	NM_133437	NP_597681	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	13437	-			4332					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.13213A>G		.	.	.	.	.	.	.	.	.	.	T	5.774	0.327102	0.10900	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.60797	0.19;0.17;0.16	5.82	-2.73	0.05950	.	.	.	.	.	T	0.37461	0.1004	N	0.19112	0.55	0.19300	N	0.999979	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.25117	-1.0141	9	0.87932	D	0	.	7.1244	0.25463	0.0:0.3176:0.112:0.5704	.	4213;4338;4405	D3DPF9;E7EQE6;E7ET18	.;.;.	E	4213;4405;4338;4213	ENSP00000434586:K4213E;ENSP00000340554:K4405E;ENSP00000352154:K4338E	ENSP00000340554:K4405E	K	-	1	0	TTN	179312479	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.574000	0.05868	-0.738000	0.04817	-0.290000	0.09829	AAA		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		15	68	0	0	0	0.00499	0	15	68				
SATB2	23314	broad.mit.edu	37	2	200193550	200193550	+	Missense_Mutation	SNP	C	C	A	rs367947535		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:200193550C>A	ENST00000417098.1	-	8	2073	c.1257G>T	c.(1255-1257)caG>caT	p.Q419H	SATB2_ENST00000443023.1_Missense_Mutation_p.Q360H|SATB2_ENST00000260926.5_Missense_Mutation_p.Q419H|SATB2_ENST00000457245.1_Missense_Mutation_p.Q419H|RP11-486F17.1_ENST00000489557.2_RNA|SATB2_ENST00000428695.1_Missense_Mutation_p.Q301H	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	419					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TGAGGAAATTCTGCATGGCCC	0.517																																					Colon(30;262 767 11040 24421 36230)	Colon(30;262 767 11040 24421 36230)	uc002uuy.1		NA																	0				ovary(1)	1						c.(1255-1257)CAG>CAT		SATB homeobox 2							109.0	98.0	101.0					2																	200193550		2203	4300	6503	SO:0001583	missense	23314					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity	g.chr2:200193550C>A	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1257G>T	2.37:g.200193550C>A	ENSP00000401112:p.Gln419His		Somatic				SATB2_uc010fsq.1_Missense_Mutation_p.Q301H|SATB2_uc002uuz.1_Missense_Mutation_p.Q419H|SATB2_uc002uva.1_Missense_Mutation_p.Q419H	p.Q419H	NM_015265	NP_056080	WXS	Illumina HiSeq	Unspecified	Q9UPW6	SATB2_HUMAN			8	2074	-			419			CUT 1.		A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	37	c.1257G>T	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841892	0.71488	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.50548	0.75;0.75;0.75;0.74;0.75	4.98	4.1	0.47936	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.58666	0.2138	L	0.46157	1.445	0.53688	D	0.999975	D;B	0.71674	0.998;0.211	D;B	0.83275	0.996;0.147	T	0.58781	-0.7576	10	0.66056	D	0.02	-17.5095	10.5407	0.45031	0.0:0.8506:0.0:0.1494	.	301;419	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	H	419;360;419;301;419	ENSP00000401112:Q419H;ENSP00000388764:Q360H;ENSP00000260926:Q419H;ENSP00000388581:Q301H;ENSP00000405420:Q419H	ENSP00000260926:Q419H	Q	-	3	2	SATB2	199901795	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.124000	0.50461	2.747000	0.94245	0.650000	0.86243	CAG		0.517	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265		8	34	1	0	1.12685e-05	0.004482	1.35379e-05	8	34				
MAP2	4133	broad.mit.edu	37	2	210560620	210560620	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:210560620G>C	ENST00000360351.4	+	7	4232	c.3726G>C	c.(3724-3726)caG>caC	p.Q1242H	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.Q1238H	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1242					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TAGAAGCCCAGGGAGAATATG	0.488																																					Pancreas(27;423 979 28787 29963)	Pancreas(27;423 979 28787 29963)	uc002vde.1		NA																	0				ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17						c.(3724-3726)CAG>CAC		microtubule-associated protein 2 isoform 1	Estramustine(DB01196)						76.0	80.0	79.0					2																	210560620		2203	4300	6503	SO:0001583	missense	4133				central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity	g.chr2:210560620G>C		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.3726G>C	2.37:g.210560620G>C	ENSP00000353508:p.Gln1242His		Somatic				MAP2_uc002vdc.1_Missense_Mutation_p.Q1242H|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.Q1238H	p.Q1242H	NM_002374	NP_002365	WXS	Illumina HiSeq	Unspecified	P11137	MAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	7	3974	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	1242					Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	c.3726G>C	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	7.764	0.705957	0.15172	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.18338	2.22;2.22	5.66	1.89	0.25635	MAP2/Tau projection (1);	1.437160	0.04336	N	0.353192	T	0.14874	0.0359	N	0.22421	0.69	0.09310	N	1	B;P	0.34815	0.415;0.47	B;B	0.38428	0.179;0.273	T	0.33033	-0.9884	10	0.52906	T	0.07	1.6174	6.2916	0.21063	0.3831:0.1205:0.4964:0.0	.	1238;1242	P11137-3;P11137	.;MAP2_HUMAN	H	1242;1238	ENSP00000353508:Q1242H;ENSP00000392164:Q1238H	ENSP00000353508:Q1242H	Q	+	3	2	MAP2	210268865	0.055000	0.20627	0.835000	0.33067	0.877000	0.50540	0.717000	0.25851	0.073000	0.16731	-0.806000	0.03193	CAG		0.488	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		6	54	0	0	0	0.001168	0	6	54				
CPS1	1373	broad.mit.edu	37	2	211504723	211504723	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:211504723C>A	ENST00000233072.5	+	24	3095	c.2899C>A	c.(2899-2901)Cat>Aat	p.H967N	CPS1_ENST00000497121.1_3'UTR|CPS1_ENST00000451903.2_Missense_Mutation_p.H516N|CPS1_ENST00000430249.2_Missense_Mutation_p.H973N	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	967					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TCCTCAGGAGCATGATGTCAA	0.313																																							uc002vee.3		NA																	0				ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(2899-2901)CAT>AAT		carbamoyl-phosphate synthetase 1 isoform b							134.0	128.0	130.0					2																	211504723		2203	4298	6501	SO:0001583	missense	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211504723C>A	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2899C>A	2.37:g.211504723C>A	ENSP00000233072:p.His967Asn		Somatic				CPS1_uc010fur.2_Missense_Mutation_p.H973N|CPS1_uc010fus.2_Missense_Mutation_p.H516N	p.H967N	NM_001875	NP_001866	WXS	Illumina HiSeq	Unspecified	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	24	3031	+			967					B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	c.2899C>A	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744147	0.49151	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97256	-4.31;-4.31;-4.31	5.42	5.42	0.78866	Pre-ATP-grasp fold (1);Carbamoyl-phosphate synthetase, large subunit, oligomerisation (1);	0.044170	0.85682	D	0.000000	D	0.94961	0.8370	L	0.41124	1.26	0.58432	D	0.999996	B;B	0.13145	0.007;0.007	B;B	0.11329	0.006;0.006	D	0.91231	0.5014	10	0.34782	T	0.22	-9.0703	19.586	0.95490	0.0:1.0:0.0:0.0	.	977;967	Q59HF8;P31327	.;CPSM_HUMAN	N	973;975;967;516	ENSP00000402608:H973N;ENSP00000233072:H967N;ENSP00000406136:H516N	ENSP00000233072:H967N	H	+	1	0	CPS1	211212968	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.247000	0.65416	2.699000	0.92147	0.655000	0.94253	CAT		0.313	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			7	40	1	0	1.76689e-08	0.006214	2.34232e-08	7	40				
IGFBP5	3488	broad.mit.edu	37	2	217543575	217543575	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:217543575G>T	ENST00000233813.4	-	2	1314	c.565C>A	c.(565-567)Cag>Aag	p.Q189K		NM_000599.3	NP_000590.1	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5	189	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cellular protein metabolic process (GO:0044267)|cellular response to cAMP (GO:0071320)|cellular response to organic cyclic compound (GO:0071407)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hair follicle morphogenesis (GO:0031069)|intracellular signal transduction (GO:0035556)|mammary gland involution (GO:0060056)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|striated muscle cell differentiation (GO:0051146)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|insulin-like growth factor binding protein complex (GO:0016942)	insulin-like growth factor I binding (GO:0031994)			endometrium(1)|large_intestine(3)|lung(1)	5		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGATGCACCTGCTCAGACTCC	0.562																																							uc002vgj.3		NA																	0					0						c.(565-567)CAG>AAG		insulin-like growth factor binding protein 5							65.0	65.0	65.0					2																	217543575		2203	4300	6503	SO:0001583	missense	3488				negative regulation of insulin-like growth factor receptor signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of translation|signal transduction		insulin-like growth factor I binding	g.chr2:217543575G>T		CCDS2405.1	2q35	2014-09-16			ENSG00000115461	ENSG00000115461			5474	protein-coding gene	gene with protein product		146734				7511611	Standard	NM_000599		Approved		uc002vgj.4	P24593	OTTHUMG00000133058	ENST00000233813.4:c.565C>A	2.37:g.217543575G>T	ENSP00000233813:p.Gln189Lys		Somatic					p.Q189K	NM_000599	NP_000590	WXS	Illumina HiSeq	Unspecified	P24593	IBP5_HUMAN		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	2	1339	-		Renal(323;0.0822)	189			Thyroglobulin type-1.		Q5U0A3	Missense_Mutation	SNP	ENST00000233813.4	37	c.565C>A	CCDS2405.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.573110	0.45902	.	.	ENSG00000115461	ENST00000233813	T	0.62498	0.02	4.92	4.92	0.64577	Thyroglobulin type-1 (2);	0.000000	0.35739	N	0.003009	T	0.45617	0.1351	N	0.17764	0.52	0.41142	D	0.985964	P	0.48764	0.915	B	0.37780	0.258	T	0.51647	-0.8679	10	0.41790	T	0.15	-11.2794	15.4337	0.75125	0.0:0.0:1.0:0.0	.	189	P24593	IBP5_HUMAN	K	189	ENSP00000233813:Q189K	ENSP00000233813:Q189K	Q	-	1	0	IGFBP5	217251820	1.000000	0.71417	1.000000	0.80357	0.427000	0.31564	5.806000	0.69150	2.573000	0.86826	0.561000	0.74099	CAG		0.562	IGFBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256674.2	NM_000599		9	17	1	0	2.17888e-05	0.006214	2.56426e-05	9	17				
CCDC108	255101	broad.mit.edu	37	2	219892675	219892675	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:219892675G>T	ENST00000341552.5	-	13	1991	c.1908C>A	c.(1906-1908)ttC>ttA	p.F636L	CCDC108_ENST00000441968.1_Missense_Mutation_p.F636L|CCDC108_ENST00000409865.3_Missense_Mutation_p.F625L|CCDC108_ENST00000453220.1_Missense_Mutation_p.F636L|CCDC108_ENST00000410037.1_Missense_Mutation_p.F571L	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	636						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CGTCGAAGAAGAACTCGGTCA	0.607																																							uc002vjl.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4						c.(1906-1908)TTC>TTA		coiled-coil domain containing 108 isoform 1							55.0	63.0	60.0					2																	219892675		2202	4297	6499	SO:0001583	missense	255101					integral to membrane	structural molecule activity	g.chr2:219892675G>T	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.1908C>A	2.37:g.219892675G>T	ENSP00000340776:p.Phe636Leu		Somatic				CCDC108_uc010fwa.1_Missense_Mutation_p.F79L|CCDC108_uc010zkp.1_Missense_Mutation_p.F625L|CCDC108_uc010zkq.1_Missense_Mutation_p.F571L	p.F636L	NM_194302	NP_919278	WXS	Illumina HiSeq	Unspecified	Q6ZU64	CC108_HUMAN		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	13	1992	-		Renal(207;0.0915)	636					A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	c.1908C>A	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	G	14.32	2.499113	0.44455	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000545086;ENST00000409865;ENST00000410037;ENST00000441164	T;T;T;T;T	0.06768	3.55;3.55;3.55;3.26;3.28	5.18	3.23	0.37069	.	0.542709	0.15483	N	0.260012	T	0.04543	0.0124	N	0.14661	0.345	0.80722	D	1	B;B;B	0.29988	0.061;0.061;0.264	B;B;B	0.29785	0.045;0.045;0.107	T	0.44817	-0.9303	10	0.16896	T	0.51	-11.4419	7.0411	0.25021	0.2831:0.0:0.7169:0.0	.	625;570;636	E9PG25;B4DYZ8;Q6ZU64	.;.;CC108_HUMAN	L	636;636;636;112;625;571;570	ENSP00000340776:F636L;ENSP00000413377:F636L;ENSP00000409117:F636L;ENSP00000386945:F625L;ENSP00000386258:F571L	ENSP00000340776:F636L	F	-	3	2	CCDC108	219600919	1.000000	0.71417	0.967000	0.41034	0.685000	0.39939	1.397000	0.34543	1.411000	0.46957	0.655000	0.94253	TTC		0.607	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302		21	83	1	0	3.10358e-05	0.002299	3.64013e-05	21	83				
CHPF	79586	broad.mit.edu	37	2	220408109	220408109	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:220408109G>A	ENST00000243776.6	-	1	400	c.152C>T	c.(151-153)cCg>cTg	p.P51L	CHPF_ENST00000373891.2_Missense_Mutation_p.P51L|CHPF_ENST00000535926.1_5'Flank|TMEM198_ENST00000344458.2_5'Flank|TMEM198_ENST00000373883.3_5'Flank	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	51					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GCCGCGCGGCGGCAGCTCAGA	0.741																																							uc002vmc.3		NA																	0					0						c.(151-153)CCG>CTG		chondroitin polymerizing factor							4.0	5.0	5.0					2																	220408109		1831	3796	5627	SO:0001583	missense	79586					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity|protein binding	g.chr2:220408109G>A	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.152C>T	2.37:g.220408109G>A	ENSP00000243776:p.Pro51Leu		Somatic				CHPF_uc010zlh.1_5'Flank|CHPF_uc002vmd.3_Missense_Mutation_p.P51L|TMEM198_uc002vme.2_5'Flank|TMEM198_uc002vmf.2_5'Flank	p.P51L	NM_024536	NP_078812	WXS	Illumina HiSeq	Unspecified	Q8IZ52	CHSS2_HUMAN		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)	1	379	-		Renal(207;0.0183)	51			Lumenal (Potential).		B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	ENST00000243776.6	37	c.152C>T	CCDS2443.1	.	.	.	.	.	.	.	.	.	.	G	13.73	2.324250	0.41197	.	.	ENSG00000123989	ENST00000243776;ENST00000373891	T	0.11063	2.81	3.09	3.09	0.35607	.	0.178492	0.39615	N	0.001316	T	0.06600	0.0169	N	0.17082	0.46	0.80722	D	1	P;B	0.51791	0.948;0.017	B;B	0.42738	0.396;0.002	T	0.43605	-0.9381	10	0.22706	T	0.39	-30.7591	9.9261	0.41494	0.0:0.0:1.0:0.0	.	51;51	F8W6H2;Q8IZ52	.;CHSS2_HUMAN	L	51	ENSP00000243776:P51L	ENSP00000243776:P51L	P	-	2	0	CHPF	220116353	0.892000	0.30473	0.992000	0.48379	0.969000	0.65631	1.772000	0.38552	2.021000	0.59480	0.484000	0.47621	CCG		0.741	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536		3	13	0	0	0	0.009096	0	3	13				
NDUFA10	4705	broad.mit.edu	37	2	240944656	240944656	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:240944656G>C	ENST00000252711.2	-	8	961	c.861C>G	c.(859-861)gaC>gaG	p.D287E	NDUFA10_ENST00000404554.1_Missense_Mutation_p.D287E|NDUFA10_ENST00000307300.4_Missense_Mutation_p.D317E	NM_004544.3	NP_004535.1	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa	287					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|nucleoside kinase activity (GO:0019206)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)	16		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)		AAGTGCGATTGTCCTGCTTGA	0.458																																							uc002vyn.2		NA																	0				central_nervous_system(1)	1						c.(859-861)GAC>GAG		NADH dehydrogenase (ubiquinone) 1 alpha	NADH(DB00157)						161.0	151.0	154.0					2																	240944656		2203	4300	6503	SO:0001583	missense	4705				mitochondrial electron transport, NADH to ubiquinone|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transport	mitochondrial matrix|mitochondrial respiratory chain complex I	ATP binding|NADH dehydrogenase (ubiquinone) activity|phosphotransferase activity, alcohol group as acceptor	g.chr2:240944656G>C	AF087661	CCDS2531.1	2q37.3	2011-07-04	2002-08-29		ENSG00000130414	ENSG00000130414		"""Mitochondrial respiratory chain complex / Complex I"""	7684	protein-coding gene	gene with protein product	"""complex I 42kDa subunit"""	603835	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10 (42kD)"""			9878551	Standard	NM_004544		Approved	CI-42k	uc002vyn.3	O95299	OTTHUMG00000133350	ENST00000252711.2:c.861C>G	2.37:g.240944656G>C	ENSP00000252711:p.Asp287Glu		Somatic				NDUFA10_uc010fzc.1_Missense_Mutation_p.D317E	p.D287E	NM_004544	NP_004535	WXS	Illumina HiSeq	Unspecified	O95299	NDUAA_HUMAN		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)	8	941	-		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	287					Q8WXC9	Missense_Mutation	SNP	ENST00000252711.2	37	c.861C>G	CCDS2531.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.031|6.031	0.374076|0.374076	0.11409|0.11409	.|.	.|.	ENSG00000130414|ENSG00000130414	ENST00000419408;ENST00000252711;ENST00000404554;ENST00000422018;ENST00000448880;ENST00000307300|ENST00000444548	D;D;D|.	0.94138|.	-3.36;-3.36;-3.36|.	4.71|4.71	-9.41|-9.41	0.00613|0.00613	.|.	0.525600|.	0.21938|.	N|.	0.066927|.	T|T	0.52175|0.52175	0.1718|0.1718	L|L	0.41027|0.41027	1.25|1.25	0.35904|0.35904	D|D	0.830586|0.830586	P;P|.	0.36683|.	0.565;0.548|.	B;B|.	0.37267|.	0.245;0.209|.	T|T	0.64588|0.64588	-0.6372|-0.6372	10|5	0.32370|.	T|.	0.25|.	-14.0178|-14.0178	17.826|17.826	0.88665|0.88665	0.8264:0.0:0.1736:0.0|0.8264:0.0:0.1736:0.0	.|.	317;287|.	Q8WXC9;O95299|.	.;NDUAA_HUMAN|.	E|E	52;287;287;287;50;317|58	ENSP00000252711:D287E;ENSP00000385697:D287E;ENSP00000302321:D317E|.	ENSP00000252711:D287E|.	D|Q	-|-	3|1	2|0	NDUFA10|NDUFA10	240593329|240593329	0.041000|0.041000	0.20044|0.20044	0.000000|0.000000	0.03702|0.03702	0.006000|0.006000	0.05464|0.05464	-1.033000|-1.033000	0.03571|0.03571	-2.897000|-2.897000	0.00313|0.00313	-0.743000|-0.743000	0.03520|0.03520	GAC|CAA		0.458	NDUFA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257180.2	NM_004544		20	92	0	0	0	0.001882	0	20	92				
ZNF133	7692	broad.mit.edu	37	20	18296354	18296354	+	Missense_Mutation	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr20:18296354A>G	ENST00000316358.4	+	4	956	c.859A>G	c.(859-861)Ata>Gta	p.I287V	RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000538547.1_Missense_Mutation_p.I192V|ZNF133_ENST00000401790.1_Missense_Mutation_p.I287V|ZNF133_ENST00000462170.1_3'UTR|ZNF133_ENST00000377671.3_Missense_Mutation_p.I286V|ZNF133_ENST00000535822.1_Missense_Mutation_p.I192V|ZNF133_ENST00000396026.3_Missense_Mutation_p.I290V|ZNF133_ENST00000402618.2_Missense_Mutation_p.I224V	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	287					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						AACGCTAATCATACACGAACG	0.532																																							uc010gcq.2		NA																	0				ovary(1)|pancreas(1)	2						c.(859-861)ATA>GTA		zinc finger protein 133							81.0	68.0	73.0					20																	18296354		2203	4300	6503	SO:0001583	missense	7692					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:18296354A>G	AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.859A>G	20.37:g.18296354A>G	ENSP00000346090:p.Ile287Val		Somatic				ZNF133_uc010zrv.1_Missense_Mutation_p.I290V|ZNF133_uc010zrw.1_Missense_Mutation_p.I224V|ZNF133_uc010gcr.2_Missense_Mutation_p.I287V|ZNF133_uc010zrx.1_Missense_Mutation_p.I192V|ZNF133_uc002wql.3_Missense_Mutation_p.I286V|ZNF133_uc010gcs.2_Missense_Mutation_p.I286V|ZNF133_uc010zry.1_Missense_Mutation_p.I192V|ZNF133_uc002wqm.2_Missense_Mutation_p.I287V	p.I287V	NM_003434	NP_003425	WXS	Illumina HiSeq	Unspecified	P52736	ZN133_HUMAN			5	1164	+			287			C2H2-type 3.		A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Missense_Mutation	SNP	ENST00000316358.4	37	c.859A>G		.	.	.	.	.	.	.	.	.	.	A	3.964	-0.009645	0.07727	.	.	ENSG00000125846	ENST00000377671;ENST00000396026;ENST00000402618;ENST00000401790;ENST00000538547;ENST00000535822;ENST00000316358	T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27	4.27	4.27	0.50696	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.251432	0.28214	N	0.016172	T	0.08935	0.0221	N	0.02357	-0.585	0.23232	N	0.998076	P;P;B;P	0.46064	0.872;0.462;0.387;0.728	P;B;B;P	0.48873	0.593;0.356;0.261;0.458	T	0.23904	-1.0175	10	0.08381	T	0.77	-13.2928	12.0016	0.53235	1.0:0.0:0.0:0.0	.	224;290;287;286	B4DIB8;B4DHU7;P52736;P52736-2	.;.;ZN133_HUMAN;.	V	286;290;224;287;192;192;287	ENSP00000366899:I286V;ENSP00000400897:I290V;ENSP00000385279:I224V;ENSP00000383945:I287V;ENSP00000442978:I192V;ENSP00000439427:I192V;ENSP00000346090:I287V	ENSP00000346090:I287V	I	+	1	0	ZNF133	18244354	0.000000	0.05858	1.000000	0.80357	0.418000	0.31294	0.539000	0.23175	2.154000	0.67381	0.459000	0.35465	ATA		0.532	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000127616.1	NM_003434		10	55	0	0	0	0.006214	0	10	55				
PLAGL2	5326	broad.mit.edu	37	20	30785287	30785287	+	Silent	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr20:30785287G>A	ENST00000246229.4	-	3	723	c.459C>T	c.(457-459)agC>agT	p.S153S		NM_002657.3	NP_002648.1	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	153					chylomicron assembly (GO:0034378)|lipid metabolic process (GO:0006629)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|post-embryonic development (GO:0009791)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|liver(1)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TGAGGTCACCGCTGCTGGCAG	0.602																																					Colon(163;15 1893 11280 16306 47518)	Colon(163;15 1893 11280 16306 47518)	uc002wxn.2		NA																	0				ovary(1)|skin(1)	2						c.(457-459)AGC>AGT		pleiomorphic adenoma gene-like 2							38.0	34.0	36.0					20																	30785287		2203	4300	6503	SO:0001819	synonymous_variant	5326					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:30785287G>A		CCDS13197.1	20q11.21	2013-01-08			ENSG00000126003	ENSG00000126003		"""Zinc fingers, C2H2-type"""	9047	protein-coding gene	gene with protein product	"""C2H2-type zinc finger protein"""	604866				15585652, 17950244	Standard	NM_002657		Approved	ZNF900	uc002wxn.2	Q9UPG8	OTTHUMG00000032210	ENST00000246229.4:c.459C>T	20.37:g.30785287G>A			Somatic					p.S153S	NM_002657	NP_002648	WXS	Illumina HiSeq	Unspecified	Q9UPG8	PLAL2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		3	676	-			153					A8K8T5|E1P5M3|Q92584	Silent	SNP	ENST00000246229.4	37	c.459C>T	CCDS13197.1																																																																																				0.602	PLAGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078615.2	NM_002657		4	31	0	0	0	0.009096	0	4	31				
KIAA1755	85449	broad.mit.edu	37	20	36874455	36874455	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr20:36874455G>T	ENST00000279024.4	-	2	348	c.77C>A	c.(76-78)cCc>cAc	p.P26H		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	26										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CAGGACGGTGGGTGCTGTGGC	0.632																																							uc002xhy.1		NA																	0				ovary(4)|pancreas(1)	5						c.(76-78)CCC>CAC		hypothetical protein LOC85449							61.0	53.0	56.0					20																	36874455		2203	4300	6503	SO:0001583	missense	85449							g.chr20:36874455G>T	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.77C>A	20.37:g.36874455G>T	ENSP00000279024:p.Pro26His		Somatic				KIAA1755_uc002xhz.1_Missense_Mutation_p.P26H	p.P26H	NM_001029864	NP_001025035	WXS	Illumina HiSeq	Unspecified	Q5JYT7	K1755_HUMAN			2	349	-		Myeloproliferative disorder(115;0.00874)	26					Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	c.77C>A	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783089	0.90282	.	.	ENSG00000149633	ENST00000279024	T	0.14144	2.53	5.4	5.4	0.78164	.	0.137948	0.33732	N	0.004615	T	0.41026	0.1141	M	0.77103	2.36	0.54753	D	0.999988	D	0.89917	1.0	D	0.72625	0.978	T	0.26815	-1.0092	10	0.87932	D	0	.	18.5382	0.91018	0.0:0.0:1.0:0.0	.	26	Q5JYT7	K1755_HUMAN	H	26	ENSP00000279024:P26H	ENSP00000279024:P26H	P	-	2	0	KIAA1755	36307869	1.000000	0.71417	0.250000	0.24296	0.947000	0.59692	9.797000	0.99108	2.688000	0.91661	0.655000	0.94253	CCC		0.632	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864		14	27	1	0	6.31663e-08	0.003163	8.12473e-08	14	27				
PTPRT	11122	broad.mit.edu	37	20	40877433	40877433	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr20:40877433C>T	ENST00000373187.1	-	14	2205	c.2206G>A	c.(2206-2208)Gag>Aag	p.E736K	PTPRT_ENST00000373198.4_Missense_Mutation_p.E755K|PTPRT_ENST00000373190.1_Missense_Mutation_p.E736K|PTPRT_ENST00000373184.1_Missense_Mutation_p.E736K|PTPRT_ENST00000356100.2_Missense_Mutation_p.E755K|PTPRT_ENST00000373201.1_Missense_Mutation_p.E736K|PTPRT_ENST00000373193.3_Missense_Mutation_p.E736K			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	736					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TTCTCTGGCTCCACAGTGTTA	0.502																																							uc002xkg.2		NA																	0				skin(8)|ovary(7)|lung(5)	20						c.(2206-2208)GAG>AAG		protein tyrosine phosphatase, receptor type, T							68.0	72.0	71.0					20																	40877433		2134	4242	6376	SO:0001583	missense	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40877433C>T	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2206G>A	20.37:g.40877433C>T	ENSP00000362283:p.Glu736Lys		Somatic				PTPRT_uc010ggj.2_Missense_Mutation_p.E755K	p.E736K	NM_007050	NP_008981	WXS	Illumina HiSeq	Unspecified	O14522	PTPRT_HUMAN			14	2390	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	736			Extracellular (Potential).		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	c.2206G>A	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	C	36	5.807344	0.96967	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.36157	1.32;1.3;1.3;1.31;1.3;1.27;1.27	5.88	5.88	0.94601	.	0.100952	0.64402	D	0.000003	T	0.63094	0.2482	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.979;0.998	T	0.63673	-0.6584	10	0.87932	D	0	.	20.2257	0.98340	0.0:1.0:0.0:0.0	.	755;736	O14522-1;O14522	.;PTPRT_HUMAN	K	736;736;736;755;755;736;736	ENSP00000362286:E736K;ENSP00000362283:E736K;ENSP00000362289:E736K;ENSP00000348408:E755K;ENSP00000362294:E755K;ENSP00000362280:E736K;ENSP00000362297:E736K	ENSP00000348408:E755K	E	-	1	0	PTPRT	40310847	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.458000	0.80787	2.777000	0.95525	0.549000	0.68633	GAG		0.502	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			10	34	0	0	0	0.006214	0	10	34				
ZSWIM1	90204	broad.mit.edu	37	20	44511423	44511423	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr20:44511423G>T	ENST00000372523.1	+	2	287	c.192G>T	c.(190-192)caG>caT	p.Q64H	ZSWIM1_ENST00000372520.1_Missense_Mutation_p.Q64H	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	64						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				TCAACTACCAGAGCTGCTTTA	0.473																																							uc010ghi.2		NA																	0				skin(1)	1						c.(190-192)CAG>CAT		zinc finger, SWIM-type containing 1							129.0	106.0	114.0					20																	44511423		2203	4300	6503	SO:0001583	missense	90204						zinc ion binding	g.chr20:44511423G>T	AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.192G>T	20.37:g.44511423G>T	ENSP00000361601:p.Gln64His		Somatic				ZSWIM1_uc010zxh.1_Intron	p.Q64H	NM_080603	NP_542170	WXS	Illumina HiSeq	Unspecified	Q9BR11	ZSWM1_HUMAN			2	305	+		Myeloproliferative disorder(115;0.028)	64					Q5JZH2|Q9BR12|Q9BV30	Missense_Mutation	SNP	ENST00000372523.1	37	c.192G>T	CCDS13382.2	.	.	.	.	.	.	.	.	.	.	G	16.28	3.077487	0.55753	.	.	ENSG00000168612	ENST00000372523;ENST00000372520	T;T	0.57752	0.38;0.38	5.3	2.31	0.28768	.	0.000000	0.47455	U	0.000228	T	0.67496	0.2899	M	0.71581	2.175	0.37026	D	0.896426	D	0.89917	1.0	D	0.85130	0.997	T	0.71563	-0.4555	10	0.87932	D	0	-15.7412	9.756	0.40504	0.2276:0.0:0.7724:0.0	.	64	Q9BR11	ZSWM1_HUMAN	H	64	ENSP00000361601:Q64H;ENSP00000361598:Q64H	ENSP00000361598:Q64H	Q	+	3	2	ZSWIM1	43944830	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.698000	0.37794	0.374000	0.24650	0.655000	0.94253	CAG		0.473	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157064.2	NM_080603		16	26	1	0	3.52763e-06	0.00499	4.29775e-06	16	26				
SLC13A3	64849	broad.mit.edu	37	20	45195002	45195002	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr20:45195002C>A	ENST00000279027.4	-	11	1378	c.1360G>T	c.(1360-1362)Ggg>Tgg	p.G454W	SLC13A3_ENST00000435032.1_Missense_Mutation_p.G39W|SLC13A3_ENST00000290317.5_Missense_Mutation_p.G407W|SLC13A3_ENST00000413164.2_Missense_Mutation_p.G404W|SLC13A3_ENST00000495082.1_Missense_Mutation_p.G407W|SLC13A3_ENST00000472148.1_Missense_Mutation_p.G372W|SLC13A3_ENST00000396360.1_Missense_Mutation_p.G372W	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	454					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	TGCAGCTGCCCACCAATCCAT	0.617																																							uc002xsf.1		NA																	0				ovary(1)	1						c.(1360-1362)GGG>TGG		solute carrier family 13 member 3 isoform a	Succinic acid(DB00139)						81.0	82.0	82.0					20																	45195002		2203	4300	6503	SO:0001583	missense	64849					integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity	g.chr20:45195002C>A	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1360G>T	20.37:g.45195002C>A	ENSP00000279027:p.Gly454Trp		Somatic				SLC13A3_uc010ghn.1_Missense_Mutation_p.G423W|SLC13A3_uc010zxw.1_Missense_Mutation_p.G404W|SLC13A3_uc002xsg.1_Missense_Mutation_p.G407W|SLC13A3_uc010gho.1_Missense_Mutation_p.G372W|SLC13A3_uc010zxx.1_Missense_Mutation_p.G356W|SLC13A3_uc002xse.1_5'Flank|SLC13A3_uc010ghm.1_Missense_Mutation_p.G41W|SLC13A3_uc010zxv.1_Missense_Mutation_p.G39W	p.G454W	NM_022829	NP_073740	WXS	Illumina HiSeq	Unspecified	Q8WWT9	S13A3_HUMAN			11	1398	-		Myeloproliferative disorder(115;0.0122)	454			Cytoplasmic (Potential).		B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	37	c.1360G>T	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120715	0.56613	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000435032;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915	T;T;T;T;T;T;T;T	0.02944	4.1;4.1;4.1;4.1;4.1;4.1;4.1;4.1	5.38	3.4	0.38934	.	0.353469	0.33438	N	0.004905	T	0.12817	0.0311	M	0.81802	2.56	0.47547	D	0.999454	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.998;0.999;0.999	D;D;D;D;D;D	0.87578	0.998;0.985;0.975;0.99;0.997;0.997	T	0.00175	-1.1955	10	0.72032	D	0.01	-4.803	7.2926	0.26374	0.0:0.7133:0.1397:0.147	.	404;39;372;407;356;454	B4DIR8;B4E181;Q8WWT9-3;F6WI18;B4DF27;Q8WWT9	.;.;.;.;.;S13A3_HUMAN	W	407;372;39;454;372;404;407;407	ENSP00000290317:G407W;ENSP00000379648:G372W;ENSP00000403394:G39W;ENSP00000279027:G454W;ENSP00000420177:G372W;ENSP00000415852:G404W;ENSP00000419621:G407W;ENSP00000417784:G407W	ENSP00000279027:G454W	G	-	1	0	SLC13A3	44628409	0.017000	0.18338	0.065000	0.19835	0.808000	0.45660	0.653000	0.24902	0.610000	0.30035	0.655000	0.94253	GGG		0.617	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2			25	97	1	0	3.01185e-09	0.003954	4.0707e-09	25	97				
