#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CAMTA1	23261	broad.mit.edu	37	1	7805023	7805023	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:7805023G>C	ENST00000303635.7	+	17	4518	c.4311G>C	c.(4309-4311)atG>atC	p.M1437I	CAMTA1_ENST00000439411.2_Missense_Mutation_p.M1437I|CAMTA1_ENST00000476864.1_Start_Codon_SNP_p.M1I	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1437					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GCAGTACAATGAGCTGGCTGG	0.517			T	WWTR1	epitheliod hemangioendothelioma																																		uc001aoi.2		NA		Dom	yes		1	1p36.31-p36.23	611501		calmodulin binding transcription activator 1			M					0				ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9						c.(4309-4311)ATG>ATC		calmodulin-binding transcription activator 1							115.0	101.0	106.0					1																	7805023		2203	4300	6503	SO:0001583	missense	23261				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding	g.chr1:7805023G>C	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.4311G>C	1.37:g.7805023G>C	ENSP00000306522:p.Met1437Ile		Somatic				CAMTA1_uc010nzv.1_Missense_Mutation_p.M524I|CAMTA1_uc001aok.3_Missense_Mutation_p.M480I|CAMTA1_uc001aoj.2_Missense_Mutation_p.M393I|CAMTA1_uc009vmf.2_Missense_Mutation_p.M41I	p.M1437I	NM_015215	NP_056030	WXS	Illumina HiSeq	Unspecified	Q9Y6Y1	CMTA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)	17	4518	+	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)	1437					A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	c.4311G>C	CCDS30576.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.930225|4.930225	0.92389|0.92389	.|.	.|.	ENSG00000171735|ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646;ENST00000476864|ENST00000495233;ENST00000490905	T;T;T|.	0.55413|.	1.99;1.82;0.52|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.76227|.	0.3958|.	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	P;P;D;D|.	0.65815|.	0.824;0.936;0.995;0.978|.	B;P;D;D|.	0.77004|.	0.372;0.885;0.989;0.909|.	T|.	0.75065|.	-0.3449|.	10|.	0.41790|.	T|.	0.15|.	-24.6153|-24.6153	19.2599|19.2599	0.93964|0.93964	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1437;500;393;1437|.	Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1|.	.;.;.;CMTA1_HUMAN|.	I|S	1437;1437;500;393;1|394;17	ENSP00000306522:M1437I;ENSP00000402561:M1437I;ENSP00000452319:M1I|.	ENSP00000306522:M1437I|.	M|X	+|+	3|2	0|2	CAMTA1|CAMTA1	7727610|7727610	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	9.516000|9.516000	0.98017|0.98017	2.549000|2.549000	0.85964|0.85964	0.655000|0.655000	0.94253|0.94253	ATG|TGA		0.517	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215		4	65	0	0	0	0.00024832	0	4	65				
PRAMEF12	390999	broad.mit.edu	37	1	12836075	12836075	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:12836075T>A	ENST00000357726.4	+	2	704	c.677T>A	c.(676-678)cTg>cAg	p.L226Q		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	226					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCCCCTTACCTGGGCCAGATG	0.522																																							uc001aui.2		NA																	0				ovary(3)	3						c.(676-678)CTG>CAG		PRAME family member 12							144.0	153.0	150.0					1																	12836075		2203	4300	6503	SO:0001583	missense	390999							g.chr1:12836075T>A		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.677T>A	1.37:g.12836075T>A	ENSP00000350358:p.Leu226Gln		Somatic					p.L226Q	NM_001080830	NP_001074299	WXS	Illumina HiSeq	Unspecified	O95522	PRA12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	2	704	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	226						Missense_Mutation	SNP	ENST00000357726.4	37	c.677T>A	CCDS41254.1	.	.	.	.	.	.	.	.	.	.	.	17.15	3.317158	0.60524	.	.	ENSG00000116726	ENST00000357726	T	0.01287	5.05	2.8	2.8	0.32819	.	0.000000	0.64402	D	0.000018	T	0.11196	0.0273	H	0.96048	3.76	0.26130	N	0.980422	D	0.89917	1.0	D	0.97110	1.0	T	0.04373	-1.0956	10	0.87932	D	0	.	7.4228	0.27081	0.0:0.0:0.0:1.0	.	226	O95522	PRA12_HUMAN	Q	226	ENSP00000350358:L226Q	ENSP00000350358:L226Q	L	+	2	0	PRAMEF12	12758662	0.634000	0.27190	0.622000	0.29159	0.407000	0.30961	1.359000	0.34113	1.517000	0.48917	0.260000	0.18958	CTG		0.522	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760		28	85	0	0	0	0.000878237	0	28	85				
CELA2A	63036	broad.mit.edu	37	1	15783627	15783627	+	Silent	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:15783627G>T	ENST00000359621.4	+	2	112	c.87G>T	c.(85-87)gtG>gtT	p.V29V	CELA2A_ENST00000497590.1_3'UTR	NM_033440.2	NP_254275.1	P08217	CEL2A_HUMAN	chymotrypsin-like elastase family, member 2A	29	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|keratohyalin granule (GO:0036457)	serine hydrolase activity (GO:0017171)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(2)|prostate(1)	16						TGACTAGGGTGGTTGGCGGTG	0.567																																							uc001awk.2		NA																	0				ovary(2)	2						c.(85-87)GTG>GTT		elastase 2A preproprotein							105.0	97.0	99.0					1																	15783627		2203	4300	6503	SO:0001819	synonymous_variant	63036				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr1:15783627G>T		CCDS157.1	1p36.21	2009-07-09			ENSG00000142615	ENSG00000142615	3.4.21.71		24609	protein-coding gene	gene with protein product	"""elastase 2A"""	609443				3646943, 2834346	Standard	NM_033440		Approved	ELA2A	uc001awk.3	P08217	OTTHUMG00000002258	ENST00000359621.4:c.87G>T	1.37:g.15783627G>T			Somatic					p.V29V	NM_033440	NP_254275	WXS	Illumina HiSeq	Unspecified	P08217	CEL2A_HUMAN			2	113	+			29			Peptidase S1.		B2R5I4|Q14243	Silent	SNP	ENST00000359621.4	37	c.87G>T	CCDS157.1																																																																																				0.567	CELA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006445.1	NM_033440		8	30	1	0	1.58986e-06	0.000673444	5.52161e-06	8	30				
IL22RA1	58985	broad.mit.edu	37	1	24454646	24454646	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:24454646C>A	ENST00000270800.1	-	5	693	c.655G>T	c.(655-657)Gtg>Ttg	p.V219L		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	219	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		AGTGTCTTCACTCGGCACATG	0.547																																							uc001biq.1		NA																	0				skin(1)	1						c.(655-657)GTG>TTG		interleukin 22 receptor, alpha 1 precursor							76.0	69.0	72.0					1																	24454646		2203	4300	6503	SO:0001583	missense	58985					integral to membrane	interferon receptor activity	g.chr1:24454646C>A	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.655G>T	1.37:g.24454646C>A	ENSP00000270800:p.Val219Leu		Somatic				IL22RA1_uc010oeg.1_Missense_Mutation_p.V111L|IL22RA1_uc009vrb.1_Missense_Mutation_p.V83L|IL22RA1_uc010oeh.1_Missense_Mutation_p.V219L	p.V219L	NM_021258	NP_067081	WXS	Illumina HiSeq	Unspecified	Q8N6P7	I22R1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)	5	694	-		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)	219			Extracellular (Potential).|Fibronectin type-III 2.		A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	ENST00000270800.1	37	c.655G>T	CCDS247.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640138	0.47153	.	.	ENSG00000142677	ENST00000270800	T	0.10960	2.82	4.91	3.99	0.46301	Immunoglobulin-like fold (1);	0.638824	0.15576	N	0.255162	T	0.19046	0.0457	L	0.36672	1.1	0.36260	D	0.854498	B;D	0.61697	0.043;0.99	B;D	0.65684	0.018;0.937	T	0.10870	-1.0611	10	0.30854	T	0.27	-15.1852	9.1369	0.36879	0.0:0.8975:0.0:0.1025	.	111;219	B4E2V9;Q8N6P7	.;I22R1_HUMAN	L	219	ENSP00000270800:V219L	ENSP00000270800:V219L	V	-	1	0	IL22RA1	24327233	1.000000	0.71417	1.000000	0.80357	0.276000	0.26787	3.494000	0.53273	1.044000	0.40200	0.448000	0.29417	GTG		0.547	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1			4	23	1	0	0.00024832	0.00024832	0.000757292	4	23				
HMGB4	127540	broad.mit.edu	37	1	34330269	34330269	+	Silent	SNP	C	C	G	rs570437886		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:34330269C>G	ENST00000522796.1	+	4	2382	c.477C>G	c.(475-477)ctC>ctG	p.L159L	CSMD2_ENST00000373381.4_Intron|HMGB4_ENST00000425537.1_3'UTR|HMGB4_ENST00000519684.1_Silent_p.L159L			Q8WW32	HMGB4_HUMAN	high mobility group box 4	159						chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AACTTGAACTCTACCGTAAAC	0.488																																							uc001bxp.2		NA																	0					0						c.(475-477)CTC>CTG		HMG2 like isoform 1							60.0	68.0	65.0					1																	34330269		2203	4300	6503	SO:0001819	synonymous_variant	127540					nucleus	DNA binding	g.chr1:34330269C>G		CCDS30668.1	1p35.1	2011-07-01	2011-04-05		ENSG00000176256	ENSG00000176256		"""High-mobility group / Canonical"""	24954	protein-coding gene	gene with protein product			"""high-mobility group box 4"""				Standard	NR_033264		Approved	FLJ40388	uc001bxp.3	Q8WW32	OTTHUMG00000013143	ENST00000522796.1:c.477C>G	1.37:g.34330269C>G			Somatic				CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxn.1_Intron|HMGB4_uc001bxq.2_Silent_p.L85L	p.L159L	NM_145205	NP_660206	WXS	Illumina HiSeq	Unspecified	Q8WW32	HMGB4_HUMAN			2	2220	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	159					B2R4X7|Q0QWA4	Silent	SNP	ENST00000522796.1	37	c.477C>G	CCDS30668.1																																																																																				0.488	HMGB4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375773.1	NM_145205		5	32	0	0	0	0.00116845	0	5	32				
ZMYM4	9202	broad.mit.edu	37	1	35862216	35862216	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:35862216T>A	ENST00000314607.6	+	19	3055	c.2975T>A	c.(2974-2976)aTa>aAa	p.I992K	ZMYM4_ENST00000373297.2_Missense_Mutation_p.I903K	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	992					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTTGTTCCCATACCTCTTCAC	0.393																																							uc001byt.2		NA																	0				large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5						c.(2974-2976)ATA>AAA		zinc finger protein 262							220.0	198.0	206.0					1																	35862216		2203	4300	6503	SO:0001583	missense	9202				multicellular organismal development		DNA binding|zinc ion binding	g.chr1:35862216T>A	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2975T>A	1.37:g.35862216T>A	ENSP00000322915:p.Ile992Lys		Somatic				ZMYM4_uc009vuu.2_Missense_Mutation_p.I960K|ZMYM4_uc001byu.2_Missense_Mutation_p.I668K|ZMYM4_uc009vuv.2_Missense_Mutation_p.I731K	p.I992K	NM_005095	NP_005086	WXS	Illumina HiSeq	Unspecified	Q5VZL5	ZMYM4_HUMAN			19	3055	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	992					A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	c.2975T>A	CCDS389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.83|18.83	3.707805|3.707805	0.68615|0.68615	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000457946|ENST00000314607;ENST00000373297	.|T;T	.|0.23552	.|1.9;1.91	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.267039	.|0.35436	.|N	.|0.003216	T|T	0.20292|0.20292	0.0488|0.0488	N|N	0.22421|0.22421	0.69|0.69	0.43874|0.43874	D|D	0.996486|0.996486	.|B	.|0.34103	.|0.437	.|B	.|0.33799	.|0.17	T|T	0.06267|0.06267	-1.0836|-1.0836	5|10	.|0.87932	.|D	.|0	-6.3043|-6.3043	14.9828|14.9828	0.71324|0.71324	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|992	.|Q5VZL5	.|ZMYM4_HUMAN	Q|K	650|992;903	.|ENSP00000322915:I992K;ENSP00000362394:I903K	.|ENSP00000322915:I992K	H|I	+|+	3|2	2|0	ZMYM4|ZMYM4	35634803|35634803	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.976000|0.976000	0.68499|0.68499	6.443000|6.443000	0.73447|0.73447	1.931000|1.931000	0.55961|0.55961	0.528000|0.528000	0.53228|0.53228	CAT|ATA		0.393	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095		18	73	0	0	0	0.00121646	0	18	73				
SZT2	23334	broad.mit.edu	37	1	43896264	43896264	+	Silent	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:43896264A>G	ENST00000562955.1	+	31	4407	c.4407A>G	c.(4405-4407)ctA>ctG	p.L1469L	SZT2_ENST00000372442.1_Silent_p.L627L	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1526					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CTGCTGGGCTAGACTCTGCCT	0.567																																							uc001cjk.1		NA																	0					0						c.(1879-1881)CTA>CTG		hypothetical protein LOC23334							87.0	89.0	88.0					1																	43896264		2203	4300	6503	SO:0001819	synonymous_variant	23334					peroxisome		g.chr1:43896264A>G	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.4407A>G	1.37:g.43896264A>G			Somatic					p.L627L	NM_015284	NP_056099	WXS	Illumina HiSeq	Unspecified	Q5T011	SZT2_HUMAN			17	2343	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	1526					A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Silent	SNP	ENST00000562955.1	37	c.1881A>G	CCDS30694.2																																																																																				0.567	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284		10	51	0	0	0	0.00185496	0	10	51				
FAF1	11124	broad.mit.edu	37	1	50941222	50941222	+	Missense_Mutation	SNP	T	T	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:50941222T>G	ENST00000396153.2	-	18	2234	c.1783A>C	c.(1783-1785)Aag>Cag	p.K595Q	FAF1_ENST00000545823.1_Missense_Mutation_p.K353Q|FAF1_ENST00000371778.4_Missense_Mutation_p.K595Q	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	595	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.				apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		ATCTGGAGCTTGTTGCTGGCC	0.512																																							uc009vyx.1		NA																	0				ovary(1)|pancreas(1)	2						c.(1783-1785)AAG>CAG		FAS-associated factor 1							89.0	91.0	90.0					1																	50941222		2203	4300	6503	SO:0001583	missense	11124				apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity	g.chr1:50941222T>G	AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.1783A>C	1.37:g.50941222T>G	ENSP00000379457:p.Lys595Gln		Somatic				FAF1_uc009vyw.1_RNA|FAF1_uc001cse.1_Missense_Mutation_p.K595Q|FAF1_uc010onc.1_Missense_Mutation_p.K353Q	p.K595Q	NM_007051	NP_008982	WXS	Illumina HiSeq	Unspecified	Q9UNN5	FAF1_HUMAN		GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)	19	1846	-			595			UBX.		Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Missense_Mutation	SNP	ENST00000396153.2	37	c.1783A>C	CCDS554.1	.	.	.	.	.	.	.	.	.	.	T	13.66	2.303963	0.40795	.	.	ENSG00000185104	ENST00000396153;ENST00000371778;ENST00000545823;ENST00000371780;ENST00000543607	.	.	.	5.51	4.32	0.51571	UBX (3);	0.146878	0.64402	D	0.000010	T	0.52789	0.1756	L	0.36672	1.1	0.44908	D	0.997922	B;B	0.09022	0.002;0.001	B;B	0.22601	0.04;0.008	T	0.52793	-0.8528	9	0.46703	T	0.11	-14.2178	12.9456	0.58371	0.0:0.0:0.2329:0.7671	.	353;595	B4DEJ6;Q9UNN5	.;FAF1_HUMAN	Q	595;595;353;435;443	.	ENSP00000360843:K595Q	K	-	1	0	FAF1	50713810	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.820000	0.55693	2.083000	0.62718	0.533000	0.62120	AAG		0.512	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021807.1	NM_007051		7	49	0	0	0	0.00198382	0	7	49				
EPS15	2060	broad.mit.edu	37	1	51869091	51869091	+	Splice_Site	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:51869091C>A	ENST00000371733.3	-	17	1887	c.1791G>T	c.(1789-1791)gaG>gaT	p.E597D	EPS15_ENST00000371730.2_Splice_Site_p.E463D|EPS15_ENST00000493793.1_5'Flank|EPS15_ENST00000396122.4_Splice_Site_p.E274D	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	597					cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(2)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						CATTTTTTACCTCTTTTGAAT	0.358			T	MLL	ALL																																		uc001csq.1		NA		Dom	yes		1	1p32	2060	T	epidermal growth factor receptor pathway substrate 15 (AF1p)			L	MLL		ALL		2	Whole gene deletion(2)		thyroid(1)|central_nervous_system(1)	lung(1)|kidney(1)	2						c.(1789-1791)GAG>GAT		epidermal growth factor receptor pathway							93.0	93.0	93.0					1																	51869091		2203	4300	6503	SO:0001630	splice_region_variant	2060				cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding	g.chr1:51869091C>A	BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.1791+1G>T	1.37:g.51869091C>A			Somatic				EPS15_uc009vyz.1_Missense_Mutation_p.E463D|EPS15_uc001csp.3_Missense_Mutation_p.E283D	p.E597D	NM_001981	NP_001972	WXS	Illumina HiSeq	Unspecified	P42566	EPS15_HUMAN			17	1883	-			597					B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	ENST00000371733.3	37	c.1791G>T	CCDS557.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.917483	0.73098	.	.	ENSG00000085832	ENST00000371730;ENST00000371733;ENST00000396122	T;T;T	0.19105	2.17;2.17;2.17	4.6	4.6	0.57074	.	0.000000	0.32736	N	0.005713	T	0.10594	0.0259	N	0.12182	0.205	0.48762	D	0.999701	P;B;B	0.43788	0.817;0.43;0.002	B;B;B	0.33750	0.169;0.164;0.006	T	0.18304	-1.0341	9	.	.	.	.	15.2333	0.73407	0.0:1.0:0.0:0.0	.	463;597;283	B1AUU8;P42566;P42566-2	.;EPS15_HUMAN;.	D	463;597;274	ENSP00000360795:E463D;ENSP00000360798:E597D;ENSP00000379428:E274D	.	E	-	3	2	EPS15	51641679	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	3.366000	0.52343	2.847000	0.97988	0.591000	0.81541	GAG		0.358	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022422.1	NM_001981	Missense_Mutation	7	52	1	0	2.7689e-08	0.00198382	1.06575e-07	7	52				
DMRTB1	63948	broad.mit.edu	37	1	53930460	53930460	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:53930460C>A	ENST00000371445.3	+	3	956	c.901C>A	c.(901-903)Cca>Aca	p.P301T		NM_033067.1	NP_149056.1	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal, 1	301	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|lung(5)|ovary(1)|skin(1)	10						GCCACCGCCACCACCACCTCC	0.637																																							uc001cvq.1		NA																	0				ovary(1)|skin(1)	2						c.(901-903)CCA>ACA		DMRT-like family B with proline-rich C-terminal,							114.0	112.0	112.0					1																	53930460		2203	4300	6503	SO:0001583	missense	63948				sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity	g.chr1:53930460C>A	AJ291671	CCDS581.1	1p32	2008-08-29			ENSG00000143006	ENSG00000143006			13913	protein-coding gene	gene with protein product		614805					Standard	NM_033067		Approved		uc001cvq.1	Q96MA1	OTTHUMG00000008080	ENST00000371445.3:c.901C>A	1.37:g.53930460C>A	ENSP00000360500:p.Pro301Thr		Somatic					p.P301T	NM_033067	NP_149056	WXS	Illumina HiSeq	Unspecified	Q96MA1	DMRTB_HUMAN			3	956	+			301			Pro-rich.		Q96SD2	Missense_Mutation	SNP	ENST00000371445.3	37	c.901C>A	CCDS581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.55|17.55	3.417511|3.417511	0.62622|0.62622	.|.	.|.	ENSG00000143006|ENSG00000143006	ENST00000371445|ENST00000431335	T|.	0.32515|.	1.45|.	4.4|4.4	4.4|4.4	0.53042|0.53042	.|.	0.407672|.	0.23000|.	N|.	0.053096|.	T|T	0.58119|0.58119	0.2100|0.2100	M|M	0.65975|0.65975	2.015|2.015	0.09310|0.09310	N|N	0.999999|0.999999	D|.	0.76494|.	0.999|.	D|.	0.66084|.	0.941|.	T|T	0.53669|0.53669	-0.8406|-0.8406	10|6	0.72032|0.87932	D|D	0.01|0	-7.1324|-7.1324	12.6606|12.6606	0.56811|0.56811	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	301|.	Q96MA1|.	DMRTB_HUMAN|.	T|N	301|131	ENSP00000360500:P301T|.	ENSP00000360500:P301T|ENSP00000395130:T131N	P|T	+|+	1|2	0|0	DMRTB1|DMRTB1	53703048|53703048	0.057000|0.057000	0.20700|0.20700	0.606000|0.606000	0.28943|0.28943	0.032000|0.032000	0.12392|0.12392	3.233000|3.233000	0.51311|0.51311	2.426000|2.426000	0.82243|0.82243	0.462000|0.462000	0.41574|0.41574	CCA|ACC		0.637	DMRTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022110.1			7	71	1	0	5.18039e-06	0.00307968	1.7629e-05	7	71				
SGIP1	84251	broad.mit.edu	37	1	67147941	67147941	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:67147941G>C	ENST00000371037.4	+	15	1281	c.1204G>C	c.(1204-1206)Gat>Cat	p.D402H	SGIP1_ENST00000371035.3_Intron|SGIP1_ENST00000237247.6_Missense_Mutation_p.D406H|SGIP1_ENST00000371036.3_Intron|SGIP1_ENST00000371039.1_Intron	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	402	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						ATCTCCTAAAGATTTTGGGTT	0.512																																							uc001dcr.2		NA																	0				ovary(3)	3						c.(1204-1206)GAT>CAT		SH3-domain GRB2-like (endophilin) interacting							81.0	91.0	88.0					1																	67147941		2203	4300	6503	SO:0001583	missense	84251				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding	g.chr1:67147941G>C	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1204G>C	1.37:g.67147941G>C	ENSP00000360076:p.Asp402His		Somatic				SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Missense_Mutation_p.D169H	p.D402H	NM_032291	NP_115667	WXS	Illumina HiSeq	Unspecified	Q9BQI5	SGIP1_HUMAN			15	1421	+			402			Pro-rich.		A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	37	c.1204G>C	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927084	0.73327	.	.	ENSG00000118473	ENST00000237247;ENST00000371038;ENST00000407289;ENST00000371037	T;T	0.21734	1.99;2.15	5.19	5.19	0.71726	.	0.233781	0.42172	D	0.000752	T	0.21103	0.0508	L	0.40543	1.245	0.80722	D	1	P;P	0.45396	0.857;0.856	P;P	0.50791	0.65;0.579	T	0.00647	-1.1628	10	0.46703	T	0.11	-10.8064	19.0749	0.93156	0.0:0.0:1.0:0.0	.	405;402	A6NEV3;Q9BQI5	.;SGIP1_HUMAN	H	406;405;405;402	ENSP00000237247:D406H;ENSP00000360076:D402H	ENSP00000237247:D406H	D	+	1	0	SGIP1	66920529	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.667000	0.68067	2.570000	0.86706	0.455000	0.32223	GAT		0.512	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291		16	84	0	0	0	0.00400662	0	16	84				
GBP4	115361	broad.mit.edu	37	1	89655932	89655932	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:89655932G>A	ENST00000355754.6	-	7	1083	c.986C>T	c.(985-987)gCa>gTa	p.A329V		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	329						cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		TGCTGTCACTGCATTCTCCAG	0.537																																							uc001dnb.2		NA																	0					0						c.(985-987)GCA>GTA		guanylate binding protein 4							71.0	70.0	70.0					1																	89655932		2203	4300	6503	SO:0001583	missense	115361					cytoplasm	GTP binding|GTPase activity	g.chr1:89655932G>A	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.986C>T	1.37:g.89655932G>A	ENSP00000359490:p.Ala329Val		Somatic					p.A329V	NM_052941	NP_443173	WXS	Illumina HiSeq	Unspecified	Q96PP9	GBP4_HUMAN		all cancers(265;0.00723)|Epithelial(280;0.0291)	7	1102	-			329					B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	c.986C>T	CCDS721.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.204860	0.58234	.	.	ENSG00000162654	ENST00000355754	T	0.03152	4.03	5.07	4.03	0.46877	Guanylate-binding protein, C-terminal (3);	0.057448	0.64402	N	0.000002	T	0.03608	0.0103	M	0.81179	2.53	0.31067	N	0.713485	P	0.45715	0.865	P	0.44477	0.451	T	0.14587	-1.0467	10	0.51188	T	0.08	.	10.0066	0.41961	0.1145:0.0:0.8855:0.0	.	329	Q96PP9	GBP4_HUMAN	V	329	ENSP00000359490:A329V	ENSP00000359490:A329V	A	-	2	0	GBP4	89428520	0.935000	0.31712	0.081000	0.20488	0.169000	0.22640	3.039000	0.49791	1.236000	0.43740	0.655000	0.94253	GCA		0.537	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941		15	44	0	0	0	0.00074312	0	15	44				
HFM1	164045	broad.mit.edu	37	1	91739299	91739299	+	Missense_Mutation	SNP	T	T	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:91739299T>C	ENST00000370425.3	-	34	3840	c.3742A>G	c.(3742-3744)Aga>Gga	p.R1248G	HFM1_ENST00000294696.5_Missense_Mutation_p.R480G|HFM1_ENST00000370424.3_Missense_Mutation_p.R927G|HFM1_ENST00000462405.1_5'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1248					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		GGTTCTTGTCTAACTTTTCCA	0.318																																							uc001doa.3		NA																	0					0						c.(3742-3744)AGA>GGA		HFM1 protein							150.0	131.0	137.0					1																	91739299		2203	4298	6501	SO:0001583	missense	164045						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr1:91739299T>C	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3742A>G	1.37:g.91739299T>C	ENSP00000359454:p.Arg1248Gly		Somatic				HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Missense_Mutation_p.R927G|HFM1_uc001dob.3_Missense_Mutation_p.R436G|HFM1_uc010osv.1_Missense_Mutation_p.R932G	p.R1248G	NM_001017975	NP_001017975	WXS	Illumina HiSeq	Unspecified	A2PYH4	HFM1_HUMAN		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)	34	3842	-		all_lung(203;0.00961)|Lung NSC(277;0.0351)	1248					B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	c.3742A>G	CCDS30769.2	.	.	.	.	.	.	.	.	.	.	T	6.686	0.495114	0.12762	.	.	ENSG00000162669	ENST00000370425;ENST00000294696;ENST00000370424	T;T;T	0.63744	0.31;0.68;-0.06	5.75	3.85	0.44370	.	0.432772	0.19612	N	0.110116	T	0.20292	0.0488	N	0.08118	0	0.09310	N	1	B;B;B	0.12013	0.005;0.005;0.005	B;B;B	0.16722	0.016;0.01;0.006	T	0.16689	-1.0394	10	0.41790	T	0.15	.	9.3504	0.38133	0.0:0.1495:0.681:0.1695	.	927;459;1248	A6NGI5;B1B0B5;A2PYH4	.;.;HFM1_HUMAN	G	1248;480;927	ENSP00000359454:R1248G;ENSP00000294696:R480G;ENSP00000359453:R927G	ENSP00000294696:R480G	R	-	1	2	HFM1	91511887	0.745000	0.28261	0.040000	0.18447	0.526000	0.34562	2.320000	0.43797	0.734000	0.32515	-0.213000	0.12676	AGA		0.318	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975		16	60	0	0	0	0.000958276	0	16	60				
OLFM3	118427	broad.mit.edu	37	1	102269968	102269969	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:102269968_102269969GG>TT	ENST00000338858.5	-	6	1261_1262	c.1262_1263CC>AA	c.(1261-1263)tCC>tAA	p.S421*	OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000370103.4_Nonsense_Mutation_p.S401*			Q96PB7	NOE3_HUMAN	olfactomedin 3	421	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		AGGTTTTGGTGGAATAGGAATA	0.446																																							uc001duf.2		NA																	0				ovary(2)|skin(1)	3						c.(1261-1263)TCC>TAA		olfactomedin 3																																				SO:0001587	stop_gained	118427					extracellular region		g.chr1:102269968_102269969GG>TT	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.1262_1263delinsTT	1.37:g.102269968_102269969delinsTT	ENSP00000345192:p.Ser421*		Somatic				OLFM3_uc001dug.2_Nonsense_Mutation_p.S401*|OLFM3_uc001duh.2_RNA|OLFM3_uc001dui.2_RNA|OLFM3_uc001duj.2_Nonsense_Mutation_p.S326*|OLFM3_uc001due.2_RNA	p.S421*	NM_058170	NP_477518	WXS	Illumina HiSeq	Unspecified	Q96PB7	NOE3_HUMAN		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)	6	1333_1334	-		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)	421			Olfactomedin-like.		Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Nonsense_Mutation	DNP	ENST00000338858.5	37	c.1262_1263CC>AA																																																																																					0.446	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1			21	164	0	0	0	6.4e-05	0	21	164				
HIST2H3D	653604	broad.mit.edu	37	1	149784921	149784921	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:149784921C>T	ENST00000331491.1	-	1	315	c.316G>A	c.(316-318)Gaa>Aaa	p.E106K	HIST2H2BF_ENST00000427880.2_5'Flank|HIST2H2BF_ENST00000545683.1_5'Flank|HIST2H2BF_ENST00000369167.1_5'Flank|HIST2H2BF_ENST00000469483.1_5'Flank|RP11-196G18.21_ENST00000420462.1_RNA	NM_001123375.2	NP_001116847.1	Q71DI3	H32_HUMAN	histone cluster 2, H3d	106					blood coagulation (GO:0007596)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			biliary_tract(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(3)	7						TTCGTGTCTTCGAACAGCCCC	0.652																																							uc010pbl.1		NA																	0					0						c.(316-318)GAA>AAA		histone cluster 2, H3d							28.0	31.0	30.0					1																	149784921		1567	3568	5135	SO:0001583	missense	653604				blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr1:149784921C>T	AL591493	CCDS41388.1	1q21.2	2012-03-08	2006-10-11		ENSG00000183598	ENSG00000183598		"""Histones / Replication-dependent"""	25311	protein-coding gene	gene with protein product			"""histone 2, H3d"""				Standard	NM_001123375		Approved		uc010pbl.2	Q71DI3	OTTHUMG00000012092	ENST00000331491.1:c.316G>A	1.37:g.149784921C>T	ENSP00000333277:p.Glu106Lys		Somatic				HIST2H2BF_uc010pbj.1_5'Flank|HIST2H2BF_uc010pbk.1_5'Flank|HIST2H2BF_uc001esr.2_5'Flank	p.E106K	NM_001123375	NP_001116847	WXS	Illumina HiSeq	Unspecified	Q71DI3	H32_HUMAN			1	316	-			106					A2BDF6|A6NFS4|Q6B053	Missense_Mutation	SNP	ENST00000331491.1	37	c.316G>A	CCDS41388.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.226548	0.58668	.	.	ENSG00000183598	ENST00000331491	T	0.71341	-0.56	3.83	3.83	0.44106	.	0.000000	0.53938	U	0.000047	T	0.76292	0.3967	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	T	0.80692	-0.1269	7	0.87932	D	0	.	14.8329	0.70162	0.0:1.0:0.0:0.0	.	.	.	.	K	106	ENSP00000333277:E106K	ENSP00000333277:E106K	E	-	1	0	HIST2H3D	148051545	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.244000	0.65400	2.139000	0.66308	0.436000	0.28706	GAA		0.652	HIST2H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033452.1	NM_001123375		6	32	0	0	0	0.00116845	0	6	32				
HORMAD1	84072	broad.mit.edu	37	1	150681431	150681431	+	Missense_Mutation	SNP	A	A	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:150681431A>C	ENST00000361824.2	-	8	439	c.334T>G	c.(334-336)Tca>Gca	p.S112A	HORMAD1_ENST00000368993.2_Missense_Mutation_p.S112A|HORMAD1_ENST00000368995.4_Missense_Mutation_p.S32A|HORMAD1_ENST00000322343.7_Missense_Mutation_p.S105A	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	112	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TAACATTCTGAAATTGTCTTA	0.303																																							uc001evk.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(334-336)TCA>GCA		HORMA domain containing 1							102.0	97.0	98.0					1																	150681431		2203	4299	6502	SO:0001583	missense	84072				blastocyst development|cell differentiation|meiotic DNA double-strand break formation|meiotic recombination checkpoint|meiotic sister chromatid cohesion|mitosis|oogenesis|regulation of homologous chromosome segregation|spermatogenesis|synaptonemal complex assembly	chromosome|nucleus		g.chr1:150681431A>C	AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.334T>G	1.37:g.150681431A>C	ENSP00000355167:p.Ser112Ala		Somatic				HORMAD1_uc001evl.1_Missense_Mutation_p.S105A|HORMAD1_uc001evm.1_Missense_Mutation_p.S32A	p.S112A	NM_032132	NP_115508	WXS	Illumina HiSeq	Unspecified	Q86X24	HORM1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)		8	440	-	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		112			HORMA.		A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Missense_Mutation	SNP	ENST00000361824.2	37	c.334T>G	CCDS967.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.781886	0.70222	.	.	ENSG00000143452	ENST00000368995;ENST00000368993;ENST00000368992;ENST00000540570;ENST00000322343;ENST00000361824;ENST00000368987;ENST00000442853	T;T;T;T	0.41400	1.0;1.58;1.59;1.58	5.67	3.17	0.36434	DNA-binding HORMA (4);	0.164595	0.51477	D	0.000087	T	0.21962	0.0529	L	0.47716	1.5	0.28553	N	0.911517	P;P;B	0.52577	0.954;0.838;0.425	P;B;B	0.48141	0.568;0.414;0.324	T	0.04360	-1.0957	10	0.24483	T	0.36	-12.6737	8.8497	0.35192	0.515:0.0:0.0:0.485	.	32;105;112	Q86X24-4;Q86X24-2;Q86X24	.;.;HORM1_HUMAN	A	32;112;41;32;105;112;41;34	ENSP00000357991:S32A;ENSP00000357989:S112A;ENSP00000326489:S105A;ENSP00000355167:S112A	ENSP00000326489:S105A	S	-	1	0	HORMAD1	148948055	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.294000	0.59043	0.943000	0.37553	0.528000	0.53228	TCA		0.303	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084722.1	NM_032132		5	45	0	0	0	0.00116845	0	5	45				
FLG	2312	broad.mit.edu	37	1	152280118	152280119	+	Missense_Mutation	DNP	AG	AG	TT			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	AG	AG	-	-	AG	AG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:152280118_152280119AG>TT	ENST00000368799.1	-	3	7278_7279	c.7243_7244CT>AA	c.(7243-7245)CTc>AAc	p.L2415N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2415	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CACCTGGTAGAGGAAAGACCCT	0.614									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(7243-7245)CTC>AAC		filaggrin																																				SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152280118_152280119AG>TT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7243_7244delinsTT	1.37:g.152280118_152280119delinsTT	ENSP00000357789:p.Leu2415Asn		Somatic					p.L2415N	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	7279_7280	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2415			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	DNP	ENST00000368799.1	37	c.7243_7244CT>AA	CCDS30860.1																																																																																				0.614	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		27	143	0	0	0	6.4e-05	0	27	143				
FLG2	388698	broad.mit.edu	37	1	152324228	152324228	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:152324228G>T	ENST00000388718.5	-	3	6106	c.6034C>A	c.(6034-6036)Cat>Aat	p.H2012N	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2012					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACTGTCCATGACCAGAGTGG	0.527																																							uc001ezw.3		NA																	0				ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(6034-6036)CAT>AAT		filaggrin family member 2							392.0	360.0	371.0					1																	152324228		2201	4300	6501	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152324228G>T	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6034C>A	1.37:g.152324228G>T	ENSP00000373370:p.His2012Asn		Somatic				uc001ezv.2_Intron	p.H2012N	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6107	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2012			Filaggrin 9.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.6034C>A	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175855	0.38413	.	.	ENSG00000143520	ENST00000388718	T	0.38077	1.16	4.63	4.63	0.57726	.	.	.	.	.	T	0.25082	0.0609	M	0.75777	2.31	0.09310	N	1	P	0.43750	0.816	B	0.42282	0.382	T	0.19095	-1.0316	9	0.18710	T	0.47	-7.9059	13.3331	0.60500	0.0:0.0:1.0:0.0	.	2012	Q5D862	FILA2_HUMAN	N	2012	ENSP00000373370:H2012N	ENSP00000373370:H2012N	H	-	1	0	FLG2	150590852	0.015000	0.18098	0.021000	0.16686	0.007000	0.05969	2.074000	0.41529	2.600000	0.87896	0.478000	0.44815	CAT		0.527	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		91	235	1	0	1.42479e-40	0.00361006	7.31895e-40	91	235				
FLG2	388698	broad.mit.edu	37	1	152325056	152325056	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:152325056C>A	ENST00000388718.5	-	3	5278	c.5206G>T	c.(5206-5208)Ggg>Tgg	p.G1736W	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1736					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G1736W(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGAGTACCCTTCACTGTCA	0.488																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(5206-5208)GGG>TGG		filaggrin family member 2							405.0	365.0	379.0					1																	152325056		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152325056C>A	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5206G>T	1.37:g.152325056C>A	ENSP00000373370:p.Gly1736Trp		Somatic				uc001ezv.2_Intron	p.G1736W	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	5279	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1736					Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.5206G>T	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935527	0.34189	.	.	ENSG00000143520	ENST00000388718	T	0.01464	4.86	4.09	-8.17	0.01057	.	.	.	.	.	T	0.00637	0.0021	L	0.61218	1.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47018	-0.9149	9	0.66056	D	0.02	2.8711	4.7277	0.12948	0.4545:0.274:0.0:0.2715	.	1736	Q5D862	FILA2_HUMAN	W	1736	ENSP00000373370:G1736W	ENSP00000373370:G1736W	G	-	1	0	FLG2	150591680	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.990000	0.01479	-1.652000	0.01502	-1.348000	0.01239	GGG		0.488	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		70	219	1	0	8.29215e-51	0.00361006	4.29222e-50	70	219				
LCE3A	353142	broad.mit.edu	37	1	152595328	152595328	+	Silent	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:152595328A>G	ENST00000335674.1	-	1	251	c.252T>C	c.(250-252)agT>agC	p.S84S		NM_178431.1	NP_848518.1	Q5TA76	LCE3A_HUMAN	late cornified envelope 3A	84					keratinization (GO:0031424)					endometrium(1)|lung(5)	6	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCCGCAGAACTGTGGCCAC	0.547																																							uc010pdt.1		NA																	0					0						c.(250-252)AGT>AGC		late cornified envelope 3A							47.0	52.0	50.0					1																	152595328		2203	4299	6502	SO:0001819	synonymous_variant	353142				keratinization			g.chr1:152595328A>G		CCDS1017.1	1q21.3	2008-02-05			ENSG00000185962	ENSG00000185962		"""Late cornified envelopes"""	29461	protein-coding gene	gene with protein product		612613				11698679	Standard	NM_178431		Approved	LEP13	uc010pdt.2	Q5TA76	OTTHUMG00000012397	ENST00000335674.1:c.252T>C	1.37:g.152595328A>G			Somatic					p.S84S	NM_178431	NP_848518	WXS	Illumina HiSeq	Unspecified	Q5TA76	LCE3A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		1	252	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		84						Silent	SNP	ENST00000335674.1	37	c.252T>C	CCDS1017.1																																																																																				0.547	LCE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034517.2	NM_178431		7	54	0	0	0	0.00198382	0	7	54				
BCAN	63827	broad.mit.edu	37	1	156628521	156628521	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:156628521G>A	ENST00000329117.5	+	13	2960	c.2624G>A	c.(2623-2625)aGa>aAa	p.R875K	RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	875					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTGCCCAGAAGACCTGTGAGT	0.607																																							uc001fpp.2		NA																	0				ovary(1)|pancreas(1)	2						c.(2623-2625)AGA>AAA		brevican isoform 1							50.0	51.0	51.0					1																	156628521		2203	4299	6502	SO:0001583	missense	63827				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding	g.chr1:156628521G>A	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.2624G>A	1.37:g.156628521G>A	ENSP00000331210:p.Arg875Lys		Somatic					p.R875K	NM_021948	NP_068767	WXS	Illumina HiSeq	Unspecified	Q96GW7	PGCB_HUMAN			13	2960	+	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		875					D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	c.2624G>A	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962357	0.74016	.	.	ENSG00000132692	ENST00000329117	T	0.13901	2.55	4.96	4.96	0.65561	.	0.000000	0.43260	D	0.000591	T	0.07098	0.0180	N	0.24115	0.695	0.80722	D	1	P	0.46656	0.882	P	0.46796	0.527	T	0.29488	-1.0010	10	0.33141	T	0.24	-17.6099	13.5717	0.61851	0.0:0.0:1.0:0.0	.	875	Q96GW7	PGCB_HUMAN	K	875	ENSP00000331210:R875K	ENSP00000331210:R875K	R	+	2	0	BCAN	154895145	0.456000	0.25744	1.000000	0.80357	0.890000	0.51754	-0.017000	0.12590	2.590000	0.87494	0.555000	0.69702	AGA		0.607	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948		11	38	0	0	0	0.000978159	0	11	38				
CD1A	909	broad.mit.edu	37	1	158225793	158225793	+	Splice_Site	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:158225793G>C	ENST00000289429.5	+	3	858		c.e3-1			NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule						antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	CATAACCCCAGATCCTTTTGA	0.423																																							uc001frt.2		NA																	0				pancreas(2)|skin(1)	3						c.e3-1		CD1A antigen precursor	Antithymocyte globulin(DB00098)						66.0	63.0	64.0					1																	158225793		2202	4299	6501	SO:0001630	splice_region_variant	909				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex		g.chr1:158225793G>C	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.326-1G>C	1.37:g.158225793G>C			Somatic					p.Y109_splice	NM_001763	NP_001754	WXS	Illumina HiSeq	Unspecified	P06126	CD1A_HUMAN			3	859	+	all_hematologic(112;0.0378)							D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Splice_Site	SNP	ENST00000289429.5	37	c.326_splice	CCDS1174.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882091	0.33255	.	.	ENSG00000158477	ENST00000289429	.	.	.	4.02	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9376	0.52882	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD1A	156492417	0.834000	0.29399	0.913000	0.36048	0.148000	0.21650	2.398000	0.44486	2.260000	0.74910	0.579000	0.79373	.		0.423	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763	Intron	18	75	0	0	0	0.00121646	0	18	75				
MNDA	4332	broad.mit.edu	37	1	158813834	158813834	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:158813834C>A	ENST00000368141.4	+	4	753	c.492C>A	c.(490-492)gcC>gcA	p.A164A		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	164					B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					CCTCAGGAGCCAGCACATCTG	0.488																																							uc001fsz.1		NA																	0				ovary(2)|skin(2)	4						c.(490-492)GCC>GCA		myeloid cell nuclear differentiation antigen							241.0	200.0	214.0					1																	158813834		2203	4300	6503	SO:0001819	synonymous_variant	4332				B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr1:158813834C>A	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.492C>A	1.37:g.158813834C>A			Somatic					p.A164A	NM_002432	NP_002423	WXS	Illumina HiSeq	Unspecified	P41218	MNDA_HUMAN			4	692	+	all_hematologic(112;0.0378)		164						Silent	SNP	ENST00000368141.4	37	c.492C>A	CCDS1177.1																																																																																				0.488	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432		30	79	1	0	8.88839e-20	0.00209593	4.25823e-19	30	79				
CACNA1E	777	broad.mit.edu	37	1	181452918	181452918	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:181452918G>T	ENST00000367573.2	+	1	38	c.38G>T	c.(37-39)gGg>gTg	p.G13V	CACNA1E_ENST00000360108.3_Missense_Mutation_p.G13V|CACNA1E_ENST00000358338.5_5'UTR|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000526775.1_Missense_Mutation_p.G13V|CACNA1E_ENST00000357570.5_5'UTR|CACNA1E_ENST00000367570.1_Missense_Mutation_p.G13V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	13					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GCCAGGCCAGGGTCCGGCGAT	0.652																																							uc001gow.2		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(37-39)GGG>GTG		calcium channel, voltage-dependent, R type,							29.0	33.0	31.0					1																	181452918		1897	4106	6003	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181452918G>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.38G>T	1.37:g.181452918G>T	ENSP00000356545:p.Gly13Val		Somatic					p.G13V	NM_000721	NP_000712	WXS	Illumina HiSeq	Unspecified	Q15878	CAC1E_HUMAN			1	203	+			13			Cytoplasmic (Potential).		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.38G>T	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309087	0.40895	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000360108;ENST00000367573	D;D;D;D;D	0.98105	-4.72;-4.36;-4.33;-4.35;-4.37	5.28	3.38	0.38709	.	0.129568	0.31010	N	0.008421	D	0.96889	0.8984	M	0.85197	2.74	0.80722	D	1	B	0.26809	0.16	B	0.28232	0.087	D	0.94822	0.7988	10	0.87932	D	0	.	10.2164	0.43170	0.0764:0.1362:0.7873:0.0	.	13	Q15878-3	.	V	13	ENSP00000432038:G13V;ENSP00000356542:G13V;ENSP00000434814:G13V;ENSP00000353222:G13V;ENSP00000356545:G13V	ENSP00000353222:G13V	G	+	2	0	CACNA1E	179719541	0.994000	0.37717	0.846000	0.33378	0.992000	0.81027	2.947000	0.49058	0.593000	0.29745	0.561000	0.74099	GGG		0.652	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		11	22	1	0	1.36491e-13	0.00185496	6.20874e-13	11	22				
HMCN1	83872	broad.mit.edu	37	1	186008104	186008104	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:186008104G>T	ENST00000271588.4	+	38	6224	c.5995G>T	c.(5995-5997)Gct>Tct	p.A1999S	HMCN1_ENST00000367492.2_Missense_Mutation_p.A1999S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1999	Ig-like C2-type 17.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTCAGCTGGAGCTACAGAGTT	0.408																																							uc001grq.1		NA																	0				ovary(22)|skin(1)	23						c.(5995-5997)GCT>TCT		hemicentin 1 precursor							100.0	92.0	95.0					1																	186008104		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186008104G>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5995G>T	1.37:g.186008104G>T	ENSP00000271588:p.Ala1999Ser		Somatic					p.A1999S	NM_031935	NP_114141	WXS	Illumina HiSeq	Unspecified	Q96RW7	HMCN1_HUMAN			38	6224	+			1999			Ig-like C2-type 17.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.5995G>T	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	5.521	0.281011	0.10458	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.65732	-0.17;-0.17	5.85	3.74	0.42951	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.435085	0.26832	N	0.022279	T	0.38799	0.1054	N	0.00538	-1.39	0.21984	N	0.999431	D	0.76494	0.999	D	0.83275	0.996	T	0.49716	-0.8910	10	0.08179	T	0.78	.	5.1211	0.14860	0.176:0.0:0.6345:0.1895	.	1999	Q96RW7	HMCN1_HUMAN	S	1999	ENSP00000271588:A1999S;ENSP00000356462:A1999S	ENSP00000271588:A1999S	A	+	1	0	HMCN1	184274727	0.971000	0.33674	1.000000	0.80357	0.996000	0.88848	2.574000	0.46016	2.773000	0.95371	0.655000	0.94253	GCT		0.408	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		18	81	1	0	2.35188e-11	0.00074312	1.0087e-10	18	81				
ZBTB41	360023	broad.mit.edu	37	1	197150178	197150178	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:197150178C>G	ENST00000367405.4	-	5	1684	c.1616G>C	c.(1615-1617)tGt>tCt	p.C539S	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	539					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						ACCATGAGTACATTCTATATG	0.358																																							uc001gtx.1		NA																	0				ovary(1)|skin(1)	2						c.(1615-1617)TGT>TCT		zinc finger and BTB domain containing 41							155.0	142.0	146.0					1																	197150178		2203	4300	6503	SO:0001583	missense	360023				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:197150178C>G		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.1616G>C	1.37:g.197150178C>G	ENSP00000356375:p.Cys539Ser		Somatic				ZBTB41_uc009wyz.1_RNA	p.C539S	NM_194314	NP_919290	WXS	Illumina HiSeq	Unspecified	Q5SVQ8	ZBT41_HUMAN			5	1685	-			539			C2H2-type 7.		A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	ENST00000367405.4	37	c.1616G>C	CCDS30960.1	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872077	0.72180	.	.	ENSG00000177888	ENST00000367405	T	0.01516	4.81	5.47	5.47	0.80525	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000210	T	0.01523	0.0049	N	0.03948	-0.315	0.58432	D	0.999999	P	0.47762	0.9	P	0.46452	0.517	T	0.76961	-0.2765	10	0.33141	T	0.24	.	12.9803	0.58559	0.0:0.9257:0.0:0.0742	.	539	Q5SVQ8	ZBT41_HUMAN	S	539	ENSP00000356375:C539S	ENSP00000356375:C539S	C	-	2	0	ZBTB41	195416801	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.697000	0.68295	2.729000	0.93468	0.585000	0.79938	TGT		0.358	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088249.2	NM_194314		14	60	0	0	0	0.00185496	0	14	60				
KDM5B	10765	broad.mit.edu	37	1	202711841	202711841	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:202711841C>G	ENST00000367265.3	-	17	3580	c.2416G>C	c.(2416-2418)Gat>Cat	p.D806H	KDM5B_ENST00000367264.2_Missense_Mutation_p.D842H	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	806					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						TTCTCTGCATCCTGTGTGACT	0.458																																							uc001gyf.2		NA																	0				ovary(2)|breast(2)|urinary_tract(1)	5						c.(2416-2418)GAT>CAT		jumonji, AT rich interactive domain 1B							138.0	129.0	132.0					1																	202711841		2203	4300	6503	SO:0001583	missense	10765				negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding	g.chr1:202711841C>G	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.2416G>C	1.37:g.202711841C>G	ENSP00000356234:p.Asp806His		Somatic				KDM5B_uc009xag.2_Missense_Mutation_p.D842H|KDM5B_uc001gyg.1_Missense_Mutation_p.D648H	p.D806H	NM_006618	NP_006609	WXS	Illumina HiSeq	Unspecified	Q9UGL1	KDM5B_HUMAN			17	2532	-			806					O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	37	c.2416G>C	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.048562	0.93740	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790;ENST00000543924	T;T;T	0.44083	0.93;0.93;0.93	5.74	5.74	0.90152	Lysine-specific demethylase-like domain (1);	0.045424	0.85682	D	0.000000	T	0.64560	0.2609	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;0.984	D;D	0.73708	0.981;0.957	T	0.65352	-0.6189	10	0.87932	D	0	-27.0397	19.9346	0.97133	0.0:1.0:0.0:0.0	.	842;806	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	H	806;648;842;648;175	ENSP00000356234:D806H;ENSP00000356233:D842H;ENSP00000235790:D648H	ENSP00000235790:D648H	D	-	1	0	KDM5B	200978464	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	7.818000	0.86416	2.712000	0.92718	0.563000	0.77884	GAT		0.458	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618		25	89	0	0	0	0.00395357	0	25	89				
CR2	1380	broad.mit.edu	37	1	207646412	207646412	+	Nonsense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:207646412C>A	ENST00000367058.3	+	10	2055	c.1866C>A	c.(1864-1866)taC>taA	p.Y622*	CR2_ENST00000458541.2_Nonsense_Mutation_p.Y595*|CR2_ENST00000367059.3_Nonsense_Mutation_p.Y622*|CR2_ENST00000367057.3_Nonsense_Mutation_p.Y622*	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	622	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CATATTTCTACAATGACACTG	0.438																																							uc001hfw.2		NA																	0				upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						c.(1864-1866)TAC>TAA		complement component (3d/Epstein Barr virus)							94.0	91.0	92.0					1																	207646412		2203	4300	6503	SO:0001587	stop_gained	1380				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity	g.chr1:207646412C>A	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1866C>A	1.37:g.207646412C>A	ENSP00000356025:p.Tyr622*		Somatic				CR2_uc001hfv.2_Nonsense_Mutation_p.Y622*|CR2_uc009xch.2_Nonsense_Mutation_p.Y622*|CR2_uc009xci.1_Nonsense_Mutation_p.Y107*	p.Y622*	NM_001877	NP_001868	WXS	Illumina HiSeq	Unspecified	P20023	CR2_HUMAN			10	1960	+			622			Sushi 10.|Extracellular (Potential).		C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Nonsense_Mutation	SNP	ENST00000367058.3	37	c.1866C>A	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	C	37	6.094210	0.97276	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	.	.	.	5.77	3.58	0.41010	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.9467	0.35762	0.0:0.806:0.0:0.194	.	.	.	.	X	622;622;622;595	.	ENSP00000356024:Y622X	Y	+	3	2	CR2	205713035	0.961000	0.32948	1.000000	0.80357	0.690000	0.40134	-0.085000	0.11250	1.445000	0.47624	-0.140000	0.14226	TAC		0.438	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877		14	71	1	0	4.36969e-10	0.00185496	1.77815e-09	14	71				
MARK1	4139	broad.mit.edu	37	1	220825454	220825454	+	Silent	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:220825454G>C	ENST00000366917.4	+	15	1964	c.1698G>C	c.(1696-1698)ctG>ctC	p.L566L	MARK1_ENST00000402574.1_Silent_p.L431L|MARK1_ENST00000366918.4_Silent_p.L544L					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		AAGTCACACTGCCAACCATTA	0.473																																							uc001hmn.3		NA																	0				ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10						c.(1696-1698)CTG>CTC		MAP/microtubule affinity-regulating kinase 1							136.0	126.0	130.0					1																	220825454		2203	4300	6503	SO:0001819	synonymous_variant	4139				intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr1:220825454G>C	AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1698G>C	1.37:g.220825454G>C			Somatic				MARK1_uc009xdw.2_Silent_p.L566L|MARK1_uc010pun.1_Silent_p.L566L|MARK1_uc001hmm.3_Silent_p.L544L	p.L566L	NM_018650	NP_061120	WXS	Illumina HiSeq	Unspecified	Q9P0L2	MARK1_HUMAN		GBM - Glioblastoma multiforme(131;0.0407)	15	2295	+			566						Silent	SNP	ENST00000366917.4	37	c.1698G>C	CCDS31029.2																																																																																				0.473	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1			13	78	0	0	0	0.00244969	0	13	78				
HHIPL2	79802	broad.mit.edu	37	1	222717364	222717364	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:222717364C>A	ENST00000343410.6	-	2	547	c.489G>T	c.(487-489)agG>agT	p.R163S		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	163					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		GGGTACCGTCCCTTCCATGAG	0.567																																							uc001hnh.1		NA																	0				ovary(1)	1						c.(487-489)AGG>AGT		HHIP-like 2 precursor							67.0	79.0	75.0					1																	222717364		2175	4280	6455	SO:0001583	missense	79802				carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding	g.chr1:222717364C>A	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.489G>T	1.37:g.222717364C>A	ENSP00000342118:p.Arg163Ser		Somatic					p.R163S	NM_024746	NP_079022	WXS	Illumina HiSeq	Unspecified	Q6UWX4	HIPL2_HUMAN		GBM - Glioblastoma multiforme(131;0.0185)	2	547	-			163					Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	c.489G>T	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	0.339	-0.951423	0.02285	.	.	ENSG00000143512	ENST00000343410	T	0.27557	1.66	5.59	3.04	0.35103	Folate receptor-like (1);	0.566227	0.18863	N	0.129074	T	0.17238	0.0414	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.31364	-0.9946	10	0.10636	T	0.68	-0.8698	8.4707	0.32984	0.0:0.7452:0.1367:0.1182	.	163	Q6UWX4	HIPL2_HUMAN	S	163	ENSP00000342118:R163S	ENSP00000342118:R163S	R	-	3	2	HHIPL2	220783987	0.000000	0.05858	0.017000	0.16124	0.003000	0.03518	-0.207000	0.09384	0.377000	0.24735	-0.226000	0.12346	AGG		0.567	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746		14	46	1	0	0.000151284	0.00185496	0.000470934	14	46				
AGT	183	broad.mit.edu	37	1	230841707	230841707	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:230841707G>T	ENST00000366667.4	-	3	1310	c.1096C>A	c.(1096-1098)Ctc>Atc	p.L366I		NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	366					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATCCAGTTGAGGGAGTTTTGC	0.607																																							uc001hty.3		NA																	0					0						c.(1096-1098)CTC>ATC		angiotensinogen preproprotein	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)						111.0	116.0	114.0					1																	230841707		2203	4300	6503	SO:0001583	missense	183				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding	g.chr1:230841707G>T	K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.1096C>A	1.37:g.230841707G>T	ENSP00000355627:p.Leu366Ile		Somatic				AGT_uc009xfe.2_Missense_Mutation_p.L366I|AGT_uc009xff.2_Missense_Mutation_p.L338I	p.L366I	NM_000029	NP_000020	WXS	Illumina HiSeq	Unspecified	P01019	ANGT_HUMAN		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	3	1604	-	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)	366					Q16358|Q16359|Q96F91	Missense_Mutation	SNP	ENST00000366667.4	37	c.1096C>A	CCDS1585.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.828057	0.32329	.	.	ENSG00000135744	ENST00000366667;ENST00000430091	D	0.84660	-1.88	5.08	-2.35	0.06684	Serpin domain (3);	0.752485	0.12955	N	0.425524	D	0.85204	0.5643	M	0.62723	1.935	0.09310	N	1	B;P;B	0.35468	0.45;0.503;0.45	P;P;P	0.49502	0.528;0.613;0.528	T	0.76932	-0.2776	10	0.35671	T	0.21	.	7.0854	0.25254	0.3582:0.0:0.5332:0.1086	.	366;366;366	B0ZBE2;B2R5S1;P01019	.;.;ANGT_HUMAN	I	366;284	ENSP00000355627:L366I	ENSP00000355627:L366I	L	-	1	0	AGT	228908330	0.375000	0.25089	0.002000	0.10522	0.011000	0.07611	0.550000	0.23345	-0.324000	0.08589	-0.469000	0.05056	CTC		0.607	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092102.1	NM_000029		20	75	1	0	4.35082e-09	0.00152264	1.71369e-08	20	75				
AGT	183	broad.mit.edu	37	1	230846414	230846414	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:230846414C>A	ENST00000366667.4	-	2	397	c.183G>T	c.(181-183)aaG>aaT	p.K61N	RP11-99J16__A.2_ENST00000412344.1_RNA	NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	61					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GGTCTTTGGGCTTCCCGGCAT	0.572																																							uc001hty.3		NA																	0					0						c.(181-183)AAG>AAT		angiotensinogen preproprotein	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)						92.0	93.0	92.0					1																	230846414		2203	4300	6503	SO:0001583	missense	183				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding	g.chr1:230846414C>A	K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.183G>T	1.37:g.230846414C>A	ENSP00000355627:p.Lys61Asn		Somatic				AGT_uc009xfe.2_Missense_Mutation_p.K61N|AGT_uc009xff.2_Intron	p.K61N	NM_000029	NP_000020	WXS	Illumina HiSeq	Unspecified	P01019	ANGT_HUMAN		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	2	691	-	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)	61					Q16358|Q16359|Q96F91	Missense_Mutation	SNP	ENST00000366667.4	37	c.183G>T	CCDS1585.1	.	.	.	.	.	.	.	.	.	.	C	2.299	-0.360677	0.05103	.	.	ENSG00000135744	ENST00000366667;ENST00000430091	D	0.87650	-2.28	5.19	-10.4	0.00318	.	0.758719	0.12946	N	0.426206	T	0.67841	0.2936	N	0.22421	0.69	0.09310	N	1	B;B	0.25048	0.117;0.045	B;B	0.17979	0.02;0.015	T	0.54456	-0.8291	10	0.17832	T	0.49	.	7.919	0.29835	0.0724:0.1067:0.2031:0.6179	.	61;61	B2R5S1;P01019	.;ANGT_HUMAN	N	61	ENSP00000355627:K61N	ENSP00000355627:K61N	K	-	3	2	AGT	228913037	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-5.065000	0.00155	-1.610000	0.01583	-0.367000	0.07326	AAG		0.572	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092102.1	NM_000029		6	33	1	0	8.12818e-05	0.00198382	0.000254784	6	33				