EYA2	2139	broad.mit.edu	37	20	45801492	45801492	+	Missense_Mutation	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr20:45801492A>T	ENST00000327619.5	+	12	1549	c.1175A>T	c.(1174-1176)aAt>aTt	p.N392I	EYA2_ENST00000317304.6_Missense_Mutation_p.N362I|EYA2_ENST00000357410.3_Missense_Mutation_p.N392I	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	392					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				GAGATGTACAATACCTACAAG	0.602																																					Pancreas(120;56 1725 18501 25218 43520)	Pancreas(120;56 1725 18501 25218 43520)	uc002xsm.2		NA																	0				ovary(1)	1						c.(1174-1176)AAT>ATT		eyes absent 2 isoform a							88.0	70.0	76.0					20																	45801492		2203	4300	6503	SO:0001583	missense	2139				DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity	g.chr20:45801492A>T		CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.1175A>T	20.37:g.45801492A>T	ENSP00000333640:p.Asn392Ile		Somatic				EYA2_uc010ghp.2_Missense_Mutation_p.N392I|EYA2_uc002xsn.2_Missense_Mutation_p.N397I|EYA2_uc002xso.2_Missense_Mutation_p.N392I|EYA2_uc002xsp.2_Missense_Mutation_p.N392I|EYA2_uc002xsq.2_Missense_Mutation_p.N362I	p.N392I	NM_005244	NP_005235	WXS	Illumina HiSeq	Unspecified	O00167	EYA2_HUMAN			12	1549	+		Myeloproliferative disorder(115;0.0241)	392					Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Missense_Mutation	SNP	ENST00000327619.5	37	c.1175A>T	CCDS13403.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.069660	0.76301	.	.	ENSG00000064655	ENST00000327619;ENST00000357410;ENST00000484200;ENST00000317304	D;D;D	0.82984	-1.67;-1.67;-1.67	5.59	5.59	0.84812	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.045263	0.85682	D	0.000000	D	0.89269	0.6667	M	0.83384	2.64	0.58432	D	0.999995	D;D;D;D	0.63880	0.993;0.984;0.991;0.981	P;P;P;P	0.59889	0.865;0.819;0.736;0.663	D	0.90447	0.4436	10	0.87932	D	0	-19.698	10.1535	0.42809	0.9255:0.0:0.0745:0.0	.	392;362;392;392	O00167-3;E7ETN2;A8KAG7;O00167	.;.;.;EYA2_HUMAN	I	392;392;362;362	ENSP00000333640:N392I;ENSP00000349986:N392I;ENSP00000321590:N362I	ENSP00000321590:N362I	N	+	2	0	EYA2	45234899	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.645000	0.46621	2.127000	0.65507	0.533000	0.62120	AAT		0.602	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080326.2	NM_005244		15	52	0	0	0	0.00245	0	15	52				
SPO11	23626	broad.mit.edu	37	20	55906984	55906984	+	Nonsense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr20:55906984C>G	ENST00000371263.3	+	2	336	c.227C>G	c.(226-228)tCa>tGa	p.S76*	SPO11_ENST00000345868.4_Intron|SPO11_ENST00000371260.4_Intron	NM_012444.2	NP_036576.1	Q9Y5K1	SPO11_HUMAN	SPO11 meiotic protein covalently bound to DSB	76					DNA catabolic process, endonucleolytic (GO:0000737)|female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|ovarian follicle development (GO:0001541)|protein localization to chromosome (GO:0034502)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|hydrolase activity (GO:0016787)			autonomic_ganglia(1)|breast(3)|large_intestine(4)|lung(8)|skin(2)	18	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)			GACAACAGATCAAGCTGGGAA	0.313								Editing and processing nucleases																															uc002xye.2		NA																	0				breast(2)|skin(1)	3						c.(226-228)TCA>TGA	Editing_and_processing_nucleases	meiotic recombination protein SPO11 isoform a							107.0	112.0	111.0					20																	55906984		2203	4300	6503	SO:0001587	stop_gained	23626				female gamete generation|reciprocal meiotic recombination	chromosome|nucleus	ATP binding|DNA binding|hydrolase activity	g.chr20:55906984C>G	AF169385	CCDS13456.1, CCDS13457.1	20q13.31	2013-06-05	2013-06-05		ENSG00000054796	ENSG00000054796			11250	protein-coding gene	gene with protein product	"""cancer/testis antigen 35"", ""spermatogenesis associated 43"""	605114	"""SPO11, meiotic protein covalently bound to DSB (S. cerevisiae)-like"", ""SPO11 meiotic protein covalently bound to DSB-like (S. cerevisiae)"", ""SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)"""			10534401	Standard	NM_012444		Approved	CT35, SPATA43, TOPVIA	uc002xye.3	Q9Y5K1	OTTHUMG00000032817	ENST00000371263.3:c.227C>G	20.37:g.55906984C>G	ENSP00000360310:p.Ser76*		Somatic				SPO11_uc002xyf.2_Intron	p.S76*	NM_012444	NP_036576	WXS	Illumina HiSeq	Unspecified	Q9Y5K1	SPO11_HUMAN	BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)		2	320	+	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		76					Q5TCI1|Q8N4V0|Q9NQM7|Q9NQM8	Nonsense_Mutation	SNP	ENST00000371263.3	37	c.227C>G	CCDS13456.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833794	0.91036	.	.	ENSG00000054796	ENST00000371263;ENST00000418127	.	.	.	5.42	5.42	0.78866	.	0.061993	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-12.2708	17.7557	0.88447	0.0:1.0:0.0:0.0	.	.	.	.	X	76;54	.	ENSP00000360310:S76X	S	+	2	0	SPO11	55340391	1.000000	0.71417	0.998000	0.56505	0.721000	0.41392	6.910000	0.75741	2.700000	0.92200	0.585000	0.79938	TCA		0.313	SPO11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079836.2	NM_012444		26	132	0	0	0	0.004656	0	26	132				
COL9A3	1299	broad.mit.edu	37	20	61452879	61452879	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr20:61452879C>A	ENST00000343916.3	+	7	369	c.366C>A	c.(364-366)ccC>ccA	p.P122P		NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	122	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					TCCCTGGACCCCCCGTGAGTA	0.647																																							uc002ydm.2		NA																	0					0						c.(364-366)CCC>CCA		alpha 3 type IX collagen precursor							44.0	45.0	45.0					20																	61452879		2203	4300	6503	SO:0001819	synonymous_variant	1299				axon guidance	collagen type IX		g.chr20:61452879C>A	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.366C>A	20.37:g.61452879C>A			Somatic					p.P122P	NM_001853	NP_001844	WXS	Illumina HiSeq	Unspecified	Q14050	CO9A3_HUMAN			7	369	+	Breast(26;5.68e-08)		122			Triple-helical region 3 (COL3).		Q13681|Q9H4G9|Q9UPE2	Silent	SNP	ENST00000343916.3	37	c.366C>A	CCDS13505.1																																																																																				0.647	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853		9	43	1	0	0.00829132	0.008291	0.00879999	9	43				
TPTE	7179	broad.mit.edu	37	21	10920121	10920121	+	Missense_Mutation	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr21:10920121T>A	ENST00000361285.4	-	19	1462	c.1133A>T	c.(1132-1134)cAc>cTc	p.H378L	TPTE_ENST00000298232.7_Missense_Mutation_p.H360L|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.H340L	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	378	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTTTTCGCTGTGGGTTTTATC	0.383																																							uc002yip.1		NA																	0				ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(1132-1134)CAC>CTC		transmembrane phosphatase with tensin homology							102.0	97.0	99.0					21																	10920121		2203	4300	6503	SO:0001583	missense	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10920121T>A	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1133A>T	21.37:g.10920121T>A	ENSP00000355208:p.His378Leu		Somatic				TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.H360L|TPTE_uc002yir.1_Missense_Mutation_p.H340L|TPTE_uc010gkv.1_Missense_Mutation_p.H240L	p.H378L	NM_199261	NP_954870	WXS	Illumina HiSeq	Unspecified	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	19	1501	-			378			Phosphatase tensin-type.		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	c.1133A>T	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	0.007	-2.012239	0.00422	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.85258	-1.96;-1.96;-1.96	2.32	-4.64	0.03349	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	1.051430	0.07415	N	0.893083	T	0.60130	0.2245	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.10296	0.003;0.003;0.002	B;B;B	0.06405	0.001;0.001;0.002	T	0.50800	-0.8785	10	0.11485	T	0.65	-0.0238	4.7474	0.13043	0.0:0.3433:0.2836:0.3731	.	340;360;378	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	L	360;378;340	ENSP00000298232:H360L;ENSP00000355208:H378L;ENSP00000344441:H340L	ENSP00000298232:H360L	H	-	2	0	TPTE	9941992	0.000000	0.05858	0.005000	0.12908	0.058000	0.15608	-1.290000	0.02777	-1.484000	0.01856	0.155000	0.16302	CAC		0.383	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			6	46	0	0	0	0.001168	0	6	46				
LIPI	149998	broad.mit.edu	37	21	15538703	15538703	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr21:15538703C>G	ENST00000536861.1	-	5	712	c.713G>C	c.(712-714)tGt>tCt	p.C238S	LIPI_ENST00000344577.2_Missense_Mutation_p.C259S			Q6XZB0	LIPI_HUMAN	lipase, member I	238					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TGATTTAGGACAGCCAGGTTG	0.348																																							uc002yjm.2		NA																	0				ovary(2)	2						c.(775-777)TGT>TCT		lipase, member I							123.0	119.0	121.0					21																	15538703		2203	4300	6503	SO:0001583	missense	149998				lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity	g.chr21:15538703C>G	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.713G>C	21.37:g.15538703C>G	ENSP00000440381:p.Cys238Ser		Somatic				LIPI_uc010gkw.1_Intron	p.C259S	NM_198996	NP_945347	WXS	Illumina HiSeq	Unspecified	Q6XZB0	LIPI_HUMAN		Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)	5	786	-			238					G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	ENST00000536861.1	37	c.776G>C		.	.	.	.	.	.	.	.	.	.	C	15.41	2.825730	0.50739	.	.	ENSG00000188992	ENST00000344577;ENST00000536861	D;D	0.93366	-3.21;-3.21	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.97757	0.9264	H	0.95574	3.69	0.51482	D	0.999927	D	0.89917	1.0	D	0.97110	1.0	D	0.98628	1.0670	10	0.87932	D	0	.	16.6428	0.85130	0.0:1.0:0.0:0.0	.	259	Q6XZB0-2	.	S	259;238	ENSP00000343331:C259S;ENSP00000440381:C238S	ENSP00000343331:C259S	C	-	2	0	LIPI	14460574	1.000000	0.71417	1.000000	0.80357	0.204000	0.24138	5.203000	0.65174	2.733000	0.93635	0.650000	0.86243	TGT		0.348	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996		9	61	0	0	0	0.006214	0	9	61				
HSPA13	6782	broad.mit.edu	37	21	15753847	15753847	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr21:15753847G>A	ENST00000285667.3	-	2	110	c.43C>T	c.(43-45)Ctc>Ttc	p.L15F	HSPA13_ENST00000544452.1_5'UTR|HSPA13_ENST00000478035.1_5'UTR	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	15						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						GCCAACAGGAGAGTCAAAACA	0.373																																							uc002yjt.2		NA																	0				kidney(1)	1						c.(43-45)CTC>TTC		heat shock protein 70kDa family member 13							40.0	37.0	38.0					21																	15753847		2203	4300	6503	SO:0001583	missense	6782					endoplasmic reticulum|microsome	ATP binding	g.chr21:15753847G>A		CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.43C>T	21.37:g.15753847G>A	ENSP00000285667:p.Leu15Phe		Somatic				HSPA13_uc011abx.1_5'UTR	p.L15F	NM_006948	NP_008879	WXS	Illumina HiSeq	Unspecified	P48723	HSP13_HUMAN			2	112	-			15					B2R616|Q8NE40	Missense_Mutation	SNP	ENST00000285667.3	37	c.43C>T	CCDS13567.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371361	0.82573	.	.	ENSG00000155304	ENST00000285667	T	0.02067	4.47	5.46	5.46	0.80206	.	0.117608	0.64402	D	0.000017	T	0.12732	0.0309	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00143	-1.1995	10	0.72032	D	0.01	-10.2876	19.3065	0.94164	0.0:0.0:1.0:0.0	.	15	P48723	HSP13_HUMAN	F	15	ENSP00000285667:L15F	ENSP00000285667:L15F	L	-	1	0	HSPA13	14675718	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.172000	0.71932	2.574000	0.86865	0.557000	0.71058	CTC		0.373	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157815.1			8	18	0	0	0	0.006214	0	8	18				
TRPM2	7226	broad.mit.edu	37	21	45825814	45825814	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr21:45825814G>T	ENST00000397928.1	+	18	3129	c.2684G>T	c.(2683-2685)gGg>gTg	p.G895V	TRPM2_ENST00000397932.2_Missense_Mutation_p.G895V|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300481.9_Missense_Mutation_p.G875V|TRPM2_ENST00000300482.5_Missense_Mutation_p.G895V	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	895					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CTGTACCCCGGGCGCGTCATC	0.617																																							uc002zet.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2683-2685)GGG>GTG		transient receptor potential cation channel,							82.0	85.0	84.0					21																	45825814		2203	4299	6502	SO:0001583	missense	7226					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity	g.chr21:45825814G>T	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2684G>T	21.37:g.45825814G>T	ENSP00000381023:p.Gly895Val		Somatic				TRPM2_uc002zeu.1_Missense_Mutation_p.G895V|TRPM2_uc002zew.1_Missense_Mutation_p.G895V|TRPM2_uc010gpt.1_Missense_Mutation_p.G895V|TRPM2_uc002zex.1_Missense_Mutation_p.G681V|TRPM2_uc002zey.1_Missense_Mutation_p.G408V	p.G895V	NM_003307	NP_003298	WXS	Illumina HiSeq	Unspecified	O94759	TRPM2_HUMAN			19	2897	+			895			Extracellular (Potential).		D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	c.2684G>T	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	g	16.07	3.017734	0.54576	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66	4.3	4.3	0.51218	Ion transport (1);	0.139126	0.47852	D	0.000212	D	0.85435	0.5696	M	0.87682	2.9	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.997	D;D;D	0.69654	0.965;0.965;0.965	D	0.88918	0.3364	10	0.87932	D	0	-21.7358	16.8112	0.85720	0.0:0.0:1.0:0.0	.	895;681;895	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	V	895;895;875;895	ENSP00000300482:G895V;ENSP00000381023:G895V;ENSP00000300481:G875V;ENSP00000381026:G895V	ENSP00000300481:G875V	G	+	2	0	TRPM2	44650242	1.000000	0.71417	0.999000	0.59377	0.063000	0.16089	9.123000	0.94387	2.131000	0.65755	0.536000	0.68110	GGG		0.617	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307		26	79	1	0	1.1804e-14	0.003954	1.80716e-14	26	79				
KRTAP10-7	386675	broad.mit.edu	37	21	46021441	46021441	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr21:46021441G>T	ENST00000380102.2	+	1	945	c.920G>T	c.(919-921)tGc>tTc	p.C307F	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	307	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						ACCACCTCCTGCTGCAGACCC	0.672																																							uc002zfn.3		NA																	0					0						c.(904-906)TGC>TTC		keratin associated protein 10-7							77.0	69.0	72.0					21																	46021441		2203	4277	6480	SO:0001583	missense	386675					keratin filament		g.chr21:46021441G>T	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.920G>T	21.37:g.46021441G>T	ENSP00000369445:p.Cys307Phe		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.C302F	NM_198689	NP_941962	WXS	Illumina HiSeq	Unspecified	P60409	KR107_HUMAN			2	930	+			307			27.|30 X 5 AA repeats of C-C-X(3).		Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	37	c.905G>T		.	.	.	.	.	.	.	.	.	.	g	11.66	1.705495	0.30232	.	.	ENSG00000205441	ENST00000380102	T	0.03717	3.83	3.89	2.99	0.34606	.	.	.	.	.	T	0.18215	0.0437	M	0.89534	3.04	0.38284	D	0.942512	D	0.61697	0.99	D	0.64410	0.925	T	0.02053	-1.1222	9	0.66056	D	0.02	.	9.2883	0.37771	0.1107:0.0:0.8893:0.0	.	302	P60409-2	.	F	307	ENSP00000369445:C307F	ENSP00000369445:C307F	C	+	2	0	KRTAP10-7	44845869	1.000000	0.71417	0.500000	0.27589	0.642000	0.38348	2.334000	0.43920	0.753000	0.32945	0.467000	0.42956	TGC		0.672	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689		26	99	1	0	7.38237e-10	0.00632	1.02172e-09	26	99				
KRTAP10-9	386676	broad.mit.edu	37	21	46047942	46047942	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr21:46047942C>T	ENST00000397911.3	+	1	903	c.854C>T	c.(853-855)tCc>tTc	p.S285F	KRTAP10-9_ENST00000484861.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	285						keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						TACAGCTTCTCCTCAGGCCAG	0.701																																							uc002zfp.3		NA																	0					0						c.(853-855)TCC>TTC		keratin associated protein 10-9							55.0	69.0	64.0					21																	46047942		2175	4282	6457	SO:0001583	missense	386676					keratin filament		g.chr21:46047942C>T	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.854C>T	21.37:g.46047942C>T	ENSP00000381009:p.Ser285Phe		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.S285F	NM_198690	NP_941963	WXS	Illumina HiSeq	Unspecified	P60411	KR109_HUMAN			1	903	+			285					A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	ENST00000397911.3	37	c.854C>T	CCDS42961.1	.	.	.	.	.	.	.	.	.	.	c	10.40	1.339252	0.24339	.	.	ENSG00000221837	ENST00000397911	T	0.00792	5.69	2.29	2.29	0.28610	.	.	.	.	.	T	0.02119	0.0066	L	0.40543	1.245	0.09310	N	0.999991	D	0.65815	0.995	D	0.68483	0.958	T	0.54483	-0.8287	8	.	.	.	.	10.657	0.45680	0.0:1.0:0.0:0.0	.	285	P60411	KR109_HUMAN	F	285	ENSP00000381009:S285F	.	S	+	2	0	KRTAP10-9	44872370	0.009000	0.17119	0.028000	0.17463	0.026000	0.11368	0.890000	0.28295	1.197000	0.43143	0.462000	0.41574	TCC		0.701	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128040.1			23	63	0	0	0	0.007291	0	23	63				
CACNA1I	8911	broad.mit.edu	37	22	39966877	39966877	+	Silent	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr22:39966877G>A	ENST00000402142.3	+	1	120	c.120G>A	c.(118-120)gaG>gaA	p.E40E	CACNA1I_ENST00000404898.1_Silent_p.E40E|CACNA1I_ENST00000336649.4_Silent_p.E40E|CACNA1I_ENST00000400164.3_Silent_p.E40E|CACNA1I_ENST00000401624.1_Silent_p.E40E|CACNA1I_ENST00000407673.1_Silent_p.E40E	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	40					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GCCTGGAGGAGCCTCTGGATG	0.677																																							uc003ayc.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(118-120)GAG>GAA		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)						47.0	55.0	52.0					22																	39966877		2032	4167	6199	SO:0001819	synonymous_variant	8911				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding	g.chr22:39966877G>A	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.120G>A	22.37:g.39966877G>A			Somatic				CACNA1I_uc003ayd.2_Silent_p.E40E	p.E40E	NM_021096	NP_066919	WXS	Illumina HiSeq	Unspecified	Q9P0X4	CAC1I_HUMAN			1	120	+	Melanoma(58;0.0749)		40			Cytoplasmic (Potential).		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	37	c.120G>A	CCDS46710.1																																																																																				0.677	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406		17	64	0	0	0	0.004007	0	17	64				
GRM7	2917	broad.mit.edu	37	3	6903146	6903146	+	Missense_Mutation	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:6903146T>A	ENST00000357716.4	+	1	345	c.71T>A	c.(70-72)cTc>cAc	p.L24H	GRM7_ENST00000402647.2_Missense_Mutation_p.L24H|GRM7_ENST00000389336.4_Missense_Mutation_p.L24H|GRM7_ENST00000403881.1_Missense_Mutation_p.L24H|GRM7_ENST00000486284.1_Missense_Mutation_p.L24H	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	24					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CTGGAGGTGCTCCTGTGCGCG	0.706																																							uc003bqm.2		NA																	0				ovary(4)|lung(3)	7						c.(70-72)CTC>CAC		glutamate receptor, metabotropic 7 isoform a	L-Glutamic Acid(DB00142)						12.0	10.0	11.0					3																	6903146		2058	4063	6121	SO:0001583	missense	2917				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding	g.chr3:6903146T>A	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.71T>A	3.37:g.6903146T>A	ENSP00000350348:p.Leu24His		Somatic				GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.L24H|GRM7_uc003bql.2_Missense_Mutation_p.L24H	p.L24H	NM_000844	NP_000835	WXS	Illumina HiSeq	Unspecified	Q14831	GRM7_HUMAN			1	345	+			24					Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	c.71T>A	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.724746	0.30593	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.90261	-2.6;-2.64;-2.63;-2.64;-2.64	5.23	5.23	0.72850	.	0.587551	0.12887	N	0.430903	D	0.84669	0.5523	L	0.29908	0.895	0.27222	N	0.959639	P;B;B	0.35656	0.514;0.38;0.115	B;B;B	0.36418	0.224;0.112;0.224	T	0.77400	-0.2602	10	0.41790	T	0.15	.	8.6364	0.33950	0.0:0.0865:0.0:0.9135	.	24;24;24	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	H	24	ENSP00000350348:L24H;ENSP00000417536:L24H;ENSP00000373987:L24H;ENSP00000385664:L24H;ENSP00000384585:L24H	ENSP00000350348:L24H	L	+	2	0	GRM7	6878146	0.980000	0.34600	0.998000	0.56505	0.047000	0.14425	2.685000	0.46959	1.962000	0.57031	0.455000	0.32223	CTC		0.706	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		4	8	0	0	0	0.009096	0	4	8				
ITGA9	3680	broad.mit.edu	37	3	37512507	37512507	+	Silent	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:37512507G>T	ENST00000264741.5	+	2	451	c.195G>T	c.(193-195)gtG>gtT	p.V65V	ITGA9_ENST00000422441.1_Silent_p.V65V	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	65					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		GGGTCCTTGTGGGCGCACCAA	0.527																																							uc003chd.2		NA																	0				breast(3)|pancreas(1)|lung(1)|skin(1)	6						c.(193-195)GTG>GTT		integrin, alpha 9 precursor							81.0	76.0	78.0					3																	37512507		2203	4300	6503	SO:0001819	synonymous_variant	3680				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr3:37512507G>T	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.195G>T	3.37:g.37512507G>T			Somatic				ITGA9_uc003chc.2_Silent_p.V65V	p.V65V	NM_002207	NP_002198	WXS	Illumina HiSeq	Unspecified	Q13797	ITA9_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)	2	248	+			65			Extracellular (Potential).|FG-GAP 1.		Q14638	Silent	SNP	ENST00000264741.5	37	c.195G>T	CCDS2669.1																																																																																				0.527	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207		6	50	1	0	0.000157383	0.00308	0.000177377	6	50				
RHOA	387	broad.mit.edu	37	3	49394909	49394909	+	IGR	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:49394909G>A	ENST00000418115.1	-	0	2031				GPX1_ENST00000419349.1_3'UTR|GPX1_ENST00000419783.1_Missense_Mutation_p.P175L|GPX1_ENST00000496791.1_5'Flank	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CCTGCGTAGGGGCACACCGTC	0.617																																							uc011bcl.1		NA																	0				large_intestine(1)	1						c.(523-525)CCC>CTC		glutathione peroxidase 1 isoform 1	Glutathione(DB00143)						26.0	29.0	28.0					3																	49394909		1943	4123	6066	SO:0001628	intergenic_variant	2876				anti-apoptosis|cell redox homeostasis|glutathione metabolic process|heart contraction|hydrogen peroxide catabolic process|negative regulation of caspase activity|purine base metabolic process|purine nucleotide catabolic process|regulation of gene expression, epigenetic|regulation of mammary gland epithelial cell proliferation|regulation of proteasomal protein catabolic process|release of cytochrome c from mitochondria|response to selenium ion|UV protection	cytosol|mitochondrion	endopeptidase inhibitor activity|glutathione peroxidase activity|SH3 domain binding	g.chr3:49394909G>A	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49394909G>A			Somatic				GPX1_uc011bcm.1_3'UTR	p.P175L	NM_000581	NP_000572	WXS	Illumina HiSeq	Unspecified	P07203	GPX1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	3	604	-			175					P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	c.524C>T	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241084	0.58995	.	.	ENSG00000233276	ENST00000419783	T	0.03496	3.91	5.4	4.53	0.55603	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.12646	0.0307	L	0.48935	1.535	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00719	-1.1595	10	0.87932	D	0	.	13.0412	0.58899	0.0787:0.0:0.9213:0.0	.	175	P07203	GPX1_HUMAN	L	175	ENSP00000407375:P175L	ENSP00000407375:P175L	P	-	2	0	GPX1	49369913	1.000000	0.71417	0.041000	0.18516	0.072000	0.16883	7.996000	0.88334	1.280000	0.44463	-0.291000	0.09656	CCC		0.617	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664		10	33	0	0	0	0.001368	0	10	33				
ROBO1	6091	broad.mit.edu	37	3	78666888	78666888	+	Silent	SNP	C	C	T	rs551043364		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:78666888C>T	ENST00000464233.1	-	27	4292	c.4179G>A	c.(4177-4179)tcG>tcA	p.S1393S	ROBO1_ENST00000467549.1_Silent_p.S1293S|ROBO1_ENST00000436010.2_Silent_p.S1354S|ROBO1_ENST00000495273.1_Silent_p.S1348S	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1393					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AGGAGCCGTCCGAAGAACTAA	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		16778	0.0		0.0	False		,,,				2504	0.001						uc003dqe.2		NA																	0				large_intestine(2)	2						c.(4177-4179)TCG>TCA		roundabout 1 isoform a							55.0	60.0	58.0					3																	78666888		1967	4134	6101	SO:0001819	synonymous_variant	6091				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding	g.chr3:78666888C>T	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.4179G>A	3.37:g.78666888C>T			Somatic				ROBO1_uc003dqb.2_Silent_p.S1354S|ROBO1_uc003dqc.2_Silent_p.S1293S|ROBO1_uc003dqd.2_Silent_p.S1348S|ROBO1_uc010hoh.2_Silent_p.S585S|ROBO1_uc011bgl.1_Silent_p.S965S	p.S1393S	NM_002941	NP_002932	WXS	Illumina HiSeq	Unspecified	Q9Y6N7	ROBO1_HUMAN		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)	27	4387	-		Lung SC(41;0.0257)|Lung NSC(201;0.0439)	1393			Cytoplasmic (Potential).		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	37	c.4179G>A	CCDS54611.1																																																																																				0.577	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941		4	42	0	0	0	0.000602	0	4	42				
ARL13B	200894	broad.mit.edu	37	3	93761947	93761947	+	Missense_Mutation	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:93761947A>T	ENST00000394222.3	+	7	1162	c.887A>T	c.(886-888)gAg>gTg	p.E296V	ARL13B_ENST00000471138.1_Missense_Mutation_p.E296V|ARL13B_ENST00000303097.7_Missense_Mutation_p.E189V|ARL13B_ENST00000535334.1_Missense_Mutation_p.E193V|ARL13B_ENST00000539730.1_Missense_Mutation_p.E17V	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	296					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						ATGGAGCATGAGCAAATAGAG	0.343																																							uc003drc.2		NA																	0					0						c.(886-888)GAG>GTG		ADP-ribosylation factor-like 2-like 1 isoform 1							85.0	82.0	83.0					3																	93761947		2203	4299	6502	SO:0001583	missense	200894						GTP binding	g.chr3:93761947A>T	AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.887A>T	3.37:g.93761947A>T	ENSP00000377769:p.Glu296Val		Somatic				ARL13B_uc010hop.2_Missense_Mutation_p.E147V|ARL13B_uc003drd.2_Missense_Mutation_p.E189V|ARL13B_uc003dre.2_Missense_Mutation_p.E281V|ARL13B_uc003drf.2_Missense_Mutation_p.E296V|ARL13B_uc003drg.2_Missense_Mutation_p.E193V	p.E296V	NM_182896	NP_878899	WXS	Illumina HiSeq	Unspecified	Q3SXY8	AR13B_HUMAN			7	1173	+			296					D3DN29|G3V1S8|Q504W8|Q8TCL5	Missense_Mutation	SNP	ENST00000394222.3	37	c.887A>T	CCDS2925.1	.	.	.	.	.	.	.	.	.	.	A	10.31	1.315405	0.23908	.	.	ENSG00000169379	ENST00000535334;ENST00000303097;ENST00000394222;ENST00000471138;ENST00000539730	T;T;T;T;T	0.69306	1.41;-0.39;-0.15;-0.15;0.52	5.33	5.33	0.75918	.	0.406617	0.27323	N	0.019893	T	0.74359	0.3706	M	0.66939	2.045	0.43734	D	0.996221	P;B;D;B	0.57571	0.617;0.391;0.98;0.335	B;B;P;B	0.53649	0.242;0.079;0.731;0.086	T	0.78160	-0.2312	10	0.87932	D	0	-1.5908	13.8064	0.63236	1.0:0.0:0.0:0.0	.	193;296;189;296	G3V1S8;B4DLH1;Q3SXY8-2;Q3SXY8	.;.;.;AR13B_HUMAN	V	193;189;296;296;17	ENSP00000445145:E193V;ENSP00000306225:E189V;ENSP00000377769:E296V;ENSP00000420780:E296V;ENSP00000437977:E17V	ENSP00000306225:E189V	E	+	2	0	ARL13B	95244637	0.990000	0.36364	0.139000	0.22197	0.037000	0.13140	3.137000	0.50562	2.145000	0.66743	0.533000	0.62120	GAG		0.343	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352904.1	NM_182896		3	20	0	0	0	0.009096	0	3	20				
POLQ	10721	broad.mit.edu	37	3	121209076	121209076	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:121209076C>A	ENST00000264233.5	-	16	2830	c.2702G>T	c.(2701-2703)tGt>tTt	p.C901F		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	901					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TAACAGGGCACATGGATTCCA	0.393								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	Pancreas(152;907 1925 26081 31236 36904)	uc003eee.3		NA																	0				ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(2701-2703)TGT>TTT	DNA_polymerases_(catalytic_subunits)	DNA polymerase theta							163.0	134.0	144.0					3																	121209076		2203	4300	6503	SO:0001583	missense	10721				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity	g.chr3:121209076C>A	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.2702G>T	3.37:g.121209076C>A	ENSP00000264233:p.Cys901Phe		Somatic				POLQ_uc003eed.2_Missense_Mutation_p.C73F	p.C901F	NM_199420	NP_955452	WXS	Illumina HiSeq	Unspecified	O75417	DPOLQ_HUMAN		GBM - Glioblastoma multiforme(114;0.0915)	16	2831	-			901					O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	c.2702G>T	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	C	3.786	-0.044645	0.07452	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.46451	0.87	5.47	2.87	0.33458	.	1.395780	0.04614	N	0.400814	T	0.25158	0.0611	N	0.08118	0	0.09310	N	1	B;B	0.18741	0.03;0.001	B;B	0.06405	0.002;0.0	T	0.20907	-1.0261	10	0.34782	T	0.22	.	6.9916	0.24758	0.0:0.0766:0.1487:0.7747	.	901;73	O75417;O75417-2	DPOLQ_HUMAN;.	F	524;901;1037	ENSP00000264233:C901F	ENSP00000264233:C901F	C	-	2	0	POLQ	122691766	0.430000	0.25538	0.015000	0.15790	0.023000	0.10783	0.660000	0.25009	0.343000	0.23821	-0.455000	0.05494	TGT		0.393	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		33	42	1	0	1.36615e-20	0.002836	2.18836e-20	33	42				
HEG1	57493	broad.mit.edu	37	3	124746163	124746163	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:124746163C>A	ENST00000311127.4	-	3	866	c.799G>T	c.(799-801)Gag>Tag	p.E267*		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	267					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TCTCCCATCTCCAAAGCAGGA	0.552																																							uc003ehs.3		NA																	0				ovary(2)	2						c.(799-801)GAG>TAG		HEG homolog 1 precursor							58.0	61.0	60.0					3																	124746163		1978	4148	6126	SO:0001587	stop_gained	57493					extracellular region|integral to membrane	calcium ion binding	g.chr3:124746163C>A	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.799G>T	3.37:g.124746163C>A	ENSP00000311502:p.Glu267*		Somatic				HEG1_uc011bke.1_Nonsense_Mutation_p.E267*	p.E267*	NM_020733	NP_065784	WXS	Illumina HiSeq	Unspecified	Q9ULI3	HEG1_HUMAN			3	867	-			267			Extracellular (Potential).		Q6NX66|Q8NC40|Q9BSV0	Nonsense_Mutation	SNP	ENST00000311127.4	37	c.799G>T	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544551	0.86022	.	.	ENSG00000173706	ENST00000311127	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	13.0686	0.59048	0.0:1.0:0.0:0.0	.	.	.	.	X	267	.	ENSP00000311502:E267X	E	-	1	0	HEG1	126228853	0.303000	0.24463	0.029000	0.17559	0.018000	0.09664	1.892000	0.39748	2.524000	0.85096	0.650000	0.86243	GAG		0.552	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386		13	20	1	0	0.000219431	0.00245	0.000246504	13	20				
PLXND1	23129	broad.mit.edu	37	3	129305058	129305058	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:129305058C>A	ENST00000324093.4	-	4	1856	c.1678G>T	c.(1678-1680)Ggt>Tgt	p.G560C	PLXND1_ENST00000393239.1_Missense_Mutation_p.G560C	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	560					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						TCCGCCGCACCCACGCAGTCC	0.697																																					Ovarian(97;366 1484 3738 22084 39045)	Ovarian(97;366 1484 3738 22084 39045)	uc003emx.2		NA																	0				large_intestine(1)	1						c.(1678-1680)GGT>TGT		plexin D1 precursor							12.0	13.0	12.0					3																	129305058		2158	4242	6400	SO:0001583	missense	23129				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr3:129305058C>A	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.1678G>T	3.37:g.129305058C>A	ENSP00000317128:p.Gly560Cys		Somatic					p.G560C	NM_015103	NP_055918	WXS	Illumina HiSeq	Unspecified	Q9Y4D7	PLXD1_HUMAN			4	1778	-			560			Extracellular (Potential).		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	c.1678G>T	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964085	0.74131	.	.	ENSG00000004399	ENST00000324093;ENST00000393239;ENST00000505237	T;T;T	0.17854	2.25;2.25;2.25	5.13	5.13	0.70059	.	0.115998	0.56097	D	0.000028	T	0.43545	0.1252	M	0.73598	2.24	0.54753	D	0.999989	D	0.71674	0.998	D	0.66716	0.946	T	0.43750	-0.9372	10	0.87932	D	0	.	18.5771	0.91159	0.0:1.0:0.0:0.0	.	560	Q9Y4D7	PLXD1_HUMAN	C	560;560;123	ENSP00000317128:G560C;ENSP00000376931:G560C;ENSP00000426241:G123C	ENSP00000317128:G560C	G	-	1	0	PLXND1	130787748	1.000000	0.71417	0.997000	0.53966	0.365000	0.29674	4.163000	0.58183	2.388000	0.81334	0.561000	0.74099	GGT		0.697	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103		6	12	1	0	0.00448238	0.004482	0.00481647	6	12				
COL6A6	131873	broad.mit.edu	37	3	130289965	130289965	+	Missense_Mutation	SNP	C	C	A	rs377477478		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:130289965C>A	ENST00000358511.6	+	6	2736	c.2705C>A	c.(2704-2706)gCc>gAc	p.A902D	COL6A6_ENST00000453409.2_Missense_Mutation_p.A902D	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	902	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TTCACTGAAGCCCGGGGCAGC	0.542																																							uc010htl.2		NA																	0				ovary(6)|central_nervous_system(1)|pancreas(1)	8						c.(2704-2706)GCC>GAC		collagen type VI alpha 6 precursor		C	ASP/ALA	0,3768		0,0,1884	40.0	42.0	41.0		2705	3.0	1.0	3		41	1,8183		0,1,4091	no	missense	COL6A6	NM_001102608.1	126	0,1,5975	AA,AC,CC		0.0122,0.0,0.0084	possibly-damaging	902/2264	130289965	1,11951	1884	4092	5976	SO:0001583	missense	131873				axon guidance|cell adhesion	collagen		g.chr3:130289965C>A	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2705C>A	3.37:g.130289965C>A	ENSP00000351310:p.Ala902Asp		Somatic					p.A902D	NM_001102608	NP_001096078	WXS	Illumina HiSeq	Unspecified	A6NMZ7	CO6A6_HUMAN			6	2736	+			902			VWFA 5.|Nonhelical region.		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	c.2705C>A	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.071818	0.36566	0.0	1.22E-4	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.84070	-1.8;-1.8	4.92	2.96	0.34315	von Willebrand factor, type A (3);	0.469930	0.20049	N	0.100360	T	0.74329	0.3702	L	0.49126	1.545	0.30552	N	0.765339	P	0.36354	0.549	B	0.37780	0.258	T	0.69811	-0.5044	10	0.35671	T	0.21	.	3.2391	0.06774	0.239:0.4517:0.2236:0.0858	.	902	A6NMZ7	CO6A6_HUMAN	D	902	ENSP00000351310:A902D;ENSP00000399236:A902D	ENSP00000351310:A902D	A	+	2	0	COL6A6	131772655	0.000000	0.05858	0.999000	0.59377	0.973000	0.67179	0.396000	0.20867	1.195000	0.43115	0.561000	0.74099	GCC		0.542	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		5	23	1	0	1.23904e-05	0.000602	1.47322e-05	5	23				
COPB2	9276	broad.mit.edu	37	3	139093397	139093397	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:139093397C>T	ENST00000333188.5	-	7	866	c.685G>A	c.(685-687)Gcc>Acc	p.A229T	COPB2_ENST00000507777.1_Missense_Mutation_p.A200T	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	229					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						ACATTTTGGGCATGTCCTTCC	0.378																																							uc003etf.3		NA																	0				ovary(2)	2						c.(685-687)GCC>ACC		coatomer protein complex, subunit beta 2 (beta							193.0	173.0	180.0					3																	139093397		2203	4300	6503	SO:0001583	missense	9276				COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity	g.chr3:139093397C>T	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.685G>A	3.37:g.139093397C>T	ENSP00000329419:p.Ala229Thr		Somatic				COPB2_uc011bmv.1_Missense_Mutation_p.A200T|COPB2_uc010hui.2_Missense_Mutation_p.A200T|COPB2_uc011bmw.1_Missense_Mutation_p.A229T	p.A229T	NM_004766	NP_004757	WXS	Illumina HiSeq	Unspecified	P35606	COPB2_HUMAN			7	815	-			229			WD 6.		B4DZI8	Missense_Mutation	SNP	ENST00000333188.5	37	c.685G>A	CCDS3108.1	.	.	.	.	.	.	.	.	.	.	C	12.45	1.940574	0.34283	.	.	ENSG00000184432	ENST00000333188;ENST00000507777	T;T	0.54279	0.58;0.58	5.87	5.87	0.94306	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.24353	0.0590	N	0.00980	-1.08	0.80722	D	1	B;B	0.10296	0.001;0.003	B;B	0.16289	0.006;0.015	T	0.39623	-0.9605	10	0.02654	T	1	-11.7998	19.7965	0.96487	0.0:1.0:0.0:0.0	.	229;229	B4E2C9;P35606	.;COPB2_HUMAN	T	229;200	ENSP00000329419:A229T;ENSP00000422295:A200T	ENSP00000329419:A229T	A	-	1	0	COPB2	140576087	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.443000	0.80521	2.774000	0.95407	0.655000	0.94253	GCC		0.378	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766		7	57	0	0	0	0.001984	0	7	57				
TRIM42	287015	broad.mit.edu	37	3	140401880	140401880	+	Silent	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:140401880C>T	ENST00000286349.3	+	2	1109	c.918C>T	c.(916-918)aaC>aaT	p.N306N		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	306						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCAATGACAACAAATTGCTCT	0.562																																							uc003eto.1		NA																	0				lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						c.(916-918)AAC>AAT		tripartite motif-containing 42							253.0	216.0	229.0					3																	140401880		2203	4300	6503	SO:0001819	synonymous_variant	287015					intracellular	zinc ion binding	g.chr3:140401880C>T	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.918C>T	3.37:g.140401880C>T			Somatic					p.N306N	NM_152616	NP_689829	WXS	Illumina HiSeq	Unspecified	Q8IWZ5	TRI42_HUMAN			2	1109	+			306			B box-type 2.		A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	37	c.918C>T	CCDS3113.1																																																																																				0.562	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616		24	42	0	0	0	0.002299	0	24	42				
VEPH1	79674	broad.mit.edu	37	3	157031456	157031456	+	Missense_Mutation	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:157031456T>A	ENST00000362010.2	-	11	2271	c.1964A>T	c.(1963-1965)cAc>cTc	p.H655L	VEPH1_ENST00000543418.1_Intron|RP11-550I24.2_ENST00000487238.1_RNA|RP11-550I24.2_ENST00000475102.1_RNA|RP11-550I24.2_ENST00000494885.1_RNA|VEPH1_ENST00000392832.2_Missense_Mutation_p.H655L|VEPH1_ENST00000392833.2_Intron	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	655						plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			TTCAAAGCTGTGAGCACCCCC	0.488																																							uc003fbj.1		NA																	0				breast(3)|ovary(1)|lung(1)	5						c.(1963-1965)CAC>CTC		ventricular zone expressed PH domain homolog 1							74.0	75.0	75.0					3																	157031456		2203	4300	6503	SO:0001583	missense	79674					plasma membrane		g.chr3:157031456T>A	AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.1964A>T	3.37:g.157031456T>A	ENSP00000354919:p.His655Leu		Somatic				VEPH1_uc003fbk.1_Missense_Mutation_p.H655L|VEPH1_uc010hvu.1_Intron	p.H655L	NM_024621	NP_078897	WXS	Illumina HiSeq	Unspecified	Q14D04	MELT_HUMAN	Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)		11	2281	-			655					D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	ENST00000362010.2	37	c.1964A>T	CCDS3179.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.221144	0.39201	.	.	ENSG00000197415	ENST00000362010;ENST00000392832	T;T	0.08896	3.04;3.04	5.01	2.48	0.30137	.	0.052069	0.85682	D	0.000000	T	0.07413	0.0187	L	0.46157	1.445	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.27536	-1.0071	10	0.28530	T	0.3	-9.7044	7.2152	0.25955	0.0:0.0795:0.1455:0.775	.	655	Q14D04	MELT_HUMAN	L	655	ENSP00000354919:H655L;ENSP00000376577:H655L	ENSP00000354919:H655L	H	-	2	0	VEPH1	158514150	1.000000	0.71417	0.791000	0.31998	0.726000	0.41606	5.242000	0.65389	0.286000	0.22352	0.397000	0.26171	CAC		0.488	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351845.3	NM_024621		5	45	0	0	0	0.000602	0	5	45				
UBXN7	26043	broad.mit.edu	37	3	196134252	196134252	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr3:196134252C>T	ENST00000296328.4	-	2	160	c.86G>A	c.(85-87)aGt>aAt	p.S29N	UBXN7_ENST00000535858.1_Intron|UBXN7_ENST00000428095.1_Intron	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	29						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						TTTTCCTACACTTTCACTTGC	0.378																																							uc003fwm.3		NA																	0				ovary(2)|pancreas(1)	3						c.(85-87)AGT>AAT		UBX domain containing 7							143.0	126.0	131.0					3																	196134252		1869	4099	5968	SO:0001583	missense	26043						protein binding	g.chr3:196134252C>T	AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.86G>A	3.37:g.196134252C>T	ENSP00000296328:p.Ser29Asn		Somatic				UBXN7_uc003fwn.3_Intron|UBXN7_uc010iae.2_Intron|UBXN7_uc010iaf.2_Missense_Mutation_p.S29N	p.S29N	NM_015562	NP_056377	WXS	Illumina HiSeq	Unspecified	O94888	UBXN7_HUMAN			2	161	-			29					D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	ENST00000296328.4	37	c.86G>A	CCDS43191.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385535	0.61956	.	.	ENSG00000163960	ENST00000296328	T	0.13657	2.57	5.46	5.46	0.80206	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.10895	0.0266	N	0.25957	0.775	0.80722	D	1	B	0.30824	0.296	B	0.19946	0.027	T	0.17992	-1.0351	10	0.22109	T	0.4	-11.0078	18.9054	0.92458	0.0:1.0:0.0:0.0	.	29	O94888	UBXN7_HUMAN	N	29	ENSP00000296328:S29N	ENSP00000296328:S29N	S	-	2	0	UBXN7	197618649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.415000	0.66411	2.558000	0.86282	0.650000	0.86243	AGT		0.378	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340938.2	XM_087353		9	61	0	0	0	0.004482	0	9	61				
CCKAR	886	broad.mit.edu	37	4	26490886	26490886	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr4:26490886G>T	ENST00000295589.3	-	2	527	c.333C>A	c.(331-333)agC>agA	p.S111R		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	111					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)			NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	TGCAAACGGCGCTCCCGAAGA	0.557																																							uc003gse.1		NA																	0				lung(3)|pancreas(1)	4						c.(331-333)AGC>AGA		cholecystokinin A receptor	Ceruletide(DB00403)						160.0	146.0	151.0					4																	26490886		2203	4300	6503	SO:0001583	missense	886				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity	g.chr4:26490886G>T	L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.333C>A	4.37:g.26490886G>T	ENSP00000295589:p.Ser111Arg		Somatic					p.S111R	NM_000730	NP_000721	WXS	Illumina HiSeq	Unspecified	P32238	CCKAR_HUMAN			2	486	-		Breast(46;0.0503)	111			Extracellular (Potential).		B2R9Z5	Missense_Mutation	SNP	ENST00000295589.3	37	c.333C>A	CCDS3438.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074322	0.36566	.	.	ENSG00000163394	ENST00000295589	T	0.71461	-0.57	5.24	-8.02	0.01118	GPCR, rhodopsin-like superfamily (1);	0.089227	0.85682	D	0.000000	T	0.69097	0.3073	L	0.39397	1.21	0.29230	N	0.873329	D	0.60575	0.988	P	0.61477	0.889	T	0.70385	-0.4886	10	0.14656	T	0.56	.	19.2035	0.93720	0.7454:0.0:0.2546:0.0	.	111	P32238	CCKAR_HUMAN	R	111	ENSP00000295589:S111R	ENSP00000295589:S111R	S	-	3	2	CCKAR	26099984	0.030000	0.19436	0.005000	0.12908	0.365000	0.29674	-0.520000	0.06252	-1.951000	0.01029	-0.254000	0.11334	AGC		0.557	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2			47	591	1	0	1.06522e-23	0.003214	1.72227e-23	47	591				
KLB	152831	broad.mit.edu	37	4	39408945	39408945	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr4:39408945G>T	ENST00000257408.4	+	1	473	c.376G>T	c.(376-378)Ggt>Tgt	p.G126C		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	126	Glycosyl hydrolase-1 1.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						CAGCACGAATGGTTCCAGTGA	0.388																																							uc003gua.2		NA																	0				skin(1)	1						c.(376-378)GGT>TGT		klotho beta							93.0	101.0	98.0					4																	39408945		2203	4300	6503	SO:0001583	missense	152831				carbohydrate metabolic process	integral to membrane|plasma membrane	cation binding|fibroblast growth factor binding|hydrolase activity, hydrolyzing O-glycosyl compounds	g.chr4:39408945G>T	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.376G>T	4.37:g.39408945G>T	ENSP00000257408:p.Gly126Cys		Somatic				KLB_uc011byj.1_Missense_Mutation_p.G126C	p.G126C	NM_175737	NP_783864	WXS	Illumina HiSeq	Unspecified	Q86Z14	KLOTB_HUMAN			1	473	+			126			Extracellular (Potential).|Glycosyl hydrolase-1 1.		Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	37	c.376G>T	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	G	10.90	1.482210	0.26598	.	.	ENSG00000134962	ENST00000257408	T	0.29397	1.57	4.7	2.73	0.32206	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.579568	0.17581	N	0.169128	T	0.26412	0.0645	L	0.36672	1.1	0.09310	N	1	D;D	0.58620	0.983;0.983	P;P	0.46362	0.514;0.514	T	0.09443	-1.0674	10	0.72032	D	0.01	-0.1323	7.2808	0.26310	0.3573:0.0:0.6427:0.0	.	126;126	B7ZL50;Q86Z14	.;KLOTB_HUMAN	C	126	ENSP00000257408:G126C	ENSP00000257408:G126C	G	+	1	0	KLB	39085340	0.463000	0.25799	0.003000	0.11579	0.441000	0.31987	3.417000	0.52714	0.265000	0.21872	0.467000	0.42956	GGT		0.388	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737		47	102	1	0	1.0331e-37	0.00361	1.7352e-37	47	102				
FRYL	285527	broad.mit.edu	37	4	48563563	48563563	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr4:48563563G>A	ENST00000503238.1	-	30	3786	c.3787C>T	c.(3787-3789)Ctc>Ttc	p.L1263F	FRYL_ENST00000358350.4_Missense_Mutation_p.L1263F|FRYL_ENST00000537810.1_Missense_Mutation_p.L1263F|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507711.1_Missense_Mutation_p.L1263F			O94915	FRYL_HUMAN	FRY-like	1263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ACAGAATAGAGATGTGGTAGA	0.438																																							uc003gyh.1		NA																	0				skin(1)	1						c.(3787-3789)CTC>TTC		furry-like							117.0	117.0	117.0					4																	48563563		1925	4127	6052	SO:0001583	missense	285527				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr4:48563563G>A	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.3787C>T	4.37:g.48563563G>A	ENSP00000426064:p.Leu1263Phe		Somatic				FRYL_uc003gyk.2_Missense_Mutation_p.L1263F|FRYL_uc003gyi.1_Missense_Mutation_p.L152F	p.L1263F	NM_015030	NP_055845	WXS	Illumina HiSeq	Unspecified	O94915	FRYL_HUMAN			33	4392	-			1263					O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	c.3787C>T	CCDS43227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.92|13.92	2.379702|2.379702	0.42207|0.42207	.|.	.|.	ENSG00000075539|ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711|ENST00000514617	T;T;T;T|.	0.46819|.	1.84;1.84;1.84;0.86|.	5.82|5.82	4.05|4.05	0.47172|0.47172	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63710|0.63710	0.2534|0.2534	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.997;0.995;0.999|.	D;D;D|.	0.79108|.	0.992;0.98;0.987|.	T|T	0.60444|0.60444	-0.7262|-0.7262	10|5	0.59425|.	D|.	0.04|.	.|.	9.3769|9.3769	0.38288|0.38288	0.3303:0.0:0.6697:0.0|0.3303:0.0:0.6697:0.0	.|.	1263;94;1263|.	F2Z2S2;Q6ZR29;O94915|.	.;.;FRYL_HUMAN|.	F|F	1263|133	ENSP00000426064:L1263F;ENSP00000351113:L1263F;ENSP00000441114:L1263F;ENSP00000421584:L1263F|.	ENSP00000351113:L1263F|.	L|S	-|-	1|2	0|0	FRYL|FRYL	48258320|48258320	1.000000|1.000000	0.71417|0.71417	0.930000|0.930000	0.37139|0.37139	0.010000|0.010000	0.07245|0.07245	3.366000|3.366000	0.52343|0.52343	0.731000|0.731000	0.32448|0.32448	0.655000|0.655000	0.94253|0.94253	CTC|TCT		0.438	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2			3	32	0	0	0	0.004672	0	3	32				
CEP135	9662	broad.mit.edu	37	4	56851486	56851486	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr4:56851486G>T	ENST00000257287.4	+	14	1943	c.1819G>T	c.(1819-1821)Gag>Tag	p.E607*		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	607					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)	p.E607Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					ATCAGAATTAGAGAAAACTAT	0.289																																							uc003hbi.2		NA																	1	Substitution - Missense(1)		breast(1)	ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(1819-1821)GAG>TAG		centrosome protein 4							78.0	87.0	84.0					4																	56851486		2199	4274	6473	SO:0001587	stop_gained	9662				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding	g.chr4:56851486G>T	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.1819G>T	4.37:g.56851486G>T	ENSP00000257287:p.Glu607*		Somatic				CEP135_uc003hbj.2_Nonsense_Mutation_p.E313*	p.E607*	NM_025009	NP_079285	WXS	Illumina HiSeq	Unspecified	Q66GS9	CP135_HUMAN			14	2053	+	Glioma(25;0.08)|all_neural(26;0.101)		607			Potential.		B2RMY0|O75130|Q58F25|Q9H8H7	Nonsense_Mutation	SNP	ENST00000257287.4	37	c.1819G>T	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	G	39	7.888050	0.98545	.	.	ENSG00000174799	ENST00000257287	.	.	.	5.17	5.17	0.71159	.	0.196579	0.52532	D	0.000077	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	.	14.9016	0.70684	0.0:0.0:1.0:0.0	.	.	.	.	X	607	.	ENSP00000257287:E607X	E	+	1	0	CEP135	56546243	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.422000	0.59854	2.793000	0.96121	0.591000	0.81541	GAG		0.289	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009		7	63	1	0	8.12818e-05	0.001984	9.22083e-05	7	63				
DKK2	27123	broad.mit.edu	37	4	107845182	107845182	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr4:107845182G>T	ENST00000285311.3	-	4	1414	c.709C>A	c.(709-711)Ctg>Atg	p.L237M	DKK2_ENST00000513208.1_Missense_Mutation_p.L137M|DKK2_ENST00000510463.1_Missense_Mutation_p.L191M	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	237	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		TTGCAAGACAGGCCCTTCGCA	0.488																																							uc003hyi.2		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(709-711)CTG>ATG		dickkopf homolog 2 precursor							158.0	145.0	150.0					4																	107845182		2203	4300	6503	SO:0001583	missense	27123				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space		g.chr4:107845182G>T	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.709C>A	4.37:g.107845182G>T	ENSP00000285311:p.Leu237Met		Somatic				DKK2_uc003hyj.1_3'UTR	p.L237M	NM_014421	NP_055236	WXS	Illumina HiSeq	Unspecified	Q9UBU2	DKK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)	4	1414	-		Hepatocellular(203;0.217)	237			DKK-type Cys-2.		A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	ENST00000285311.3	37	c.709C>A	CCDS3675.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365485	0.61513	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.69561	-0.41;-0.03;-0.24	5.64	2.98	0.34508	.	0.000000	0.85682	D	0.000000	T	0.77123	0.4084	M	0.66297	2.02	0.47123	D	0.999325	D	0.71674	0.998	D	0.77557	0.99	T	0.75926	-0.3145	10	0.87932	D	0	-15.2021	9.4925	0.38969	0.3414:0.0:0.6586:0.0	.	237	Q9UBU2	DKK2_HUMAN	M	237;137;191	ENSP00000285311:L237M;ENSP00000421255:L137M;ENSP00000423797:L191M	ENSP00000285311:L237M	L	-	1	2	DKK2	108064631	1.000000	0.71417	0.967000	0.41034	0.970000	0.65996	4.651000	0.61447	0.326000	0.23384	0.585000	0.79938	CTG		0.488	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4			18	69	1	0	2.35188e-11	0.006122	3.36261e-11	18	69				
NDST4	64579	broad.mit.edu	37	4	115856477	115856477	+	Missense_Mutation	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr4:115856477T>C	ENST00000264363.2	-	6	2099	c.1421A>G	c.(1420-1422)cAg>cGg	p.Q474R		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	474	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CCCACAAGTCTGTCGAGGGAG	0.403																																							uc003ibu.2		NA																	0				skin(3)|ovary(1)	4						c.(1420-1422)CAG>CGG		heparan sulfate N-deacetylase/N-sulfotransferase							131.0	130.0	131.0					4																	115856477		2203	4300	6503	SO:0001583	missense	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115856477T>C	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1421A>G	4.37:g.115856477T>C	ENSP00000264363:p.Gln474Arg		Somatic				NDST4_uc010imw.2_RNA	p.Q474R	NM_022569	NP_072091	WXS	Illumina HiSeq	Unspecified	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	6	2100	-		Ovarian(17;0.156)	474			Lumenal (Potential).|Heparan sulfate N-deacetylase 4.		Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	c.1421A>G	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.769077	0.90020	.	.	ENSG00000138653	ENST00000264363	T	0.52754	0.65	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.74846	0.3770	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.81735	-0.0797	10	0.87932	D	0	.	14.9199	0.70829	0.0:0.0:0.0:1.0	.	474	Q9H3R1	NDST4_HUMAN	R	474	ENSP00000264363:Q474R	ENSP00000264363:Q474R	Q	-	2	0	NDST4	116075926	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.985000	0.88162	1.912000	0.55364	0.482000	0.46254	CAG		0.403	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569		5	27	0	0	0	0.000602	0	5	27				
POU4F2	5458	broad.mit.edu	37	4	147561134	147561134	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr4:147561134C>T	ENST00000281321.3	+	2	652	c.404C>T	c.(403-405)cCc>cTc	p.P135L	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	135					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					CACCACAGCCCCTTCAAACCG	0.647																																							uc003ikv.2		NA																	0				breast(1)	1						c.(403-405)CCC>CTC		Brn3b POU domain transcription factor							116.0	147.0	136.0					4																	147561134		2203	4300	6503	SO:0001583	missense	5458				estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription	g.chr4:147561134C>T	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.404C>T	4.37:g.147561134C>T	ENSP00000281321:p.Pro135Leu		Somatic					p.P135L	NM_004575	NP_004566	WXS	Illumina HiSeq	Unspecified	Q12837	PO4F2_HUMAN			2	652	+	all_hematologic(180;0.151)		135					B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	ENST00000281321.3	37	c.404C>T	CCDS34074.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446135	0.63178	.	.	ENSG00000151615	ENST00000281321	T	0.25579	1.79	5.77	5.77	0.91146	.	0.141235	0.32459	N	0.006065	T	0.25121	0.0610	L	0.49778	1.585	0.80722	D	1	P	0.39250	0.665	B	0.29663	0.105	T	0.05068	-1.0908	10	0.62326	D	0.03	.	18.7641	0.91865	0.0:1.0:0.0:0.0	.	135	Q12837	PO4F2_HUMAN	L	135	ENSP00000281321:P135L	ENSP00000281321:P135L	P	+	2	0	POU4F2	147780584	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	7.744000	0.85034	2.729000	0.93468	0.467000	0.42956	CCC		0.647	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575		7	26	0	0	0	0.00308	0	7	26				
DCHS2	54798	broad.mit.edu	37	4	155219858	155219858	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr4:155219858C>A	ENST00000357232.4	-	18	4242	c.4243G>T	c.(4243-4245)Gga>Tga	p.G1415*		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1415	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TCAGTATTTCCATCTATTAAA	0.333																																							uc003inw.2		NA																	0				ovary(3)|pancreas(1)	4						c.(4243-4245)GGA>TGA		dachsous 2 isoform 1							46.0	51.0	49.0					4																	155219858		2203	4300	6503	SO:0001587	stop_gained	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155219858C>A	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.4243G>T	4.37:g.155219858C>A	ENSP00000349768:p.Gly1415*		Somatic					p.G1415*	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	18	4243	-	all_hematologic(180;0.208)	Renal(120;0.0854)	1415			Cadherin 12.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Nonsense_Mutation	SNP	ENST00000357232.4	37	c.4243G>T	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	44	10.627927	0.99440	.	.	ENSG00000197410	ENST00000357232	.	.	.	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.2786	0.98501	0.0:1.0:0.0:0.0	.	.	.	.	X	1415	.	ENSP00000349768:G1415X	G	-	1	0	DCHS2	155439308	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	6.883000	0.75595	2.868000	0.98415	0.557000	0.71058	GGA		0.333	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		8	39	1	0	3.86212e-05	0.008291	4.41021e-05	8	39				
MORF4	10934	broad.mit.edu	37	4	174537370	174537370	+	IGR	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr4:174537370C>A								RP11-475B2.1 (21663 upstream) : RP11-161D15.2 (280174 downstream)																							TAGCTGGGTGCCCAACATTAG	0.423																																							uc011cke.1		NA																	0					0						c.(424-426)GGC>GTC		mortality factor 4							186.0	199.0	195.0					4																	174537370		2202	4300	6502	SO:0001628	intergenic_variant	10934							g.chr4:174537370C>A																													4.37:g.174537370C>A			Somatic					p.G142V	NM_006792	NP_006783	WXS	Illumina HiSeq	Unspecified				all cancers(43;1.88e-18)|Epithelial(43;1.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)	1	425	-		Prostate(90;0.00201)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0765)|all_hematologic(60;0.107)							Missense_Mutation	SNP		37	c.425G>T																																																																																				0	0.423									43	132	1	0	2.00842e-17	0.002522	3.1444e-17	43	132				