C1orf101	257044	broad.mit.edu	37	1	244747191	244747191	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:244747191G>T	ENST00000366534.4	+	13	2089	c.2035G>T	c.(2035-2037)Gtt>Ttt	p.V679F	C1orf101_ENST00000366531.3_Missense_Mutation_p.V528F|C1orf101_ENST00000366533.4_Missense_Mutation_p.V679F|C1orf101_ENST00000473875.1_3'UTR	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	679						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			TCTTGTGCTGGTTCAGTTTCG	0.423																																							uc001iam.2		NA																	0				ovary(1)|breast(1)	2						c.(2035-2037)GTT>TTT		hypothetical protein LOC257044 isoform 1							97.0	78.0	84.0					1																	244747191		2203	4300	6503	SO:0001583	missense	257044					integral to membrane		g.chr1:244747191G>T	BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.2035G>T	1.37:g.244747191G>T	ENSP00000355492:p.Val679Phe		Somatic				C1orf101_uc001iak.1_Missense_Mutation_p.V233F|C1orf101_uc001ial.2_Missense_Mutation_p.V679F|C1orf101_uc010pym.1_Missense_Mutation_p.V528F|C1orf101_uc010pyn.1_Missense_Mutation_p.V612F	p.V679F	NM_001130957	NP_001124429	WXS	Illumina HiSeq	Unspecified	Q5SY80	CA101_HUMAN	all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)		13	2094	+	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		679			Extracellular (Potential).		B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	ENST00000366534.4	37	c.2035G>T	CCDS44340.1	.	.	.	.	.	.	.	.	.	.	G	6.051	0.377822	0.11466	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000428042;ENST00000366531	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	4.87	-9.73	0.00512	.	1.259200	0.05616	N	0.578986	T	0.11452	0.0279	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.14438	0.007;0.004;0.01;0.001	B;B;B;B	0.15052	0.012;0.005;0.007;0.003	T	0.20107	-1.0285	10	0.20046	T	0.44	.	0.8701	0.01212	0.3769:0.1731:0.1111:0.339	.	599;679;679;528	B1AQM6;Q5SY80;Q5SY80-2;B4DZR4	.;CA101_HUMAN;.;.	F	679;679;679;599;528	ENSP00000355492:V679F;ENSP00000355491:V679F;ENSP00000395796:V599F;ENSP00000355489:V528F	ENSP00000355489:V528F	V	+	1	0	C1orf101	242813814	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.423000	0.02450	-2.466000	0.00533	-1.036000	0.02392	GTT		0.423	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096701.1	NM_173807		14	26	1	0	0.000219431	0.00244969	0.000672226	14	26				
OR2B11	127623	broad.mit.edu	37	1	247614745	247614745	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:247614745G>C	ENST00000318749.6	-	1	563	c.540C>G	c.(538-540)aaC>aaG	p.N180K		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CACAGAAAAAGTTGTTCAGCA	0.592																																							uc010pyx.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(538-540)AAC>AAG		olfactory receptor, family 2, subfamily B,							55.0	56.0	56.0					1																	247614745		2203	4300	6503	SO:0001583	missense	127623				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247614745G>C		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.540C>G	1.37:g.247614745G>C	ENSP00000325682:p.Asn180Lys		Somatic					p.N180K	NM_001004492	NP_001004492	WXS	Illumina HiSeq	Unspecified	Q5JQS5	OR2BB_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	540	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	180			Extracellular (Potential).		B2RP03	Missense_Mutation	SNP	ENST00000318749.6	37	c.540C>G	CCDS31090.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735703	0.30774	.	.	ENSG00000177535	ENST00000318749	T	0.00076	8.76	4.96	3.1	0.35709	GPCR, rhodopsin-like superfamily (1);	0.437833	0.21309	N	0.076669	T	0.00178	0.0005	M	0.75447	2.3	0.26058	N	0.981395	P	0.35551	0.509	B	0.35607	0.206	T	0.16689	-1.0394	10	0.87932	D	0	.	6.74	0.23431	0.2807:0.0:0.7193:0.0	.	180	Q5JQS5	OR2BB_HUMAN	K	180	ENSP00000325682:N180K	ENSP00000325682:N180K	N	-	3	2	OR2B11	245681368	0.103000	0.21917	1.000000	0.80357	0.097000	0.18754	-0.056000	0.11787	0.815000	0.34398	0.551000	0.68910	AAC		0.592	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492		5	19	0	0	0	0.00116845	0	5	19				
OR2L2	26246	broad.mit.edu	37	1	248201833	248201833	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:248201833C>G	ENST00000366479.2	+	1	360	c.264C>G	c.(262-264)aaC>aaG	p.N88K	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			tgtatggaaacaagtctatct	0.413																																							uc001idw.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(262-264)AAC>AAG		olfactory receptor, family 2, subfamily L,							188.0	173.0	178.0					1																	248201833		2203	4300	6503	SO:0001583	missense	26246				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248201833C>G	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.264C>G	1.37:g.248201833C>G	ENSP00000355435:p.Asn88Lys		Somatic				OR2L13_uc001ids.2_Intron	p.N88K	NM_001004686	NP_001004686	WXS	Illumina HiSeq	Unspecified	Q8NH16	OR2L2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	360	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		88			Extracellular (Potential).		Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	c.264C>G	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	0.521	-0.862003	0.02610	.	.	ENSG00000203663	ENST00000366479	T	0.02863	4.13	1.9	-0.614	0.11590	GPCR, rhodopsin-like superfamily (1);	0.767336	0.10614	U	0.654156	T	0.01061	0.0035	N	0.03253	-0.375	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.47724	-0.9095	10	0.06099	T	0.92	.	1.8787	0.03223	0.1999:0.4748:0.1962:0.1291	.	88	Q8NH16	OR2L2_HUMAN	K	88	ENSP00000355435:N88K	ENSP00000355435:N88K	N	+	3	2	OR2L2	246268456	0.000000	0.05858	0.674000	0.29902	0.128000	0.20619	-4.757000	0.00189	0.038000	0.15604	0.194000	0.17425	AAC		0.413	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686		46	220	0	0	0	0.0025221	0	46	220				
OR2L2	26246	broad.mit.edu	37	1	248202089	248202089	+	Missense_Mutation	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:248202089A>G	ENST00000366479.2	+	1	616	c.520A>G	c.(520-522)Aat>Gat	p.N174D	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CAGAGCCATCAATCATTTTTT	0.428																																							uc001idw.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(520-522)AAT>GAT		olfactory receptor, family 2, subfamily L,							214.0	195.0	202.0					1																	248202089		2203	4300	6503	SO:0001583	missense	26246				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248202089A>G	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.520A>G	1.37:g.248202089A>G	ENSP00000355435:p.Asn174Asp		Somatic				OR2L13_uc001ids.2_Intron	p.N174D	NM_001004686	NP_001004686	WXS	Illumina HiSeq	Unspecified	Q8NH16	OR2L2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	616	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		174			Extracellular (Potential).		Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	c.520A>G	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	8.300	0.819760	0.16678	.	.	ENSG00000203663	ENST00000366479	T	0.00069	8.77	1.9	1.9	0.25705	GPCR, rhodopsin-like superfamily (1);	0.222920	0.22294	N	0.061941	T	0.00073	0.0002	N	0.10972	0.075	0.09310	N	1	B	0.17038	0.02	B	0.20384	0.029	T	0.04065	-1.0980	10	0.20046	T	0.44	.	4.6576	0.12626	0.6914:0.0:0.3086:0.0	.	174	Q8NH16	OR2L2_HUMAN	D	174	ENSP00000355435:N174D	ENSP00000355435:N174D	N	+	1	0	OR2L2	246268712	0.000000	0.05858	0.880000	0.34516	0.543000	0.35085	-0.070000	0.11523	0.746000	0.32786	0.163000	0.16589	AAT		0.428	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686		72	201	0	0	0	0.00361006	0	72	201				
OR2L3	391192	broad.mit.edu	37	1	248224498	248224498	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:248224498C>G	ENST00000359959.3	+	1	515	c.515C>G	c.(514-516)gCc>gGc	p.A172G	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CAATCCAGGGCCATCAATCAT	0.468																																							uc001idx.1		NA																	0					0						c.(514-516)GCC>GGC		olfactory receptor, family 2, subfamily L,							118.0	158.0	144.0					1																	248224498		2202	4299	6501	SO:0001583	missense	391192				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248224498C>G	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.515C>G	1.37:g.248224498C>G	ENSP00000353044:p.Ala172Gly		Somatic				OR2L13_uc001ids.2_Intron	p.A172G	NM_001004687	NP_001004687	WXS	Illumina HiSeq	Unspecified	Q8NG85	OR2L3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	515	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		172			Extracellular (Potential).		B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	c.515C>G	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	.	4.389	0.071798	0.08436	.	.	ENSG00000198128	ENST00000359959	T	0.00084	8.75	2.05	-1.21	0.09524	GPCR, rhodopsin-like superfamily (1);	1.126930	0.06999	U	0.823061	T	0.00178	0.0005	L	0.31926	0.97	0.09310	N	1	B	0.34349	0.45	P	0.46825	0.528	T	0.17868	-1.0355	10	0.66056	D	0.02	.	4.8191	0.13381	0.0:0.4297:0.1605:0.4098	.	172	Q8NG85	OR2L3_HUMAN	G	172	ENSP00000353044:A172G	ENSP00000353044:A172G	A	+	2	0	OR2L3	246291121	0.000000	0.05858	0.005000	0.12908	0.000000	0.00434	-4.086000	0.00298	-0.160000	0.11002	-1.281000	0.01382	GCC		0.468	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687		31	131	0	0	0	0.00178596	0	31	131				
OR2L3	391192	broad.mit.edu	37	1	248224827	248224827	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:248224827C>A	ENST00000359959.3	+	1	844	c.844C>A	c.(844-846)Cca>Aca	p.P282T	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CACCCTCACTCCAATGCTCAA	0.488																																							uc001idx.1		NA																	0					0						c.(844-846)CCA>ACA		olfactory receptor, family 2, subfamily L,							91.0	85.0	87.0					1																	248224827		2203	4300	6503	SO:0001583	missense	391192				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248224827C>A	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.844C>A	1.37:g.248224827C>A	ENSP00000353044:p.Pro282Thr		Somatic				OR2L13_uc001ids.2_Intron	p.P282T	NM_001004687	NP_001004687	WXS	Illumina HiSeq	Unspecified	Q8NG85	OR2L3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	844	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		282			Helical; Name=7; (Potential).		B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	c.844C>A	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	C	12.72	2.022522	0.35701	.	.	ENSG00000198128	ENST00000359959	T	0.00344	8.02	2.01	2.01	0.26516	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31279	U	0.007921	T	0.01156	0.0038	H	0.95611	3.695	0.43936	D	0.99659	D	0.89917	1.0	D	0.97110	1.0	T	0.52366	-0.8585	10	0.87932	D	0	.	11.9452	0.52924	0.0:1.0:0.0:0.0	.	282	Q8NG85	OR2L3_HUMAN	T	282	ENSP00000353044:P282T	ENSP00000353044:P282T	P	+	1	0	OR2L3	246291450	0.982000	0.34865	0.281000	0.24762	0.201000	0.24016	3.915000	0.56409	1.119000	0.41883	0.456000	0.33151	CCA		0.488	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687		21	63	1	0	5.45024e-15	0.00332997	2.52167e-14	21	63				
OR14C36	127066	broad.mit.edu	37	1	248512663	248512663	+	Missense_Mutation	SNP	T	T	C	rs369954783		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:248512663T>C	ENST00000317861.1	+	1	587	c.587T>C	c.(586-588)aTg>aCg	p.M196T		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						AATGAGGTCATGATTGTTGTC	0.493																																							uc010pzl.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(586-588)ATG>ACG		olfactory receptor, family 14, subfamily C,		T	THR/MET	0,4406		0,0,2203	158.0	144.0	149.0		587	1.2	0.0	1		149	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR14C36	NM_001001918.1	81	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	196/313	248512663	1,13005	2203	4300	6503	SO:0001583	missense	127066				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248512663T>C	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.587T>C	1.37:g.248512663T>C	ENSP00000324534:p.Met196Thr		Somatic					p.M196T	NM_001001918	NP_001001918	WXS	Illumina HiSeq	Unspecified	Q8NHC7	O14CZ_HUMAN			1	587	+			196			Helical; Name=5; (Potential).		Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	37	c.587T>C	CCDS31112.1	.	.	.	.	.	.	.	.	.	.	T	5.169	0.216733	0.09810	0.0	1.16E-4	ENSG00000177174	ENST00000317861	T	0.37411	1.2	4.05	1.22	0.21188	GPCR, rhodopsin-like superfamily (1);	2.266520	0.02129	N	0.056248	T	0.22589	0.0545	N	0.12527	0.23	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15838	-1.0423	10	0.22706	T	0.39	.	7.1875	0.25806	0.0:0.3244:0.0:0.6756	.	196	Q8NHC7	O14CZ_HUMAN	T	196	ENSP00000324534:M196T	ENSP00000324534:M196T	M	+	2	0	OR14C36	246579286	0.000000	0.05858	0.000000	0.03702	0.418000	0.31294	-2.045000	0.01410	0.051000	0.15978	-0.560000	0.04181	ATG		0.493	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918		13	71	0	0	0	0.00185496	0	13	71				
OR14C36	127066	broad.mit.edu	37	1	248512671	248512671	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:248512671G>T	ENST00000317861.1	+	1	595	c.595G>T	c.(595-597)Gtc>Ttc	p.V199F		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						CATGATTGTTGTCTCTGCTCT	0.488																																							uc010pzl.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(595-597)GTC>TTC		olfactory receptor, family 14, subfamily C,							161.0	147.0	152.0					1																	248512671		2203	4300	6503	SO:0001583	missense	127066				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248512671G>T	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.595G>T	1.37:g.248512671G>T	ENSP00000324534:p.Val199Phe		Somatic					p.V199F	NM_001001918	NP_001001918	WXS	Illumina HiSeq	Unspecified	Q8NHC7	O14CZ_HUMAN			1	595	+			199			Helical; Name=5; (Potential).		Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	37	c.595G>T	CCDS31112.1	.	.	.	.	.	.	.	.	.	.	G	8.380	0.837204	0.16891	.	.	ENSG00000177174	ENST00000317861	T	0.00174	8.62	4.05	-0.136	0.13473	GPCR, rhodopsin-like superfamily (1);	0.826472	0.10001	U	0.728464	T	0.00109	0.0003	N	0.13003	0.285	0.09310	N	1	B	0.20459	0.045	B	0.29598	0.104	T	0.02691	-1.1123	10	0.27082	T	0.32	.	4.1206	0.10104	0.4959:0.0:0.3412:0.1629	.	199	Q8NHC7	O14CZ_HUMAN	F	199	ENSP00000324534:V199F	ENSP00000324534:V199F	V	+	1	0	OR14C36	246579294	0.000000	0.05858	0.000000	0.03702	0.279000	0.26890	-1.674000	0.01949	-0.179000	0.10654	0.395000	0.25975	GTC		0.488	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918		11	71	1	0	5.50884e-06	0.00136819	1.84676e-05	11	71				
OR2T6	254879	broad.mit.edu	37	1	248551233	248551233	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:248551233G>T	ENST00000355728.2	+	1	324	c.324G>T	c.(322-324)atG>atT	p.M108I		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGGGCTTTATGGGGGCTGAAT	0.562																																							uc001iei.1		NA																	0				ovary(2)|skin(1)	3						c.(322-324)ATG>ATT		olfactory receptor, family 2, subfamily T,							94.0	100.0	98.0					1																	248551233		2203	4300	6503	SO:0001583	missense	254879				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248551233G>T	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.324G>T	1.37:g.248551233G>T	ENSP00000347965:p.Met108Ile		Somatic					p.M108I	NM_001005471	NP_001005471	WXS	Illumina HiSeq	Unspecified	Q8NHC8	OR2T6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	324	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		108			Helical; Name=3; (Potential).		A6NE36	Missense_Mutation	SNP	ENST00000355728.2	37	c.324G>T	CCDS31114.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.562917	0.00903	.	.	ENSG00000198104	ENST00000355728	T	0.19394	2.15	4.19	-0.063	0.13778	GPCR, rhodopsin-like superfamily (1);	0.173987	0.27778	N	0.017891	T	0.04452	0.0122	N	0.01464	-0.85	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32929	-0.9888	10	0.08179	T	0.78	.	1.7176	0.02905	0.4711:0.141:0.2436:0.1443	.	108	Q8NHC8	OR2T6_HUMAN	I	108	ENSP00000347965:M108I	ENSP00000347965:M108I	M	+	3	0	OR2T6	246617856	0.000000	0.05858	0.999000	0.59377	0.720000	0.41350	-1.764000	0.01800	0.109000	0.17891	-0.796000	0.03273	ATG		0.562	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471		12	67	1	0	6.40141e-05	0.000978159	0.00020349	12	67				
OR2T1	26696	broad.mit.edu	37	1	248570293	248570294	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:248570293_248570294CC>AA	ENST00000366474.1	+	1	998_999	c.998_999CC>AA	c.(997-999)cCC>cAA	p.P333Q		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	333						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATTCTCACACCCATGCTGAACC	0.525																																							uc010pzm.1		NA																	0				pancreas(1)	1						c.(997-999)CCC>CAA		olfactory receptor, family 2, subfamily T,																																				SO:0001583	missense	26696				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248570293_248570294CC>AA	U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	Exception_encountered	1.37:g.248570293_248570294delinsAA	ENSP00000355430:p.Pro333Gln		Somatic					p.P333Q	NM_030904	NP_112166	WXS	Illumina HiSeq	Unspecified	O43869	OR2T1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	998_999	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		333			Helical; Name=7; (Potential).		Q6IEZ9	Missense_Mutation	DNP	ENST00000366474.1	37	c.998_999CC>AA	CCDS31115.1																																																																																				0.525	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097346.2			27	122	0	0	0	6.4e-05	0	27	122				
OR2T3	343173	broad.mit.edu	37	1	248637474	248637474	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:248637474C>A	ENST00000359594.2	+	1	848	c.823C>A	c.(823-825)Cag>Aag	p.Q275K		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CACAGCTGAGCAGGACATGAT	0.542																																							uc001iel.1		NA																	0				skin(1)	1						c.(823-825)CAG>AAG		olfactory receptor, family 2, subfamily T,							299.0	283.0	289.0					1																	248637474		2203	4300	6503	SO:0001583	missense	343173				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248637474C>A		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.823C>A	1.37:g.248637474C>A	ENSP00000352604:p.Gln275Lys		Somatic					p.Q275K	NM_001005495	NP_001005495	WXS	Illumina HiSeq	Unspecified	Q8NH03	OR2T3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	823	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		275			Extracellular (Potential).		B2RNJ1	Missense_Mutation	SNP	ENST00000359594.2	37	c.823C>A	CCDS31117.1	.	.	.	.	.	.	.	.	.	.	c	2.734	-0.263808	0.05754	.	.	ENSG00000196539	ENST00000359594	T	0.00137	8.68	2.37	1.27	0.21489	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.05306	-0.075	0.09310	N	1	B	0.15141	0.012	B	0.18871	0.023	T	0.00433	-1.1742	9	0.13470	T	0.59	.	7.0743	0.25195	0.4148:0.5852:0.0:0.0	.	275	Q8NH03	OR2T3_HUMAN	K	275	ENSP00000352604:Q275K	ENSP00000352604:Q275K	Q	+	1	0	OR2T3	246704097	0.000000	0.05858	0.107000	0.21349	0.296000	0.27459	-2.054000	0.01399	1.014000	0.39417	0.186000	0.17326	CAG		0.542	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495		36	266	1	0	1.59932e-28	0.00170553	8.03229e-28	36	266				
OR2T5	401993	broad.mit.edu	37	1	248652006	248652006	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:248652006C>A	ENST00000366473.2	+	1	122	c.117C>A	c.(115-117)ttC>ttA	p.F39L		NM_001004697.1	NP_001004697.1	Q6IEZ7	OR2T5_HUMAN	olfactory receptor, family 2, subfamily T, member 5	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(2)|pancreas(1)|skin(2)	9	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTGTGGTTTTCCTGAAGGCGT	0.478																																							uc001iem.1		NA																	0					0						c.(115-117)TTC>TTA		olfactory receptor, family 2, subfamily T,							96.0	118.0	111.0					1																	248652006		2199	4296	6495	SO:0001583	missense	401993				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248652006C>A	BK004465	CCDS31118.1	1q44	2012-08-09			ENSG00000203661	ENSG00000203661		"""GPCR / Class A : Olfactory receptors"""	15017	protein-coding gene	gene with protein product							Standard	NM_001004697		Approved		uc001iem.1	Q6IEZ7	OTTHUMG00000040481	ENST00000366473.2:c.117C>A	1.37:g.248652006C>A	ENSP00000355429:p.Phe39Leu		Somatic					p.F39L	NM_001004697	NP_001004697	WXS	Illumina HiSeq	Unspecified	Q6IEZ7	OR2T5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	117	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		39			Helical; Name=1; (Potential).			Missense_Mutation	SNP	ENST00000366473.2	37	c.117C>A	CCDS31118.1	.	.	.	.	.	.	.	.	.	.	c	12.39	1.923140	0.33908	.	.	ENSG00000203661	ENST00000366473	T	0.04234	3.67	2.64	0.537	0.17144	.	0.000000	0.47852	D	0.000203	T	0.06096	0.0158	M	0.65677	2.01	0.28445	N	0.916637	B	0.20988	0.05	B	0.24394	0.053	T	0.16689	-1.0394	10	0.66056	D	0.02	.	5.1768	0.15139	0.0:0.4366:0.0:0.5634	.	39	Q6IEZ7	OR2T5_HUMAN	L	39	ENSP00000355429:F39L	ENSP00000355429:F39L	F	+	3	2	OR2T5	246718629	0.000000	0.05858	0.077000	0.20336	0.232000	0.25224	-2.124000	0.01318	0.236000	0.21180	0.413000	0.27773	TTC		0.478	OR2T5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097422.1	NM_001004697		16	108	1	0	2.19358e-23	0.00111076	1.08554e-22	16	108				
ANKRD16	54522	broad.mit.edu	37	10	5927686	5927686	+	Splice_Site	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:5927686C>A	ENST00000380094.5	-	3	1121	c.578G>T	c.(577-579)aGg>aTg	p.R193M	ANKRD16_ENST00000191063.8_Splice_Site_p.R193M|ANKRD16_ENST00000380092.4_Splice_Site_p.R193M	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	193										breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						ttgttcttacctcttaaGAAG	0.383																																							uc010qat.1		NA																	0					0						c.(577-579)AGG>ATG		ankyrin repeat domain 16 isoform a							129.0	112.0	117.0					10																	5927686		2203	4300	6503	SO:0001630	splice_region_variant	54522							g.chr10:5927686C>A	AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.578+1G>T	10.37:g.5927686C>A			Somatic				ANKRD16_uc009xie.2_Missense_Mutation_p.R193M|ANKRD16_uc009xif.2_Missense_Mutation_p.R193M|ANKRD16_uc001iiq.2_Missense_Mutation_p.R193M	p.R193M	NM_019046	NP_061919	WXS	Illumina HiSeq	Unspecified	Q6P6B7	ANR16_HUMAN			3	1121	-			193			ANK 5.		A6NEF0|F8WEI4|Q9NT01	Missense_Mutation	SNP	ENST00000380094.5	37	c.578G>T	CCDS31136.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.012779	0.75161	.	.	ENSG00000134461	ENST00000380094;ENST00000380092;ENST00000191063	T;T;T	0.65916	-0.18;-0.18;-0.18	4.7	4.7	0.59300	Ankyrin repeat-containing domain (4);	0.000000	0.85682	U	0.000000	T	0.73297	0.3569	L	0.48642	1.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.982;0.985;0.976	T	0.74509	-0.3642	10	0.49607	T	0.09	-15.1145	16.8322	0.85947	0.0:1.0:0.0:0.0	.	193;193;193	Q6P6B7;C9JP28;F8WEI4	ANR16_HUMAN;.;.	M	193	ENSP00000369436:R193M;ENSP00000369434:R193M;ENSP00000352361:R193M	ENSP00000352361:R193M	R	-	2	0	ANKRD16	5967692	1.000000	0.71417	0.986000	0.45419	0.804000	0.45430	5.869000	0.69613	2.308000	0.77769	0.650000	0.86243	AGG		0.383	ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046611.2	XM_166138	Missense_Mutation	7	30	1	0	5.18039e-06	0.00307968	1.7629e-05	7	30				
FBXO18	84893	broad.mit.edu	37	10	5960359	5960359	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:5960359C>A	ENST00000362091.4	+	13	2133	c.2018C>A	c.(2017-2019)cCg>cAg	p.P673Q	FBXO18_ENST00000397269.3_Missense_Mutation_p.P160Q|FBXO18_ENST00000379999.5_Missense_Mutation_p.P724Q	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	673					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)	p.P724Q(1)		NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GTAGGGGACCCGCACCAGCAG	0.537																																							uc001iis.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2017-2019)CCG>CAG		F-box only protein, helicase, 18 isoform 2							145.0	143.0	144.0					10																	5960359		2203	4300	6503	SO:0001583	missense	84893				DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr10:5960359C>A	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2018C>A	10.37:g.5960359C>A	ENSP00000355415:p.Pro673Gln		Somatic				FBXO18_uc001iir.2_Missense_Mutation_p.P599Q|FBXO18_uc009xig.2_Missense_Mutation_p.P599Q|FBXO18_uc001iit.2_Missense_Mutation_p.P724Q	p.P673Q	NM_178150	NP_835363	WXS	Illumina HiSeq	Unspecified	Q8NFZ0	FBX18_HUMAN			13	2113	+			673					Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	c.2018C>A	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	C	32	5.115400	0.94339	.	.	ENSG00000134452	ENST00000397269;ENST00000362091;ENST00000379999	D;D;D	0.84370	-1.84;-1.84;-1.84	6.0	6.0	0.97389	.	0.000000	0.85682	D	0.000000	D	0.94026	0.8086	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.995	D	0.93979	0.7256	10	0.66056	D	0.02	-13.9758	20.142	0.98061	0.0:1.0:0.0:0.0	.	724;673;599	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	Q	160;673;724	ENSP00000380439:P160Q;ENSP00000355415:P673Q;ENSP00000369335:P724Q	ENSP00000355415:P673Q	P	+	2	0	FBXO18	6000365	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	6.995000	0.76257	2.850000	0.98022	0.650000	0.86243	CCG		0.537	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807		7	98	1	0	0.00307968	0.00307968	0.00896691	7	98				
FAM171A1	221061	broad.mit.edu	37	10	15255673	15255673	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:15255673C>A	ENST00000378116.4	-	8	1920	c.1914G>T	c.(1912-1914)ctG>ctT	p.L638L	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	638						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CCTGGGAAGACAGGGGCTGGG	0.602																																							uc001iob.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(1912-1914)CTG>CTT		hypothetical protein LOC221061 precursor							50.0	58.0	55.0					10																	15255673		2203	4300	6503	SO:0001819	synonymous_variant	221061					integral to membrane		g.chr10:15255673C>A	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1914G>T	10.37:g.15255673C>A			Somatic					p.L638L	NM_001010924	NP_001010924	WXS	Illumina HiSeq	Unspecified	Q5VUB5	F1711_HUMAN			8	1921	-			638			Cytoplasmic (Potential).		D3DRT9|Q32M49|Q8N4I0	Silent	SNP	ENST00000378116.4	37	c.1914G>T	CCDS31154.1																																																																																				0.602	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709		16	22	1	0	0.000308642	0.00316338	0.000932831	16	22				
ITGA8	8516	broad.mit.edu	37	10	15600165	15600165	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:15600165C>T	ENST00000378076.3	-	26	3027	c.2674G>A	c.(2674-2676)Gcc>Acc	p.A892T		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	892					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						CGCAAAAAGGCGCTGAGCTCA	0.458																																							uc001ioc.1		NA																	0				ovary(3)|lung(3)	6						c.(2674-2676)GCC>ACC		integrin, alpha 8 precursor							66.0	64.0	65.0					10																	15600165		2203	4300	6503	SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15600165C>T	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2674G>A	10.37:g.15600165C>T	ENSP00000367316:p.Ala892Thr		Somatic				ITGA8_uc010qcb.1_Missense_Mutation_p.A877T	p.A892T	NM_003638	NP_003629	WXS	Illumina HiSeq	Unspecified	P53708	ITA8_HUMAN			26	2674	-			892			Extracellular (Potential).		B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	c.2674G>A	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.131165	0.37630	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.44482	0.92	6.06	6.06	0.98353	Integrin alpha-2 (1);	0.122107	0.56097	D	0.000032	T	0.36082	0.0954	L	0.48362	1.52	0.42278	D	0.992086	B;B	0.31655	0.286;0.334	B;B	0.28139	0.051;0.086	T	0.13845	-1.0494	10	0.10636	T	0.68	.	17.5395	0.87843	0.0:1.0:0.0:0.0	.	877;892	F5H818;P53708	.;ITA8_HUMAN	T	892;877	ENSP00000367316:A892T	ENSP00000367316:A892T	A	-	1	0	ITGA8	15640171	0.997000	0.39634	0.994000	0.49952	0.583000	0.36354	4.646000	0.61411	2.885000	0.99019	0.643000	0.83706	GCC		0.458	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		12	40	0	0	0	0.00185496	0	12	40				
YME1L1	10730	broad.mit.edu	37	10	27409370	27409370	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:27409370C>A	ENST00000326799.3	-	14	1724	c.1576G>T	c.(1576-1578)Gat>Tat	p.D526Y	YME1L1_ENST00000375972.3_Missense_Mutation_p.D436Y|YME1L1_ENST00000376016.3_Missense_Mutation_p.D469Y	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	526					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						TTACATTGATCAAACTTTATT	0.333																																							uc001iti.2		NA																	0				ovary(1)	1						c.(1576-1578)GAT>TAT		YME1-like 1 isoform 1							87.0	81.0	83.0					10																	27409370		2203	4300	6503	SO:0001583	missense	10730				protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity	g.chr10:27409370C>A	AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.1576G>T	10.37:g.27409370C>A	ENSP00000318480:p.Asp526Tyr		Somatic				YME1L1_uc001itj.2_Missense_Mutation_p.D469Y|YME1L1_uc010qdl.1_Missense_Mutation_p.D436Y|YME1L1_uc009xkv.2_Intron	p.D526Y	NM_139312	NP_647473	WXS	Illumina HiSeq	Unspecified	Q96TA2	YMEL1_HUMAN			14	1758	-			526					B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	ENST00000326799.3	37	c.1576G>T	CCDS7152.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916010	0.73098	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000546122	T;T;T	0.78924	-1.22;-1.22;-1.22	5.72	5.72	0.89469	Peptidase M41, FtsH (2);	0.000000	0.85682	D	0.000000	D	0.90484	0.7019	M	0.89353	3.025	0.80722	D	1	D;D;P	0.89917	1.0;0.997;0.781	D;D;B	0.85130	0.997;0.946;0.248	D	0.90379	0.4386	10	0.52906	T	0.07	-25.9894	20.2441	0.98394	0.0:1.0:0.0:0.0	.	436;469;526	B4DNM1;Q96TA2-2;Q96TA2	.;.;YMEL1_HUMAN	Y	469;526;526;436;272	ENSP00000365184:D469Y;ENSP00000318480:D526Y;ENSP00000365139:D436Y	ENSP00000318480:D526Y	D	-	1	0	YME1L1	27449376	1.000000	0.71417	1.000000	0.80357	0.518000	0.34316	7.734000	0.84928	2.865000	0.98341	0.655000	0.94253	GAT		0.333	YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1	NM_139312		11	40	1	0	9.70103e-10	0.000673444	3.92398e-09	11	40				
LRRC37A6P	387646	broad.mit.edu	37	10	27539200	27539200	+	lincRNA	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:27539200G>T	ENST00000574842.1	+	0	469				LRRC37A6P_ENST00000284414.4_RNA																							TGAGTTTGATGGTGACCTGGA	0.532																																							uc001its.2		NA																	0					0						c.(193-195)CAT>AAT		SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;							76.0	69.0	71.0					10																	27539200		692	1591	2283			387646							g.chr10:27539200G>T																													10.37:g.27539200G>T			Somatic					p.H65N	NR_003525		WXS	Illumina HiSeq	Unspecified					1	2036	-									Missense_Mutation	SNP	ENST00000574842.1	37	c.193C>A																																																																																					0.532	RP11-85G18.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000436904.1			19	82	1	0	2.94398e-08	0.000958276	1.12354e-07	19	82				
MTPAP	55149	broad.mit.edu	37	10	30615418	30615418	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:30615418C>A	ENST00000263063.4	-	5	970	c.927G>T	c.(925-927)cgG>cgT	p.R309R	MTPAP_ENST00000488290.1_5'UTR|MTPAP_ENST00000358107.4_Silent_p.R439R	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	309					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CGAGCGGACACCGGGCATTTA	0.443																																							uc001iva.3		NA																	0				ovary(1)	1						c.(925-927)CGG>CGT		PAP associated domain containing 1 precursor							107.0	115.0	112.0					10																	30615418		2203	4300	6503	SO:0001819	synonymous_variant	55149				cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding	g.chr10:30615418C>A	AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.927G>T	10.37:g.30615418C>A			Somatic				MTPAP_uc001ivb.3_Silent_p.R439R	p.R309R	NM_018109	NP_060579	WXS	Illumina HiSeq	Unspecified	Q9NVV4	PAPD1_HUMAN			5	990	-			309					D3DRX0|Q659E3|Q6P7E5|Q9HA74	Silent	SNP	ENST00000263063.4	37	c.927G>T	CCDS7165.1																																																																																				0.443	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047426.2	NM_018109		15	108	1	0	0.000219431	0.00244969	0.000672226	15	108				
RET	5979	broad.mit.edu	37	10	43610004	43610004	+	Silent	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:43610004G>C	ENST00000355710.3	+	11	2188	c.1956G>C	c.(1954-1956)ctG>ctC	p.L652L	RET_ENST00000340058.5_Silent_p.L652L	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	652					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CGGTGCTGCTGTCTGCCTTCT	0.627		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	uc001jal.2		1	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	T|Mis|N|F	ret proto-oncogene	yes	Hirschsprung disease	"""E, O"""	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma		0				thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451						c.(1954-1956)CTG>CTC		ret proto-oncogene isoform a	Sunitinib(DB01268)						189.0	118.0	142.0					10																	43610004		2203	4300	6503	SO:0001819	synonymous_variant	5979	Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity	g.chr10:43610004G>C	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.1956G>C	10.37:g.43610004G>C			Somatic				RET_uc001jak.1_Silent_p.L652L|RET_uc010qez.1_Silent_p.L398L	p.L652L	NM_020975	NP_066124	WXS	Illumina HiSeq	Unspecified	P07949	RET_HUMAN			11	2146	+		Ovarian(717;0.0423)	652			Helical; (Potential).		A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Silent	SNP	ENST00000355710.3	37	c.1956G>C	CCDS7200.1																																																																																				0.627	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975		8	42	0	0	0	0.00307968	0	8	42				
SLC18A3	6572	broad.mit.edu	37	10	50819098	50819098	+	Silent	SNP	G	G	A	rs199561778		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:50819098G>A	ENST00000374115.3	+	1	752	c.312G>A	c.(310-312)gcG>gcA	p.A104A	CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000337653.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	104					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						CGACAGCTGCGTGGCCAGCGG	0.682																																							uc001jhw.2		NA																	0				ovary(2)	2						c.(310-312)GCG>GCA		vesicular acetylcholine transporter							47.0	49.0	48.0					10																	50819098		2202	4300	6502	SO:0001819	synonymous_variant	6572				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity	g.chr10:50819098G>A	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.312G>A	10.37:g.50819098G>A			Somatic				CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank	p.A104A	NM_003055	NP_003046	WXS	Illumina HiSeq	Unspecified	Q16572	VACHT_HUMAN			1	752	+			104			Lumenal, vesicle (Potential).		B2R7S1	Silent	SNP	ENST00000374115.3	37	c.312G>A	CCDS7231.1																																																																																				0.682	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055		9	30	0	0	0	0.00448238	0	9	30				
PCDH15	65217	broad.mit.edu	37	10	55582648	55582648	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:55582648C>G	ENST00000320301.6	-	33	5232	c.4838G>C	c.(4837-4839)gGa>gCa	p.G1613A	PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000437009.1_Missense_Mutation_p.G1544A|PCDH15_ENST00000395430.1_Missense_Mutation_p.G1610A|PCDH15_ENST00000395432.2_Missense_Mutation_p.G1573A|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.G1615A|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395433.1_Missense_Mutation_p.G1590A|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1613					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGTACAGATTCCAGTGTTTTC	0.433										HNSCC(58;0.16)																													uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(4837-4839)GGA>GCA		protocadherin 15 isoform CD1-4 precursor							191.0	184.0	186.0					10																	55582648		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55582648C>G	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4838G>C	10.37:g.55582648C>G	ENSP00000322604:p.Gly1613Ala	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.G1610A|PCDH15_uc010qhw.1_Missense_Mutation_p.G1573A|PCDH15_uc010qhx.1_Missense_Mutation_p.G1544A|PCDH15_uc010qhy.1_Missense_Mutation_p.G1620A|PCDH15_uc010qhz.1_Missense_Mutation_p.G1615A|PCDH15_uc010qia.1_Missense_Mutation_p.G1593A|PCDH15_uc010qib.1_Missense_Mutation_p.G1590A	p.G1613A	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			33	5233	-		Melanoma(3;0.117)|Lung SC(717;0.238)	1613			Cytoplasmic (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.4838G>C	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	8.749	0.920895	0.17982	.	.	ENSG00000150275	ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T	0.57107	0.45;0.42;0.46;0.43;0.43;0.44	5.09	2.2	0.27929	.	.	.	.	.	T	0.46073	0.1374	L	0.47716	1.5	0.09310	N	1	B;B;B;B;B;B;B;B	0.29936	0.262;0.228;0.228;0.228;0.228;0.228;0.262;0.228	B;B;B;B;B;B;B;B	0.35114	0.196;0.071;0.071;0.071;0.103;0.071;0.156;0.071	T	0.39482	-0.9612	9	0.40728	T	0.16	.	7.8746	0.29586	0.0:0.5462:0.0:0.4538	.	1590;1613;1615;1620;1544;1573;1610;1613	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;Q96QU1	.;.;.;.;.;.;.;PCD15_HUMAN	A	1573;1615;1590;1613;1610;1620;1544	ENSP00000378820:G1573A;ENSP00000354950:G1615A;ENSP00000378821:G1590A;ENSP00000322604:G1613A;ENSP00000378818:G1610A;ENSP00000412628:G1544A	ENSP00000322604:G1613A	G	-	2	0	PCDH15	55252654	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	0.303000	0.19210	0.554000	0.29061	-0.142000	0.14014	GGA		0.433	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		26	106	0	0	0	0.00465635	0	26	106				
PCDH15	65217	broad.mit.edu	37	10	55826597	55826597	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:55826597C>A	ENST00000320301.6	-	18	2534	c.2140G>T	c.(2140-2142)Gct>Tct	p.A714S	PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395438.1_Missense_Mutation_p.A714S|PCDH15_ENST00000437009.1_Missense_Mutation_p.A643S|PCDH15_ENST00000395430.1_Missense_Mutation_p.A714S|PCDH15_ENST00000395432.2_Missense_Mutation_p.A677S|PCDH15_ENST00000373957.3_Missense_Mutation_p.A692S|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.A721S|PCDH15_ENST00000395445.1_Missense_Mutation_p.A721S|PCDH15_ENST00000361849.3_Missense_Mutation_p.A714S|PCDH15_ENST00000409834.1_Missense_Mutation_p.A325S|PCDH15_ENST00000414778.1_Missense_Mutation_p.A719S|PCDH15_ENST00000395433.1_Missense_Mutation_p.A692S|PCDH15_ENST00000373955.1_Missense_Mutation_p.A714S|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	714	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AACACTGGAGCATTGTCATTG	0.363										HNSCC(58;0.16)																													uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(2140-2142)GCT>TCT		protocadherin 15 isoform CD1-4 precursor							101.0	92.0	95.0					10																	55826597		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55826597C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2140G>T	10.37:g.55826597C>A	ENSP00000322604:p.Ala714Ser	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Missense_Mutation_p.A719S|PCDH15_uc010qhr.1_Missense_Mutation_p.A714S|PCDH15_uc010qhs.1_Missense_Mutation_p.A726S|PCDH15_uc010qht.1_Missense_Mutation_p.A721S|PCDH15_uc010qhu.1_Missense_Mutation_p.A714S|PCDH15_uc001jjv.1_Missense_Mutation_p.A692S|PCDH15_uc010qhv.1_Missense_Mutation_p.A714S|PCDH15_uc010qhw.1_Missense_Mutation_p.A677S|PCDH15_uc010qhx.1_Missense_Mutation_p.A643S|PCDH15_uc010qhy.1_Missense_Mutation_p.A719S|PCDH15_uc010qhz.1_Missense_Mutation_p.A714S|PCDH15_uc010qia.1_Missense_Mutation_p.A692S|PCDH15_uc010qib.1_Missense_Mutation_p.A692S|PCDH15_uc001jjw.2_Missense_Mutation_p.A714S	p.A714S	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			18	2535	-		Melanoma(3;0.117)|Lung SC(717;0.238)	714			Cadherin 6.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.2140G>T	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322577	0.41096	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.12;0.08	5.85	5.85	0.93711	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.46171	0.1379	N	0.25647	0.755	0.38113	D	0.937622	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.25486	0.05;0.012;0.002;0.007;0.127;0.012;0.05;0.007;0.021;0.021;0.007;0.012;0.002;0.012;0.007	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.23419	0.027;0.011;0.003;0.003;0.046;0.003;0.027;0.007;0.01;0.004;0.007;0.011;0.003;0.011;0.003	T	0.41556	-0.9502	9	0.14252	T	0.57	.	18.9349	0.92582	0.0:1.0:0.0:0.0	.	692;714;714;719;643;677;714;714;721;721;714;719;714;692;714	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	S	721;719;714;714;325;721;677;714;692;692;714;714;719;643;714	ENSP00000363076:A721S;ENSP00000410304:A719S;ENSP00000378826:A714S;ENSP00000386693:A325S;ENSP00000378832:A721S;ENSP00000378820:A677S;ENSP00000354950:A714S;ENSP00000378821:A692S;ENSP00000363068:A692S;ENSP00000322604:A714S;ENSP00000378818:A714S;ENSP00000412628:A643S;ENSP00000363066:A714S	ENSP00000322604:A714S	A	-	1	0	PCDH15	55496603	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	6.355000	0.73041	2.773000	0.95371	0.655000	0.94253	GCT		0.363	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		11	75	1	0	5.16669e-11	0.000978159	2.18815e-10	11	75				
SUPV3L1	6832	broad.mit.edu	37	10	70956824	70956824	+	Silent	SNP	G	G	T	rs200795704	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:70956824G>T	ENST00000359655.4	+	8	1068	c.1008G>T	c.(1006-1008)acG>acT	p.T336T		NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	336					ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGTACACAACGGGGGAGGAAG	0.473																																							uc001jpe.1		NA																	0				urinary_tract(1)|ovary(1)	2						c.(1006-1008)ACG>ACT		suppressor of var1, 3-like 1 precursor							199.0	177.0	184.0					10																	70956824		2203	4300	6503	SO:0001819	synonymous_variant	6832				DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding	g.chr10:70956824G>T	AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.1008G>T	10.37:g.70956824G>T			Somatic				SUPV3L1_uc010qjd.1_Silent_p.T205T	p.T336T	NM_003171	NP_003162	WXS	Illumina HiSeq	Unspecified	Q8IYB8	SUV3_HUMAN			8	1063	+			336					A8K301|O43630	Silent	SNP	ENST00000359655.4	37	c.1008G>T	CCDS7287.1																																																																																				0.473	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048396.2	NM_003171		17	86	1	0	4.96729e-08	0.00121646	1.87978e-07	17	86				
PSAP	5660	broad.mit.edu	37	10	73591639	73591639	+	Silent	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:73591639G>A	ENST00000394936.3	-	3	360	c.213C>T	c.(211-213)acC>acT	p.T71T	PSAP_ENST00000394934.1_Silent_p.T71T			P07602	SAP_HUMAN	prosaposin	71	Saposin B-type 1. {ECO:0000255|PROSITE- ProRule:PRU00415}.				blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						CACCAGCTGCGGTGACAACGT	0.517																																							uc001jsm.2		NA																	0				ovary(1)	1						c.(211-213)ACC>ACT		prosaposin isoform a preproprotein							198.0	181.0	187.0					10																	73591639		2203	4300	6503	SO:0001819	synonymous_variant	5660				glycosphingolipid metabolic process|lipid transport|platelet activation|platelet degranulation	extracellular space|Golgi apparatus|integral to membrane|lysosomal lumen	enzyme activator activity|lipid binding	g.chr10:73591639G>A	BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.213C>T	10.37:g.73591639G>A			Somatic					p.T71T	NM_002778	NP_002769	WXS	Illumina HiSeq	Unspecified	P07602	SAP_HUMAN			3	317	-			71			Saposin B-type 1.		P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Silent	SNP	ENST00000394936.3	37	c.213C>T	CCDS7311.1																																																																																				0.517	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778		29	95	0	0	0	0.0024448	0	29	95				
LRIT2	340745	broad.mit.edu	37	10	85984201	85984201	+	Silent	SNP	G	G	T	rs531350179		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:85984201G>T	ENST00000372113.4	-	2	785	c.780C>A	c.(778-780)gcC>gcA	p.A260A	LRIT2_ENST00000538192.1_Silent_p.A260A	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	260	Ig-like.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						TGGTGATATTGGCACTGGGGG	0.542																																							uc001kcy.2		NA																	0				ovary(2)	2						c.(778-780)GCC>GCA		leucine rich repeat containing 22 precursor							110.0	99.0	103.0					10																	85984201		2203	4300	6503	SO:0001819	synonymous_variant	340745					integral to membrane		g.chr10:85984201G>T		CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.780C>A	10.37:g.85984201G>T			Somatic				LRIT2_uc010qmc.1_Silent_p.A260A	p.A260A	NM_001017924	NP_001017924	WXS	Illumina HiSeq	Unspecified	A6NDA9	LRIT2_HUMAN			2	788	-			260			Ig-like.		B7ZME6	Silent	SNP	ENST00000372113.4	37	c.780C>A	CCDS31234.1																																																																																				0.542	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049110.4	XM_291697		13	54	1	0	2.31682e-05	0.00316338	7.5241e-05	13	54				
RNLS	55328	broad.mit.edu	37	10	90074241	90074241	+	Silent	SNP	T	T	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:90074241T>C	ENST00000331772.4	-	6	880	c.858A>G	c.(856-858)caA>caG	p.Q286Q	RNLS_ENST00000371947.3_Silent_p.Q286Q|RNLS_ENST00000437752.1_Silent_p.Q203Q|RNLS_ENST00000466945.1_5'Flank	NM_001031709.2	NP_001026879.2	Q5VYX0	RNLS_HUMAN	renalase, FAD-dependent amine oxidase	286					cardiac left ventricle morphogenesis (GO:0003214)|dopamine metabolic process (GO:0042417)|epinephrine metabolic process (GO:0042414)|heart contraction (GO:0060047)|norepinephrine metabolic process (GO:0042415)|phosphate ion homeostasis (GO:0055062)|regulation of systemic arterial blood pressure (GO:0003073)|response to epinephrine (GO:0071871)|response to ischemia (GO:0002931)|response to norepinephrine (GO:0071873)|response to salt (GO:1902074)	extracellular space (GO:0005615)	oxidoreductase activity (GO:0016491)			breast(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7						GTCTCCATTTTTGGCATTTGG	0.418																																							uc001kfe.2		NA																	0				ovary(1)	1						c.(856-858)CAA>CAG		renalase isoform 1							130.0	117.0	121.0					10																	90074241		2203	4300	6503	SO:0001819	synonymous_variant	55328					extracellular region	oxidoreductase activity	g.chr10:90074241T>C	BC005364	CCDS7388.1, CCDS31239.1	10q23.31	2009-04-22	2009-04-22	2009-04-22	ENSG00000184719	ENSG00000184719			25641	protein-coding gene	gene with protein product		609360	"""chromosome 10 open reading frame 59"""	C10orf59		15841207, 17565281	Standard	NM_001031709		Approved	FLJ11218, renalase	uc001kfe.3	Q5VYX0	OTTHUMG00000018692	ENST00000331772.4:c.858A>G	10.37:g.90074241T>C			Somatic				RNLS_uc010qms.1_Silent_p.Q203Q|RNLS_uc001kfd.2_Silent_p.Q286Q|RNLS_uc009xtj.2_Silent_p.Q118Q	p.Q286Q	NM_001031709	NP_001026879	WXS	Illumina HiSeq	Unspecified	Q5VYX0	RNLS_HUMAN			6	993	-			286					Q9BS33|Q9NUP8	Silent	SNP	ENST00000331772.4	37	c.858A>G	CCDS31239.1																																																																																				0.418	RNLS-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049250.1	NM_018363		24	70	0	0	0	0.00106085	0	24	70				
KIF20B	9585	broad.mit.edu	37	10	91488933	91488933	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:91488933G>T	ENST00000371728.3	+	18	2385	c.2320G>T	c.(2320-2322)Gat>Tat	p.D774Y	KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000394289.2_Missense_Mutation_p.D774Y|KIF20B_ENST00000260753.4_Missense_Mutation_p.D734Y|KIF20B_ENST00000416354.1_Missense_Mutation_p.D774Y	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	774					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						AAATATAATTGATCAAAAAGA	0.244																																							uc001kgs.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(2320-2322)GAT>TAT		M-phase phosphoprotein 1							23.0	25.0	25.0					10																	91488933		2134	4200	6334	SO:0001583	missense	9585				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding	g.chr10:91488933G>T	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.2320G>T	10.37:g.91488933G>T	ENSP00000360793:p.Asp774Tyr		Somatic				KIF20B_uc001kgr.1_Missense_Mutation_p.D734Y|KIF20B_uc001kgt.1_5'UTR	p.D774Y	NM_016195	NP_057279	WXS	Illumina HiSeq	Unspecified	Q96Q89	KI20B_HUMAN			18	2392	+			774			Potential.		A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37	c.2320G>T		.	.	.	.	.	.	.	.	.	.	G	8.138	0.784630	0.16189	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728;ENST00000439656	T;T;T;T	0.46451	0.97;0.87;0.87;0.87	3.24	0.294	0.15747	.	0.886116	0.09296	N	0.821612	T	0.43188	0.1236	L	0.57536	1.79	0.22171	N	0.999314	P;D	0.54207	0.94;0.965	B;P	0.47981	0.36;0.563	T	0.33137	-0.9880	10	0.66056	D	0.02	.	6.5355	0.22350	0.357:0.0:0.643:0.0	.	774;734	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	Y	734;774;774;774;341	ENSP00000260753:D734Y;ENSP00000411545:D774Y;ENSP00000377830:D774Y;ENSP00000360793:D774Y	ENSP00000260753:D734Y	D	+	1	0	KIF20B	91478913	0.691000	0.27709	0.087000	0.20705	0.434000	0.31775	0.692000	0.25482	-0.138000	0.11434	-0.140000	0.14226	GAT		0.244	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195		9	57	1	0	0.000442599	0.000442599	0.0013229	9	57				
MYOF	26509	broad.mit.edu	37	10	95141111	95141111	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:95141111G>T	ENST00000359263.4	-	20	1740	c.1741C>A	c.(1741-1743)Cat>Aat	p.H581N	MYOF_ENST00000371502.4_Missense_Mutation_p.H581N|MYOF_ENST00000371501.4_Missense_Mutation_p.H581N|MYOF_ENST00000358334.5_Missense_Mutation_p.H568N	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	581					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GTGGCTGAATGAAACACGGCA	0.448																																							uc001kin.2		NA																	0				ovary(3)|breast(1)	4						c.(1741-1743)CAT>AAT		myoferlin isoform a							124.0	120.0	121.0					10																	95141111		2061	4228	6289	SO:0001583	missense	26509				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding	g.chr10:95141111G>T	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.1741C>A	10.37:g.95141111G>T	ENSP00000352208:p.His581Asn		Somatic				MYOF_uc001kio.2_Missense_Mutation_p.H568N|MYOF_uc009xue.2_RNA	p.H581N	NM_013451	NP_038479	WXS	Illumina HiSeq	Unspecified	Q9NZM1	MYOF_HUMAN			20	1864	-			581			Cytoplasmic (Potential).		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	c.1741C>A	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.877889	0.72294	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	D	0.90352	0.6981	M	0.79123	2.44	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.69479	0.964;0.959	D	0.89846	0.4006	10	0.37606	T	0.19	-18.0565	17.4865	0.87689	0.0:0.0:1.0:0.0	.	568;581	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	N	568;581;581;581	ENSP00000351094:H568N;ENSP00000352208:H581N;ENSP00000360556:H581N;ENSP00000360557:H581N	ENSP00000351094:H568N	H	-	1	0	MYOF	95131101	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.793000	0.85851	2.370000	0.80446	0.491000	0.48974	CAT		0.448	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451		15	43	1	0	0.000422831	0.00400662	0.0012751	15	43				
LGI1	9211	broad.mit.edu	37	10	95518028	95518028	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:95518028C>A	ENST00000371418.4	+	1	387	c.127C>A	c.(127-129)Cct>Act	p.P43T	LGI1_ENST00000478763.1_3'UTR|LGI1_ENST00000542308.1_Missense_Mutation_p.P43T|LGI1_ENST00000371413.3_Missense_Mutation_p.P43T	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	43	LRRNT.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				GCCAAAATGCCCTGCCGTGTG	0.463																																							uc001kjc.3		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(127-129)CCT>ACT		leucine-rich, glioma inactivated 1 precursor							164.0	165.0	165.0					10																	95518028		2203	4300	6503	SO:0001583	missense	9211				axon guidance|cell proliferation|positive regulation of cell growth|positive regulation of synaptic transmission	cell junction|extracellular space|synapse	receptor binding	g.chr10:95518028C>A	AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.127C>A	10.37:g.95518028C>A	ENSP00000360472:p.Pro43Thr		Somatic				LGI1_uc010qnv.1_Missense_Mutation_p.P43T|LGI1_uc001kjd.3_Missense_Mutation_p.P43T|LGI1_uc009xui.2_RNA|LGI1_uc001kje.2_RNA	p.P43T	NM_005097	NP_005088	WXS	Illumina HiSeq	Unspecified	O95970	LGI1_HUMAN			1	463	+		Colorectal(252;0.124)	43			LRRNT.		A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	ENST00000371418.4	37	c.127C>A	CCDS7431.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.574814	0.65878	.	.	ENSG00000108231	ENST00000542308;ENST00000371418;ENST00000371413	D;T;T	0.82893	-1.66;-0.74;-0.77	4.99	4.99	0.66335	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91586	0.7342	M	0.79693	2.465	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.992	D	0.92565	0.6061	10	0.87932	D	0	-6.6493	18.4618	0.90741	0.0:1.0:0.0:0.0	.	43;43;43	O95970-3;O95970-2;O95970	.;.;LGI1_HUMAN	T	43	ENSP00000440763:P43T;ENSP00000360472:P43T;ENSP00000360467:P43T	ENSP00000360467:P43T	P	+	1	0	LGI1	95508018	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.896000	0.75665	2.604000	0.88044	0.455000	0.32223	CCT		0.463	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049445.1	NM_005097		17	97	1	0	6.49762e-13	0.00074312	2.89712e-12	17	97				
COL17A1	1308	broad.mit.edu	37	10	105815145	105815145	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:105815145T>A	ENST00000353479.5	-	19	1992	c.1702A>T	c.(1702-1704)Agc>Tgc	p.S568C	COL17A1_ENST00000369733.3_Missense_Mutation_p.S568C|COL17A1_ENST00000480127.1_5'UTR	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	568	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GGGCCAGGGCTTCCTCGGAGA	0.448																																							uc001kxr.2		NA																	0				ovary(4)|pancreas(1)	5						c.(1702-1704)AGC>TGC		alpha 1 type XVII collagen							117.0	103.0	108.0					10																	105815145		2203	4300	6503	SO:0001583	missense	1308				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding	g.chr10:105815145T>A	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1702A>T	10.37:g.105815145T>A	ENSP00000340937:p.Ser568Cys		Somatic				COL17A1_uc010qqv.1_Missense_Mutation_p.S552C	p.S568C	NM_000494	NP_000485	WXS	Illumina HiSeq	Unspecified	Q9UMD9	COHA1_HUMAN		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	19	1871	-		Colorectal(252;0.103)|Breast(234;0.122)	568			Extracellular (Potential).|Triple-helical region.		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	c.1702A>T	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	T	14.42	2.529290	0.44969	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872	D;D	0.94457	-3.43;-3.43	5.21	4.08	0.47627	.	0.589457	0.16018	N	0.233462	D	0.92658	0.7667	L	0.28192	0.835	0.80722	D	1	D;D	0.56287	0.969;0.975	P;P	0.57548	0.73;0.823	D	0.91146	0.4949	10	0.56958	D	0.05	-5.1919	6.9273	0.24422	0.0:0.1012:0.0:0.8988	.	568;568	Q9UMD9-2;Q9UMD9	.;COHA1_HUMAN	C	568;568;552	ENSP00000340937:S568C;ENSP00000358748:S568C	ENSP00000340937:S568C	S	-	1	0	COL17A1	105805135	0.989000	0.36119	1.000000	0.80357	0.994000	0.84299	2.022000	0.41030	1.968000	0.57251	0.454000	0.30748	AGC		0.448	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		16	61	0	0	0	0.00400662	0	16	61				
CFAP43	80217	broad.mit.edu	37	10	105990542	105990542	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:105990542T>A	ENST00000357060.3	-	2	240	c.125A>T	c.(124-126)tAc>tTc	p.Y42F	WDR96_ENST00000369720.1_5'UTR|WDR96_ENST00000278064.2_5'UTR|WDR96_ENST00000428666.1_Missense_Mutation_p.Y42F|WDR96_ENST00000369719.1_5'UTR	NM_025145.5	NP_079421.5														NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCCACAAGGGTAGCAAATGGT	0.358																																							uc001kxw.2		NA																	0					0						c.(124-126)TAC>TTC		hypothetical protein LOC80217							75.0	75.0	75.0					10																	105990542		2203	4300	6503	SO:0001583	missense	80217							g.chr10:105990542T>A																												ENST00000357060.3:c.125A>T	10.37:g.105990542T>A	ENSP00000349568:p.Tyr42Phe		Somatic				C10orf79_uc001kxx.3_Missense_Mutation_p.Y42F|C10orf79_uc001kxy.1_Missense_Mutation_p.Y42F|C10orf79_uc001kxz.2_Missense_Mutation_p.Y42F	p.Y42F	NM_025145	NP_079421	WXS	Illumina HiSeq	Unspecified	Q8NDM7	WDR96_HUMAN		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)	2	241	-		Colorectal(252;0.178)	42						Missense_Mutation	SNP	ENST00000357060.3	37	c.125A>T	CCDS31281.1	.	.	.	.	.	.	.	.	.	.	T	19.71	3.878322	0.72294	.	.	ENSG00000197748	ENST00000357060;ENST00000428666	T;T	0.11712	2.75;2.75	4.83	4.83	0.62350	.	.	.	.	.	T	0.24851	0.0603	L	0.43923	1.385	0.48571	D	0.999678	P;D;D	0.89917	0.909;1.0;0.981	P;D;P	0.85130	0.673;0.997;0.84	T	0.00865	-1.1535	9	0.39692	T	0.17	.	14.4076	0.67093	0.0:0.0:0.0:1.0	.	42;42;42	Q8NDM7-5;B4DHB6;Q8NDM7	.;.;WDR96_HUMAN	F	42	ENSP00000349568:Y42F;ENSP00000400289:Y42F	ENSP00000349568:Y42F	Y	-	2	0	WDR96	105980532	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	6.937000	0.75898	1.813000	0.52934	0.402000	0.26972	TAC		0.358	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				10	72	0	0	0	0.000673444	0	10	72				
DMBT1	1755	broad.mit.edu	37	10	124396776	124396776	+	Missense_Mutation	SNP	C	C	G	rs371601589		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:124396776C>G	ENST00000338354.3	+	51	6609	c.6503C>G	c.(6502-6504)cCg>cGg	p.P2168R	DMBT1_ENST00000368909.3_Missense_Mutation_p.P2168R|DMBT1_ENST00000330163.4_Missense_Mutation_p.P1540R|DMBT1_ENST00000368956.2_Missense_Mutation_p.P1540R|DMBT1_ENST00000344338.3_Missense_Mutation_p.P2158R|DMBT1_ENST00000359586.6_Missense_Mutation_p.P888R|DMBT1_ENST00000368955.3_Missense_Mutation_p.P2158R			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	2168	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CAGATAACGCCGAACCTGGTG	0.517																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	0				central_nervous_system(7)	7						c.(6502-6504)CCG>CGG		deleted in malignant brain tumors 1 isoform b							83.0	79.0	80.0					10																	124396776		1939	4128	6067	SO:0001583	missense	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124396776C>G		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.6503C>G	10.37:g.124396776C>G	ENSP00000342210:p.Pro2168Arg		Somatic				DMBT1_uc001lgl.1_Missense_Mutation_p.P2158R|DMBT1_uc001lgm.1_Missense_Mutation_p.P1540R|DMBT1_uc009xzz.1_Missense_Mutation_p.P2167R|DMBT1_uc010qtx.1_Missense_Mutation_p.P888R|DMBT1_uc009yab.1_Missense_Mutation_p.P871R|DMBT1_uc009yac.1_Missense_Mutation_p.P462R	p.P2168R	NM_007329	NP_015568	WXS	Illumina HiSeq	Unspecified	Q9UGM3	DMBT1_HUMAN			51	6609	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	2168			ZP.		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37	c.6503C>G		.	.	.	.	.	.	.	.	.	.	C	10.56	1.384369	0.25031	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	T;T;T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49	4.99	-0.523	0.11924	Zona pellucida sperm-binding protein (3);	.	.	.	.	T	0.66607	0.2806	N	0.13098	0.295	0.09310	N	1	B;D;B;B;B;B;B	0.54964	0.124;0.969;0.077;0.028;0.077;0.028;0.035	B;P;B;B;B;B;B	0.48368	0.015;0.575;0.015;0.015;0.015;0.015;0.025	T	0.58323	-0.7656	9	0.52906	T	0.07	.	4.2158	0.10533	0.1211:0.2996:0.4323:0.147	.	888;2148;1417;2297;1540;2158;2168	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	R	2168;2297;2168;2168;2168;2167;1540;2158;1540;1540;2168;2158;1540;314;888	ENSP00000342210:P2168R;ENSP00000343175:P2158R;ENSP00000327747:P1540R;ENSP00000357905:P2168R;ENSP00000357951:P2158R;ENSP00000357952:P1540R;ENSP00000352593:P888R	ENSP00000331522:P1540R	P	+	2	0	DMBT1	124386766	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.075000	0.03423	-0.307000	0.08804	-0.137000	0.14449	CCG		0.517	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		3	18	0	0	0	6.4e-05	0	3	18				