AGA	175	broad.mit.edu	37	4	178355600	178355600	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr4:178355600C>A	ENST00000264595.2	-	7	869	c.742G>T	c.(742-744)Gac>Tac	p.D248Y	AGA_ENST00000506853.1_5'UTR	NM_000027.3|NM_001171988.1	NP_000018.2|NP_001165459.1	P20933	ASPG_HUMAN	aspartylglucosaminidase	248					protein deglycosylation (GO:0006517)|protein maturation (GO:0051604)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity (GO:0003948)|peptidase activity (GO:0008233)			endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|skin(2)	16		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)		GCAGTATCGTCAGCATAGGCT	0.463																																							uc003iuu.1		NA																	0					0						c.(742-744)GAC>TAC		aspartylglucosaminidase precursor							111.0	105.0	107.0					4																	178355600		2203	4300	6503	SO:0001583	missense	175				asparagine catabolic process via L-aspartate|protein deglycosylation|protein maturation	endoplasmic reticulum|intermediate filament cytoskeleton|lysosome|microtubule cytoskeleton	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity	g.chr4:178355600C>A	X55330	CCDS3829.1	4q34.3	2014-06-23			ENSG00000038002	ENSG00000038002	3.5.1.26		318	protein-coding gene	gene with protein product	"""glycosylasparaginase"", ""N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase"""	613228					Standard	NM_000027		Approved	ASRG	uc003iuu.2	P20933	OTTHUMG00000160723	ENST00000264595.2:c.742G>T	4.37:g.178355600C>A	ENSP00000264595:p.Asp248Tyr		Somatic				AGA_uc010irt.1_RNA|AGA_uc003iuv.1_3'UTR|AGA_uc003iuw.2_Missense_Mutation_p.D142Y	p.D248Y	NM_000027	NP_000018	WXS	Illumina HiSeq	Unspecified	P20933	ASPG_HUMAN		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)	7	804	-		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)	248					B2R7H2|D3DP47|Q4W5Q2|Q6FHN6|Q9UCK6|Q9UCK7|Q9UCK8	Missense_Mutation	SNP	ENST00000264595.2	37	c.742G>T	CCDS3829.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.540662	0.65085	.	.	ENSG00000038002	ENST00000264595;ENST00000502310	D;D	0.89270	-2.49;-2.49	5.68	5.68	0.88126	.	0.134095	0.64402	D	0.000003	D	0.96990	0.9017	H	0.98027	4.13	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98119	1.0424	10	0.87932	D	0	-24.2725	19.3909	0.94583	0.0:1.0:0.0:0.0	.	248	P20933	ASPG_HUMAN	Y	248;105	ENSP00000264595:D248Y;ENSP00000423798:D105Y	ENSP00000264595:D248Y	D	-	1	0	AGA	178592594	1.000000	0.71417	0.202000	0.23494	0.159000	0.22180	5.649000	0.67936	2.695000	0.91970	0.650000	0.86243	GAC		0.463	AGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361916.1	NM_000027		9	77	1	0	7.48243e-07	0.006214	9.34628e-07	9	77				
PRDM9	56979	broad.mit.edu	37	5	23524524	23524524	+	Silent	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:23524524C>T	ENST00000296682.3	+	10	1214	c.1032C>T	c.(1030-1032)tgC>tgT	p.C344C		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	344	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						ATAGAACCTGCCGAGTCATTA	0.547										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(1030-1032)TGC>TGT		PR domain containing 9							66.0	69.0	68.0					5																	23524524		1903	4111	6014	SO:0001819	synonymous_variant	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23524524C>T	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1032C>T	5.37:g.23524524C>T		HNSCC(3;0.000094)	Somatic					p.C344C	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			10	1214	+			344			SET.		B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	c.1032C>T	CCDS43307.1																																																																																				0.547	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		53	63	0	0	0	0.00361	0	53	63				
ADAMTS12	81792	broad.mit.edu	37	5	33549399	33549399	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:33549399G>T	ENST00000504830.1	-	21	4550	c.4215C>A	c.(4213-4215)tgC>tgA	p.C1405*	ADAMTS12_ENST00000352040.3_Nonsense_Mutation_p.C1320*	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1405	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CCAGGAACTGGCAGTGAAATG	0.612										HNSCC(64;0.19)																													uc003jia.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(4213-4215)TGC>TGA		ADAM metallopeptidase with thrombospondin type 1							78.0	83.0	81.0					5																	33549399		2203	4300	6503	SO:0001587	stop_gained	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33549399G>T	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4215C>A	5.37:g.33549399G>T	ENSP00000422554:p.Cys1405*	HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Nonsense_Mutation_p.C1320*	p.C1405*	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			21	4378	-			1405			TSP type-1 6.		A2RRN9|A5D6V6|Q6UWL3	Nonsense_Mutation	SNP	ENST00000504830.1	37	c.4215C>A	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	46	12.126440	0.99638	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	.	.	.	5.16	2.31	0.28768	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.898	0.29719	0.2705:0.0:0.7295:0.0	.	.	.	.	X	1405;1320	.	ENSP00000344847:C1320X	C	-	3	2	ADAMTS12	33585156	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.822000	0.39052	1.140000	0.42260	0.650000	0.86243	TGC		0.612	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		69	96	1	0	1.55545e-33	0.00361	2.57505e-33	69	96				
SLC45A2	51151	broad.mit.edu	37	5	33964012	33964012	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:33964012C>A	ENST00000296589.4	-	3	818	c.672G>T	c.(670-672)ttG>ttT	p.L224F	SLC45A2_ENST00000382102.3_Missense_Mutation_p.L224F|SLC45A2_ENST00000345083.5_Intron|SLC45A2_ENST00000342059.3_Missense_Mutation_p.L165F|SLC45A2_ENST00000509381.1_Intron	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	224					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						AAGTGAGCACCAATGCAGAGA	0.512																																					Ovarian(31;380 859 8490 22203 49048)	Ovarian(31;380 859 8490 22203 49048)	uc003jid.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(670-672)TTG>TTT		membrane-associated transporter protein isoform							115.0	113.0	114.0					5																	33964012		2203	4300	6503	SO:0001583	missense	51151				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane		g.chr5:33964012C>A	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.672G>T	5.37:g.33964012C>A	ENSP00000296589:p.Leu224Phe		Somatic				SLC45A2_uc003jie.2_Missense_Mutation_p.L224F|SLC45A2_uc003jif.3_Intron|SLC45A2_uc011coe.1_Intron	p.L224F	NM_016180	NP_057264	WXS	Illumina HiSeq	Unspecified	Q9UMX9	S45A2_HUMAN			3	764	-			224			Helical; Name=6; (Potential).		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000296589.4	37	c.672G>T	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638568	0.47153	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	D;D;D;D	0.95137	-3.62;-1.57;-3.62;-3.62	5.93	5.03	0.67393	Major facilitator superfamily domain, general substrate transporter (1);	0.068208	0.56097	D	0.000032	D	0.91054	0.7185	L	0.49699	1.58	0.80722	D	1	B;B	0.16603	0.014;0.018	B;B	0.28305	0.036;0.088	D	0.85812	0.1380	10	0.48119	T	0.1	-20.0624	5.3371	0.15963	0.1484:0.632:0.1432:0.0764	.	224;224	Q9UMX9-4;Q9UMX9	.;S45A2_HUMAN	F	224;165;224;49	ENSP00000296589:L224F;ENSP00000341014:L165F;ENSP00000371534:L224F;ENSP00000424010:L49F	ENSP00000296589:L224F	L	-	3	2	SLC45A2	33999769	0.998000	0.40836	0.694000	0.30210	0.528000	0.34623	0.878000	0.28126	2.814000	0.96858	0.563000	0.77884	TTG		0.512	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180		38	56	1	0	3.76114e-14	0.004289	5.70769e-14	38	56				
PLCXD3	345557	broad.mit.edu	37	5	41381978	41381978	+	Missense_Mutation	SNP	G	G	T	rs367634633		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:41381978G>T	ENST00000377801.3	-	2	836	c.762C>A	c.(760-762)agC>agA	p.S254R	PLCXD3_ENST00000328457.3_Missense_Mutation_p.S254R			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	254					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TGACCACAGTGCTAGCTTTGG	0.438																																							uc003jmm.1		NA																	0				skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						c.(760-762)AGC>AGA		phosphatidylinositol-specific phospholipase C, X		G	ARG/SER	0,4406		0,0,2203	83.0	88.0	86.0		762	4.3	1.0	5		86	1,8599	1.2+/-3.3	0,1,4299	no	missense	PLCXD3	NM_001005473.2	110	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign	254/322	41381978	1,13005	2203	4300	6503	SO:0001583	missense	345557				intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity	g.chr5:41381978G>T		CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.762C>A	5.37:g.41381978G>T	ENSP00000367032:p.Ser254Arg		Somatic					p.S254R	NM_001005473	NP_001005473	WXS	Illumina HiSeq	Unspecified	Q63HM9	PLCX3_HUMAN			2	864	-			254					A6NL04	Missense_Mutation	SNP	ENST00000377801.3	37	c.762C>A	CCDS34150.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299185	0.40694	0.0	1.16E-4	ENSG00000182836	ENST00000377801;ENST00000328457	.	.	.	6.07	4.28	0.50868	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.071420	0.85682	D	0.000000	T	0.46464	0.1394	N	0.10945	0.07	0.80722	D	1	D	0.61697	0.99	D	0.66497	0.944	T	0.23833	-1.0177	9	0.23302	T	0.38	-12.7713	8.9535	0.35803	0.2279:0.0:0.7721:0.0	.	254	Q63HM9	PLCX3_HUMAN	R	254	.	ENSP00000333751:S254R	S	-	3	2	PLCXD3	41417735	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.929000	0.40114	2.885000	0.99019	0.655000	0.94253	AGC		0.438	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367109.1	XM_293875		22	96	1	0	7.92952e-12	0.003954	1.14317e-11	22	96				
ERBB2IP	55914	broad.mit.edu	37	5	65349306	65349306	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:65349306C>G	ENST00000284037.5	+	21	2549	c.2160C>G	c.(2158-2160)ttC>ttG	p.F720L	ERBB2IP_ENST00000508515.1_Missense_Mutation_p.F720L|ERBB2IP_ENST00000416865.2_Intron|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.F720L|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.F720L|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.F720L|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.F720L|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.F720L|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.F716L|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.F720L	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	720					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		AGGAAAAGTTCAAAGCTCATG	0.289																																							uc003juk.1		NA																	0				ovary(3)|lung(2)|central_nervous_system(2)	7						c.(2158-2160)TTC>TTG		ERBB2 interacting protein isoform 2							60.0	70.0	67.0					5																	65349306		2201	4286	6487	SO:0001583	missense	55914				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton	g.chr5:65349306C>G		CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.2160C>G	5.37:g.65349306C>G	ENSP00000284037:p.Phe720Leu		Somatic				ERBB2IP_uc003jui.1_Missense_Mutation_p.F720L|ERBB2IP_uc003juj.1_Missense_Mutation_p.F720L|ERBB2IP_uc011cqx.1_Missense_Mutation_p.F720L|ERBB2IP_uc011cqy.1_Missense_Mutation_p.F720L|ERBB2IP_uc011cqz.1_Intron|ERBB2IP_uc010iwx.1_Missense_Mutation_p.F716L|ERBB2IP_uc003jul.1_Missense_Mutation_p.F716L	p.F720L	NM_018695	NP_061165	WXS	Illumina HiSeq	Unspecified	Q96RT1	LAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)	21	2468	+		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)	720					A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	ENST00000284037.5	37	c.2160C>G	CCDS58953.1	.	.	.	.	.	.	.	.	.	.	C	0.029	-1.349941	0.01266	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T	0.31510	1.67;1.67;1.67;1.87;1.49;1.74;1.67;1.7;1.49	4.88	3.97	0.46021	.	0.559808	0.18777	N	0.131445	T	0.12817	0.0311	N	0.14661	0.345	0.18873	N	0.999982	B;B;B;B;B;B;B	0.09022	0.0;0.0;0.0;0.0;0.002;0.0;0.001	B;B;B;B;B;B;B	0.12156	0.001;0.0;0.0;0.0;0.003;0.0;0.007	T	0.34625	-0.9821	10	0.05833	T	0.94	.	3.6661	0.08257	0.1742:0.5814:0.1479:0.0965	.	720;720;720;716;720;720;720	Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;LAP2_HUMAN;.;.	L	720;720;720;720;720;720;716;720;720	ENSP00000284037:F720L;ENSP00000370330:F720L;ENSP00000370326:F720L;ENSP00000370323:F720L;ENSP00000370322:F720L;ENSP00000370325:F720L;ENSP00000422766:F716L;ENSP00000426632:F720L;ENSP00000422015:F720L	ENSP00000284037:F720L	F	+	3	2	ERBB2IP	65385062	0.637000	0.27216	0.330000	0.25442	0.823000	0.46562	0.597000	0.24059	1.104000	0.41587	0.467000	0.42956	TTC		0.289	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	NM_018695		12	75	0	0	0	0.001368	0	12	75				
CARTPT	9607	broad.mit.edu	37	5	71015107	71015107	+	5'UTR	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:71015107C>T	ENST00000296777.4	+	0	118					NM_004291.3	NP_004282.1	Q16568	CART_HUMAN	CART prepropeptide						activation of MAPKK activity (GO:0000186)|adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|circadian regulation of gene expression (GO:0032922)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of appetite (GO:0032099)|negative regulation of bone resorption (GO:0045779)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of osteoclast differentiation (GO:0045671)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of epinephrine secretion (GO:0032812)|positive regulation of transmission of nerve impulse (GO:0051971)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|somatostatin secretion (GO:0070253)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|secretory granule (GO:0030141)				large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(167;0.00153)|Ovarian(174;0.0175)|Prostate(74;0.11)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;8.4e-56)	Amphetamine(DB00182)	CCAGCAACGACGAGTTTCAGA	0.652																																							uc003kbv.1		NA																	0				ovary(1)	1						c.(-15--11)GACGA>GATGA		cocaine- and amphetamine-regulated transcript	Amphetamine(DB00182)						56.0	58.0	58.0					5																	71015107		2203	4300	6503	SO:0001623	5_prime_UTR_variant	9607				activation of MAPKK activity|adult feeding behavior|cellular glucose homeostasis|cellular response to starvation|circadian regulation of gene expression|negative regulation of appetite|negative regulation of bone resorption|negative regulation of osteoclast differentiation|neuropeptide signaling pathway|positive regulation of blood pressure|positive regulation of epinephrine secretion|positive regulation of transmission of nerve impulse|synaptic transmission	extracellular space		g.chr5:71015107C>T	U16826	CCDS4011.1	5q13.2	2008-02-05			ENSG00000164326	ENSG00000164326			24323	protein-coding gene	gene with protein product	"""cocaine and amphetamine regulated transcript"""	602606				9590691, 8647455	Standard	NM_004291		Approved	CART	uc003kbv.2	Q16568	OTTHUMG00000131261	ENST00000296777.4:c.-14C>T	5.37:g.71015107C>T			Somatic						NM_004291	NP_004282	WXS	Illumina HiSeq	Unspecified	Q16568	CART_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;8.4e-56)	1	114	+		Lung NSC(167;0.00153)|Ovarian(174;0.0175)|Prostate(74;0.11)|Breast(144;0.198)						Q6FG92	Translation_Start_Site	SNP	ENST00000296777.4	37	c.-13C>T	CCDS4011.1																																																																																				0.652	CARTPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254029.2	NM_004291		13	66	0	0	0	0.001855	0	13	66				
ZNF366	167465	broad.mit.edu	37	5	71756824	71756824	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:71756824G>T	ENST00000318442.5	-	2	990	c.500C>A	c.(499-501)aCt>aAt	p.T167N		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	167					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		CAGGAATGGAGTGGGCGTTGG	0.642																																							uc003kce.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(499-501)ACT>AAT		zinc finger protein 366							104.0	110.0	108.0					5																	71756824		2203	4300	6503	SO:0001583	missense	167465				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr5:71756824G>T	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.500C>A	5.37:g.71756824G>T	ENSP00000313158:p.Thr167Asn		Somatic					p.T167N	NM_152625	NP_689838	WXS	Illumina HiSeq	Unspecified	Q8N895	ZN366_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)	2	686	-		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)	167					Q5HYI9|Q7RTV4	Missense_Mutation	SNP	ENST00000318442.5	37	c.500C>A	CCDS4015.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.664692	0.29604	.	.	ENSG00000178175	ENST00000318442	T	0.08102	3.13	5.92	5.92	0.95590	.	0.405202	0.23856	N	0.043898	T	0.06005	0.0156	N	0.08118	0	0.19575	N	0.999963	B	0.17667	0.023	B	0.15870	0.014	T	0.41124	-0.9526	10	0.15499	T	0.54	-4.0822	20.3206	0.98668	0.0:0.0:1.0:0.0	.	167	Q8N895	ZN366_HUMAN	N	167	ENSP00000313158:T167N	ENSP00000313158:T167N	T	-	2	0	ZNF366	71792580	1.000000	0.71417	0.007000	0.13788	0.005000	0.04900	9.420000	0.97426	2.813000	0.96785	0.561000	0.74099	ACT		0.642	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3			25	86	1	0	6.36457e-07	0.003954	8.03702e-07	25	86				
PAM	5066	broad.mit.edu	37	5	102326096	102326097	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:102326096_102326097GG>TT	ENST00000438793.3	+	15	2074_2075	c.1604_1605GG>TT	c.(1603-1605)tGG>tTT	p.W535F	PAM_ENST00000304400.7_Missense_Mutation_p.W535F|PAM_ENST00000455264.2_Missense_Mutation_p.W535F|PAM_ENST00000379787.4_5'UTR|PAM_ENST00000346918.2_Missense_Mutation_p.W535F|PAM_ENST00000348126.2_Missense_Mutation_p.W428F|PAM_ENST00000274392.9_Missense_Mutation_p.W438F	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	535	Peptidyl-alpha-hydroxyglycine alpha- amidating lyase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	GACCATGTCTGGGATGGAAAGT	0.371																																							uc003knw.2		NA																	0					0						c.(1603-1605)TGG>TTT		peptidylglycine alpha-amidating monooxygenase	Vitamin C(DB00126)																																			SO:0001583	missense	5066				peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding	g.chr5:102326096_102326097GG>TT	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	Exception_encountered	5.37:g.102326096_102326097delinsTT	ENSP00000396493:p.Trp535Phe		Somatic				PAM_uc003kns.2_Missense_Mutation_p.W428F|PAM_uc003knt.2_Missense_Mutation_p.W535F|PAM_uc003knu.2_Missense_Mutation_p.W535F|PAM_uc003knv.2_Missense_Mutation_p.W535F|PAM_uc011cuz.1_Missense_Mutation_p.W438F|PAM_uc003knx.1_Missense_Mutation_p.W138F	p.W535F	NM_000919	NP_000910	WXS	Illumina HiSeq	Unspecified	P19021	AMD_HUMAN		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	15	1977_1978	+		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)	535			Peptidyl-alpha-hydroxyglycine alpha- amidating lyase (By similarity).|NHL 1.|Intragranular (Potential).		A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	DNP	ENST00000438793.3	37	c.1604_1605GG>TT	CCDS54885.1																																																																																				0.371	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919		3	17	0	0	0	0.004672	0	3	17				
PRR16	51334	broad.mit.edu	37	5	120021716	120021716	+	Missense_Mutation	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:120021716A>T	ENST00000407149.2	+	2	436	c.227A>T	c.(226-228)aAa>aTa	p.K76I	PRR16_ENST00000505123.1_Missense_Mutation_p.K6I|PRR16_ENST00000446965.1_Missense_Mutation_p.K6I|PRR16_ENST00000379551.2_Missense_Mutation_p.K53I			Q569H4	LARGN_HUMAN	proline rich 16	76					positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		GACAGCTCCAAAACGGACACG	0.493																																							uc003ksq.2		NA																	0				pancreas(2)|ovary(1)	3						c.(226-228)AAA>ATA		proline rich 16							108.0	99.0	102.0					5																	120021716		2203	4300	6503	SO:0001583	missense	51334							g.chr5:120021716A>T	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.227A>T	5.37:g.120021716A>T	ENSP00000385118:p.Lys76Ile		Somatic				PRR16_uc003ksp.2_Missense_Mutation_p.K53I|PRR16_uc003ksr.2_Missense_Mutation_p.K6I	p.K76I	NM_016644	NP_057728	WXS	Illumina HiSeq	Unspecified	Q569H4	PRR16_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)	2	390	+		all_cancers(142;0.0464)|Prostate(80;0.00446)	76					D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	ENST00000407149.2	37	c.227A>T		.	.	.	.	.	.	.	.	.	.	A	20.8	4.044392	0.75732	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000509923;ENST00000505123;ENST00000446965	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.64461	0.2600	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64054	-0.6497	9	.	.	.	-7.7073	14.5163	0.67821	1.0:0.0:0.0:0.0	.	76;53	Q569H4;Q569H4-3	PRR16_HUMAN;.	I	76;53;6;6;6	ENSP00000385118:K76I;ENSP00000368869:K53I;ENSP00000421256:K6I;ENSP00000423446:K6I;ENSP00000405491:K6I	.	K	+	2	0	PRR16	120049615	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.093000	0.76937	2.076000	0.62316	0.454000	0.30748	AAA		0.493	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644		10	42	0	0	0	0.008291	0	10	42				
SLC22A4	6583	broad.mit.edu	37	5	131630391	131630391	+	Missense_Mutation	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:131630391A>G	ENST00000200652.3	+	1	256	c.82A>G	c.(82-84)Agc>Ggc	p.S28G	P4HA2_ENST00000471826.1_Intron	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	28					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	GCTCAGCGCCAGCATCATCCC	0.657																																							uc003kwq.2		NA																	0					0						c.(82-84)AGC>GGC		solute carrier family 22 member 4	L-Carnitine(DB00583)						67.0	76.0	73.0					5																	131630391		2203	4300	6503	SO:0001583	missense	6583				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity	g.chr5:131630391A>G	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.82A>G	5.37:g.131630391A>G	ENSP00000200652:p.Ser28Gly		Somatic				uc003kwm.3_Intron|SLC22A4_uc010jdq.1_5'Flank	p.S28G	NM_003059	NP_003050	WXS	Illumina HiSeq	Unspecified	Q9H015	S22A4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		1	247	+		all_cancers(142;0.0752)|Breast(839;0.198)	28			Helical; Name=1; (Potential).		O14546	Missense_Mutation	SNP	ENST00000200652.3	37	c.82A>G	CCDS4153.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.358301	0.82243	.	.	ENSG00000197208	ENST00000200652	D	0.82255	-1.59	4.45	4.45	0.53987	Major facilitator superfamily domain, general substrate transporter (1);	0.136711	0.64402	D	0.000004	D	0.86715	0.5999	M	0.85462	2.755	0.40301	D	0.978613	P	0.40602	0.723	P	0.44946	0.465	D	0.88172	0.2865	10	0.44086	T	0.13	.	14.1531	0.65401	1.0:0.0:0.0:0.0	.	28	Q9H015	S22A4_HUMAN	G	28	ENSP00000200652:S28G	ENSP00000200652:S28G	S	+	1	0	SLC22A4	131658290	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.454000	0.60068	1.994000	0.58287	0.402000	0.26972	AGC		0.657	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059		10	41	0	0	0	0.000978	0	10	41				
DCANP1	140947	broad.mit.edu	37	5	134785609	134785609	+	5'Flank	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:134785609G>T	ENST00000503143.2	-	0	0				CTB-138E5.1_ENST00000510230.1_RNA|TIFAB_ENST00000537858.1_Silent_p.V7V	NM_130848.2	NP_570900.1	Q8TF63	DCNP1_HUMAN								nucleus (GO:0005634)				endometrium(1)|lung(1)|prostate(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCACTCGCAGGACGGTGAGGG	0.602																																							uc003law.3		NA																	0					0						c.(19-21)GTC>GTA		TIFA-related protein TIFAB							74.0	82.0	80.0					5																	134785609		2110	4225	6335	SO:0001631	upstream_gene_variant	497189							g.chr5:134785609G>T																													5.37:g.134785609G>T	Exception_encountered		Somatic				C5orf20_uc003lav.2_5'Flank	p.V7V	NM_001099221	NP_001092691	WXS	Illumina HiSeq	Unspecified	Q6ZNK6	TIFAB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		2	222	-			7						Silent	SNP	ENST00000503143.2	37	c.21C>A	CCDS4186.1																																																																																				0.602	C5orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372531.1			16	58	1	0	5.3912e-06	0.006122	6.52223e-06	16	58				
CDC25C	995	broad.mit.edu	37	5	137627777	137627777	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:137627777G>T	ENST00000323760.6	-	8	922	c.644C>A	c.(643-645)cCg>cAg	p.P215Q	CDC25C_ENST00000415130.2_Missense_Mutation_p.P142Q|CDC25C_ENST00000357274.3_Missense_Mutation_p.P172Q|CDC25C_ENST00000348983.3_Missense_Mutation_p.P142Q|CDC25C_ENST00000513970.1_Missense_Mutation_p.P215Q|CDC25C_ENST00000356505.3_Missense_Mutation_p.P185Q|CDC25C_ENST00000514555.1_Missense_Mutation_p.P185Q	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	215					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TGGCATCGACGGGGAGCGATA	0.443																																							uc003lcp.1		NA																	0				lung(3)	3						c.(643-645)CCG>CAG		cell division cycle 25C isoform a							136.0	141.0	139.0					5																	137627777		2203	4300	6503	SO:0001583	missense	995				cell cycle checkpoint|cell division|cell proliferation|DNA replication|G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of mitosis|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm	protein tyrosine phosphatase activity|WW domain binding	g.chr5:137627777G>T	M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.644C>A	5.37:g.137627777G>T	ENSP00000321656:p.Pro215Gln		Somatic				CDC25C_uc003lcq.1_Missense_Mutation_p.P142Q|CDC25C_uc003lcr.1_Missense_Mutation_p.P215Q|CDC25C_uc011cyp.1_Missense_Mutation_p.P232Q|CDC25C_uc003lcs.1_Missense_Mutation_p.P293Q	p.P215Q	NM_001790	NP_001781	WXS	Illumina HiSeq	Unspecified	P30307	MPIP3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)		8	915	-			215					D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	ENST00000323760.6	37	c.644C>A	CCDS4202.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881640	0.33255	.	.	ENSG00000158402	ENST00000323760;ENST00000356505;ENST00000357274;ENST00000348983;ENST00000415130;ENST00000513970;ENST00000534892;ENST00000514555;ENST00000503022	T;T;T;T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16	3.09	2.22	0.28083	.	0.151094	0.41097	D	0.000956	T	0.43010	0.1228	L	0.50333	1.59	0.34355	D	0.690342	P;P;D;P	0.53151	0.742;0.742;0.958;0.782	B;B;P;B	0.54706	0.32;0.242;0.759;0.355	T	0.58819	-0.7569	10	0.87932	D	0	-0.8414	9.9249	0.41485	0.1089:0.0:0.8911:0.0	.	232;185;142;215	G3V1P6;P30307-2;P30307-4;P30307	.;.;.;MPIP3_HUMAN	Q	215;185;172;142;142;215;232;185;215	ENSP00000321656:P215Q;ENSP00000348898:P185Q;ENSP00000349821:P172Q;ENSP00000345205:P142Q;ENSP00000392631:P142Q;ENSP00000424795:P215Q;ENSP00000425470:P185Q;ENSP00000427251:P215Q	ENSP00000321656:P215Q	P	-	2	0	CDC25C	137655676	0.985000	0.35326	0.570000	0.28473	0.294000	0.27393	1.920000	0.40025	0.858000	0.35431	0.557000	0.71058	CCG		0.443	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251280.1			22	87	1	0	2.70639e-06	0.002299	3.32061e-06	22	87				
ITK	3702	broad.mit.edu	37	5	156671307	156671307	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:156671307G>T	ENST00000422843.3	+	13	1420	c.1268G>T	c.(1267-1269)gGg>gTg	p.G423V	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	423	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CAGCTGTATGGGGTGTGCCTG	0.522			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)	Esophageal Squamous(70;1378 1469 8785 19883)	uc003lwo.1		NA		Dom	yes		5	5q31-q32	3702	T	IL2-inducible T-cell kinase			L	SYK		peripheral T-cell lymphoma		0				lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26						c.(1267-1269)GGG>GTG		IL2-inducible T-cell kinase							75.0	74.0	74.0					5																	156671307		2203	4300	6503	SO:0001583	missense	3702				cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr5:156671307G>T	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1268G>T	5.37:g.156671307G>T	ENSP00000398655:p.Gly423Val		Somatic					p.G423V	NM_005546	NP_005537	WXS	Illumina HiSeq	Unspecified	Q08881	ITK_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		13	1350	+	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	423			Protein kinase.		B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	c.1268G>T	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406730	0.83230	.	.	ENSG00000113263	ENST00000422843	D	0.89123	-2.47	6.08	6.08	0.98989	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.099746	0.64402	D	0.000002	D	0.96993	0.9018	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97459	1.0033	10	0.87932	D	0	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	423	Q08881	ITK_HUMAN	V	423	ENSP00000398655:G423V	ENSP00000398655:G423V	G	+	2	0	ITK	156603885	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	6.504000	0.73704	2.894000	0.99253	0.591000	0.81541	GGG		0.522	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			9	42	1	0	3.07112e-06	0.000978	3.75479e-06	9	42				
ATP10B	23120	broad.mit.edu	37	5	160025868	160025868	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:160025868G>T	ENST00000327245.5	-	22	4319	c.3473C>A	c.(3472-3474)cCt>cAt	p.P1158H		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1158					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GACAAGAGGAGGCAAGGAGGT	0.458																																							uc003lym.1		NA																	0				ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(3472-3474)CCT>CAT		ATPase, class V, type 10B							180.0	174.0	176.0					5																	160025868		1955	4146	6101	SO:0001583	missense	23120				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr5:160025868G>T	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.3473C>A	5.37:g.160025868G>T	ENSP00000313600:p.Pro1158His		Somatic				ATP10B_uc010jit.1_Intron	p.P1158H	NM_025153	NP_079429	WXS	Illumina HiSeq	Unspecified	O94823	AT10B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		22	4320	-	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	1158			Helical; (Potential).		Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	c.3473C>A	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759113	0.89843	.	.	ENSG00000118322	ENST00000327245	D	0.81996	-1.56	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.95736	0.8613	H	0.99682	4.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97960	1.0337	9	.	.	.	.	18.2403	0.89966	0.0:0.0:1.0:0.0	.	1158	O94823	AT10B_HUMAN	H	1158	ENSP00000313600:P1158H	.	P	-	2	0	ATP10B	159958446	1.000000	0.71417	0.941000	0.38009	0.977000	0.68977	9.751000	0.98889	2.542000	0.85734	0.655000	0.94253	CCT		0.458	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153		43	107	1	0	6.5261e-18	0.00874	1.03106e-17	43	107				