MTG1	92170	broad.mit.edu	37	10	135233639	135233639	+	Silent	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr10:135233639G>T	ENST00000317502.6	+	11	1025	c.975G>T	c.(973-975)cgG>cgT	p.R325R	MTG1_ENST00000477902.2_Silent_p.R284R|RP11-108K14.8_ENST00000468317.2_Silent_p.R330R	NM_138384.2	NP_612393.2	Q9BT17	MTG1_HUMAN	mitochondrial ribosome-associated GTPase 1	325					GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)		ACGTCCTGCGGGGCCACCCCC	0.637																																							uc001lnd.2		NA																	0				skin(1)	1						c.(973-975)CGG>CGT		GTP_binding protein precursor							67.0	63.0	65.0					10																	135233639		2203	4300	6503	SO:0001819	synonymous_variant	92170					mitochondrion	GTP binding|protein binding	g.chr10:135233639G>T		CCDS31320.1	10q26.3	2013-05-24	2013-05-24	2006-01-09	ENSG00000148824	ENSG00000148824			32159	protein-coding gene	gene with protein product			"""GTP-binding protein 7"", ""GTP-binding protein 7 (putative)"", ""mitochondrial GTPase 1 homolog (S. cerevisiae)"""	GTPBP7		12808030, 23396448	Standard	NM_138384		Approved		uc001lnd.3	Q9BT17	OTTHUMG00000166564	ENST00000317502.6:c.975G>T	10.37:g.135233639G>T			Somatic				MTG1_uc010qve.1_Silent_p.R190R	p.R325R	NM_138384	NP_612393	WXS	Illumina HiSeq	Unspecified	Q9BT17	MTG1_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|all cancers(32;1.69e-06)|Epithelial(32;1.94e-06)	11	1079	+		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)	325					Q5VWX8|Q6PIY9|Q8IYJ4|Q8NC48|Q9BVU8	Silent	SNP	ENST00000317502.6	37	c.975G>T	CCDS31320.1																																																																																				0.637	MTG1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051166.1	NM_138384		10	20	1	0	0.000442599	0.000442599	0.0013229	10	20				
MUC5B	727897	broad.mit.edu	37	11	1268767	1268767	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:1268767C>A	ENST00000529681.1	+	31	10715	c.10657C>A	c.(10657-10659)Ctg>Atg	p.L3553M	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.L3556M	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3553	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CACCTCGACCCTGCTGCCCAG	0.682																																							uc009ycr.1		NA																	0					0						c.(12241-12243)CTG>ATG		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							44.0	69.0	61.0					11																	1268767		2034	4177	6211	SO:0001583	missense	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1268767C>A	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10657C>A	11.37:g.1268767C>A	ENSP00000436812:p.Leu3553Met		Somatic				MUC5B_uc001ltb.2_Missense_Mutation_p.L3556M	p.L4081M	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	50	12367	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	3553	Missing (in Ref. 6; AAB61398).		7 X Cys-rich subdomain repeats.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	c.12241C>A	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	6.624	0.483635	0.12581	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.18502	2.21;2.35	2.58	2.58	0.30949	.	.	.	.	.	T	0.29850	0.0746	L	0.50333	1.59	0.09310	N	1	D;P	0.55172	0.97;0.932	P;B	0.60682	0.878;0.265	T	0.03945	-1.0990	9	0.87932	D	0	.	9.3413	0.38082	0.0:1.0:0.0:0.0	.	4081;3556	A7Y9J9;E9PBJ0	.;.	M	3553;3556;3525;3458	ENSP00000436812:L3553M;ENSP00000415793:L3556M	ENSP00000343037:L3525M	L	+	1	2	MUC5B	1225343	0.010000	0.17322	0.001000	0.08648	0.406000	0.30931	0.194000	0.17135	1.428000	0.47296	0.297000	0.19635	CTG		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		5	41	1	0	8.12818e-05	0.00198382	0.000254784	5	41				
TRAF6	7189	broad.mit.edu	37	11	36512083	36512083	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:36512083C>A	ENST00000526995.1	-	7	1120	c.874G>T	c.(874-876)Gtc>Ttc	p.V292F	TRAF6_ENST00000348124.5_Missense_Mutation_p.V292F|TRAF6_ENST00000529150.1_5'UTR	NM_004620.3	NP_004611.1	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6, E3 ubiquitin protein ligase	292	Interaction with TAX1BP1.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of protein kinase activity (GO:0032147)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic signaling pathway (GO:0097190)|bone resorption (GO:0045453)|cell development (GO:0048468)|cellular response to lipopolysaccharide (GO:0071222)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein autoubiquitination (GO:0051865)|protein complex assembly (GO:0006461)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of immunoglobulin secretion (GO:0051023)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	histone deacetylase binding (GO:0042826)|ligase activity (GO:0016874)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)	27	all_lung(20;0.211)	all_hematologic(20;0.107)				AAATTCCGGACCTCTGAGATA	0.483																																							uc001mwr.1		NA																	0				ovary(1)	1						c.(874-876)GTC>TTC		TNF receptor-associated factor 6							116.0	113.0	114.0					11																	36512083		2202	4298	6500	SO:0001583	missense	7189				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:36512083C>A		CCDS7901.1	11p12	2013-01-09	2012-02-23		ENSG00000175104	ENSG00000175104		"""RING-type (C3HC4) zinc fingers"""	12036	protein-coding gene	gene with protein product		602355	"""TNF receptor-associated factor 6"""			8837778	Standard	NM_004620		Approved	RNF85	uc001mws.2	Q9Y4K3	OTTHUMG00000166391	ENST00000526995.1:c.874G>T	11.37:g.36512083C>A	ENSP00000433623:p.Val292Phe		Somatic				TRAF6_uc001mws.1_Missense_Mutation_p.V292F	p.V292F	NM_145803	NP_665802	WXS	Illumina HiSeq	Unspecified	Q9Y4K3	TRAF6_HUMAN			8	1214	-	all_lung(20;0.211)	all_hematologic(20;0.107)	292			Potential.|Interaction with TAX1BP1.		A6NKI7|A8KAB3|D3DR16|Q8NEH5	Missense_Mutation	SNP	ENST00000526995.1	37	c.874G>T	CCDS7901.1	.	.	.	.	.	.	.	.	.	.	C	5.873	0.345222	0.11126	.	.	ENSG00000175104	ENST00000526995;ENST00000348124	D;D	0.82433	-1.61;-1.61	4.8	1.62	0.23740	.	0.666573	0.16373	N	0.217239	T	0.76758	0.4032	M	0.65975	2.015	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.60151	-0.7319	10	0.20519	T	0.43	-1.9218	6.7931	0.23711	0.131:0.669:0.1268:0.0732	.	292	Q9Y4K3	TRAF6_HUMAN	F	292	ENSP00000433623:V292F;ENSP00000337853:V292F	ENSP00000337853:V292F	V	-	1	0	TRAF6	36468659	1.000000	0.71417	0.044000	0.18714	0.041000	0.13682	1.072000	0.30678	0.529000	0.28599	0.455000	0.32223	GTC		0.483	TRAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389530.1	NM_145803		24	88	1	0	2.65835e-16	0.00127121	1.24271e-15	24	88				
MADD	8567	broad.mit.edu	37	11	47296557	47296557	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:47296557C>G	ENST00000311027.5	+	3	671	c.506C>G	c.(505-507)tCc>tGc	p.S169C	MADD_ENST00000349238.3_Missense_Mutation_p.S169C|RP11-17G12.3_ENST00000543925.1_RNA|MADD_ENST00000407859.3_Missense_Mutation_p.S169C|MADD_ENST00000395336.3_Missense_Mutation_p.S169C|MADD_ENST00000395344.3_Missense_Mutation_p.S169C|RP11-17G12.3_ENST00000545474.1_RNA|MADD_ENST00000342922.4_Missense_Mutation_p.S169C|MADD_ENST00000402799.1_Missense_Mutation_p.S169C|MADD_ENST00000402192.2_Missense_Mutation_p.S169C|MADD_ENST00000406482.1_Missense_Mutation_p.S169C	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GGGAGCCGCTCCCGCAACAGT	0.602																																							uc001ner.1		NA																	0				ovary(5)|skin(4)|central_nervous_system(2)	11						c.(505-507)TCC>TGC		MAP-kinase activating death domain-containing							66.0	68.0	68.0					11																	47296557		2201	4298	6499	SO:0001583	missense	8567				activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity	g.chr11:47296557C>G	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.506C>G	11.37:g.47296557C>G	ENSP00000310933:p.Ser169Cys		Somatic				MADD_uc001neq.2_Missense_Mutation_p.S169C|MADD_uc001nev.1_Missense_Mutation_p.S169C|MADD_uc001nes.1_Missense_Mutation_p.S169C|MADD_uc001net.1_Missense_Mutation_p.S169C|MADD_uc009yln.1_Missense_Mutation_p.S169C|MADD_uc001neu.1_Missense_Mutation_p.S169C|MADD_uc001nex.2_Missense_Mutation_p.S169C|MADD_uc001nez.2_Missense_Mutation_p.S169C|MADD_uc001new.2_Missense_Mutation_p.S169C	p.S169C	NM_003682	NP_003673	WXS	Illumina HiSeq	Unspecified	Q8WXG6	MADD_HUMAN		Lung(87;0.182)	3	697	+			169						Missense_Mutation	SNP	ENST00000311027.5	37	c.506C>G	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	C	16.06	3.015059	0.54468	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192	T;T;T;T;T;T;T;T;T	0.06608	3.39;3.29;3.29;3.39;3.39;3.28;3.29;3.39;3.39	6.07	5.11	0.69529	.	0.106120	0.64402	D	0.000003	T	0.05914	0.0154	L	0.29908	0.895	0.80722	D	1	B;B;B;B;B;B;B;B;B;B	0.29862	0.029;0.036;0.0;0.0;0.05;0.012;0.0;0.259;0.0;0.0	B;B;B;B;B;B;B;B;B;B	0.22753	0.008;0.025;0.0;0.001;0.022;0.022;0.001;0.041;0.0;0.0	T	0.47222	-0.9134	9	.	.	.	-19.8503	16.8999	0.86110	0.0:0.8722:0.1278:0.0	.	169;169;169;169;169;169;169;169;169;169	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	C	169	ENSP00000343902:S169C;ENSP00000385585:S169C;ENSP00000384435:S169C;ENSP00000304505:S169C;ENSP00000310933:S169C;ENSP00000384204:S169C;ENSP00000378753:S169C;ENSP00000378745:S169C;ENSP00000384287:S169C	.	S	+	2	0	MADD	47253133	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	2.480000	0.45206	2.885000	0.99019	0.655000	0.94253	TCC		0.602	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1			7	33	0	0	0	0.00448238	0	7	33				
OR4B1	119765	broad.mit.edu	37	11	48238420	48238420	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:48238420C>A	ENST00000309562.2	+	1	77	c.59C>A	c.(58-60)gCt>gAt	p.A20D		NM_001005470.1	NP_001005470.1	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B, member 1	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						CAGGATCCAGCTGTGCAGAGT	0.507																																							uc010rhs.1		NA																	0				skin(2)|ovary(1)|pancreas(1)	4						c.(58-60)GCT>GAT		olfactory receptor, family 4, subfamily B,							241.0	196.0	211.0					11																	48238420		2201	4298	6499	SO:0001583	missense	119765				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48238420C>A	AB065848	CCDS31485.1	11p11.2	2012-08-09			ENSG00000175619	ENSG00000175619		"""GPCR / Class A : Olfactory receptors"""	8290	protein-coding gene	gene with protein product							Standard	NM_001005470		Approved	OST208	uc010rhs.2	Q8NGF8	OTTHUMG00000166576	ENST00000309562.2:c.59C>A	11.37:g.48238420C>A	ENSP00000311605:p.Ala20Asp		Somatic					p.A20D	NM_001005470	NP_001005470	WXS	Illumina HiSeq	Unspecified	Q8NGF8	OR4B1_HUMAN			1	59	+			20			Extracellular (Potential).		Q6IF75|Q96R64	Missense_Mutation	SNP	ENST00000309562.2	37	c.59C>A	CCDS31485.1	.	.	.	.	.	.	.	.	.	.	C	2.890	-0.229897	0.06022	.	.	ENSG00000175619	ENST00000309562	T	0.02863	4.13	5.4	1.6	0.23607	.	0.691121	0.12907	N	0.429284	T	0.00998	0.0033	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47459	-0.9116	10	0.33940	T	0.23	.	0.7877	0.01051	0.4878:0.1733:0.1787:0.1602	.	20	Q8NGF8	OR4B1_HUMAN	D	20	ENSP00000311605:A20D	ENSP00000311605:A20D	A	+	2	0	OR4B1	48194996	0.000000	0.05858	0.399000	0.26333	0.011000	0.07611	-0.271000	0.08572	0.359000	0.24239	-0.750000	0.03501	GCT		0.507	OR4B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390554.1	NM_001005470		17	67	1	0	1.78486e-19	0.000958276	8.52067e-19	17	67				
OR4A16	81327	broad.mit.edu	37	11	55110821	55110821	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:55110821G>T	ENST00000314721.2	+	1	195	c.145G>T	c.(145-147)Ggc>Tgc	p.G49C		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						GACTACTATTGGCAGCCCCTC	0.413																																							uc010rie.1		NA																	0				large_intestine(2)|pancreas(1)	3						c.(145-147)GGC>TGC		olfactory receptor, family 4, subfamily A,							122.0	118.0	119.0					11																	55110821		2201	4296	6497	SO:0001583	missense	81327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55110821G>T	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.145G>T	11.37:g.55110821G>T	ENSP00000325128:p.Gly49Cys		Somatic					p.G49C	NM_001005274	NP_001005274	WXS	Illumina HiSeq	Unspecified	Q8NH70	O4A16_HUMAN			1	145	+			49			Cytoplasmic (Potential).		Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	37	c.145G>T	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	g	0.574	-0.839840	0.02692	.	.	ENSG00000181961	ENST00000314721	T	0.03065	4.06	2.57	-2.16	0.07080	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02012	0.0063	N	0.12611	0.24	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.45175	-0.9279	9	0.38643	T	0.18	.	3.4023	0.07328	0.2501:0.0:0.4172:0.3326	.	49	Q8NH70	O4A16_HUMAN	C	49	ENSP00000325128:G49C	ENSP00000325128:G49C	G	+	1	0	OR4A16	54867397	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.294000	0.02767	-0.827000	0.04278	-2.286000	0.00268	GGC		0.413	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		19	87	1	0	2.94398e-08	0.000958276	1.12354e-07	19	87				
OR4A16	81327	broad.mit.edu	37	11	55111429	55111429	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:55111429C>A	ENST00000314721.2	+	1	803	c.753C>A	c.(751-753)ccC>ccA	p.P251P		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TTTTTGTTCCCTGTATTTTTA	0.373																																							uc010rie.1		NA																	0				large_intestine(2)|pancreas(1)	3						c.(751-753)CCC>CCA		olfactory receptor, family 4, subfamily A,							168.0	156.0	160.0					11																	55111429		2201	4296	6497	SO:0001819	synonymous_variant	81327				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55111429C>A	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.753C>A	11.37:g.55111429C>A			Somatic					p.P251P	NM_001005274	NP_001005274	WXS	Illumina HiSeq	Unspecified	Q8NH70	O4A16_HUMAN			1	753	+			251			Helical; Name=6; (Potential).		Q6IFL3	Silent	SNP	ENST00000314721.2	37	c.753C>A	CCDS31499.1																																																																																				0.373	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		12	57	1	0	9.31168e-06	0.00185496	3.09854e-05	12	57				
OR5M9	390162	broad.mit.edu	37	11	56230095	56230095	+	Silent	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:56230095G>T	ENST00000279791.1	-	1	782	c.783C>A	c.(781-783)ccC>ccA	p.P261P		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P261P(1)|p.P261Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					ATTCCTCAGTGGGTCTCCTGA	0.493																																							uc010rjj.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		urinary_tract(1)|lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(781-783)CCC>CCA		olfactory receptor, family 5, subfamily M,							69.0	62.0	65.0					11																	56230095		2201	4296	6497	SO:0001819	synonymous_variant	390162				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56230095G>T	AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.783C>A	11.37:g.56230095G>T			Somatic					p.P261P	NM_001004743	NP_001004743	WXS	Illumina HiSeq	Unspecified	Q8NGP3	OR5M9_HUMAN			1	783	-	Esophageal squamous(21;0.00448)		261			Extracellular (Potential).		Q6IEW5|Q96RB9	Silent	SNP	ENST00000279791.1	37	c.783C>A	CCDS31531.1																																																																																				0.493	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743		8	38	1	0	0.000157383	0.00307968	0.000488793	8	38				
OR5B3	441608	broad.mit.edu	37	11	58170847	58170847	+	Silent	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:58170847A>T	ENST00000309403.2	-	1	35	c.36T>A	c.(34-36)ctT>ctA	p.L12L		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	12						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TTAGTCCTAGAAGAATGAATT	0.383																																							uc010rkf.1		NA																	0					0						c.(34-36)CTT>CTA		olfactory receptor, family 5, subfamily B,							119.0	116.0	117.0					11																	58170847		2199	4284	6483	SO:0001819	synonymous_variant	441608				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58170847A>T	AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.36T>A	11.37:g.58170847A>T			Somatic					p.L12L	NM_001005469	NP_001005469	WXS	Illumina HiSeq	Unspecified	Q8NH48	OR5B3_HUMAN			1	36	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	12			Extracellular (Potential).		Q6IEV6	Silent	SNP	ENST00000309403.2	37	c.36T>A	CCDS31549.1																																																																																				0.383	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394886.1	NM_001005469		19	89	0	0	0	0.00152264	0	19	89				
GLYAT	10249	broad.mit.edu	37	11	58478071	58478071	+	Silent	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:58478071G>T	ENST00000344743.3	-	5	621	c.480C>A	c.(478-480)ccC>ccA	p.P160P	GLYAT_ENST00000529732.1_Silent_p.P160P|GLYAT_ENST00000278400.3_Silent_p.P160P	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	160					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	ACATGGCCTTGGGTTTGCCAC	0.443																																							uc001nnb.2		NA																	0					0						c.(478-480)CCC>CCA		glycine-N-acyltransferase isoform a	Glycine(DB00145)						124.0	120.0	121.0					11																	58478071		2201	4295	6496	SO:0001819	synonymous_variant	10249				acyl-CoA metabolic process|response to toxin|xenobiotic metabolic process	mitochondrial matrix	glycine N-acyltransferase activity|glycine N-benzoyltransferase activity	g.chr11:58478071G>T	AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.480C>A	11.37:g.58478071G>T			Somatic				GLYAT_uc001nnc.2_Silent_p.P160P	p.P160P	NM_201648	NP_964011	WXS	Illumina HiSeq	Unspecified	Q6IB77	GLYAT_HUMAN			5	635	-		Breast(21;0.0044)|all_epithelial(135;0.0157)	160					O14833|Q96QK7	Silent	SNP	ENST00000344743.3	37	c.480C>A	CCDS7970.1																																																																																				0.443	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394593.1			12	67	1	0	8.00594e-06	0.000958276	2.67723e-05	12	67				
TCN1	6947	broad.mit.edu	37	11	59630179	59630179	+	Silent	SNP	C	C	A	rs190797183		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:59630179C>A	ENST00000257264.3	-	3	380	c.276G>T	c.(274-276)tcG>tcT	p.S92S	TCN1_ENST00000532419.1_5'UTR	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	92	Globular N-terminal alpha domain.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAAGCTCTCCCGAGCTTACAT	0.388																																							uc001noj.2		NA																	0				ovary(2)	2						c.(274-276)TCG>TCT		transcobalamin I precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						104.0	99.0	101.0					11																	59630179		2201	4295	6496	SO:0001819	synonymous_variant	6947				cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding	g.chr11:59630179C>A	J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.276G>T	11.37:g.59630179C>A			Somatic					p.S92S	NM_001062	NP_001053	WXS	Illumina HiSeq	Unspecified	P20061	TCO1_HUMAN			3	374	-		all_epithelial(135;0.198)	92					A8KAC5|Q8WV77	Silent	SNP	ENST00000257264.3	37	c.276G>T	CCDS7978.1																																																																																				0.388	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394503.1	NM_001062		21	67	1	0	5.45024e-15	0.00332997	2.52167e-14	21	67				
PICALM	8301	broad.mit.edu	37	11	85692255	85692255	+	Nonsense_Mutation	SNP	G	G	A	rs551997403		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:85692255G>A	ENST00000393346.3	-	17	1844	c.1696C>T	c.(1696-1698)Caa>Taa	p.Q566*	PICALM_ENST00000356360.5_Nonsense_Mutation_p.Q566*|PICALM_ENST00000526033.1_Nonsense_Mutation_p.Q559*|PICALM_ENST00000532317.1_Nonsense_Mutation_p.Q516*|PICALM_ENST00000528398.1_Nonsense_Mutation_p.Q465*			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	566					axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)			endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				TCACCTGGTTGACTCCAATTT	0.353			T	"""MLLT10, MLL"""	"""TALL, AML, """																																		uc001pbm.2		NA		Dom	yes		11	11q14	8301	T	phosphatidylinositol binding clathrin assembly protein (CALM)			L	MLLT10|MLL		TALL|AML|		0				urinary_tract(1)|ovary(1)	2						c.(1696-1698)CAA>TAA		phosphatidylinositol-binding clathrin assembly							129.0	120.0	123.0					11																	85692255		2203	4299	6502	SO:0001587	stop_gained	8301				clathrin coat assembly|endosome transport|negative regulation of receptor-mediated endocytosis|positive regulation of transcription, DNA-dependent|receptor internalization|regulation of protein localization	clathrin coat|clathrin-coated vesicle|coated pit|Golgi apparatus|nucleus|postsynaptic membrane|presynaptic membrane	1-phosphatidylinositol binding|clathrin heavy chain binding	g.chr11:85692255G>A	BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.1696C>T	11.37:g.85692255G>A	ENSP00000377015:p.Gln566*		Somatic				PICALM_uc001pbl.2_Nonsense_Mutation_p.Q516*|PICALM_uc001pbn.2_Nonsense_Mutation_p.Q559*|PICALM_uc010rtl.1_Nonsense_Mutation_p.Q465*|PICALM_uc001pbk.2_RNA|PICALM_uc010rtk.1_Nonsense_Mutation_p.Q143*|PICALM_uc001pbo.1_Nonsense_Mutation_p.Q198*	p.Q566*	NM_007166	NP_009097	WXS	Illumina HiSeq	Unspecified	Q13492	PICAL_HUMAN			17	1982	-		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)	566					B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Nonsense_Mutation	SNP	ENST00000393346.3	37	c.1696C>T	CCDS8272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.741840|7.741840	0.98465|0.98465	.|.	.|.	ENSG00000073921|ENSG00000073921	ENST00000532317;ENST00000526033;ENST00000447890;ENST00000393346;ENST00000528398;ENST00000356360|ENST00000529760;ENST00000532603;ENST00000526961;ENST00000530542	.|T;T;T;T	.|0.39056	.|1.1;1.1;1.1;1.1	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.59878	.|0.2226	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.56481	.|-0.7972	.|4	.|.	.|.	.|.	-3.4445|-3.4445	19.2492|19.2492	0.93917|0.93917	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	516;559;566;566;465;566|213;67;169;263	.|ENSP00000435807:S213L;ENSP00000435311:S67L;ENSP00000432976:S169L;ENSP00000435737:S263L	.|.	Q|S	-|-	1|2	0|0	PICALM|PICALM	85369903|85369903	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	9.420000|9.420000	0.97426|0.97426	2.635000|2.635000	0.89317|0.89317	0.585000|0.585000	0.79938|0.79938	CAA|TCA		0.353	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392224.1	NM_007166		17	53	0	0	0	0.00074312	0	17	53				
ENDOD1	23052	broad.mit.edu	37	11	94862474	94862474	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:94862474C>T	ENST00000278505.4	+	2	1352	c.1234C>T	c.(1234-1236)Ctc>Ttc	p.L412F		NM_015036.2	NP_055851.1	O94919	ENDD1_HUMAN	endonuclease domain containing 1	412						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				CATCAGGGCTCTCCTCCGGAT	0.552																																							uc001pfh.2		NA																	0					0						c.(1234-1236)CTC>TTC		endonuclease domain containing 1 precursor							149.0	142.0	144.0					11																	94862474		2029	4180	6209	SO:0001583	missense	23052					extracellular region	endonuclease activity|metal ion binding|nucleic acid binding	g.chr11:94862474C>T	BC026191	CCDS41699.1	11q21	2010-03-19			ENSG00000149218	ENSG00000149218			29129	protein-coding gene	gene with protein product						10048485	Standard	NM_015036		Approved	KIAA0830	uc001pfh.3	O94919	OTTHUMG00000167835	ENST00000278505.4:c.1234C>T	11.37:g.94862474C>T	ENSP00000278505:p.Leu412Phe		Somatic					p.L412F	NM_015036	NP_055851	WXS	Illumina HiSeq	Unspecified	O94919	ENDD1_HUMAN			2	1309	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)	412					A8K6K8|Q6GQY5|Q8TAQ8	Missense_Mutation	SNP	ENST00000278505.4	37	c.1234C>T	CCDS41699.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.888812	0.00527	.	.	ENSG00000149218	ENST00000278505	T	0.35789	1.29	6.03	-12.1	0.00011	.	1.423390	0.04220	N	0.333374	T	0.09992	0.0245	N	0.02802	-0.49	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04840	-1.0923	10	0.02654	T	1	-0.5976	7.1282	0.25484	0.086:0.2576:0.4572:0.1993	.	412	O94919	ENDD1_HUMAN	F	412	ENSP00000278505:L412F	ENSP00000278505:L412F	L	+	1	0	ENDOD1	94502122	0.000000	0.05858	0.000000	0.03702	0.140000	0.21249	-3.119000	0.00596	-3.549000	0.00143	-1.434000	0.01081	CTC		0.552	ENDOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396545.1	NM_015036		12	69	0	0	0	0.000978159	0	12	69				
EXPH5	23086	broad.mit.edu	37	11	108384345	108384345	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:108384345G>A	ENST00000265843.4	-	6	1999	c.1889C>T	c.(1888-1890)tCc>tTc	p.S630F	EXPH5_ENST00000428840.1_Missense_Mutation_p.S554F|EXPH5_ENST00000524840.1_5'UTR|EXPH5_ENST00000525344.1_Missense_Mutation_p.S623F|EXPH5_ENST00000443411.1_Missense_Mutation_p.S442F	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	630					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CTGGGAAAAGGAAGTTTTGAA	0.408																																							uc001pkk.2		NA																	0				skin(3)|ovary(2)	5						c.(1888-1890)TCC>TTC		exophilin 5 isoform a							99.0	102.0	101.0					11																	108384345		2201	4298	6499	SO:0001583	missense	23086				intracellular protein transport		Rab GTPase binding	g.chr11:108384345G>A		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.1889C>T	11.37:g.108384345G>A	ENSP00000265843:p.Ser630Phe		Somatic				EXPH5_uc010rvy.1_Missense_Mutation_p.S442F|EXPH5_uc010rvz.1_Missense_Mutation_p.S474F|EXPH5_uc010rwa.1_Missense_Mutation_p.S554F	p.S630F	NM_015065	NP_055880	WXS	Illumina HiSeq	Unspecified	Q8NEV8	EXPH5_HUMAN		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)	6	2000	-		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)	630					Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	c.1889C>T	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	G	6.616	0.482133	0.12581	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.06294	3.92;3.85;3.7;3.92;3.75;3.32	5.71	3.81	0.43845	.	0.630018	0.14997	N	0.286304	T	0.07638	0.0192	L	0.51422	1.61	0.09310	N	1	B	0.24368	0.102	B	0.24155	0.051	T	0.24621	-1.0155	10	0.52906	T	0.07	-0.8168	8.0121	0.30359	0.085:0.1605:0.7546:0.0	.	630	Q8NEV8	EXPH5_HUMAN	F	630;554;442;623;474;554;442	ENSP00000265843:S630F;ENSP00000391966:S554F;ENSP00000411390:S442F;ENSP00000432546:S623F;ENSP00000432683:S554F;ENSP00000446434:S442F	ENSP00000265843:S630F	S	-	2	0	EXPH5	107889555	0.373000	0.25073	0.040000	0.18447	0.090000	0.18270	1.681000	0.37618	0.863000	0.35553	0.557000	0.71058	TCC		0.408	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065		8	115	0	0	0	0.000442599	0	8	115				
OR10G7	390265	broad.mit.edu	37	11	123909438	123909438	+	Missense_Mutation	SNP	T	T	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:123909438T>C	ENST00000330487.5	-	1	279	c.271A>G	c.(271-273)Atc>Gtc	p.I91V		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TGGAAGGAGATAGTCCTGCCG	0.527																																							uc001pzq.1		NA																	0				ovary(2)	2						c.(271-273)ATC>GTC		olfactory receptor, family 10, subfamily G,							211.0	226.0	221.0					11																	123909438		2200	4299	6499	SO:0001583	missense	390265				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123909438T>C	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.271A>G	11.37:g.123909438T>C	ENSP00000329689:p.Ile91Val		Somatic					p.I91V	NM_001004463	NP_001004463	WXS	Illumina HiSeq	Unspecified	Q8NGN6	O10G7_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	271	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	91			Extracellular (Potential).		Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	c.271A>G	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	T	3.108	-0.183203	0.06340	.	.	ENSG00000182634	ENST00000330487	T	0.00469	7.21	3.39	0.858	0.19030	GPCR, rhodopsin-like superfamily (1);	0.131269	0.34291	N	0.004089	T	0.00496	0.0016	M	0.82923	2.615	0.09310	N	0.999996	B	0.12630	0.006	B	0.17979	0.02	T	0.50110	-0.8866	10	0.66056	D	0.02	.	2.1812	0.03875	0.1546:0.0932:0.1598:0.5924	.	91	Q8NGN6	O10G7_HUMAN	V	91	ENSP00000329689:I91V	ENSP00000329689:I91V	I	-	1	0	OR10G7	123414648	0.998000	0.40836	0.246000	0.24233	0.233000	0.25261	2.866000	0.48420	0.054000	0.16065	0.374000	0.22700	ATC		0.527	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463		21	118	0	0	0	0.00278032	0	21	118				
ARHGAP32	9743	broad.mit.edu	37	11	128839603	128839603	+	Silent	SNP	G	G	T	rs79505038	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:128839603G>T	ENST00000310343.9	-	22	5462	c.5463C>A	c.(5461-5463)ccC>ccA	p.P1821P	ARHGAP32_ENST00000392657.3_Silent_p.P1472P|ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000527272.1_Silent_p.P1472P	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1821	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)	p.P1472P(1)|p.P1821P(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CCTCTCCCTCGGGACTGATGG	0.577																																							uc009zcp.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(3)|ovary(2)	5						c.(5461-5463)CCC>CCA		Rho GTPase-activating protein isoform 1							84.0	79.0	80.0					11																	128839603		2201	4297	6498	SO:0001819	synonymous_variant	9743				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding	g.chr11:128839603G>T	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.5463C>A	11.37:g.128839603G>T			Somatic				ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_Silent_p.P780P|ARHGAP32_uc001qez.2_Silent_p.P1472P	p.P1821P	NM_001142685	NP_001136157	WXS	Illumina HiSeq	Unspecified	A7KAX9	RHG32_HUMAN			22	5463	-			1821			Interaction with FYN.		I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	37	c.5463C>A	CCDS44769.1																																																																																				0.577	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715		5	46	1	0	0.00116845	0.00116845	0.00343167	5	46				
CACNA2D4	93589	broad.mit.edu	37	12	1965194	1965194	+	Silent	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:1965194C>T	ENST00000382722.5	-	22	2498	c.2136G>A	c.(2134-2136)aaG>aaA	p.K712K	CACNA2D4_ENST00000585732.1_Silent_p.K573K|CACNA2D4_ENST00000587995.1_Silent_p.K687K|CACNA2D4_ENST00000585708.1_Silent_p.K648K|CACNA2D4_ENST00000588077.1_Silent_p.K648K|CACNA2D4_ENST00000586184.1_Silent_p.K712K|CACNA2D4_ENST00000539048.2_5'UTR	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	712					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GGTCTGGGTCCTTCCTGGTGA	0.577																																					Colon(2;101 179 21030 23310 28141)	Colon(2;101 179 21030 23310 28141)	uc001qjp.2		NA																	0				ovary(1)	1						c.(2134-2136)AAG>AAA		voltage-gated calcium channel alpha(2)delta-4							58.0	64.0	62.0					12																	1965194		2033	4187	6220	SO:0001819	synonymous_variant	93589					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity	g.chr12:1965194C>T	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2136G>A	12.37:g.1965194C>T			Somatic				CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Silent_p.K576K|CACNA2D4_uc009zdr.1_5'Flank	p.K712K	NM_172364	NP_758952	WXS	Illumina HiSeq	Unspecified	Q7Z3S7	CA2D4_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)	22	2367	-	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	712			Extracellular (Potential).		Q7Z3S8|Q86XZ5|Q8IZS9	Silent	SNP	ENST00000382722.5	37	c.2136G>A	CCDS44785.1																																																																																				0.577	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2			5	25	0	0	0	0.000602214	0	5	25				
CACNA1C	775	broad.mit.edu	37	12	2791158	2791158	+	Missense_Mutation	SNP	G	G	T	rs528997596	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:2791158G>T	ENST00000399617.1	+	43	5487	c.5487G>T	c.(5485-5487)agG>agT	p.R1829S	CACNA1C_ENST00000402845.3_Intron|CACNA1C_ENST00000347598.4_Intron|CACNA1C_ENST00000399591.1_Intron|CACNA1C_ENST00000399601.1_Intron|CACNA1C_ENST00000399634.1_Intron|CACNA1C_ENST00000399655.1_Intron|CACNA1C_ENST00000399637.1_Intron|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399638.1_Intron|CACNA1C_ENST00000399595.1_Intron|CACNA1C_ENST00000399597.1_Intron|CACNA1C_ENST00000335762.5_Intron|CACNA1C_ENST00000344100.3_Intron|CACNA1C_ENST00000399606.1_Intron|CACNA1C_ENST00000399603.1_Intron|CACNA1C_ENST00000399644.1_Intron|CACNA1C_ENST00000399641.1_Intron|CACNA1C_ENST00000399621.1_Intron|CACNA1C_ENST00000399629.1_Intron|CACNA1C_ENST00000406454.3_Intron|CACNA1C_ENST00000327702.7_Missense_Mutation_p.R1829S|CACNA1C_ENST00000399649.1_Intron	NM_001167624.1	NP_001161096.1	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1877					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGCTCAGGAGGGATTCAGGCT	0.572																																							uc009zdu.1		NA																	0				ovary(10)|central_nervous_system(1)	11						c.(5629-5631)AGG>AGT		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						140.0	117.0	124.0					12																	2791158		1568	3582	5150	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2791158G>T	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000399617.1:c.5487G>T	12.37:g.2791158G>T	ENSP00000382526:p.Arg1829Ser		Somatic				CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Missense_Mutation_p.R1829S|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Missense_Mutation_p.R1565S|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc010sea.1_Intron|uc001qkx.1_Intron|CACNA1C_uc001qky.1_Intron	p.R1877S	NM_199460	NP_955630	WXS	Illumina HiSeq	Unspecified	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	45	5944	+			1877			Cytoplasmic (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000399617.1	37	c.5631G>T	CCDS53733.1	.	.	.	.	.	.	.	.	.	.	G	8.926	0.962260	0.18583	.	.	ENSG00000151067	ENST00000327702;ENST00000399617	D;D	0.95069	-3.5;-3.6	3.4	-2.34	0.06704	.	.	.	.	.	T	0.80586	0.4651	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.002;0.004;0.001	T	0.70219	-0.4932	9	0.07482	T	0.82	.	0.5616	0.00680	0.3588:0.1728:0.2921:0.1762	.	1877;1829;1829	Q13936;Q13936-33;E9PDJ0	CAC1C_HUMAN;.;.	S	1829	ENSP00000329877:R1829S;ENSP00000382526:R1829S	ENSP00000329877:R1829S	R	+	3	2	CACNA1C	2661419	0.000000	0.05858	0.000000	0.03702	0.831000	0.47069	-2.283000	0.01155	-0.502000	0.06596	0.585000	0.79938	AGG		0.572	CACNA1C-013	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317031.1	NM_000719		6	47	1	0	5.9392e-07	0.00116845	2.12271e-06	6	47				
ZNF384	171017	broad.mit.edu	37	12	6776900	6776900	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:6776900C>T	ENST00000396801.3	-	11	1921	c.1714G>A	c.(1714-1716)Gag>Aag	p.E572K	ZNF384_ENST00000319770.3_Missense_Mutation_p.E495K|RP4-761J14.8_ENST00000589924.1_RNA|ZNF384_ENST00000396795.1_Missense_Mutation_p.E511K|ZNF384_ENST00000396799.2_Missense_Mutation_p.E511K|ZNF384_ENST00000361959.3_Missense_Mutation_p.E572K|RP4-761J14.8_ENST00000586338.1_RNA|ZNF384_ENST00000355772.4_Missense_Mutation_p.E456K	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	572					nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						GCCAGGTGCTCCACCTGGATG	0.557			T	"""EWSR1, TAF15 """	ALL																																		uc010sfh.1		NA		Dom	yes		12	12p13	171017	T	zinc finger protein 384 (CIZ/NMP4)			L	EWSR1|TAF15 		ALL	EWSR1/ZNF384(4)	0				haematopoietic_and_lymphoid_tissue(4)|central_nervous_system(3)|kidney(1)	8						c.(1714-1716)GAG>AAG		nuclear matrix transcription factor 4 isoform d							157.0	157.0	157.0					12																	6776900		2203	4300	6503	SO:0001583	missense	171017				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr12:6776900C>T	U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.1714G>A	12.37:g.6776900C>T	ENSP00000380019:p.Glu572Lys		Somatic				ZNF384_uc001qpz.2_Missense_Mutation_p.E511K|ZNF384_uc001qqa.2_Missense_Mutation_p.E511K|ZNF384_uc001qqb.2_Missense_Mutation_p.E495K|ZNF384_uc001qqc.2_Missense_Mutation_p.E511K|ZNF384_uc001qqd.2_Missense_Mutation_p.E456K|ZNF384_uc001qqe.2_Missense_Mutation_p.E495K	p.E572K	NM_001135734	NP_001129206	WXS	Illumina HiSeq	Unspecified	Q8TF68	ZN384_HUMAN			11	1922	-			572					O15407|Q7Z722|Q8N938	Missense_Mutation	SNP	ENST00000396801.3	37	c.1714G>A	CCDS44817.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280021	0.80692	.	.	ENSG00000126746	ENST00000319770;ENST00000396795;ENST00000396801;ENST00000361959;ENST00000355772;ENST00000396799	T;T;T;T;T;T	0.14391	2.91;2.88;2.51;2.51;2.75;2.88	5.83	5.83	0.93111	.	0.111469	0.64402	D	0.000008	T	0.29223	0.0727	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.67145	0.993;0.996;0.996;0.996	D;D;D;D	0.73708	0.956;0.981;0.981;0.981	T	0.01182	-1.1426	10	0.72032	D	0.01	-20.9262	20.1141	0.97919	0.0:1.0:0.0:0.0	.	572;456;495;511	Q8TF68;Q8TF68-3;F8W6Q3;Q8TF68-2	ZN384_HUMAN;.;.;.	K	495;511;572;572;456;511	ENSP00000321650:E495K;ENSP00000380013:E511K;ENSP00000380019:E572K;ENSP00000354592:E572K;ENSP00000348018:E456K;ENSP00000380017:E511K	ENSP00000321650:E495K	E	-	1	0	ZNF384	6647161	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.390000	0.79816	2.757000	0.94681	0.591000	0.81541	GAG		0.557	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1			12	109	0	0	0	0.000978159	0	12	109				
CD163	9332	broad.mit.edu	37	12	7632483	7632483	+	Silent	SNP	C	C	T	rs267603678		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:7632483C>T	ENST00000359156.4	-	16	3655	c.3453G>A	c.(3451-3453)aaG>aaA	p.K1151K	CD163_ENST00000432237.2_3'UTR|CD163_ENST00000396620.3_3'UTR|CD163_ENST00000541972.1_3'UTR	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	1151					acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	TCCCATTTTCCTTTTCAGTGT	0.403																																							uc001qsz.3		NA																	0				ovary(6)|pancreas(1)|skin(1)	8						c.(3451-3453)AAG>AAA		CD163 antigen isoform a							114.0	112.0	113.0					12																	7632483		2203	4300	6503	SO:0001819	synonymous_variant	9332				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	g.chr12:7632483C>T	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.3453G>A	12.37:g.7632483C>T			Somatic				CD163_uc001qta.3_3'UTR|CD163_uc009zfw.2_3'UTR	p.K1151K	NM_004244	NP_004235	WXS	Illumina HiSeq	Unspecified	Q86VB7	C163A_HUMAN			16	3581	-			1151			Cytoplasmic (Potential).		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Silent	SNP	ENST00000359156.4	37	c.3453G>A	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	C	6.554	0.470529	0.12461	.	.	ENSG00000177575	ENST00000537626	.	.	.	4.84	-2.22	0.06952	.	.	.	.	.	T	0.19406	0.0466	.	.	.	0.27649	N	0.947442	.	.	.	.	.	.	T	0.26018	-1.0115	4	.	.	.	.	1.4158	0.02301	0.1335:0.2801:0.328:0.2584	.	.	.	.	K	132	.	.	R	-	2	0	CD163	7523750	0.002000	0.14202	0.486000	0.27416	0.926000	0.56050	-0.626000	0.05527	-0.535000	0.06307	-0.253000	0.11424	AGG		0.403	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		17	63	0	0	0	0.000566183	0	17	63				
SLC2A14	144195	broad.mit.edu	37	12	7984305	7984305	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:7984305G>T	ENST00000543909.1	-	9	995	c.236C>A	c.(235-237)tCt>tAt	p.S79Y	SLC2A14_ENST00000396589.2_Missense_Mutation_p.S79Y|SLC2A14_ENST00000539924.1_Missense_Mutation_p.S94Y|SLC2A14_ENST00000340749.5_Missense_Mutation_p.S56Y|SLC2A14_ENST00000431042.2_Missense_Mutation_p.S56Y|SLC2A14_ENST00000535295.1_Intron|SLC2A14_ENST00000542546.1_Intron|SLC2A14_ENST00000542505.1_Intron			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	79					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		CAGCACCTCAGAGGGAGGGGC	0.463											OREG0021654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001qtk.2		NA																	0				ovary(1)	1						c.(235-237)TCT>TAT		glucose transporter 14							116.0	107.0	110.0					12																	7984305		2203	4300	6503	SO:0001583	missense	144195				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity	g.chr12:7984305G>T	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.236C>A	12.37:g.7984305G>T	ENSP00000440480:p.Ser79Tyr		Somatic	OREG0021654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	645	SLC2A14_uc001qtl.2_Missense_Mutation_p.S56Y|SLC2A14_uc001qtm.2_Missense_Mutation_p.S56Y|SLC2A14_uc010sgg.1_Intron|SLC2A14_uc001qtn.2_Missense_Mutation_p.S79Y|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Missense_Mutation_p.S94Y	p.S79Y	NM_153449	NP_703150	WXS	Illumina HiSeq	Unspecified	Q8TDB8	GTR14_HUMAN		Kidney(36;0.0883)	9	1029	-			79			Extracellular (Potential).		B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	c.236C>A	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116154	0.37339	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000539924;ENST00000546234;ENST00000542782;ENST00000535344;ENST00000537557;ENST00000535266;ENST00000542916	T;T;T;T;T;T;T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94;-0.94	3.6	1.54	0.23209	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.637474	0.16192	N	0.225348	D	0.86347	0.5911	M	0.94021	3.485	0.09310	N	1	P;P;P	0.48294	0.908;0.704;0.841	P;P;P	0.57620	0.615;0.48;0.824	T	0.78537	-0.2166	10	0.72032	D	0.01	.	11.1292	0.48336	0.0:0.5088:0.4912:0.0	.	94;56;79	B7ZAC3;Q8TDB8-2;Q8TDB8	.;.;GTR14_HUMAN	Y	56;79;56;79;94;56;56;56;79;79;56	ENSP00000340450:S56Y;ENSP00000440480:S79Y;ENSP00000407287:S56Y;ENSP00000379834:S79Y;ENSP00000445929:S94Y;ENSP00000440043:S56Y;ENSP00000438312:S56Y;ENSP00000443217:S56Y;ENSP00000440044:S79Y;ENSP00000437653:S79Y;ENSP00000442402:S56Y	ENSP00000340450:S56Y	S	-	2	0	SLC2A14	7875572	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.820000	0.27323	0.050000	0.15949	0.585000	0.79938	TCT		0.463	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449		14	53	1	0	6.31663e-08	0.00316338	2.36392e-07	14	53				
ZNF705A	440077	broad.mit.edu	37	12	8329900	8329900	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:8329900C>A	ENST00000359286.4	+	5	713	c.624C>A	c.(622-624)gcC>gcA	p.A208A	FAM66C_ENST00000454799.2_RNA|FAM66C_ENST00000456135.2_RNA|FAM66C_ENST00000541558.1_RNA|FAM66C_ENST00000544214.1_RNA	NM_001004328.2|NM_001278713.1	NP_001004328.1|NP_001265642.1	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(3)|stomach(4)	18				Kidney(36;0.0877)		GTGGAAAAGCCTTCACTCAGT	0.423																																							uc001qud.1		NA																	0					0						c.(622-624)GCC>GCA		zinc finger protein 705A							36.0	36.0	36.0					12																	8329900		2161	4256	6417	SO:0001819	synonymous_variant	440077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr12:8329900C>A	AK131339	CCDS31737.1	12p13.31	2014-02-12	2005-09-22		ENSG00000196946	ENSG00000196946		"""Zinc fingers, C2H2-type"", ""-"""	32281	protein-coding gene	gene with protein product							Standard	NM_001004328		Approved	FLJ16353	uc001qud.1	Q6ZN79	OTTHUMG00000168635	ENST00000359286.4:c.624C>A	12.37:g.8329900C>A			Somatic				FAM66C_uc001que.3_5'Flank|FAM66C_uc001quf.3_5'Flank|FAM66C_uc009zgc.2_5'Flank|FAM66C_uc001qug.3_5'Flank	p.A208A	NM_001004328	NP_001004328	WXS	Illumina HiSeq	Unspecified	Q6ZN79	Z705A_HUMAN		Kidney(36;0.0877)	5	696	+			208			C2H2-type 2.			Silent	SNP	ENST00000359286.4	37	c.624C>A	CCDS31737.1																																																																																				0.423	ZNF705A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400449.1	NM_001004328		27	82	1	0	6.70999e-13	0.00428921	2.98197e-12	27	82				
PZP	5858	broad.mit.edu	37	12	9353608	9353608	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:9353608C>A	ENST00000261336.2	-	6	578	c.550G>T	c.(550-552)Gct>Tct	p.A184S	PZP_ENST00000381997.2_Missense_Mutation_p.A53S	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	184					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						TTGATGCCAGCTTCTAGCTTG	0.478																																					Melanoma(125;1402 1695 4685 34487 38571)	Melanoma(125;1402 1695 4685 34487 38571)	uc001qvl.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						c.(550-552)GCT>TCT		pregnancy-zone protein precursor							135.0	127.0	130.0					12																	9353608		2203	4300	6503	SO:0001583	missense	5858							g.chr12:9353608C>A	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.550G>T	12.37:g.9353608C>A	ENSP00000261336:p.Ala184Ser		Somatic				PZP_uc009zgl.2_Missense_Mutation_p.A53S	p.A184S	NM_002864	NP_002855	WXS	Illumina HiSeq	Unspecified					6	579	-								A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	c.550G>T	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	C	1.777	-0.482959	0.04383	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.73258	-0.73;-0.73	3.29	-3.68	0.04463	Alpha-2-macroglobulin, N-terminal (1);	1.710380	0.03385	N	0.201005	T	0.44891	0.1315	N	0.10874	0.06	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.0;0.002	T	0.32719	-0.9896	10	0.09338	T	0.73	.	5.2478	0.15506	0.0:0.5127:0.1962:0.291	.	53;184	P20742-2;P20742	.;PZP_HUMAN	S	184;53	ENSP00000261336:A184S;ENSP00000371427:A53S	ENSP00000261336:A184S	A	-	1	0	PZP	9244875	0.000000	0.05858	0.001000	0.08648	0.263000	0.26337	-1.845000	0.01677	-0.586000	0.05898	0.313000	0.20887	GCT		0.478	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864		18	87	1	0	1.50039e-11	0.00188189	6.49688e-11	18	87				
PTPRO	5800	broad.mit.edu	37	12	15669860	15669861	+	Missense_Mutation	DNP	AG	AG	TT			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	AG	AG	-	-	AG	AG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:15669860_15669861AG>TT	ENST00000281171.4	+	9	2079_2080	c.1749_1750AG>TT	c.(1747-1752)atAGca>atTTca	p.A584S	PTPRO_ENST00000348962.2_Missense_Mutation_p.A584S|PTPRO_ENST00000543886.1_Missense_Mutation_p.A584S	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	584	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				ACTATGAAATAGCAGCAACTGT	0.416																																							uc001rcv.1		NA																	0				skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9						c.(1747-1752)ATAGCA>ATTTCA		receptor-type protein tyrosine phosphatase O																																				SO:0001583	missense	5800					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:15669860_15669861AG>TT	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	Exception_encountered	12.37:g.15669860_15669861delinsTT	ENSP00000281171:p.Ala584Ser		Somatic				PTPRO_uc001rcw.1_Missense_Mutation_p.A584S|PTPRO_uc001rcu.1_Missense_Mutation_p.A584S	p.A584S	NM_030667	NP_109592	WXS	Illumina HiSeq	Unspecified	Q16827	PTPRO_HUMAN			9	1923_1924	+		Hepatocellular(102;0.244)	584			Fibronectin type-III 6.|Extracellular (Potential).		A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	DNP	ENST00000281171.4	37	c.1749_1750AG>TT	CCDS8675.1																																																																																				0.416	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1			31	113	0	0	0	6.4e-05	0	31	113				
SOX5	6660	broad.mit.edu	37	12	23818489	23818489	+	Nonsense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:23818489G>A	ENST00000451604.2	-	7	921	c.820C>T	c.(820-822)Cag>Tag	p.Q274*	SOX5_ENST00000541536.1_Nonsense_Mutation_p.Q261*|SOX5_ENST00000381381.2_Nonsense_Mutation_p.Q261*|SOX5_ENST00000309359.1_Nonsense_Mutation_p.Q261*|SOX5_ENST00000545921.1_Nonsense_Mutation_p.Q264*|SOX5_ENST00000546136.1_Nonsense_Mutation_p.Q261*|SOX5_ENST00000537393.1_Nonsense_Mutation_p.Q239*			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	274					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						GGCGGCAGCTGACCTTGAACC	0.483																																							uc001rfw.2		NA																	0				ovary(5)|lung(1)	6						c.(820-822)CAG>TAG		SRY (sex determining region Y)-box 5 isoform a							98.0	98.0	98.0					12																	23818489		2203	4300	6503	SO:0001587	stop_gained	6660				transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr12:23818489G>A	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.820C>T	12.37:g.23818489G>A	ENSP00000398273:p.Gln274*		Somatic				SOX5_uc001rfx.2_Nonsense_Mutation_p.Q261*|SOX5_uc001rfy.2_Nonsense_Mutation_p.Q261*|SOX5_uc010siv.1_Nonsense_Mutation_p.Q261*|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Nonsense_Mutation_p.Q226*	p.Q274*	NM_006940	NP_008871	WXS	Illumina HiSeq	Unspecified	P35711	SOX5_HUMAN			7	922	-			274			Potential.		B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Nonsense_Mutation	SNP	ENST00000451604.2	37	c.820C>T	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	G	39	7.724843	0.98456	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921	.	.	.	5.17	5.17	0.71159	.	0.197272	0.45867	D	0.000340	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	18.8599	0.92267	0.0:0.0:1.0:0.0	.	.	.	.	X	261;261;261;274;226;239;261;264	.	ENSP00000308927:Q261X	Q	-	1	0	SOX5	23709756	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.767000	0.85331	2.685000	0.91497	0.655000	0.94253	CAG		0.483	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940		20	63	0	0	0	0.00188189	0	20	63				
OVOS2	144203	broad.mit.edu	37	12	31301909	31301909	+	IGR	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:31301909T>A								RP11-551L14.1 (31504 upstream) : FAM60A (131608 downstream)																							AAATTTAAGCTGTACAAGAAA	0.303																																							uc010sjy.1		NA																	0					NA						c.e10-1		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							37.0	32.0	33.0					12																	31301909		1794	4061	5855	SO:0001628	intergenic_variant	0							g.chr12:31301909T>A																													12.37:g.31301909T>A			Somatic					p.L349_splice			WXS	Illumina HiSeq	Unspecified					10	1045	-									Splice_Site	SNP		37	c.1045_splice																																																																																				0	0.303									4	24	0	0	0	0.00024832	0	4	24				
SYT10	341359	broad.mit.edu	37	12	33579112	33579112	+	Missense_Mutation	SNP	C	C	A	rs375066285		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:33579112C>A	ENST00000228567.3	-	2	766	c.470G>T	c.(469-471)cGt>cTt	p.R157L	SYT10_ENST00000535526.1_5'UTR|SYT10_ENST00000567656.1_5'Flank	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	157					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					TCTTTGCACACGTGCATGTTT	0.408																																							uc001rll.1		NA																	0				ovary(1)|skin(1)	2						c.(469-471)CGT>CTT		synaptotagmin X							188.0	196.0	193.0					12																	33579112		2203	4300	6503	SO:0001583	missense	341359					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr12:33579112C>A	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.470G>T	12.37:g.33579112C>A	ENSP00000228567:p.Arg157Leu		Somatic				SYT10_uc009zju.1_5'UTR	p.R157L	NM_198992	NP_945343	WXS	Illumina HiSeq	Unspecified	Q6XYQ8	SYT10_HUMAN			2	767	-	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)		157			Cytoplasmic (Potential).		Q495U2	Missense_Mutation	SNP	ENST00000228567.3	37	c.470G>T	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	C	18.19	3.569503	0.65765	.	.	ENSG00000110975	ENST00000228567	T	0.52754	0.65	3.78	3.78	0.43462	.	0.180839	0.26231	U	0.025567	T	0.57873	0.2083	L	0.58510	1.815	0.80722	D	1	P	0.42941	0.794	P	0.52109	0.69	T	0.62946	-0.6746	10	0.59425	D	0.04	.	15.8987	0.79356	0.0:1.0:0.0:0.0	.	157	Q6XYQ8	SYT10_HUMAN	L	157	ENSP00000228567:R157L	ENSP00000228567:R157L	R	-	2	0	SYT10	33470379	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.516000	0.45520	2.390000	0.81377	0.655000	0.94253	CGT		0.408	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992		41	175	1	0	2.47872e-24	0.0025221	1.2357e-23	41	175				
CNTN1	1272	broad.mit.edu	37	12	41316083	41316083	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:41316083G>T	ENST00000551295.2	+	5	370	c.253G>T	c.(253-255)Gat>Tat	p.D85Y	CNTN1_ENST00000547702.1_Missense_Mutation_p.D85Y|CNTN1_ENST00000348761.2_Missense_Mutation_p.D74Y|CNTN1_ENST00000547849.1_Missense_Mutation_p.D85Y|CNTN1_ENST00000360099.3_Missense_Mutation_p.D85Y|CNTN1_ENST00000347616.1_Missense_Mutation_p.D85Y	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	85	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TGGGGACGTTGATCTCACAAG	0.393																																							uc001rmm.1		NA																	0				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9						c.(253-255)GAT>TAT		contactin 1 isoform 1 precursor							145.0	129.0	135.0					12																	41316083		2203	4300	6503	SO:0001583	missense	1272				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane		g.chr12:41316083G>T	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.253G>T	12.37:g.41316083G>T	ENSP00000447006:p.Asp85Tyr		Somatic				CNTN1_uc009zjy.1_Missense_Mutation_p.D85Y|CNTN1_uc001rmn.1_Missense_Mutation_p.D74Y|CNTN1_uc001rmo.2_Missense_Mutation_p.D85Y	p.D85Y	NM_001843	NP_001834	WXS	Illumina HiSeq	Unspecified	Q12860	CNTN1_HUMAN			5	366	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	85			Ig-like C2-type 1.		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	c.253G>T	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582120	0.86748	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000548005;ENST00000552248;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T;T	0.42131	2.6;2.6;0.98;2.6;2.6;2.6;2.6	5.74	5.74	0.90152	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.66925	0.2839	M	0.73962	2.25	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.997;0.997	D;D;D	0.72982	0.977;0.964;0.979	T	0.65651	-0.6116	10	0.52906	T	0.07	.	20.3075	0.98634	0.0:0.0:1.0:0.0	.	85;74;85	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	Y	85;85;85;85;85;85;85;74	ENSP00000448004:D85Y;ENSP00000447006:D85Y;ENSP00000447860:D85Y;ENSP00000448653:D85Y;ENSP00000325660:D85Y;ENSP00000353213:D85Y;ENSP00000261160:D74Y	ENSP00000325660:D85Y	D	+	1	0	CNTN1	39602350	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.115000	0.64655	2.880000	0.98712	0.650000	0.86243	GAT		0.393	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843		17	54	1	0	7.45023e-12	0.00152264	3.26794e-11	17	54				
ADAMTS20	80070	broad.mit.edu	37	12	43777718	43777718	+	Silent	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:43777718A>G	ENST00000389420.3	-	30	4514	c.4515T>C	c.(4513-4515)gtT>gtC	p.V1505V		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1505	TSP type-1 12. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CCACCTGACCAACACCTTTCA	0.488																																							uc010skx.1		NA																	0				central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(4513-4515)GTT>GTC		a disintegrin-like and metalloprotease with							128.0	102.0	111.0					12																	43777718		2203	4300	6503	SO:0001819	synonymous_variant	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43777718A>G	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4515T>C	12.37:g.43777718A>G			Somatic					p.V1505V	NM_025003	NP_079279	WXS	Illumina HiSeq	Unspecified	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	30	4515	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	1505			TSP type-1 12.		A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	37	c.4515T>C	CCDS31778.2																																																																																				0.488	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		6	38	0	0	0	0.00116845	0	6	38				
DBX2	440097	broad.mit.edu	37	12	45417504	45417504	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:45417504G>T	ENST00000332700.6	-	3	844	c.673C>A	c.(673-675)Cta>Ata	p.L225I		NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	225					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		GATTCCTTTAGTCCCAAGTTG	0.423																																							uc001rok.1		NA																	0					0						c.(673-675)CTA>ATA		developing brain homeobox 2							276.0	274.0	275.0					12																	45417504		2203	4300	6503	SO:0001583	missense	440097					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:45417504G>T		CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.673C>A	12.37:g.45417504G>T	ENSP00000331470:p.Leu225Ile		Somatic					p.L225I	NM_001004329	NP_001004329	WXS	Illumina HiSeq	Unspecified	Q6ZNG2	DBX2_HUMAN		GBM - Glioblastoma multiforme(48;0.0515)	3	845	-	Lung SC(27;0.192)	Lung NSC(34;0.142)	225			Homeobox.			Missense_Mutation	SNP	ENST00000332700.6	37	c.673C>A	CCDS31781.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.603915	0.87157	.	.	ENSG00000185610	ENST00000332700	D	0.98012	-4.66	5.73	4.83	0.62350	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.49305	D	0.000144	D	0.98337	0.9448	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98604	1.0660	10	0.87932	D	0	-12.0221	14.1496	0.65373	0.0716:0.0:0.9284:0.0	.	225	Q6ZNG2	DBX2_HUMAN	I	225	ENSP00000331470:L225I	ENSP00000331470:L225I	L	-	1	2	DBX2	43703771	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.715000	0.68430	2.698000	0.92095	0.655000	0.94253	CTA		0.423	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404810.1	NM_001004329		43	197	1	0	1.91693e-13	0.00361006	8.69051e-13	43	197				