GABRA1	2554	broad.mit.edu	37	5	161300189	161300189	+	Missense_Mutation	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:161300189A>G	ENST00000428797.2	+	6	677	c.322A>G	c.(322-324)Atg>Gtg	p.M108V	GABRA1_ENST00000393943.4_Missense_Mutation_p.M108V|GABRA1_ENST00000420560.1_Missense_Mutation_p.M108V|GABRA1_ENST00000437025.2_Missense_Mutation_p.M108V|GABRA1_ENST00000023897.6_Missense_Mutation_p.M108V|GABRA1_ENST00000444819.1_Missense_Mutation_p.M108V	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	108					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	TAAAGGACCTATGACAGTCCT	0.383																																							uc010jiw.2		NA																	0				ovary(2)|pancreas(1)	3						c.(322-324)ATG>GTG		gamma-aminobutyric acid (GABA) A receptor, alpha	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)						86.0	90.0	88.0					5																	161300189		2203	4300	6503	SO:0001583	missense	2554				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr5:161300189A>G		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.322A>G	5.37:g.161300189A>G	ENSP00000393097:p.Met108Val		Somatic				GABRA1_uc010jix.2_Missense_Mutation_p.M108V|GABRA1_uc010jiy.2_Missense_Mutation_p.M108V|GABRA1_uc003lyx.3_Missense_Mutation_p.M108V|GABRA1_uc010jiz.2_Missense_Mutation_p.M108V|GABRA1_uc010jja.2_Missense_Mutation_p.M108V|GABRA1_uc010jjb.2_Missense_Mutation_p.M108V	p.M108V	NM_000806	NP_000797	WXS	Illumina HiSeq	Unspecified	P14867	GBRA1_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	6	790	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	108			Extracellular (Probable).		D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	c.322A>G	CCDS4357.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.005624	0.54254	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819;ENST00000519621	T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.85	5.85	0.93711	Neurotransmitter-gated ion-channel ligand-binding (3);	0.077821	0.85682	D	0.000000	T	0.73606	0.3608	L	0.47190	1.495	0.80722	D	1	B	0.06786	0.001	B	0.16289	0.015	T	0.68777	-0.5319	10	0.46703	T	0.11	.	16.2365	0.82377	1.0:0.0:0.0:0.0	.	108	P14867	GBRA1_HUMAN	V	108	ENSP00000023897:M108V;ENSP00000393097:M108V;ENSP00000377517:M108V;ENSP00000415441:M108V;ENSP00000408041:M108V;ENSP00000414232:M108V;ENSP00000430435:M108V	ENSP00000023897:M108V	M	+	1	0	GABRA1	161232767	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.228000	0.95250	2.238000	0.73509	0.477000	0.44152	ATG		0.383	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5		11	67	0	0	0	0.000978	0	11	67				
TENM2	57451	broad.mit.edu	37	5	167674702	167674702	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:167674702G>T	ENST00000518659.1	+	27	6797	c.6758G>T	c.(6757-6759)cGg>cTg	p.R2253L	TENM2_ENST00000545108.1_Missense_Mutation_p.R2252L|TENM2_ENST00000403607.2_Missense_Mutation_p.R2077L|TENM2_ENST00000520394.1_Missense_Mutation_p.R2014L|TENM2_ENST00000519204.1_Missense_Mutation_p.R2132L	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2253					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CTCCGGGATCGGATAACCAGA	0.532																																							uc010jjd.2		NA																	0				ovary(6)|central_nervous_system(4)	10						c.(6730-6732)CGG>CTG		odz, odd Oz/ten-m homolog 2							52.0	54.0	53.0					5																	167674702		2133	4245	6378	SO:0001583	missense	57451							g.chr5:167674702G>T	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6758G>T	5.37:g.167674702G>T	ENSP00000429430:p.Arg2253Leu		Somatic				ODZ2_uc003lzr.3_Missense_Mutation_p.R2014L|ODZ2_uc003lzt.3_Missense_Mutation_p.R1617L|ODZ2_uc010jje.2_Missense_Mutation_p.R1508L	p.R2244L	NM_001122679	NP_001116151	WXS	Illumina HiSeq	Unspecified			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	27	6731	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37	c.6731G>T		.	.	.	.	.	.	.	.	.	.	G	24.1	4.493662	0.84962	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.91843	-2.43;-2.42;-2.55;-2.89;-2.92	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.97077	0.9045	M	0.91090	3.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.91635	0.999;0.999;0.986	D	0.97241	0.9891	10	0.59425	D	0.04	.	19.5848	0.95486	0.0:0.0:1.0:0.0	.	2252;2253;2014	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	L	2253;2252;2132;2014;2077	ENSP00000429430:R2253L;ENSP00000438635:R2252L;ENSP00000428964:R2132L;ENSP00000427874:R2014L;ENSP00000384905:R2077L	ENSP00000384905:R2077L	R	+	2	0	ODZ2	167607280	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	9.869000	0.99810	2.636000	0.89361	0.561000	0.74099	CGG		0.532	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		17	40	1	0	4.75885e-15	0.00499	7.41694e-15	17	40				
ZNF454	285676	broad.mit.edu	37	5	178392679	178392679	+	Nonsense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:178392679C>G	ENST00000320129.3	+	5	1577	c.1274C>G	c.(1273-1275)tCa>tGa	p.S425*	ZNF454_ENST00000519564.1_Nonsense_Mutation_p.S425*	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	425					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		CGGGACCAATCAGCACTAGCC	0.433																																							uc003mjo.1		NA																	0				ovary(2)|lung(1)	3						c.(1273-1275)TCA>TGA		zinc finger protein 454							73.0	74.0	74.0					5																	178392679		2203	4300	6503	SO:0001587	stop_gained	285676				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr5:178392679C>G	AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.1274C>G	5.37:g.178392679C>G	ENSP00000326249:p.Ser425*		Somatic				ZNF454_uc010jkz.1_Nonsense_Mutation_p.S425*	p.S425*	NM_182594	NP_872400	WXS	Illumina HiSeq	Unspecified	Q8N9F8	ZN454_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)	5	1545	+	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	425			C2H2-type 9.		Q2M1P2|Q2M323	Nonsense_Mutation	SNP	ENST00000320129.3	37	c.1274C>G	CCDS4441.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880601	0.72294	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	.	.	.	4.25	3.3	0.37823	.	0.000000	0.34025	N	0.004321	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-4.5465	11.9313	0.52847	0.0:0.8224:0.1776:0.0	.	.	.	.	X	425	.	ENSP00000326249:S425X	S	+	2	0	ZNF454	178325285	0.000000	0.05858	0.986000	0.45419	0.006000	0.05464	0.491000	0.22419	2.367000	0.80283	0.650000	0.86243	TCA		0.433	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253476.2	XM_209718		9	26	0	0	0	0.004482	0	9	26				
OR2V2	285659	broad.mit.edu	37	5	180582665	180582665	+	Silent	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr5:180582665C>T	ENST00000328275.1	+	1	723	c.723C>T	c.(721-723)acC>acT	p.T241T		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCTGGCCACCTGCTCCTCCC	0.577																																							uc011dhj.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(721-723)ACC>ACT		olfactory receptor, family 2, subfamily V,							116.0	112.0	114.0					5																	180582665		2203	4300	6503	SO:0001819	synonymous_variant	285659				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr5:180582665C>T	AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.723C>T	5.37:g.180582665C>T			Somatic					p.T241T	NM_206880	NP_996763	WXS	Illumina HiSeq	Unspecified	Q96R30	OR2V2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		1	723	+	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	241			Helical; Name=6; (Potential).		Q6IFL6|Q8NGV1	Silent	SNP	ENST00000328275.1	37	c.723C>T	CCDS4461.1																																																																																				0.577	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253529.1			14	76	0	0	0	0.00245	0	14	76				
RREB1	6239	broad.mit.edu	37	6	7229815	7229815	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:7229815G>T	ENST00000349384.6	+	10	1797	c.1483G>T	c.(1483-1485)Gcc>Tcc	p.A495S	RREB1_ENST00000379938.2_Missense_Mutation_p.A495S|RREB1_ENST00000379933.3_Missense_Mutation_p.A495S|RREB1_ENST00000334984.6_Missense_Mutation_p.A495S	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	495	Pro-rich.				multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GGCCCCTGCCGCCCCACTGCA	0.642																																							uc003mxc.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11						c.(1483-1485)GCC>TCC		ras responsive element binding protein 1 isoform							123.0	142.0	136.0					6																	7229815		2203	4297	6500	SO:0001583	missense	6239				multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding	g.chr6:7229815G>T	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.1483G>T	6.37:g.7229815G>T	ENSP00000305560:p.Ala495Ser		Somatic				RREB1_uc003mxb.2_Missense_Mutation_p.A495S|RREB1_uc010jnx.2_Missense_Mutation_p.A495S	p.A495S	NM_001003698	NP_001003698	WXS	Illumina HiSeq	Unspecified	Q92766	RREB1_HUMAN			10	1873	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	495			Pro-rich.		A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	c.1483G>T	CCDS34336.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.139003	0.00335	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984;ENST00000483150	T;T;T;T;T	0.10477	3.0;2.97;3.0;2.87;2.96	5.67	-6.29	0.02013	.	1.316200	0.05044	N	0.476932	T	0.01661	0.0053	N	0.12182	0.205	0.09310	N	1	B;B;B	0.18863	0.021;0.031;0.001	B;B;B	0.21360	0.034;0.025;0.003	T	0.41324	-0.9515	10	0.08837	T	0.75	-10.8702	16.9267	0.86178	0.7835:0.0:0.2165:0.0	.	495;495;495	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	S	495	ENSP00000369265:A495S;ENSP00000369270:A495S;ENSP00000305560:A495S;ENSP00000335574:A495S;ENSP00000419511:A495S	ENSP00000335574:A495S	A	+	1	0	RREB1	7174814	0.000000	0.05858	0.000000	0.03702	0.301000	0.27625	0.032000	0.13732	-1.285000	0.02387	-1.069000	0.02264	GCC		0.642	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1			27	502	1	0	6.07407e-21	0.007291	9.77502e-21	27	502				
ATXN1	6310	broad.mit.edu	37	6	16327906	16327906	+	Missense_Mutation	SNP	C	C	A	rs376233432		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:16327906C>A	ENST00000244769.4	-	8	1572	c.636G>T	c.(634-636)caG>caT	p.Q212H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q212H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	212	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgatgctgat	0.672																																							uc003nbt.2		NA																	0				skin(3)|central_nervous_system(1)	4						c.(634-636)CAG>CAT		ataxin 1							5.0	8.0	7.0					6																	16327906		1594	3492	5086	SO:0001583	missense	6310				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association	g.chr6:16327906C>A	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.636G>T	6.37:g.16327906C>A	ENSP00000244769:p.Gln212His		Somatic				ATXN1_uc010jpi.2_Missense_Mutation_p.Q212H|ATXN1_uc010jpj.1_Intron	p.Q212H	NM_000332	NP_000323	WXS	Illumina HiSeq	Unspecified	P54253	ATX1_HUMAN			8	1607	-	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)	212			Poly-Gln.		Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	c.636G>T	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	C	5.858	0.342494	0.11069	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.57752	0.38;0.38	.	.	.	.	.	.	.	.	T	0.12689	0.0308	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.21552	-1.0242	5	0.49607	T	0.09	.	.	.	.	.	212	P54253	ATX1_HUMAN	H	212	ENSP00000244769:Q212H;ENSP00000416360:Q212H	ENSP00000244769:Q212H	Q	-	3	2	ATXN1	16435885	0.148000	0.22702	0.022000	0.16811	0.070000	0.16714	0.333000	0.19768	0.000000	0.14550	0.000000	0.15137	CAG		0.672	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332		3	19	1	0	0.004672	0.004672	0.00500468	3	19				
HIST1H3C	8352	broad.mit.edu	37	6	26045648	26045648	+	Missense_Mutation	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:26045648A>G	ENST00000540144.1	+	1	10	c.10A>G	c.(10-12)Acg>Gcg	p.T4A	HIST1H2BB_ENST00000357905.2_5'Flank	NM_003531.2	NP_003522.1	P68431	H31_HUMAN	histone cluster 1, H3c	4					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|skin(1)	8						AATGGCTCGTACGAAGCAAAC	0.502																																							uc003nfv.2		NA																	0				ovary(1)	1						c.(10-12)ACG>GCG		histone cluster 1, H3c							49.0	52.0	51.0					6																	26045648		2203	4298	6501	SO:0001583	missense	8352				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26045648A>G	X57128	CCDS4576.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196532	ENSG00000278272		"""Histones / Replication-dependent"""	4768	protein-coding gene	gene with protein product		602812	"""H3 histone family, member C"", ""histone 1, H3c"""	H3FC		8227173, 9119399, 12408966	Standard	NM_003531		Approved	H3/c, H3.1	uc003nfv.3	P68431	OTTHUMG00000014416	ENST00000540144.1:c.10A>G	6.37:g.26045648A>G	ENSP00000439493:p.Thr4Ala		Somatic				HIST1H2BB_uc003nfu.2_5'Flank	p.T4A	NM_003531	NP_003522	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	10	+			4					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000540144.1	37	c.10A>G	CCDS4576.1	.	.	.	.	.	.	.	.	.	.	A	9.093	1.002116	0.19121	.	.	ENSG00000196532	ENST00000540144	T	0.45276	0.9	4.67	4.67	0.58626	.	.	.	.	.	T	0.49115	0.1538	.	.	.	0.40475	D	0.980386	.	.	.	.	.	.	T	0.56288	-0.8004	6	0.87932	D	0	.	13.9855	0.64331	1.0:0.0:0.0:0.0	.	.	.	.	A	4	ENSP00000439493:T4A	ENSP00000439493:T4A	T	+	1	0	HIST1H3C	26153627	1.000000	0.71417	0.826000	0.32828	0.156000	0.22039	9.175000	0.94831	2.045000	0.60652	0.482000	0.46254	ACG		0.502	HIST1H3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040078.1	NM_003531		12	67	0	0	0	0.001855	0	12	67				
HIST1H1T	3010	broad.mit.edu	37	6	26107828	26107828	+	Missense_Mutation	SNP	C	C	T	rs143795730		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:26107828C>T	ENST00000338379.4	-	1	536	c.494G>A	c.(493-495)aGg>aAg	p.R165K		NM_005323.3	NP_005314.2	P22492	H1T_HUMAN	histone cluster 1, H1t	165					binding of sperm to zona pellucida (GO:0007339)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|nucleosome assembly (GO:0006334)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(1)|lung(3)|ovary(2)|prostate(1)	9						TCTCCCGCTCCTAACAGTTTT	0.478																																							uc003ngj.2		NA																	0				ovary(2)	2						c.(493-495)AGG>AAG		histone cluster 1, H1t		C	LYS/ARG	1,4405		0,1,2202	133.0	127.0	129.0		494	-1.9	0.0	6	dbSNP_134	129	0,8600		0,0,4300	no	missense	HIST1H1T	NM_005323.3	26	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	165/208	26107828	1,13005	2203	4300	6503	SO:0001583	missense	3010				cell differentiation|multicellular organismal development|nucleosome assembly|spermatogenesis	nucleosome	DNA binding	g.chr6:26107828C>T	M60094	CCDS34349.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000187475	ENSG00000187475		"""Histones / Replication-dependent"""	4720	protein-coding gene	gene with protein product		142712	"""H1 histone family, member T (testis-specific)"", ""histone 1, H1t"""	H1FT		8175896, 12408966	Standard	NM_005323		Approved	H1t	uc003ngj.3	P22492	OTTHUMG00000014430	ENST00000338379.4:c.494G>A	6.37:g.26107828C>T	ENSP00000341214:p.Arg165Lys		Somatic					p.R165K	NM_005323	NP_005314	WXS	Illumina HiSeq	Unspecified	P22492	H1T_HUMAN			1	537	-			165					Q6ISI1|Q8IUE8	Missense_Mutation	SNP	ENST00000338379.4	37	c.494G>A	CCDS34349.1	.	.	.	.	.	.	.	.	.	.	.	5.573	0.290549	0.10567	2.27E-4	0.0	ENSG00000187475	ENST00000338379	T	0.02944	4.1	5.08	-1.89	0.07689	.	0.392209	0.24330	N	0.039466	T	0.00328	0.0010	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39941	-0.9589	10	0.02654	T	1	-6.7889	5.4013	0.16297	0.0:0.1956:0.2945:0.5099	.	165	P22492	H1T_HUMAN	K	165	ENSP00000341214:R165K	ENSP00000341214:R165K	R	-	2	0	HIST1H1T	26215807	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.366000	0.07563	-0.242000	0.09667	-1.583000	0.00853	AGG		0.478	HIST1H1T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040093.2	NM_005323		16	146	0	0	0	0.00499	0	16	146				
HIST1H2AL	8332	broad.mit.edu	37	6	27833185	27833185	+	Missense_Mutation	SNP	G	G	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:27833185G>C	ENST00000357320.2	+	1	152	c.53G>C	c.(52-54)cGc>cCc	p.R18P		NM_003511.2	NP_003502.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2al	18						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(2)	9						GCCAAGACCCGCTCTTCTCGT	0.632																																							uc003njw.2		NA																	0					0						c.(52-54)CGC>CCC		histone cluster 1, H2al							77.0	87.0	84.0					6																	27833185		2203	4300	6503	SO:0001583	missense	8332				nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding	g.chr6:27833185G>C	X83549	CCDS4634.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198374	ENSG00000276903		"""Histones / Replication-dependent"""	4730	protein-coding gene	gene with protein product		602793	"""H2A histone family, member I"", ""histone 1, H2al"""	H2AFI		9439656, 9031620, 12408966	Standard	NM_003511		Approved	H2A/i, dJ193B12.9	uc003njw.3	P0C0S8	OTTHUMG00000014492	ENST00000357320.2:c.53G>C	6.37:g.27833185G>C	ENSP00000349873:p.Arg18Pro		Somatic					p.R18P	NM_003511	NP_003502	WXS	Illumina HiSeq	Unspecified	P0C0S8	H2A1_HUMAN			1	79	+			18					P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000357320.2	37	c.53G>C	CCDS4634.1	.	.	.	.	.	.	.	.	.	.	.	11.96	1.794438	0.31777	.	.	ENSG00000198374	ENST00000357320	T	0.70749	-0.51	4.69	4.69	0.59074	.	0.000000	0.30869	U	0.008714	T	0.78355	0.4270	.	.	.	0.44323	D	0.9972	.	.	.	.	.	.	T	0.81883	-0.0728	7	0.87932	D	0	.	16.9879	0.86345	0.0:0.0:1.0:0.0	.	.	.	.	P	18	ENSP00000349873:R18P	ENSP00000349873:R18P	R	+	2	0	HIST1H2AL	27941164	1.000000	0.71417	0.199000	0.23439	0.134000	0.20937	7.358000	0.79466	2.332000	0.79248	0.655000	0.94253	CGC		0.632	HIST1H2AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040160.1	NM_003511		24	128	0	0	0	0.004656	0	24	128				
OR2B2	81697	broad.mit.edu	37	6	27879515	27879515	+	Missense_Mutation	SNP	T	T	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:27879515T>G	ENST00000303324.2	-	1	659	c.583A>C	c.(583-585)Aat>Cat	p.N195H		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						TCAGCCTCATTTGCTGTTGTG	0.433																																							uc011dkw.1		NA																	0					0						c.(583-585)AAT>CAT		olfactory receptor, family 2, subfamily B,							113.0	105.0	108.0					6																	27879515		2203	4300	6503	SO:0001583	missense	81697				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:27879515T>G	Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.583A>C	6.37:g.27879515T>G	ENSP00000304419:p.Asn195His		Somatic					p.N195H	NM_033057	NP_149046	WXS	Illumina HiSeq	Unspecified	Q9GZK3	OR2B2_HUMAN			1	583	-			195			Extracellular (Potential).		B2RNH2|Q9GZL2|Q9Y299	Missense_Mutation	SNP	ENST00000303324.2	37	c.583A>C	CCDS4641.1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.982616	0.53827	.	.	ENSG00000168131	ENST00000303324	T	0.00231	8.49	4.32	4.32	0.51571	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41712	U	0.000824	T	0.00271	0.0008	M	0.83852	2.665	0.23962	N	0.996332	D	0.63880	0.993	D	0.68192	0.956	T	0.37337	-0.9710	10	0.49607	T	0.09	.	12.0474	0.53487	0.0:0.0:0.0:1.0	.	195	Q9GZK3	OR2B2_HUMAN	H	195	ENSP00000304419:N195H	ENSP00000304419:N195H	N	-	1	0	OR2B2	27987494	0.046000	0.20272	0.961000	0.40146	0.798000	0.45092	1.375000	0.34295	1.873000	0.54277	0.460000	0.39030	AAT		0.433	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040163.1			15	84	0	0	0	0.00245	0	15	84				
PTCHD4	442213	broad.mit.edu	37	6	47846204	47846204	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:47846204C>A	ENST00000339488.4	-	3	2409	c.2376G>T	c.(2374-2376)ggG>ggT	p.G792G		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	792						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										GTGTGCAACCCCCAGTGAGCA	0.428																																							uc011dwm.1		NA																	0				central_nervous_system(1)	1						c.(2323-2325)GGG>GGT		hypothetical protein LOC442213							70.0	70.0	70.0					6																	47846204		2203	4300	6503	SO:0001819	synonymous_variant	442213					integral to membrane	hedgehog receptor activity	g.chr6:47846204C>A		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.2376G>T	6.37:g.47846204C>A			Somatic				C6orf138_uc011dwn.1_Silent_p.G539G	p.G775G	NM_001013732	NP_001013754	WXS	Illumina HiSeq	Unspecified	Q6ZW05	CF138_HUMAN			3	2410	-			792			Helical; (Potential).		B0QZ29|B4DRK3|Q5T884	Silent	SNP	ENST00000339488.4	37	c.2325G>T	CCDS34473.2																																																																																				0.428	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732		5	61	1	0	1.23904e-05	0.000602	1.47322e-05	5	61				
GFRAL	389400	broad.mit.edu	37	6	55214912	55214912	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:55214912C>G	ENST00000340465.2	+	4	425	c.339C>G	c.(337-339)ttC>ttG	p.F113L		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	113					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			AGGATAAATTCAAATGGAATC	0.303																																							uc003pcm.1		NA																	0				ovary(1)|breast(1)	2						c.(337-339)TTC>TTG		GDNF family receptor alpha like precursor							77.0	74.0	75.0					6																	55214912		2202	4297	6499	SO:0001583	missense	389400					integral to membrane	receptor activity	g.chr6:55214912C>G	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.339C>G	6.37:g.55214912C>G	ENSP00000343636:p.Phe113Leu		Somatic					p.F113L	NM_207410	NP_997293	WXS	Illumina HiSeq	Unspecified	Q6UXV0	GFRAL_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		4	425	+	Lung NSC(77;0.0875)|Renal(3;0.122)		113			Extracellular (Potential).		Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	37	c.339C>G	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	C	0.149	-1.093049	0.01858	.	.	ENSG00000187871	ENST00000340465	T	0.27104	1.69	4.67	-2.66	0.06077	.	7.009170	0.00166	N	0.000000	T	0.03520	0.0101	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.11591	-1.0581	10	0.07030	T	0.85	-33.5881	0.7793	0.01038	0.2755:0.2705:0.271:0.1831	.	113	Q6UXV0	GFRAL_HUMAN	L	113	ENSP00000343636:F113L	ENSP00000343636:F113L	F	+	3	2	GFRAL	55322871	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	-0.600000	0.05693	-0.145000	0.11294	-0.150000	0.13652	TTC		0.303	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410		11	47	0	0	0	0.000978	0	11	47				
HMGCLL1	54511	broad.mit.edu	37	6	55364050	55364050	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:55364050G>T	ENST00000398661.2	-	7	811	c.680C>A	c.(679-681)cCg>cAg	p.P227Q	HMGCLL1_ENST00000508459.1_Intron|HMGCLL1_ENST00000308161.4_Missense_Mutation_p.P165Q|HMGCLL1_ENST00000370850.2_Intron|HMGCLL1_ENST00000274901.4_Missense_Mutation_p.P197Q	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	227					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			CACTTTTTGCGGTGTAATACT	0.318																																					Ovarian(35;840 893 7837 15538 42887)	Ovarian(35;840 893 7837 15538 42887)	uc003pcn.2		NA																	0				skin(2)|ovary(1)|pancreas(1)	4						c.(679-681)CCG>CAG		3-hydroxymethyl-3-methylglutaryl-Coenzyme A							103.0	102.0	102.0					6																	55364050		1841	4096	5937	SO:0001583	missense	54511						hydroxymethylglutaryl-CoA lyase activity|metal ion binding	g.chr6:55364050G>T	AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.680C>A	6.37:g.55364050G>T	ENSP00000381654:p.Pro227Gln		Somatic				HMGCLL1_uc003pco.2_Missense_Mutation_p.P197Q|HMGCLL1_uc010jzx.2_Missense_Mutation_p.P98Q|HMGCLL1_uc011dxc.1_Missense_Mutation_p.P165Q|HMGCLL1_uc011dxd.1_Intron|HMGCLL1_uc011dxe.1_Intron	p.P227Q	NM_019036	NP_061909	WXS	Illumina HiSeq	Unspecified	Q8TB92	HMGC2_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		7	839	-	Lung NSC(77;0.0875)		227					B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	ENST00000398661.2	37	c.680C>A	CCDS43475.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532487	0.64972	.	.	ENSG00000146151	ENST00000274901;ENST00000398661;ENST00000308161	D;D;D	0.98585	-5.01;-5.01;-5.01	5.72	4.86	0.63082	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.269954	0.42964	D	0.000623	D	0.98757	0.9582	M	0.85299	2.745	0.80722	D	1	P;D;D	0.71674	0.847;0.981;0.998	P;P;D	0.70487	0.907;0.887;0.969	D	0.99632	1.0986	10	0.87932	D	0	-20.3821	14.7554	0.69560	0.069:0.0:0.931:0.0	.	165;197;227	F8W793;Q8TB92-2;Q8TB92	.;.;HMGC2_HUMAN	Q	197;227;165	ENSP00000274901:P197Q;ENSP00000381654:P227Q;ENSP00000309737:P165Q	ENSP00000274901:P197Q	P	-	2	0	HMGCLL1	55472009	1.000000	0.71417	0.027000	0.17364	0.721000	0.41392	6.672000	0.74477	1.443000	0.47586	0.655000	0.94253	CCG		0.318	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360290.1	XM_166383		7	68	1	0	3.86212e-05	0.008291	4.41021e-05	7	68				
DST	667	broad.mit.edu	37	6	56457018	56457018	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:56457018C>T	ENST00000361203.3	-	45	12239	c.12232G>A	c.(12232-12234)Gac>Aac	p.D4078N	DST_ENST00000446842.2_Missense_Mutation_p.D3754N|DST_ENST00000312431.6_Missense_Mutation_p.D4078N|DST_ENST00000244364.6_Missense_Mutation_p.D1666N|DST_ENST00000370754.5_Missense_Mutation_p.D4258N|DST_ENST00000370788.2_Missense_Mutation_p.D1992N|DST_ENST00000370769.4_Missense_Mutation_p.D4080N|DST_ENST00000421834.2_Missense_Mutation_p.D1992N			Q03001	DYST_HUMAN	dystonin	4078					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTTTTGGGGTCCACCGCAATA	0.433																																							uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(6508-6510)GAC>AAC		dystonin isoform 2							80.0	77.0	78.0					6																	56457018		1873	4104	5977	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56457018C>T	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.12232G>A	6.37:g.56457018C>T	ENSP00000354508:p.Asp4078Asn		Somatic				DST_uc003pcz.3_Missense_Mutation_p.D1992N|DST_uc011dxj.1_Missense_Mutation_p.D2021N|DST_uc011dxk.1_Missense_Mutation_p.D2032N|DST_uc003pcy.3_Missense_Mutation_p.D1666N|DST_uc010kaa.1_RNA	p.D2170N	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		43	6536	-	Lung NSC(77;0.103)		4078			Spectrin 3.		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.6508G>A		.	.	.	.	.	.	.	.	.	.	C	21.5	4.162931	0.78226	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T;T	0.60040	0.85;0.85;0.85;0.85;0.85;0.22;0.85;0.85	5.8	5.8	0.92144	.	0.000000	0.53938	D	0.000047	T	0.56156	0.1966	L	0.39397	1.21	0.32169	N	0.581871	B;P;P;B;P	0.52061	0.033;0.95;0.897;0.235;0.552	B;P;P;B;P	0.60415	0.038;0.874;0.463;0.103;0.525	T	0.60652	-0.7221	9	0.54805	T	0.06	.	13.2812	0.60214	0.0:0.928:0.0:0.072	.	1992;4080;4258;4078;1666	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	N	1666;4258;4080;1992;3754;4078;1992;4078	ENSP00000244364:D1666N;ENSP00000359790:D4258N;ENSP00000359805:D4080N;ENSP00000400883:D1992N;ENSP00000393645:D3754N;ENSP00000307959:D4078N;ENSP00000359824:D1992N;ENSP00000354508:D4078N	ENSP00000244364:D1666N	D	-	1	0	DST	56564977	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.546000	0.67243	2.741000	0.93983	0.650000	0.86243	GAC		0.433	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		11	10	0	0	0	0.001855	0	11	10				
COL12A1	1303	broad.mit.edu	37	6	75848603	75848603	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:75848603C>T	ENST00000322507.8	-	28	5341	c.5032G>A	c.(5032-5034)Gga>Aga	p.G1678R	COL12A1_ENST00000345356.6_Missense_Mutation_p.G514R|COL12A1_ENST00000416123.2_Missense_Mutation_p.G1678R|COL12A1_ENST00000483888.2_Missense_Mutation_p.G1678R	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1678	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TCTGAAGCTCCATGATCCCAA	0.438																																							uc003phs.2		NA																	0				ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(5032-5034)GGA>AGA		collagen, type XII, alpha 1 long isoform							122.0	121.0	121.0					6																	75848603		1858	4099	5957	SO:0001583	missense	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75848603C>T	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5032G>A	6.37:g.75848603C>T	ENSP00000325146:p.Gly1678Arg		Somatic				COL12A1_uc003pht.2_Missense_Mutation_p.G514R	p.G1678R	NM_004370	NP_004361	WXS	Illumina HiSeq	Unspecified	Q99715	COCA1_HUMAN			28	5198	-			1678			Fibronectin type-III 12.		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	c.5032G>A	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.12|17.12	3.307545|3.307545	0.60305|0.60305	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888|ENST00000419671	T;T;T;T|.	0.56941|.	0.43;0.43;0.43;0.43|.	5.95|5.95	5.95|5.95	0.96441|0.96441	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.120488|.	0.56097|.	D|.	0.000035|.	T|.	0.72382|.	0.3453|.	M|M	0.71581|0.71581	2.175|2.175	0.53688|0.53688	D|D	0.99997|0.99997	D;D|.	0.54207|.	0.957;0.965|.	P;D|.	0.65773|.	0.888;0.938|.	T|.	0.68739|.	-0.5329|.	10|.	0.66056|.	D|.	0.02|.	.|.	20.4024|20.4024	0.99000|0.99000	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	514;1678|.	Q99715-2;Q99715|.	.;COCA1_HUMAN|.	R|X	1678;1678;514;1678;1678|419	ENSP00000325146:G1678R;ENSP00000305147:G514R;ENSP00000412864:G1678R;ENSP00000421216:G1678R|.	ENSP00000325146:G1678R|.	G|W	-|-	1|2	0|0	COL12A1|COL12A1	75905323|75905323	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.132000|0.132000	0.20833|0.20833	5.513000|5.513000	0.67037|0.67037	2.827000|2.827000	0.97445|0.97445	0.650000|0.650000	0.86243|0.86243	GGA|TGG		0.438	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		10	20	0	0	0	0.006214	0	10	20				