KRT6B	3854	broad.mit.edu	37	12	52845722	52845722	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:52845722C>A	ENST00000252252.3	-	1	188	c.141G>T	c.(139-141)ctG>ctT	p.L47L		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	47	Head.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		ATGCGCCACCCAGGCCACCAC	0.667																																							uc001sak.2		NA																	0				ovary(2)	2						c.(139-141)CTG>CTT		keratin 6B							64.0	67.0	66.0					12																	52845722		2203	4299	6502	SO:0001819	synonymous_variant	3854				ectoderm development	keratin filament	structural constituent of cytoskeleton	g.chr12:52845722C>A	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.141G>T	12.37:g.52845722C>A			Somatic					p.L47L	NM_005555	NP_005546	WXS	Illumina HiSeq	Unspecified	P04259	K2C6B_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.083)	1	189	-			47			Head.		P48669	Silent	SNP	ENST00000252252.3	37	c.141G>T	CCDS8828.1																																																																																				0.667	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555		8	68	1	0	1.08611e-07	0.000978159	3.99818e-07	8	68				
OR10A7	121364	broad.mit.edu	37	12	55615378	55615378	+	Silent	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:55615378G>A	ENST00000326258.1	+	1	570	c.570G>A	c.(568-570)gtG>gtA	p.V190V		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	190						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						TAGTCACAGTGGATACAACCA	0.448																																							uc010spf.1		NA																	0				ovary(4)	4						c.(568-570)GTG>GTA		olfactory receptor, family 10, subfamily A,							230.0	181.0	197.0					12																	55615378		2203	4300	6503	SO:0001819	synonymous_variant	121364				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55615378G>A	BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.570G>A	12.37:g.55615378G>A			Somatic					p.V190V	NM_001005280	NP_001005280	WXS	Illumina HiSeq	Unspecified	Q8NGE5	O10A7_HUMAN			1	570	+			190			Extracellular (Potential).		Q6IFD5|Q96R19	Silent	SNP	ENST00000326258.1	37	c.570G>A	CCDS31815.1																																																																																				0.448	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406308.1			14	57	0	0	0	0.00185496	0	14	57				
LGR5	8549	broad.mit.edu	37	12	71898402	71898402	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:71898402G>T	ENST00000266674.5	+	2	532	c.221G>T	c.(220-222)aGt>aTt	p.S74I	LGR5_ENST00000536515.1_Missense_Mutation_p.S74I|LGR5_ENST00000540815.2_Missense_Mutation_p.S74I			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	74					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						AGAGACCTCAGTATGAACAAC	0.493																																							uc001swl.2		NA																	0				lung(4)|skin(3)|ovary(1)|pancreas(1)	9						c.(220-222)AGT>ATT		leucine-rich repeat-containing G protein-coupled							259.0	243.0	249.0					12																	71898402		2203	4300	6503	SO:0001583	missense	8549					integral to plasma membrane	protein-hormone receptor activity	g.chr12:71898402G>T	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.221G>T	12.37:g.71898402G>T	ENSP00000266674:p.Ser74Ile		Somatic				LGR5_uc001swm.2_Missense_Mutation_p.S74I|LGR5_uc001swn.1_RNA	p.S74I	NM_003667	NP_003658	WXS	Illumina HiSeq	Unspecified	O75473	LGR5_HUMAN			2	269	+			74			LRR 1.|Extracellular (Potential).		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	ENST00000266674.5	37	c.221G>T	CCDS9000.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.922508	0.73213	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515;ENST00000540815	T;D;T	0.92348	3.33;-3.02;4.0	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000001	D	0.97291	0.9114	M	0.92122	3.275	0.46061	D	0.998841	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97335	0.9953	10	0.87932	D	0	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	74;74	O75473-2;O75473	.;LGR5_HUMAN	I	74	ENSP00000266674:S74I;ENSP00000443033:S74I;ENSP00000441035:S74I	ENSP00000266674:S74I	S	+	2	0	LGR5	70184669	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.985000	0.76193	2.941000	0.99782	0.655000	0.94253	AGT		0.493	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667		43	193	1	0	2.51966e-14	0.00361006	1.1618e-13	43	193				
RPH3A	22895	broad.mit.edu	37	12	113319615	113319615	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:113319615C>A	ENST00000389385.4	+	15	1787	c.1290C>A	c.(1288-1290)ccC>ccA	p.P430P	RPH3A_ENST00000551052.1_Silent_p.P426P|RPH3A_ENST00000420983.2_Silent_p.P430P|RPH3A_ENST00000447659.2_Silent_p.P381P|RPH3A_ENST00000548866.1_Silent_p.P381P|RPH3A_ENST00000415485.3_Silent_p.P430P|RPH3A_ENST00000543106.2_Silent_p.P430P|RPH3A_ENST00000549913.2_3'UTR	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	430	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		TGGCTGATCCCTACGTTAAGC	0.607																																							uc010syl.1		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)	7						c.(1288-1290)CCC>CCA		rabphilin 3A homolog isoform 1							105.0	97.0	100.0					12																	113319615		2203	4300	6503	SO:0001819	synonymous_variant	22895				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding	g.chr12:113319615C>A	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1290C>A	12.37:g.113319615C>A			Somatic				RPH3A_uc001ttz.2_Silent_p.P430P|RPH3A_uc001tty.2_Silent_p.P426P|RPH3A_uc009zwe.1_Silent_p.P426P|RPH3A_uc010sym.1_Silent_p.P381P|RPH3A_uc001tua.2_Silent_p.P190P	p.P430P	NM_001143854	NP_001137326	WXS	Illumina HiSeq	Unspecified	Q9Y2J0	RP3A_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.00453)	15	1652	+			430			C2 1.		B7Z3C3|Q96AE0	Silent	SNP	ENST00000389385.4	37	c.1290C>A	CCDS44979.1																																																																																				0.607	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954		14	49	1	0	1.3612e-06	0.00316338	4.77659e-06	14	49				
MED13L	23389	broad.mit.edu	37	12	116413011	116413011	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:116413011C>A	ENST00000281928.3	-	25	5902	c.5696G>T	c.(5695-5697)gGg>gTg	p.G1899V		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1899						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.G1899V(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CCCAAGTCGCCCGATTACAAC	0.443																																							uc001tvw.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8						c.(5695-5697)GGG>GTG		mediator complex subunit 13-like							74.0	71.0	72.0					12																	116413011		2203	4300	6503	SO:0001583	missense	23389				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent			g.chr12:116413011C>A	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.5696G>T	12.37:g.116413011C>A	ENSP00000281928:p.Gly1899Val		Somatic					p.G1899V	NM_015335	NP_056150	WXS	Illumina HiSeq	Unspecified	Q71F56	MD13L_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0407)	25	5751	-	all_neural(191;0.117)|Medulloblastoma(191;0.163)		1899					A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	c.5696G>T	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	C	31	5.096359	0.94197	.	.	ENSG00000123066	ENST00000281928	D	0.83506	-1.73	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.92681	0.7674	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92091	0.5680	10	0.51188	T	0.08	.	20.3754	0.98918	0.0:1.0:0.0:0.0	.	1899	Q71F56	MD13L_HUMAN	V	1899	ENSP00000281928:G1899V	ENSP00000281928:G1899V	G	-	2	0	MED13L	114897394	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	7.438000	0.80431	2.894000	0.99253	0.591000	0.81541	GGG		0.443	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			9	62	1	0	7.48243e-07	0.000442599	2.65322e-06	9	62				
CCDC60	160777	broad.mit.edu	37	12	119937958	119937958	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:119937958C>G	ENST00000327554.2	+	6	1098	c.633C>G	c.(631-633)ttC>ttG	p.F211L	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	211										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		GGGAGCATTTCATCACAGCGC	0.468																																							uc001txe.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(631-633)TTC>TTG		coiled-coil domain containing 60							89.0	89.0	89.0					12																	119937958		2203	4300	6503	SO:0001583	missense	160777							g.chr12:119937958C>G	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.633C>G	12.37:g.119937958C>G	ENSP00000333374:p.Phe211Leu		Somatic				uc001txf.2_Intron	p.F211L	NM_178499	NP_848594	WXS	Illumina HiSeq	Unspecified	Q8IWA6	CCD60_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.207)	6	1098	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		211						Missense_Mutation	SNP	ENST00000327554.2	37	c.633C>G	CCDS9190.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.224173	0.58668	.	.	ENSG00000183273	ENST00000327554	T	0.28895	1.59	5.57	4.69	0.59074	.	0.107751	0.41500	N	0.000879	T	0.50274	0.1606	M	0.66506	2.035	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.48410	-0.9038	9	.	.	.	-21.2967	10.4453	0.44490	0.0:0.9108:0.0:0.0892	.	211	Q8IWA6	CCD60_HUMAN	L	211	ENSP00000333374:F211L	.	F	+	3	2	CCDC60	118422341	0.083000	0.21467	0.877000	0.34402	0.678000	0.39670	0.157000	0.16402	1.346000	0.45694	0.650000	0.86243	TTC		0.468	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499		14	47	0	0	0	0.00244969	0	14	47				
PITPNM2	57605	broad.mit.edu	37	12	123477210	123477210	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr12:123477210T>A	ENST00000542749.1	-	14	2303	c.2240A>T	c.(2239-2241)cAg>cTg	p.Q747L	PITPNM2_ENST00000280562.5_Missense_Mutation_p.Q747L|PITPNM2_ENST00000320201.4_Missense_Mutation_p.Q747L|PITPNM2_ENST00000392428.1_Missense_Mutation_p.Q468L			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	747	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CGGCCGCAGCTGGAAAACTGG	0.662																																							uc001uej.1		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2239-2241)CAG>CTG		phosphatidylinositol transfer protein,							24.0	30.0	28.0					12																	123477210		2201	4295	6496	SO:0001583	missense	57605				metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding	g.chr12:123477210T>A	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.2240A>T	12.37:g.123477210T>A	ENSP00000437611:p.Gln747Leu		Somatic				PITPNM2_uc001uek.1_Missense_Mutation_p.Q747L	p.Q747L	NM_020845	NP_065896	WXS	Illumina HiSeq	Unspecified	Q9BZ72	PITM2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)	15	2379	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		747			DDHD.		Q9P271	Missense_Mutation	SNP	ENST00000542749.1	37	c.2240A>T	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.127724	0.56721	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	T;T;T;T	0.49139	1.15;1.11;0.79;1.11	3.95	3.95	0.45737	DDHD (2);	0.174269	0.41194	D	0.000925	T	0.38852	0.1056	N	0.17379	0.485	0.44168	D	0.99697	P;P	0.48911	0.917;0.837	P;B	0.50314	0.637;0.356	T	0.09975	-1.0650	10	0.19147	T	0.46	-35.3899	13.0057	0.58703	0.0:0.0:0.0:1.0	.	747;747	Q9BZ72-2;Q9BZ72	.;PITM2_HUMAN	L	747;747;468;747	ENSP00000280562:Q747L;ENSP00000322218:Q747L;ENSP00000376223:Q468L;ENSP00000437611:Q747L	ENSP00000280562:Q747L	Q	-	2	0	PITPNM2	122043163	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.808000	0.55598	1.644000	0.50603	0.379000	0.24179	CAG		0.662	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845		3	14	0	0	0	6.4e-05	0	3	14				
SACS	26278	broad.mit.edu	37	13	23904603	23904603	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:23904603T>A	ENST00000382292.3	-	9	13685	c.13412A>T	c.(13411-13413)gAg>gTg	p.E4471V	SACS_ENST00000402364.1_Missense_Mutation_p.E3721V|SACS_ENST00000382298.3_Missense_Mutation_p.E4471V			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4471	HEPN. {ECO:0000255|PROSITE- ProRule:PRU00105}.				cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GCACACCCACTCATTGGCATT	0.443																																							uc001uon.2		NA																	0				ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(13411-13413)GAG>GTG		sacsin							122.0	123.0	123.0					13																	23904603		2203	4299	6502	SO:0001583	missense	26278				cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding	g.chr13:23904603T>A	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.13412A>T	13.37:g.23904603T>A	ENSP00000371729:p.Glu4471Val		Somatic				SACS_uc001uoo.2_Missense_Mutation_p.E4324V|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	p.E4471V	NM_014363	NP_055178	WXS	Illumina HiSeq	Unspecified	Q9NZJ4	SACS_HUMAN		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)	10	14001	-		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)	4471			HEPN.		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	c.13412A>T	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	29.0	4.969671	0.92855	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87103	-2.21;-2.21;-2.21	5.85	5.85	0.93711	HEPN (3);	0.000000	0.85682	D	0.000000	D	0.91666	0.7366	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92363	0.5899	10	0.72032	D	0.01	.	16.2271	0.82306	0.0:0.0:0.0:1.0	.	4471	Q9NZJ4	SACS_HUMAN	V	4471;3721;4471	ENSP00000371729:E4471V;ENSP00000385844:E3721V;ENSP00000371735:E4471V	ENSP00000371729:E4471V	E	-	2	0	SACS	22802603	1.000000	0.71417	0.872000	0.34217	0.976000	0.68499	8.040000	0.89188	2.234000	0.73211	0.460000	0.39030	GAG		0.443	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		35	125	0	0	0	0.000953801	0	35	125				
PARP4	143	broad.mit.edu	37	13	25021220	25021220	+	Silent	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:25021220G>A	ENST00000381989.3	-	26	3324	c.3219C>T	c.(3217-3219)gcC>gcT	p.A1073A		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1073					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		ACGGCACCTGGGCTGGGGCCT	0.512																																							uc001upl.2		NA																	0				ovary(3)|skin(1)	4						c.(3217-3219)GCC>GCT		poly (ADP-ribose) polymerase family, member 4							63.0	54.0	57.0					13																	25021220		2203	4300	6503	SO:0001819	synonymous_variant	143				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity	g.chr13:25021220G>A	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3219C>T	13.37:g.25021220G>A			Somatic					p.A1073A	NM_006437	NP_006428	WXS	Illumina HiSeq	Unspecified	Q9UKK3	PARP4_HUMAN		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)	26	3325	-		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)	1073					O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	ENST00000381989.3	37	c.3219C>T	CCDS9307.1																																																																																				0.512	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437		6	68	0	0	0	0.00198382	0	6	68				
N4BP2L2	10443	broad.mit.edu	37	13	33110497	33110497	+	Missense_Mutation	SNP	T	T	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:33110497T>C	ENST00000267068.3	-	2	832	c.668A>G	c.(667-669)gAt>gGt	p.D223G	N4BP2L2_ENST00000446957.2_Missense_Mutation_p.D223G|N4BP2L2_ENST00000357505.6_Intron|N4BP2L2_ENST00000399396.3_Intron|N4BP2L2_ENST00000504114.1_Intron	NM_014887.2	NP_055702.1	Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	223					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		ATTACTAAGATCTTTCTTTTC	0.353																																							uc001uuk.3		NA																	0					0						c.(667-669)GAT>GGT		phosphonoformate immuno-associated protein 5							92.0	88.0	89.0					13																	33110497		2203	4299	6502	SO:0001583	missense	10443							g.chr13:33110497T>C	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000267068.3:c.668A>G	13.37:g.33110497T>C	ENSP00000267068:p.Asp223Gly		Somatic				N4BP2L2_uc010abe.1_Intron|N4BP2L2_uc010tdz.1_Intron|N4BP2L2_uc001uul.1_Missense_Mutation_p.D223G|N4BP2L2_uc001uum.2_5'Flank	p.D223G	NM_014887	NP_055702	WXS	Illumina HiSeq	Unspecified	Q92802	N42L2_HUMAN		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)	2	846	-		Lung SC(185;0.0262)	223					A3KME8	Missense_Mutation	SNP	ENST00000267068.3	37	c.668A>G	CCDS9346.1	.	.	.	.	.	.	.	.	.	.	T	10.57	1.387206	0.25031	.	.	ENSG00000244754	ENST00000446957;ENST00000505213;ENST00000267068	T;T;T	0.42513	0.97;0.97;0.97	5.5	3.12	0.35913	.	.	.	.	.	T	0.33177	0.0854	L	0.39898	1.24	0.09310	N	0.999996	B;B	0.17465	0.022;0.012	B;B	0.17433	0.018;0.006	T	0.25117	-1.0141	9	0.48119	T	0.1	-19.6977	7.8462	0.29426	0.0:0.17:0.0:0.83	.	223;223	D6R968;Q92802	.;N42L2_HUMAN	G	223	ENSP00000394239:D223G;ENSP00000423362:D223G;ENSP00000267068:D223G	ENSP00000267068:D223G	D	-	2	0	N4BP2L2	32008497	0.000000	0.05858	0.003000	0.11579	0.805000	0.45488	0.374000	0.20501	0.418000	0.25898	0.460000	0.39030	GAT		0.353	N4BP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044421.1	NM_014887		11	73	0	0	0	0.00136819	0	11	73				
NBEA	26960	broad.mit.edu	37	13	36228995	36228995	+	Missense_Mutation	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:36228995A>G	ENST00000400445.3	+	53	8510	c.7976A>G	c.(7975-7977)aAt>aGt	p.N2659S	NBEA_ENST00000540320.1_Missense_Mutation_p.N2659S|NBEA_ENST00000379939.2_Missense_Mutation_p.N2656S|NBEA_ENST00000310336.4_Missense_Mutation_p.N2659S|NBEA_ENST00000379922.3_Missense_Mutation_p.N237S|NBEA_ENST00000537702.1_Missense_Mutation_p.N452S	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2659					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CTTTTAGCCAATAATTCAGGT	0.348																																							uc001uvb.2		NA																	0				ovary(9)|large_intestine(2)	11						c.(7975-7977)AAT>AGT		neurobeachin							78.0	71.0	73.0					13																	36228995		1844	4085	5929	SO:0001583	missense	26960					cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding	g.chr13:36228995A>G	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.7976A>G	13.37:g.36228995A>G	ENSP00000383295:p.Asn2659Ser		Somatic				NBEA_uc010abi.2_Missense_Mutation_p.N1315S|NBEA_uc010tef.1_Missense_Mutation_p.N452S|NBEA_uc001uvd.2_Missense_Mutation_p.N237S	p.N2659S	NM_015678	NP_056493	WXS	Illumina HiSeq	Unspecified	Q8NFP9	NBEA_HUMAN		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)	53	8182	+		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)	2659					B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	c.7976A>G	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	A	11.01	1.511887	0.27036	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000402346;ENST00000537702;ENST00000379922	T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	5.75	5.75	0.90469	.	0.091274	0.85682	D	0.000000	T	0.39064	0.1064	N	0.00707	-1.245	0.80722	D	1	B;B;B	0.17667	0.023;0.001;0.002	B;B;B	0.17433	0.018;0.006;0.008	T	0.48896	-0.8994	10	0.08599	T	0.76	.	16.0755	0.80965	1.0:0.0:0.0:0.0	.	2659;237;2656	Q8NFP9;Q8NFP9-2;Q5T321	NBEA_HUMAN;.;.	S	2659;2659;2656;2659;1286;237;452;237	ENSP00000440951:N2659S;ENSP00000383295:N2659S;ENSP00000369271:N2656S;ENSP00000308534:N2659S;ENSP00000440233:N452S;ENSP00000369254:N237S	ENSP00000308534:N2659S	N	+	2	0	NBEA	35126995	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.149000	0.77396	2.182000	0.69389	0.528000	0.53228	AAT		0.348	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678		4	25	0	0	0	0.00024832	0	4	25				
EPSTI1	94240	broad.mit.edu	37	13	43474446	43474446	+	Splice_Site	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:43474446C>A	ENST00000398762.3	-	10	847	c.848G>T	c.(847-849)aGg>aTg	p.R283M	EPSTI1_ENST00000313640.7_Splice_Site_p.R283M|EPSTI1_ENST00000313624.7_Splice_Site_p.R272M			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	283										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		CCAGTTTTACCTCCTGTGTTC	0.343																																							uc001uyw.1		NA																	0				ovary(1)	1						c.(847-849)AGG>ATG		epithelial stromal interaction 1 isoform 1							209.0	183.0	192.0					13																	43474446		2202	4300	6502	SO:0001630	splice_region_variant	94240							g.chr13:43474446C>A	AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.848+1G>T	13.37:g.43474446C>A			Somatic				EPSTI1_uc001uyx.1_Missense_Mutation_p.R272M	p.R283M	NM_001002264	NP_001002264	WXS	Illumina HiSeq	Unspecified	Q96J88	ESIP1_HUMAN		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)	10	924	-		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)	283					Q8IVC7|Q8NDQ7	Missense_Mutation	SNP	ENST00000398762.3	37	c.848G>T	CCDS9387.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380456	0.61845	.	.	ENSG00000133106	ENST00000313640;ENST00000313624;ENST00000398762	T	0.22539	1.95	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.46034	0.1372	M	0.69823	2.125	0.45883	D	0.998736	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.22661	-1.0210	9	.	.	.	-15.2715	16.0176	0.80455	0.0:1.0:0.0:0.0	.	272;283	Q96J88-2;Q96J88-3	.;.	M	283;272;283	ENSP00000318982:R283M	.	R	-	2	0	EPSTI1	42372446	1.000000	0.71417	1.000000	0.80357	0.481000	0.33189	4.050000	0.57404	2.835000	0.97688	0.650000	0.86243	AGG		0.343	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	Missense_Mutation	12	43	1	0	4.3838e-07	0.00185496	1.58781e-06	12	43				
SERPINE3	647174	broad.mit.edu	37	13	51922467	51922467	+	Silent	SNP	C	C	T	rs187355657	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:51922467C>T	ENST00000521255.1	+	4	879	c.819C>T	c.(817-819)atC>atT	p.I273I	MIR5693_ENST00000577722.1_RNA|SERPINE3_ENST00000400389.4_Silent_p.I273I|SERPINE3_ENST00000524365.1_Silent_p.I273I	NM_001101320.1	NP_001094790.1	A8MV23	SERP3_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3	273					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(2)	2						TGAGCCACATCGAGCCACACC	0.622													C|||	2	0.000399361	0.0	0.0014	5008	,	,		17163	0.0		0.001	False		,,,				2504	0.0						uc001vfh.2		NA																	0				ovary(2)	2						c.(817-819)ATC>ATT		nexin-related serine protease inhibitor		C		0,4266		0,0,2133	53.0	70.0	64.0		819	-0.5	0.2	13		64	1,8495		0,1,4247	no	coding-synonymous	SERPINE3	NM_001101320.1		0,1,6380	TT,TC,CC		0.0118,0.0,0.0078		273/425	51922467	1,12761	2133	4248	6381	SO:0001819	synonymous_variant	647174				regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity	g.chr13:51922467C>T	AX772926	CCDS53870.1	13q14.3	2014-02-18			ENSG00000253309	ENSG00000253309		"""Serine (or cysteine) peptidase inhibitors"""	24774	protein-coding gene	gene with protein product						24172014	Standard	NM_001101320		Approved		uc001vfh.2	A8MV23	OTTHUMG00000016943	ENST00000521255.1:c.819C>T	13.37:g.51922467C>T			Somatic				SERPINE3_uc010tgp.1_Silent_p.I273I	p.I273I	NM_001101320	NP_001094790	WXS	Illumina HiSeq	Unspecified	A8MV23	SERP3_HUMAN			4	879	+			273					B1V8P3	Silent	SNP	ENST00000521255.1	37	c.819C>T	CCDS53870.1																																																																																				0.622	SERPINE3-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045021.2	NM_001101320		6	18	0	0	0	0.00198382	0	6	18				
THSD1	55901	broad.mit.edu	37	13	52951957	52951957	+	Silent	SNP	A	A	G	rs370923980		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:52951957A>G	ENST00000258613.4	-	5	2326	c.2148T>C	c.(2146-2148)agT>agC	p.S716S	THSD1_ENST00000544466.1_Silent_p.S337S|THSD1_ENST00000349258.4_Silent_p.S663S	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	716					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CACGGGTTCCACTTGCCTCTT	0.557																																							uc001vgo.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4						c.(2146-2148)AGT>AGC		thrombospondin type I domain-containing 1							87.0	86.0	86.0					13																	52951957		2203	4300	6503	SO:0001819	synonymous_variant	55901					extracellular region|integral to membrane|intracellular membrane-bounded organelle		g.chr13:52951957A>G	AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.2148T>C	13.37:g.52951957A>G			Somatic				THSD1_uc001vgp.2_Silent_p.S663S|THSD1_uc010tgz.1_Silent_p.S337S|THSD1_uc010aea.2_Silent_p.S177S	p.S716S	NM_018676	NP_061146	WXS	Illumina HiSeq	Unspecified	Q9NS62	THSD1_HUMAN		GBM - Glioblastoma multiforme(99;2.8e-08)	5	2693	-		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	716			Cytoplasmic (Potential).		A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Silent	SNP	ENST00000258613.4	37	c.2148T>C	CCDS9432.1																																																																																				0.557	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3			9	40	0	0	0	0.000673444	0	9	40				
PCDH9	5101	broad.mit.edu	37	13	67205364	67205364	+	Silent	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:67205364A>G	ENST00000377865.2	-	3	3452	c.3318T>C	c.(3316-3318)gaT>gaC	p.D1106D	PCDH9_ENST00000456367.1_Silent_p.D1072D|PCDH9_ENST00000328454.5_Silent_p.D1072D|RNU7-87P_ENST00000459343.1_RNA|PCDH9_ENST00000544246.1_Silent_p.D1106D			Q9HC56	PCDH9_HUMAN	protocadherin 9	1106					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CAGAGTTGCCATCTGCTTCAG	0.478																																							uc001vik.2		NA																	0				ovary(4)|pancreas(1)|skin(1)	6						c.(3316-3318)GAT>GAC		protocadherin 9 isoform 1 precursor							106.0	106.0	106.0					13																	67205364		2203	4300	6503	SO:0001819	synonymous_variant	5101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr13:67205364A>G	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3318T>C	13.37:g.67205364A>G			Somatic				PCDH9_uc010aei.2_RNA|PCDH9_uc001vil.2_Silent_p.D1072D|PCDH9_uc010thl.1_Silent_p.D1064D	p.D1106D	NM_203487	NP_982354	WXS	Illumina HiSeq	Unspecified	Q9HC56	PCDH9_HUMAN		GBM - Glioblastoma multiforme(99;0.00819)	4	4010	-		Hepatocellular(98;0.0906)|Breast(118;0.107)	1106			Cytoplasmic (Potential).		A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Silent	SNP	ENST00000377865.2	37	c.3318T>C	CCDS9444.1																																																																																				0.478	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487		11	80	0	0	0	0.00136819	0	11	80				
SLITRK1	114798	broad.mit.edu	37	13	84455447	84455447	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:84455447G>T	ENST00000377084.2	-	1	1081	c.196C>A	c.(196-198)Cat>Aat	p.H66N		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	66					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GAATTGCCATGCAGAAATAAA	0.438																																							uc001vlk.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(196-198)CAT>AAT		slit and trk like 1 protein precursor							71.0	73.0	72.0					13																	84455447		2203	4300	6503	SO:0001583	missense	114798					integral to membrane		g.chr13:84455447G>T	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.196C>A	13.37:g.84455447G>T	ENSP00000366288:p.His66Asn		Somatic					p.H66N	NM_052910	NP_443142	WXS	Illumina HiSeq	Unspecified	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	1082	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	66			LRR 1.|Extracellular (Potential).		Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	c.196C>A	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	4.236	0.042820	0.08196	.	.	ENSG00000178235	ENST00000377084	T	0.51071	0.72	4.89	4.89	0.63831	.	0.053099	0.85682	D	0.000000	T	0.31009	0.0783	N	0.16743	0.435	0.51767	D	0.999938	B	0.14805	0.011	B	0.15870	0.014	T	0.11690	-1.0577	10	0.08179	T	0.78	-8.0374	16.7944	0.85598	0.0:0.0:1.0:0.0	.	66	Q96PX8	SLIK1_HUMAN	N	66	ENSP00000366288:H66N	ENSP00000366288:H66N	H	-	1	0	SLITRK1	83353448	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.449000	0.73473	2.533000	0.85409	0.561000	0.74099	CAT		0.438	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		13	65	1	0	1.61879e-10	0.00136819	6.70855e-10	13	65				
OXGR1	27199	broad.mit.edu	37	13	97639970	97639970	+	Missense_Mutation	SNP	G	G	T	rs376470936		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:97639970G>T	ENST00000298440.1	-	4	287	c.44C>A	c.(43-45)cCc>cAc	p.P15H	OXGR1_ENST00000543457.1_Missense_Mutation_p.P15H	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	15					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			TGCATAATCGGGGAAATCAGA	0.403																																							uc001vmx.1		NA																	0				ovary(1)|skin(1)	2						c.(43-45)CCC>CAC		oxoglutarate (alpha-ketoglutarate) receptor 1							113.0	113.0	113.0					13																	97639970		2203	4300	6503	SO:0001583	missense	27199					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr13:97639970G>T	AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.44C>A	13.37:g.97639970G>T	ENSP00000298440:p.Pro15His		Somatic				OXGR1_uc010afr.1_Missense_Mutation_p.P15H	p.P15H	NM_080818	NP_543008	WXS	Illumina HiSeq	Unspecified	Q96P68	OXGR1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.186)		4	288	-	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		15			Extracellular (Potential).		Q5T5A7|Q86TL1	Missense_Mutation	SNP	ENST00000298440.1	37	c.44C>A	CCDS9482.1	.	.	.	.	.	.	.	.	.	.	G	0.390	-0.924049	0.02377	.	.	ENSG00000165621	ENST00000298440;ENST00000543457;ENST00000541518;ENST00000541038	T;T;T;T	0.38077	1.16;1.16;1.16;1.16	5.7	3.76	0.43208	.	0.730829	0.12721	N	0.444663	T	0.16428	0.0395	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.23833	-1.0177	10	0.15499	T	0.54	.	5.9924	0.19474	0.1774:0.0:0.6001:0.2225	.	15	Q96P68	OXGR1_HUMAN	H	15	ENSP00000298440:P15H;ENSP00000438800:P15H;ENSP00000445269:P15H;ENSP00000437356:P15H	ENSP00000298440:P15H	P	-	2	0	OXGR1	96437971	0.000000	0.05858	0.545000	0.28153	0.430000	0.31655	0.463000	0.21972	1.382000	0.46385	0.655000	0.94253	CCC		0.403	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045521.3	NM_080818		18	88	1	0	1.28384e-07	0.00188189	4.71322e-07	18	88				
ABHD13	84945	broad.mit.edu	37	13	108881821	108881821	+	Silent	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:108881821A>G	ENST00000375898.3	+	2	556	c.255A>G	c.(253-255)ccA>ccG	p.P85P		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	85						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					CTGGCATTCCACATGAAAACA	0.378																																					Pancreas(22;506 789 38166 45896 51596)	Pancreas(22;506 789 38166 45896 51596)	uc001vqq.2		NA																	0		p.P85L(1)		ovary(2)|upper_aerodigestive_tract(1)	3						c.(253-255)CCA>CCG		abhydrolase domain containing 13							94.0	93.0	94.0					13																	108881821		2203	4299	6502	SO:0001819	synonymous_variant	84945					integral to membrane	hydrolase activity	g.chr13:108881821A>G	AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	ENST00000375898.3:c.255A>G	13.37:g.108881821A>G			Somatic					p.P85P	NM_032859	NP_116248	WXS	Illumina HiSeq	Unspecified	Q7L211	ABHDD_HUMAN			2	520	+	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)		85					B3KWE7|Q8NBW1|Q96JX9	Silent	SNP	ENST00000375898.3	37	c.255A>G	CCDS32007.1																																																																																				0.378	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045743.1	NM_032859		22	133	0	0	0	0.00332997	0	22	133				
NFKBIA	4792	broad.mit.edu	37	14	35873698	35873698	+	Silent	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr14:35873698C>T	ENST00000216797.5	-	1	254	c.153G>A	c.(151-153)gaG>gaA	p.E51E	NFKBIA_ENST00000557100.1_5'UTR|NFKBIA_ENST00000557140.1_Silent_p.E51E|NFKBIA_ENST00000557389.1_5'Flank	NM_020529.2	NP_065390.1	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	51					apoptotic process (GO:0006915)|cellular response to cold (GO:0070417)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|cytoplasmic sequestering of transcription factor (GO:0042994)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein import into nucleus, translocation (GO:0000060)|regulation of cell proliferation (GO:0042127)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to exogenous dsRNA (GO:0043330)|response to muramyl dipeptide (GO:0032495)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|nuclear localization sequence binding (GO:0008139)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(1)|large_intestine(2)|liver(1)	7	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	Acetylsalicylic acid(DB00945)	CGAGGCGGATCTCCTGCAGCT	0.677																																							uc001wtf.3		NA																	0				breast(2)	2						c.(151-153)GAG>GAA		nuclear factor of kappa light polypeptide gene							17.0	18.0	18.0					14																	35873698		2201	4297	6498	SO:0001819	synonymous_variant	4792				anti-apoptosis|apoptosis|cellular response to cold|cytoplasmic sequestering of NF-kappaB|innate immune response|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of DNA binding|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|I-kappaB/NF-kappaB complex|nucleus|plasma membrane	identical protein binding|NF-kappaB binding|nuclear localization sequence binding|ubiquitin protein ligase binding	g.chr14:35873698C>T		CCDS9656.1	14q13	2014-09-17			ENSG00000100906	ENSG00000100906		"""Ankyrin repeat domain containing"""	7797	protein-coding gene	gene with protein product		164008		NFKBI		1829648	Standard	NM_020529		Approved	IKBA, MAD-3, IkappaBalpha	uc001wtf.4	P25963	OTTHUMG00000140220	ENST00000216797.5:c.153G>A	14.37:g.35873698C>T			Somatic				NFKBIA_uc001wte.3_5'Flank|NFKBIA_uc001wtg.3_Silent_p.E51E|NFKBIA_uc010amo.2_RNA	p.E51E	NM_020529	NP_065390	WXS	Illumina HiSeq	Unspecified	P25963	IKBA_HUMAN	Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	1	263	-	Breast(36;0.0484)|Hepatocellular(127;0.158)		51	MVKELQEI->AAKEAQEA: No nuclear export.		Nuclear export signal.		B2R8L6	Silent	SNP	ENST00000216797.5	37	c.153G>A	CCDS9656.1																																																																																				0.677	NFKBIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276683.1	NM_020529		5	11	0	0	0	0.00116845	0	5	11				
RGS6	9628	broad.mit.edu	37	14	72939605	72939605	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr14:72939605G>A	ENST00000553530.1	+	9	769	c.562G>A	c.(562-564)Gaa>Aaa	p.E188K	RGS6_ENST00000555571.1_Missense_Mutation_p.E188K|RGS6_ENST00000404301.2_Missense_Mutation_p.E188K|RGS6_ENST00000554782.1_Missense_Mutation_p.E49K|RGS6_ENST00000402788.2_Missense_Mutation_p.E188K|RGS6_ENST00000407322.4_Missense_Mutation_p.E188K|RGS6_ENST00000343854.6_Missense_Mutation_p.E188K|RGS6_ENST00000434263.2_Missense_Mutation_p.E119K|RGS6_ENST00000556437.1_Missense_Mutation_p.E188K|RGS6_ENST00000355512.6_Missense_Mutation_p.E188K|RGS6_ENST00000406236.4_Missense_Mutation_p.E188K|RGS6_ENST00000553690.1_3'UTR|RGS6_ENST00000553525.1_Missense_Mutation_p.E188K	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	188					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		AGACAAGACAGAAAGGAAAAT	0.398																																					Ovarian(143;1926 2468 21071 48641)	Ovarian(143;1926 2468 21071 48641)	uc001xna.3		NA																	0				upper_aerodigestive_tract(1)|lung(1)|skin(1)	3						c.(562-564)GAA>AAA		regulator of G-protein signalling 6							138.0	155.0	150.0					14																	72939605		2203	4300	6503	SO:0001583	missense	9628				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity	g.chr14:72939605G>A	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.562G>A	14.37:g.72939605G>A	ENSP00000452331:p.Glu188Lys		Somatic				RGS6_uc010ttn.1_Missense_Mutation_p.E188K|RGS6_uc001xmx.3_Missense_Mutation_p.E188K|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Missense_Mutation_p.E188K|RGS6_uc010ttp.1_Missense_Mutation_p.E119K|RGS6_uc001xmz.1_Missense_Mutation_p.E49K|RGS6_uc010arg.2_RNA	p.E188K	NM_004296	NP_004287	WXS	Illumina HiSeq	Unspecified	P49758	RGS6_HUMAN		all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)	9	1085	+			188					C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	ENST00000553530.1	37	c.562G>A	CCDS9808.1	.	.	.	.	.	.	.	.	.	.	G	36	5.882058	0.97062	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000343854;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T;T	0.38722	1.25;1.13;1.13;1.25;1.13;1.27;1.27;1.28;1.13;1.12;1.2;1.26	5.78	5.78	0.91487	.	0.043988	0.85682	D	0.000000	T	0.68044	0.2958	M	0.82323	2.585	0.80722	D	1	P;D;P;D	0.61697	0.85;0.99;0.85;0.982	P;D;B;P	0.64237	0.507;0.923;0.41;0.839	T	0.71728	-0.4505	10	0.87932	D	0	-16.8835	19.6166	0.95636	0.0:0.0:1.0:0.0	.	119;188;193;188	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	K	188;188;188;188;188;188;188;188;188;188;160;119;49;49	ENSP00000451030:E188K;ENSP00000450936:E188K;ENSP00000452331:E188K;ENSP00000451855:E188K;ENSP00000347699:E188K;ENSP00000385243:E188K;ENSP00000384218:E188K;ENSP00000384612:E188K;ENSP00000383953:E188K;ENSP00000341199:E188K;ENSP00000412144:E119K;ENSP00000451912:E49K	ENSP00000341199:E188K	E	+	1	0	RGS6	72009358	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.898000	0.92538	2.735000	0.93741	0.650000	0.86243	GAA		0.398	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2			68	154	0	0	0	0.00361006	0	68	154				
YLPM1	56252	broad.mit.edu	37	14	75264921	75264921	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr14:75264921C>T	ENST00000325680.7	+	5	3045	c.2921C>T	c.(2920-2922)tCa>tTa	p.S974L	YLPM1_ENST00000238571.3_Missense_Mutation_p.S779L|YLPM1_ENST00000552421.1_Intron	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	779	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GTAGCAACATCATCATTAACA	0.448																																							uc001xqj.3		NA																	0				ovary(2)|pancreas(1)	3						c.(2920-2922)TCA>TTA		YLP motif containing 1							88.0	89.0	88.0					14																	75264921		1917	4133	6050	SO:0001583	missense	56252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck		g.chr14:75264921C>T	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.2921C>T	14.37:g.75264921C>T	ENSP00000324463:p.Ser974Leu		Somatic				YLPM1_uc001xql.3_RNA	p.S974L	NM_019589	NP_062535	WXS	Illumina HiSeq	Unspecified	P49750	YLPM1_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)	5	3045	+			779					P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000325680.7	37	c.2921C>T	CCDS45135.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897808	0.33535	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	4.95	4.95	0.65309	.	0.641577	0.14590	N	0.310296	T	0.39784	0.1091	N	0.22421	0.69	0.28966	N	0.889557	B	0.30634	0.288	B	0.33690	0.168	T	0.29761	-1.0001	9	0.29301	T	0.29	-3.891	18.1476	0.89662	0.0:1.0:0.0:0.0	.	974	P49750-4	.	L	974;779;687	.	ENSP00000238571:S779L	S	+	2	0	YLPM1	74334674	0.023000	0.18921	1.000000	0.80357	0.962000	0.63368	2.255000	0.43222	2.453000	0.82957	0.643000	0.83706	TCA		0.448	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404451.1	NM_019589		22	36	0	0	0	0.00395357	0	22	36				
TSHR	7253	broad.mit.edu	37	14	81610628	81610628	+	Silent	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr14:81610628T>A	ENST00000541158.2	+	11	2548	c.2226T>A	c.(2224-2226)atT>atA	p.I742I	TSHR_ENST00000298171.2_Silent_p.I742I|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	742					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)			breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	ATGAACTGATTGAAAACTCCC	0.438			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																																uc001xvd.1		NA	yes	Dom	yes		14	14q31	7253	Mis	thyroid stimulating hormone receptor	yes	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 	E		thyroid  adenoma	toxic thyroid adenoma		0				thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299						c.(2224-2226)ATT>ATA		thyroid stimulating hormone receptor isoform 1	Thyrotropin Alfa(DB00024)						112.0	105.0	107.0					14																	81610628		2203	4300	6503	SO:0001819	synonymous_variant	7253				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity	g.chr14:81610628T>A	AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.2226T>A	14.37:g.81610628T>A			Somatic					p.I742I	NM_000369	NP_000360	WXS	Illumina HiSeq	Unspecified	P16473	TSHR_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0402)	10	2382	+			742			Cytoplasmic (Potential).		A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Silent	SNP	ENST00000541158.2	37	c.2226T>A	CCDS9872.1																																																																																				0.438	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369		38	67	0	0	0	0.00195071	0	38	67				
EML5	161436	broad.mit.edu	37	14	89091321	89091321	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr14:89091321C>G	ENST00000380664.5	-	34	4866	c.4867G>C	c.(4867-4869)Gaa>Caa	p.E1623Q	EML5_ENST00000554922.1_Missense_Mutation_p.E1631Q|EML5_ENST00000553320.1_5'UTR|EML5_ENST00000352093.5_Missense_Mutation_p.E1585Q			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1623						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CACGGCCTTTCCTTTCCCCCA	0.453																																							uc001xxg.2		NA																	0				ovary(3)	3						c.(4891-4893)GAA>CAA		echinoderm microtubule associated protein like							60.0	60.0	60.0					14																	89091321		1963	4158	6121	SO:0001583	missense	161436					cytoplasm|microtubule		g.chr14:89091321C>G	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.4867G>C	14.37:g.89091321C>G	ENSP00000370039:p.Glu1623Gln		Somatic				EML5_uc001xxf.2_Missense_Mutation_p.E418Q|EML5_uc001xxh.1_Missense_Mutation_p.E762Q	p.E1631Q	NM_183387	NP_899243	WXS	Illumina HiSeq	Unspecified	Q05BV3	EMAL5_HUMAN			36	5077	-			1623			WD 24.		B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	37	c.4891G>C	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	C	31	5.072876	0.93950	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664;ENST00000555823	T;T;T;T	0.57595	0.96;0.7;1.0;0.39	5.01	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);	0.112728	0.64402	D	0.000011	T	0.69593	0.3128	L	0.56769	1.78	0.58432	D	0.999991	D;D	0.89917	0.995;1.0	D;D	0.72625	0.962;0.978	T	0.69989	-0.4995	10	0.51188	T	0.08	-29.3256	18.5013	0.90882	0.0:1.0:0.0:0.0	.	1631;1623	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	Q	1631;1585;1623;72	ENSP00000451998:E1631Q;ENSP00000298315:E1585Q;ENSP00000370039:E1623Q;ENSP00000452030:E72Q	ENSP00000298315:E1585Q	E	-	1	0	EML5	88161074	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.171000	0.77595	2.612000	0.88384	0.561000	0.74099	GAA		0.453	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1			9	17	0	0	0	0.00448238	0	9	17				
SLC12A6	9990	broad.mit.edu	37	15	34528271	34528271	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr15:34528271G>A	ENST00000354181.3	-	24	3664	c.3172C>T	c.(3172-3174)Cgg>Tgg	p.R1058W	SLC12A6_ENST00000560611.1_Missense_Mutation_p.R1058W|SLC12A6_ENST00000558667.1_Missense_Mutation_p.R1058W|SLC12A6_ENST00000397707.2_Missense_Mutation_p.R1043W|SLC12A6_ENST00000560164.1_Missense_Mutation_p.R870W|SLC12A6_ENST00000558589.1_Missense_Mutation_p.R1049W|SLC12A6_ENST00000397702.2_Missense_Mutation_p.R999W|SLC12A6_ENST00000451844.2_Missense_Mutation_p.R870W|SLC12A6_ENST00000458406.2_Missense_Mutation_p.R999W|SLC12A6_ENST00000290209.5_Missense_Mutation_p.R1007W			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	1058					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	TTTTGTCCCCGGGATGCCATG	0.458																																							uc001zhw.2		NA																	0				central_nervous_system(5)|ovary(1)|skin(1)	7						c.(3172-3174)CGG>TGG		solute carrier family 12, member 6 isoform a	Potassium Chloride(DB00761)						248.0	195.0	213.0					15																	34528271		2201	4298	6499	SO:0001583	missense	9990				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity	g.chr15:34528271G>A	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.3172C>T	15.37:g.34528271G>A	ENSP00000346112:p.Arg1058Trp		Somatic				SLC12A6_uc001zhv.2_Missense_Mutation_p.R1007W|SLC12A6_uc001zhx.2_Missense_Mutation_p.R1043W|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.R999W|SLC12A6_uc001zib.2_Missense_Mutation_p.R1049W|SLC12A6_uc001zic.2_Missense_Mutation_p.R1058W|SLC12A6_uc010bau.2_Missense_Mutation_p.R1058W|SLC12A6_uc001zid.2_Missense_Mutation_p.R999W|SLC12A6_uc001zht.2_RNA|SLC12A6_uc001zhu.2_Missense_Mutation_p.R870W	p.R1058W	NM_133647	NP_598408	WXS	Illumina HiSeq	Unspecified	Q9UHW9	S12A6_HUMAN		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	23	3336	-		all_lung(180;2.78e-08)	1058			Cytoplasmic (Potential).		A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	c.3172C>T	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375855	0.61735	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	5.21	5.21	0.72293	.	0.208191	0.39475	N	0.001355	T	0.40694	0.1127	L	0.55481	1.735	0.58432	D	0.999999	B;B;B;B	0.30741	0.002;0.031;0.293;0.018	B;B;B;B	0.22880	0.013;0.006;0.042;0.009	T	0.39800	-0.9596	10	0.66056	D	0.02	.	17.536	0.87832	0.0:0.0:1.0:0.0	.	1043;1058;1007;870	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	W	1007;1043;1049;999;999;870	ENSP00000290209:R1007W;ENSP00000380819:R1043W;ENSP00000380814:R999W;ENSP00000387725:R999W;ENSP00000390199:R870W	ENSP00000290209:R1007W	R	-	1	2	SLC12A6	32315563	0.985000	0.35326	1.000000	0.80357	0.991000	0.79684	2.167000	0.42415	2.448000	0.82819	0.557000	0.71058	CGG		0.458	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135		8	83	0	0	0	0.00307968	0	8	83				
FBN1	2200	broad.mit.edu	37	15	48808532	48808532	+	Missense_Mutation	SNP	G	G	A	rs534127494		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr15:48808532G>A	ENST00000316623.5	-	11	1630	c.1175C>T	c.(1174-1176)cCt>cTt	p.P392L		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	392					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AATTACCATAGGAACAGAGCA	0.483																																							uc001zwx.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(1174-1176)CCT>CTT		fibrillin 1 precursor							64.0	67.0	66.0					15																	48808532		2197	4296	6493	SO:0001583	missense	2200				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding	g.chr15:48808532G>A	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.1175C>T	15.37:g.48808532G>A	ENSP00000325527:p.Pro392Leu		Somatic					p.P392L	NM_000138	NP_000129	WXS	Illumina HiSeq	Unspecified	P35555	FBN1_HUMAN		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)	11	1503	-		all_lung(180;0.00279)	392					B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	c.1175C>T	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.303686	0.23736	.	.	ENSG00000166147	ENST00000316623	D	0.81996	-1.56	5.54	5.54	0.83059	Matrix fibril-associated (1);	0.298933	0.37857	N	0.001918	T	0.74741	0.3756	L	0.38175	1.15	0.80722	D	1	B	0.30793	0.295	B	0.26310	0.068	T	0.69903	-0.5019	10	0.16420	T	0.52	.	16.3373	0.83068	0.0:0.0:1.0:0.0	.	392	P35555	FBN1_HUMAN	L	392	ENSP00000325527:P392L	ENSP00000325527:P392L	P	-	2	0	FBN1	46595824	1.000000	0.71417	0.989000	0.46669	0.799000	0.45148	5.125000	0.64715	2.884000	0.98904	0.655000	0.94253	CCT		0.483	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1			15	34	0	0	0	0.00316338	0	15	34				
NTRK3	4916	broad.mit.edu	37	15	88476310	88476310	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr15:88476310C>A	ENST00000360948.2	-	15	1983	c.1822G>T	c.(1822-1824)Ggc>Tgc	p.G608C	NTRK3_ENST00000355254.2_Missense_Mutation_p.G608C|NTRK3_ENST00000357724.2_Missense_Mutation_p.G600C|NTRK3_ENST00000542733.2_Missense_Mutation_p.G510C|NTRK3_ENST00000557856.1_Missense_Mutation_p.G600C|NTRK3_ENST00000558676.1_Missense_Mutation_p.G600C|NTRK3_ENST00000394480.2_Missense_Mutation_p.G608C	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	608	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G608S(2)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TCCCCATCGCCGCACACTCCA	0.547			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	2	Substitution - Missense(2)	p.G608S(2)	large_intestine(1)|pancreas(1)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(1822-1824)GGC>TGC		neurotrophic tyrosine kinase, receptor, type 3							80.0	70.0	73.0					15																	88476310		2201	4299	6500	SO:0001583	missense	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88476310C>A	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1822G>T	15.37:g.88476310C>A	ENSP00000354207:p.Gly608Cys	TSP Lung(13;0.10)	Somatic				NTRK3_uc002bmh.2_Missense_Mutation_p.G600C|NTRK3_uc002bmf.1_Missense_Mutation_p.G608C|NTRK3_uc010upl.1_Missense_Mutation_p.G510C|NTRK3_uc010bnh.1_Missense_Mutation_p.G600C	p.G608C	NM_001012338	NP_001012338	WXS	Illumina HiSeq	Unspecified	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		15	1984	-			608			Cytoplasmic (Potential).|Protein kinase.		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	c.1822G>T	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481082	0.63849	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000343782	D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62	5.49	5.49	0.81192	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.053490	0.85682	D	0.000000	D	0.83843	0.5342	N	0.13043	0.29	0.80722	D	1	D;D;D;D;P	0.76494	0.99;0.999;0.978;0.999;0.954	D;D;D;P;P	0.64410	0.925;0.925;0.915;0.878;0.877	D	0.86854	0.2025	10	0.72032	D	0.01	.	18.3583	0.90365	0.0:1.0:0.0:0.0	.	510;600;600;608;608	B7Z7U4;E9PG56;B7Z4C5;Q16288-3;Q16288	.;.;.;.;NTRK3_HUMAN	C	608;608;600;608;510;104	ENSP00000377990:G608C;ENSP00000354207:G608C;ENSP00000350356:G600C;ENSP00000347397:G608C;ENSP00000437773:G510C	ENSP00000342792:G104C	G	-	1	0	NTRK3	86277314	0.999000	0.42202	0.163000	0.22734	0.295000	0.27426	5.898000	0.69838	2.574000	0.86865	0.650000	0.86243	GGC		0.547	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				10	21	1	0	0.000442599	0.000442599	0.0013229	10	21				
LINS	55180	broad.mit.edu	37	15	101109855	101109855	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr15:101109855C>A	ENST00000314742.8	-	7	2084	c.1862G>T	c.(1861-1863)cGg>cTg	p.R621L	LINS_ENST00000559149.1_5'Flank	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	621								p.R621fs*13(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						TTGAGAGGCCCGGGGGGAAGA	0.527																																							uc002bwe.2		NA																	1	Insertion - Frameshift(1)		large_intestine(1)		0						c.(1861-1863)CGG>CTG		lines homolog 1							70.0	73.0	72.0					15																	101109855		2203	4300	6503	SO:0001583	missense	55180							g.chr15:101109855C>A	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1862G>T	15.37:g.101109855C>A	ENSP00000318423:p.Arg621Leu		Somatic				LINS1_uc002bwd.2_Missense_Mutation_p.R208L|LINS1_uc002bwf.2_Missense_Mutation_p.R621L|LINS1_uc002bwg.2_Missense_Mutation_p.R621L|LINS1_uc002bwh.2_Missense_Mutation_p.R621L	p.R621L	NM_001040614	NP_001035704	WXS	Illumina HiSeq	Unspecified	Q8NG48	LINES_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00095)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		8	2153	-	Lung NSC(78;0.0018)|all_lung(78;0.00223)|Melanoma(26;0.00852)		621					Q96FW2|Q9NVQ3	Missense_Mutation	SNP	ENST00000314742.8	37	c.1862G>T	CCDS10385.1	.	.	.	.	.	.	.	.	.	.	C	11.96	1.793539	0.31685	.	.	ENSG00000140471	ENST00000314742	T	0.10860	2.83	5.05	-9.92	0.00455	.	1.446370	0.04605	N	0.399177	T	0.06371	0.0164	N	0.24115	0.695	0.09310	N	1	B	0.26195	0.144	B	0.22601	0.04	T	0.22243	-1.0222	10	0.40728	T	0.16	8.8895	9.4189	0.38539	0.0:0.2745:0.1847:0.5407	.	621	Q8NG48	LINES_HUMAN	L	621	ENSP00000318423:R621L	ENSP00000318423:R621L	R	-	2	0	LINS	98927378	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-3.608000	0.00416	-2.368000	0.00604	-0.918000	0.02743	CGG		0.527	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148		5	64	1	0	0.00116845	0.00116845	0.00343167	5	64				
CRAMP1L	57585	broad.mit.edu	37	16	1718043	1718043	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:1718043G>C	ENST00000397412.3	+	18	3282	c.3183G>C	c.(3181-3183)gaG>gaC	p.E1061D	CRAMP1L_ENST00000262317.4_Missense_Mutation_p.E439D|CRAMP1L_ENST00000293925.5_Missense_Mutation_p.E1061D|LA16c-431H6.6_ENST00000454337.1_3'UTR|CRAMP1L_ENST00000436138.3_Missense_Mutation_p.E1058D			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	1061						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						CCTCGTCAGAGAGCTCCAGCA	0.617																																							uc010uvh.1		NA																	0					0						c.(3181-3183)GAG>GAC		Crm, cramped-like							43.0	44.0	44.0					16																	1718043		2079	4227	6306	SO:0001583	missense	57585					nucleus	DNA binding	g.chr16:1718043G>C	AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.3183G>C	16.37:g.1718043G>C	ENSP00000380559:p.Glu1061Asp		Somatic				CRAMP1L_uc002cmf.2_RNA	p.E1061D	NM_020825	NP_065876	WXS	Illumina HiSeq	Unspecified	Q96RY5	CRML_HUMAN			17	3183	+			1061					A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Missense_Mutation	SNP	ENST00000397412.3	37	c.3183G>C	CCDS10440.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.04|13.04	2.119763|2.119763	0.37436|0.37436	.|.	.|.	ENSG00000007545|ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138;ENST00000262317|ENST00000415022	.|.	.|.	.|.	5.86|5.86	2.3|2.3	0.28687|0.28687	.|.	0.116715|0.116715	0.56097|0.56097	D|D	0.000025|0.000025	T|T	0.34774|0.34774	0.0909|0.0909	L|L	0.29908|0.29908	0.895|0.895	0.24000|0.24000	N|N	0.996214|0.996214	P|.	0.48230|.	0.907|.	P|.	0.50708|.	0.648|.	T|T	0.20306|0.20306	-1.0279|-1.0279	9|7	0.34782|0.51188	T|T	0.22|0.08	-35.5188|-35.5188	10.0633|10.0633	0.42288|0.42288	0.3952:0.0:0.6047:0.0|0.3952:0.0:0.6047:0.0	.|.	1061|.	Q96RY5|.	CRML_HUMAN|.	D|Q	1061;1061;1058;439|162	.|.	ENSP00000262317:E439D|ENSP00000399172:E162Q	E|E	+|+	3|1	2|0	CRAMP1L|CRAMP1L	1658044|1658044	0.990000|0.990000	0.36364|0.36364	0.053000|0.053000	0.19242|0.19242	0.029000|0.029000	0.11900|0.11900	1.227000|1.227000	0.32576|0.32576	0.302000|0.302000	0.22762|0.22762	0.650000|0.650000	0.86243|0.86243	GAG|GAG		0.617	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4			3	21	0	0	0	6.4e-05	0	3	21				
ABCC6	368	broad.mit.edu	37	16	16276354	16276354	+	Missense_Mutation	SNP	C	C	A	rs72650701		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:16276354C>A	ENST00000205557.7	-	17	2191	c.2162G>T	c.(2161-2163)tGg>tTg	p.W721L	ABCC6_ENST00000574094.1_Intron	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	721	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	TCTCTCCAGCCAGGGTGGGTC	0.592																																							uc002den.3		NA																	0				skin(2)|ovary(1)	3	GRCh37	CM053090	ABCC6	M	rs72650701	c.(2161-2163)TGG>TTG		ATP-binding cassette, sub-family C, member 6							78.0	71.0	74.0					16																	16276354		2197	4300	6497	SO:0001583	missense	368				response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:16276354C>A	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.2162G>T	16.37:g.16276354C>A	ENSP00000205557:p.Trp721Leu		Somatic				ABCC6_uc010bvo.2_RNA	p.W721L	NM_001171	NP_001162	WXS	Illumina HiSeq	Unspecified	O95255	MRP6_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	17	2199	-			721			ABC transporter 1.|Cytoplasmic (By similarity).		A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	37	c.2162G>T	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	C	9.132	1.011743	0.19277	.	.	ENSG00000091262	ENST00000205557;ENST00000456970	D;D	0.93604	-3.25;-3.25	4.62	4.62	0.57501	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.46758	U	0.000275	D	0.87513	0.6196	N	0.04387	-0.21	0.80722	D	1	P	0.49307	0.922	P	0.54060	0.741	D	0.84483	0.0606	10	0.11485	T	0.65	.	11.493	0.50391	0.1798:0.8202:0.0:0.0	.	721	O95255	MRP6_HUMAN	L	721	ENSP00000205557:W721L;ENSP00000405002:W721L	ENSP00000205557:W721L	W	-	2	0	ABCC6	16183855	1.000000	0.71417	0.966000	0.40874	0.199000	0.23934	4.354000	0.59417	2.113000	0.64589	0.491000	0.48974	TGG		0.592	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2			11	28	1	0	0.000673444	0.000673444	0.00199523	11	28				
ACSM5	54988	broad.mit.edu	37	16	20441082	20441082	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:20441082A>T	ENST00000331849.4	+	8	1231	c.1084A>T	c.(1084-1086)Act>Tct	p.T362S		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	362					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						GAAACACCAGACTGGTGTGGA	0.592																																							uc002dhe.2		NA																	0				ovary(2)	2						c.(1084-1086)ACT>TCT		acyl-CoA synthetase medium-chain family member 5							84.0	88.0	87.0					16																	20441082		2203	4300	6503	SO:0001583	missense	54988				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20441082A>T		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1084A>T	16.37:g.20441082A>T	ENSP00000327916:p.Thr362Ser		Somatic					p.T362S	NM_017888	NP_060358	WXS	Illumina HiSeq	Unspecified	Q6NUN0	ACSM5_HUMAN			8	1231	+			362					Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	c.1084A>T	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	A	10.42	1.345023	0.24426	.	.	ENSG00000183549	ENST00000331849	T	0.40756	1.02	4.44	3.31	0.37934	AMP-dependent synthetase/ligase (1);	0.224024	0.31082	N	0.008299	T	0.44540	0.1298	M	0.73372	2.23	0.33182	D	0.549736	B	0.26512	0.151	B	0.34991	0.193	T	0.56098	-0.8035	10	0.66056	D	0.02	-3.6019	8.6325	0.33928	0.8997:0.0:0.1003:0.0	.	362	Q6NUN0	ACSM5_HUMAN	S	362	ENSP00000327916:T362S	ENSP00000327916:T362S	T	+	1	0	ACSM5	20348583	0.995000	0.38212	0.475000	0.27278	0.057000	0.15508	5.538000	0.67193	0.626000	0.30322	0.455000	0.32223	ACT		0.592	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		4	38	0	0	0	0.000602214	0	4	38				
ACSM2A	123876	broad.mit.edu	37	16	20482880	20482880	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:20482880G>C	ENST00000573854.1	+	6	877	c.763G>C	c.(763-765)Gat>Cat	p.D255H	ACSM2A_ENST00000417235.2_Missense_Mutation_p.D176H|ACSM2A_ENST00000396104.2_Missense_Mutation_p.D255H|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000575690.1_Missense_Mutation_p.D255H|ACSM2A_ENST00000536134.1_Missense_Mutation_p.D27H|ACSM2A_ENST00000219054.6_Missense_Mutation_p.D255H	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	255					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						GCAAGCCTCTGATATAATGTG	0.458																																							uc010bwe.2		NA																	0				skin(2)|breast(1)	3						c.(763-765)GAT>CAT		acyl-CoA synthetase medium-chain family member							150.0	142.0	144.0					16																	20482880		2203	4298	6501	SO:0001583	missense	123876				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding	g.chr16:20482880G>C	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.763G>C	16.37:g.20482880G>C	ENSP00000459451:p.Asp255His		Somatic				ACSM2A_uc010bwd.1_RNA|ACSM2A_uc010vax.1_Missense_Mutation_p.D176H|ACSM2A_uc002dhf.3_Missense_Mutation_p.D255H|ACSM2A_uc002dhg.3_Missense_Mutation_p.D255H|ACSM2A_uc010vay.1_Missense_Mutation_p.D176H	p.D255H	NM_001010845	NP_001010845	WXS	Illumina HiSeq	Unspecified	Q08AH3	ACS2A_HUMAN			7	1002	+			255					B3KTT9|O75202	Missense_Mutation	SNP	ENST00000573854.1	37	c.763G>C	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202387	0.58234	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	3.51	3.51	0.40186	AMP-dependent synthetase/ligase (1);	0.143106	0.32120	N	0.006546	T	0.79986	0.4541	M	0.92970	3.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.85178	0.1002	10	0.87932	D	0	-16.5625	13.0354	0.58867	0.0:0.0:1.0:0.0	.	176;255	B7Z8R0;Q08AH3	.;ACS2A_HUMAN	H	176;255;27;255	ENSP00000392169:D176H;ENSP00000219054:D255H;ENSP00000445082:D27H;ENSP00000379411:D255H	ENSP00000219054:D255H	D	+	1	0	ACSM2A	20390381	1.000000	0.71417	0.495000	0.27527	0.086000	0.17979	5.238000	0.65366	1.796000	0.52611	0.298000	0.19748	GAT		0.458	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845		22	118	0	0	0	0.0024448	0	22	118				