TBX18	9096	broad.mit.edu	37	6	85453977	85453977	+	Splice_Site	SNP	A	A	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr6:85453977A>C	ENST00000369663.5	-	6	1342		c.e6+1		TBX18_ENST00000606784.1_Splice_Site|TBX18_ENST00000606521.1_Splice_Site	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18						anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		ACTAAGGCCCACCTGTTGCGC	0.338																																							uc003pkl.1		NA																	0				ovary(2)|pancreas(2)|lung(1)	5						c.e6+1		T-box 18							45.0	45.0	45.0					6																	85453977		2203	4299	6502	SO:0001630	splice_region_variant	9096				multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:85453977A>C	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1004+1T>G	6.37:g.85453977A>C			Somatic				TBX18_uc010kbq.1_Splice_Site_p.R177_splice	p.R335_splice	NM_001080508	NP_001073977	WXS	Illumina HiSeq	Unspecified	O95935	TBX18_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0267)	6	1004	-		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)						A2RU13|Q7Z6U4|Q9UJI6	Splice_Site	SNP	ENST00000369663.5	37	c.1004_splice	CCDS34495.1	.	.	.	.	.	.	.	.	.	.	A	17.34	3.365886	0.61513	.	.	ENSG00000112837	ENST00000416980;ENST00000369663	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3636	0.83296	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TBX18	85510696	1.000000	0.71417	0.944000	0.38274	0.457000	0.32468	7.068000	0.76748	2.267000	0.75376	0.528000	0.53228	.		0.338	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508	Intron	13	4	0	0	0	0.00245	0	13	4				
AMZ1	155185	broad.mit.edu	37	7	2740255	2740255	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:2740255C>T	ENST00000312371.4	+	2	538	c.170C>T	c.(169-171)aCc>aTc	p.T57I	AMZ1_ENST00000407112.1_Missense_Mutation_p.T57I	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	57							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CTCTTCTGCACCCTGCTCATC	0.677																																							uc003smr.1		NA																	0					0						c.(169-171)ACC>ATC		archaelysin family metallopeptidase 1							97.0	104.0	102.0					7																	2740255		2203	4300	6503	SO:0001583	missense	155185						metallopeptidase activity|zinc ion binding	g.chr7:2740255C>T	AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.170C>T	7.37:g.2740255C>T	ENSP00000308149:p.Thr57Ile		Somatic				AMZ1_uc003sms.1_Missense_Mutation_p.T57I|AMZ1_uc011jwa.1_5'Flank	p.T57I	NM_133463	NP_597720	WXS	Illumina HiSeq	Unspecified	Q400G9	AMZ1_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)	2	531	+		Ovarian(82;0.0779)	57					B3KRS0|Q8TF51	Missense_Mutation	SNP	ENST00000312371.4	37	c.170C>T	CCDS34589.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347938	0.61183	.	.	ENSG00000174945	ENST00000312371;ENST00000407112	T;T	0.17528	2.27;2.27	4.34	4.34	0.51931	.	0.086330	0.47093	D	0.000244	T	0.27278	0.0669	M	0.63428	1.95	0.20196	N	0.999929	D;P	0.57899	0.981;0.718	P;B	0.51550	0.673;0.168	T	0.08106	-1.0738	10	0.52906	T	0.07	-8.8176	11.8969	0.52661	0.0:0.8243:0.1756:0.0	.	57;57	B3KRS0;Q400G9	.;AMZ1_HUMAN	I	57	ENSP00000308149:T57I;ENSP00000386020:T57I	ENSP00000308149:T57I	T	+	2	0	AMZ1	2706781	0.022000	0.18835	0.055000	0.19348	0.919000	0.55068	2.803000	0.47924	1.969000	0.57287	0.561000	0.74099	ACC		0.677	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325244.1	NM_133463		40	122	0	0	0	0.005524	0	40	122				
ZNF12	7559	broad.mit.edu	37	7	6731811	6731811	+	Silent	SNP	C	C	T	rs372158854		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:6731811C>T	ENST00000405858.1	-	5	1303	c.762G>A	c.(760-762)tcG>tcA	p.S254S	AC073343.13_ENST00000366167.2_RNA|ZNF12_ENST00000404360.1_Silent_p.S180S|AC073343.2_ENST00000577401.1_RNA|ZNF12_ENST00000342651.5_Silent_p.S216S	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	254					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		CAGTGAGGTCCGACATCTGGA	0.383																																							uc003sqt.1		NA																	0					0						c.(760-762)TCG>TCA		zinc finger protein 12 isoform a		T	,	1,4335		0,1,2167	55.0	60.0	58.0		648,762	-1.6	0.3	7		58	0,8578		0,0,4289	no	coding-synonymous,coding-synonymous	ZNF12	NM_006956.2,NM_016265.3	,	0,1,6456	TT,TC,CC		0.0,0.0231,0.0077	,	216/660,254/698	6731811	1,12913	2168	4289	6457	SO:0001819	synonymous_variant	7559				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:6731811C>T	X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.762G>A	7.37:g.6731811C>T			Somatic				ZNF12_uc011jxa.1_Silent_p.S92S|ZNF12_uc003sqs.1_Silent_p.S216S	p.S254S	NM_016265	NP_057349	WXS	Illumina HiSeq	Unspecified	P17014	ZNF12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)	5	1316	-		Ovarian(82;0.0776)	254					A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Silent	SNP	ENST00000405858.1	37	c.762G>A	CCDS47538.1																																																																																				0.383	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324373.2	NM_016265		13	20	0	0	0	0.001368	0	13	20				
HDAC9	9734	broad.mit.edu	37	7	18788664	18788664	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:18788664G>T	ENST00000432645.2	+	13	1937	c.1937G>T	c.(1936-1938)tGc>tTc	p.C646F	HDAC9_ENST00000441542.2_Missense_Mutation_p.C649F|HDAC9_ENST00000406451.4_Missense_Mutation_p.C646F|HDAC9_ENST00000401921.1_Missense_Mutation_p.C605F	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	646	Histone deacetylase.			HQCV -> KPNS (in Ref. 9; AAF04254). {ECO:0000305}.	B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	AAACACCAGTGCGTTTGTGGC	0.448																																							uc003suh.2		NA																	0				lung(2)|central_nervous_system(2)|kidney(1)	5						c.(1936-1938)TGC>TTC		histone deacetylase 9 isoform 1	Valproic Acid(DB00313)						88.0	86.0	86.0					7																	18788664		1933	4154	6087	SO:0001583	missense	9734				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity	g.chr7:18788664G>T	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1937G>T	7.37:g.18788664G>T	ENSP00000410337:p.Cys646Phe		Somatic				HDAC9_uc003sue.2_Missense_Mutation_p.C646F|HDAC9_uc011jyd.1_Missense_Mutation_p.C646F|HDAC9_uc003sui.2_Missense_Mutation_p.C649F|HDAC9_uc003suj.2_Missense_Mutation_p.C605F|HDAC9_uc003sua.1_Missense_Mutation_p.C624F|HDAC9_uc010kue.1_Missense_Mutation_p.C301F	p.C646F	NM_058176	NP_478056	WXS	Illumina HiSeq	Unspecified	Q9UKV0	HDAC9_HUMAN			13	1978	+	all_lung(11;0.187)		646	HQCV -> KPNS (in Ref. 8; AAF04254).		Histone deacetylase.		A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	c.1937G>T	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483985	0.84854	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.62232	0.05;0.04;0.06;0.05	5.3	5.3	0.74995	Histone deacetylase domain (1);	0.000000	0.64402	D	0.000004	D	0.85102	0.5620	M	0.93420	3.415	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.85130	0.955;0.997;0.995;0.995;0.997;0.995;0.997	D	0.88552	0.3117	10	0.87932	D	0	-12.1398	19.1356	0.93426	0.0:0.0:1.0:0.0	.	646;558;605;649;646;646;624	Q9UKV0-4;Q9UKV0-2;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q8N879	.;.;.;.;HDAC9_HUMAN;.;.	F	646;605;646;649;558	ENSP00000384657:C646F;ENSP00000383912:C605F;ENSP00000410337:C646F;ENSP00000408617:C649F	ENSP00000339165:C558F	C	+	2	0	HDAC9	18755189	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.657000	0.98554	2.756000	0.94617	0.563000	0.77884	TGC		0.448	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1			6	26	1	0	2.7689e-08	0.001984	3.65663e-08	6	26				
HECW1	23072	broad.mit.edu	37	7	43484944	43484944	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:43484944G>A	ENST00000395891.2	+	11	2778	c.2173G>A	c.(2173-2175)Gcc>Acc	p.A725T	HECW1_ENST00000453890.1_Missense_Mutation_p.A725T	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	725					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CGTGGACAGCGCCAAGATCTC	0.627																																							uc003tid.1		NA																	0				ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						c.(2173-2175)GCC>ACC		NEDD4-like ubiquitin-protein ligase 1							66.0	71.0	70.0					7																	43484944		2137	4244	6381	SO:0001583	missense	23072				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity	g.chr7:43484944G>A	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.2173G>A	7.37:g.43484944G>A	ENSP00000379228:p.Ala725Thr		Somatic				HECW1_uc011kbi.1_Missense_Mutation_p.A725T	p.A725T	NM_015052	NP_055867	WXS	Illumina HiSeq	Unspecified	Q76N89	HECW1_HUMAN			11	2778	+			725					A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	c.2173G>A	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225841	0.79576	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.34859	1.43;1.34	4.71	4.71	0.59529	.	0.678072	0.14992	N	0.286647	T	0.32133	0.0819	N	0.20986	0.625	0.52501	D	0.999957	D;P	0.57899	0.981;0.95	B;B	0.44044	0.431;0.439	T	0.31779	-0.9931	10	0.66056	D	0.02	.	17.6622	0.88195	0.0:0.0:1.0:0.0	.	725;725	B4DH42;Q76N89	.;HECW1_HUMAN	T	725	ENSP00000379228:A725T;ENSP00000407774:A725T	ENSP00000265522:A725T	A	+	1	0	HECW1	43451469	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.280000	0.78610	2.154000	0.67381	0.655000	0.94253	GCC		0.627	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		18	92	0	0	0	0.007413	0	18	92				
COBL	23242	broad.mit.edu	37	7	51261079	51261079	+	Silent	SNP	A	A	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:51261079A>G	ENST00000265136.7	-	3	618	c.453T>C	c.(451-453)ccT>ccC	p.P151P	COBL_ENST00000441453.1_Silent_p.P151P|COBL_ENST00000395540.2_Silent_p.P151P|COBL_ENST00000395542.2_Silent_p.P151P	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	151					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TACTAACCTCAGGCACCTTAG	0.463																																					NSCLC(189;2119 2138 12223 30818 34679)	NSCLC(189;2119 2138 12223 30818 34679)	uc003tpr.3		NA																	0				skin(3)|ovary(2)	5						c.(451-453)CCT>CCC		cordon-bleu homolog							78.0	72.0	74.0					7																	51261079		2203	4300	6503	SO:0001819	synonymous_variant	23242							g.chr7:51261079A>G	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.453T>C	7.37:g.51261079A>G			Somatic				COBL_uc003tps.2_Silent_p.P151P|COBL_uc011kcl.1_Silent_p.P151P|COBL_uc010kzc.2_Silent_p.P151P|COBL_uc003tpt.2_Silent_p.P151P|COBL_uc003tpp.3_5'Flank|COBL_uc003tpq.3_Silent_p.P67P	p.P151P	NM_015198	NP_056013	WXS	Illumina HiSeq	Unspecified	O75128	COBL_HUMAN			3	638	-	Glioma(55;0.08)		151					A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	ENST00000265136.7	37	c.453T>C	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	A	6.695	0.496825	0.12762	.	.	ENSG00000106078	ENST00000452534	.	.	.	5.58	0.148	0.14843	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.9809	0.09495	0.4877:0.0:0.1401:0.3722	.	.	.	.	R	70	.	.	X	-	1	0	COBL	51228573	0.552000	0.26505	0.994000	0.49952	0.526000	0.34562	-0.138000	0.10374	0.071000	0.16664	-0.336000	0.08194	TGA		0.463	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198		6	22	0	0	0	0.001168	0	6	22				
CACNA2D1	781	broad.mit.edu	37	7	81579728	81579728	+	Missense_Mutation	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:81579728T>A	ENST00000356253.5	-	39	3547	c.3292A>T	c.(3292-3294)Agc>Tgc	p.S1098C	CACNA2D1_ENST00000535308.1_Missense_Mutation_p.S298C|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.S1086C			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	1098					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CGGTGTGTGCTGCCAGATACC	0.448																																							uc003uhr.1		NA																	0				ovary(5)|pancreas(1)	6						c.(3256-3258)AGC>TGC		calcium channel, voltage-dependent, alpha	Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)						97.0	96.0	96.0					7																	81579728		2203	4300	6503	SO:0001583	missense	781					voltage-gated calcium channel complex	metal ion binding	g.chr7:81579728T>A	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.3292A>T	7.37:g.81579728T>A	ENSP00000348589:p.Ser1098Cys		Somatic				uc003uhq.1_5'Flank|CACNA2D1_uc011kgy.1_Missense_Mutation_p.S298C	p.S1086C	NM_000722	NP_000713	WXS	Illumina HiSeq	Unspecified	P54289	CA2D1_HUMAN			39	3512	-			1098			Cytoplasmic (Potential).		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37	c.3256A>T		.	.	.	.	.	.	.	.	.	.	T	19.30	3.801223	0.70567	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000535308	T;T;T	0.34667	3.12;3.12;1.35	4.96	4.96	0.65561	.	0.275476	0.36591	N	0.002514	T	0.54631	0.1870	M	0.67953	2.075	0.32866	D	0.508573	D;D	0.67145	0.995;0.996	P;P	0.60682	0.878;0.794	T	0.68815	-0.5309	10	0.62326	D	0.03	-17.4828	14.9184	0.70815	0.0:0.0:0.0:1.0	.	298;1086	B7Z658;P54289-2	.;.	C	1086;1105;1098;298	ENSP00000349320:S1086C;ENSP00000348589:S1098C;ENSP00000443124:S298C	ENSP00000284088:S1105C	S	-	1	0	CACNA2D1	81417664	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.173000	0.50839	1.970000	0.57323	0.528000	0.53228	AGC		0.448	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				14	60	0	0	0	0.004007	0	14	60				
TMEM130	222865	broad.mit.edu	37	7	98460868	98460868	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:98460868G>A	ENST00000416379.2	-	2	245	c.241C>T	c.(241-243)Ctt>Ttt	p.L81F	TMEM130_ENST00000450876.1_5'UTR|TMEM130_ENST00000546258.1_Missense_Mutation_p.L62F|TMEM130_ENST00000339375.4_Missense_Mutation_p.L81F|TMEM130_ENST00000345589.4_Intron			Q8N3G9	TM130_HUMAN	transmembrane protein 130	81						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	25	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTGCCAGTAAGCACCAGCGGG	0.657																																							uc003upo.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(241-243)CTT>TTT		transmembrane protein 130 isoform a							62.0	61.0	61.0					7																	98460868		2203	4300	6503	SO:0001583	missense	222865					Golgi membrane|integral to membrane		g.chr7:98460868G>A		CCDS5658.1, CCDS47649.1, CCDS47650.1	7q22.1	2006-03-09			ENSG00000166448	ENSG00000166448			25429	protein-coding gene	gene with protein product						12975309	Standard	NM_152913		Approved	DKFZp761L1417, FLJ42643	uc003upo.3	Q8N3G9	OTTHUMG00000154419	ENST00000416379.2:c.241C>T	7.37:g.98460868G>A	ENSP00000413163:p.Leu81Phe		Somatic				TMEM130_uc011kiq.1_Missense_Mutation_p.L62F|TMEM130_uc011kir.1_Missense_Mutation_p.L81F|TMEM130_uc003upn.2_Intron	p.L81F	NM_001134450	NP_001127922	WXS	Illumina HiSeq	Unspecified	Q8N3G9	TM130_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		2	430	-	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		81			Extracellular (Potential).		A4D266|B7Z364|Q8IY46|Q8N0W9|Q8N3R2	Missense_Mutation	SNP	ENST00000416379.2	37	c.241C>T	CCDS47650.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.862079	0.51482	.	.	ENSG00000166448	ENST00000416379;ENST00000339375;ENST00000546258	T;T;T	0.15952	2.38;2.38;2.38	4.48	4.48	0.54585	.	0.000000	0.64402	D	0.000010	T	0.36552	0.0971	L	0.59436	1.845	0.37528	D	0.917798	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.998;0.998;0.998	T	0.22312	-1.0220	10	0.49607	T	0.09	-38.2409	13.3884	0.60809	0.0:0.0:1.0:0.0	.	81;62;81	Q8N3G9-2;B7Z2F1;Q8N3G9	.;.;TM130_HUMAN	F	81;81;62	ENSP00000413163:L81F;ENSP00000341256:L81F;ENSP00000445869:L62F	ENSP00000341256:L81F	L	-	1	0	TMEM130	98298804	0.998000	0.40836	0.776000	0.31678	0.127000	0.20565	3.096000	0.50243	2.432000	0.82394	0.505000	0.49811	CTT		0.657	TMEM130-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380713.1	NM_152913		15	24	0	0	0	0.003163	0	15	24				
NYAP1	222950	broad.mit.edu	37	7	100084640	100084640	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:100084640G>A	ENST00000300179.2	+	3	424	c.265G>A	c.(265-267)Ggc>Agc	p.G89S	NYAP1_ENST00000423930.1_Missense_Mutation_p.G89S|NYAP1_ENST00000454988.1_Missense_Mutation_p.G32S	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	89	Involved in CYFIP1- and NCKAP1-binding. {ECO:0000250}.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CCACTCGGTGGGCAGCATGGA	0.711																																							uc003uvd.1		NA																	0				skin(1)	1						c.(265-267)GGC>AGC		hypothetical protein FLJ37538							13.0	17.0	16.0					7																	100084640		2155	4231	6386	SO:0001583	missense	222950							g.chr7:100084640G>A	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.265G>A	7.37:g.100084640G>A	ENSP00000300179:p.Gly89Ser		Somatic				C7orf51_uc003uve.1_5'Flank	p.G89S	NM_173564	NP_775835	WXS	Illumina HiSeq	Unspecified	Q6ZVC0	CG051_HUMAN			3	424	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		89					Q6U9Y3|Q8N1V0	Missense_Mutation	SNP	ENST00000300179.2	37	c.265G>A	CCDS5696.1	.	.	.	.	.	.	.	.	.	.	G	32	5.169094	0.94768	.	.	ENSG00000166924	ENST00000300179;ENST00000423930;ENST00000454988	T;T;T	0.46451	0.87;0.87;0.87	5.55	4.62	0.57501	.	0.000000	0.52532	D	0.000080	T	0.55752	0.1940	L	0.47016	1.485	0.54753	D	0.999984	D	0.89917	1.0	D	0.74674	0.984	T	0.55630	-0.8111	10	0.56958	D	0.05	-19.2397	13.586	0.61931	0.0:0.1571:0.8429:0.0	.	89	Q6ZVC0	CG051_HUMAN	S	89;89;32	ENSP00000300179:G89S;ENSP00000411861:G89S;ENSP00000394424:G32S	ENSP00000300179:G89S	G	+	1	0	C7orf51	99922576	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.700000	0.74619	2.606000	0.88127	0.462000	0.41574	GGC		0.711	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564		8	18	0	0	0	0.006214	0	8	18				
LAMB4	22798	broad.mit.edu	37	7	107756519	107756519	+	Missense_Mutation	SNP	G	G	T	rs140462508		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:107756519G>T	ENST00000388781.3	-	3	205	c.122C>A	c.(121-123)aCg>aAg	p.T41K	LAMB4_ENST00000388780.3_Missense_Mutation_p.T41K|LAMB4_ENST00000205386.4_Missense_Mutation_p.T41K|LAMB4_ENST00000414450.2_Missense_Mutation_p.T41K|LAMB4_ENST00000418464.1_Missense_Mutation_p.T41K	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	41	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						CATAAGCTGCGTGTTCCTGCC	0.522																																							uc010ljo.1		NA																	0				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						c.(121-123)ACG>AAG		laminin, beta 4 precursor							114.0	112.0	113.0					7																	107756519		2203	4300	6503	SO:0001583	missense	22798				cell adhesion	basement membrane		g.chr7:107756519G>T	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.122C>A	7.37:g.107756519G>T	ENSP00000373433:p.Thr41Lys		Somatic				LAMB4_uc003vey.2_Missense_Mutation_p.T41K	p.T41K	NM_007356	NP_031382	WXS	Illumina HiSeq	Unspecified	A4D0S4	LAMB4_HUMAN			3	206	-			41			Laminin N-terminal.		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	c.122C>A	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	g	0.850	-0.738894	0.03088	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.29142	1.61;1.61;1.63;1.58;1.64	5.69	-4.2	0.03823	Laminin, N-terminal (3);	1.577520	0.04031	N	0.301483	T	0.07593	0.0191	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.20174	-1.0283	10	0.09084	T	0.74	.	1.5897	0.02651	0.2681:0.08:0.291:0.3609	.	41	A4D0S4	LAMB4_HUMAN	K	41	ENSP00000205386:T41K;ENSP00000373433:T41K;ENSP00000373432:T41K;ENSP00000402353:T41K;ENSP00000402265:T41K	ENSP00000205386:T41K	T	-	2	0	LAMB4	107543755	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.151000	0.10175	-0.408000	0.07565	-3.426000	0.00037	ACG		0.522	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		15	99	1	0	1.3612e-06	0.003163	1.69416e-06	15	99				
EIF3IP1	442720	broad.mit.edu	37	7	109599884	109599884	+	IGR	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:109599884C>A								AC073071.1 (362661 upstream) : AC003088.1 (472411 downstream)																							AAGAAGCTCACAAAGCACTGA	0.463																																							uc003vfp.1		NA																	0					0						c.(214-216)GTG>TTG		Homo sapiens eukaryotic translation initiation factor 3, subunit I pseudogene 1 (EIF3IP1), non-coding RNA.																																				SO:0001628	intergenic_variant	442720							g.chr7:109599884C>A																													7.37:g.109599884C>A			Somatic					p.V72L	NR_003024		WXS	Illumina HiSeq	Unspecified					1	387	-									Missense_Mutation	SNP		37	c.214G>T																																																																																				0	0.463									11	12	1	0	3.86212e-05	0.008291	4.41021e-05	11	12				
FAM131B	9715	broad.mit.edu	37	7	143053838	143053838	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:143053838C>A	ENST00000409408.1	-	6	2512	c.804G>T	c.(802-804)ctG>ctT	p.L268L	FAM131B_ENST00000409222.3_Silent_p.L268L|FAM131B_ENST00000443739.2_Silent_p.L296L|FAM131B_ENST00000409346.1_Silent_p.L268L|FAM131B_ENST00000409578.1_Silent_p.L284L			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	268										breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					GGCCCCTTGCCAGGTCCACTG	0.632																																							uc003wct.2		NA																	0					0						c.(802-804)CTG>CTT		hypothetical protein LOC9715 isoform b							97.0	109.0	104.0					7																	143053838		2203	4300	6503	SO:0001819	synonymous_variant	9715							g.chr7:143053838C>A	BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.804G>T	7.37:g.143053838C>A			Somatic				FAM131B_uc010loz.2_Silent_p.L236L|FAM131B_uc003wcu.3_Silent_p.L268L|FAM131B_uc010lpa.2_Silent_p.L296L	p.L268L	NM_014690	NP_055505	WXS	Illumina HiSeq	Unspecified	Q86XD5	F131B_HUMAN			6	2510	-	Melanoma(164;0.205)		268					A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Silent	SNP	ENST00000409408.1	37	c.804G>T	CCDS5882.1																																																																																				0.632	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328057.1	NM_014690		24	172	1	0	5.45024e-15	0.00333	8.45643e-15	24	172				
OR2A25	392138	broad.mit.edu	37	7	143771460	143771460	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:143771460C>A	ENST00000408898.2	+	1	186	c.148C>A	c.(148-150)Ctg>Atg	p.L50M		NM_001004488.1	NP_001004488.1	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A, member 25	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(16)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	24	Melanoma(164;0.0783)					GCTCATCTCACTGGACTCCAG	0.562																																							uc011ktx.1		NA																	0					0						c.(148-150)CTG>ATG		olfactory receptor, family 2, subfamily A,							82.0	83.0	83.0					7																	143771460		2203	4300	6503	SO:0001583	missense	392138				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143771460C>A		CCDS43669.1	7q35	2012-08-09		2004-03-10	ENSG00000221933	ENSG00000221933		"""GPCR / Class A : Olfactory receptors"""	19562	protein-coding gene	gene with protein product				OR2A25P, OR2A27			Standard	NM_001004488		Approved		uc011ktx.2	A4D2G3	OTTHUMG00000158013	ENST00000408898.2:c.148C>A	7.37:g.143771460C>A	ENSP00000386167:p.Leu50Met		Somatic					p.L50M	NM_001004488	NP_001004488	WXS	Illumina HiSeq	Unspecified	A4D2G3	O2A25_HUMAN			1	148	+	Melanoma(164;0.0783)		50			Cytoplasmic (Potential).		B2RNC9	Missense_Mutation	SNP	ENST00000408898.2	37	c.148C>A	CCDS43669.1	.	.	.	.	.	.	.	.	.	.	C	9.042	0.989876	0.18966	.	.	ENSG00000221933	ENST00000408898	T	0.03065	4.06	4.88	3.05	0.35203	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.06462	0.0166	L	0.49699	1.58	0.09310	N	1	D	0.53619	0.961	P	0.49752	0.621	T	0.32929	-0.9888	9	0.54805	T	0.06	-5.0634	4.9301	0.13912	0.0:0.6381:0.1761:0.1858	.	50	A4D2G3	O2A25_HUMAN	M	50	ENSP00000386167:L50M	ENSP00000386167:L50M	L	+	1	2	OR2A25	143402393	0.000000	0.05858	0.545000	0.28153	0.023000	0.10783	-0.299000	0.08254	0.636000	0.30508	0.563000	0.77884	CTG		0.562	OR2A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350000.1			10	93	1	0	4.68919e-08	0.008291	6.12249e-08	10	93				
ZNF467	168544	broad.mit.edu	37	7	149462585	149462585	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr7:149462585C>A	ENST00000302017.3	-	5	1419	c.1006G>T	c.(1006-1008)Gct>Tct	p.A336S	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGAGGAGAAGCGGACGAGTCG	0.657																																							uc003wgd.2		NA																	0					0						c.(1006-1008)GCT>TCT		zinc finger protein 467							14.0	16.0	15.0					7																	149462585		2187	4284	6471	SO:0001583	missense	168544				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:149462585C>A	BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1006G>T	7.37:g.149462585C>A	ENSP00000304769:p.Ala336Ser		Somatic				ZNF467_uc003wgc.2_Intron	p.A336S	NM_207336	NP_997219	WXS	Illumina HiSeq	Unspecified	Q7Z7K2	ZN467_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		5	1147	-	Melanoma(164;0.165)|Ovarian(565;0.177)		336						Missense_Mutation	SNP	ENST00000302017.3	37	c.1006G>T	CCDS5899.1	.	.	.	.	.	.	.	.	.	.	C	3.824	-0.037143	0.07497	.	.	ENSG00000181444	ENST00000302017	T	0.07114	3.22	3.55	0.262	0.15597	.	0.554851	0.13373	U	0.392777	T	0.04770	0.0129	N	0.24115	0.695	0.09310	N	1	B	0.24426	0.103	B	0.21151	0.033	T	0.43048	-0.9415	10	0.24483	T	0.36	.	5.4385	0.16494	0.0:0.482:0.3959:0.122	.	336	Q7Z7K2	ZN467_HUMAN	S	336	ENSP00000304769:A336S	ENSP00000304769:A336S	A	-	1	0	ZNF467	149093518	.	.	0.000000	0.03702	0.010000	0.07245	.	.	0.190000	0.20209	0.456000	0.33151	GCT		0.657	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349833.1	NM_207336		5	9	1	0	0.00116845	0.001168	0.00127534	5	9				
CSMD1	64478	broad.mit.edu	37	8	2824155	2824155	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:2824155C>G	ENST00000520002.1	-	59	9595	c.9040G>C	c.(9040-9042)Ggg>Cgg	p.G3014R	CSMD1_ENST00000602557.1_Missense_Mutation_p.G3014R|CSMD1_ENST00000537824.1_Missense_Mutation_p.G3013R|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3014	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GTCATGAGCCCTGAGGTCTTG	0.537																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(9040-9042)GGG>CGG		CUB and Sushi multiple domains 1 precursor							70.0	74.0	73.0					8																	2824155		2076	4218	6294	SO:0001583	missense	64478					integral to membrane		g.chr8:2824155C>G			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9040G>C	8.37:g.2824155C>G	ENSP00000430733:p.Gly3014Arg		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.G2343R|CSMD1_uc010lrg.2_Intron	p.G3014R	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	58	9430	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	3014			Extracellular (Potential).|Sushi 23.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.9040G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.30|18.30	3.592995|3.592995	0.66219|0.66219	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000520002;ENST00000318252;ENST00000537824|ENST00000335551	T;T|.	0.72725|.	-0.68;-0.68|.	5.46|5.46	5.46|5.46	0.80206|0.80206	Complement control module (2);Sushi/SCR/CCP (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.91324|0.91324	0.7264|0.7264	H|H	0.98918|0.98918	4.37|4.37	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.94685|0.94685	0.7869|0.7869	10|5	0.87932|.	D|.	0|.	.|.	19.3169|19.3169	0.94218|0.94218	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3014;3014|.	E5RIG2;Q96PZ7|.	.;CSMD1_HUMAN|.	R|T	3014;2875;3013|2430	ENSP00000430733:G3014R;ENSP00000441462:G3013R|.	ENSP00000320445:G2875R|.	G|R	-|-	1|2	0|0	CSMD1|CSMD1	2811562|2811562	1.000000|1.000000	0.71417|0.71417	0.920000|0.920000	0.36463|0.36463	0.005000|0.005000	0.04900|0.04900	7.635000|7.635000	0.83286|0.83286	2.557000|2.557000	0.86248|0.86248	0.655000|0.655000	0.94253|0.94253	GGG|AGG		0.537	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		9	14	0	0	0	0.004482	0	9	14				
MICU3	286097	broad.mit.edu	37	8	16942779	16942779	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:16942779G>T	ENST00000318063.5	+	6	771	c.729G>T	c.(727-729)atG>atT	p.M243I		NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	243	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)										CTTTCAACATGTTTGACACTG	0.328																																						Pancreas(177;1461 2846 10523 14242)|Colon(184;2703 2719 18484 23400)	uc003wxd.2		NA																	0				skin(1)	1						c.(727-729)ATG>ATT		EF-hand domain family, member A2							128.0	130.0	129.0					8																	16942779		2203	4300	6503	SO:0001583	missense	286097					integral to membrane	calcium ion binding	g.chr8:16942779G>T	BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.729G>T	8.37:g.16942779G>T	ENSP00000321455:p.Met243Ile		Somatic					p.M243I	NM_181723	NP_859074	WXS	Illumina HiSeq	Unspecified	Q86XE3	EFHA2_HUMAN		Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)	6	771	+			243			EF-hand 1.		Q8IYZ3	Missense_Mutation	SNP	ENST00000318063.5	37	c.729G>T	CCDS5999.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.0|27.0	4.787251|4.787251	0.90367|0.90367	.|.	.|.	ENSG00000155970|ENSG00000155970	ENST00000519044|ENST00000318063	.|D	.|0.84660	.|-1.88	5.19|5.19	5.19|5.19	0.71726|0.71726	.|EF-hand-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93080|0.93080	0.7797|0.7797	M|M	0.85945|0.85945	2.785|2.785	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|D	.|0.80764	.|0.994	D|D	0.92647|0.92647	0.6129|0.6129	5|10	.|0.42905	.|T	.|0.14	-5.1354|-5.1354	19.0982|19.0982	0.93263|0.93263	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|243	.|Q86XE3	.|EFHA2_HUMAN	F|I	101|243	.|ENSP00000321455:M243I	.|ENSP00000321455:M243I	C|M	+|+	2|3	0|0	EFHA2|EFHA2	16987150|16987150	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.448000|9.448000	0.97600|0.97600	2.583000|2.583000	0.87209|0.87209	0.591000|0.591000	0.81541|0.81541	TGT|ATG		0.328	MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214031.1	NM_181723		8	50	1	0	1.58986e-06	0.008291	1.95763e-06	8	50				