DNAH3	55567	broad.mit.edu	37	16	21048036	21048036	+	Splice_Site	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:21048036C>A	ENST00000261383.3	-	35	5084	c.5085G>T	c.(5083-5085)caG>caT	p.Q1695H	DNAH3_ENST00000415178.1_Splice_Site_p.Q1695H	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1695	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AGGAACCAACCTGGATAATTT	0.383																																							uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(5083-5085)CAG>CAT		dynein, axonemal, heavy chain 3							104.0	96.0	99.0					16																	21048036		2201	4300	6501	SO:0001630	splice_region_variant	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:21048036C>A	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.5085+1G>T	16.37:g.21048036C>A			Somatic					p.Q1695H	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	35	5085	-			1695			AAA 2 (By similarity).		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.5085G>T	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938925	0.73557	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.39997	1.05;1.17	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000001	T	0.76263	0.3963	H	0.95745	3.715	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.83734	0.0200	9	.	.	.	.	19.4307	0.94765	0.0:1.0:0.0:0.0	.	1695	Q8TD57	DYH3_HUMAN	H	1695	ENSP00000261383:Q1695H;ENSP00000394245:Q1695H	.	Q	-	3	2	DNAH3	20955537	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.696000	0.68287	2.663000	0.90544	0.563000	0.77884	CAG		0.383	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	Missense_Mutation	18	55	1	0	2.94398e-08	0.000958276	1.12354e-07	18	55				
DNAH3	55567	broad.mit.edu	37	16	21073854	21073854	+	Silent	SNP	C	C	A	rs376257072		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:21073854C>A	ENST00000261383.3	-	25	3668	c.3669G>T	c.(3667-3669)tcG>tcT	p.S1223S	DNAH3_ENST00000415178.1_Silent_p.S1223S	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1223	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTTCTTTTTCCGAGCTGATCA	0.428																																							uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(3667-3669)TCG>TCT		dynein, axonemal, heavy chain 3							159.0	148.0	152.0					16																	21073854		2201	4300	6501	SO:0001819	synonymous_variant	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:21073854C>A	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3669G>T	16.37:g.21073854C>A			Somatic					p.S1223S	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	25	3669	-			1223			Stem (By similarity).		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	37	c.3669G>T	CCDS10594.1																																																																																				0.428	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		24	111	1	0	1.85244e-09	0.00332997	7.40428e-09	24	111				
CDH16	1014	broad.mit.edu	37	16	66950032	66950032	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:66950032A>T	ENST00000299752.4	-	5	553	c.360T>A	c.(358-360)aaT>aaA	p.N120K	CDH16_ENST00000570262.1_Missense_Mutation_p.N40K|CDH16_ENST00000394055.3_Missense_Mutation_p.N120K|CDH16_ENST00000568632.1_Missense_Mutation_p.N120K|CDH16_ENST00000565796.1_Missense_Mutation_p.N120K	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	120	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		GCACCTGGTCATTCTCATCCT	0.577																																							uc002eql.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(358-360)AAT>AAA		cadherin 16 precursor							123.0	103.0	110.0					16																	66950032		2200	4300	6500	SO:0001583	missense	1014				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr16:66950032A>T	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.360T>A	16.37:g.66950032A>T	ENSP00000299752:p.Asn120Lys		Somatic				CDH16_uc010cdy.2_Missense_Mutation_p.N120K|CDH16_uc002eqm.2_Missense_Mutation_p.N120K	p.N120K	NM_004062	NP_004053	WXS	Illumina HiSeq	Unspecified	O75309	CAD16_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)	5	433	-		Ovarian(137;0.0563)	120			Extracellular (Potential).|Cadherin 1.		B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	ENST00000299752.4	37	c.360T>A	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.712220	0.30322	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.70869	-0.52;-0.52	4.89	0.134	0.14771	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.84142	0.5407	H	0.97564	4.03	0.48395	D	0.999642	D;P;D	0.56521	0.976;0.841;0.959	P;B;P	0.56474	0.799;0.197;0.655	T	0.82794	-0.0281	10	0.87932	D	0	-15.748	7.4772	0.27382	0.65:0.0:0.35:0.0	.	120;120;120	O75309-2;B2R7S8;O75309	.;.;CAD16_HUMAN	K	120;120;84	ENSP00000377619:N120K;ENSP00000299752:N120K	ENSP00000299752:N120K	N	-	3	2	CDH16	65507533	0.831000	0.29352	0.997000	0.53966	0.882000	0.50991	-0.546000	0.06062	-0.158000	0.11040	0.443000	0.29094	AAT		0.577	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062		7	32	0	0	0	0.00307968	0	7	32				
PLEKHG4	25894	broad.mit.edu	37	16	67320659	67320659	+	Missense_Mutation	SNP	T	T	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:67320659T>C	ENST00000360461.5	+	16	5297	c.2762T>C	c.(2761-2763)cTc>cCc	p.L921P	PLEKHG4_ENST00000450733.1_Missense_Mutation_p.L840P|PLEKHG4_ENST00000379344.3_Missense_Mutation_p.L921P|PLEKHG4_ENST00000427155.2_Missense_Mutation_p.L921P	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	921	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		CAGGTTAACCTCAAGGAACAG	0.602																																							uc002eso.3		NA																	0				skin(1)|pancreas(1)	2						c.(2761-2763)CTC>CCC		pleckstrin homology domain containing, family G							33.0	38.0	37.0					16																	67320659		2198	4300	6498	SO:0001583	missense	25894				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr16:67320659T>C	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.2762T>C	16.37:g.67320659T>C	ENSP00000353646:p.Leu921Pro		Somatic				PLEKHG4_uc002esp.3_Missense_Mutation_p.L728P|PLEKHG4_uc002esq.3_Missense_Mutation_p.L921P|PLEKHG4_uc010cef.2_Missense_Mutation_p.L921P|PLEKHG4_uc002ess.3_Missense_Mutation_p.L921P|PLEKHG4_uc010ceg.2_Missense_Mutation_p.L840P	p.L921P	NM_015432	NP_056247	WXS	Illumina HiSeq	Unspecified	Q58EX7	PKHG4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)	16	5297	+			921			PH.		Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Missense_Mutation	SNP	ENST00000360461.5	37	c.2762T>C	CCDS32466.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.253234	0.80135	.	.	ENSG00000196155	ENST00000360461;ENST00000427155;ENST00000379344;ENST00000450733	T;T;T;T	0.17054	2.3;2.3;2.3;2.3	4.62	4.62	0.57501	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.30347	N	0.009840	T	0.49575	0.1565	M	0.91663	3.23	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.61758	-0.6997	10	0.87932	D	0	.	13.4932	0.61408	0.0:0.0:0.0:1.0	.	840;921	Q58EX7-2;Q58EX7	.;PKHG4_HUMAN	P	921;921;921;840	ENSP00000353646:L921P;ENSP00000401118:L921P;ENSP00000368649:L921P;ENSP00000398030:L840P	ENSP00000353646:L921P	L	+	2	0	PLEKHG4	65878160	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	6.207000	0.72159	1.858000	0.53909	0.260000	0.18958	CTC		0.602	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432		4	12	0	0	0	0.00024832	0	4	12				
SF3B3	23450	broad.mit.edu	37	16	70595659	70595659	+	Missense_Mutation	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:70595659A>G	ENST00000302516.5	+	17	2471	c.2260A>G	c.(2260-2262)Att>Gtt	p.I754V		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	754					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				TCCCGAGGGCATTGTGGCCAT	0.527																																							uc002ezf.2		NA																	0				ovary(1)	1						c.(2260-2262)ATT>GTT		splicing factor 3b, subunit 3							145.0	119.0	128.0					16																	70595659		2198	4300	6498	SO:0001583	missense	23450				protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding	g.chr16:70595659A>G	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2260A>G	16.37:g.70595659A>G	ENSP00000305790:p.Ile754Val		Somatic					p.I754V	NM_012426	NP_036558	WXS	Illumina HiSeq	Unspecified	Q15393	SF3B3_HUMAN			17	2471	+		Ovarian(137;0.0694)	754					Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	c.2260A>G	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	A	13.27	2.185959	0.38609	.	.	ENSG00000189091	ENST00000302516	T	0.33438	1.41	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.23649	0.0572	L	0.28054	0.825	0.80722	D	1	B	0.09022	0.002	B	0.12837	0.008	T	0.06006	-1.0851	10	0.18276	T	0.48	-9.9876	16.3426	0.83092	1.0:0.0:0.0:0.0	.	754	Q15393	SF3B3_HUMAN	V	754	ENSP00000305790:I754V	ENSP00000305790:I754V	I	+	1	0	SF3B3	69153160	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.229000	0.95273	2.317000	0.78254	0.460000	0.39030	ATT		0.527	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426		16	53	0	0	0	0.00400662	0	16	53				
ADAMTS18	170692	broad.mit.edu	37	16	77401440	77401440	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:77401440C>A	ENST00000282849.5	-	4	1094	c.676G>T	c.(676-678)Ggt>Tgt	p.G226C	ADAMTS18_ENST00000567121.1_5'UTR	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	226					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						GGGGAGTAACCAGGATAATTC	0.537																																							uc002ffc.3		NA																	0				large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						c.(676-678)GGT>TGT		ADAM metallopeptidase with thrombospondin type 1							83.0	76.0	78.0					16																	77401440		2198	4300	6498	SO:0001583	missense	170692				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr16:77401440C>A	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.676G>T	16.37:g.77401440C>A	ENSP00000282849:p.Gly226Cys		Somatic				ADAMTS18_uc002ffe.1_5'UTR|ADAMTS18_uc010vni.1_RNA	p.G226C	NM_199355	NP_955387	WXS	Illumina HiSeq	Unspecified	Q8TE60	ATS18_HUMAN			4	1095	-			226					Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	c.676G>T	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120608	0.56613	.	.	ENSG00000140873	ENST00000282849;ENST00000449265	T;T	0.60548	0.18;2.75	4.57	3.62	0.41486	.	0.479540	0.21464	N	0.074106	T	0.56046	0.1959	L	0.51422	1.61	0.09310	N	0.999999	P	0.52061	0.95	P	0.48189	0.57	T	0.50659	-0.8802	10	0.56958	D	0.05	.	9.9556	0.41663	0.0:0.9061:0.0:0.0939	.	226	Q8TE60	ATS18_HUMAN	C	226	ENSP00000282849:G226C;ENSP00000392540:G226C	ENSP00000282849:G226C	G	-	1	0	ADAMTS18	75958941	0.111000	0.22076	0.345000	0.25642	0.878000	0.50629	3.154000	0.50693	1.153000	0.42468	0.555000	0.69702	GGT		0.537	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			11	30	1	0	0.00010058	0.00136819	0.000314545	11	30				
GAN	8139	broad.mit.edu	37	16	81388292	81388292	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr16:81388292G>T	ENST00000568107.2	+	3	727	c.565G>T	c.(565-567)Gtt>Ttt	p.V189F		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	189	BACK.				cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.V189F(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				GAAGTTAAACGTTGGCAATGA	0.383																																					GBM(106;1239 1507 7582 9741 33976)	GBM(106;1239 1507 7582 9741 33976)	uc002fgo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(565-567)GTT>TTT		gigaxonin							81.0	79.0	80.0					16																	81388292		2202	4300	6502	SO:0001583	missense	8139				cell death	cytoplasm|neurofilament	protein binding	g.chr16:81388292G>T	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.565G>T	16.37:g.81388292G>T	ENSP00000476795:p.Val189Phe		Somatic					p.V189F	NM_022041	NP_071324	WXS	Illumina HiSeq	Unspecified	Q9H2C0	GAN_HUMAN			3	713	+		Colorectal(91;0.153)	189			BACK.			Missense_Mutation	SNP	ENST00000568107.2	37	c.565G>T	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512064	0.85389	.	.	ENSG00000127688	ENST00000248272	T	0.73575	-0.76	5.8	5.8	0.92144	BTB/Kelch-associated (2);	0.051565	0.85682	D	0.000000	D	0.90283	0.6961	M	0.93939	3.475	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	D	0.92006	0.5614	10	0.87932	D	0	.	20.0637	0.97700	0.0:0.0:1.0:0.0	.	189	Q9H2C0	GAN_HUMAN	F	189	ENSP00000248272:V189F	ENSP00000248272:V189F	V	+	1	0	GAN	79945793	1.000000	0.71417	0.964000	0.40570	0.971000	0.66376	7.600000	0.82769	2.751000	0.94390	0.650000	0.86243	GTT		0.383	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3			29	75	1	0	9.39395e-14	0.00106085	4.30211e-13	29	75				
TP53	7157	broad.mit.edu	37	17	7577570	7577570	+	Missense_Mutation	SNP	C	C	T	rs587782664		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:7577570C>T	ENST00000269305.4	-	7	900	c.711G>A	c.(709-711)atG>atA	p.M237I	TP53_ENST00000359597.4_Missense_Mutation_p.M237I|TP53_ENST00000455263.2_Missense_Mutation_p.M237I|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.M237I|TP53_ENST00000420246.2_Missense_Mutation_p.M237I|TP53_ENST00000445888.2_Missense_Mutation_p.M237I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	237	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M237I(109)|p.0?(8)|p.?(5)|p.M144I(4)|p.M237_N239delMCN(4)|p.Y236_M237delYM(1)|p.H233fs*6(1)|p.M144_N146delMCN(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.H233_C242del10(1)|p.M237fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACTGTTACACATGTAGTTGT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		139	Substitution - Missense(113)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)|Insertion - In frame(1)	p.M237I(99)|p.M237K(8)|p.0?(7)|p.M237V(6)|p.M237fs*10(4)|p.M237R(3)|p.M237T(2)|p.M237L(2)|p.Y236_M237delYM(1)|p.Y236_M237insXX(1)|p.M237_N239delMCN(1)|p.H233fs*6(1)|p.M144I(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.Y236_M237>*L(1)|p.H233_C242del10(1)|p.M237fs*1(1)	upper_aerodigestive_tract(23)|ovary(22)|lung(18)|breast(18)|central_nervous_system(11)|haematopoietic_and_lymphoid_tissue(9)|large_intestine(9)|stomach(6)|biliary_tract(5)|bone(5)|oesophagus(4)|urinary_tract(3)|pancreas(2)|thyroid(1)|testis(1)|soft_tissue(1)|liver(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM011014	TP53	M		c.(709-711)ATG>ATA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							130.0	102.0	112.0					17																	7577570		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577570C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.711G>A	17.37:g.7577570C>T	ENSP00000269305:p.Met237Ile	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.M237I|TP53_uc002gih.2_Missense_Mutation_p.M237I|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.M105I|TP53_uc010cng.1_Missense_Mutation_p.M105I|TP53_uc002gii.1_Missense_Mutation_p.M105I|TP53_uc010cnh.1_Missense_Mutation_p.M237I|TP53_uc010cni.1_Missense_Mutation_p.M237I|TP53_uc002gij.2_Missense_Mutation_p.M237I|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.M144I|TP53_uc002gio.2_Missense_Mutation_p.M105I	p.M237I	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	905	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	237		M -> L (in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.711G>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.343240	0.82022	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.09	3.12	0.35913	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	M	0.86953	2.85	0.54753	D	0.999983	D;D;D;D;D;D	0.89917	1.0;0.975;0.999;1.0;0.998;1.0	D;P;D;D;D;D	0.91635	0.999;0.864;0.999;0.999;0.999;0.998	D	0.97922	1.0315	10	0.72032	D	0.01	-32.6033	10.0519	0.42221	0.0:0.8993:0.0:0.1007	.	237;237;144;237;237;237	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	I	237;237;237;237;237;237;226;144;105;144	ENSP00000410739:M237I;ENSP00000352610:M237I;ENSP00000269305:M237I;ENSP00000398846:M237I;ENSP00000391127:M237I;ENSP00000391478:M237I;ENSP00000425104:M105I;ENSP00000423862:M144I	ENSP00000269305:M237I	M	-	3	0	TP53	7518295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	1.305000	0.44909	0.462000	0.41574	ATG		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		8	34	0	0	0	0.00448238	0	8	34				
FLCN	201163	broad.mit.edu	37	17	17122418	17122418	+	Missense_Mutation	SNP	G	G	T	rs138031155	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:17122418G>T	ENST00000285071.4	-	9	1431	c.977C>A	c.(976-978)cCg>cAg	p.P326Q	RP11-45M22.4_ENST00000427497.3_Intron	NM_144997.5	NP_659434.2	Q8NFG4	FLCN_HUMAN	folliculin	326					cell-cell junction assembly (GO:0007043)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in kidney development (GO:1901723)|negative regulation of energy homeostasis (GO:2000506)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of gene expression (GO:0010629)|negative regulation of mitochondrion organization (GO:0010823)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of gene expression (GO:0010628)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cytokinesis (GO:0032465)|regulation of histone acetylation (GO:0035065)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|regulation of TOR signaling (GO:0032006)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|stomach(1)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GGACTCTGCCGGGCCCTGGGT	0.627									Familial Non-VHL Clear Cell Renal Cancer;Birt-Hogg-Dub syndrome																														uc002gra.3		NA																	0				thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3						c.(976-978)CCG>CAG		folliculin isoform 1							90.0	105.0	100.0					17																	17122418		2203	4300	6503	SO:0001583	missense	201163	Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer	Familial Cancer Database	Familial Clear Cell Renal Cell Cancer, FcRCC, Familial Non-VHL Non-Papillary Clear Cell Renal Cancer;BHD, Fibrofolliculomas with Trichodiscomas and Acrochordons, incl.: Hornstein-Knickenberg syndrome, Perifollicular Fibromatosis	regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding	g.chr17:17122418G>T	AF517523	CCDS32579.1, CCDS32580.1	17p11.2	2014-09-17			ENSG00000154803	ENSG00000154803			27310	protein-coding gene	gene with protein product		607273					Standard	NM_144997		Approved	BHD, MGC17998, MGC23445	uc002gra.4	Q8NFG4	OTTHUMG00000059275	ENST00000285071.4:c.977C>A	17.37:g.17122418G>T	ENSP00000285071:p.Pro326Gln		Somatic				PLD6_uc010cpn.2_Intron	p.P326Q	NM_144997	NP_659434	WXS	Illumina HiSeq	Unspecified	Q8NFG4	FLCN_HUMAN			9	1481	-			326					A6NJJ8|Q6ZRX1|Q96BD2|Q96BE4	Missense_Mutation	SNP	ENST00000285071.4	37	c.977C>A	CCDS32579.1	.	.	.	.	.	.	.	.	.	.	G	2.585	-0.296510	0.05532	.	.	ENSG00000154803	ENST00000285071	D	0.92199	-2.99	5.83	3.86	0.44501	.	0.708628	0.14990	N	0.286739	D	0.87253	0.6131	L	0.44542	1.39	0.34726	D	0.729231	B	0.28082	0.2	B	0.27715	0.082	T	0.82808	-0.0274	10	0.12430	T	0.62	-17.2203	12.0847	0.53690	0.1378:0.0:0.8622:0.0	.	326	Q8NFG4	FLCN_HUMAN	Q	326	ENSP00000285071:P326Q	ENSP00000285071:P326Q	P	-	2	0	FLCN	17063143	0.995000	0.38212	0.002000	0.10522	0.002000	0.02628	2.427000	0.44740	0.814000	0.34374	0.655000	0.94253	CCG		0.627	FLCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131577.1	NM_144606		21	79	1	0	5.35356e-11	0.00278032	2.25316e-10	21	79				
ULK2	9706	broad.mit.edu	37	17	19687150	19687150	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:19687150C>A	ENST00000395544.4	-	22	2819	c.2320G>T	c.(2320-2322)Ggc>Tgc	p.G774C	ULK2_ENST00000361658.2_Missense_Mutation_p.G774C	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	774					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					AAGCCTGGGCCAGGCGGGGAC	0.642																																							uc002gwm.3		NA																	0				skin(2)|large_intestine(1)|stomach(1)	4						c.(2320-2322)GGC>TGC		unc-51-like kinase 2							38.0	44.0	42.0					17																	19687150		2203	4300	6503	SO:0001583	missense	9706				signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity	g.chr17:19687150C>A	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.2320G>T	17.37:g.19687150C>A	ENSP00000378914:p.Gly774Cys		Somatic				ULK2_uc002gwn.2_Missense_Mutation_p.G774C	p.G774C	NM_001142610	NP_001136082	WXS	Illumina HiSeq	Unspecified	Q8IYT8	ULK2_HUMAN			22	2829	-	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)		774					A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	c.2320G>T	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.682827	0.47991	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.69040	-0.37;-0.37	5.44	5.44	0.79542	.	0.216830	0.48286	D	0.000191	T	0.67173	0.2865	L	0.29908	0.895	0.41125	D	0.98584	D	0.69078	0.997	P	0.57371	0.819	T	0.70350	-0.4896	10	0.66056	D	0.02	-8.723	11.6875	0.51494	0.0:0.9198:0.0:0.0802	.	774	Q8IYT8	ULK2_HUMAN	C	774	ENSP00000354877:G774C;ENSP00000378914:G774C	ENSP00000354877:G774C	G	-	1	0	ULK2	19627742	0.917000	0.31117	0.176000	0.23000	0.067000	0.16453	2.893000	0.48633	2.541000	0.85698	0.561000	0.74099	GGC		0.642	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683		7	20	1	0	2.0095e-06	0.00198382	6.9433e-06	7	20				
NOS2	4843	broad.mit.edu	37	17	26086080	26086080	+	Silent	SNP	G	G	T	rs200470759		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:26086080G>T	ENST00000313735.6	-	26	3414	c.3181C>A	c.(3181-3183)Cgg>Agg	p.R1061R		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	1061					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	AGCTGCTGCCGCAGGATGTCC	0.622																																							uc002gzu.2		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(3181-3183)CGG>AGG		nitric oxide synthase 2A	Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)						19.0	19.0	19.0					17																	26086080		2200	4297	6497	SO:0001819	synonymous_variant	4843				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding	g.chr17:26086080G>T	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.3181C>A	17.37:g.26086080G>T			Somatic					p.R1061R	NM_000625	NP_000616	WXS	Illumina HiSeq	Unspecified	P35228	NOS2_HUMAN			26	3445	-			1061					A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	ENST00000313735.6	37	c.3181C>A	CCDS11223.1																																																																																				0.622	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625		4	12	1	0	1.23904e-05	0.000602214	4.04334e-05	4	12				
LRRC37B	114659	broad.mit.edu	37	17	30349307	30349307	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:30349307C>G	ENST00000341671.7	+	1	1147	c.1142C>G	c.(1141-1143)tCt>tGt	p.S381C	LRRC37B_ENST00000394713.3_Missense_Mutation_p.S381C|LRRC37B_ENST00000327564.7_Missense_Mutation_p.S408C|LRRC37B_ENST00000543378.2_Missense_Mutation_p.S299C|LRRC37B_ENST00000584368.1_Missense_Mutation_p.S393C	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	381						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				GAACCTTCTTCTACAGCCCTG	0.547																																							uc002hgu.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1141-1143)TCT>TGT		leucine rich repeat containing 37B precursor							91.0	99.0	96.0					17																	30349307		2203	4300	6503	SO:0001583	missense	114659					integral to membrane		g.chr17:30349307C>G	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.1142C>G	17.37:g.30349307C>G	ENSP00000340519:p.Ser381Cys		Somatic				LRRC37B_uc010wbx.1_Missense_Mutation_p.S299C|LRRC37B_uc010csu.2_Missense_Mutation_p.S381C	p.S381C	NM_052888	NP_443120	WXS	Illumina HiSeq	Unspecified	Q96QE4	LR37B_HUMAN			1	1153	+		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)	381			Extracellular (Potential).		Q17RC9|Q5YKG6	Missense_Mutation	SNP	ENST00000341671.7	37	c.1142C>G	CCDS32609.1	.	.	.	.	.	.	.	.	.	.	N	6.307	0.424692	0.11928	.	.	ENSG00000185158	ENST00000543378;ENST00000327564;ENST00000394713;ENST00000341671	T;T;T;T	0.68181	-0.25;-0.31;0.79;-0.3	1.81	0.805	0.18703	.	.	.	.	.	T	0.48277	0.1491	L	0.27053	0.805	0.09310	N	1	D;B	0.65815	0.995;0.289	B;B	0.41917	0.37;0.095	T	0.42732	-0.9434	9	0.72032	D	0.01	.	4.5237	0.11971	0.0:0.7958:0.0:0.2042	.	381;381	Q17RC9;Q96QE4	.;LR37B_HUMAN	C	299;408;381;381	ENSP00000443345:S299C;ENSP00000332536:S408C;ENSP00000378202:S381C;ENSP00000340519:S381C	ENSP00000332536:S408C	S	+	2	0	LRRC37B	27373420	0.000000	0.05858	0.002000	0.10522	0.068000	0.16541	0.200000	0.17257	0.351000	0.24027	-0.701000	0.03672	TCT		0.547	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888		24	81	0	0	0	0.00229938	0	24	81				
KRT23	25984	broad.mit.edu	37	17	39092731	39092731	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:39092731C>G	ENST00000209718.3	-	2	549	c.125G>C	c.(124-126)cGc>cCc	p.R42P	KRT23_ENST00000436344.3_Intron|KRT23_ENST00000582283.1_5'Flank|AC004231.2_ENST00000418393.1_RNA	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	42	Head.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				CAGGGAGATGCGGGCTCCCCC	0.706																																							uc002hvm.1		NA																	0				ovary(1)	1						c.(124-126)CGC>CCC		keratin 23							33.0	39.0	37.0					17																	39092731		2203	4299	6502	SO:0001583	missense	25984					intermediate filament	structural molecule activity	g.chr17:39092731C>G	AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.125G>C	17.37:g.39092731C>G	ENSP00000209718:p.Arg42Pro		Somatic				KRT23_uc010wfl.1_Intron|KRT23_uc010cxf.1_Intron|KRT23_uc010cxg.2_Missense_Mutation_p.R42P|KRT23_uc002hvn.1_Missense_Mutation_p.R42P	p.R42P	NM_015515	NP_056330	WXS	Illumina HiSeq	Unspecified	Q9C075	K1C23_HUMAN			2	714	-		Breast(137;0.000301)|Ovarian(249;0.15)	42			Head.		A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Missense_Mutation	SNP	ENST00000209718.3	37	c.125G>C	CCDS11380.1	.	.	.	.	.	.	.	.	.	.	C	8.113	0.779289	0.16120	.	.	ENSG00000108244	ENST00000209718	D	0.83075	-1.68	5.73	4.76	0.60689	.	0.116156	0.39341	N	0.001389	T	0.68540	0.3012	N	0.14661	0.345	0.58432	D	0.999999	P	0.35872	0.525	B	0.35510	0.204	T	0.67643	-0.5618	10	0.35671	T	0.21	.	10.0572	0.42252	0.0:0.8334:0.0:0.1666	.	42	Q9C075	K1C23_HUMAN	P	42	ENSP00000209718:R42P	ENSP00000209718:R42P	R	-	2	0	KRT23	36346257	0.000000	0.05858	0.066000	0.19879	0.011000	0.07611	0.438000	0.21559	1.432000	0.47375	-0.252000	0.11476	CGC		0.706	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257223.1			6	21	0	0	0	0.00198382	0	6	21				
EFCAB13	124989	broad.mit.edu	37	17	45518003	45518003	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:45518003C>A	ENST00000331493.2	+	25	3256	c.2845C>A	c.(2845-2847)Cac>Aac	p.H949N		NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	949						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										TATAAAACAACACAAGATTAG	0.313																																							uc002iln.2		NA																	0				breast(1)|central_nervous_system(1)|skin(1)	3						c.(2845-2847)CAC>AAC		hypothetical protein LOC124989							80.0	84.0	82.0					17																	45518003		2203	4293	6496	SO:0001583	missense	124989						calcium ion binding	g.chr17:45518003C>A	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.2845C>A	17.37:g.45518003C>A	ENSP00000332111:p.His949Asn		Somatic					p.H949N	NM_152347	NP_689560	WXS	Illumina HiSeq	Unspecified	Q8IY85	CQ057_HUMAN			25	3256	+			949					G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	37	c.2845C>A	CCDS11512.1	.	.	.	.	.	.	.	.	.	.	.	8.188	0.795364	0.16327	.	.	ENSG00000178852	ENST00000331493	T	0.60548	0.18	1.77	-0.886	0.10590	.	.	.	.	.	T	0.26919	0.0659	N	0.08118	0	0.09310	N	0.999999	P	0.40619	0.724	B	0.29267	0.1	T	0.14504	-1.0470	9	0.72032	D	0.01	.	4.6065	0.12380	0.0:0.5903:0.0:0.4097	.	949	Q8IY85	CQ057_HUMAN	N	949	ENSP00000332111:H949N	ENSP00000332111:H949N	H	+	1	0	C17orf57	42873002	0.000000	0.05858	0.030000	0.17652	0.279000	0.26890	-3.459000	0.00464	-0.200000	0.10300	0.306000	0.20318	CAC		0.313	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347		14	81	1	0	0.000219431	0.00244969	0.000672226	14	81				
NXPH3	11248	broad.mit.edu	37	17	47656161	47656161	+	Silent	SNP	G	G	A	rs36092288	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:47656161G>A	ENST00000328741.5	+	2	620	c.258G>A	c.(256-258)ccG>ccA	p.P86P	RP5-1029K10.4_ENST00000503624.1_RNA|NXPH3_ENST00000513748.1_Silent_p.P86P	NM_007225.2	NP_009156.2	O95157	NXPH3_HUMAN	neurexophilin 3	86	III.				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(2)|large_intestine(3)|lung(4)|pancreas(1)|skin(2)	12	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					CCAACCGCCCGAACCACAGCC	0.627																																							uc002ipa.2		NA																	0				pancreas(1)|skin(1)	2						c.(256-258)CCG>CCA		neurexophilin 3 precursor							28.0	34.0	32.0					17																	47656161		2203	4300	6503	SO:0001819	synonymous_variant	11248				neuropeptide signaling pathway	extracellular region		g.chr17:47656161G>A	AF043468	CCDS11550.1	17q	2008-07-03				ENSG00000182575			8077	protein-coding gene	gene with protein product		604636				9570794	Standard	NM_007225		Approved	NPH3	uc002ipa.3	O95157		ENST00000328741.5:c.258G>A	17.37:g.47656161G>A			Somatic				NXPH3_uc010wlw.1_Silent_p.P86P	p.P86P	NM_007225	NP_009156	WXS	Illumina HiSeq	Unspecified	O95157	NXPH3_HUMAN			2	542	+	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)		86			III.		Q8NDC3|Q8TBF6|Q9ULR1	Silent	SNP	ENST00000328741.5	37	c.258G>A	CCDS11550.1																																																																																				0.627	NXPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365143.1			4	23	0	0	0	0.00024832	0	4	23				
CA10	56934	broad.mit.edu	37	17	50008437	50008437	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:50008437T>A	ENST00000285273.4	-	4	1303	c.192A>T	c.(190-192)aaA>aaT	p.K64N	CA10_ENST00000340813.6_Missense_Mutation_p.K70N|CA10_ENST00000442502.2_Missense_Mutation_p.K64N|CA10_ENST00000451037.2_Missense_Mutation_p.K64N|CA10_ENST00000570565.1_5'UTR	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	64					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	GCGACTGCCGTTTCCCCACAG	0.478																																							uc002itw.3		NA																	0				ovary(1)|skin(1)	2						c.(190-192)AAA>AAT		carbonic anhydrase X							198.0	185.0	190.0					17																	50008437		2203	4300	6503	SO:0001583	missense	56934				brain development			g.chr17:50008437T>A	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.192A>T	17.37:g.50008437T>A	ENSP00000285273:p.Lys64Asn		Somatic				CA10_uc002itv.3_Missense_Mutation_p.K70N|CA10_uc002itx.3_Missense_Mutation_p.K64N|CA10_uc002ity.3_Missense_Mutation_p.K64N|CA10_uc002itz.2_Missense_Mutation_p.K64N	p.K64N	NM_020178	NP_064563	WXS	Illumina HiSeq	Unspecified	Q9NS85	CAH10_HUMAN	BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		3	1178	-			64					B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	c.192A>T	CCDS32684.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.467189	0.84533	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	5.93	-0.251	0.13003	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	T	0.68815	0.3042	L	0.38733	1.17	0.36079	D	0.842643	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.67945	-0.5539	9	.	.	.	.	10.1038	0.42521	0.0:0.3436:0.0:0.6564	.	64;70	Q9NS85;Q68D28	CAH10_HUMAN;.	N	64;64;64;70	ENSP00000390666:K64N;ENSP00000285273:K64N;ENSP00000405388:K64N;ENSP00000340363:K70N	.	K	-	3	2	CA10	47363436	1.000000	0.71417	0.991000	0.47740	0.957000	0.61999	1.374000	0.34283	-0.331000	0.08501	-0.290000	0.09829	AAA		0.478	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178		18	107	0	0	0	0.000958276	0	18	107				
ANKFN1	162282	broad.mit.edu	37	17	54543847	54543847	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:54543847A>T	ENST00000318698.2	+	14	1732	c.1697A>T	c.(1696-1698)cAg>cTg	p.Q566L	ANKFN1_ENST00000566473.2_Missense_Mutation_p.Q566L	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	566										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						AAATGGATGCAGATCTCAAAG	0.398																																							uc002iun.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(1696-1698)CAG>CTG		ankyrin-repeat and fibronectin type III domain							92.0	83.0	86.0					17																	54543847		2203	4300	6503	SO:0001583	missense	162282							g.chr17:54543847A>T	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1697A>T	17.37:g.54543847A>T	ENSP00000321627:p.Gln566Leu		Somatic					p.Q566L	NM_153228	NP_694960	WXS	Illumina HiSeq	Unspecified	Q8N957	ANKF1_HUMAN			14	1732	+			566						Missense_Mutation	SNP	ENST00000318698.2	37	c.1697A>T	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.778076	0.31502	.	.	ENSG00000153930	ENST00000318698	T	0.24151	1.87	5.69	4.55	0.56014	.	0.170440	0.53938	D	0.000057	T	0.27313	0.0670	L	0.60455	1.87	0.53005	D	0.999963	B	0.12630	0.006	B	0.10450	0.005	T	0.09818	-1.0657	10	0.72032	D	0.01	-8.9318	12.5055	0.55979	0.8608:0.1392:0.0:0.0	.	566	Q8N957	ANKF1_HUMAN	L	566	ENSP00000321627:Q566L	ENSP00000321627:Q566L	Q	+	2	0	ANKFN1	51898846	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.794000	0.69067	2.163000	0.67991	0.533000	0.62120	CAG		0.398	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228		8	37	0	0	0	0.00307968	0	8	37				
BZRAP1	9256	broad.mit.edu	37	17	56400700	56400700	+	Nonsense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:56400700C>A	ENST00000343736.4	-	7	1226	c.1063G>T	c.(1063-1065)Gag>Tag	p.E355*	BZRAP1_ENST00000355701.3_Nonsense_Mutation_p.E355*|BZRAP1-AS1_ENST00000579527.1_RNA|BZRAP1_ENST00000268893.6_Nonsense_Mutation_p.E295*			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	355						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCTTCCTGCTCCAGGCTCTCG	0.607																																							uc002ivx.3		NA																	0				upper_aerodigestive_tract(2)|skin(1)	3						c.(1063-1065)GAG>TAG		peripheral benzodiazepine receptor-associated							177.0	185.0	182.0					17																	56400700		2203	4300	6503	SO:0001587	stop_gained	9256					mitochondrion	benzodiazepine receptor binding	g.chr17:56400700C>A	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.1063G>T	17.37:g.56400700C>A	ENSP00000345824:p.Glu355*		Somatic				BZRAP1_uc010dcs.2_Nonsense_Mutation_p.E295*|BZRAP1_uc010wnt.1_Nonsense_Mutation_p.E355*	p.E355*	NM_004758	NP_004749	WXS	Illumina HiSeq	Unspecified	O95153	RIMB1_HUMAN			7	1934	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		355					O75111|Q8N5W3	Nonsense_Mutation	SNP	ENST00000343736.4	37	c.1063G>T	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	C	46	12.381043	0.99662	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	.	.	.	4.05	4.05	0.47172	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	15.5735	0.76356	0.0:1.0:0.0:0.0	.	.	.	.	X	355;355;295	.	ENSP00000268893:E295X	E	-	1	0	BZRAP1	53755699	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.691000	0.54720	1.978000	0.57642	0.561000	0.74099	GAG		0.607	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758		21	90	1	0	6.44725e-10	0.00229938	2.61569e-09	21	90				
VMP1	81671	broad.mit.edu	37	17	57917132	57917132	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:57917132G>C	ENST00000262291.4	+	12	1391	c.1081G>C	c.(1081-1083)Gaa>Caa	p.E361Q	VMP1_ENST00000537567.1_Missense_Mutation_p.E227Q|VMP1_ENST00000536180.1_Missense_Mutation_p.E264Q|MIR21_ENST00000362134.1_RNA|VMP1_ENST00000588617.1_3'UTR|VMP1_ENST00000545362.1_Missense_Mutation_p.E305Q|VMP1_ENST00000539763.1_Missense_Mutation_p.E169Q	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	361					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						TCTACAGGGAGAAAACTGGTT	0.368																																							uc002ixu.3		NA																	0					0						c.(1081-1083)GAA>CAA		transmembrane protein 49							284.0	274.0	277.0					17																	57917132		2203	4300	6503	SO:0001583	missense	81671				autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane		g.chr17:57917132G>C		CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.1081G>C	17.37:g.57917132G>C	ENSP00000262291:p.Glu361Gln		Somatic				TMEM49_uc010wog.1_Missense_Mutation_p.E169Q|TMEM49_uc010woh.1_Missense_Mutation_p.E305Q|TMEM49_uc010woi.1_Missense_Mutation_p.E264Q|TMEM49_uc010woj.1_Missense_Mutation_p.E227Q|TMEM49_uc002ixv.2_RNA|MIR21_hsa-mir-21|MI0000077_5'Flank	p.E361Q	NM_030938	NP_112200	WXS	Illumina HiSeq	Unspecified	Q96GC9	VMP1_HUMAN	Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)		12	1354	+	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		361			Cytoplasmic (Potential).		B4DVV9|Q9H0P4|Q9P089	Missense_Mutation	SNP	ENST00000262291.4	37	c.1081G>C	CCDS11619.1	.	.	.	.	.	.	.	.	.	.	G	9.372	1.070804	0.20147	.	.	ENSG00000062716	ENST00000262291;ENST00000537567;ENST00000539763;ENST00000536180;ENST00000545362	.	.	.	5.43	4.46	0.54185	.	0.051015	0.85682	D	0.000000	T	0.60932	0.2307	M	0.61703	1.905	0.80722	D	1	B;P;D;B	0.54601	0.061;0.61;0.967;0.061	B;B;P;B	0.50490	0.026;0.202;0.642;0.069	T	0.58668	-0.7596	9	0.15499	T	0.54	-13.3179	14.1333	0.65270	0.0726:0.0:0.9274:0.0	.	227;264;305;361	B4DED7;B4DGZ7;F5H2J3;Q96GC9	.;.;.;VMP1_HUMAN	Q	361;227;169;264;305	.	ENSP00000262291:E361Q	E	+	1	0	VMP1	55271914	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	9.624000	0.98398	1.299000	0.44798	0.555000	0.69702	GAA		0.368	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1	NM_030938		20	299	0	0	0	0.00229938	0	20	299				
DNAI2	64446	broad.mit.edu	37	17	72278023	72278023	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:72278023C>G	ENST00000311014.6	+	2	134	c.67C>G	c.(67-69)Cgc>Ggc	p.R23G	DNAI2_ENST00000582036.1_Missense_Mutation_p.R23G|DNAI2_ENST00000579490.1_Missense_Mutation_p.R80G|DNAI2_ENST00000307504.5_5'UTR|DNAI2_ENST00000446837.2_Missense_Mutation_p.R23G			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	23					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TTTCTCGGACCGCCAGGCCGA	0.617									Kartagener syndrome																														uc002jkf.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(67-69)CGC>GGC		dynein, axonemal, intermediate polypeptide 2							143.0	120.0	128.0					17																	72278023		2203	4300	6503	SO:0001583	missense	64446	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity	g.chr17:72278023C>G	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.67C>G	17.37:g.72278023C>G	ENSP00000308312:p.Arg23Gly		Somatic				DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA	p.R23G	NM_023036	NP_075462	WXS	Illumina HiSeq	Unspecified	Q9GZS0	DNAI2_HUMAN			2	166	+			23					C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	37	c.67C>G	CCDS11697.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.910488	0.52439	.	.	ENSG00000171595	ENST00000311014;ENST00000446837	T;T	0.67698	-0.28;-0.28	5.22	5.22	0.72569	.	0.253251	0.39615	N	0.001302	T	0.76499	0.3996	M	0.82716	2.605	0.80722	D	1	P	0.49253	0.921	P	0.51101	0.659	T	0.78560	-0.2157	10	0.48119	T	0.1	-37.5674	14.327	0.66528	0.0:0.9271:0.0:0.0728	.	23	Q9GZS0	DNAI2_HUMAN	G	23	ENSP00000308312:R23G;ENSP00000400252:R23G	ENSP00000308312:R23G	R	+	1	0	DNAI2	69789618	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.456000	0.44997	2.731000	0.93534	0.644000	0.83932	CGC		0.617	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036		11	34	0	0	0	0.00185496	0	11	34				
PIEZO2	63895	broad.mit.edu	37	18	10681738	10681738	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:10681738T>A	ENST00000503781.3	-	47	7359	c.7360A>T	c.(7360-7362)Atg>Ttg	p.M2454L	PIEZO2_ENST00000538948.1_Missense_Mutation_p.M411L|PIEZO2_ENST00000580640.1_Missense_Mutation_p.M2479L|PIEZO2_ENST00000581680.1_5'Flank|PIEZO2_ENST00000302079.6_Missense_Mutation_p.M2391L|PIEZO2_ENST00000285141.4_Missense_Mutation_p.M246L	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2454					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										TGGGCACTCATTGTGAAAATA	0.378																																							uc002kor.3		NA																	0				ovary(1)	1						c.(1231-1233)ATG>TTG		family with sequence similarity 38, member B							139.0	134.0	136.0					18																	10681738		2203	4300	6503	SO:0001583	missense	63895					integral to membrane	ion channel activity	g.chr18:10681738T>A	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.7360A>T	18.37:g.10681738T>A	ENSP00000421377:p.Met2454Leu		Somatic				FAM38B_uc002koq.2_Missense_Mutation_p.M246L	p.M411L	NM_022068	NP_071351	WXS	Illumina HiSeq	Unspecified	Q9H5I5	PIEZ2_HUMAN			9	1371	-			2454					B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	ENST00000503781.3	37	c.1231A>T		.	.	.	.	.	.	.	.	.	.	T	21.4	4.146936	0.77888	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	T;T;T	0.71934	0.1;-0.61;-0.61	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.83936	0.5362	M	0.86502	2.82	0.44073	D	0.996824	D	0.76494	0.999	D	0.83275	0.996	T	0.82870	-0.0243	10	0.10636	T	0.68	.	15.2211	0.73310	0.0:0.0:0.0:1.0	.	348	D6RFZ0	.	L	348;2454;411;246	ENSP00000303316:M2454L;ENSP00000443129:M411L;ENSP00000285141:M246L	ENSP00000285141:M246L	M	-	1	0	FAM38B	10671738	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.958000	0.76025	2.061000	0.61500	0.459000	0.35465	ATG		0.378	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068		16	71	0	0	0	0.00074312	0	16	71				
MC5R	4161	broad.mit.edu	37	18	13826290	13826290	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:13826290G>T	ENST00000324750.3	+	1	748	c.526G>T	c.(526-528)Gtc>Ttc	p.V176F	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	176					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						CTGCGGCATTGTCTTCATCCT	0.557																																							uc010xaf.1		NA																	0				ovary(3)|lung(2)|breast(1)	6						c.(526-528)GTC>TTC		melanocortin 5 receptor							431.0	370.0	391.0					18																	13826290		2203	4300	6503	SO:0001583	missense	4161				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding	g.chr18:13826290G>T	AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.526G>T	18.37:g.13826290G>T	ENSP00000318077:p.Val176Phe		Somatic					p.V176F	NM_005913	NP_005904	WXS	Illumina HiSeq	Unspecified	P33032	MC5R_HUMAN			1	526	+			176			Helical; Name=4; (Potential).		B0YJ34|Q502V1	Missense_Mutation	SNP	ENST00000324750.3	37	c.526G>T	CCDS11868.1	.	.	.	.	.	.	.	.	.	.	G	9.228	1.035182	0.19590	.	.	ENSG00000176136	ENST00000324750	T	0.38240	1.15	5.01	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.308838	0.35291	N	0.003311	T	0.55097	0.1899	M	0.85197	2.74	0.39917	D	0.974104	D	0.56968	0.978	D	0.63113	0.911	T	0.58047	-0.7705	10	0.87932	D	0	.	7.2725	0.26264	0.5173:0.0:0.4827:0.0	.	176	P33032	MC5R_HUMAN	F	176	ENSP00000318077:V176F	ENSP00000318077:V176F	V	+	1	0	MC5R	13816290	0.206000	0.23470	0.001000	0.08648	0.008000	0.06430	0.578000	0.23773	0.397000	0.25310	0.455000	0.32223	GTC		0.557	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254638.1	NM_005913		68	203	1	0	1.77791e-30	0.00361006	9.02993e-30	68	203				
ANKRD30B	374860	broad.mit.edu	37	18	14787073	14787073	+	Missense_Mutation	SNP	G	G	T	rs372948852		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:14787073G>T	ENST00000358984.4	+	15	1888	c.1708G>T	c.(1708-1710)Gat>Tat	p.D570Y	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Missense_Mutation_p.D570Y	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	570										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						ACAAAAGGACGATGAAGAAAA	0.289																																							uc010dlo.2		NA																	0				ovary(1)|skin(1)	2						c.(1708-1710)GAT>TAT		ankyrin repeat domain 30B							171.0	145.0	152.0					18																	14787073		692	1585	2277	SO:0001583	missense	374860							g.chr18:14787073G>T	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1708G>T	18.37:g.14787073G>T	ENSP00000351875:p.Asp570Tyr		Somatic				ANKRD30B_uc010xak.1_RNA	p.D570Y	NM_001145029	NP_001138501	WXS	Illumina HiSeq	Unspecified	Q9BXX2	AN30B_HUMAN			15	1888	+			570					B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.1708G>T	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	0.013	-1.632882	0.00806	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.05855	3.38;3.38	1.15	0.246	0.15516	.	.	.	.	.	T	0.04182	0.0116	L	0.31752	0.955	0.09310	N	1	D	0.53312	0.959	B	0.40134	0.32	T	0.40421	-0.9564	9	0.39692	T	0.17	.	4.2079	0.10497	0.2405:0.0:0.7595:0.0	.	570	F8WAG3	.	Y	570	ENSP00000351875:D570Y;ENSP00000399031:D570Y	ENSP00000351875:D570Y	D	+	1	0	ANKRD30B	14777073	0.016000	0.18221	0.000000	0.03702	0.002000	0.02628	-0.106000	0.10890	0.032000	0.15435	-1.377000	0.01181	GAT		0.289	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		12	47	1	0	4.3838e-07	0.00185496	1.58781e-06	12	47				
ZNF521	25925	broad.mit.edu	37	18	22806665	22806665	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:22806665C>A	ENST00000361524.3	-	4	1365	c.1217G>T	c.(1216-1218)aGc>aTc	p.S406I	ZNF521_ENST00000584787.1_Missense_Mutation_p.S186I|ZNF521_ENST00000538137.2_Missense_Mutation_p.S406I|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	406					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GTAAATACAGCTGTAGGTAAC	0.463			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(1216-1218)AGC>ATC		zinc finger protein 521							96.0	92.0	94.0					18																	22806665		2203	4300	6503	SO:0001583	missense	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22806665C>A	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1217G>T	18.37:g.22806665C>A	ENSP00000354794:p.Ser406Ile		Somatic				ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.S406I|ZNF521_uc002kvl.2_Missense_Mutation_p.S186I	p.S406I	NM_015461	NP_056276	WXS	Illumina HiSeq	Unspecified	Q96K83	ZN521_HUMAN			4	1464	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		406			C2H2-type 9; degenerate.		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	c.1217G>T	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.808333	0.31961	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.09723	2.95;2.97	6.16	6.16	0.99307	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.21267	0.0512	L	0.29908	0.895	0.49483	D	0.999794	D	0.58620	0.983	P	0.56788	0.806	T	0.00063	-1.2154	10	0.62326	D	0.03	-31.5658	20.8598	0.99761	0.0:1.0:0.0:0.0	.	406	Q96K83	ZN521_HUMAN	I	406;440;406	ENSP00000354794:S406I;ENSP00000382352:S406I	ENSP00000354794:S406I	S	-	2	0	ZNF521	21060663	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.710000	0.68392	2.937000	0.99478	0.650000	0.86243	AGC		0.463	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		26	49	1	0	3.73988e-18	0.00106085	1.76664e-17	26	49				
CDH2	1000	broad.mit.edu	37	18	25570215	25570215	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:25570215C>A	ENST00000269141.3	-	10	1867	c.1444G>T	c.(1444-1446)Gca>Tca	p.A482S	CDH2_ENST00000399380.3_Missense_Mutation_p.A451S	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	482	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GACACGGTTGCAGTTGACTGA	0.448																																							uc002kwg.2		NA																	0				ovary(3)|lung(1)	4						c.(1444-1446)GCA>TCA		cadherin 2, type 1 preproprotein							103.0	99.0	101.0					18																	25570215		2203	4300	6503	SO:0001583	missense	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25570215C>A	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1444G>T	18.37:g.25570215C>A	ENSP00000269141:p.Ala482Ser		Somatic				CDH2_uc010xbn.1_Missense_Mutation_p.A451S	p.A482S	NM_001792	NP_001783	WXS	Illumina HiSeq	Unspecified	P19022	CADH2_HUMAN			10	1903	-			482			Extracellular (Potential).|Cadherin 3.		A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	c.1444G>T	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	33	5.226811	0.95173	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.55588	0.51;0.51	6.16	6.16	0.99307	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.76912	0.4054	M	0.82517	2.595	0.80722	D	1	B;B	0.32620	0.378;0.089	P;B	0.54140	0.743;0.367	T	0.74842	-0.3527	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	451;482	A8MWK3;P19022	.;CADH2_HUMAN	S	482;451	ENSP00000269141:A482S;ENSP00000382312:A451S	ENSP00000269141:A482S	A	-	1	0	CDH2	23824213	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	5.666000	0.68059	2.937000	0.99478	0.650000	0.86243	GCA		0.448	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		18	49	1	0	1.01871e-10	0.00121646	4.23471e-10	18	49				
CDH2	1000	broad.mit.edu	37	18	25583076	25583076	+	Missense_Mutation	SNP	C	C	A	rs184596097		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:25583076C>A	ENST00000269141.3	-	7	1328	c.905G>T	c.(904-906)gGg>gTg	p.G302V	CDH2_ENST00000399380.3_Missense_Mutation_p.G271V	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	302	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CCTCAACATCCCATTGAGGGC	0.458																																							uc002kwg.2		NA																	0				ovary(3)|lung(1)	4						c.(904-906)GGG>GTG		cadherin 2, type 1 preproprotein							233.0	169.0	191.0					18																	25583076		2203	4300	6503	SO:0001583	missense	1000				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding	g.chr18:25583076C>A	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.905G>T	18.37:g.25583076C>A	ENSP00000269141:p.Gly302Val		Somatic				CDH2_uc010xbn.1_Missense_Mutation_p.G271V	p.G302V	NM_001792	NP_001783	WXS	Illumina HiSeq	Unspecified	P19022	CADH2_HUMAN			7	1364	-			302			Extracellular (Potential).|Cadherin 2.		A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	c.905G>T	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.972421	0.92919	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.53640	0.61;0.61	5.48	5.48	0.80851	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.74794	0.3763	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.78838	-0.2046	10	0.87932	D	0	.	19.6936	0.96012	0.0:1.0:0.0:0.0	.	271;302	A8MWK3;P19022	.;CADH2_HUMAN	V	302;271	ENSP00000269141:G302V;ENSP00000382312:G271V	ENSP00000269141:G302V	G	-	2	0	CDH2	23837074	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.724000	0.93272	0.563000	0.77884	GGG		0.458	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792		21	41	1	0	0.000175454	0.00152264	0.000543667	21	41				
DSC2	1824	broad.mit.edu	37	18	28651795	28651795	+	Missense_Mutation	SNP	C	C	G	rs200475862	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:28651795C>G	ENST00000280904.6	-	13	2344	c.1901G>C	c.(1900-1902)cGt>cCt	p.R634P	DSC2_ENST00000251081.6_Missense_Mutation_p.R634P|snoU13_ENST00000459603.1_RNA	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	634	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			ATAGGAAAGACGTGCTGCTGT	0.323																																							uc002kwl.3		NA																	0				ovary(2)|skin(1)	3						c.(1900-1902)CGT>CCT		desmocollin 2 isoform Dsc2a preproprotein							96.0	87.0	90.0					18																	28651795		2203	4300	6503	SO:0001583	missense	1824				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:28651795C>G	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1901G>C	18.37:g.28651795C>G	ENSP00000280904:p.Arg634Pro		Somatic				DSC2_uc002kwk.3_Missense_Mutation_p.R634P	p.R634P	NM_024422	NP_077740	WXS	Illumina HiSeq	Unspecified	Q02487	DSC2_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.0241)		13	2355	-			634			Extracellular (Potential).|Cadherin 5.			Missense_Mutation	SNP	ENST00000280904.6	37	c.1901G>C	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.626906	0.46840	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.60920	0.15;0.15	6.02	4.26	0.50523	Cadherin (2);Cadherin-like (1);	0.260464	0.20474	N	0.091622	T	0.67477	0.2897	M	0.80982	2.52	0.09310	N	1	D;D	0.56521	0.96;0.976	P;P	0.57371	0.572;0.819	T	0.60372	-0.7276	10	0.45353	T	0.12	.	4.6969	0.12808	0.1526:0.6073:0.0:0.2401	.	634;634	Q02487;Q02487-2	DSC2_HUMAN;.	P	634;634;400;647	ENSP00000251081:R634P;ENSP00000280904:R634P	ENSP00000251081:R634P	R	-	2	0	DSC2	26905793	0.000000	0.05858	0.063000	0.19743	0.931000	0.56810	0.102000	0.15272	0.888000	0.36160	0.650000	0.86243	CGT		0.323	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949		12	34	0	0	0	0.00244969	0	12	34				
DSG3	1830	broad.mit.edu	37	18	29039949	29039949	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:29039949C>A	ENST00000257189.4	+	6	742	c.659C>A	c.(658-660)aCt>aAt	p.T220N		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	220	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GAAGTCCGTACTTTGACCAAT	0.438																																							uc002kws.2		NA																	0				skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9						c.(658-660)ACT>AAT		desmoglein 3 preproprotein							68.0	62.0	64.0					18																	29039949		2203	4300	6503	SO:0001583	missense	1830				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding	g.chr18:29039949C>A	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.659C>A	18.37:g.29039949C>A	ENSP00000257189:p.Thr220Asn		Somatic					p.T220N	NM_001944	NP_001935	WXS	Illumina HiSeq	Unspecified	P32926	DSG3_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		6	768	+			220			Extracellular (Potential).|Cadherin 2.		A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	37	c.659C>A	CCDS11898.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760239	0.69763	.	.	ENSG00000134757	ENST00000257189	T	0.57273	0.41	5.13	5.13	0.70059	Cadherin (4);Cadherin-like (1);	0.000000	0.48767	D	0.000178	T	0.76190	0.3953	M	0.90309	3.105	0.25635	N	0.986264	D	0.76494	0.999	D	0.79108	0.992	T	0.71692	-0.4516	10	0.87932	D	0	.	13.3185	0.60421	0.0:0.921:0.0:0.079	.	220	P32926	DSG3_HUMAN	N	220	ENSP00000257189:T220N	ENSP00000257189:T220N	T	+	2	0	DSG3	27293947	0.384000	0.25164	0.964000	0.40570	0.979000	0.70002	3.205000	0.51090	2.564000	0.86499	0.561000	0.74099	ACT		0.438	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944		10	16	1	0	1.08611e-07	0.000978159	3.99818e-07	10	16				
CCDC178	374864	broad.mit.edu	37	18	30926184	30926184	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:30926184C>G	ENST00000383096.3	-	9	831	c.649G>C	c.(649-651)Gtg>Ctg	p.V217L	CCDC178_ENST00000406524.2_Missense_Mutation_p.V217L|CCDC178_ENST00000583930.1_Missense_Mutation_p.V217L|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000579947.1_Missense_Mutation_p.V217L|CCDC178_ENST00000403303.1_Missense_Mutation_p.V217L|CCDC178_ENST00000402325.1_Missense_Mutation_p.V217L|CCDC178_ENST00000300227.8_Missense_Mutation_p.V217L			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	217																	CCTTTCTGCACAGCCAATGGG	0.323																																							uc002kxn.2		NA																	0				ovary(1)	1						c.(649-651)GTG>CTG		hypothetical protein LOC374864 isoform 1							100.0	100.0	100.0					18																	30926184		2203	4300	6503	SO:0001583	missense	374864							g.chr18:30926184C>G	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.649G>C	18.37:g.30926184C>G	ENSP00000372576:p.Val217Leu		Somatic				C18orf34_uc010xbr.1_Missense_Mutation_p.V217L|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Missense_Mutation_p.V217L|C18orf34_uc002kxp.2_Missense_Mutation_p.V217L	p.V217L	NM_001105528	NP_001098998	WXS	Illumina HiSeq	Unspecified	Q5BJE1	CR034_HUMAN			8	791	-			217					A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	c.649G>C	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	C	11.53	1.664881	0.29604	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.61859	1.45;1.45;1.44;1.46;1.44;0.07	5.59	5.59	0.84812	.	.	.	.	.	T	0.70465	0.3227	L	0.55990	1.75	0.35903	D	0.830531	D;D;D;D	0.76494	0.999;0.998;0.998;0.998	D;D;D;D	0.80764	0.994;0.971;0.971;0.971	T	0.70517	-0.4850	9	0.22706	T	0.39	-16.5976	16.5129	0.84290	0.0:1.0:0.0:0.0	.	217;217;217;217	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	L	217	ENSP00000385591:V217L;ENSP00000372576:V217L;ENSP00000300227:V217L;ENSP00000385867:V217L;ENSP00000385234:V217L;ENSP00000382130:V217L	ENSP00000300227:V217L	V	-	1	0	C18orf34	29180182	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	4.659000	0.61504	2.636000	0.89361	0.557000	0.71058	GTG		0.323	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		24	56	0	0	0	0.00127121	0	24	56				
ACAA2	10449	broad.mit.edu	37	18	47329179	47329179	+	Nonsense_Mutation	SNP	C	C	A	rs147007453		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:47329179C>A	ENST00000285093.10	-	2	536	c.61G>T	c.(61-63)Gga>Tga	p.G21*	RP11-886H22.1_ENST00000590532.2_3'UTR|ACAA2_ENST00000589432.1_5'UTR|ACAA2_ENST00000587994.1_Nonsense_Mutation_p.G18*	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	21					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)	p.G21*(1)		large_intestine(2)|lung(7)|ovary(1)	10						AGAAGGCCTCCGTAAGCTCCA	0.453																																							uc002ldw.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(61-63)GGA>TGA		acetyl-coenzyme A acyltransferase 2							117.0	107.0	110.0					18																	47329179		2203	4300	6503	SO:0001587	stop_gained	10449				anti-apoptosis|cholesterol biosynthetic process		acetyl-CoA C-acyltransferase activity|protein binding	g.chr18:47329179C>A	D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.61G>T	18.37:g.47329179C>A	ENSP00000285093:p.Gly21*		Somatic				ACAA2_uc002ldx.3_Nonsense_Mutation_p.G18*	p.G21*	NM_006111	NP_006102	WXS	Illumina HiSeq	Unspecified	P42765	THIM_HUMAN			2	458	-			21					Q9BUT6	Nonsense_Mutation	SNP	ENST00000285093.10	37	c.61G>T	CCDS11939.1	.	.	.	.	.	.	.	.	.	.	C	40	8.427283	0.98806	.	.	ENSG00000167315	ENST00000285093	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-20.8355	19.3136	0.94202	0.0:1.0:0.0:0.0	.	.	.	.	X	21	.	ENSP00000285093:G21X	G	-	1	0	ACAA2	45583177	1.000000	0.71417	0.966000	0.40874	0.865000	0.49528	7.693000	0.84214	2.659000	0.90383	0.655000	0.94253	GGA		0.453	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255921.2	NM_006111		21	50	1	0	7.41877e-09	0.00188189	2.89675e-08	21	50				
SERPINB3	6317	broad.mit.edu	37	18	61328320	61328320	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:61328320C>A	ENST00000283752.5	-	2	274	c.131G>T	c.(130-132)gGa>gTa	p.G44V	SERPINB11_ENST00000489748.1_RNA|SERPINB3_ENST00000332821.8_Missense_Mutation_p.G44V	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	44					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						GTCTTTGGCTCCTAAGAGGAC	0.438																																							uc002ljg.2		NA																	0				ovary(2)|lung(1)	3						c.(130-132)GGA>GTA		SubName: Full=Squamous cell carcinoma antigen 2;							240.0	208.0	219.0					18																	61328320		2203	4300	6503	SO:0001583	missense	6318				immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity	g.chr18:61328320C>A	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.131G>T	18.37:g.61328320C>A	ENSP00000283752:p.Gly44Val		Somatic				SERPINB3_uc002lji.2_Missense_Mutation_p.G44V|SERPINB3_uc010dqa.2_Missense_Mutation_p.G44V|SERPINB3_uc010dqb.2_Missense_Mutation_p.G44V|SERPINB3_uc010dqc.2_Missense_Mutation_p.G44V	p.G44V			WXS	Illumina HiSeq	Unspecified	P48594	SPB4_HUMAN			1	157	-			44					A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	ENST00000283752.5	37	c.131G>T	CCDS11987.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.595393	0.46318	.	.	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.89123	-2.47;-2.47	3.1	3.1	0.35709	Serpin domain (3);	0.000000	0.40144	N	0.001170	D	0.96327	0.8802	H	0.98351	4.21	0.41399	D	0.987663	D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.999	D;D;D;D;D	0.91635	0.999;0.979;0.996;0.979;0.979	D	0.96931	0.9681	10	0.87932	D	0	.	12.1414	0.54000	0.0:0.8254:0.1746:0.0	.	44;44;44;44;44	B3W5Y6;A8K847;P29508-2;P29508;Q5K684	.;.;.;SPB3_HUMAN;.	V	44	ENSP00000283752:G44V;ENSP00000329498:G44V	ENSP00000283752:G44V	G	-	2	0	SERPINB3	59479300	0.999000	0.42202	0.027000	0.17364	0.005000	0.04900	6.008000	0.70739	2.054000	0.61138	0.555000	0.69702	GGA		0.438	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919		28	97	1	0	5.60225e-13	0.00178596	2.5145e-12	28	97				
SERPINB10	5273	broad.mit.edu	37	18	61602259	61602259	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:61602259C>A	ENST00000238508.3	+	8	1036	c.977C>A	c.(976-978)tCt>tAt	p.S326Y	AC009802.1_ENST00000599868.1_Intron	NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	326					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				TCAGGAATGTCTTCAGCAAGA	0.428																																							uc010xev.1		NA																	0				lung(1)|kidney(1)|skin(1)	3						c.(976-978)TCT>TAT		serine (or cysteine) proteinase inhibitor, clade							141.0	124.0	130.0					18																	61602259		2203	4300	6503	SO:0001583	missense	5273					cytoplasm|nucleus	serine-type endopeptidase inhibitor activity	g.chr18:61602259C>A	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.977C>A	18.37:g.61602259C>A	ENSP00000238508:p.Ser326Tyr		Somatic				SERPINB10_uc010xew.1_Missense_Mutation_p.S326Y	p.S326Y	NM_005024	NP_005015	WXS	Illumina HiSeq	Unspecified	P48595	SPB10_HUMAN			8	1067	+		Esophageal squamous(42;0.131)	326					Q4VAX4|Q4VAX7	Missense_Mutation	SNP	ENST00000238508.3	37	c.977C>A	CCDS11990.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969241	0.34754	.	.	ENSG00000242550	ENST00000238508	D	0.84070	-1.8	5.65	4.77	0.60923	Serpin domain (3);	0.239813	0.44097	D	0.000493	D	0.92655	0.7666	M	0.92923	3.36	0.47476	D	0.99943	D	0.76494	0.999	D	0.69479	0.964	D	0.94427	0.7646	10	0.87932	D	0	.	15.3559	0.74425	0.1406:0.8594:0.0:0.0	.	326	P48595	SPB10_HUMAN	Y	326	ENSP00000238508:S326Y	ENSP00000238508:S326Y	S	+	2	0	SERPINB10	59753239	0.715000	0.27946	0.822000	0.32727	0.014000	0.08584	3.008000	0.49544	1.511000	0.48818	-0.181000	0.13052	TCT		0.428	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	NM_005024		16	32	1	0	6.31663e-08	0.00316338	2.36392e-07	16	32				
PQLC1	80148	broad.mit.edu	37	18	77703343	77703343	+	Missense_Mutation	SNP	C	C	A	rs139297349		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr18:77703343C>A	ENST00000397778.2	-	3	505	c.323G>T	c.(322-324)cGc>cTc	p.R108L	PQLC1_ENST00000357575.4_Missense_Mutation_p.R108L|PQLC1_ENST00000590381.1_Missense_Mutation_p.R108L|PQLC1_ENST00000409073.1_Missense_Mutation_p.R25L	NM_025078.4	NP_079354.2	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1	108						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	9		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		AAAGGAGCGGCGCCTGGCGTT	0.587																																							uc002lnl.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(322-324)CGC>CTC		PQ loop repeat containing 1 isoform 1							116.0	118.0	117.0					18																	77703343		2203	4300	6503	SO:0001583	missense	80148					integral to membrane		g.chr18:77703343C>A	AK123870	CCDS12020.1, CCDS54192.1, CCDS54193.1	18q23	2004-01-14			ENSG00000122490	ENSG00000122490			26188	protein-coding gene	gene with protein product						12477932	Standard	NM_025078		Approved	FLJ22378	uc002lnl.2	Q8N2U9	OTTHUMG00000132921	ENST00000397778.2:c.323G>T	18.37:g.77703343C>A	ENSP00000380880:p.Arg108Leu		Somatic				PQLC1_uc010dre.2_Missense_Mutation_p.R25L|PQLC1_uc002lnk.2_Missense_Mutation_p.R108L|PQLC1_uc010xfm.1_Missense_Mutation_p.R108L	p.R108L	NM_025078	NP_079354	WXS	Illumina HiSeq	Unspecified	Q8N2U9	PQLC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)	3	495	-		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)	108					B7Z7D9|G5E989|Q9H6D0	Missense_Mutation	SNP	ENST00000397778.2	37	c.323G>T	CCDS12020.1	.	.	.	.	.	.	.	.	.	.	C	14.02	2.411368	0.42817	.	.	ENSG00000122490	ENST00000397778;ENST00000409073;ENST00000357575;ENST00000351365	.	.	.	5.47	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.77432	0.4129	M	0.79475	2.455	0.80722	D	1	D;P;D	0.89917	1.0;0.683;0.998	D;B;D	0.66196	0.926;0.342;0.942	T	0.79685	-0.1700	9	0.51188	T	0.08	-34.2018	14.4244	0.67204	0.0:0.9276:0.0:0.0724	.	108;108;108	B7Z7D9;Q8N2U9;G5E989	.;PQLC1_HUMAN;.	L	108;25;108;108	.	ENSP00000315627:R108L	R	-	2	0	PQLC1	75804331	1.000000	0.71417	0.962000	0.40283	0.045000	0.14185	4.214000	0.58527	1.434000	0.47414	0.655000	0.94253	CGC		0.587	PQLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256434.1	NM_025078		28	114	1	0	2.47511e-08	0.001512	9.55391e-08	28	114				
ABCA7	10347	broad.mit.edu	37	19	1053825	1053825	+	Silent	SNP	A	A	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:1053825A>C	ENST00000263094.6	+	25	3693	c.3462A>C	c.(3460-3462)acA>acC	p.T1154T	ABCA7_ENST00000433129.1_Silent_p.T1154T|ABCA7_ENST00000435683.2_Silent_p.T1016T	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1154					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCGGACACAGATATGGAGG	0.627																																							uc002lqw.3		NA																	0				pancreas(7)|ovary(1)|central_nervous_system(1)	9						c.(3460-3462)ACA>ACC		ATP-binding cassette, sub-family A, member 7							89.0	90.0	90.0					19																	1053825		2203	4300	6503	SO:0001819	synonymous_variant	10347				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity	g.chr19:1053825A>C	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.3462A>C	19.37:g.1053825A>C			Somatic				ABCA7_uc010dsb.1_Silent_p.T1016T	p.T1154T	NM_019112	NP_061985	WXS	Illumina HiSeq	Unspecified	Q8IZY2	ABCA7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	25	3693	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)	1154					Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	c.3462A>C	CCDS12055.1																																																																																				0.627	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112		8	49	0	0	0	0.000442599	0	8	49				
PCSK4	54760	broad.mit.edu	37	19	1488005	1488005	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:1488005G>T	ENST00000300954.5	-	4	535	c.474C>A	c.(472-474)gaC>gaA	p.D158E	PCSK4_ENST00000587784.1_5'UTR|CTB-25B13.6_ENST00000585643.1_RNA	NM_017573.3	NP_060043.2			proprotein convertase subtilisin/kexin type 4											cervix(2)|endometrium(2)|kidney(1)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGATGCCATCGTCCAGCACAG	0.682																																							uc002ltb.1		NA																	0					0						c.(472-474)GAC>GAA		proprotein convertase subtilisin/kexin type 4							93.0	91.0	92.0					19																	1488005		2203	4300	6503	SO:0001583	missense	54760				proteolysis	integral to membrane	serine-type endopeptidase activity	g.chr19:1488005G>T	AK057235	CCDS12069.2	19p13.3	2008-02-05			ENSG00000115257	ENSG00000115257			8746	protein-coding gene	gene with protein product		600487				7782070	Standard	XM_005259586		Approved	PC4, SPC5, DKFZp434B217, MGC34749	uc002ltb.1	Q6UW60	OTTHUMG00000128541	ENST00000300954.5:c.474C>A	19.37:g.1488005G>T	ENSP00000300954:p.Asp158Glu		Somatic				PCSK4_uc002lta.2_5'UTR	p.D158E	NM_017573	NP_060043	WXS	Illumina HiSeq	Unspecified	Q6UW60	PCSK4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	4	536	-		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)	158			Catalytic (By similarity).	Charge relay system (By similarity).		Missense_Mutation	SNP	ENST00000300954.5	37	c.474C>A	CCDS12069.2	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726669	0.48833	.	.	ENSG00000115257	ENST00000300954	D	0.97665	-4.48	2.67	-4.66	0.03329	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.51477	D	0.000087	D	0.98492	0.9497	H	0.97291	3.975	0.54753	D	0.99998	D	0.89917	1.0	D	0.85130	0.997	D	0.96804	0.9591	10	0.87932	D	0	.	9.0522	0.36383	0.722:0.0:0.278:0.0	.	158	Q6UW60	PCSK4_HUMAN	E	158	ENSP00000300954:D158E	ENSP00000300954:D158E	D	-	3	2	PCSK4	1439005	0.003000	0.15002	0.964000	0.40570	0.521000	0.34408	-1.282000	0.02799	-0.723000	0.04915	-1.169000	0.01745	GAC		0.682	PCSK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449703.1	NM_017573		15	62	1	0	4.14922e-12	0.00400662	1.83189e-11	15	62				
NMRK2	27231	broad.mit.edu	37	19	3941117	3941117	+	Missense_Mutation	SNP	C	C	A	rs142587749		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:3941117C>A	ENST00000168977.2	+	7	734	c.444C>A	c.(442-444)caC>caA	p.H148Q	NMRK2_ENST00000593949.1_Missense_Mutation_p.H153Q|NMRK2_ENST00000599576.1_Intron	NM_170678.2	NP_733778.1	Q9NPI5	NRK2_HUMAN	nicotinamide riboside kinase 2	148					NAD biosynthetic process (GO:0009435)|negative regulation of myoblast differentiation (GO:0045662)	intracellular (GO:0005622)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|ribosylnicotinamide kinase activity (GO:0050262)										TCGATGGCCACGTGTGGCCCA	0.612																																							uc002lyz.3		NA																	0				skin(2)	2						c.(442-444)CAC>CAA		integrin beta 1 binding protein 3							136.0	118.0	124.0					19																	3941117		2203	4300	6503	SO:0001583	missense	27231				pyridine nucleotide biosynthetic process		ATP binding|metal ion binding|protein binding|ribosylnicotinamide kinase activity	g.chr19:3941117C>A	AF190819	CCDS12115.1, CCDS74259.1	19p13.3	2013-10-28	2012-05-31	2012-05-31	ENSG00000077009	ENSG00000077009			17871	protein-coding gene	gene with protein product	"""muscle-specific beta 1 integrin binding protein"", ""nicotinamide riboside kinase 2"""	608705	"""integrin beta 1 binding protein 3"""	ITGB1BP3		10613898, 15137942	Standard	NM_170678		Approved	MIBP, NRK2	uc002lyz.4	Q9NPI5	OTTHUMG00000181758	ENST00000168977.2:c.444C>A	19.37:g.3941117C>A	ENSP00000168977:p.His148Gln		Somatic				ITGB1BP3_uc010xia.1_Missense_Mutation_p.H153Q	p.H148Q	NM_170678	NP_733778	WXS	Illumina HiSeq	Unspecified	Q9NPI5	NRK2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00463)|STAD - Stomach adenocarcinoma(1328;0.18)	7	734	+		Hepatocellular(1079;0.137)	148					B7ZKR3|Q52M81|Q9NZK3	Missense_Mutation	SNP	ENST00000168977.2	37	c.444C>A	CCDS12115.1	.	.	.	.	.	.	.	.	.	.	C	9.259	1.042615	0.19748	.	.	ENSG00000077009	ENST00000168977	T	0.61859	0.07	4.03	-0.773	0.10995	.	0.000000	0.85682	U	0.000000	T	0.70107	0.3186	M	0.83603	2.65	0.37867	D	0.929935	D;D	0.89917	0.999;1.0	D;D	0.97110	0.999;1.0	T	0.68269	-0.5453	10	0.29301	T	0.29	-35.9171	7.6955	0.28592	0.0:0.4911:0.0:0.5089	.	153;148	B7ZKR3;Q9NPI5	.;NRK2_HUMAN	Q	148	ENSP00000168977:H148Q	ENSP00000168977:H148Q	H	+	3	2	ITGB1BP3	3892117	0.599000	0.26891	0.955000	0.39395	0.132000	0.20833	-0.366000	0.07563	-0.066000	0.12998	-0.216000	0.12614	CAC		0.612	NMRK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457492.1	NM_014446, NM_170678		5	36	1	0	2.0095e-06	0.00198382	6.9433e-06	5	36				
MAP2K2	5605	broad.mit.edu	37	19	4110509	4110509	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:4110509T>A	ENST00000262948.5	-	3	701	c.448A>T	c.(448-450)Atg>Ttg	p.M150L	MAP2K2_ENST00000599345.1_5'UTR|MAP2K2_ENST00000394867.4_Missense_Mutation_p.M53L	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	150	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	GCACTCACCATGTGTTCCATG	0.627																																							uc002lzk.2		NA																	0					0						c.(448-450)ATG>TTG		mitogen-activated protein kinase kinase 2							76.0	66.0	69.0					19																	4110509		2203	4300	6503	SO:0001583	missense	5605	Cardiofaciocutaneous_syndrome			activation of MAPK activity|activation of MAPKK activity|axon guidance|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|extracellular region	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr19:4110509T>A	L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.448A>T	19.37:g.4110509T>A	ENSP00000262948:p.Met150Leu		Somatic					p.M150L	NM_030662	NP_109587	WXS	Illumina HiSeq	Unspecified	P36507	MP2K2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	3	702	-		Hepatocellular(1079;0.137)	150			Protein kinase.			Missense_Mutation	SNP	ENST00000262948.5	37	c.448A>T	CCDS12120.1	.	.	.	.	.	.	.	.	.	.	t	29.9	5.046015	0.93685	.	.	ENSG00000126934	ENST00000262948;ENST00000394867	D;D	0.92249	-3.0;-3.0	5.3	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94235	0.8149	L	0.46741	1.465	0.80722	D	1	D	0.67145	0.996	D	0.85130	0.997	D	0.94821	0.7987	10	0.87932	D	0	-55.061	14.0565	0.64772	0.0:0.0:0.0:1.0	.	150	P36507	MP2K2_HUMAN	L	150;53	ENSP00000262948:M150L;ENSP00000378336:M53L	ENSP00000262948:M150L	M	-	1	0	MAP2K2	4061509	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.849000	0.86908	1.999000	0.58509	0.459000	0.35465	ATG		0.627	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258957.2			6	44	0	0	0	0.00198382	0	6	44				
MUC16	94025	broad.mit.edu	37	19	9028337	9028337	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:9028337G>T	ENST00000397910.4	-	11	36658	c.36455C>A	c.(36454-36456)cCt>cAt	p.P12152H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12154	SEA 1. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGGTCTTCAGGGTCAGGGCG	0.572																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(36454-36456)CCT>CAT		mucin 16							164.0	167.0	166.0					19																	9028337		2106	4222	6328	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9028337G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36455C>A	19.37:g.9028337G>T	ENSP00000381008:p.Pro12152His		Somatic					p.P12152H	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			11	36659	-			12154			SEA 1.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.36455C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.477326	0.26511	.	.	ENSG00000181143	ENST00000397910	D	0.84298	-1.83	2.63	2.63	0.31362	.	.	.	.	.	D	0.90645	0.7066	M	0.78049	2.395	.	.	.	D	0.89917	1.0	D	0.87578	0.998	D	0.92169	0.5742	8	0.87932	D	0	.	8.8909	0.35432	0.0:0.0:1.0:0.0	.	12152	B5ME49	.	H	12152	ENSP00000381008:P12152H	ENSP00000381008:P12152H	P	-	2	0	MUC16	8889337	0.993000	0.37304	0.087000	0.20705	0.034000	0.12701	3.908000	0.56355	1.757000	0.51966	0.591000	0.81541	CCT		0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		23	81	1	0	4.16121e-05	0.00278032	0.000133534	23	81				
MUC16	94025	broad.mit.edu	37	19	9090346	9090346	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:9090346G>T	ENST00000397910.4	-	1	1672	c.1469C>A	c.(1468-1470)tCt>tAt	p.S490Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	490	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGCCTCCCAGAGGTGCTGCC	0.537																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(1468-1470)TCT>TAT		mucin 16							110.0	107.0	108.0					19																	9090346		2039	4194	6233	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9090346G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1469C>A	19.37:g.9090346G>T	ENSP00000381008:p.Ser490Tyr		Somatic					p.S490Y	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	1673	-			490			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.1469C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.451	0.083495	0.08533	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.36	1.36	0.22044	.	.	.	.	.	T	0.03178	0.0093	N	0.08118	0	.	.	.	D	0.62365	0.991	P	0.56163	0.793	T	0.44314	-0.9336	8	0.87932	D	0	.	6.1127	0.20110	0.0:0.0:1.0:0.0	.	490	B5ME49	.	Y	490	ENSP00000381008:S490Y	ENSP00000381008:S490Y	S	-	2	0	MUC16	8951346	0.002000	0.14202	0.005000	0.12908	0.268000	0.26511	0.556000	0.23438	1.052000	0.40392	0.313000	0.20887	TCT		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		15	54	1	0	2.32078e-09	0.00316338	9.19466e-09	15	54				
OR7G2	390882	broad.mit.edu	37	19	9213468	9213468	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:9213468G>A	ENST00000305456.2	-	1	514	c.515C>T	c.(514-516)aCt>aTt	p.T172I		NM_001005193.1	NP_001005193.1	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G, member 2	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|skin(3)	16						CACAACACTAGTCAACAGAGA	0.522																																					Esophageal Squamous(67;143 1448 28637 40648)	Esophageal Squamous(67;143 1448 28637 40648)	uc010xkk.1		NA																	0				skin(1)	1						c.(514-516)ACT>ATT		olfactory receptor, family 7, subfamily G,							78.0	71.0	74.0					19																	9213468		2203	4300	6503	SO:0001583	missense	390882				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9213468G>A		CCDS32897.1	19p13.2	2013-09-24			ENSG00000170923	ENSG00000170923		"""GPCR / Class A : Olfactory receptors"""	8466	protein-coding gene	gene with protein product							Standard	NM_001005193		Approved	OST260	uc010xkk.2	Q8NG99	OTTHUMG00000179931	ENST00000305456.2:c.515C>T	19.37:g.9213468G>A	ENSP00000303822:p.Thr172Ile		Somatic					p.T172I	NM_001005193	NP_001005193	WXS	Illumina HiSeq	Unspecified	Q8NG99	OR7G2_HUMAN			1	515	-			151			Helical; Name=4; (Potential).		Q6IFJ4|Q96RA0	Missense_Mutation	SNP	ENST00000305456.2	37	c.515C>T	CCDS32897.1	.	.	.	.	.	.	.	.	.	.	g	0.006	-2.115753	0.00349	.	.	ENSG00000170923	ENST00000305456	T	0.35048	1.33	3.27	1.16	0.20824	GPCR, rhodopsin-like superfamily (1);	0.414923	0.17112	N	0.186572	T	0.06826	0.0174	N	0.00201	-1.865	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.40440	-0.9563	10	0.02654	T	1	.	8.1042	0.30877	0.7869:0.0:0.2131:0.0	.	151	Q8NG99	OR7G2_HUMAN	I	172	ENSP00000303822:T172I	ENSP00000303822:T172I	T	-	2	0	OR7G2	9074468	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.162000	0.10012	0.192000	0.20272	-1.483000	0.00984	ACT		0.522	OR7G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448994.1			7	46	0	0	0	0.00448238	0	7	46				
ZNF699	374879	broad.mit.edu	37	19	9407478	9407478	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:9407478C>A	ENST00000591998.1	-	6	830	c.602G>T	c.(601-603)gGa>gTa	p.G201V	ZNF699_ENST00000308650.3_Missense_Mutation_p.G201V|CTC-325H20.4_ENST00000591336.1_RNA			Q32M78	ZN699_HUMAN	zinc finger protein 699	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GAAGGCCTTTCCACACTCATG	0.418																																							uc002mlc.1		NA																	0					0						c.(601-603)GGA>GTA		zinc finger protein 699							148.0	134.0	139.0					19																	9407478		1999	4183	6182	SO:0001583	missense	374879				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9407478C>A	BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.602G>T	19.37:g.9407478C>A	ENSP00000467723:p.Gly201Val		Somatic					p.G201V	NM_198535	NP_940937	WXS	Illumina HiSeq	Unspecified	Q32M78	ZN699_HUMAN			5	602	-			201			C2H2-type 1.		Q8N9A1	Missense_Mutation	SNP	ENST00000591998.1	37	c.602G>T	CCDS42495.1	.	.	.	.	.	.	.	.	.	.	C	9.767	1.171614	0.21704	.	.	ENSG00000196110	ENST00000308650	T	0.23754	1.89	3.15	-0.369	0.12534	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.166780	0.06766	N	0.782680	T	0.32615	0.0835	M	0.87038	2.855	0.41348	D	0.987342	B	0.09022	0.002	B	0.10450	0.005	T	0.37244	-0.9714	10	0.66056	D	0.02	.	4.248	0.10680	0.2071:0.5944:0.0:0.1985	.	201	Q32M78	ZN699_HUMAN	V	201	ENSP00000311596:G201V	ENSP00000311596:G201V	G	-	2	0	ZNF699	9268478	0.000000	0.05858	0.043000	0.18650	0.007000	0.05969	-0.102000	0.10956	-0.027000	0.13873	-0.324000	0.08512	GGA		0.418	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449010.1	NM_198535		24	99	1	0	8.24728e-16	0.00465635	3.8421e-15	24	99				
DNASE2	1777	broad.mit.edu	37	19	12989306	12989306	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:12989306A>T	ENST00000222219.3	-	5	691	c.599T>A	c.(598-600)gTg>gAg	p.V200E	CTD-2265O21.7_ENST00000592400.1_RNA|DNASE2_ENST00000538460.1_Missense_Mutation_p.V145E	NM_001375.2	NP_001366.1	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal	200					apoptotic DNA fragmentation (GO:0006309)|DNA metabolic process (GO:0006259)|erythrocyte differentiation (GO:0030218)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(4)|ovary(1)	7						GCCCTTGACCACATTCTCCAA	0.552																																							uc002mvn.1		NA																	0					0						c.(598-600)GTG>GAG	Direct_reversal_of_damage	deoxyribonuclease II, lysosomal precursor							119.0	118.0	118.0					19																	12989306		2203	4300	6503	SO:0001583	missense	1777				apoptosis	lysosome	deoxyribonuclease II activity|DNA binding|protein binding	g.chr19:12989306A>T	AF045937	CCDS12284.1	19p13.2	2012-10-02			ENSG00000105612	ENSG00000105612	3.1.22.1		2960	protein-coding gene	gene with protein product		126350		DNL, DNL2		1586130	Standard	NM_001375		Approved		uc002mvn.1	O00115		ENST00000222219.3:c.599T>A	19.37:g.12989306A>T	ENSP00000222219:p.Val200Glu		Somatic				DNASE2_uc010xmr.1_Missense_Mutation_p.V145E	p.V200E	NM_001375	NP_001366	WXS	Illumina HiSeq	Unspecified	O00115	DNS2A_HUMAN			5	745	-			200					B2RD06|B7Z4K6|O43910	Missense_Mutation	SNP	ENST00000222219.3	37	c.599T>A	CCDS12284.1	.	.	.	.	.	.	.	.	.	.	A	11.37	1.617555	0.28801	.	.	ENSG00000105612	ENST00000222219;ENST00000538460	T;T	0.14391	2.51;2.51	5.49	3.25	0.37280	.	0.421448	0.24940	N	0.034399	T	0.28300	0.0699	M	0.83012	2.62	0.09310	N	1	P;P	0.48162	0.906;0.872	P;P	0.55345	0.629;0.774	T	0.11348	-1.0591	10	0.66056	D	0.02	.	5.0122	0.14319	0.6447:0.0:0.3553:0.0	.	145;200	B7Z4K6;O00115	.;DNS2A_HUMAN	E	200;145	ENSP00000222219:V200E;ENSP00000445988:V145E	ENSP00000222219:V200E	V	-	2	0	DNASE2	12850306	0.154000	0.22792	0.019000	0.16419	0.007000	0.05969	1.250000	0.32850	0.914000	0.36822	-0.400000	0.06385	GTG		0.552	DNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451790.1			8	26	0	0	0	0.00307968	0	8	26				
SLC5A5	6528	broad.mit.edu	37	19	17986910	17986910	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:17986910C>A	ENST00000222248.3	+	5	1040	c.693C>A	c.(691-693)ctC>ctA	p.L231L		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	231					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GGATCAACCTCATGGAGTGAG	0.622																																					Melanoma(65;1008 1708 7910 46650)	Melanoma(65;1008 1708 7910 46650)	uc002nhr.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(691-693)CTC>CTA		solute carrier family 5 (sodium iodide							139.0	115.0	123.0					19																	17986910		2203	4300	6503	SO:0001819	synonymous_variant	6528				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity	g.chr19:17986910C>A		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.693C>A	19.37:g.17986910C>A			Somatic					p.L231L	NM_000453	NP_000444	WXS	Illumina HiSeq	Unspecified	Q92911	SC5A5_HUMAN			5	1040	+			231			Extracellular (Potential).		O43702|Q2M335|Q9NYB6	Silent	SNP	ENST00000222248.3	37	c.693C>A	CCDS12368.1																																																																																				0.622	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1			13	35	1	0	5.50884e-06	0.00136819	1.84676e-05	13	35				
NCAN	1463	broad.mit.edu	37	19	19345853	19345853	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:19345853T>A	ENST00000252575.6	+	10	3297	c.3198T>A	c.(3196-3198)aaT>aaA	p.N1066K	NCAN_ENST00000538881.1_Missense_Mutation_p.N517K|RNU6-1028P_ENST00000517164.1_RNA	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1066	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	ATGAGGTCAATGGCTTTGTCT	0.517																																							uc002nlz.2		NA																	0				ovary(4)	4						c.(3196-3198)AAT>AAA		chondroitin sulfate proteoglycan 3 precursor							174.0	138.0	151.0					19																	19345853		2203	4300	6503	SO:0001583	missense	1463				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr19:19345853T>A	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3198T>A	19.37:g.19345853T>A	ENSP00000252575:p.Asn1066Lys		Somatic				NCAN_uc010ecc.1_Missense_Mutation_p.N630K	p.N1066K	NM_004386	NP_004377	WXS	Illumina HiSeq	Unspecified	O14594	NCAN_HUMAN	Epithelial(12;0.00544)		10	3297	+			1066			EGF-like 2; calcium-binding (Potential).		Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	37	c.3198T>A	CCDS12397.1	.	.	.	.	.	.	.	.	.	.	T	17.25	3.342898	0.61073	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	D;D	0.91577	-2.87;-2.87	4.53	-4.82	0.03171	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.43260	D	0.000598	D	0.93674	0.7979	M	0.82056	2.57	0.35635	D	0.81054	D;D	0.89917	1.0;0.997	D;P	0.75484	0.986;0.815	D	0.92843	0.6290	10	0.62326	D	0.03	.	13.8842	0.63699	0.0:0.6774:0.0:0.3226	.	1080;1066	Q4LE67;O14594	.;NCAN_HUMAN	K	1080;1066;517	ENSP00000252575:N1066K;ENSP00000442202:N517K	ENSP00000252575:N1066K	N	+	3	2	NCAN	19206853	0.039000	0.19947	0.033000	0.17914	0.926000	0.56050	-0.394000	0.07296	-1.469000	0.01890	-1.431000	0.01090	AAT		0.517	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386		5	45	0	0	0	0.000602214	0	5	45				
ZNF681	148213	broad.mit.edu	37	19	23927743	23927743	+	Silent	SNP	A	A	G	rs61397759	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:23927743A>G	ENST00000402377.3	-	4	750	c.609T>C	c.(607-609)tgT>tgC	p.C203C	ZNF681_ENST00000395385.3_Silent_p.C134C	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	203					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C134fs*5(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				AGGCTTTTCCACAGTCTTCAC	0.294																																							uc002nrk.3		NA																	1	Deletion - Frameshift(1)		ovary(1)		0						c.(607-609)TGT>TGC		zinc finger protein 681							26.0	23.0	24.0					19																	23927743		2193	4192	6385	SO:0001819	synonymous_variant	148213				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:23927743A>G	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.609T>C	19.37:g.23927743A>G			Somatic				ZNF681_uc002nrl.3_Silent_p.C134C|ZNF681_uc002nrj.3_Silent_p.C134C	p.C203C	NM_138286	NP_612143	WXS	Illumina HiSeq	Unspecified	Q96N22	ZN681_HUMAN			4	751	-		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)	203			C2H2-type 2.		B3KVF7	Silent	SNP	ENST00000402377.3	37	c.609T>C	CCDS12414.2																																																																																				0.294	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286		7	18	0	0	0	0.00448238	0	7	18				
ZNF536	9745	broad.mit.edu	37	19	30934603	30934603	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:30934603A>T	ENST00000355537.3	+	2	281	c.134A>T	c.(133-135)cAt>cTt	p.H45L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	45					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CAGCTCAGCCATGCCTTCCCC	0.682																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(133-135)CAT>CTT		zinc finger protein 536							79.0	79.0	79.0					19																	30934603		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30934603A>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.134A>T	19.37:g.30934603A>T	ENSP00000347730:p.His45Leu		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.H45L	p.H45L	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			2	272	+	Esophageal squamous(110;0.0834)		45					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.134A>T	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	A	16.53	3.148991	0.57151	.	.	ENSG00000198597	ENST00000355537	T	0.09817	2.94	5.37	5.37	0.77165	.	0.049652	0.85682	D	0.000000	T	0.23886	0.0578	L	0.32530	0.975	0.58432	D	0.999998	P;D	0.89917	0.956;1.0	P;D	0.83275	0.63;0.996	T	0.01084	-1.1457	10	0.66056	D	0.02	-5.3781	15.6688	0.77255	1.0:0.0:0.0:0.0	.	45;45	A7E228;O15090	.;ZN536_HUMAN	L	45	ENSP00000347730:H45L	ENSP00000347730:H45L	H	+	2	0	ZNF536	35626443	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.254000	0.95512	2.172000	0.68678	0.379000	0.24179	CAT		0.682	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		9	58	0	0	0	0.000442599	0	9	58				
ZNF536	9745	broad.mit.edu	37	19	31039599	31039599	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:31039599C>A	ENST00000355537.3	+	4	3220	c.3073C>A	c.(3073-3075)Ctg>Atg	p.L1025M		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1025					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGCCAACCACCTGGGCAAAGC	0.557																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(3073-3075)CTG>ATG		zinc finger protein 536							80.0	71.0	74.0					19																	31039599		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31039599C>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3073C>A	19.37:g.31039599C>A	ENSP00000347730:p.Leu1025Met		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.L1025M	p.L1025M	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			4	3211	+	Esophageal squamous(110;0.0834)		1025					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.3073C>A	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442303	0.43326	.	.	ENSG00000198597	ENST00000355537	T	0.10573	2.86	5.89	2.23	0.28157	.	0.000000	0.85682	D	0.000000	T	0.15998	0.0385	N	0.19112	0.55	0.40182	D	0.977307	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.03344	-1.1046	10	0.59425	D	0.04	-24.2891	9.0844	0.36572	0.0:0.6577:0.0:0.3423	.	1025;1025	A7E228;O15090	.;ZN536_HUMAN	M	1025	ENSP00000347730:L1025M	ENSP00000347730:L1025M	L	+	1	2	ZNF536	35731439	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.757000	0.38400	0.835000	0.34877	0.655000	0.94253	CTG		0.557	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		7	49	1	0	1.12685e-05	0.00448238	3.70408e-05	7	49				
TSHZ3	57616	broad.mit.edu	37	19	31770099	31770099	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:31770099G>T	ENST00000240587.4	-	2	927	c.600C>A	c.(598-600)agC>agA	p.S200R		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	200					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					AGAGCTTGCTGCTCTGCCGGT	0.627																																							uc002nsy.3		NA																	0				ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(598-600)AGC>AGA		zinc finger protein 537							64.0	60.0	61.0					19																	31770099		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31770099G>T	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.600C>A	19.37:g.31770099G>T	ENSP00000240587:p.Ser200Arg		Somatic					p.S200R	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	665	-	Esophageal squamous(110;0.226)		200					Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.600C>A	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760882	0.69763	.	.	ENSG00000121297	ENST00000240587	T	0.13307	2.6	5.42	4.38	0.52667	.	0.044268	0.85682	D	0.000000	T	0.29256	0.0728	L	0.44542	1.39	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.02214	-1.1194	10	0.87932	D	0	-24.2671	13.9862	0.64337	0.073:0.0:0.927:0.0	.	200	Q63HK5	TSH3_HUMAN	R	200	ENSP00000240587:S200R	ENSP00000240587:S200R	S	-	3	2	TSHZ3	36461939	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.434000	0.73408	1.260000	0.44134	0.655000	0.94253	AGC		0.627	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		9	34	1	0	1.08611e-07	0.000978159	3.99818e-07	9	34				
ZFP30	22835	broad.mit.edu	37	19	38126323	38126323	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:38126323C>A	ENST00000351218.2	-	6	1676	c.1119G>T	c.(1117-1119)caG>caT	p.Q373H	ZFP30_ENST00000514101.2_Missense_Mutation_p.Q373H|ZFP30_ENST00000392144.1_Missense_Mutation_p.Q373H|ZFP30_ENST00000589018.1_Intron	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TATGTATTCTCTGATGGAGAG	0.403																																							uc002ogv.1		NA																	0					0						c.(1117-1119)CAG>CAT		zinc finger protein 30 homolog							69.0	72.0	71.0					19																	38126323		2203	4300	6503	SO:0001583	missense	22835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38126323C>A	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.1119G>T	19.37:g.38126323C>A	ENSP00000343581:p.Gln373His		Somatic				ZFP30_uc002ogw.1_Missense_Mutation_p.Q373H|ZFP30_uc002ogx.1_Missense_Mutation_p.Q373H|ZFP30_uc010xtt.1_Missense_Mutation_p.Q372H	p.Q373H	NM_014898	NP_055713	WXS	Illumina HiSeq	Unspecified	Q9Y2G7	ZFP30_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1635	-			373			C2H2-type 8.		Q58EY8	Missense_Mutation	SNP	ENST00000351218.2	37	c.1119G>T	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525449	0.27299	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	T;T;T	0.18502	2.21;2.21;2.21	3.9	2.86	0.33363	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.247697	0.21206	N	0.078383	T	0.14442	0.0349	L	0.46819	1.47	0.31464	N	0.669196	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.05920	-1.0856	10	0.51188	T	0.08	.	7.4869	0.27439	0.0:0.7931:0.0:0.2069	.	373;373	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	H	373;373;373;288	ENSP00000343581:Q373H;ENSP00000422930:Q373H;ENSP00000375988:Q373H	ENSP00000343581:Q373H	Q	-	3	2	ZFP30	42818163	0.003000	0.15002	1.000000	0.80357	0.982000	0.71751	0.795000	0.26972	0.987000	0.38709	0.591000	0.81541	CAG		0.403	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898		21	66	1	0	5.26018e-13	0.00188189	2.36883e-12	21	66				
MAP4K1	11184	broad.mit.edu	37	19	39103262	39103262	+	Silent	SNP	C	C	G	rs373092159		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:39103262C>G	ENST00000591517.1	-	9	682	c.654G>C	c.(652-654)gtG>gtC	p.V218V	MAP4K1_ENST00000586296.1_Silent_p.V218V|MAP4K1_ENST00000396857.2_Silent_p.V218V|MAP4K1_ENST00000589002.1_5'UTR|MAP4K1_ENST00000589130.1_Silent_p.V214V|MAP4K1_ENST00000423454.2_5'UTR	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	218	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGAGAGGGTGCACATCAAAGA	0.622																																							uc002oix.1		NA																	0				skin(4)|lung(3)|ovary(1)	8						c.(652-654)GTG>GTC		mitogen-activated protein kinase kinase kinase							40.0	45.0	43.0					19																	39103262		2112	4248	6360	SO:0001819	synonymous_variant	11184				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity	g.chr19:39103262C>G	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.654G>C	19.37:g.39103262C>G			Somatic				MAP4K1_uc002oiy.1_Silent_p.V218V|MAP4K1_uc010xug.1_5'UTR	p.V218V	NM_007181	NP_009112	WXS	Illumina HiSeq	Unspecified	Q92918	M4K1_HUMAN	Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)		9	762	-	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		218			Protein kinase.			Silent	SNP	ENST00000591517.1	37	c.654G>C	CCDS59385.1																																																																																				0.622	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	NM_001042600		6	24	0	0	0	0.00116845	0	6	24				
PSG7	5676	broad.mit.edu	37	19	43430685	43430685	+	RNA	SNP	G	G	T	rs528891743		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:43430685G>T	ENST00000406070.2	-	0	989				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				CGTGACACTGGGTAGAATGAG	0.502																																							uc002ovl.3		NA																	0					0						c.(892-894)CCC>CAC		pregnancy specific beta-1-glycoprotein 7							194.0	181.0	185.0					19																	43430685		2200	4281	6481			5676				female pregnancy	extracellular region		g.chr19:43430685G>T			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43430685G>T			Somatic				PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_RNA|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Missense_Mutation_p.P176H	p.P298H	NM_002783	NP_002774	WXS	Illumina HiSeq	Unspecified	Q13046	PSG7_HUMAN			5	995	-		Prostate(69;0.00682)	298			Ig-like C2-type 2.		Q15232	Missense_Mutation	SNP	ENST00000406070.2	37	c.893C>A																																																																																					0.502	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650		41	188	1	0	1.41504e-22	0.00285205	6.95168e-22	41	188				
PSG4	5672	broad.mit.edu	37	19	43708326	43708326	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:43708326C>A	ENST00000405312.3	-	2	379	c.142G>T	c.(142-144)Ggg>Tgg	p.G48W	PSG4_ENST00000433626.2_Missense_Mutation_p.G48W|PSG4_ENST00000244295.9_Missense_Mutation_p.G48W	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	48	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				ACATCCTTCCCCTCAGAAACT	0.463																																							uc002ovy.2		NA																	0				ovary(1)	1						c.(142-144)GGG>TGG		pregnancy specific beta-1-glycoprotein 4 isoform							148.0	161.0	157.0					19																	43708326		2139	4268	6407	SO:0001583	missense	5672				defense response|female pregnancy	extracellular region		g.chr19:43708326C>A		CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.142G>T	19.37:g.43708326C>A	ENSP00000384770:p.Gly48Trp		Somatic				PSG4_uc002owa.2_RNA|PSG4_uc002owb.2_Missense_Mutation_p.G48W|PSG4_uc002ovz.2_Missense_Mutation_p.G48W	p.G48W	NM_002780	NP_002771	WXS	Illumina HiSeq	Unspecified	Q00888	PSG4_HUMAN			2	244	-		Prostate(69;0.00682)	48			Ig-like V-type.		E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Missense_Mutation	SNP	ENST00000405312.3	37	c.142G>T	CCDS46093.1	.	.	.	.	.	.	.	.	.	.	N	12.73	2.026265	0.35701	.	.	ENSG00000243137	ENST00000244295;ENST00000405312;ENST00000433626;ENST00000451895	D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52	1.65	1.65	0.23941	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89427	0.6712	M	0.89715	3.055	0.09310	N	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.997;1.0;0.999	T	0.76884	-0.2794	9	0.87932	D	0	.	6.8053	0.23774	0.0:1.0:0.0:0.0	.	48;48;48	E7EX79;Q00888-2;Q00888	.;.;PSG4_HUMAN	W	48;48;48;64	ENSP00000244295:G48W;ENSP00000384770:G48W;ENSP00000387864:G48W;ENSP00000388134:G64W	ENSP00000244295:G48W	G	-	1	0	PSG4	48400166	0.129000	0.22400	0.005000	0.12908	0.284000	0.27059	1.770000	0.38532	1.251000	0.43983	0.173000	0.16961	GGG		0.463	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633		32	178	1	0	1.71298e-08	0.00375469	6.6501e-08	32	178				
TEX101	83639	broad.mit.edu	37	19	43920616	43920616	+	Silent	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:43920616G>C	ENST00000598265.1	+	4	466	c.300G>C	c.(298-300)ctG>ctC	p.L100L	TEX101_ENST00000601707.1_3'UTR|TEX101_ENST00000253435.7_Silent_p.L118L|TEX101_ENST00000602198.1_Silent_p.L118L	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	100						acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				CTCCCGGCCTGATCGTGACCT	0.527																																							uc010xwo.1		NA																	0				ovary(1)	1						c.(298-300)CTG>CTC		testis expressed 101 isoform 2							216.0	200.0	206.0					19																	43920616		2203	4300	6503	SO:0001819	synonymous_variant	83639					anchored to membrane|plasma membrane		g.chr19:43920616G>C	AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.300G>C	19.37:g.43920616G>C			Somatic				TEX101_uc002owk.2_Silent_p.L118L	p.L100L	NM_001130011	NP_001123483	WXS	Illumina HiSeq	Unspecified	Q9BY14	TX101_HUMAN			4	495	+		Prostate(69;0.0199)	100					Q7L5R2|Q9BPY7	Silent	SNP	ENST00000598265.1	37	c.300G>C	CCDS59393.1																																																																																				0.527	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000463176.1	NM_031451		28	143	0	0	0	0.00178596	0	28	143				
SLC8A2	6543	broad.mit.edu	37	19	47935674	47935674	+	Silent	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:47935674G>C	ENST00000236877.6	-	9	2534	c.2139C>G	c.(2137-2139)tcC>tcG	p.S713S	SLC8A2_ENST00000539381.1_Silent_p.S176S|SLC8A2_ENST00000542837.1_Silent_p.S469S|SLC8A2_ENST00000601757.1_5'UTR	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	713					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		GCTCCTCCCGGGACCCGTCCT	0.622																																							uc002pgx.2		NA																	0				skin(3)|ovary(1)	4						c.(2137-2139)TCC>TCG		solute carrier family 8 member 2 precursor							66.0	69.0	68.0					19																	47935674		2203	4300	6503	SO:0001819	synonymous_variant	6543				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding	g.chr19:47935674G>C	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.2139C>G	19.37:g.47935674G>C			Somatic				SLC8A2_uc010xyq.1_Silent_p.S469S|SLC8A2_uc010xyr.1_Silent_p.S176S|SLC8A2_uc010ele.2_Silent_p.S713S	p.S713S	NM_015063	NP_055878	WXS	Illumina HiSeq	Unspecified	Q9UPR5	NAC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)	9	2417	-		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)	713			Cytoplasmic (Potential).		B4DYQ9	Silent	SNP	ENST00000236877.6	37	c.2139C>G	CCDS33065.1																																																																																				0.622	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1			6	35	0	0	0	0.00198382	0	6	35				
KLK2	3817	broad.mit.edu	37	19	51381809	51381809	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:51381809C>A	ENST00000325321.3	+	5	1005	c.780C>A	c.(778-780)aaC>aaA	p.N260K	KLK2_ENST00000391810.2_Missense_Mutation_p.N158K|KLK2_ENST00000358049.4_3'UTR			P20151	KLK2_HUMAN	kallikrein-related peptidase 2	260					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)		KLK2/ETV1(3)|KLK2/ETV4(2)	large_intestine(3)|lung(6)|ovary(1)|skin(1)	11		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		TCGCAGCCAACCCCTGAGTGC	0.557			T	ETV4	prostate																																		uc002ptv.2		NA		Dom	yes		19	19q13.41	3817	T	kallikrein-related peptidase 2			E	ETV4		prostate		0				ovary(1)|skin(1)	2						c.(778-780)AAC>AAA		kallikrein 2, prostatic isoform 1							169.0	155.0	160.0					19																	51381809		2203	4300	6503	SO:0001583	missense	3817				proteolysis		serine-type endopeptidase activity	g.chr19:51381809C>A	M18157	CCDS12808.1, CCDS42597.1, CCDS58675.1	19q13.33	2008-02-05	2006-10-27				3.4.21.35	"""Kallikreins"""	6363	protein-coding gene	gene with protein product		147960	"""kallikrein 2, prostatic"""			2468530, 16800724, 16800723	Standard	NM_005551		Approved		uc002ptv.3	P20151		ENST00000325321.3:c.780C>A	19.37:g.51381809C>A	ENSP00000313581:p.Asn260Lys		Somatic				KLK2_uc002ptu.2_3'UTR|KLK2_uc002ptt.2_RNA|KLK2_uc010ycl.1_Missense_Mutation_p.N243K|KLK2_uc010ycm.1_Missense_Mutation_p.N158K|KLK2_uc010eoh.2_Missense_Mutation_p.N158K	p.N260K	NM_005551	NP_005542	WXS	Illumina HiSeq	Unspecified	P20151	KLK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)	5	821	+		all_neural(266;0.026)	260					B4DU93|B4DUB0|F5H8L3|Q15946|Q9UJZ9	Missense_Mutation	SNP	ENST00000325321.3	37	c.780C>A	CCDS12808.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867975	0.51588	.	.	ENSG00000167751	ENST00000325321;ENST00000391810	D;D	0.89681	-2.5;-2.55	3.54	-0.178	0.13303	Peptidase cysteine/serine, trypsin-like (1);	0.000000	0.41605	D	0.000852	D	0.91680	0.7370	M	0.69523	2.12	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.953	D	0.84060	0.0374	10	0.87932	D	0	.	8.3205	0.32126	0.0:0.6776:0.0:0.3224	.	243;260	B4DU77;P20151	.;KLK2_HUMAN	K	260;158	ENSP00000313581:N260K;ENSP00000375686:N158K	ENSP00000313581:N260K	N	+	3	2	KLK2	56073621	0.017000	0.18338	0.014000	0.15608	0.116000	0.19942	-0.054000	0.11826	0.113000	0.18004	0.563000	0.77884	AAC		0.557	KLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464438.3	NM_005551.3		17	71	1	0	1.33834e-09	0.000958276	5.38123e-09	17	71				
SIGLEC8	27181	broad.mit.edu	37	19	51955805	51955805	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:51955805C>A	ENST00000321424.3	-	7	1394	c.1328G>T	c.(1327-1329)gGa>gTa	p.G443V	SIGLEC8_ENST00000430817.1_Missense_Mutation_p.G334V|SIGLEC8_ENST00000340550.5_Missense_Mutation_p.G350V|SIGLEC8_ENST00000597352.1_5'Flank	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	443					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		ATGGAGCTCTCCTTCCTCCCC	0.567																																							uc002pwt.2		NA																	0				ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5						c.(1327-1329)GGA>GTA		sialic acid binding Ig-like lectin 8 precursor							61.0	60.0	60.0					19																	51955805		2203	4300	6503	SO:0001583	missense	27181				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity	g.chr19:51955805C>A	AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.1328G>T	19.37:g.51955805C>A	ENSP00000321077:p.Gly443Val		Somatic				SIGLEC8_uc010yda.1_Missense_Mutation_p.G334V|SIGLEC8_uc002pwu.2_Intron|SIGLEC8_uc010eox.2_Missense_Mutation_p.G350V	p.G443V	NM_014442	NP_055257	WXS	Illumina HiSeq	Unspecified	Q9NYZ4	SIGL8_HUMAN		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)	7	1395	-		all_neural(266;0.0199)	443			Cytoplasmic (Potential).		Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	c.1328G>T	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	12.19	1.862886	0.32884	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.04758	3.56;3.56;3.56	3.09	-3.89	0.04193	.	.	.	.	.	T	0.03695	0.0105	L	0.36672	1.1	0.09310	N	1	P;D;P	0.53312	0.93;0.959;0.93	B;B;B	0.42188	0.379;0.362;0.258	T	0.31861	-0.9928	9	0.49607	T	0.09	.	3.9366	0.09309	0.0:0.2568:0.3773:0.3659	.	334;350;443	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	V	334;443;350	ENSP00000389142:G334V;ENSP00000321077:G443V;ENSP00000339448:G350V	ENSP00000321077:G443V	G	-	2	0	SIGLEC8	56647617	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.972000	0.03802	-0.510000	0.06523	-0.467000	0.05162	GGA		0.567	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442		12	33	1	0	5.50884e-06	0.00136819	1.84676e-05	12	33				
ZNF534	147658	broad.mit.edu	37	19	52937229	52937229	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:52937229G>A	ENST00000332323.6	+	2	98	c.37G>A	c.(37-39)Gtg>Atg	p.V13M	ZNF534_ENST00000301085.4_Missense_Mutation_p.V13M|ZNF534_ENST00000432303.2_Missense_Mutation_p.V13M|ZNF534_ENST00000433050.1_Missense_Mutation_p.V13M	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	13	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						ATTCAGCGATGTGGCCATAGA	0.443																																							uc002pzk.2		NA																	0					0						c.(37-39)GTG>ATG		zinc finger protein 534 isoform 2							111.0	102.0	105.0					19																	52937229		1568	3582	5150	SO:0001583	missense	147658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52937229G>A	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.37G>A	19.37:g.52937229G>A	ENSP00000327538:p.Val13Met		Somatic				ZNF534_uc002pzj.1_Missense_Mutation_p.V13M|ZNF534_uc010epo.1_Missense_Mutation_p.V13M|ZNF534_uc002pzl.2_Missense_Mutation_p.V13M	p.V13M	NM_001143939	NP_001137411	WXS	Illumina HiSeq	Unspecified	Q76KX8	ZN534_HUMAN			2	98	+			13			KRAB.		Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	37	c.37G>A	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	G	10.18	1.278587	0.23307	.	.	ENSG00000198633	ENST00000301085;ENST00000432303;ENST00000332323;ENST00000433050;ENST00000391790	T;T;T;T	0.10382	2.88;2.88;2.88;2.88	0.978	-0.176	0.13311	Krueppel-associated box (4);	.	.	.	.	T	0.35970	0.0950	M	0.92649	3.33	0.20821	N	0.999846	D;P;D;D	0.89917	1.0;0.842;0.999;1.0	D;B;D;D	0.97110	0.999;0.201;0.998;1.0	T	0.07947	-1.0746	9	0.87932	D	0	.	6.5048	0.22188	0.1893:0.0:0.8107:0.0	.	13;13;13;13	Q1T7F6;Q76KX8-2;Q76KX8;Q1T7F5	.;.;ZN534_HUMAN;.	M	13;13;13;13;12	ENSP00000301085:V13M;ENSP00000409421:V13M;ENSP00000327538:V13M;ENSP00000391358:V13M	ENSP00000301085:V13M	V	+	1	0	ZNF534	57629041	0.998000	0.40836	0.896000	0.35187	0.198000	0.23893	4.147000	0.58078	-0.014000	0.14175	0.404000	0.27445	GTG		0.443	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512		14	59	0	0	0	0.00244969	0	14	59				
BIRC8	112401	broad.mit.edu	37	19	53793483	53793483	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:53793483A>T	ENST00000426466.1	-	1	1392	c.145T>A	c.(145-147)Tgg>Agg	p.W49R		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	49					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		TTGGGCTTCCAGTTGGCTAGC	0.433																																							uc002qbk.2		NA																	0				lung(1)	1						c.(145-147)TGG>AGG		baculoviral IAP repeat-containing 8							88.0	86.0	87.0					19																	53793483		2203	4300	6503	SO:0001583	missense	112401				apoptosis		zinc ion binding	g.chr19:53793483A>T	AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.145T>A	19.37:g.53793483A>T	ENSP00000412957:p.Trp49Arg		Somatic					p.W49R	NM_033341	NP_203127	WXS	Illumina HiSeq	Unspecified	Q96P09	BIRC8_HUMAN		GBM - Glioblastoma multiforme(134;0.00304)	1	1393	-			49			BIR.		Q6IPY1|Q96RW5	Missense_Mutation	SNP	ENST00000426466.1	37	c.145T>A	CCDS12863.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.171251	0.38315	.	.	ENSG00000163098	ENST00000426466	T	0.12465	2.68	0.502	0.502	0.16932	Baculoviral inhibition of apoptosis protein repeat (5);	.	.	.	.	T	0.48021	0.1477	H	0.98996	4.395	0.54753	D	0.999989	D	0.89917	1.0	D	0.97110	1.0	T	0.50381	-0.8835	9	0.87932	D	0	-26.1962	5.4107	0.16346	0.9999:0.0:1.0E-4:0.0	.	49	Q96P09	BIRC8_HUMAN	R	49	ENSP00000412957:W49R	ENSP00000412957:W49R	W	-	1	0	BIRC8	58485295	0.998000	0.40836	0.004000	0.12327	0.002000	0.02628	5.182000	0.65059	0.486000	0.27676	0.344000	0.21773	TGG		0.433	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464357.1	NM_033341		11	45	0	0	0	0.000978159	0	11	45				
NLRP12	91662	broad.mit.edu	37	19	54313761	54313761	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:54313761C>A	ENST00000324134.6	-	3	1320	c.1152G>T	c.(1150-1152)gcG>gcT	p.A384A	NLRP12_ENST00000351894.4_Silent_p.A384A|NLRP12_ENST00000391775.3_Silent_p.A384A|NLRP12_ENST00000354278.3_Silent_p.A384A|NLRP12_ENST00000391772.1_Silent_p.A384A|NLRP12_ENST00000391773.1_Silent_p.A384A|NLRP12_ENST00000535162.1_Silent_p.A384A|NLRP12_ENST00000345770.5_Silent_p.A384A	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	384	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		AGACTTGGCCCGCCTGCTCTG	0.562																																							uc002qch.3		NA																	0				ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(1150-1152)GCG>GCT		NLR family, pyrin domain containing 12 isoform							195.0	194.0	194.0					19																	54313761		2203	4300	6503	SO:0001819	synonymous_variant	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54313761C>A	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1152G>T	19.37:g.54313761C>A			Somatic				NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Silent_p.A384A|NLRP12_uc002qcj.3_Silent_p.A384A|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.A384A	p.A384A	NM_144687	NP_653288	WXS	Illumina HiSeq	Unspecified	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	3	1372	-	Ovarian(34;0.19)		384			NACHT.		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	37	c.1152G>T	CCDS12864.1																																																																																				0.562	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		34	139	1	0	5.66738e-07	0.00128727	2.04177e-06	34	139				
USP29	57663	broad.mit.edu	37	19	57640279	57640279	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:57640279A>T	ENST00000254181.4	+	4	690	c.236A>T	c.(235-237)aAc>aTc	p.N79I	USP29_ENST00000598197.1_Missense_Mutation_p.N79I	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	79					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTGAAAAACAACGTGTTCTTG	0.333																																							uc002qny.2		NA																	0				lung(6)|ovary(2)|breast(2)|pancreas(1)	11						c.(235-237)AAC>ATC		ubiquitin specific peptidase 29							51.0	51.0	51.0					19																	57640279		2203	4300	6503	SO:0001583	missense	57663				protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chr19:57640279A>T		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.236A>T	19.37:g.57640279A>T	ENSP00000254181:p.Asn79Ile		Somatic					p.N79I	NM_020903	NP_065954	WXS	Illumina HiSeq	Unspecified	Q9HBJ7	UBP29_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	592	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	79						Missense_Mutation	SNP	ENST00000254181.4	37	c.236A>T	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	A	13.45	2.240627	0.39598	.	.	ENSG00000131864	ENST00000254181	T	0.53857	0.6	2.79	2.79	0.32731	.	0.446678	0.16574	U	0.208518	T	0.61578	0.2358	L	0.55990	1.75	0.09310	N	1	D	0.69078	0.997	D	0.65684	0.937	T	0.48525	-0.9028	10	0.87932	D	0	-5.5862	7.4381	0.27166	1.0:0.0:0.0:0.0	.	79	Q9HBJ7	UBP29_HUMAN	I	79	ENSP00000254181:N79I	ENSP00000254181:N79I	N	+	2	0	USP29	62332091	0.002000	0.14202	0.002000	0.10522	0.003000	0.03518	1.312000	0.33574	1.492000	0.48499	0.482000	0.46254	AAC		0.333	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			10	43	0	0	0	0.000442599	0	10	43				
ZNF264	9422	broad.mit.edu	37	19	57724116	57724116	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:57724116A>T	ENST00000263095.6	+	4	2065	c.1651A>T	c.(1651-1653)Agc>Tgc	p.S551C	ZNF264_ENST00000536056.1_Missense_Mutation_p.S551C	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	551					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		CTTCAGTCGCAGCTCGTCCCT	0.458																																							uc002qob.2		NA																	0				ovary(2)	2						c.(1651-1653)AGC>TGC		zinc finger protein 264							102.0	98.0	100.0					19																	57724116		2203	4300	6503	SO:0001583	missense	9422				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57724116A>T	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1651A>T	19.37:g.57724116A>T	ENSP00000263095:p.Ser551Cys		Somatic					p.S551C	NM_003417	NP_003408	WXS	Illumina HiSeq	Unspecified	O43296	ZN264_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)	4	2064	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	551			C2H2-type 13.		A8K8Y9|Q9P1V0	Missense_Mutation	SNP	ENST00000263095.6	37	c.1651A>T	CCDS33127.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.028975	0.54790	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.10763	2.84;2.84	2.35	2.35	0.29111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19765	0.0475	L	0.48877	1.53	0.22639	N	0.998907	D	0.76494	0.999	D	0.65573	0.936	T	0.07404	-1.0774	9	0.36615	T	0.2	.	6.7826	0.23654	0.7611:0.2389:0.0:0.0	.	551	O43296	ZN264_HUMAN	C	551	ENSP00000263095:S551C;ENSP00000440376:S551C	ENSP00000263095:S551C	S	+	1	0	ZNF264	62415928	0.001000	0.12720	0.992000	0.48379	0.993000	0.82548	1.214000	0.32419	1.344000	0.45657	0.402000	0.26972	AGC		0.458	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1			20	59	0	0	0	0.000958276	0	20	59				
ZSCAN4	201516	broad.mit.edu	37	19	58187796	58187796	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:58187796G>C	ENST00000318203.5	+	3	980	c.283G>C	c.(283-285)Ggt>Cgt	p.G95R		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	95	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTTTATGATTGGTGGCCACTG	0.398																																							uc002qpu.2		NA																	0				ovary(1)	1						c.(283-285)GGT>CGT		zinc finger and SCAN domain containing 4							81.0	78.0	79.0					19																	58187796		2203	4300	6503	SO:0001583	missense	201516				telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58187796G>C	AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.283G>C	19.37:g.58187796G>C	ENSP00000321963:p.Gly95Arg		Somatic					p.G95R	NM_152677	NP_689890	WXS	Illumina HiSeq	Unspecified	Q8NAM6	ZSCA4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	3	980	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	95			SCAN box.		Q3MIQ2	Missense_Mutation	SNP	ENST00000318203.5	37	c.283G>C	CCDS12958.1	.	.	.	.	.	.	.	.	.	.	G	6.027	0.373414	0.11409	.	.	ENSG00000180532	ENST00000318203	T	0.04194	3.68	4.42	3.4	0.38934	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (2);	0.621864	0.15256	N	0.272023	T	0.01353	0.0044	N	0.00436	-1.5	0.09310	N	1	B	0.28820	0.224	B	0.25614	0.062	T	0.43491	-0.9388	10	0.31617	T	0.26	-14.9392	6.2135	0.20642	0.8855:0.0:0.1145:0.0	.	95	Q8NAM6	ZSCA4_HUMAN	R	95	ENSP00000321963:G95R	ENSP00000321963:G95R	G	+	1	0	ZSCAN4	62879608	0.082000	0.21442	0.007000	0.13788	0.022000	0.10575	1.285000	0.33261	1.036000	0.39998	-0.302000	0.09304	GGT		0.398	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466812.1	NM_152677		15	79	0	0	0	0.000566183	0	15	79				
ZNF135	7694	broad.mit.edu	37	19	58578565	58578566	+	Missense_Mutation	DNP	GA	GA	AG	rs200166263		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:58578565_58578566GA>AG	ENST00000313434.5	+	5	814_815	c.713_714GA>AG	c.(712-714)gGA>gAG	p.G238E	ZNF135_ENST00000506786.1_Missense_Mutation_p.G196E|ZNF135_ENST00000359978.6_Missense_Mutation_p.G250E|ZNF135_ENST00000439855.2_Missense_Mutation_p.G238E|ZNF135_ENST00000401053.4_Missense_Mutation_p.G262E|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000511556.1_Missense_Mutation_p.G250E	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	238					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		ACGCACACAGGAGAGAGACCTT	0.47																																							uc010yhq.1		NA																	0				ovary(1)	1						c.(748-750)GGA>GAG		zinc finger protein 135 isoform 2																																				SO:0001583	missense	7694				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:58578565_58578566GA>AG	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		Exception_encountered	19.37:g.58578565_58578566delinsAG	ENSP00000321406:p.Gly238Glu		Somatic				ZNF135_uc002qre.2_Missense_Mutation_p.G238E|ZNF135_uc002qrd.1_Missense_Mutation_p.G196E|ZNF135_uc002qrf.2_Missense_Mutation_p.G196E|ZNF135_uc002qrg.2_Missense_Mutation_p.G208E|ZNF135_uc010yhr.1_Missense_Mutation_p.G59E	p.G250E	NM_003436	NP_003427	WXS	Illumina HiSeq	Unspecified	B4DHH9	B4DHH9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)	5	845_846	+		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)	250					B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	DNP	ENST00000313434.5	37	c.749_750GA>AG																																																																																					0.470	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436		19	115	0	0	0	6.4e-05	0	19	115				