ADAM7	8756	broad.mit.edu	37	8	24342843	24342843	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:24342843G>T	ENST00000175238.6	+	10	1012	c.929G>T	c.(928-930)tGc>tTc	p.C310F	ADAM7_ENST00000380789.1_Missense_Mutation_p.C310F|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM7_ENST00000520720.1_Missense_Mutation_p.C82F	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	310	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		GGGGGTATGTGCCTGCCCTAT	0.358																																							uc003xeb.2		NA																	0				skin(3)|ovary(1)|kidney(1)	5						c.(928-930)TGC>TTC		a disintegrin and metalloproteinase domain 7							147.0	142.0	144.0					8																	24342843		2203	4300	6503	SO:0001583	missense	8756				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr8:24342843G>T	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.929G>T	8.37:g.24342843G>T	ENSP00000175238:p.Cys310Phe		Somatic				ADAM7_uc003xec.2_Missense_Mutation_p.C82F	p.C310F	NM_003817	NP_003808	WXS	Illumina HiSeq	Unspecified	Q9H2U9	ADAM7_HUMAN		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)	10	1042	+		Prostate(55;0.0181)	310			Peptidase M12B.|Extracellular (Potential).		A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	ENST00000175238.6	37	c.929G>T	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.185209	0.57909	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	D;D;D	0.85556	-2.0;-2.0;-2.0	5.44	5.44	0.79542	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000012	D	0.94935	0.8362	H	0.97158	3.95	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96236	0.9172	10	0.87932	D	0	.	14.8368	0.70190	0.0:0.0:1.0:0.0	.	82;310	E5RK87;Q9H2U9	.;ADAM7_HUMAN	F	310;310;82;125	ENSP00000175238:C310F;ENSP00000370166:C310F;ENSP00000430400:C82F	ENSP00000175238:C310F	C	+	2	0	ADAM7	24398733	0.999000	0.42202	1.000000	0.80357	0.640000	0.38277	4.449000	0.60034	2.569000	0.86673	0.644000	0.83932	TGC		0.358	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817		35	43	1	0	4.00102e-26	0.00623	6.52996e-26	35	43				
WRN	7486	broad.mit.edu	37	8	30924680	30924680	+	Silent	SNP	T	T	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:30924680T>C	ENST00000298139.5	+	6	885	c.636T>C	c.(634-636)taT>taC	p.Y212Y		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	212	3'-5' exonuclease.|Interaction with WRNIP1. {ECO:0000250}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		AGAAACTGTATGCAGCCACTG	0.343			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	Ovarian(18;161 598 2706 14834 27543)	uc003xio.3		NA	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Mis|N|F|S	Werner syndrome (RECQL2)			"""L, E, M, O"""		osteosarcoma|meningioma|others			0				ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7						c.(634-636)TAT>TAC	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner syndrome protein							76.0	68.0	70.0					8																	30924680		2203	4300	6503	SO:0001819	synonymous_variant	7486	Werner_syndrome	Familial Cancer Database	WS, Adult Progeria	base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding	g.chr8:30924680T>C		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.636T>C	8.37:g.30924680T>C			Somatic					p.Y212Y	NM_000553	NP_000544	WXS	Illumina HiSeq	Unspecified	Q14191	WRN_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)	6	1424	+		Breast(100;0.195)	212	Y->F: Strongly reduces exonuclease activity.		Interaction with WRNIP1 (By similarity).|3'-5' exonuclease.		A1KYY9	Silent	SNP	ENST00000298139.5	37	c.636T>C	CCDS6082.1																																																																																				0.343	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1			5	44	0	0	0	0.001168	0	5	44				
ERLIN2	11160	broad.mit.edu	37	8	37605155	37605155	+	Intron	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:37605155C>T	ENST00000276461.5	+	7	491				ERLIN2_ENST00000519638.1_Intron	NM_007175.6	NP_009106.1	O94905	ERLN2_HUMAN	ER lipid raft associated 2						cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|lung(5)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			AAAGCCCTGGCCAAACTTGAC	0.468																																							uc010lvx.1		NA																	0					0						c.(220-222)GGC>GAC		SubName: Full=cDNA FLJ38978 fis, clone NT2RI2004209; SubName: Full=Chromosome X open reading frame 56, isoform CRA_b; SubName: Full=Putative uncharacterized protein CXorf56;																																				SO:0001627	intron_variant	728024							g.chr8:37605155C>T	AY358108	CCDS6095.1, CCDS34879.1	8p11.2	2012-11-23	2007-01-26	2007-01-26	ENSG00000147475	ENSG00000147475			1356	protein-coding gene	gene with protein product		611605	"""chromosome 8 open reading frame 2"", ""SPFH domain family, member 2"""	C8orf2, SPFH2, Erlin-2		10449903, 15897872, 16835267	Standard	NM_007175		Approved	NET32, SPG18	uc003xke.4	O94905	OTTHUMG00000164005	ENST00000276461.5:c.425-1922C>T	8.37:g.37605155C>T			Somatic				ERLIN2_uc003xke.3_Intron	p.G74D	NR_003671		WXS	Illumina HiSeq	Unspecified					1	367	-								A0JLQ1|A8K5S9|B4DM38|D3DSW0|Q6NW21|Q86VS6|Q86W49	Missense_Mutation	SNP	ENST00000276461.5	37	c.221G>A	CCDS6095.1																																																																																				0.468	ERLIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376712.2	NM_007175		58	45	0	0	0	0.00361	0	58	45				
CYP7A1	1581	broad.mit.edu	37	8	59407086	59407086	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:59407086G>T	ENST00000301645.3	-	4	1155	c.1018C>A	c.(1018-1020)Ctg>Atg	p.L340M		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	340					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				AGGTCATTCAGTTCTGCTTGA	0.353									Neonatal Giant Cell Hepatitis																														uc003xtm.3		NA																	0				ovary(1)	1						c.(1018-1020)CTG>ATG		cytochrome P450, family 7, subfamily A,							158.0	134.0	142.0					8																	59407086		2203	4300	6503	SO:0001583	missense	1581	Neonatal_Giant_Cell_Hepatitis	Familial Cancer Database	Neonatal Hemochromatosis	bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding	g.chr8:59407086G>T	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.1018C>A	8.37:g.59407086G>T	ENSP00000301645:p.Leu340Met		Somatic					p.L340M	NM_000780	NP_000771	WXS	Illumina HiSeq	Unspecified	P22680	CP7A1_HUMAN			4	1081	-		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)	340					P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	ENST00000301645.3	37	c.1018C>A	CCDS6171.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.909214	0.33721	.	.	ENSG00000167910	ENST00000301645	T	0.72505	-0.66	5.74	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.81153	0.4763	M	0.79475	2.455	0.54753	D	0.999981	D	0.76494	0.999	D	0.77557	0.99	T	0.79960	-0.1583	10	0.56958	D	0.05	-11.4367	7.5527	0.27806	0.1354:0.0:0.7297:0.135	.	340	P22680	CP7A1_HUMAN	M	340	ENSP00000301645:L340M	ENSP00000301645:L340M	L	-	1	2	CYP7A1	59569640	0.997000	0.39634	0.904000	0.35570	0.085000	0.17905	2.513000	0.45494	0.786000	0.33708	-0.803000	0.03203	CTG		0.353	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780		6	53	1	0	0.00116845	0.001168	0.00127534	6	53				
CPA6	57094	broad.mit.edu	37	8	68423860	68423860	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:68423860C>A	ENST00000297770.4	-	4	563	c.348G>T	c.(346-348)ctG>ctT	p.L116L	CPA6_ENST00000518549.1_Silent_p.L116L|CPA6_ENST00000297769.4_5'UTR	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	116						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TTCCCTTCTCCAGTGTTTTCT	0.383																																							uc003xxq.3		NA																	0				ovary(2)	2						c.(346-348)CTG>CTT		carboxypeptidase A6 isoform 1 precursor							181.0	186.0	185.0					8																	68423860		2203	4300	6503	SO:0001819	synonymous_variant	57094				proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding	g.chr8:68423860C>A	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.348G>T	8.37:g.68423860C>A			Somatic				CPA6_uc003xxr.3_5'UTR|CPA6_uc003xxs.2_Silent_p.L116L	p.L116L	NM_020361	NP_065094	WXS	Illumina HiSeq	Unspecified	Q8N4T0	CBPA6_HUMAN	Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)		4	604	-			116					Q8NEX8|Q8TDE8|Q9NRI9	Silent	SNP	ENST00000297770.4	37	c.348G>T	CCDS6200.1																																																																																				0.383	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361		27	236	1	0	9.39395e-14	0.00632	1.41318e-13	27	236				
ZFHX4	79776	broad.mit.edu	37	8	77618376	77618376	+	Missense_Mutation	SNP	A	A	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:77618376A>T	ENST00000521891.2	+	2	2501	c.2053A>T	c.(2053-2055)Agg>Tgg	p.R685W	ZFHX4_ENST00000050961.6_Missense_Mutation_p.R685W|ZFHX4_ENST00000518282.1_Missense_Mutation_p.R685W|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000455469.2_Missense_Mutation_p.R685W	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	685					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCCTCACCCCAGGCTTGCCCG	0.502										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(2053-2055)AGG>TGG		zinc finger homeodomain 4							43.0	47.0	46.0					8																	77618376		2112	4257	6369	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77618376A>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2053A>T	8.37:g.77618376A>T	ENSP00000430497:p.Arg685Trp	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yat.1_Missense_Mutation_p.R685W|ZFHX4_uc003yau.1_Missense_Mutation_p.R685W|ZFHX4_uc003yaw.1_Missense_Mutation_p.R685W	p.R685W	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		2	2440	+			685					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.2053A>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	13.76	2.333834	0.41297	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.57436	0.45;0.44;0.41;0.4	5.0	2.39	0.29439	.	0.000000	0.45867	U	0.000337	T	0.70780	0.3263	M	0.79805	2.47	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.999;0.999;1.0	T	0.74902	-0.3506	10	0.87932	D	0	.	11.7325	0.51746	0.4583:0.5417:0.0:0.0	.	685;685;685;685	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	W	685	ENSP00000430497:R685W;ENSP00000399605:R685W;ENSP00000050961:R685W;ENSP00000430848:R685W	ENSP00000050961:R685W	R	+	1	2	ZFHX4	77780931	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.177000	0.58276	0.993000	0.38866	0.533000	0.62120	AGG		0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		6	77	0	0	0	0.001168	0	6	77				
RUNX1T1	862	broad.mit.edu	37	8	93026891	93026891	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:93026891C>A	ENST00000523629.1	-	4	838	c.384G>T	c.(382-384)agG>agT	p.R128S	RUNX1T1_ENST00000518844.1_Missense_Mutation_p.R101S|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.R101S|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.R91S|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.R128S|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.R139S|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.R91S|RUNX1T1_ENST00000521553.1_Missense_Mutation_p.R91S|RUNX1T1_ENST00000522163.1_5'Flank|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.R91S	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	128	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TAGTAAGGAACCTTTTCAGCT	0.522																																							uc003yfd.2		NA																	0				lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16						c.(382-384)AGG>AGT		acute myelogenous leukemia 1 translocation 1							93.0	89.0	90.0					8																	93026891		2203	4300	6503	SO:0001583	missense	862				generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:93026891C>A	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.384G>T	8.37:g.93026891C>A	ENSP00000428543:p.Arg128Ser		Somatic				RUNX1T1_uc003yfc.1_Missense_Mutation_p.R101S|RUNX1T1_uc003yfe.1_Missense_Mutation_p.R91S|RUNX1T1_uc010mao.2_Missense_Mutation_p.R101S|RUNX1T1_uc011lgi.1_Missense_Mutation_p.R139S|RUNX1T1_uc003yfh.1_Missense_Mutation_p.R91S|RUNX1T1_uc003yfb.1_Missense_Mutation_p.R91S|RUNX1T1_uc003yff.1_Missense_Mutation_p.R91S|RUNX1T1_uc003yfg.1_Missense_Mutation_p.R91S	p.R128S	NM_175634	NP_783552	WXS	Illumina HiSeq	Unspecified	Q06455	MTG8_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0141)		3	468	-			128	R->D: Loss of interaction with TCF12.		TAFH.		B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	c.384G>T	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024401	0.75390	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844;ENST00000521553;ENST00000518992;ENST00000521054;ENST00000519847;ENST00000517792;ENST00000522467;ENST00000517919;ENST00000521733;ENST00000520556	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	6.05	0.634	0.17718	TAFH/NHR1 (3);	0.000000	0.85682	D	0.000000	T	0.59169	0.2174	M	0.77103	2.36	0.80722	D	1	P;P;D;P;P	0.61697	0.542;0.915;0.99;0.915;0.695	P;P;D;D;P	0.73380	0.752;0.899;0.98;0.943;0.788	T	0.55379	-0.8150	10	0.46703	T	0.11	-15.7826	2.8554	0.05571	0.3922:0.193:0.0:0.4148	.	139;139;101;128;101	E7EPN4;B7Z4P4;B2R6I9;Q06455;Q06455-2	.;.;.;MTG8_HUMAN;.	S	128;101;128;91;91;91;139;101;91;128;91;128;91;128;128;101;91	ENSP00000428543:R128S;ENSP00000379520:R101S;ENSP00000265814:R128S;ENSP00000353504:R91S;ENSP00000390137:R91S;ENSP00000428742:R91S;ENSP00000402257:R139S;ENSP00000430728:R101S;ENSP00000429728:R91S;ENSP00000431094:R128S;ENSP00000427763:R91S;ENSP00000430204:R128S;ENSP00000429940:R91S;ENSP00000429532:R128S	ENSP00000265814:R128S	R	-	3	2	RUNX1T1	93096067	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.685000	0.25378	0.183000	0.20059	0.650000	0.86243	AGG		0.522	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635		29	106	1	0	7.26314e-15	0.007291	1.1219e-14	29	106				
GRHL2	79977	broad.mit.edu	37	8	102570830	102570830	+	Silent	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:102570830G>T	ENST00000251808.3	+	4	806	c.468G>T	c.(466-468)acG>acT	p.T156T	GRHL2_ENST00000395927.1_Silent_p.T140T	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	156					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			CGGGAATCACGGTGGTGAAAG	0.522																																							uc010mbu.2		NA																	0				ovary(2)|skin(1)	3						c.(466-468)ACG>ACT		transcription factor CP2-like 3							107.0	100.0	103.0					8																	102570830		2203	4300	6503	SO:0001819	synonymous_variant	79977					cytoplasm|nucleus	DNA binding	g.chr8:102570830G>T	AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.468G>T	8.37:g.102570830G>T			Somatic				GRHL2_uc011lhi.1_Silent_p.T156T	p.T156T	NM_024915	NP_079191	WXS	Illumina HiSeq	Unspecified	Q6ISB3	GRHL2_HUMAN	Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)		4	798	+	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		156					A1L303|Q6NT03|Q9H8B8	Silent	SNP	ENST00000251808.3	37	c.468G>T	CCDS34931.1																																																																																				0.522	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313882.1	NM_024915		79	76	1	0	1.63007e-36	0.00361	2.71156e-36	79	76				
PKHD1L1	93035	broad.mit.edu	37	8	110451174	110451174	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:110451174C>G	ENST00000378402.5	+	32	3913	c.3809C>G	c.(3808-3810)aCa>aGa	p.T1270R		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1270	IPT/TIG 6.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.T1272R(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AATGAACTCACACAAAACATG	0.343										HNSCC(38;0.096)																													uc003yne.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(3808-3810)ACA>AGA		fibrocystin L precursor							61.0	59.0	59.0					8																	110451174		1812	4067	5879	SO:0001583	missense	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110451174C>G	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3809C>G	8.37:g.110451174C>G	ENSP00000367655:p.Thr1270Arg	HNSCC(38;0.096)	Somatic					p.T1270R	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		32	3913	+			1270			Extracellular (Potential).|IPT/TIG 6.		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.3809C>G	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	8.166	0.790503	0.16258	.	.	ENSG00000205038	ENST00000378402	T	0.77358	-1.09	6.07	2.18	0.27775	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.593501	0.16570	N	0.208667	T	0.66519	0.2797	L	0.52759	1.655	0.09310	N	0.999996	B	0.28055	0.199	B	0.26693	0.072	T	0.50825	-0.8782	10	0.21014	T	0.42	.	6.745	0.23456	0.2732:0.6089:0.0:0.1179	.	1270	Q86WI1	PKHL1_HUMAN	R	1270	ENSP00000367655:T1270R	ENSP00000367655:T1270R	T	+	2	0	PKHD1L1	110520350	0.385000	0.25172	0.749000	0.31150	0.752000	0.42762	0.548000	0.23314	0.840000	0.34995	0.655000	0.94253	ACA		0.343	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		50	30	0	0	0	0.00361	0	50	30				
CSMD3	114788	broad.mit.edu	37	8	113275890	113275890	+	Missense_Mutation	SNP	A	A	C			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:113275890A>C	ENST00000297405.5	-	61	10084	c.9840T>G	c.(9838-9840)agT>agG	p.S3280R	CSMD3_ENST00000352409.3_Missense_Mutation_p.S3210R|CSMD3_ENST00000455883.2_Missense_Mutation_p.S3111R|CSMD3_ENST00000343508.3_Missense_Mutation_p.S3240R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3280	Sushi 25. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S3240R(2)|p.S3280R(2)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTACTTCACCACTCCAGGTAC	0.393										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(9838-9840)AGT>AGG		CUB and Sushi multiple domains 3 isoform 1							94.0	80.0	85.0					8																	113275890		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113275890A>C	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9840T>G	8.37:g.113275890A>C	ENSP00000297405:p.Ser3280Arg	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.S2482R|CSMD3_uc003ynt.2_Missense_Mutation_p.S3240R|CSMD3_uc011lhx.1_Missense_Mutation_p.S3111R	p.S3280R	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			61	9999	-			3280			Sushi 25.|Extracellular (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.9840T>G	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	12.91	2.078644	0.36662	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35	5.76	4.61	0.57282	Complement control module (2);Sushi/SCR/CCP (3);	0.054580	0.64402	D	0.000001	T	0.65196	0.2668	M	0.67569	2.06	0.45554	D	0.998504	B;B;B	0.18461	0.009;0.011;0.028	B;B;B	0.25405	0.027;0.06;0.028	T	0.62572	-0.6826	10	0.52906	T	0.07	.	11.5193	0.50541	0.9305:0.0:0.0695:0.0	.	3111;3280;3240	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	R	3240;3280;2550;3111;3210	ENSP00000345799:S3240R;ENSP00000297405:S3280R;ENSP00000341558:S2550R;ENSP00000412263:S3111R;ENSP00000343124:S3210R	ENSP00000297405:S3280R	S	-	3	2	CSMD3	113345066	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.750000	0.38329	1.017000	0.39495	0.533000	0.62120	AGT		0.393	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		7	41	0	0	0	0.001984	0	7	41				
COL14A1	7373	broad.mit.edu	37	8	121259915	121259915	+	Missense_Mutation	SNP	C	C	T	rs369592872		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:121259915C>T	ENST00000297848.3	+	21	2813	c.2543C>T	c.(2542-2544)aCg>aTg	p.T848M	COL14A1_ENST00000309791.4_Missense_Mutation_p.T848M|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000247781.3_Missense_Mutation_p.T753M	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TTGCGCATTACGTGGGACCCC	0.468																																							uc003yox.2		NA																	0				ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(2542-2544)ACG>ATG		collagen, type XIV, alpha 1 precursor		C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	107.0	95.0	99.0		2543	5.5	0.4	8		99	0,8600		0,0,4300	no	missense	COL14A1	NM_021110.1	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	848/1797	121259915	1,13005	2203	4300	6503	SO:0001583	missense	7373				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	g.chr8:121259915C>T		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2543C>T	8.37:g.121259915C>T	ENSP00000297848:p.Thr848Met		Somatic				COL14A1_uc003yoy.2_Missense_Mutation_p.T526M	p.T848M	NM_021110	NP_066933	WXS	Illumina HiSeq	Unspecified	Q05707	COEA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		21	2808	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		848			Fibronectin type-III 7.			Missense_Mutation	SNP	ENST00000297848.3	37	c.2543C>T	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396927	0.62177	2.27E-4	0.0	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	5.47	5.47	0.80525	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.561096	0.18566	N	0.137468	T	0.67221	0.2870	L	0.59436	1.845	0.80722	D	1	D;P	0.56746	0.977;0.95	P;P	0.54401	0.647;0.751	T	0.68827	-0.5306	10	0.66056	D	0.02	.	15.5548	0.76184	0.0:0.8238:0.1762:0.0	.	848;848	Q05707-2;Q05707	.;COEA1_HUMAN	M	848;848;753;661	ENSP00000311809:T848M;ENSP00000297848:T848M;ENSP00000247781:T753M;ENSP00000409461:T661M	ENSP00000247781:T753M	T	+	2	0	COL14A1	121329096	0.958000	0.32768	0.447000	0.26932	0.620000	0.37586	2.014000	0.40951	2.745000	0.94114	0.462000	0.41574	ACG		0.468	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		38	84	0	0	0	0.007835	0	38	84				
TBC1D2	55357	broad.mit.edu	37	9	100971119	100971119	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr9:100971119C>T	ENST00000375064.1	-	9	2019	c.1981G>A	c.(1981-1983)Gcc>Acc	p.A661T	TBC1D2_ENST00000493589.2_5'UTR|TBC1D2_ENST00000375066.5_Missense_Mutation_p.A661T|TBC1D2_ENST00000375063.1_Missense_Mutation_p.A201T|TBC1D2_ENST00000342112.5_Missense_Mutation_p.A443T	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	661	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		TGCTCGCGGGCCTGGCCCCGG	0.652																																							uc011lvb.1		NA																	0				ovary(3)	3						c.(1981-1983)GCC>ACC		TBC1 domain family, member 2							77.0	75.0	76.0					9																	100971119		2203	4300	6503	SO:0001583	missense	55357					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity	g.chr9:100971119C>T	AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.1981G>A	9.37:g.100971119C>T	ENSP00000364205:p.Ala661Thr		Somatic				TBC1D2_uc004ayp.2_Missense_Mutation_p.A201T|TBC1D2_uc004ayq.2_Missense_Mutation_p.A661T|TBC1D2_uc004ayr.2_Missense_Mutation_p.A443T|TBC1D2_uc004ayo.3_Missense_Mutation_p.A661T	p.A661T	NM_018421	NP_060891	WXS	Illumina HiSeq	Unspecified	Q9BYX2	TBD2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)	9	2161	-		Myeloproliferative disorder(762;0.0255)	661			Rab-GAP TBC.		B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Missense_Mutation	SNP	ENST00000375064.1	37	c.1981G>A		.	.	.	.	.	.	.	.	.	.	C	0.812	-0.751555	0.03041	.	.	ENSG00000095383	ENST00000375064;ENST00000375066;ENST00000342112;ENST00000375063	T;T;T;T	0.11604	2.76;2.76;2.76;2.76	5.7	0.0635	0.14349	Rab-GAP/TBC domain (4);	0.492914	0.23418	N	0.048393	T	0.03739	0.0106	N	0.02296	-0.605	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.002	T	0.43637	-0.9379	10	0.22109	T	0.4	.	10.7677	0.46303	0.0:0.5543:0.0:0.4457	.	661;661	Q9BYX2;Q9BYX2-2	TBD2A_HUMAN;.	T	661;661;443;201	ENSP00000364205:A661T;ENSP00000364207:A661T;ENSP00000341567:A443T;ENSP00000364203:A201T	ENSP00000341567:A443T	A	-	1	0	TBC1D2	100010940	0.000000	0.05858	0.201000	0.23476	0.036000	0.12997	-0.060000	0.11712	0.079000	0.16929	-0.137000	0.14449	GCC		0.652	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053366.1	NM_018421		9	37	0	0	0	0.006214	0	9	37				
ABCA1	19	broad.mit.edu	37	9	107602707	107602707	+	Missense_Mutation	SNP	C	C	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr9:107602707C>T	ENST00000374736.3	-	9	1301	c.907G>A	c.(907-909)Gct>Act	p.A303T		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	303					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CGAGACACAGCCTGGTAGATT	0.537																																							uc004bcl.2		NA																	0				large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17						c.(907-909)GCT>ACT		ATP-binding cassette, sub-family A member 1	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						97.0	74.0	82.0					9																	107602707		2203	4300	6503	SO:0001583	missense	19				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding	g.chr9:107602707C>T	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.907G>A	9.37:g.107602707C>T	ENSP00000363868:p.Ala303Thr		Somatic					p.A303T	NM_005502	NP_005493	WXS	Illumina HiSeq	Unspecified	O95477	ABCA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;0.023)	9	1220	-			303			Extracellular.		Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	c.907G>A	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	C	19.39	3.819060	0.71028	.	.	ENSG00000165029	ENST00000374736	D	0.88354	-2.37	5.19	4.28	0.50868	.	0.000000	0.85682	D	0.000000	D	0.88093	0.6344	M	0.81942	2.565	0.80722	D	1	P	0.42483	0.781	B	0.37387	0.248	D	0.86191	0.1612	10	0.21540	T	0.41	.	15.6497	0.77081	0.0:0.8622:0.1378:0.0	.	303	O95477	ABCA1_HUMAN	T	303	ENSP00000363868:A303T	ENSP00000363868:A303T	A	-	1	0	ABCA1	106642528	1.000000	0.71417	0.994000	0.49952	0.963000	0.63663	7.487000	0.81328	1.165000	0.42670	0.655000	0.94253	GCT		0.537	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502		10	34	0	0	0	0.008291	0	10	34				
KIAA0368	23392	broad.mit.edu	37	9	114134778	114134778	+	Missense_Mutation	SNP	C	C	G			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr9:114134778C>G	ENST00000338205.5	-	41	4678	c.4459G>C	c.(4459-4461)Gct>Cct	p.A1487P	KIAA0368_ENST00000465499.1_5'Flank|KIAA0368_ENST00000259335.4_Missense_Mutation_p.A1665P|KIAA0368_ENST00000374378.3_5'UTR			Q5VYK3	ECM29_HUMAN	KIAA0368	1493					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TCCTCATCAGCAATTTCATGC	0.413																																							uc004bfe.1		NA																	0					0						c.(4993-4995)GCT>CCT		KIAA0368 protein							112.0	105.0	107.0					9																	114134778		1846	4095	5941	SO:0001583	missense	23392							g.chr9:114134778C>G	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.4459G>C	9.37:g.114134778C>G	ENSP00000339889:p.Ala1487Pro		Somatic					p.A1665P	NM_001080398	NP_001073867	WXS	Illumina HiSeq	Unspecified					43	4993	-								O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37	c.4993G>C		.	.	.	.	.	.	.	.	.	.	C	12.93	2.085494	0.36758	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000543827	T	0.64260	-0.09	5.95	1.86	0.25419	.	0.412424	0.26251	N	0.025442	T	0.36082	0.0954	N	0.17082	0.46	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.07121	-1.0789	10	0.27082	T	0.32	.	1.6789	0.02827	0.3271:0.3655:0.1585:0.149	.	962	B3KXF2	.	P	1487;1665;962	ENSP00000259335:A1665P	ENSP00000259335:A1665P	A	-	1	0	KIAA0368	113174599	0.780000	0.28664	0.995000	0.50966	0.966000	0.64601	0.394000	0.20834	0.404000	0.25506	0.655000	0.94253	GCT		0.413	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686		12	47	0	0	0	0.000978	0	12	47				
DNAJC25	548645	broad.mit.edu	37	9	114411817	114411817	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr9:114411817G>A	ENST00000313525.3	+	3	630	c.574G>A	c.(574-576)Gcc>Acc	p.A192T	DNAJC25_ENST00000556107.1_Intron|DNAJC25-GNG10_ENST00000374294.3_Intron	NM_001015882.2	NP_001015882.2	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25	192						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(1)|skin(4)	8						TACAGAGATTGCCAAGCAGCA	0.413																																							uc004bfl.2		NA																	0					0						c.(574-576)GCC>ACC		DnaJ (Hsp40) homolog, subfamily C , member 25							45.0	43.0	44.0					9																	114411817		1854	4103	5957	SO:0001583	missense	548645				protein folding	integral to membrane	heat shock protein binding|unfolded protein binding	g.chr9:114411817G>A		CCDS43862.1	9q31.3	2011-09-02			ENSG00000059769	ENSG00000059769		"""Heat shock proteins / DNAJ (HSP40)"""	34187	protein-coding gene	gene with protein product							Standard	NM_001015882		Approved	bA16L21.2.1	uc004bfl.3	Q9H1X3	OTTHUMG00000020491	ENST00000313525.3:c.574G>A	9.37:g.114411817G>A	ENSP00000320650:p.Ala192Thr		Somatic				DNAJC25-GNG10_uc004bfn.2_Intron|DNAJC25_uc004bfm.2_Missense_Mutation_p.A70T	p.A192T	NM_001015882	NP_001015882	WXS	Illumina HiSeq	Unspecified	Q9H1X3	DJC25_HUMAN			3	630	+			192					Q5QTD8|Q96BN9	Missense_Mutation	SNP	ENST00000313525.3	37	c.574G>A	CCDS43862.1	.	.	.	.	.	.	.	.	.	.	G	34	5.366035	0.95900	.	.	ENSG00000059769	ENST00000313525	T	0.49432	0.78	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.73908	0.3647	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.75056	-0.3452	10	0.59425	D	0.04	-28.2992	19.0599	0.93085	0.0:0.0:1.0:0.0	.	192	Q9H1X3	DJC25_HUMAN	T	192	ENSP00000320650:A192T	ENSP00000320650:A192T	A	+	1	0	DNAJC25	113451638	1.000000	0.71417	0.995000	0.50966	0.978000	0.69477	9.397000	0.97276	2.941000	0.99782	0.655000	0.94253	GCC		0.413	DNAJC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156218.3	NM_001015882		5	12	0	0	0	0.000602	0	5	12				
OR1N2	138882	broad.mit.edu	37	9	125316283	125316284	+	Missense_Mutation	DNP	CC	CC	AA	rs142706201		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr9:125316283_125316284CC>AA	ENST00000373688.2	+	1	893_894	c.835_836CC>AA	c.(835-837)CCt>AAt	p.P279N		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						GTATTTACTTCCTCCATCAACT	0.46																																							uc011lyx.1		NA																	0				ovary(2)|skin(2)	4						c.(835-837)CCT>AAT		olfactory receptor, family 1, subfamily N,																																				SO:0001583	missense	138882				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125316283_125316284CC>AA		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	Exception_encountered	9.37:g.125316283_125316284delinsAA	ENSP00000362792:p.Pro279Asn		Somatic					p.P279N	NM_001004457	NP_001004457	WXS	Illumina HiSeq	Unspecified	Q8NGR9	OR1N2_HUMAN			1	835_836	+			279			Extracellular (Potential).		A3KFM2|B2RNY4|Q6IF17|Q96RA3	Missense_Mutation	DNP	ENST00000373688.2	37	c.835_836CC>AA	CCDS35123.1																																																																																				0.460	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2			17	51	0	0	0	0.004672	0	17	51				