NOL10	79954	broad.mit.edu	37	2	10712241	10712241	+	Nonsense_Mutation	SNP	C	C	A	rs191584876	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:10712241C>A	ENST00000381685.5	-	21	2128	c.2023G>T	c.(2023-2025)Gga>Tga	p.G675*	NOL10_ENST00000542668.1_Nonsense_Mutation_p.G625*|NOL10_ENST00000538384.1_Nonsense_Mutation_p.G649*|NOL10_ENST00000345985.3_Nonsense_Mutation_p.G625*	NM_024894.3	NP_079170.2	Q9BSC4	NOL10_HUMAN	nucleolar protein 10	675						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)					Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		TTCAGGTGTCCGGCCGAACGA	0.478																																							uc002raq.2		NA																	0					0						c.(2023-2025)GGA>TGA		nucleolar protein 10							276.0	247.0	257.0					2																	10712241		2203	4300	6503	SO:0001587	stop_gained	79954					nucleolus		g.chr2:10712241C>A	AK024137	CCDS1673.2, CCDS58697.1, CCDS58698.1	2p25.1	2008-05-23			ENSG00000115761	ENSG00000115761			25862	protein-coding gene	gene with protein product			"""polyglutamine binding protein 5"""	PQBP5		12477932	Standard	NM_024894		Approved	FLJ14075	uc002raq.3	Q9BSC4	OTTHUMG00000119023	ENST00000381685.5:c.2023G>T	2.37:g.10712241C>A	ENSP00000371101:p.Gly675*		Somatic				NOL10_uc010yje.1_Nonsense_Mutation_p.G649*|NOL10_uc010yjf.1_Nonsense_Mutation_p.G625*|NOL10_uc002rap.2_Nonsense_Mutation_p.G625*	p.G675*	NM_024894	NP_079170	WXS	Illumina HiSeq	Unspecified	Q9BSC4	NOL10_HUMAN		Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)	21	2148	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		675					A8K3R5|B4DLV0|Q53RC9|Q96TA5|Q9H7Y7|Q9H855	Nonsense_Mutation	SNP	ENST00000381685.5	37	c.2023G>T	CCDS1673.2	.	.	.	.	.	.	.	.	.	.	C	34	5.331531	0.95733	.	.	ENSG00000115761	ENST00000345985;ENST00000381685;ENST00000542668;ENST00000538384	.	.	.	5.75	1.57	0.23409	.	0.360971	0.34268	N	0.004116	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-3.0903	9.6555	0.39923	0.0:0.5921:0.0:0.4079	.	.	.	.	X	625;675;625;649	.	ENSP00000263837:G625X	G	-	1	0	NOL10	10629692	0.000000	0.05858	0.221000	0.23827	0.745000	0.42441	0.007000	0.13174	0.247000	0.21414	0.655000	0.94253	GGA		0.478	NOL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239227.1	NM_024894		46	166	1	0	6.23363e-37	0.00361006	3.19001e-36	46	166				
DDX1	1653	broad.mit.edu	37	2	15760365	15760365	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:15760365G>T	ENST00000381341.2	+	18	1629	c.1240G>T	c.(1240-1242)Gat>Tat	p.D414Y	DDX1_ENST00000233084.3_Missense_Mutation_p.D414Y			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	414	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		GCATTCTTTCGATGTAAAGAA	0.363																																							uc002rce.2		NA																	0				central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(1240-1242)GAT>TAT		DEAD (Asp-Glu-Ala-Asp) box polypeptide 1							132.0	131.0	131.0					2																	15760365		2203	4300	6503	SO:0001583	missense	1653				DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity	g.chr2:15760365G>T	X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1240G>T	2.37:g.15760365G>T	ENSP00000370745:p.Asp414Tyr		Somatic				DDX1_uc010yjq.1_Missense_Mutation_p.D322Y	p.D414Y	NM_004939	NP_004930	WXS	Illumina HiSeq	Unspecified	Q92499	DDX1_HUMAN	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)	17	1528	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	414			Necessary for interaction with RELA.|Helicase ATP-binding.		B4DME8|B4DPN6	Missense_Mutation	SNP	ENST00000381341.2	37	c.1240G>T	CCDS1686.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.049472	0.93740	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	T;T	0.18016	2.24;2.24	6.07	6.07	0.98685	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.44582	0.1300	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.15549	-1.0433	10	0.87932	D	0	-27.809	20.6525	0.99598	0.0:0.0:1.0:0.0	.	414	Q92499	DDX1_HUMAN	Y	414;414;398	ENSP00000370745:D414Y;ENSP00000233084:D414Y	ENSP00000233084:D414Y	D	+	1	0	DDX1	15677816	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.869000	0.99810	2.890000	0.99128	0.585000	0.79938	GAT		0.363	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207141.2	NM_004939		24	93	1	0	3.73808e-20	0.000878237	1.79721e-19	24	93				
NT5C1B	93034	broad.mit.edu	37	2	18765484	18765484	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:18765484G>C	ENST00000359846.2	-	6	1018	c.941C>G	c.(940-942)tCc>tGc	p.S314C	NT5C1B_ENST00000600945.1_Missense_Mutation_p.S314C|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.S314C|NT5C1B_ENST00000460052.1_5'Flank|RNU6-1215P_ENST00000384441.1_RNA|NT5C1B_ENST00000304081.4_Missense_Mutation_p.S254C	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	314					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				GAGCGCGCAGGATGAGAGAGC	0.537																																							uc002rcz.2		NA																	0				skin(2)|ovary(1)	3						c.(940-942)TCC>TGC		5' nucleotidase, cytosolic IB isoform 1							160.0	152.0	155.0					2																	18765484		2203	4300	6503	SO:0001583	missense	93034				purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding	g.chr2:18765484G>C	AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.941C>G	2.37:g.18765484G>C	ENSP00000352904:p.Ser314Cys		Somatic				NT5C1B_uc002rcy.2_Missense_Mutation_p.S314C|NT5C1B_uc010exr.2_Missense_Mutation_p.S256C|NT5C1B_uc010yju.1_Missense_Mutation_p.S254C|NT5C1B_uc002rda.2_Missense_Mutation_p.S254C|NT5C1B_uc010yjv.1_Missense_Mutation_p.S331C|NT5C1B_uc010yjw.1_Missense_Mutation_p.S297C|NT5C1B_uc010exs.2_Missense_Mutation_p.S316C|NT5C1B_uc002rdb.1_Missense_Mutation_p.S106C	p.S314C	NM_001002006	NP_001002006	WXS	Illumina HiSeq	Unspecified	Q96P26	5NT1B_HUMAN			6	1045	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)	314					B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	ENST00000359846.2	37	c.941C>G	CCDS33150.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.650456	0.87958	.	.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846	D	0.95853	-3.83	5.58	5.58	0.84498	.	0.104905	0.64402	D	0.000002	D	0.98454	0.9485	M	0.93197	3.39	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.91635	0.99;0.993;0.99;0.984;0.997;0.996;0.996;0.99;0.999	D	0.99038	1.0823	10	0.87932	D	0	-14.0417	19.9414	0.97163	0.0:0.0:1.0:0.0	.	297;331;254;297;256;106;254;314;314	E7EXB7;B4DZ86;B4DXQ9;B4DXZ9;C9J2C7;Q96P26-3;Q96P26-2;Q96P26;Q96P26-4	.;.;.;.;.;.;.;5NT1B_HUMAN;.	C	314;256;254;314	ENSP00000412639:S256C	ENSP00000305979:S254C	S	-	2	0	NT5C1B-RDH14;NT5C1B	18628965	1.000000	0.71417	0.380000	0.26093	0.781000	0.44180	9.408000	0.97327	2.779000	0.95612	0.650000	0.86243	TCC		0.537	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1			21	84	0	0	0	0.00278032	0	21	84				
APOB	338	broad.mit.edu	37	2	21225982	21225982	+	Silent	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:21225982C>T	ENST00000233242.1	-	29	12439	c.12312G>A	c.(12310-12312)ctG>ctA	p.L4104L	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4104					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATTTCTTCTCAGCTTTGAAG	0.488																																							uc002red.2		NA																	0				ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(12310-12312)CTG>CTA		apolipoprotein B precursor	Atorvastatin(DB01076)						164.0	161.0	162.0					2																	21225982		2203	4300	6503	SO:0001819	synonymous_variant	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21225982C>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.12312G>A	2.37:g.21225982C>T			Somatic					p.L4104L	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			29	12440	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		4104					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	c.12312G>A	CCDS1703.1																																																																																				0.488	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			27	120	0	0	0	0.001512	0	27	120				
SPTBN1	6711	broad.mit.edu	37	2	54858128	54858128	+	Nonsense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:54858128C>T	ENST00000356805.4	+	16	3225	c.2944C>T	c.(2944-2946)Cag>Tag	p.Q982*	SPTBN1_ENST00000333896.5_Nonsense_Mutation_p.Q969*	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	982					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			CGAGTCCACCCAGGACCTGGG	0.587																																							uc002rxu.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8						c.(2944-2946)CAG>TAG		spectrin, beta, non-erythrocytic 1 isoform 1							57.0	58.0	58.0					2																	54858128		2203	4300	6503	SO:0001587	stop_gained	6711				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton	g.chr2:54858128C>T		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.2944C>T	2.37:g.54858128C>T	ENSP00000349259:p.Gln982*		Somatic				SPTBN1_uc002rxx.2_Nonsense_Mutation_p.Q969*	p.Q982*	NM_003128	NP_003119	WXS	Illumina HiSeq	Unspecified	Q01082	SPTB2_HUMAN	Lung(47;0.24)		16	3193	+			982			Spectrin 7.		B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Nonsense_Mutation	SNP	ENST00000356805.4	37	c.2944C>T	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	C	44	11.182279	0.99527	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	18.9486	0.92632	0.0:1.0:0.0:0.0	.	.	.	.	X	982;969	.	ENSP00000334156:Q969X	Q	+	1	0	SPTBN1	54711632	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	2.479000	0.83701	0.655000	0.94253	CAG		0.587	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			6	23	0	0	0	0.00116845	0	6	23				
WDPCP	51057	broad.mit.edu	37	2	63631262	63631262	+	Missense_Mutation	SNP	C	C	G	rs372258764		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:63631262C>G	ENST00000272321.7	-	10	1883	c.1356G>C	c.(1354-1356)aaG>aaC	p.K452N	WDPCP_ENST00000409120.1_Missense_Mutation_p.K260N|WDPCP_ENST00000409199.1_Missense_Mutation_p.K260N|WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000409562.3_Missense_Mutation_p.K452N|WDPCP_ENST00000398544.3_Missense_Mutation_p.K293N	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	452					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						TACCTTCACCCTTCTGAGAAA	0.433																																							uc002sch.2		NA																	0					0						c.(1354-1356)AAG>AAC		hypothetical protein LOC51057 isoform 2							103.0	98.0	99.0					2																	63631262		1898	4125	6023	SO:0001583	missense	51057				cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane		g.chr2:63631262C>G		CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1356G>C	2.37:g.63631262C>G	ENSP00000272321:p.Lys452Asn		Somatic				C2orf86_uc002sce.2_RNA|C2orf86_uc002scf.2_Missense_Mutation_p.K293N|C2orf86_uc010ypu.1_RNA|C2orf86_uc002scg.2_Missense_Mutation_p.K260N|C2orf86_uc002sci.1_Missense_Mutation_p.K428N|C2orf86_uc010fcr.1_Missense_Mutation_p.K342N	p.K452N	NM_015910	NP_056994	WXS	Illumina HiSeq	Unspecified	O95876	FRITZ_HUMAN			10	1802	-			452					Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	ENST00000272321.7	37	c.1356G>C	CCDS42688.1	.	.	.	.	.	.	.	.	.	.	C	0.118	-1.129602	0.01756	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544;ENST00000409562	T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95	5.0	3.06	0.35304	.	0.684587	0.14963	N	0.288251	T	0.19446	0.0467	N	0.12182	0.205	0.09310	N	1	B;B;B;B	0.12630	0.006;0.004;0.002;0.005	B;B;B;B	0.14023	0.003;0.003;0.01;0.002	T	0.13308	-1.0514	10	0.18276	T	0.48	-2.654	3.3307	0.07083	0.2273:0.3791:0.3096:0.084	.	260;452;452;293	E9PFG9;O95876-2;O95876;O95876-3	.;.;FRITZ_HUMAN;.	N	452;260;260;293;452	ENSP00000272321:K452N;ENSP00000386592:K260N;ENSP00000386769:K260N;ENSP00000381552:K293N;ENSP00000387222:K452N	ENSP00000272321:K452N	K	-	3	2	WDPCP	63484766	0.067000	0.21026	0.894000	0.35097	0.033000	0.12548	0.310000	0.19356	1.450000	0.47717	0.591000	0.81541	AAG		0.433	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910		15	72	0	0	0	0.00400662	0	15	72				
C2orf78	388960	broad.mit.edu	37	2	74042529	74042529	+	Silent	SNP	C	C	A	rs143445466		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:74042529C>A	ENST00000409561.1	+	3	1300	c.1179C>A	c.(1177-1179)ccC>ccA	p.P393P		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	393										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						TAGAAATCCCCGATATTCACC	0.448																																							uc002sjr.1		NA																	0				ovary(2)	2						c.(1177-1179)CCC>CCA		hypothetical protein LOC388960							36.0	35.0	35.0					2																	74042529		1839	4089	5928	SO:0001819	synonymous_variant	388960							g.chr2:74042529C>A	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.1179C>A	2.37:g.74042529C>A			Somatic					p.P393P	NM_001080474	NP_001073943	WXS	Illumina HiSeq	Unspecified	A6NCI8	CB078_HUMAN			3	1300	+			393						Silent	SNP	ENST00000409561.1	37	c.1179C>A	CCDS46338.1																																																																																				0.448	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474		8	17	1	0	1.12685e-05	0.00448238	3.70408e-05	8	17				
LRRTM4	80059	broad.mit.edu	37	2	77745779	77745779	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:77745779G>T	ENST00000409093.1	-	3	1552	c.1216C>A	c.(1216-1218)Cca>Aca	p.P406T	LRRTM4_ENST00000409282.1_Missense_Mutation_p.P407T|LRRTM4_ENST00000409911.1_Missense_Mutation_p.P407T|LRRTM4_ENST00000409088.3_Missense_Mutation_p.P406T|LRRTM4_ENST00000409884.1_Missense_Mutation_p.P406T			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	406					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.P406T(2)		autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		TGAAACCCTGGGGAAGGGCTT	0.498																																							uc002snr.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(3)|ovary(1)	4						c.(1216-1218)CCA>ACA		leucine rich repeat transmembrane neuronal 4							115.0	113.0	114.0					2																	77745779		1880	4110	5990	SO:0001583	missense	80059					integral to membrane		g.chr2:77745779G>T	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1216C>A	2.37:g.77745779G>T	ENSP00000386357:p.Pro406Thr		Somatic				LRRTM4_uc002snq.2_Missense_Mutation_p.P406T|LRRTM4_uc002sns.2_Missense_Mutation_p.P406T|LRRTM4_uc002snt.2_Missense_Mutation_p.P407T	p.P406T	NM_001134745	NP_001128217	WXS	Illumina HiSeq	Unspecified	Q86VH4	LRRT4_HUMAN		Colorectal(11;0.059)	3	1631	-			406			Extracellular (Potential).		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	c.1216C>A	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	G	3.931	-0.016182	0.07681	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85;-0.85	5.68	4.79	0.61399	.	0.355507	0.30320	N	0.009890	T	0.52500	0.1738	N	0.08118	0	0.36852	D	0.887959	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.001;0.002;0.001	T	0.51957	-0.8639	10	0.11485	T	0.65	.	13.1739	0.59615	0.0:0.0:0.7112:0.2888	.	407;406;406	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	T	407;406;406;406;407	ENSP00000387228:P407T;ENSP00000387297:P406T;ENSP00000386357:P406T;ENSP00000386236:P406T;ENSP00000386286:P407T	ENSP00000386236:P406T	P	-	1	0	LRRTM4	77599287	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.455000	0.60075	1.343000	0.45638	0.655000	0.94253	CCA		0.498	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		9	39	1	0	7.48243e-07	0.000442599	2.65322e-06	9	39				
REG1A	5967	broad.mit.edu	37	2	79348783	79348783	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:79348783C>A	ENST00000233735.1	+	3	263	c.160C>A	c.(160-162)Cgt>Agt	p.R54S		NM_002909.4	NP_002900.2	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha	54	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(26)|prostate(1)|upper_aerodigestive_tract(1)	39						TAATGAAGACCGTGAGACCTG	0.567																																							uc002snz.2		NA																	0					0						c.(160-162)CGT>AGT		regenerating islet-derived 1 alpha precursor							161.0	153.0	156.0					2																	79348783		2203	4300	6503	SO:0001583	missense	5967				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding	g.chr2:79348783C>A		CCDS1964.1	2p12	2008-09-04	2008-06-04		ENSG00000115386	ENSG00000115386			9951	protein-coding gene	gene with protein product	"""pancreatic stone protein"", ""pancreatic thread protein"""	167770	"""regenerating islet-derived 1 alpha (pancreatic stone protein, pancreatic thread protein)"""	REG		2332435, 8333731	Standard	NM_002909		Approved	PSP, PTP, PSPS, PSPS1	uc002snz.3	P05451	OTTHUMG00000130016	ENST00000233735.1:c.160C>A	2.37:g.79348783C>A	ENSP00000233735:p.Arg54Ser		Somatic				REG1A_uc010ffx.1_Missense_Mutation_p.R54S|REG1A_uc010ysd.1_Missense_Mutation_p.R54S	p.R54S	NM_002909	NP_002900	WXS	Illumina HiSeq	Unspecified	P05451	REG1A_HUMAN			3	263	+			54			C-type lectin.		P11379|Q4ZG28	Missense_Mutation	SNP	ENST00000233735.1	37	c.160C>A	CCDS1964.1	.	.	.	.	.	.	.	.	.	.	c	15.63	2.890248	0.52014	.	.	ENSG00000115386	ENST00000233735	T	0.62639	0.01	2.97	2.08	0.27032	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	2.326850	0.02047	N	0.049728	T	0.44973	0.1319	N	0.21617	0.685	0.09310	N	1	B;B	0.31485	0.164;0.325	B;B	0.25884	0.044;0.064	T	0.31696	-0.9934	10	0.14656	T	0.56	.	5.9352	0.19161	0.0:0.8516:0.0:0.1484	.	54;54	A8K7G6;P05451	.;REG1A_HUMAN	S	54	ENSP00000233735:R54S	ENSP00000233735:R54S	R	+	1	0	REG1A	79202291	0.000000	0.05858	0.001000	0.08648	0.903000	0.53119	-1.525000	0.02231	0.798000	0.33994	0.563000	0.77884	CGT		0.567	REG1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252289.1	NM_002909		22	101	1	0	1.96292e-10	0.00152264	8.08509e-10	22	101				
REG1A	5967	broad.mit.edu	37	2	79350017	79350017	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:79350017G>T	ENST00000233735.1	+	5	475	c.372G>T	c.(370-372)tgG>tgT	p.W124C		NM_002909.4	NP_002900.2	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha	124	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(26)|prostate(1)|upper_aerodigestive_tract(1)	39						ACAAGTCCTGGGGCATTGGAG	0.552																																							uc002snz.2		NA																	0					0						c.(370-372)TGG>TGT		regenerating islet-derived 1 alpha precursor							119.0	114.0	116.0					2																	79350017		2203	4300	6503	SO:0001583	missense	5967				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding	g.chr2:79350017G>T		CCDS1964.1	2p12	2008-09-04	2008-06-04		ENSG00000115386	ENSG00000115386			9951	protein-coding gene	gene with protein product	"""pancreatic stone protein"", ""pancreatic thread protein"""	167770	"""regenerating islet-derived 1 alpha (pancreatic stone protein, pancreatic thread protein)"""	REG		2332435, 8333731	Standard	NM_002909		Approved	PSP, PTP, PSPS, PSPS1	uc002snz.3	P05451	OTTHUMG00000130016	ENST00000233735.1:c.372G>T	2.37:g.79350017G>T	ENSP00000233735:p.Trp124Cys		Somatic				REG1A_uc010ysd.1_Missense_Mutation_p.W124C	p.W124C	NM_002909	NP_002900	WXS	Illumina HiSeq	Unspecified	P05451	REG1A_HUMAN			5	475	+			124			C-type lectin.		P11379|Q4ZG28	Missense_Mutation	SNP	ENST00000233735.1	37	c.372G>T	CCDS1964.1	.	.	.	.	.	.	.	.	.	.	g	16.10	3.026214	0.54683	.	.	ENSG00000115386	ENST00000233735	T	0.14516	2.5	2.92	2.92	0.33932	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.211136	0.24204	N	0.040591	T	0.53417	0.1795	H	0.99475	4.585	0.53688	D	0.99997	D	0.89917	1.0	D	0.97110	1.0	T	0.67995	-0.5526	10	0.87932	D	0	.	9.4067	0.38466	0.0:0.0:1.0:0.0	.	124	P05451	REG1A_HUMAN	C	124	ENSP00000233735:W124C	ENSP00000233735:W124C	W	+	3	0	REG1A	79203525	0.998000	0.40836	0.760000	0.31359	0.385000	0.30292	2.984000	0.49353	1.637000	0.50538	0.557000	0.71058	TGG		0.552	REG1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252289.1	NM_002909		17	66	1	0	2.27731e-05	0.00188189	7.41359e-05	17	66				
REG1A	5967	broad.mit.edu	37	2	79350037	79350037	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:79350037G>A	ENST00000233735.1	+	5	495	c.392G>A	c.(391-393)aGt>aAt	p.S131N		NM_002909.4	NP_002900.2	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha	131	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(26)|prostate(1)|upper_aerodigestive_tract(1)	39						GCCCCAAGCAGTGTTAATCCT	0.577																																							uc002snz.2		NA																	0					0						c.(391-393)AGT>AAT		regenerating islet-derived 1 alpha precursor							111.0	106.0	108.0					2																	79350037		2203	4300	6503	SO:0001583	missense	5967				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding	g.chr2:79350037G>A		CCDS1964.1	2p12	2008-09-04	2008-06-04		ENSG00000115386	ENSG00000115386			9951	protein-coding gene	gene with protein product	"""pancreatic stone protein"", ""pancreatic thread protein"""	167770	"""regenerating islet-derived 1 alpha (pancreatic stone protein, pancreatic thread protein)"""	REG		2332435, 8333731	Standard	NM_002909		Approved	PSP, PTP, PSPS, PSPS1	uc002snz.3	P05451	OTTHUMG00000130016	ENST00000233735.1:c.392G>A	2.37:g.79350037G>A	ENSP00000233735:p.Ser131Asn		Somatic				REG1A_uc010ysd.1_Missense_Mutation_p.S131N	p.S131N	NM_002909	NP_002900	WXS	Illumina HiSeq	Unspecified	P05451	REG1A_HUMAN			5	495	+			131			C-type lectin.		P11379|Q4ZG28	Missense_Mutation	SNP	ENST00000233735.1	37	c.392G>A	CCDS1964.1	.	.	.	.	.	.	.	.	.	.	g	0.014	-1.584950	0.00872	.	.	ENSG00000115386	ENST00000233735	T	0.06294	3.32	2.38	-4.77	0.03219	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.762880	0.03432	N	0.207896	T	0.02494	0.0076	N	0.03903	-0.33	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36407	-0.9749	10	0.23302	T	0.38	.	1.8584	0.03184	0.3253:0.2212:0.3449:0.1086	.	131	P05451	REG1A_HUMAN	N	131	ENSP00000233735:S131N	ENSP00000233735:S131N	S	+	2	0	REG1A	79203545	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.064000	0.00622	-3.434000	0.00164	-1.289000	0.01358	AGT		0.577	REG1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252289.1	NM_002909		12	61	0	0	0	0.000978159	0	12	61				
SNRNP200	23020	broad.mit.edu	37	2	96952157	96952157	+	Missense_Mutation	SNP	T	T	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:96952157T>C	ENST00000323853.5	-	29	3972	c.3895A>G	c.(3895-3897)Acc>Gcc	p.T1299A	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1299					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						AAAAGTTCGGTTGGAGGGGGG	0.507																																							uc002svu.2		NA																	0				ovary(5)|skin(4)|large_intestine(1)	10						c.(3895-3897)ACC>GCC		activating signal cointegrator 1 complex subunit							81.0	92.0	89.0					2																	96952157		2203	4300	6503	SO:0001583	missense	23020					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr2:96952157T>C	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.3895A>G	2.37:g.96952157T>C	ENSP00000317123:p.Thr1299Ala		Somatic				SNRNP200_uc002svt.2_5'Flank|SNRNP200_uc010yuj.1_5'Flank|SNRNP200_uc002svv.1_5'Flank|SNRNP200_uc002svw.1_Missense_Mutation_p.T371A	p.T1299A	NM_014014	NP_054733	WXS	Illumina HiSeq	Unspecified	O75643	U520_HUMAN			29	3981	-			1299					O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	c.3895A>G	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.696802	0.88830	.	.	ENSG00000144028	ENST00000323853	T	0.37411	1.2	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.70072	0.3182	H	0.97611	4.04	0.80722	D	1	D	0.62365	0.991	P	0.60286	0.872	T	0.81922	-0.0711	10	0.87932	D	0	-16.1937	14.1467	0.65355	0.0:0.0:0.0:1.0	.	1299	O75643	U520_HUMAN	A	1299	ENSP00000317123:T1299A	ENSP00000317123:T1299A	T	-	1	0	SNRNP200	96315884	1.000000	0.71417	0.507000	0.27676	0.964000	0.63967	6.210000	0.72176	1.998000	0.58463	0.455000	0.32223	ACC		0.507	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014		13	53	0	0	0	0.00185496	0	13	53				
PDCL3	79031	broad.mit.edu	37	2	101192814	101192814	+	Splice_Site	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:101192814A>G	ENST00000264254.6	+	6	955		c.e6-1		snoU13_ENST00000458824.1_RNA	NM_024065.4	NP_076970.1	Q9H2J4	PDCL3_HUMAN	phosducin-like 3						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|protein folding (GO:0006457)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|viral process (GO:0016032)	cytoplasm (GO:0005737)	protein binding involved in protein folding (GO:0044183)			endometrium(3)|large_intestine(2)|liver(1)|lung(6)	12						TTTACCATATAGAGTTGGAAT	0.433																																							uc002tao.2		NA																	0					0						c.e6-2		phosducin-like 3							81.0	75.0	77.0					2																	101192814		2203	4300	6503	SO:0001630	splice_region_variant	79031				apoptosis|interspecies interaction between organisms	cytoplasm	protein binding	g.chr2:101192814A>G	AF267853	CCDS33261.1	2q12	2008-02-05			ENSG00000115539	ENSG00000115539			28860	protein-coding gene	gene with protein product		611678					Standard	NM_024065		Approved	VIAF1	uc002tao.2	Q9H2J4	OTTHUMG00000153141	ENST00000264254.6:c.578-1A>G	2.37:g.101192814A>G			Somatic					p.E193_splice	NM_024065	NP_076970	WXS	Illumina HiSeq	Unspecified	Q9H2J4	PDCL3_HUMAN			6	690	+								B2RA00|Q53S68	Splice_Site	SNP	ENST00000264254.6	37	c.578_splice	CCDS33261.1	.	.	.	.	.	.	.	.	.	.	a	13.55	2.269607	0.40095	.	.	ENSG00000115539	ENST00000264254	.	.	.	5.53	4.38	0.52667	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.297	0.49284	0.9288:0.0:0.0712:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDCL3	100559246	1.000000	0.71417	0.977000	0.42913	0.380000	0.30137	8.304000	0.89958	0.934000	0.37316	0.482000	0.46254	.		0.433	PDCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329734.1	NM_024065	Intron	14	69	0	0	0	0.00316338	0	14	69				
RGPD3	653489	broad.mit.edu	37	2	107040375	107040375	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:107040375C>T	ENST00000409886.3	-	20	4135	c.4048G>A	c.(4048-4050)Ggt>Agt	p.G1350S	RGPD3_ENST00000304514.7_Missense_Mutation_p.G1350S	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1350	RanBD1 2. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTTTCCTCACCACTGGATACT	0.383																																							uc010ywi.1		NA																	0				ovary(1)	1						c.(4048-4050)GGT>AGT		RANBP2-like and GRIP domain containing 3							22.0	17.0	18.0					2																	107040375		690	1573	2263	SO:0001583	missense	653489				intracellular transport		binding	g.chr2:107040375C>T		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.4048G>A	2.37:g.107040375C>T	ENSP00000386588:p.Gly1350Ser		Somatic					p.G1350S	NM_001144013	NP_001137485	WXS	Illumina HiSeq	Unspecified	A6NKT7	RGPD3_HUMAN			20	4105	-			1350			RanBD1 2.		B8ZZM4	Missense_Mutation	SNP	ENST00000409886.3	37	c.4048G>A	CCDS46379.1	.	.	.	.	.	.	.	.	.	.	.	14.07	2.426126	0.43020	.	.	ENSG00000153165	ENST00000409886;ENST00000304514	T;T	0.50548	0.74;0.74	2.35	2.35	0.29111	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.72153	0.3425	M	0.92219	3.285	0.42428	D	0.992663	D	0.89917	1.0	D	0.87578	0.998	T	0.77784	-0.2458	9	0.72032	D	0.01	-32.7981	10.4115	0.44296	0.0:1.0:0.0:0.0	.	1350	A6NKT7	RGPD3_HUMAN	S	1350	ENSP00000386588:G1350S;ENSP00000303659:G1350S	ENSP00000303659:G1350S	G	-	1	0	RGPD3	106406807	1.000000	0.71417	1.000000	0.80357	0.363000	0.29612	7.578000	0.82498	1.314000	0.45095	0.186000	0.17326	GGT		0.383	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931		22	261	0	0	0	0.00106085	0	22	261				
INSIG2	51141	broad.mit.edu	37	2	118864760	118864760	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:118864760G>A	ENST00000245787.4	+	5	837	c.631G>A	c.(631-633)Gca>Aca	p.A211T	INSIG2_ENST00000485520.1_3'UTR	NM_016133.2	NP_057217.2	Q9Y5U4	INSI2_HUMAN	insulin induced gene 2	211					cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						TCGACAACTGGCAATGGTAAG	0.378																																							uc002tlk.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(631-633)GCA>ACA		insulin induced protein 2							125.0	124.0	124.0					2																	118864760		2203	4300	6503	SO:0001583	missense	51141				ER-nuclear sterol response pathway	SREBP-SCAP-Insig complex		g.chr2:118864760G>A	AF527632	CCDS2122.1	2q14.1	2008-02-05			ENSG00000125629	ENSG00000125629			20452	protein-coding gene	gene with protein product		608660				12242332	Standard	NM_016133		Approved		uc002tlk.3	Q9Y5U4	OTTHUMG00000058518	ENST00000245787.4:c.631G>A	2.37:g.118864760G>A	ENSP00000245787:p.Ala211Thr		Somatic				INSIG2_uc010yye.1_Missense_Mutation_p.A103T|INSIG2_uc002tll.2_Intron	p.A211T	NM_016133	NP_057217	WXS	Illumina HiSeq	Unspecified	Q9Y5U4	INSI2_HUMAN			5	837	+			211					A8K5W8|Q8TBI8	Missense_Mutation	SNP	ENST00000245787.4	37	c.631G>A	CCDS2122.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946718	0.92593	.	.	ENSG00000125629	ENST00000245787	.	.	.	5.24	5.24	0.73138	.	0.098661	0.64402	D	0.000001	T	0.75391	0.3843	M	0.84326	2.69	0.80722	D	1	P	0.45348	0.856	P	0.50231	0.635	T	0.76030	-0.3108	9	0.42905	T	0.14	.	19.3662	0.94464	0.0:0.0:1.0:0.0	.	211	Q9Y5U4	INSI2_HUMAN	T	211	.	ENSP00000245787:A211T	A	+	1	0	INSIG2	118581230	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.688000	0.84153	2.885000	0.99019	0.579000	0.79373	GCA		0.378	INSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129624.1	NM_016133		8	106	0	0	0	0.00307968	0	8	106				
POTEF	728378	broad.mit.edu	37	2	130832747	130832747	+	Silent	SNP	G	G	T	rs373389063	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:130832747G>T	ENST00000409914.2	-	17	2697	c.2298C>A	c.(2296-2298)acC>acA	p.T766T	POTEF_ENST00000357462.5_Silent_p.T766T	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	766	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GGTACTTCAGGGTCAGGATGC	0.592																																							uc010fmh.2		NA																	0				skin(3)|ovary(2)	5						c.(2296-2298)ACC>ACA		prostate, ovary, testis expressed protein on							55.0	54.0	54.0					2																	130832747		2202	4283	6485	SO:0001819	synonymous_variant	728378					cell cortex	ATP binding	g.chr2:130832747G>T	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2298C>A	2.37:g.130832747G>T			Somatic					p.T766T	NM_001099771	NP_001093241	WXS	Illumina HiSeq	Unspecified	A5A3E0	POTEF_HUMAN			17	2698	-			766			Actin-like.		A6NC34	Silent	SNP	ENST00000409914.2	37	c.2298C>A	CCDS46409.1																																																																																				0.592	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771		15	60	1	0	1.99824e-07	0.000566183	7.31603e-07	15	60				
LRP1B	53353	broad.mit.edu	37	2	141200182	141200182	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:141200182G>T	ENST00000389484.3	-	66	11276	c.10305C>A	c.(10303-10305)agC>agA	p.S3435R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3435	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGGAGAACAGCTGTTTTCAG	0.378										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(10303-10305)AGC>AGA		low density lipoprotein-related protein 1B							101.0	101.0	101.0					2																	141200182		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141200182G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10305C>A	2.37:g.141200182G>T	ENSP00000374135:p.Ser3435Arg	TSP Lung(27;0.18)	Somatic					p.S3435R	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	66	11277	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3435			Extracellular (Potential).|LDL-receptor class A 24.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.10305C>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517633	0.64634	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95272	-3.66	5.47	4.59	0.56863	.	0.061993	0.64402	U	0.000005	D	0.91334	0.7267	L	0.48935	1.535	0.32893	D	0.512066	P	0.43231	0.801	P	0.45829	0.494	D	0.89727	0.3923	10	0.22109	T	0.4	.	6.034	0.19697	0.1662:0.0:0.6805:0.1534	.	3435	Q9NZR2	LRP1B_HUMAN	R	3435;3373	ENSP00000374135:S3435R	ENSP00000374135:S3435R	S	-	3	2	LRP1B	140916652	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.747000	0.26290	1.297000	0.44761	0.650000	0.86243	AGC		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		22	72	1	0	4.26978e-12	0.00332997	1.87898e-11	22	72				
CYTIP	9595	broad.mit.edu	37	2	158300414	158300414	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:158300414C>A	ENST00000264192.3	-	1	240	c.119G>T	c.(118-120)aGa>aTa	p.R40I	CYTIP_ENST00000540637.1_Intron|AC019201.1_ENST00000401235.1_RNA|CYTIP_ENST00000497432.1_Intron	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	40					regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						TTGAATCCTTCTATTATCGTC	0.502																																							uc002tzj.1		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(118-120)AGA>ATA		cytohesin 1 interacting protein							178.0	153.0	161.0					2																	158300414		2203	4300	6503	SO:0001583	missense	9595				regulation of cell adhesion	cell cortex|early endosome	protein binding	g.chr2:158300414C>A	L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.119G>T	2.37:g.158300414C>A	ENSP00000264192:p.Arg40Ile		Somatic				CYTIP_uc010zcl.1_Intron	p.R40I	NM_004288	NP_004279	WXS	Illumina HiSeq	Unspecified	O60759	CYTIP_HUMAN			1	191	-			40					B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	ENST00000264192.3	37	c.119G>T	CCDS2204.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399458	0.62177	.	.	ENSG00000115165	ENST00000264192;ENST00000439355;ENST00000435117	T;T;T	0.61040	2.01;1.15;0.14	4.34	4.34	0.51931	.	0.237808	0.34676	N	0.003776	T	0.51924	0.1703	L	0.27053	0.805	0.80722	D	1	P	0.48911	0.917	P	0.49226	0.603	T	0.56547	-0.7961	10	0.72032	D	0.01	-19.4613	12.6657	0.56842	0.0:1.0:0.0:0.0	.	40	O60759	CYTIP_HUMAN	I	40;5;5	ENSP00000264192:R40I;ENSP00000402771:R5I;ENSP00000402155:R5I	ENSP00000264192:R40I	R	-	2	0	CYTIP	158008660	0.995000	0.38212	0.999000	0.59377	0.480000	0.33159	1.311000	0.33562	2.691000	0.91804	0.655000	0.94253	AGA		0.502	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254926.1	NM_004288		9	86	1	0	2.74318e-10	0.000442599	1.12645e-09	9	86				
ACVR1C	130399	broad.mit.edu	37	2	158401076	158401076	+	Missense_Mutation	SNP	T	T	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:158401076T>C	ENST00000243349.8	-	5	1184	c.824A>G	c.(823-825)cAg>cGg	p.Q275R	ACVR1C_ENST00000335450.7_Missense_Mutation_p.Q195R|ACVR1C_ENST00000409680.3_Missense_Mutation_p.Q225R|ACVR1C_ENST00000348328.5_Missense_Mutation_p.Q118R	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						TAAGGAGCCCTGTTCATGATA	0.383																																							uc002tzk.3		NA																	0				lung(3)|ovary(2)|skin(2)	7						c.(823-825)CAG>CGG		activin A receptor, type IC isoform 1							83.0	84.0	84.0					2																	158401076		2203	4300	6503	SO:0001583	missense	130399				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity	g.chr2:158401076T>C	BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.824A>G	2.37:g.158401076T>C	ENSP00000243349:p.Gln275Arg		Somatic				ACVR1C_uc002tzl.3_Missense_Mutation_p.Q195R|ACVR1C_uc010fof.2_Missense_Mutation_p.Q118R|ACVR1C_uc010foe.2_Missense_Mutation_p.Q225R	p.Q275R	NM_145259	NP_660302	WXS	Illumina HiSeq	Unspecified	Q8NER5	ACV1C_HUMAN			5	1067	-			275			Protein kinase.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000243349.8	37	c.824A>G	CCDS2205.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.963587	0.53507	.	.	ENSG00000123612	ENST00000243349;ENST00000409680;ENST00000348328;ENST00000335450	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.08	2.55	0.30701	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.126274	0.35970	N	0.002876	T	0.81856	0.4911	N	0.01446	-0.86	0.46061	D	0.998847	B;B;B	0.30281	0.275;0.009;0.002	B;B;B	0.36186	0.219;0.003;0.016	T	0.74928	-0.3497	10	0.37606	T	0.19	.	10.0599	0.42268	0.2686:0.0:0.0:0.7314	.	118;195;275	Q8NER5-2;Q8NER5-3;Q8NER5	.;.;ACV1C_HUMAN	R	275;225;118;195	ENSP00000243349:Q275R;ENSP00000387168:Q225R;ENSP00000335139:Q118R;ENSP00000335178:Q195R	ENSP00000243349:Q275R	Q	-	2	0	ACVR1C	158109322	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	5.123000	0.64703	0.302000	0.22762	0.477000	0.44152	CAG		0.383	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259		13	69	0	0	0	0.00136819	0	13	69				
GCA	25801	broad.mit.edu	37	2	163215621	163215621	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:163215621C>G	ENST00000437150.2	+	6	683	c.522C>G	c.(520-522)ttC>ttG	p.F174L	GCA_ENST00000429691.2_Intron|GCA_ENST00000233612.4_Missense_Mutation_p.F155L	NM_012198.3	NP_036330.1	P28676	GRAN_HUMAN	grancalcin, EF-hand calcium binding protein	174	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				membrane fusion (GO:0061025)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(1)	9						GCAGAATTTTCTTTGATGATT	0.308																																							uc002ucg.2		NA																	0					0						c.(520-522)TTC>TTG		grancalcin, EF-hand calcium binding protein							139.0	142.0	141.0					2																	163215621		2203	4296	6499	SO:0001583	missense	25801				cellular membrane fusion	cytoplasm|plasma membrane	calcium ion binding|protein homodimerization activity	g.chr2:163215621C>G	M81637	CCDS2218.1	2q24.2	2013-01-10	2001-11-28		ENSG00000115271	ENSG00000115271		"""EF-hand domain containing"""	15990	protein-coding gene	gene with protein product		607030	"""grancalcin, EF-hand calcium-binding protein"""			1737748, 1530588, 12804766	Standard	NM_012198		Approved	GCL	uc002ucg.3	P28676	OTTHUMG00000132057	ENST00000437150.2:c.522C>G	2.37:g.163215621C>G	ENSP00000394842:p.Phe174Leu		Somatic				GCA_uc010zcu.1_Missense_Mutation_p.F155L	p.F174L	NM_012198	NP_036330	WXS	Illumina HiSeq	Unspecified	P28676	GRAN_HUMAN			6	698	+			174			EF-hand 4.		B2R5X3|Q53TB5|Q59EP3	Missense_Mutation	SNP	ENST00000437150.2	37	c.522C>G	CCDS2218.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.96|11.96	1.795041|1.795041	0.31777|0.31777	.|.	.|.	ENSG00000115271|ENSG00000115271	ENST00000437150;ENST00000233612|ENST00000414723	T;T|.	0.41065|.	1.01;1.01|.	5.47|5.47	5.47|5.47	0.80525|0.80525	EF-hand-like domain (1);|.	0.113654|.	0.64402|.	D|.	0.000005|.	T|T	0.35566|0.35566	0.0936|0.0936	N|N	0.11560|0.11560	0.145|0.145	0.44282|0.44282	D|D	0.997142|0.997142	P|.	0.50369|.	0.934|.	B|.	0.39562|.	0.303|.	T|T	0.18085|0.18085	-1.0348|-1.0348	10|5	0.25751|.	T|.	0.34|.	.|.	8.7727|8.7727	0.34742|0.34742	0.0:0.8385:0.0:0.1615|0.0:0.8385:0.0:0.1615	.|.	174|.	P28676|.	GRAN_HUMAN|.	L|C	174;155|87	ENSP00000394842:F174L;ENSP00000233612:F155L|.	ENSP00000233612:F155L|.	F|S	+|+	3|2	2|0	GCA|GCA	162923867|162923867	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.141000|2.141000	0.42168|0.42168	2.720000|2.720000	0.93068|0.93068	0.557000|0.557000	0.71058|0.71058	TTC|TCT		0.308	GCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255080.3	NM_012198		14	160	0	0	0	0.000566183	0	14	160				
KCNH7	90134	broad.mit.edu	37	2	163693067	163693067	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:163693067A>T	ENST00000332142.5	-	2	386	c.287T>A	c.(286-288)gTc>gAc	p.V96D	KCNH7_ENST00000328032.4_Missense_Mutation_p.V96D	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	96	PAC.				circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	ATAGTAGGTGACCTCCACTTT	0.418																																					GBM(196;1492 2208 17507 24132 45496)	GBM(196;1492 2208 17507 24132 45496)	uc002uch.1		NA																	0				ovary(3)|skin(2)	5						c.(286-288)GTC>GAC		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						70.0	63.0	66.0					2																	163693067		2203	4300	6503	SO:0001583	missense	90134				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity	g.chr2:163693067A>T	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.287T>A	2.37:g.163693067A>T	ENSP00000331727:p.Val96Asp		Somatic				KCNH7_uc002uci.2_Missense_Mutation_p.V96D	p.V96D	NM_033272	NP_150375	WXS	Illumina HiSeq	Unspecified	Q9NS40	KCNH7_HUMAN			2	499	-			96			Cytoplasmic (Potential).|PAC.		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	c.287T>A	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.090845	0.76756	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.99701	-6.45;-6.45	5.87	4.71	0.59529	PAS fold-3 (1);PAS (1);	0.185192	0.47093	D	0.000247	D	0.99399	0.9788	L	0.56769	1.78	0.58432	D	0.999999	D;D	0.56035	0.974;0.971	P;P	0.60541	0.804;0.876	D	0.98572	1.0646	10	0.87932	D	0	.	11.061	0.47946	0.9277:0.0:0.0723:0.0	.	96;96	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	D	96	ENSP00000331727:V96D;ENSP00000333781:V96D	ENSP00000333781:V96D	V	-	2	0	KCNH7	163401313	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	1.049000	0.40321	0.533000	0.62120	GTC		0.418	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		6	34	0	0	0	0.00198382	0	6	34				
SCN3A	6328	broad.mit.edu	37	2	165947492	165947492	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:165947492G>T	ENST00000360093.3	-	28	5662	c.5171C>A	c.(5170-5172)cCc>cAc	p.P1724H	AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000409101.3_Missense_Mutation_p.P1675H|SCN3A_ENST00000540861.1_Missense_Mutation_p.P207H|SCN3A_ENST00000283254.7_Missense_Mutation_p.P1724H|SCN3A_ENST00000465043.1_5'Flank	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1724					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTCACAGTCGGGTGGTGCACT	0.458																																							uc002ucx.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(5170-5172)CCC>CAC		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						157.0	157.0	157.0					2																	165947492		2203	4300	6503	SO:0001583	missense	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:165947492G>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5171C>A	2.37:g.165947492G>T	ENSP00000353206:p.Pro1724His		Somatic				SCN3A_uc010zcy.1_Missense_Mutation_p.P207H|SCN3A_uc002ucy.2_Missense_Mutation_p.P1675H|SCN3A_uc002ucz.2_Missense_Mutation_p.P1675H	p.P1724H	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			28	5663	-			1724					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37	c.5171C>A		.	.	.	.	.	.	.	.	.	.	G	18.27	3.585936	0.66105	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.97480	-4.24;-4.24;-4.18;-4.4	5.95	5.95	0.96441	.	0.093545	0.47852	D	0.000211	D	0.98924	0.9635	M	0.92268	3.29	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.996	D	0.99229	1.0881	10	0.87932	D	0	.	20.4582	0.99154	0.0:0.0:1.0:0.0	.	1675;1675;1724	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	H	1724;1724;1675;207	ENSP00000353206:P1724H;ENSP00000283254:P1724H;ENSP00000386726:P1675H;ENSP00000439920:P207H	ENSP00000283254:P1724H	P	-	2	0	SCN3A	165655738	1.000000	0.71417	0.939000	0.37840	0.916000	0.54674	9.865000	0.99609	2.836000	0.97738	0.650000	0.86243	CCC		0.458	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		25	115	1	0	4.87955e-14	0.000878237	2.24227e-13	25	115				
SCN2A	6326	broad.mit.edu	37	2	166179956	166179956	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:166179956C>A	ENST00000375437.2	+	12	2252	c.1962C>A	c.(1960-1962)gtC>gtA	p.V654V	SCN2A_ENST00000375427.2_Silent_p.V654V|SCN2A_ENST00000283256.6_Silent_p.V654V|SCN2A_ENST00000357398.3_Silent_p.V654V	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	654					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGGTGTGGTCTCCCTGGTCG	0.582																																							uc002udc.2		NA																	0				ovary(6)|breast(1)|pancreas(1)	8						c.(1960-1962)GTC>GTA		sodium channel, voltage-gated, type II, alpha	Lamotrigine(DB00555)						45.0	40.0	42.0					2																	166179956		2203	4300	6503	SO:0001819	synonymous_variant	6326				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166179956C>A	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1962C>A	2.37:g.166179956C>A			Somatic				SCN2A_uc002udd.2_Silent_p.V654V|SCN2A_uc002ude.2_Silent_p.V654V	p.V654V	NM_001040142	NP_001035232	WXS	Illumina HiSeq	Unspecified	Q99250	SCN2A_HUMAN			12	2252	+			654					A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	ENST00000375437.2	37	c.1962C>A	CCDS33314.1																																																																																				0.582	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007		4	11	1	0	0.000602214	0.000602214	0.00178811	4	11				
SCN7A	6332	broad.mit.edu	37	2	167262212	167262212	+	Nonsense_Mutation	SNP	G	G	A	rs370894451		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:167262212G>A	ENST00000409855.1	-	25	5053	c.4927C>T	c.(4927-4929)Cga>Tga	p.R1643*		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1643					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TTGTCATTTCGCCTCAAGCGG	0.368																																							uc002udu.1		NA																	0				large_intestine(1)	1						c.(4927-4929)CGA>TGA		sodium channel, voltage-gated, type VII, alpha		G	stop/ARG	0,3710		0,0,1855	202.0	187.0	191.0		4927	3.6	1.0	2		191	1,8193		0,1,4096	no	stop-gained	SCN7A	NM_002976.3		0,1,5951	AA,AG,GG		0.0122,0.0,0.0084		1643/1683	167262212	1,11903	1855	4097	5952	SO:0001587	stop_gained	6332				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:167262212G>A	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.4927C>T	2.37:g.167262212G>A	ENSP00000386796:p.Arg1643*		Somatic					p.R1643*	NM_002976	NP_002967	WXS	Illumina HiSeq	Unspecified	Q01118	SCN7A_HUMAN			25	5054	-			1643						Nonsense_Mutation	SNP	ENST00000409855.1	37	c.4927C>T	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	G	40	8.427597	0.98806	0.0	1.22E-4	ENSG00000136546	ENST00000409855;ENST00000259060	.	.	.	4.51	3.56	0.40772	.	0.520730	0.17436	N	0.174285	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9305	0.41519	0.0:0.207:0.793:0.0	.	.	.	.	X	1643	.	ENSP00000259060:R1643X	R	-	1	2	SCN7A	166970458	0.992000	0.36948	0.959000	0.39883	0.409000	0.31022	6.962000	0.76048	2.514000	0.84764	0.655000	0.94253	CGA		0.368	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1			16	166	0	0	0	0.000566183	0	16	166				
XIRP2	129446	broad.mit.edu	37	2	168099116	168099116	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:168099116C>T	ENST00000409195.1	+	9	1303	c.1214C>T	c.(1213-1215)tCa>tTa	p.S405L	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.S405L|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.S183L	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	230					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAGCCATCATCAGTTGTGAGT	0.428																																							uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(1213-1215)TCA>TTA		xin actin-binding repeat containing 2 isoform 1							136.0	124.0	128.0					2																	168099116		1916	4124	6040	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168099116C>T	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.1214C>T	2.37:g.168099116C>T	ENSP00000386840:p.Ser405Leu		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.S230L|XIRP2_uc010fpq.2_Missense_Mutation_p.S183L|XIRP2_uc010fpr.2_Intron	p.S405L	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	1232	+			230					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.1214C>T	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812040	0.32053	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02916	4.11;4.11;4.11	5.59	4.72	0.59763	.	0.822150	0.10882	N	0.623730	T	0.11367	0.0277	L	0.58101	1.795	0.09310	N	1	D;D;D	0.67145	0.993;0.996;0.996	P;P;P	0.62298	0.796;0.9;0.9	T	0.17198	-1.0377	10	0.72032	D	0.01	-3.2315	12.4345	0.55593	0.0:0.9215:0.0:0.0785	.	230;230;183	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	L	405;405;183	ENSP00000386840:S405L;ENSP00000295237:S405L;ENSP00000387255:S183L	ENSP00000295237:S405L	S	+	2	0	XIRP2	167807362	0.957000	0.32711	0.338000	0.25549	0.040000	0.13550	3.418000	0.52721	1.377000	0.46286	-0.136000	0.14681	TCA		0.428	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		24	95	0	0	0	0.00395357	0	24	95				
HOXD11	3237	broad.mit.edu	37	2	176973687	176973688	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:176973687_176973688CC>AA	ENST00000249504.5	+	2	904_905	c.834_835CC>AA	c.(832-837)atCCgc>atAAgc	p.R279S	AC009336.1_ENST00000401374.2_RNA|HOXD10_ENST00000490088.2_3'UTR|HOXD11_ENST00000498438.1_3'UTR	NM_021192.2	NP_067015.2	P31277	HXD11_HUMAN	homeobox D11	279					anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|single fertilization (GO:0007338)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)							OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		AGTACCAGATCCGCGAACTGGA	0.525			T	NUP98	AML																																		uc002uki.2		NA		Dom	yes		2	2q31-q32	3237	T	homeo box D11			L	NUP98		AML		0					0						c.(832-837)ATCCGC>ATAAGC		homeobox D11																																				SO:0001583	missense	3237					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:176973687_176973688CC>AA		CCDS2265.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128713	ENSG00000128713		"""Homeoboxes / ANTP class : HOXL subclass"""	5134	protein-coding gene	gene with protein product		142986	"""homeo box D11"""	HOX4, HOX4F		1973146, 1358459	Standard	NM_021192		Approved		uc002uki.3	P31277	OTTHUMG00000132510	Exception_encountered	2.37:g.176973687_176973688delinsAA	ENSP00000249504:p.Arg279Ser		Somatic				HOXD11_uc010fqx.2_RNA	p.R279S	NM_021192	NP_067015	WXS	Illumina HiSeq	Unspecified	P31277	HXD11_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)	2	834_835	+			279			Homeobox.		A6NIS4|Q9NS02	Missense_Mutation	DNP	ENST00000249504.5	37	c.834_835CC>AA	CCDS2265.1																																																																																				0.525	HOXD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359250.2			10	65	0	0	0	6.4e-05	0	10	65				
TTN	7273	broad.mit.edu	37	2	179416521	179416521	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:179416521A>T	ENST00000591111.1	-	285	86407	c.86183T>A	c.(86182-86184)aTc>aAc	p.I28728N	TTN_ENST00000460472.2_Missense_Mutation_p.I21304N|TTN_ENST00000342175.6_Missense_Mutation_p.I21496N|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I30369N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I21429N|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I27801N|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28728	Fibronectin type-III 109. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGCCAGAGGATGCTATTTCT	0.408																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(83401-83403)ATC>AAC		titin isoform N2-A							188.0	184.0	186.0					2																	179416521		1862	4113	5975	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179416521A>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.86183T>A	2.37:g.179416521A>T	ENSP00000465570:p.Ile28728Asn		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.I21496N|TTN_uc010zfi.1_Missense_Mutation_p.I21429N|TTN_uc010zfj.1_Missense_Mutation_p.I21304N	p.I27801N	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		284	83626	-			28728					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.83402T>A		.	.	.	.	.	.	.	.	.	.	A	16.62	3.174362	0.57692	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	5.9	5.9	0.94986	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60881	0.2303	N	0.25332	0.735	0.58432	D	0.999999	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;D;D;D	0.66979	0.948;0.948;0.948;0.948	T	0.65216	-0.6222	9	0.87932	D	0	.	16.3317	0.83023	1.0:0.0:0.0:0.0	.	21304;21429;21496;28728	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	27801;21304;21496;21429;21301	ENSP00000343764:I27801N;ENSP00000434586:I21304N;ENSP00000340554:I21496N;ENSP00000352154:I21429N	ENSP00000340554:I21496N	I	-	2	0	TTN	179124767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.264000	0.75181	0.533000	0.62120	ATC		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		13	127	0	0	0	0.00185496	0	13	127				
TTN	7273	broad.mit.edu	37	2	179430521	179430521	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:179430521G>A	ENST00000591111.1	-	276	75639	c.75415C>T	c.(75415-75417)Cct>Tct	p.P25139S	TTN_ENST00000460472.2_Missense_Mutation_p.P17715S|TTN_ENST00000342175.6_Missense_Mutation_p.P17907S|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P26780S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P17840S|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P24212S|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25139	Fibronectin type-III 82. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGGAAGGAGGTTCAGCAGCT	0.478																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(72634-72636)CCT>TCT		titin isoform N2-A							213.0	202.0	205.0					2																	179430521		1998	4186	6184	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179430521G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.75415C>T	2.37:g.179430521G>A	ENSP00000465570:p.Pro25139Ser		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P17907S|TTN_uc010zfi.1_Missense_Mutation_p.P17840S|TTN_uc010zfj.1_Missense_Mutation_p.P17715S	p.P24212S	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	72858	-			25139					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.72634C>T		.	.	.	.	.	.	.	.	.	.	G	11.73	1.725008	0.30593	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.81	5.81	0.92471	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57651	0.2068	M	0.82716	2.605	0.41138	D	0.985939	B;P;P;B	0.37061	0.39;0.58;0.58;0.39	B;B;B;B	0.34536	0.054;0.185;0.185;0.054	T	0.65804	-0.6079	9	0.87932	D	0	.	15.5369	0.76011	0.0:0.1375:0.8625:0.0	.	17715;17840;17907;25139	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	24212;17715;17907;17840;17713	ENSP00000343764:P24212S;ENSP00000434586:P17715S;ENSP00000340554:P17907S;ENSP00000352154:P17840S	ENSP00000340554:P17907S	P	-	1	0	TTN	179138767	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.723000	0.61965	2.752000	0.94435	0.555000	0.69702	CCT		0.478	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		36	131	0	0	0	0.00148497	0	36	131				
TTN	7273	broad.mit.edu	37	2	179451991	179451991	+	Missense_Mutation	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:179451991A>G	ENST00000591111.1	-	257	59248	c.59024T>C	c.(59023-59025)gTt>gCt	p.V19675A	TTN_ENST00000460472.2_Missense_Mutation_p.V12251A|TTN_ENST00000342175.6_Missense_Mutation_p.V12443A|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V21316A|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V12376A|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V18748A|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19675	Fibronectin type-III 42. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTGGGGTAACGGTCGACCA	0.493																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(56242-56244)GTT>GCT		titin isoform N2-A							122.0	121.0	121.0					2																	179451991		1929	4132	6061	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179451991A>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.59024T>C	2.37:g.179451991A>G	ENSP00000465570:p.Val19675Ala		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V12443A|TTN_uc010zfi.1_Missense_Mutation_p.V12376A|TTN_uc010zfj.1_Missense_Mutation_p.V12251A	p.V18748A	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		256	56467	-			19675					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.56243T>C		.	.	.	.	.	.	.	.	.	.	A	16.53	3.148511	0.57151	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.98	4.8	0.61643	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.48077	0.1480	L	0.43554	1.36	0.44635	D	0.997611	B;B;B;B	0.23735	0.09;0.09;0.09;0.09	B;B;B;B	0.28385	0.082;0.082;0.082;0.089	T	0.46005	-0.9222	9	0.87932	D	0	.	13.2265	0.59916	0.8672:0.1328:0.0:0.0	.	12251;12376;12443;19675	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	18748;12251;12443;12376;12249	ENSP00000343764:V18748A;ENSP00000434586:V12251A;ENSP00000340554:V12443A;ENSP00000352154:V12376A	ENSP00000340554:V12443A	V	-	2	0	TTN	179160237	1.000000	0.71417	0.087000	0.20705	0.900000	0.52787	5.722000	0.68485	1.050000	0.40346	0.528000	0.53228	GTT		0.493	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		14	44	0	0	0	0.00185496	0	14	44				
TTN	7273	broad.mit.edu	37	2	179546109	179546109	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:179546109G>T	ENST00000591111.1	-	135	32514	c.32290C>A	c.(32290-32292)Ccc>Acc	p.P10764T	TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P11081T|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P9837T|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTACCTTTGGGTGGTGGAGGT	0.363																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(29509-29511)CCC>ACC		titin isoform N2-A							177.0	166.0	170.0					2																	179546109		1853	4096	5949	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179546109G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.32290C>A	2.37:g.179546109G>T	ENSP00000465570:p.Pro10764Thr		Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P6498T|TTN_uc010fre.1_Intron|TTN_uc002una.1_5'Flank|TTN_uc010frf.1_5'Flank	p.P9837T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		134	29733	-			10764					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.29509C>A		.	.	.	.	.	.	.	.	.	.	G	12.22	1.874109	0.33069	.	.	ENSG00000155657	ENST00000342992	T	0.77229	-1.08	5.49	3.57	0.40892	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.67552	0.2905	L	0.38175	1.15	0.80722	D	1	B	0.14805	0.011	B	0.22152	0.038	T	0.66685	-0.5861	9	0.87932	D	0	.	7.9738	0.30143	0.0895:0.2529:0.6576:0.0	.	10764	Q8WZ42	TITIN_HUMAN	T	9837	ENSP00000343764:P9837T	ENSP00000343764:P9837T	P	-	1	0	TTN	179254354	0.004000	0.15560	0.996000	0.52242	0.887000	0.51463	0.585000	0.23879	1.470000	0.48102	0.555000	0.69702	CCC		0.363	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		9	35	1	0	1.12685e-05	0.00448238	3.70408e-05	9	35				