OR1K1	392392	broad.mit.edu	37	9	125562914	125562914	+	Silent	SNP	T	T	G	rs575348318		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr9:125562914T>G	ENST00000277309.2	+	1	545	c.513T>G	c.(511-513)gcT>gcG	p.A171A		NM_080859.1	NP_543135.1	Q8NGR3	OR1K1_HUMAN	olfactory receptor, family 1, subfamily K, member 1	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(8)|lung(2)|ovary(1)|skin(4)|stomach(1)	17						CCTTCTGTGCTTCCCACCAAG	0.607																																							uc011lze.1		NA																	0				ovary(1)	1						c.(511-513)GCT>GCG		olfactory receptor, family 1, subfamily K,							150.0	96.0	114.0					9																	125562914		2203	4300	6503	SO:0001819	synonymous_variant	392392				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125562914T>G	AL359512	CCDS35132.1	9q33	2013-09-20			ENSG00000165204	ENSG00000165204		"""GPCR / Class A : Olfactory receptors"""	8212	protein-coding gene	gene with protein product							Standard	NM_080859		Approved	hg99, MNAB	uc011lze.2	Q8NGR3	OTTHUMG00000020625	ENST00000277309.2:c.513T>G	9.37:g.125562914T>G			Somatic					p.A171A	NM_080859	NP_543135	WXS	Illumina HiSeq	Unspecified	Q8NGR3	OR1K1_HUMAN			1	513	+			171			Extracellular (Potential).		B9EH41|Q4VXB7|Q96R23	Silent	SNP	ENST00000277309.2	37	c.513T>G	CCDS35132.1																																																																																				0.607	OR1K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053958.1			28	63	0	0	0	0.008361	0	28	63				
CRB2	286204	broad.mit.edu	37	9	126125320	126125320	+	Missense_Mutation	SNP	G	G	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr9:126125320G>A	ENST00000373631.3	+	2	272	c.271G>A	c.(271-273)Ggc>Agc	p.G91S	CRB2_ENST00000359999.3_Missense_Mutation_p.G91S	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	91	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						AGATCCCACCGGCTTCCGCTG	0.692																																							uc004bnx.1		NA																	0				ovary(1)	1						c.(271-273)GGC>AGC		crumbs homolog 2 precursor							41.0	40.0	41.0					9																	126125320		2201	4298	6499	SO:0001583	missense	286204					extracellular region|integral to membrane|plasma membrane	calcium ion binding	g.chr9:126125320G>A	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.271G>A	9.37:g.126125320G>A	ENSP00000362734:p.Gly91Ser		Somatic				CRB2_uc004bnw.1_Missense_Mutation_p.G91S	p.G91S	NM_173689	NP_775960	WXS	Illumina HiSeq	Unspecified	Q5IJ48	CRUM2_HUMAN			2	363	+			91			Extracellular (Potential).|EGF-like 1.		A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	c.271G>A	CCDS6852.2	.	.	.	.	.	.	.	.	.	.	G	7.759	0.704887	0.15172	.	.	ENSG00000148204	ENST00000359999;ENST00000373631	D;D	0.84442	-1.85;-1.85	4.7	1.72	0.24424	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.510568	0.16431	N	0.214718	T	0.65923	0.2738	N	0.20304	0.555	0.09310	N	1	B;B	0.23891	0.029;0.093	B;B	0.17098	0.003;0.017	T	0.52358	-0.8586	10	0.02654	T	1	.	4.8563	0.13561	0.2717:0.1563:0.5719:0.0	.	91;91	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	S	91	ENSP00000353092:G91S;ENSP00000362734:G91S	ENSP00000353092:G91S	G	+	1	0	CRB2	125165141	0.002000	0.14202	0.041000	0.18516	0.102000	0.19082	0.132000	0.15891	0.576000	0.29452	0.448000	0.29417	GGC		0.692	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689		8	40	0	0	0	0.004482	0	8	40				
MAGEB4	4115	broad.mit.edu	37	X	30260330	30260330	+	Missense_Mutation	SNP	G	G	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chrX:30260330G>T	ENST00000378982.2	+	1	274	c.78G>T	c.(76-78)aaG>aaT	p.K26N	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	26										breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						AGGATCTCAAGGTTGGTCAGC	0.562																																							uc004dcb.2		NA																	0				ovary(1)	1						c.(76-78)AAG>AAT		melanoma antigen family B, 4							108.0	88.0	95.0					X																	30260330		2202	4300	6502	SO:0001583	missense	4115							g.chrX:30260330G>T		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.78G>T	X.37:g.30260330G>T	ENSP00000368266:p.Lys26Asn		Somatic				MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	p.K26N	NM_002367	NP_002358	WXS	Illumina HiSeq	Unspecified	O15481	MAGB4_HUMAN			1	162	+			26					B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	37	c.78G>T	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	G	4.343	0.063126	0.08388	.	.	ENSG00000120289	ENST00000378982	T	0.04317	3.65	3.37	-1.9	0.07665	Melanoma associated antigen, MAGE, N-terminal (1);	1.217380	0.07062	U	0.833901	T	0.02848	0.0085	N	0.21282	0.65	0.09310	N	1	B	0.12630	0.006	B	0.21360	0.034	T	0.48790	-0.9004	10	0.18710	T	0.47	.	0.4967	0.00573	0.3709:0.1781:0.2679:0.1831	.	26	O15481	MAGB4_HUMAN	N	26	ENSP00000368266:K26N	ENSP00000368266:K26N	K	+	3	2	MAGEB4	30170251	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.763000	0.04740	-0.658000	0.05366	-0.351000	0.07748	AAG		0.562	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367		16	4	1	0	6.31663e-08	0.003163	8.12473e-08	16	4				
PCDH11X	27328	broad.mit.edu	37	X	91873753	91873753	+	Silent	SNP	T	T	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chrX:91873753T>A	ENST00000373094.1	+	7	4703	c.3858T>A	c.(3856-3858)gcT>gcA	p.A1286A	PCDH11X_ENST00000373097.1_Silent_p.A1276A|PCDH11X_ENST00000361655.2_Silent_p.A1268A|PCDH11X_ENST00000373088.1_Silent_p.A1249A|PCDH11X_ENST00000298274.8_Silent_p.A1249A|PCDH11X_ENST00000406881.1_Silent_p.A1278A|PCDH11X_ENST00000504220.2_3'UTR	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1286					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						TGCAAGGTGCTGATGGGCTAT	0.488																																					NSCLC(38;925 1092 2571 38200 45895)	NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	0				large_intestine(2)	2						c.(3856-3858)GCT>GCA		protocadherin 11 X-linked isoform c							321.0	278.0	293.0					X																	91873753		2203	4300	6503	SO:0001819	synonymous_variant	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91873753T>A	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3858T>A	X.37:g.91873753T>A			Somatic				PCDH11X_uc004efl.1_Silent_p.A1276A|PCDH11X_uc004efo.1_Silent_p.A1249A|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Silent_p.A1278A|PCDH11X_uc004efn.1_Silent_p.A1268A	p.A1286A	NM_032968	NP_116750	WXS	Illumina HiSeq	Unspecified	Q9BZA7	PC11X_HUMAN			7	4703	+			1286			Cytoplasmic (Potential).		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	37	c.3858T>A	CCDS14461.1																																																																																				0.488	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		59	123	0	0	0	0.00361	0	59	123				
RHOXF1	158800	broad.mit.edu	37	X	119249424	119249424	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chrX:119249424C>A	ENST00000217999.2	-	1	423	c.349G>T	c.(349-351)Gag>Tag	p.E117*	GS1-421I3.4_ENST00000422226.1_lincRNA|RP4-755D9.1_ENST00000553843.1_RNA	NM_139282.1	NP_644811.1	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	117					gamete generation (GO:0007276)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|sexual reproduction (GO:0019953)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10						CTTTCCAGCTCCTCCACCTGC	0.617																																							uc004esk.1		NA																	0					0						c.(349-351)GAG>TAG		Rhox homeobox family, member 1							75.0	64.0	67.0					X																	119249424		2203	4299	6502	SO:0001587	stop_gained	158800				gamete generation|multicellular organismal development|steroid hormone receptor signaling pathway	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:119249424C>A		CCDS14593.1	Xq24	2011-06-20			ENSG00000101883	ENSG00000101883		"""Homeoboxes / PRD class"""	29993	protein-coding gene	gene with protein product		300446				11980563, 12490318	Standard	NM_139282		Approved	OTEX, PEPP1	uc004esk.2	Q8NHV9	OTTHUMG00000022290	ENST00000217999.2:c.349G>T	X.37:g.119249424C>A	ENSP00000217999:p.Glu117*		Somatic				uc004esi.1_Intron	p.E117*	NM_139282	NP_644811	WXS	Illumina HiSeq	Unspecified	Q8NHV9	RHXF1_HUMAN			1	424	-			117			Homeobox.		O95030|Q3SYE0	Nonsense_Mutation	SNP	ENST00000217999.2	37	c.349G>T	CCDS14593.1	.	.	.	.	.	.	.	.	.	.	c	15.83	2.949301	0.53186	.	.	ENSG00000101883	ENST00000217999	.	.	.	2.67	1.77	0.24775	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-41.1157	6.6105	0.22749	0.0:0.7049:0.2951:0.0	.	.	.	.	X	117	.	ENSP00000217999:E117X	E	-	1	0	RHOXF1	119133452	0.020000	0.18652	0.003000	0.11579	0.018000	0.09664	2.247000	0.43151	0.515000	0.28320	0.509000	0.49947	GAG		0.617	RHOXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058083.2	NM_139282		50	25	1	0	1.46156e-29	0.00361	2.40809e-29	50	25				
GPR112	139378	broad.mit.edu	37	X	135430302	135430302	+	Silent	SNP	A	A	C	rs149471297		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chrX:135430302A>C	ENST00000394143.1	+	6	4728	c.4437A>C	c.(4435-4437)acA>acC	p.T1479T	GPR112_ENST00000287534.4_Silent_p.T1416T|GPR112_ENST00000394141.1_Silent_p.T1274T|GPR112_ENST00000412101.1_Silent_p.T1274T|GPR112_ENST00000370652.1_Silent_p.T1479T	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1479					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACGGTTTTACAGTTCTCTCCG	0.443																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(4435-4437)ACA>ACC		G-protein coupled receptor 112							102.0	101.0	101.0					X																	135430302		2203	4300	6503	SO:0001819	synonymous_variant	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135430302A>C	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4437A>C	X.37:g.135430302A>C			Somatic				GPR112_uc010nsb.1_Silent_p.T1274T|GPR112_uc010nsc.1_Silent_p.T1246T	p.T1479T	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			6	4728	+	Acute lymphoblastic leukemia(192;0.000127)		1479			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	ENST00000394143.1	37	c.4437A>C	CCDS35409.1																																																																																				0.443	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			63	41	0	0	0	0.00361	0	63	41				
SLITRK2	84631	broad.mit.edu	37	X	144904123	144904123	+	Silent	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chrX:144904123C>A	ENST00000370490.1	+	1	4435	c.180C>A	c.(178-180)ccC>ccA	p.P60P	SLITRK2_ENST00000447897.2_Silent_p.P60P|SLITRK2_ENST00000434188.2_Silent_p.P60P|SLITRK2_ENST00000413937.2_Silent_p.P60P|SLITRK2_ENST00000428560.2_Silent_p.P60P			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	60					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TCCAGCCCCCCCAGTATCGAA	0.433																																							uc004fcd.2		NA																	0				ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(178-180)CCC>CCA		SLIT and NTRK-like family, member 2 precursor							89.0	81.0	84.0					X																	144904123		2203	4300	6503	SO:0001819	synonymous_variant	84631					integral to membrane		g.chrX:144904123C>A	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.180C>A	X.37:g.144904123C>A			Somatic				SLITRK2_uc010nsp.2_Silent_p.P60P|SLITRK2_uc010nso.2_Silent_p.P60P|SLITRK2_uc011mwq.1_Silent_p.P60P|SLITRK2_uc011mwr.1_Silent_p.P60P|SLITRK2_uc011mws.1_Silent_p.P60P|SLITRK2_uc004fcg.2_Silent_p.P60P|SLITRK2_uc011mwt.1_Silent_p.P60P	p.P60P	NM_032539	NP_115928	WXS	Illumina HiSeq	Unspecified	Q9H156	SLIK2_HUMAN			5	1170	+	Acute lymphoblastic leukemia(192;6.56e-05)		60			Extracellular (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Silent	SNP	ENST00000370490.1	37	c.180C>A	CCDS14680.1																																																																																				0.433	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		24	8	1	0	1.10513e-12	0.002299	1.63409e-12	24	8				
SLITRK2	84631	broad.mit.edu	37	X	144906140	144906140	+	Missense_Mutation	SNP	C	C	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chrX:144906140C>A	ENST00000370490.1	+	1	6452	c.2197C>A	c.(2197-2199)Cct>Act	p.P733T	TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000447897.2_Missense_Mutation_p.P733T|SLITRK2_ENST00000434188.2_Missense_Mutation_p.P733T|SLITRK2_ENST00000413937.2_Missense_Mutation_p.P733T|SLITRK2_ENST00000428560.2_Missense_Mutation_p.P733T			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	733					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GCCAGCCACACCTGCTTACAC	0.483																																							uc004fcd.2		NA																	0				ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(2197-2199)CCT>ACT		SLIT and NTRK-like family, member 2 precursor							116.0	118.0	117.0					X																	144906140		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144906140C>A	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2197C>A	X.37:g.144906140C>A	ENSP00000359521:p.Pro733Thr		Somatic				SLITRK2_uc010nsp.2_Missense_Mutation_p.P733T|SLITRK2_uc010nso.2_Missense_Mutation_p.P733T|SLITRK2_uc011mwq.1_Missense_Mutation_p.P733T|SLITRK2_uc011mwr.1_Missense_Mutation_p.P733T|SLITRK2_uc011mws.1_Missense_Mutation_p.P733T|SLITRK2_uc004fcg.2_Missense_Mutation_p.P733T|SLITRK2_uc011mwt.1_Missense_Mutation_p.P733T|CXorf1_uc004fch.2_5'Flank	p.P733T	NM_032539	NP_115928	WXS	Illumina HiSeq	Unspecified	Q9H156	SLIK2_HUMAN			5	3187	+	Acute lymphoblastic leukemia(192;6.56e-05)		733			Cytoplasmic (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.2197C>A	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	C	0.767	-0.767187	0.02974	.	.	ENSG00000185985	ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	5.34	3.51	0.40186	.	0.747484	0.12235	N	0.487066	T	0.27241	0.0668	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.27468	-1.0073	10	0.05620	T	0.96	-0.063	8.2371	0.31634	0.1672:0.5143:0.3185:0.0	.	733	Q9H156	SLIK2_HUMAN	T	733	ENSP00000411681:P733T;ENSP00000359521:P733T;ENSP00000397015:P733T;ENSP00000407347:P733T;ENSP00000412010:P733T	ENSP00000359521:P733T	P	+	1	0	SLITRK2	144713832	0.096000	0.21769	0.007000	0.13788	0.958000	0.62258	1.070000	0.30653	0.429000	0.26202	0.513000	0.50165	CCT		0.483	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		55	39	1	0	1.57914e-17	0.00361	2.48356e-17	55	39				
SEC24C	9632	broad.mit.edu	37	10	75506613	75506614	+	Frame_Shift_Ins	INS	-	-	A			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:75506613_75506614insA	ENST00000339365.2	+	3	185_186	c.23_24insA	c.(22-27)ccacctfs	p.P9fs	SEC24C_ENST00000546025.1_Intron|SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000345254.4_Frame_Shift_Ins_p.P9fs|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_5'UTR	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	9					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					CAGTCAGTTCCACCTGTGCCAC	0.495																																							uc001juw.2		NA																	0				skin(2)|central_nervous_system(1)	3						c.(22-24)CCAfs		SEC24-related protein C																																				SO:0001589	frameshift_variant	9632				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding	g.chr10:75506613_75506614insA	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.24dupA	10.37:g.75506614_75506614dupA	ENSP00000343405:p.Pro9fs		Somatic				SEC24C_uc010qkn.1_Intron|SEC24C_uc009xrj.1_5'UTR|SEC24C_uc001jux.2_Frame_Shift_Ins_p.P8fs|SEC24C_uc010qko.1_5'UTR|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron	p.P8fs	NM_004922	NP_004913	WXS	Illumina HiSeq	Unspecified	P53992	SC24C_HUMAN			3	202_203	+	Prostate(51;0.0112)		8					B4DZT4|Q8WV25	Frame_Shift_Ins	INS	ENST00000339365.2	37	c.23_24insA	CCDS7332.1																																																																																				0.495	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1			18	72	NA	NA	NA	NA	NA	18	72	---	---	---	---
ZNF511	118472	broad.mit.edu	37	10	135125341	135125342	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr10:135125341_135125342insAT	ENST00000359035.3	+	5	679_680	c.676_677insAT	c.(676-678)catfs	p.H226fs	ZNF511_ENST00000361518.5_Frame_Shift_Ins_p.H226fs|ZNF511_ENST00000368554.4_Frame_Shift_Ins_p.H161fs|TUBGCP2_ENST00000417178.2_5'Flank|ZNF511_ENST00000463816.2_3'UTR|TUBGCP2_ENST00000368563.2_5'Flank|TUBGCP2_ENST00000470829.1_5'Flank			Q8NB15	ZN511_HUMAN	zinc finger protein 511	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)		GATCTACAGACATAGGTCAGTG	0.574																																							uc001lml.1		NA																	0					0						c.(676-678)CATfs		SubName: Full=cDNA FLJ78327; SubName: Full=Zinc finger protein 511, isoform CRA_d;																																				SO:0001589	frameshift_variant	118472				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:135125341_135125342insAT	AK091711	CCDS7677.1	10q26.3	2010-04-12			ENSG00000198546	ENSG00000198546		"""Zinc fingers, C2H2-type"""	28445	protein-coding gene	gene with protein product						12477932	Standard	NM_145806		Approved	MGC30006	uc001lmj.1	Q8NB15	OTTHUMG00000019317	ENST00000359035.3:c.677_678dupAT	10.37:g.135125342_135125343dupAT	ENSP00000351929:p.His226fs		Somatic				TUBGCP2_uc001lmg.1_5'Flank|TUBGCP2_uc010qvc.1_5'Flank|TUBGCP2_uc009ybk.1_5'Flank|TUBGCP2_uc010qvd.1_5'Flank|TUBGCP2_uc001lmh.1_RNA|ZNF511_uc001lmj.1_Frame_Shift_Ins_p.H226fs|ZNF511_uc001lmk.1_3'UTR|ZNF511_uc001lmm.1_RNA	p.H226fs			WXS	Illumina HiSeq	Unspecified	Q8NB15	ZN511_HUMAN		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)	5	701_702	+		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	226					A8K8L5|Q8WUP1|Q96BV2	Frame_Shift_Ins	INS	ENST00000359035.3	37	c.676_677insAT																																																																																					0.574	ZNF511-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051143.1	NM_145806		26	111	NA	NA	NA	NA	NA	26	111	---	---	---	---
PRB3	5544	broad.mit.edu	37	12	11420746	11420746	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:11420746delG	ENST00000279573.7	-	3	572	c.437delC	c.(436-438)ccafs	p.P146fs	PRB3_ENST00000381842.3_Frame_Shift_Del_p.P146fs|PRB3_ENST00000538488.1_Frame_Shift_Del_p.P125fs|PRB3_ENST00000440870.3_Intron			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	146	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TCCTCCTTGTGGGGGTGGTCC	0.652																																							uc001qzs.2		NA																	0				skin(1)	1						c.(436-438)CCAfs		proline-rich protein BstNI subfamily 3							15.0	14.0	14.0					12																	11420746		1239	2855	4094	SO:0001589	frameshift_variant	5544					extracellular region	Gram-negative bacterial cell surface binding	g.chr12:11420746delG			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.437delC	12.37:g.11420746delG	ENSP00000279573:p.Pro146fs		Somatic				PRB4_uc001qzf.1_Intron	p.P146fs	NM_006249	NP_006240	WXS	Illumina HiSeq	Unspecified	Q04118	PRB3_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;0.201)		3	475	-			146			10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|5.|Pro-rich.		Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Frame_Shift_Del	DEL	ENST00000279573.7	37	c.437delC																																																																																					0.652	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5	NM_006249		8	150	NA	NA	NA	NA	NA	8	150	---	---	---	---
PRB3	5544	broad.mit.edu	37	12	11420809	11420809	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:11420809delG	ENST00000279573.7	-	3	509	c.374delC	c.(373-375)ccafs	p.P125fs	PRB3_ENST00000381842.3_Frame_Shift_Del_p.P125fs|PRB3_ENST00000538488.1_Intron|PRB3_ENST00000440870.3_Intron			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	125	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TCCTCCTTGTGGGGGTGGTCC	0.647																																							uc001qzs.2		NA																	0				skin(1)	1						c.(373-375)CCAfs		proline-rich protein BstNI subfamily 3							50.0	60.0	57.0					12																	11420809		1394	3197	4591	SO:0001589	frameshift_variant	5544					extracellular region	Gram-negative bacterial cell surface binding	g.chr12:11420809delG			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.374delC	12.37:g.11420809delG	ENSP00000279573:p.Pro125fs		Somatic				PRB4_uc001qzf.1_Intron	p.P125fs	NM_006249	NP_006240	WXS	Illumina HiSeq	Unspecified	Q04118	PRB3_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;0.201)		3	412	-			125			4.|10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.		Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Frame_Shift_Del	DEL	ENST00000279573.7	37	c.374delC																																																																																					0.647	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5	NM_006249		32	243	NA	NA	NA	NA	NA	32	243	---	---	---	---
SNW1	22938	broad.mit.edu	37	14	78205113	78205127	+	Splice_Site	DEL	ATTCATACCGGATAT	ATTCATACCGGATAT	-			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	ATTCATACCGGATAT	ATTCATACCGGATAT	-	-	ATTCATACCGGATAT	ATTCATACCGGATAT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr14:78205113_78205127delATTCATACCGGATAT	ENST00000261531.7	-	5	589_596	c.527_534delATATCCGGTATGAAT	c.(526-534)tatatccgg>t	p.YIR176del	SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000555761.1_Splice_Site_p.YIR176del|SNW1_ENST00000554775.1_Splice_Site_p.YIR14del	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	176	SNW.				cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TCTAGGCATGATTCATACCGGATATACTGAGCAGG	0.423																																							uc001xuf.2		NA																	0				ovary(1)	1						c.e5+1		SKI-interacting protein																																				SO:0001630	splice_region_variant	22938				negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding	g.chr14:78205113_78205127delATTCATACCGGATAT	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.533+1ATATCCGGTATGAAT>-	14.37:g.78205113_78205127delATTCATACCGGATAT			Somatic				SNW1_uc010tvm.1_Splice_Site_p.R103_splice|SNW1_uc010asu.2_Splice_Site_p.R16_splice|SNW1_uc010tvn.1_Splice_Site_p.R178_splice	p.R178_splice	NM_012245	NP_036377	WXS	Illumina HiSeq	Unspecified	Q13573	SNW1_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)	5	560	-								A8K8A9|Q13483|Q32N03|Q5D0D6	Splice_Site	DEL	ENST00000261531.7	37	c.533_splice	CCDS9867.1																																																																																				0.423	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	In_Frame_Del	10	34	NA	NA	NA	NA	NA	10	34	---	---	---	---
RHCG	51458	broad.mit.edu	37	15	90023607	90023608	+	Frame_Shift_Ins	INS	-	-	T			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr15:90023607_90023608insT	ENST00000268122.4	-	4	622_623	c.554_555insA	c.(553-555)cacfs	p.H185fs	RHCG_ENST00000544600.1_Frame_Shift_Ins_p.H185fs	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	185					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					CGCCAAATGTGTGGATGGTCAT	0.579																																							uc002bnz.2		NA																	0				kidney(1)	1						c.(553-555)CACfs		Rh family, C glycoprotein																																				SO:0001589	frameshift_variant	51458				amine transport|cellular ion homeostasis|epithelial cell differentiation|transepithelial ammonium transport	apical plasma membrane|basolateral plasma membrane|cytoplasmic vesicle|integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding	g.chr15:90023607_90023608insT	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.555dupA	15.37:g.90023608_90023608dupT	ENSP00000268122:p.His185fs		Somatic				RHCG_uc002bny.2_5'Flank|RHCG_uc002boa.2_RNA|RHCG_uc010bnq.1_Frame_Shift_Ins_p.H69fs	p.H185fs	NM_016321	NP_057405	WXS	Illumina HiSeq	Unspecified	Q9UBD6	RHCG_HUMAN			4	578_579	-	Lung NSC(78;0.0237)|all_lung(78;0.0478)		185			Helical; (Potential).		A8K4D4|Q6X3Y4	Frame_Shift_Ins	INS	ENST00000268122.4	37	c.554_555insA	CCDS10351.1																																																																																				0.579	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2	NM_016321		21	100	NA	NA	NA	NA	NA	21	100	---	---	---	---
RNF213	57674	broad.mit.edu	37	17	78291021	78291021	+	Frame_Shift_Del	DEL	G	G	-	rs377487562		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr17:78291021delG	ENST00000582970.1	+	16	2988	c.2845delG	c.(2845-2847)gcgfs	p.A949fs	RNF213_ENST00000456466.1_Frame_Shift_Del_p.A949fs|CTD-2047H16.2_ENST00000576808.1_RNA|RNF213_ENST00000508628.2_Frame_Shift_Del_p.A998fs|RNF213_ENST00000319921.4_Frame_Shift_Del_p.A949fs	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	949					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CCAATTCCCCGCGGAGCATGG	0.562																																							uc002jyf.2		NA																	0					NA						c.(2845-2847)GCGfs		hypothetical protein LOC57714							84.0	78.0	80.0					17																	78291021		2203	4298	6501	SO:0001589	frameshift_variant	0							g.chr17:78291021delG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.2845delG	17.37:g.78291021delG	ENSP00000464087:p.Ala949fs		Somatic				uc002jyg.1_Frame_Shift_Del_p.A680fs	p.A949fs	NM_020954	NP_066005	WXS	Illumina HiSeq	Unspecified					16	2988	+								C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Frame_Shift_Del	DEL	ENST00000582970.1	37	c.2845delG	CCDS58606.1																																																																																				0.562	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		15	61	NA	NA	NA	NA	NA	15	61	---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168106663	168106664	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	AC	AC	-	-	AC	AC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:168106663_168106664delAC	ENST00000409195.1	+	9	8850_8851	c.8761_8762delAC	c.(8761-8763)acafs	p.T2921fs	XIRP2_ENST00000409273.1_Frame_Shift_Del_p.T2699fs|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Frame_Shift_Del_p.T2921fs|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2746					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GCAAGAGATTACACAGAACAAA	0.381																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(8761-8763)ACAfs		xin actin-binding repeat containing 2 isoform 1																																				SO:0001589	frameshift_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168106663_168106664delAC	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.8761_8762delAC	2.37:g.168106665_168106666delAC	ENSP00000386840:p.Thr2921fs		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Frame_Shift_Del_p.T2746fs|XIRP2_uc010fpq.2_Frame_Shift_Del_p.T2699fs|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Frame_Shift_Del_p.T267fs	p.T2921fs	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	8779_8780	+			2746					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Frame_Shift_Del	DEL	ENST00000409195.1	37	c.8761_8762delAC	CCDS42769.1																																																																																				0.381	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		9	53	NA	NA	NA	NA	NA	9	53	---	---	---	---
ZSWIM2	151112	broad.mit.edu	37	2	187692746	187692746	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr2:187692746delC	ENST00000295131.2	-	9	1906	c.1867delG	c.(1867-1869)gagfs	p.E623fs		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	623					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			AAAGATAGCTCAGTACTTTTT	0.279																																							uc002upu.1		NA																	0				ovary(2)|skin(1)	3						c.(1867-1869)GAGfs		zinc finger, SWIM domain containing 2							39.0	42.0	41.0					2																	187692746		2173	4290	6463	SO:0001589	frameshift_variant	151112				apoptosis		zinc ion binding	g.chr2:187692746delC	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.1867delG	2.37:g.187692746delC	ENSP00000295131:p.Glu623fs		Somatic					p.E623fs	NM_182521	NP_872327	WXS	Illumina HiSeq	Unspecified	Q8NEG5	ZSWM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)		9	1907	-			623					B3KXV6|Q53SI3|Q57ZY3	Frame_Shift_Del	DEL	ENST00000295131.2	37	c.1867delG	CCDS33348.1																																																																																				0.279	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521		8	24	NA	NA	NA	NA	NA	8	24	---	---	---	---
FER1L6	654463	broad.mit.edu	37	8	124975538	124975538	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr8:124975538delG	ENST00000522917.1	+	3	303	c.97delG	c.(97-99)gcafs	p.A33fs	FER1L6_ENST00000399018.1_Frame_Shift_Del_p.A33fs	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	33						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TGACACTGAAGCACTGCAGGA	0.493																																							uc003yqw.2		NA																	0				ovary(5)|skin(5)|central_nervous_system(1)	11						c.(97-99)GCAfs		fer-1-like 6							160.0	155.0	156.0					8																	124975538		1970	4156	6126	SO:0001589	frameshift_variant	654463					integral to membrane		g.chr8:124975538delG	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.97delG	8.37:g.124975538delG	ENSP00000428280:p.Ala33fs		Somatic					p.A33fs	NM_001039112	NP_001034201	WXS	Illumina HiSeq	Unspecified	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		3	303	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		33			Cytoplasmic (Potential).			Frame_Shift_Del	DEL	ENST00000522917.1	37	c.97delG	CCDS43767.1																																																																																				0.493	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		17	110	NA	NA	NA	NA	NA	17	110	---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-50-7109-01A-11D-2036-08	TCGA-50-7109-11A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5efb21c5-9c0b-4442-b0cb-3c30b0869dba	49a93a1d-94d7-47f8-8e42-1585bde5d3ac	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		5	14	1	1	0.0381472	0.00308	0.0393998	5	14	NA	NA	NA	NA