TTN	7273	broad.mit.edu	37	2	179644746	179644746	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:179644746C>A	ENST00000591111.1	-	22	3934	c.3710G>T	c.(3709-3711)aGa>aTa	p.R1237I	TTN_ENST00000460472.2_Missense_Mutation_p.R1191I|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R1191I|TTN_ENST00000360870.5_Missense_Mutation_p.R1237I|TTN_ENST00000589042.1_Missense_Mutation_p.R1237I|TTN_ENST00000359218.5_Missense_Mutation_p.R1191I|TTN_ENST00000342992.6_Missense_Mutation_p.R1237I			Q8WZ42	TITIN_HUMAN	titin	33442					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACATAAGTTCTGACCACTAC	0.303																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(3709-3711)AGA>ATA		titin isoform N2-A							124.0	114.0	118.0					2																	179644746		2203	4300	6503	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179644746C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3710G>T	2.37:g.179644746C>A	ENSP00000465570:p.Arg1237Ile		Somatic				TTN_uc010zfh.1_Missense_Mutation_p.R1191I|TTN_uc010zfi.1_Missense_Mutation_p.R1191I|TTN_uc010zfj.1_Missense_Mutation_p.R1191I|TTN_uc002unb.2_Missense_Mutation_p.R1237I	p.R1237I	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		22	3934	-			1237					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.3710G>T		.	.	.	.	.	.	.	.	.	.	C	13.71	2.319665	0.41096	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.64438	-0.1;0.14;0.13;0.12;0.24	5.88	5.88	0.94601	Ribonuclease H-like (1);	.	.	.	.	T	0.67040	0.2851	N	0.24115	0.695	0.38809	D	0.955388	D;D;D;D;D	0.89917	0.966;0.966;0.966;0.966;1.0	P;P;P;P;D	0.74674	0.641;0.641;0.641;0.641;0.984	T	0.71590	-0.4547	9	0.87932	D	0	.	13.4362	0.61086	0.0:0.9287:0.0:0.0713	.	1191;1191;1191;1237;1237	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	I	1237;1191;1191;1191;1191;1237	ENSP00000343764:R1237I;ENSP00000434586:R1191I;ENSP00000340554:R1191I;ENSP00000352154:R1191I;ENSP00000354117:R1237I	ENSP00000340554:R1191I	R	-	2	0	TTN	179352991	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	3.124000	0.50461	2.779000	0.95612	0.650000	0.86243	AGA		0.303	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		15	75	1	0	3.45872e-05	0.00400662	0.000112056	15	75				
ZNF804A	91752	broad.mit.edu	37	2	185800553	185800553	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:185800553G>C	ENST00000302277.6	+	4	1024	c.430G>C	c.(430-432)Gtg>Ctg	p.V144L		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	144							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AACTGTTACTGTGAGAGAAAA	0.353																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(430-432)GTG>CTG		zinc finger protein 804A							57.0	56.0	56.0					2																	185800553		2203	4298	6501	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185800553G>C	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.430G>C	2.37:g.185800553G>C	ENSP00000303252:p.Val144Leu		Somatic					p.V144L	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	1024	+			144					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.430G>C	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.917994	0.73098	.	.	ENSG00000170396	ENST00000302277	T	0.30182	1.54	5.18	4.3	0.51218	.	0.157745	0.30329	N	0.009872	T	0.37758	0.1015	M	0.69358	2.11	0.35490	D	0.79892	P	0.48503	0.911	P	0.46299	0.511	T	0.56378	-0.7989	10	0.72032	D	0.01	-9.8316	12.2191	0.54423	0.0825:0.0:0.9175:0.0	.	144	Q7Z570	Z804A_HUMAN	L	144	ENSP00000303252:V144L	ENSP00000303252:V144L	V	+	1	0	ZNF804A	185508798	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	6.122000	0.71608	2.418000	0.82041	0.467000	0.42956	GTG		0.353	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		19	76	0	0	0	0.00278032	0	19	76				
ZNF804A	91752	broad.mit.edu	37	2	185801970	185801970	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:185801970C>G	ENST00000302277.6	+	4	2441	c.1847C>G	c.(1846-1848)aCt>aGt	p.T616S		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	616							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GAATCAGAAACTCGCTGCAAA	0.343																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(1846-1848)ACT>AGT		zinc finger protein 804A							83.0	91.0	89.0					2																	185801970		2203	4298	6501	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185801970C>G	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1847C>G	2.37:g.185801970C>G	ENSP00000303252:p.Thr616Ser		Somatic					p.T616S	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	2441	+			616					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.1847C>G	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.485797	0.01018	.	.	ENSG00000170396	ENST00000302277	T	0.05717	3.4	5.37	2.52	0.30459	.	0.954747	0.08635	N	0.916507	T	0.04952	0.0133	L	0.36672	1.1	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.47686	-0.9098	10	0.05620	T	0.96	-3.7912	6.8052	0.23774	0.0:0.3915:0.4408:0.1676	.	616	Q7Z570	Z804A_HUMAN	S	616	ENSP00000303252:T616S	ENSP00000303252:T616S	T	+	2	0	ZNF804A	185510215	0.000000	0.05858	0.008000	0.14137	0.019000	0.09904	-0.921000	0.04008	0.221000	0.20879	0.561000	0.74099	ACT		0.343	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		31	129	0	0	0	0.00283554	0	31	129				
ZNF804A	91752	broad.mit.edu	37	2	185801983	185801983	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:185801983G>T	ENST00000302277.6	+	4	2454	c.1860G>T	c.(1858-1860)atG>atT	p.M620I		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	620							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GCTGCAAAATGGAAGCAGAGA	0.338																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(1858-1860)ATG>ATT		zinc finger protein 804A							90.0	99.0	96.0					2																	185801983		2203	4298	6501	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185801983G>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1860G>T	2.37:g.185801983G>T	ENSP00000303252:p.Met620Ile		Somatic					p.M620I	NM_194250	NP_919226	WXS	Illumina HiSeq	Unspecified	Q7Z570	Z804A_HUMAN			4	2454	+			620					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.1860G>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	1.917	-0.449297	0.04572	.	.	ENSG00000170396	ENST00000302277	T	0.05319	3.46	5.51	2.65	0.31530	.	0.353135	0.24139	N	0.041199	T	0.04543	0.0124	L	0.47716	1.5	0.22591	N	0.998958	B	0.06786	0.001	B	0.04013	0.001	T	0.45234	-0.9275	10	0.07325	T	0.83	-2.3844	3.5888	0.07981	0.2922:0.0:0.4267:0.2812	.	620	Q7Z570	Z804A_HUMAN	I	620	ENSP00000303252:M620I	ENSP00000303252:M620I	M	+	3	0	ZNF804A	185510228	0.589000	0.26807	0.989000	0.46669	0.014000	0.08584	0.784000	0.26816	0.653000	0.30826	-0.181000	0.13052	ATG		0.338	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		41	134	1	0	1.00776e-21	0.00361006	4.91508e-21	41	134				
C2orf88	84281	broad.mit.edu	37	2	190788122	190788122	+	Intron	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:190788122G>T	ENST00000478197.1	+	1	219							Q9BSF0	SMAKA_HUMAN	chromosome 2 open reading frame 88							plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|lung(1)	3						TGTATTCATTGGGAATCTCAA	0.443																																							uc002uro.2		NA																	0					NA						c.(61-63)GGG>TGG		SubName: Full=cDNA FLJ54127, highly similar to Heterogeneous nuclear ribonucleoproteins C;																																				SO:0001627	intron_variant	0							g.chr2:190788122G>T	BC005083	CCDS42792.1	2q32.2	2014-02-12	2009-04-08		ENSG00000187699	ENSG00000187699			28191	protein-coding gene	gene with protein product	"""small membrane AKAP"""	615117				23996002	Standard	NM_032321		Approved	MGC13057, smAKAP	uc002urt.3	Q9BSF0	OTTHUMG00000154361	ENST00000478197.1:c.219+43569G>T	2.37:g.190788122G>T			Somatic					p.G21W			WXS	Illumina HiSeq	Unspecified					1	204	+								D3DPI3|P0C876|Q53TC7	Missense_Mutation	SNP	ENST00000478197.1	37	c.61G>T																																																																																					0.443	C2orf88-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000334952.1	NM_032321		22	81	1	0	7.92952e-12	0.00395357	3.46692e-11	22	81				
UNC80	285175	broad.mit.edu	37	2	210650811	210650811	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:210650811C>A	ENST00000439458.1	+	5	702	c.622C>A	c.(622-624)Ctg>Atg	p.L208M	UNC80_ENST00000478701.1_3'UTR|UNC80_ENST00000272845.6_Missense_Mutation_p.L208M	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	208					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CACCTTCCGTCTGGCCAGTGG	0.498																																							uc010zjc.1		NA																	0					0						c.(622-624)CTG>ATG		chromosome 2 open reading frame 21 isoform 1							123.0	114.0	117.0					2																	210650811		2203	4300	6503	SO:0001583	missense	285175					integral to membrane		g.chr2:210650811C>A	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.622C>A	2.37:g.210650811C>A	ENSP00000391088:p.Leu208Met		Somatic				UNC80_uc002vdj.1_Missense_Mutation_p.L208M	p.L208M	NM_032504	NP_115893	WXS	Illumina HiSeq	Unspecified	Q8N2C7	UNC80_HUMAN			5	702	+			208					B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	c.622C>A	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.503814	0.64410	.	.	ENSG00000144406	ENST00000439458;ENST00000281753;ENST00000272845	T;T	0.67523	-0.27;-0.26	5.95	3.85	0.44370	.	0.074314	0.53938	D	0.000042	T	0.77438	0.4130	M	0.67700	2.07	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.997;0.999	T	0.78902	-0.2021	10	0.87932	D	0	.	9.3913	0.38374	0.0:0.7185:0.0:0.2815	.	208;208	Q8N2C7;Q8N2C7-3	UNC80_HUMAN;.	M	208	ENSP00000391088:L208M;ENSP00000272845:L208M	ENSP00000272845:L208M	L	+	1	2	UNC80	210359056	0.004000	0.15560	0.900000	0.35374	0.970000	0.65996	0.142000	0.16096	1.531000	0.49152	0.650000	0.86243	CTG		0.498	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587		19	79	1	0	8.34094e-07	0.00121646	2.93453e-06	19	79				
ERBB4	2066	broad.mit.edu	37	2	212530153	212530153	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:212530153C>A	ENST00000342788.4	-	15	2076	c.1766G>T	c.(1765-1767)tGt>tTt	p.C589F	ERBB4_ENST00000402597.1_Missense_Mutation_p.C589F|ERBB4_ENST00000436443.1_Missense_Mutation_p.C589F	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	589	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TTTTTCCACACAGTTTGGGCC	0.428										TSP Lung(8;0.080)																													uc002veg.1		NA																	0				lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33						c.(1765-1767)TGT>TTT		v-erb-a erythroblastic leukemia viral oncogene							120.0	110.0	113.0					2																	212530153		2203	4300	6503	SO:0001583	missense	2066				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr2:212530153C>A	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1766G>T	2.37:g.212530153C>A	ENSP00000342235:p.Cys589Phe	TSP Lung(8;0.080)	Somatic				ERBB4_uc002veh.1_Missense_Mutation_p.C589F|ERBB4_uc010zji.1_Missense_Mutation_p.C589F|ERBB4_uc010zjj.1_Missense_Mutation_p.C589F|ERBB4_uc010fut.1_Missense_Mutation_p.C589F	p.C589F	NM_005235	NP_005226	WXS	Illumina HiSeq	Unspecified	Q15303	ERBB4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	15	1864	-		Renal(323;0.06)|Lung NSC(271;0.197)	589			Extracellular (Potential).|Cys-rich.		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	c.1766G>T	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.485819|4.485819	0.84854|0.84854	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597|ENST00000260943	D;D;D|.	0.97642|.	-4.47;-4.47;-4.47|.	5.26|5.26	5.26|5.26	0.73747|0.73747	Growth factor, receptor (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90665|0.90665	0.7072|0.7072	H|H	0.98027|0.98027	4.13|4.13	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0|.	D|D	0.93918|0.93918	0.7203|0.7203	10|5	0.87932|.	D|.	0|.	.|.	19.2295|19.2295	0.93833|0.93833	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	589;589;448;589;589|.	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303|.	.;.;.;.;ERBB4_HUMAN|.	F|L	589|589	ENSP00000342235:C589F;ENSP00000403204:C589F;ENSP00000385565:C589F|.	ENSP00000342235:C589F|.	C|V	-|-	2|1	0|0	ERBB4|ERBB4	212238398|212238398	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.770000|7.770000	0.85390|0.85390	2.632000|2.632000	0.89209|0.89209	0.655000|0.655000	0.94253|0.94253	TGT|GTG		0.428	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599		5	49	1	0	0.00198382	0.00198382	0.00580117	5	49				
ABCA12	26154	broad.mit.edu	37	2	215884272	215884272	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:215884272A>T	ENST00000272895.7	-	12	1755	c.1536T>A	c.(1534-1536)aaT>aaA	p.N512K	AC072062.3_ENST00000437897.3_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.N194K	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	512					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ACTGATCCATATTTAAATTAA	0.343																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	0				ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(1534-1536)AAT>AAA		ATP-binding cassette, sub-family A, member 12							61.0	64.0	63.0					2																	215884272		2203	4300	6503	SO:0001583	missense	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215884272A>T	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.1536T>A	2.37:g.215884272A>T	ENSP00000272895:p.Asn512Lys		Somatic				ABCA12_uc002vev.2_Missense_Mutation_p.N194K|ABCA12_uc010zjn.1_5'UTR	p.N512K	NM_173076	NP_775099	WXS	Illumina HiSeq	Unspecified	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	12	1756	-		Renal(323;0.127)	512					Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	c.1536T>A	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.804185	0.31869	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.53206	0.63;0.63	5.91	3.56	0.40772	.	0.660250	0.15066	N	0.282497	T	0.29093	0.0723	N	0.24115	0.695	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.12156	0.003;0.007	T	0.07028	-1.0794	10	0.27785	T	0.31	.	4.1954	0.10441	0.6611:0.0:0.1571:0.1818	.	512;194	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	K	512;194	ENSP00000272895:N512K;ENSP00000374312:N194K	ENSP00000272895:N512K	N	-	3	2	ABCA12	215592517	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.130000	0.31393	0.499000	0.27970	0.523000	0.50628	AAT		0.343	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		18	75	0	0	0	0.00152264	0	18	75				
COL4A4	1286	broad.mit.edu	37	2	227876937	227876937	+	Silent	SNP	A	A	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:227876937A>C	ENST00000396625.3	-	45	4500	c.4293T>G	c.(4291-4293)cgT>cgG	p.R1431R	COL4A4_ENST00000329662.7_Silent_p.R1428R	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1431	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TGTCACCTTTACGTCCGGGAG	0.537																																							uc010zlt.1		NA																	0				ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11						c.(4291-4293)CGT>CGG		alpha 4 type IV collagen precursor							58.0	64.0	62.0					2																	227876937		1927	4130	6057	SO:0001819	synonymous_variant	1286				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding	g.chr2:227876937A>C		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4293T>G	2.37:g.227876937A>C			Somatic					p.R1431R	NM_000092	NP_000083	WXS	Illumina HiSeq	Unspecified	P53420	CO4A4_HUMAN		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)	44	4947	-		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)	1431			Triple-helical region.		A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	ENST00000396625.3	37	c.4293T>G	CCDS42828.1																																																																																				0.537	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092		3	19	0	0	0	0.00024832	0	3	19				
SP100	6672	broad.mit.edu	37	2	231371124	231371124	+	Silent	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:231371124A>T	ENST00000264052.5	+	22	2332	c.1977A>T	c.(1975-1977)atA>atT	p.I659I	RN7SL834P_ENST00000461450.2_RNA|SP100_ENST00000409112.1_Silent_p.I659I|SP100_ENST00000340126.4_Silent_p.I659I	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	659	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AGCTAAGTATACGCTGCGGTG	0.448																																							uc002vqt.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1975-1977)ATA>ATT		nuclear antigen Sp100 isoform 2							74.0	72.0	72.0					2																	231371124		2203	4300	6503	SO:0001819	synonymous_variant	6672				DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding	g.chr2:231371124A>T	AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.1977A>T	2.37:g.231371124A>T			Somatic				SP100_uc002vqs.2_Silent_p.I659I|SP100_uc002vqu.1_Silent_p.I659I|SP100_uc010fxp.1_5'UTR	p.I659I	NM_003113	NP_003104	WXS	Illumina HiSeq	Unspecified	P23497	SP100_HUMAN		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)	22	2118	+		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)	659			SAND.		B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Silent	SNP	ENST00000264052.5	37	c.1977A>T	CCDS2477.1	.	.	.	.	.	.	.	.	.	.	A	7.295	0.611929	0.14066	.	.	ENSG00000067066	ENST00000431952	.	.	.	4.65	-1.95	0.07548	.	.	.	.	.	T	0.35098	0.0920	.	.	.	0.32517	N	0.536813	.	.	.	.	.	.	T	0.45891	-0.9230	4	.	.	.	.	4.9406	0.13963	0.2731:0.3094:0.4175:0.0	.	.	.	.	S	46	.	.	T	+	1	0	SP100	231079368	0.718000	0.27976	0.320000	0.25306	0.077000	0.17291	0.090000	0.15025	-0.134000	0.11516	-0.250000	0.11733	ACG		0.448	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113		8	39	0	0	0	0.00307968	0	8	39				
PCED1A	64773	broad.mit.edu	37	20	2819111	2819111	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr20:2819111G>A	ENST00000360652.2	-	6	1110	c.608C>T	c.(607-609)gCa>gTa	p.A203V	PCED1A_ENST00000356872.3_Missense_Mutation_p.A152V|VPS16_ENST00000380469.3_5'Flank|VPS16_ENST00000380445.3_5'Flank	NM_022760.4	NP_073597.2	Q9H1Q7	PED1A_HUMAN	PC-esterase domain containing 1A	203																	CAGGGAGCCTGCCAGGGGCTG	0.572																																							uc002wgz.1		NA																	0				ovary(2)	2						c.(607-609)GCA>GTA		hypothetical protein LOC64773							48.0	53.0	52.0					20																	2819111		2203	4300	6503	SO:0001583	missense	64773						hydrolase activity|protein binding	g.chr20:2819111G>A	AK026029	CCDS13035.1, CCDS59442.1	20p13	2012-06-11	2012-06-11	2012-06-11	ENSG00000132635	ENSG00000132635			16212	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 81"", ""family with sequence similarity 113, member A"""	C20orf81, FAM113A		20056006	Standard	NM_022760		Approved	bA12M19.1, FLJ22376	uc002wgz.2	Q9H1Q7	OTTHUMG00000031716	ENST00000360652.2:c.608C>T	20.37:g.2819111G>A	ENSP00000353868:p.Ala203Val		Somatic				FAM113A_uc002whb.1_Missense_Mutation_p.A54V|FAM113A_uc002wha.1_Missense_Mutation_p.A54V|FAM113A_uc010zqa.1_Missense_Mutation_p.A50V|FAM113A_uc002whc.1_Missense_Mutation_p.A152V|VPS16_uc002whe.2_5'Flank|VPS16_uc002whf.2_5'Flank|VPS16_uc002whd.2_5'Flank	p.A203V	NM_022760	NP_073597	WXS	Illumina HiSeq	Unspecified	Q9H1Q7	F113A_HUMAN			6	1105	-			203					Q5JUA5|Q5JUA6|Q6PK19|Q86WF5|Q96CG7|Q9H1Q6|Q9H6D1	Missense_Mutation	SNP	ENST00000360652.2	37	c.608C>T	CCDS13035.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.846501	0.32606	.	.	ENSG00000132635	ENST00000356872;ENST00000360652;ENST00000448755;ENST00000439542	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	4.28	4.28	0.50868	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.224202	0.35936	N	0.002895	T	0.19087	0.0458	N	0.14661	0.345	0.35221	D	0.776023	B;B;D;B	0.64830	0.335;0.379;0.994;0.032	B;B;P;B	0.59487	0.054;0.129;0.858;0.032	T	0.15838	-1.0423	10	0.28530	T	0.3	-11.5076	12.4152	0.55490	0.0:0.0:1.0:0.0	.	152;199;50;203	Q9H1Q7-2;D3DVX4;B4DEI2;Q9H1Q7	.;.;.;F113A_HUMAN	V	152;203;152;203	ENSP00000349334:A152V;ENSP00000353868:A203V;ENSP00000388935:A152V;ENSP00000401711:A203V	ENSP00000349334:A152V	A	-	2	0	FAM113A	2767111	0.868000	0.29978	0.948000	0.38648	0.918000	0.54935	1.198000	0.32223	2.397000	0.81536	0.563000	0.77884	GCA		0.572	PCED1A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077676.2	NM_022760		5	33	0	0	0	0.00198382	0	5	33				
ASXL1	171023	broad.mit.edu	37	20	31024829	31024829	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr20:31024829G>T	ENST00000375687.4	+	13	4738	c.4314G>T	c.(4312-4314)caG>caT	p.Q1438H	ASXL1_ENST00000306058.5_Missense_Mutation_p.Q1433H	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1438					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GCATCAAGCAGGCATTTTATG	0.517			"""F, N, Mis"""		"""MDS, CMML"""																																		uc002wxs.2		NA		Rec	yes		20	20q11.1	171023	F|N|Mis	additional sex combs like 1			L			MDS|CMML		0				haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						c.(4312-4314)CAG>CAT		additional sex combs like 1 isoform 1							85.0	86.0	85.0					20																	31024829		2203	4300	6503	SO:0001583	missense	171023				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding	g.chr20:31024829G>T	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.4314G>T	20.37:g.31024829G>T	ENSP00000364839:p.Gln1438His		Somatic				ASXL1_uc010geb.2_Missense_Mutation_p.Q1329H	p.Q1438H	NM_015338	NP_056153	WXS	Illumina HiSeq	Unspecified	Q8IXJ9	ASXL1_HUMAN			12	4740	+			1438					B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	ENST00000375687.4	37	c.4314G>T	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614046	0.46631	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.19669	2.13;2.13	4.95	3.01	0.34805	.	0.186758	0.39146	N	0.001444	T	0.30479	0.0766	L	0.34521	1.04	0.36246	D	0.853589	D;D	0.89917	0.999;1.0	D;D	0.85130	0.995;0.997	T	0.30966	-0.9960	10	0.87932	D	0	-12.2071	7.9602	0.30066	0.2457:0.0:0.7543:0.0	.	1433;1438	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	H	1438;1438;1438;1359;1433	ENSP00000364839:Q1438H;ENSP00000305119:Q1433H	ENSP00000305119:Q1433H	Q	+	3	2	ASXL1	30488490	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.214000	0.32419	1.476000	0.48215	-0.136000	0.14681	CAG		0.517	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338		10	68	1	0	1.08611e-07	0.000978159	3.99818e-07	10	68				
PREX1	57580	broad.mit.edu	37	20	47268019	47268019	+	Missense_Mutation	SNP	T	T	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr20:47268019T>C	ENST00000371941.3	-	22	2592	c.2570A>G	c.(2569-2571)tAt>tGt	p.Y857C	PREX1_ENST00000396220.1_Missense_Mutation_p.Y857C	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	857					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CACATACTCATACACCACGCC	0.637																																							uc002xtw.1		NA																	0				lung(3)|ovary(2)|pancreas(1)	6						c.(2569-2571)TAT>TGT		phosphatidylinositol-3,4,							82.0	68.0	73.0					20																	47268019		2203	4300	6503	SO:0001583	missense	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47268019T>C	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2570A>G	20.37:g.47268019T>C	ENSP00000361009:p.Tyr857Cys		Somatic				PREX1_uc002xtv.1_Missense_Mutation_p.Y154C	p.Y857C	NM_020820	NP_065871	WXS	Illumina HiSeq	Unspecified	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		22	2593	-			857					E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	c.2570A>G	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.280208	0.80692	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.60548	0.18;0.18	4.71	4.71	0.59529	.	0.000000	0.49916	U	0.000128	T	0.74275	0.3695	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78081	-0.2343	10	0.87932	D	0	.	14.2161	0.65795	0.0:0.0:0.0:1.0	.	857;154	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	C	857	ENSP00000361009:Y857C;ENSP00000379522:Y857C	ENSP00000361009:Y857C	Y	-	2	0	PREX1	46701426	1.000000	0.71417	0.988000	0.46212	0.953000	0.61014	7.979000	0.88103	1.749000	0.51849	0.460000	0.39030	TAT		0.637	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		5	37	0	0	0	0.000602214	0	5	37				
KRTAP15-1	254950	broad.mit.edu	37	21	31812810	31812810	+	Nonsense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr21:31812810C>G	ENST00000334067.3	+	1	214	c.165C>G	c.(163-165)taC>taG	p.Y55*		NM_181623.1	NP_853654.1	Q3LI76	KR151_HUMAN	keratin associated protein 15-1	55						intermediate filament (GO:0005882)				kidney(1)|large_intestine(3)|lung(6)|skin(1)	11						AGGAGACCTACTGTGAGCCCA	0.502																																							uc002yod.2		NA																	0					0						c.(163-165)TAC>TAG		keratin associated protein 15-1							99.0	94.0	96.0					21																	31812810		2203	4300	6503	SO:0001587	stop_gained	254950					intermediate filament		g.chr21:31812810C>G	AP001708	CCDS13593.1	21q22.1	2008-05-21			ENSG00000186970	ENSG00000186970		"""Keratin associated proteins"""	18927	protein-coding gene	gene with protein product						12359730	Standard	NM_181623		Approved	KAP15.1	uc002yod.3	Q3LI76	OTTHUMG00000057784	ENST00000334067.3:c.165C>G	21.37:g.31812810C>G	ENSP00000334866:p.Tyr55*		Somatic					p.Y55*	NM_181623	NP_853654	WXS	Illumina HiSeq	Unspecified	Q3LI76	KR151_HUMAN			1	165	+			55					Q2M3F4	Nonsense_Mutation	SNP	ENST00000334067.3	37	c.165C>G	CCDS13593.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.402484	0.42613	.	.	ENSG00000186970	ENST00000334067	.	.	.	4.52	2.73	0.32206	.	1.463340	0.04336	N	0.353284	.	.	.	.	.	.	0.48762	D	0.999704	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-0.8833	7.0684	0.25165	0.0:0.7998:0.0:0.2002	.	.	.	.	X	55	.	ENSP00000334866:Y55X	Y	+	3	2	KRTAP15-1	30734681	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	0.243000	0.18106	0.860000	0.35481	-0.137000	0.14449	TAC		0.502	KRTAP15-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128236.1			13	80	0	0	0	0.00185496	0	13	80				
KRTAP11-1	337880	broad.mit.edu	37	21	32253550	32253550	+	Silent	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr21:32253550A>G	ENST00000332378.4	-	1	324	c.294T>C	c.(292-294)acT>acC	p.T98T		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	98						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						GGCTGTAGGTAGTTGAGCAGG	0.567																																							uc002yov.2		NA																	0				pancreas(1)	1						c.(292-294)ACT>ACC		keratin associated protein 11-1							83.0	82.0	82.0					21																	32253550		2203	4300	6503	SO:0001819	synonymous_variant	337880					keratin filament	structural molecule activity	g.chr21:32253550A>G	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.294T>C	21.37:g.32253550A>G			Somatic					p.T98T	NM_175858	NP_787054	WXS	Illumina HiSeq	Unspecified	Q8IUC1	KR111_HUMAN			1	325	-			98					A1L4I8	Silent	SNP	ENST00000332378.4	37	c.294T>C	CCDS13608.1																																																																																				0.567	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1			6	43	0	0	0	0.00116845	0	6	43				
MRPS6	64968	broad.mit.edu	37	21	35497779	35497779	+	Splice_Site	SNP	G	G	T	rs557958888		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr21:35497779G>T	ENST00000399312.2	+	2	362	c.184G>T	c.(184-186)Ggg>Tgg	p.G62W	MRPS6_ENST00000482679.1_3'UTR|AP000320.7_ENST00000362077.4_RNA	NM_032476.3	NP_115865.1	P82932	RT06_HUMAN	mitochondrial ribosomal protein S6	62					translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|pancreas(1)|skin(1)	6						CAACAGAGGCGGGTAAGTTTC	0.433																																							uc002ytp.2		NA																	0				skin(1)	1						c.(184-186)GGG>TGG		mitochondrial ribosomal protein S6							103.0	110.0	108.0					21																	35497779		2203	4300	6503	SO:0001630	splice_region_variant	64968				translation	mitochondrion|small ribosomal subunit	rRNA binding|structural constituent of ribosome	g.chr21:35497779G>T	AB051347	CCDS33548.1	21q22.11	2012-09-13	2002-06-20		ENSG00000243927	ENSG00000243927		"""Mitochondrial ribosomal proteins / small subunits"""	14051	protein-coding gene	gene with protein product		611973	"""chromosome 21 open reading frame 101"""	C21orf101			Standard	NM_032476		Approved	MRP-S6, RPMS6	uc002ytp.2	P82932	OTTHUMG00000065820	ENST00000399312.2:c.185+1G>T	21.37:g.35497779G>T			Somatic					p.G62W	NM_032476	NP_115865	WXS	Illumina HiSeq	Unspecified	P82932	RT06_HUMAN			2	362	+			62					B2R573|Q96Q64|Q9BSK8|Q9BW89	Missense_Mutation	SNP	ENST00000399312.2	37	c.184G>T	CCDS33548.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036735	0.54896	.	.	ENSG00000243927	ENST00000399312	.	.	.	5.04	5.04	0.67666	Translation elongation factor EF1B/ribosomal protein S6 (1);	0.449748	0.18519	U	0.138837	D	0.83436	0.5254	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84861	0.0819	9	0.59425	D	0.04	.	17.3298	0.87259	0.0:0.0:1.0:0.0	.	62	P82932	RT06_HUMAN	W	62	.	ENSP00000382250:G62W	G	+	1	0	MRPS6	34419649	1.000000	0.71417	0.998000	0.56505	0.094000	0.18550	5.795000	0.69074	2.606000	0.88127	0.650000	0.86243	GGG		0.433	MRPS6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141033.1	NM_032476	Missense_Mutation	26	104	1	0	3.28513e-13	0.00395357	1.48435e-12	26	104				
POTEH	23784	broad.mit.edu	37	22	16287493	16287493	+	Silent	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr22:16287493G>T	ENST00000343518.6	-	1	444	c.393C>A	c.(391-393)ctC>ctA	p.L131L		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	131										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TCTTGCTCCTGAGTGTCTTCA	0.617																																							uc010gqp.2		NA																	0				skin(1)	1						c.(391-393)CTC>CTA		ANKRD26-like family C, member 3							55.0	64.0	61.0					22																	16287493		1473	2973	4446	SO:0001819	synonymous_variant	23784							g.chr22:16287493G>T	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.393C>A	22.37:g.16287493G>T			Somatic				POTEH_uc002zlg.1_5'Flank|POTEH_uc002zlh.1_5'Flank|POTEH_uc002zlj.1_Intron	p.L131L	NM_001136213	NP_001129685	WXS	Illumina HiSeq	Unspecified	Q6S545	POTEH_HUMAN			1	445	-			131					A2CEK4|A6NCI1|A9Z1W0	Silent	SNP	ENST00000343518.6	37	c.393C>A	CCDS46658.1																																																																																				0.617	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		36	273	1	0	2.00842e-17	0.0025221	9.45427e-17	36	273				
OR11H1	81061	broad.mit.edu	37	22	16449081	16449081	+	Missense_Mutation	SNP	C	C	A	rs537405197		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr22:16449081C>A	ENST00000252835.4	-	1	724	c.724G>T	c.(724-726)Ggt>Tgt	p.G242C		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		GAAGGCATACCCAACATAGCT	0.408																																							uc011agd.1		NA																	0					0						c.(724-726)GGT>TGT		olfactory receptor, family 11, subfamily H,							182.0	175.0	177.0					22																	16449081		2201	4298	6499	SO:0001583	missense	81061				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr22:16449081C>A	AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.724G>T	22.37:g.16449081C>A	ENSP00000252835:p.Gly242Cys		Somatic					p.G242C	NM_001005239	NP_001005239	WXS	Illumina HiSeq	Unspecified	Q8NG94	O11H1_HUMAN		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)	1	724	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)	242			Cytoplasmic (Potential).		Q6IEX0|Q96R32	Missense_Mutation	SNP	ENST00000252835.4	37	c.724G>T	CCDS33594.1	.	.	.	.	.	.	.	.	.	.	c	0.895	-0.724043	0.03158	.	.	ENSG00000130538	ENST00000252835	T	0.00123	8.7	1.73	0.511	0.16989	GPCR, rhodopsin-like superfamily (1);	1.048890	0.07623	N	0.927358	T	0.00109	0.0003	N	0.24115	0.695	0.22629	N	0.998911	B	0.12013	0.005	B	0.22601	0.04	T	0.20140	-1.0284	10	0.66056	D	0.02	.	4.2531	0.10703	0.0:0.2547:0.4895:0.2558	.	242	Q8NG94	O11H1_HUMAN	C	242	ENSP00000252835:G242C	ENSP00000252835:G242C	G	-	1	0	OR11H1	14829081	0.000000	0.05858	0.954000	0.39281	0.166000	0.22503	-0.575000	0.05861	0.010000	0.14839	-1.045000	0.02358	GGT		0.408	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074923.2	NM_001005239		49	166	1	0	3.10996e-30	0.00361006	1.57362e-29	49	166				
CCT8L2	150160	broad.mit.edu	37	22	17072290	17072290	+	Missense_Mutation	SNP	C	C	A	rs141686687		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr22:17072290C>A	ENST00000359963.3	-	1	1410	c.1151G>T	c.(1150-1152)gGg>gTg	p.G384V		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	384					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				ACTCCGCAGCCCCTGGGTGGT	0.567																																							uc002zlp.1		NA																	0				ovary(1)	1						c.(1150-1152)GGG>GTG		T-complex protein 1		C	VAL/GLY	1,4405	2.1+/-5.4	0,1,2202	80.0	77.0	78.0		1151	2.0	0.2	22	dbSNP_134	78	0,8600		0,0,4300	no	missense	CCT8L2	NM_014406.4	109	0,1,6502	AA,AC,CC		0.0,0.0227,0.0077	probably-damaging	384/558	17072290	1,13005	2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072290C>A	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1151G>T	22.37:g.17072290C>A	ENSP00000353048:p.Gly384Val		Somatic					p.G384V	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	1411	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	384					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.1151G>T	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	1.096	-0.662561	0.03454	2.27E-4	0.0	ENSG00000198445	ENST00000359963	T	0.75821	-0.97	1.98	1.98	0.26296	.	0.000000	0.39834	U	0.001254	T	0.53642	0.1809	L	0.31207	0.915	0.28775	N	0.90014	B	0.17852	0.024	B	0.22152	0.038	T	0.40251	-0.9573	10	0.02654	T	1	-24.4095	7.4423	0.27190	0.0:1.0:0.0:0.0	.	384	Q96SF2	TCPQM_HUMAN	V	384	ENSP00000353048:G384V	ENSP00000353048:G384V	G	-	2	0	CCT8L2	15452290	0.905000	0.30787	0.223000	0.23860	0.528000	0.34623	1.481000	0.35476	1.115000	0.41800	0.379000	0.24179	GGG		0.567	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			18	29	1	0	5.35267e-07	0.000958276	1.93354e-06	18	29				
ARVCF	421	broad.mit.edu	37	22	19960554	19960554	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr22:19960554G>A	ENST00000263207.3	-	15	2735	c.2444C>T	c.(2443-2445)tCg>tTg	p.S815L	ARVCF_ENST00000401994.1_Missense_Mutation_p.S752L|ARVCF_ENST00000406259.1_Missense_Mutation_p.S809L|ARVCF_ENST00000406522.1_Missense_Mutation_p.S746L|ARVCF_ENST00000344269.3_Missense_Mutation_p.S752L	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	815					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					TTCGCGTACCGATTGGCTGTG	0.687																																							uc002zqz.2		NA																	0				liver(1)	1						c.(2443-2445)TCG>TTG		armadillo repeat protein							65.0	60.0	62.0					22																	19960554		2203	4300	6503	SO:0001583	missense	421				cell adhesion|multicellular organismal development		protein binding	g.chr22:19960554G>A		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.2444C>T	22.37:g.19960554G>A	ENSP00000263207:p.Ser815Leu		Somatic				ARVCF_uc002zqy.2_Missense_Mutation_p.S331L	p.S815L	NM_001670	NP_001661	WXS	Illumina HiSeq	Unspecified	O00192	ARVC_HUMAN			15	2715	-	Colorectal(54;0.0993)		815			ARM 10.		B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	37	c.2444C>T	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208838	0.58343	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	4.36	4.36	0.52297	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59905	0.2228	M	0.85197	2.74	0.80722	D	1	D;P	0.53885	0.963;0.95	P;B	0.47376	0.545;0.372	T	0.68849	-0.5300	9	.	.	.	-22.7394	16.1868	0.81960	0.0:0.0:1.0:0.0	.	815;331	O00192;E7EV58	ARVC_HUMAN;.	L	815;752;752;746;809	ENSP00000263207:S815L;ENSP00000342042:S752L;ENSP00000384341:S752L;ENSP00000384732:S746L;ENSP00000385444:S809L	.	S	-	2	0	ARVCF	18340554	1.000000	0.71417	0.878000	0.34440	0.014000	0.08584	7.275000	0.78548	2.421000	0.82119	0.561000	0.74099	TCG		0.687	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670		5	17	0	0	0	0.00116845	0	5	17				
MAPK1	5594	broad.mit.edu	37	22	22142565	22142565	+	Silent	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr22:22142565G>A	ENST00000215832.6	-	6	1025	c.837C>T	c.(835-837)ttC>ttT	p.F279F	MAPK1_ENST00000398822.3_Silent_p.F279F|MAPK1_ENST00000544786.1_Intron	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	279	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	CAGCATTTGGGAACAGCCTGT	0.363																																							uc002zvn.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(835-837)TTC>TTT		mitogen-activated protein kinase 1	Arsenic trioxide(DB01169)						109.0	102.0	104.0					22																	22142565		2203	4300	6503	SO:0001819	synonymous_variant	5594				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr22:22142565G>A	M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.837C>T	22.37:g.22142565G>A			Somatic				MAPK1_uc002zvo.2_Silent_p.F279F|MAPK1_uc010gtk.1_Intron	p.F279F	NM_002745	NP_002736	WXS	Illumina HiSeq	Unspecified	P28482	MK01_HUMAN		READ - Rectum adenocarcinoma(21;0.0689)	6	1077	-	Colorectal(54;0.105)	all_lung(157;3.89e-05)	279			Protein kinase.		A8CZ64	Silent	SNP	ENST00000215832.6	37	c.837C>T	CCDS13795.1																																																																																				0.363	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075396.2			13	63	0	0	0	0.00400662	0	13	63				
TBC1D10A	83874	broad.mit.edu	37	22	30722752	30722752	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr22:30722752G>C	ENST00000215790.7	-	1	283	c.119C>G	c.(118-120)tCt>tGt	p.S40C	TBC1D10A_ENST00000490449.1_5'UTR|TBC1D10A_ENST00000403477.3_Missense_Mutation_p.S40C	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	40					activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)			cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						AGACCCGAGAGAGCTGAGTTC	0.721																																							uc011akt.1		NA																	0				ovary(1)	1						c.(118-120)TCT>TGT		TBC1 domain family, member 10A							25.0	32.0	29.0					22																	30722752		2202	4292	6494	SO:0001583	missense	83874					intracellular|microvillus	guanyl-nucleotide exchange factor activity|PDZ domain binding|Rab GTPase activator activity	g.chr22:30722752G>C	AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.119C>G	22.37:g.30722752G>C	ENSP00000215790:p.Ser40Cys		Somatic				TBC1D10A_uc010gvu.2_Missense_Mutation_p.S40C|TBC1D10A_uc003ahk.3_Missense_Mutation_p.S40C	p.S40C	NM_031937	NP_114143	WXS	Illumina HiSeq	Unspecified	Q9BXI6	TB10A_HUMAN			1	143	-			40					B3KXT8|O76053|Q20WK7|Q543A2	Missense_Mutation	SNP	ENST00000215790.7	37	c.119C>G	CCDS13874.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.507237	0.64410	.	.	ENSG00000099992	ENST00000215790;ENST00000403477	T;T	0.19532	2.14;3.24	4.13	3.09	0.35607	.	0.149971	0.45867	D	0.000334	T	0.32823	0.0842	L	0.60455	1.87	0.80722	D	1	D;B;D	0.56287	0.975;0.058;0.975	P;B;P	0.58077	0.832;0.036;0.832	T	0.06881	-1.0802	10	0.87932	D	0	.	8.574	0.33587	0.1121:0.0:0.8879:0.0	.	40;40;40	Q20WK7;B3KXT8;Q9BXI6	.;.;TB10A_HUMAN	C	40	ENSP00000215790:S40C;ENSP00000384996:S40C	ENSP00000215790:S40C	S	-	2	0	TBC1D10A	29052752	1.000000	0.71417	0.997000	0.53966	0.526000	0.34562	4.515000	0.60489	1.999000	0.58509	0.430000	0.28490	TCT		0.721	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320550.1	NM_031937		5	20	0	0	0	0.000602214	0	5	20				
PNPLA5	150379	broad.mit.edu	37	22	44285300	44285300	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr22:44285300A>T	ENST00000597664.1	-	4	740	c.611T>A	c.(610-612)cTg>cAg	p.L204Q	PNPLA5_ENST00000216177.4_Missense_Mutation_p.L204Q|PNPLA5_ENST00000593866.1_Missense_Mutation_p.L90Q|PNPLA5_ENST00000381198.2_Missense_Mutation_p.L90Q			Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	204					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	16		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				CAGCTCATGCAGGTTGGGGGA	0.567																																							uc003beg.2		NA																	0					0						c.(610-612)CTG>CAG		patatin-like phospholipase domain containing 5							144.0	144.0	144.0					22																	44285300		2203	4300	6503	SO:0001583	missense	150379				lipid catabolic process		hydrolase activity	g.chr22:44285300A>T	Z97055	CCDS14053.1, CCDS54537.1	22q13.31	2009-01-12			ENSG00000100341	ENSG00000100341		"""Patatin-like phospholipase domain containing"""	24888	protein-coding gene	gene with protein product		611589				16799181, 19029121	Standard	NM_138814		Approved	dJ388M5.4, GS2L	uc003beg.3	Q7Z6Z6	OTTHUMG00000030779	ENST00000597664.1:c.611T>A	22.37:g.44285300A>T	ENSP00000471069:p.Leu204Gln		Somatic				PNPLA5_uc011aqc.1_Missense_Mutation_p.L64Q|PNPLA5_uc003beh.2_Missense_Mutation_p.L90Q	p.L204Q	NM_138814	NP_620169	WXS	Illumina HiSeq	Unspecified	Q7Z6Z6	PLPL5_HUMAN			4	708	-		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)	204					B1AHL8|B3KPR1|Q6ZST0	Missense_Mutation	SNP	ENST00000597664.1	37	c.611T>A		.	.	.	.	.	.	.	.	.	.	A	16.45	3.126486	0.56721	.	.	ENSG00000100341	ENST00000216177;ENST00000381198	T;T	0.78924	-1.22;0.77	5.21	4.15	0.48705	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.649607	0.13068	N	0.416312	T	0.81936	0.4928	M	0.72118	2.19	0.09310	N	1	P;P	0.46220	0.874;0.855	P;P	0.51355	0.667;0.459	T	0.70270	-0.4918	10	0.40728	T	0.16	-4.9266	10.5391	0.45022	0.855:0.0:0.0:0.145	.	90;204	Q7Z6Z6-2;Q7Z6Z6	.;PLPL5_HUMAN	Q	204;90	ENSP00000216177:L204Q;ENSP00000370595:L90Q	ENSP00000216177:L204Q	L	-	2	0	PNPLA5	42616633	0.025000	0.19082	0.001000	0.08648	0.003000	0.03518	2.848000	0.48278	0.887000	0.36136	0.459000	0.35465	CTG		0.567	PNPLA5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000075667.4	NM_138814		15	74	0	0	0	0.000566183	0	15	74				
FANCD2	2177	broad.mit.edu	37	3	10140527	10140527	+	Intron	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:10140527G>T	ENST00000419585.1	+	43	4442				FANCD2_ENST00000287647.3_Missense_Mutation_p.G1437C|FANCD2_ENST00000383806.1_Intron|FANCD2_ENST00000383807.1_Intron|FANCD2OS_ENST00000524279.1_Intron			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2						DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		ACCAGAGTCTGGCACTGATGG	0.458			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc003buw.2		NA	yes	Rec		Fanconi anaemia D2	3	3p26	2177	D|Mis|N|F	"""Fanconi anemia, complementation group D2"""			L		AML|leukemia			0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(4309-4311)GGC>TGC	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia complementation group D2 isoform							151.0	135.0	141.0					3																	10140527		2203	4300	6503	SO:0001627	intron_variant	2177	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding	g.chr3:10140527G>T	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.4281+28G>T	3.37:g.10140527G>T			Somatic				FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_Intron|C3orf24_uc003buz.2_Intron	p.G1437C	NM_033084	NP_149075	WXS	Illumina HiSeq	Unspecified	Q9BXW9	FACD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.148)	43	4387	+			1437					Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	37	c.4309G>T	CCDS33696.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.544238	0.27563	.	.	ENSG00000144554	ENST00000287647	T	0.57752	0.38	5.05	-2.39	0.06602	.	1.846620	0.02637	N	0.104973	T	0.31857	0.0810	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.14578	0.011	T	0.33163	-0.9879	10	0.72032	D	0.01	.	5.6615	0.17672	0.4279:0.0:0.437:0.1351	.	1437	Q9BXW9	FACD2_HUMAN	C	1437	ENSP00000287647:G1437C	ENSP00000287647:G1437C	G	+	1	0	FANCD2	10115527	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.064000	0.14437	-0.298000	0.08921	-0.142000	0.14014	GGC		0.458	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1			14	50	1	0	3.27435e-08	0.00244969	1.2461e-07	14	50				
ATP2B2	491	broad.mit.edu	37	3	10413663	10413663	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:10413663A>T	ENST00000352432.4	-	11	1558	c.1489T>A	c.(1489-1491)Tgc>Agc	p.C497S	ATP2B2_ENST00000360273.2_Missense_Mutation_p.C497S|ATP2B2_ENST00000343816.4_Missense_Mutation_p.C483S|ATP2B2_ENST00000397077.1_Missense_Mutation_p.C452S|ATP2B2_ENST00000383800.4_Missense_Mutation_p.C452S			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	497					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						TTGTCTGAGCAGATGGCTGTG	0.562																																					Ovarian(125;1619 1709 15675 19819 38835)	Ovarian(125;1619 1709 15675 19819 38835)	uc003bvt.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1489-1491)TGC>AGC		plasma membrane calcium ATPase 2 isoform 1							192.0	166.0	175.0					3																	10413663		2203	4300	6503	SO:0001583	missense	491				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	g.chr3:10413663A>T	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1489T>A	3.37:g.10413663A>T	ENSP00000324172:p.Cys497Ser		Somatic				ATP2B2_uc003bvv.2_Missense_Mutation_p.C452S|ATP2B2_uc003bvw.2_Missense_Mutation_p.C452S|ATP2B2_uc010hdo.2_Missense_Mutation_p.C202S	p.C497S	NM_001001331	NP_001001331	WXS	Illumina HiSeq	Unspecified	Q01814	AT2B2_HUMAN			12	1928	-			497			Cytoplasmic (Potential).		O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	c.1489T>A	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	A	18.28	3.589470	0.66105	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.97352	-4.35;-4.35;-4.35;-4.35;-4.35;-4.35	4.71	4.71	0.59529	HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.141545	0.64402	D	0.000003	D	0.99004	0.9660	H	0.98901	4.365	0.80722	D	1	B;P;D	0.57257	0.003;0.776;0.979	B;P;P	0.62491	0.007;0.588;0.903	D	0.99078	1.0836	10	0.87932	D	0	-29.2682	14.3667	0.66810	1.0:0.0:0.0:0.0	.	432;464;497	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	S	497;452;452;497;483;432;353;497	ENSP00000324172:C497S;ENSP00000373311:C452S;ENSP00000380267:C452S;ENSP00000353414:C497S;ENSP00000344677:C483S;ENSP00000414854:C353S	ENSP00000342954:C497S	C	-	1	0	ATP2B2	10388663	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.037000	0.93765	1.979000	0.57680	0.533000	0.62120	TGC		0.562	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		20	41	0	0	0	0.00188189	0	20	41				
KCNH8	131096	broad.mit.edu	37	3	19389436	19389436	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:19389436G>T	ENST00000328405.2	+	5	1056	c.790G>T	c.(790-792)Gtg>Ttg	p.V264L	KCNH8_ENST00000475063.1_3'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	264					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TGACATTGCAGTGGAGATTCT	0.403																																					NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	0				lung(4)|ovary(1)	5						c.(790-792)GTG>TTG		potassium voltage-gated channel, subfamily H,							119.0	113.0	115.0					3																	19389436		2203	4300	6503	SO:0001583	missense	131096					integral to membrane	two-component sensor activity	g.chr3:19389436G>T	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.790G>T	3.37:g.19389436G>T	ENSP00000328813:p.Val264Leu		Somatic				KCNH8_uc011awe.1_Missense_Mutation_p.V264L|KCNH8_uc010hex.1_5'UTR	p.V264L	NM_144633	NP_653234	WXS	Illumina HiSeq	Unspecified	Q96L42	KCNH8_HUMAN			5	985	+			264			Helical; Name=Segment S2; (Potential).		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	c.790G>T	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	G	32	5.142715	0.94560	.	.	ENSG00000183960	ENST00000328405	D	0.93953	-3.32	5.83	5.83	0.93111	Ion transport (1);	0.000000	0.28940	U	0.013653	D	0.96043	0.8711	L	0.58810	1.83	0.80722	D	1	D;D	0.76494	0.988;0.999	D;D	0.75484	0.919;0.986	D	0.94885	0.8042	9	.	.	.	.	20.1374	0.98035	0.0:0.0:1.0:0.0	.	264;264	B7Z398;Q96L42	.;KCNH8_HUMAN	L	264	ENSP00000328813:V264L	.	V	+	1	0	KCNH8	19364440	1.000000	0.71417	0.999000	0.59377	0.861000	0.49209	9.835000	0.99442	2.763000	0.94921	0.563000	0.77884	GTG		0.403	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		25	80	1	0	2.79863e-10	0.00465635	1.14574e-09	25	80				
ARPP21	10777	broad.mit.edu	37	3	35835431	35835431	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:35835431G>T	ENST00000187397.4	+	20	2876	c.2420G>T	c.(2419-2421)gGt>gTt	p.G807V	ARPP21_ENST00000417925.1_Missense_Mutation_p.G808V|ARPP21_ENST00000476052.1_3'UTR|ARPP21_ENST00000337271.5_Missense_Mutation_p.G788V|ARPP21_ENST00000458225.1_Missense_Mutation_p.G808V|ARPP21_ENST00000444190.1_Missense_Mutation_p.G788V	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	807					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						AGCAATGCTGGTTGGCAGGTC	0.498																																							uc003cgb.2		NA																	0				ovary(2)|skin(1)	3						c.(2419-2421)GGT>GTT		cyclic AMP-regulated phosphoprotein, 21 kD							70.0	62.0	65.0					3																	35835431		2203	4300	6503	SO:0001583	missense	10777					cytoplasm	nucleic acid binding	g.chr3:35835431G>T	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.2420G>T	3.37:g.35835431G>T	ENSP00000187397:p.Gly807Val		Somatic				ARPP21_uc003cga.2_Missense_Mutation_p.G788V|ARPP21_uc011axy.1_Missense_Mutation_p.G808V|ARPP21_uc003cgf.2_Missense_Mutation_p.G643V|ARPP21_uc003cgg.2_Missense_Mutation_p.G330V	p.G807V	NM_016300	NP_057384	WXS	Illumina HiSeq	Unspecified	Q9UBL0	ARP21_HUMAN			20	2684	+			807					B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	c.2420G>T	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.542039	0.45280	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	6.17	4.31	0.51392	.	0.155479	0.45867	D	0.000321	T	0.54515	0.1863	L	0.51422	1.61	0.58432	D	0.999999	B;P;B;B	0.47253	0.342;0.892;0.232;0.342	B;P;B;B	0.51229	0.279;0.663;0.084;0.279	T	0.60616	-0.7228	10	0.72032	D	0.01	-10.7637	15.8078	0.78527	0.0:0.2546:0.7454:0.0	.	808;330;807;788	Q9UBL0-3;Q9UBL0-5;Q9UBL0;Q9UBL0-4	.;.;ARP21_HUMAN;.	V	808;788;788;807;808	ENSP00000414351:G808V;ENSP00000337792:G788V;ENSP00000405276:G788V;ENSP00000187397:G807V;ENSP00000412326:G808V	ENSP00000187397:G807V	G	+	2	0	ARPP21	35810435	1.000000	0.71417	0.925000	0.36789	0.922000	0.55478	3.135000	0.50546	1.596000	0.50062	0.655000	0.94253	GGT		0.498	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		7	12	1	0	0.00198382	0.00198382	0.00580117	7	12				
SEMA3G	56920	broad.mit.edu	37	3	52474509	52474509	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:52474509C>G	ENST00000231721.2	-	10	1026	c.1027G>C	c.(1027-1029)Gtg>Ctg	p.V343L		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	343	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		ATGTGGTACACACAGACGGCG	0.622																																							uc003dea.1		NA																	0				ovary(2)	2						c.(1027-1029)GTG>CTG		semaphorin sem2 precursor							31.0	30.0	30.0					3																	52474509		2200	4300	6500	SO:0001583	missense	56920				multicellular organismal development	extracellular region|membrane	receptor activity	g.chr3:52474509C>G		CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.1027G>C	3.37:g.52474509C>G	ENSP00000231721:p.Val343Leu		Somatic					p.V343L	NM_020163	NP_064548	WXS	Illumina HiSeq	Unspecified	Q9NS98	SEM3G_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)	10	1027	-			343			Sema.		Q7L9D9|Q9H7Q3	Missense_Mutation	SNP	ENST00000231721.2	37	c.1027G>C	CCDS2856.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152383	0.57259	.	.	ENSG00000010319	ENST00000231721	T	0.11930	2.73	4.67	2.82	0.32997	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.147939	0.45126	N	0.000393	T	0.18923	0.0454	M	0.77486	2.375	0.46416	D	0.999034	B	0.18461	0.028	B	0.27170	0.077	T	0.02683	-1.1124	10	0.56958	D	0.05	.	8.8111	0.34967	0.1642:0.7581:0.0:0.0777	.	343	Q9NS98	SEM3G_HUMAN	L	343	ENSP00000231721:V343L	ENSP00000231721:V343L	V	-	1	0	SEMA3G	52449549	0.981000	0.34729	0.991000	0.47740	0.907000	0.53573	2.554000	0.45845	0.535000	0.28714	0.561000	0.74099	GTG		0.622	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351354.1	NM_020163		2	3	0	0	0	6.4e-05	0	2	3				
CCDC66	285331	broad.mit.edu	37	3	56627033	56627033	+	Silent	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:56627033G>C	ENST00000394672.3	+	8	1042	c.972G>C	c.(970-972)gtG>gtC	p.V324V	CCDC66_ENST00000436465.2_Silent_p.V324V|CCDC66_ENST00000326595.7_Silent_p.V290V	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	324					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)			p.V207V(1)|p.V324V(1)		breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		TCAGTGCTGTGAAACAAGAAC	0.338																																							uc003dhz.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(1)	1						c.(970-972)GTG>GTC		coiled-coil domain containing 66 isoform 1							104.0	112.0	110.0					3																	56627033		2203	4300	6503	SO:0001819	synonymous_variant	285331							g.chr3:56627033G>C	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.972G>C	3.37:g.56627033G>C			Somatic				CCDC66_uc003dhy.2_5'UTR|CCDC66_uc003dhu.2_Silent_p.V290V|CCDC66_uc003dhx.2_RNA	p.V324V	NM_001141947	NP_001135419	WXS	Illumina HiSeq	Unspecified	A2RUB6	CCD66_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)	8	1059	+			324					B3KWL8|Q4VC34|Q8N949	Silent	SNP	ENST00000394672.3	37	c.972G>C	CCDS46852.1																																																																																				0.338	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506		16	118	0	0	0	0.000958276	0	16	118				
SUCLG2	8801	broad.mit.edu	37	3	67546341	67546341	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:67546341C>A	ENST00000307227.5	-	9	970	c.943G>T	c.(943-945)Gct>Tct	p.A315S	SUCLG2_ENST00000492795.1_Missense_Mutation_p.A315S|SUCLG2_ENST00000493112.1_Missense_Mutation_p.A315S	NM_003848.3	NP_003839.2	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming, beta subunit	315					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP binding (GO:0005524)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	10		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	TCACAAGTAGCCATGGCGAGC	0.438																																							uc003dna.3		NA																	0				central_nervous_system(1)|skin(1)	2						c.(943-945)GCT>TCT		succinate-CoA ligase, GDP-forming beta subunit	Succinic acid(DB00139)						75.0	70.0	71.0					3																	67546341		1950	4143	6093	SO:0001583	missense	8801				succinyl-CoA metabolic process|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|GTP binding|succinate-CoA ligase (GDP-forming) activity	g.chr3:67546341C>A	AF058954	CCDS43104.1, CCDS54605.1	3p14.3	2004-05-17			ENSG00000172340	ENSG00000172340	6.2.1.4		11450	protein-coding gene	gene with protein product		603922				9765291	Standard	NM_001177599		Approved		uc003dna.4	Q96I99	OTTHUMG00000158740	ENST00000307227.5:c.943G>T	3.37:g.67546341C>A	ENSP00000307432:p.Ala315Ser		Somatic				SUCLG2_uc010hob.2_Intron	p.A315S	NM_003848	NP_003839	WXS	Illumina HiSeq	Unspecified	Q96I99	SUCB2_HUMAN		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	9	971	-		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)	315					C9JVT2|O95195|Q6NUH7|Q86VX8|Q8WUQ1	Missense_Mutation	SNP	ENST00000307227.5	37	c.943G>T	CCDS43104.1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928836	0.73327	.	.	ENSG00000172340	ENST00000493112;ENST00000307227;ENST00000492795	T;T;T	0.75589	-0.95;-0.95;-0.22	5.64	5.64	0.86602	Succinyl-CoA synthetase-like (2);Succinyl-CoA synthetase, beta subunit, conserved site (1);ATP-citrate lyase/succinyl-CoA ligase (1);	0.000000	0.85682	D	0.000000	D	0.85911	0.5807	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86008	0.1499	10	0.59425	D	0.04	.	19.7012	0.96054	0.0:1.0:0.0:0.0	.	315	Q96I99	SUCB2_HUMAN	S	315	ENSP00000419325:A315S;ENSP00000307432:A315S;ENSP00000417589:A315S	ENSP00000307432:A315S	A	-	1	0	SUCLG2	67629031	1.000000	0.71417	1.000000	0.80357	0.285000	0.27093	7.487000	0.81328	2.637000	0.89404	0.563000	0.77884	GCT		0.438	SUCLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351993.1	NM_003848		10	21	1	0	3.07112e-06	0.000978159	1.05307e-05	10	21				
GPR27	2850	broad.mit.edu	37	3	71804195	71804195	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:71804195G>T	ENST00000304411.2	+	1	995	c.995G>T	c.(994-996)gGc>gTc	p.G332V	EIF4E3_ENST00000421769.2_5'Flank|EIF4E3_ENST00000295612.3_5'Flank|EIF4E3_ENST00000448225.1_5'Flank	NM_018971.1	NP_061844.1	Q9NS67	GPR27_HUMAN	G protein-coupled receptor 27	332					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|lung(2)|ovary(1)|prostate(1)	5		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)		GCGCAGGCCGGCATCAACCCC	0.706																																							uc011bge.1		NA																	0				ovary(1)	1						c.(994-996)GGC>GTC		G protein-coupled receptor 27							25.0	28.0	27.0					3																	71804195		2203	4298	6501	SO:0001583	missense	2850					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr3:71804195G>T	AB040799	CCDS2915.1	3p21-p14	2012-08-21			ENSG00000170837	ENSG00000170837		"""GPCR / Class A : Orphans"""	4482	protein-coding gene	gene with protein product		605187				10833454	Standard	NM_018971		Approved	SREB1	uc011bge.2	Q9NS67	OTTHUMG00000158810	ENST00000304411.2:c.995G>T	3.37:g.71804195G>T	ENSP00000303149:p.Gly332Val		Somatic				EIF4E3_uc003dox.2_5'Flank|EIF4E3_uc011bgd.1_5'Flank|EIF4E3_uc010hoc.2_5'Flank	p.G332V	NM_018971	NP_061844	WXS	Illumina HiSeq	Unspecified	Q9NS67	GPR27_HUMAN		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)	1	995	+		Prostate(10;0.00899)	332			Helical; Name=7; (Potential).			Missense_Mutation	SNP	ENST00000304411.2	37	c.995G>T	CCDS2915.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363990	0.82353	.	.	ENSG00000170837	ENST00000304411	T	0.35605	1.3	4.61	3.66	0.41972	GPCR, rhodopsin-like superfamily (1);	0.075271	0.53938	U	0.000057	T	0.52980	0.1768	M	0.72479	2.2	0.80722	D	1	D	0.60160	0.987	P	0.58620	0.842	T	0.59830	-0.7380	10	0.62326	D	0.03	-9.7762	14.0908	0.64990	0.0:0.1517:0.8483:0.0	.	332	Q9NS67	GPR27_HUMAN	V	332	ENSP00000303149:G332V	ENSP00000303149:G332V	G	+	2	0	GPR27	71886885	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	5.404000	0.66344	2.109000	0.64355	0.454000	0.30748	GGC		0.706	GPR27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352303.1	NM_018971		4	8	1	0	0.00024832	0.00024832	0.000757292	4	8				
PDZRN3	23024	broad.mit.edu	37	3	73433092	73433092	+	Silent	SNP	C	C	G	rs141774740		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:73433092C>G	ENST00000263666.4	-	10	2739	c.2625G>C	c.(2623-2625)gcG>gcC	p.A875A	PDZRN3_ENST00000535920.1_Silent_p.A597A|PDZRN3_ENST00000466780.1_Silent_p.A532A|PDZRN3_ENST00000479530.1_Silent_p.A592A|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000462146.2_Silent_p.A532A	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	875					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GCTGGGCGTGCGCCGGGATGT	0.652																																							uc003dpl.1		NA																	0				pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7						c.(2623-2625)GCG>GCC		PDZ domain containing ring finger 3		C		0,4406		0,0,2203	69.0	66.0	67.0		2625	-1.2	1.0	3	dbSNP_134	67	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PDZRN3	NM_015009.1		0,1,6502	GG,GC,CC		0.0116,0.0,0.0077		875/1067	73433092	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23024						ubiquitin-protein ligase activity|zinc ion binding	g.chr3:73433092C>G	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2625G>C	3.37:g.73433092C>G			Somatic				PDZRN3_uc011bgh.1_Silent_p.A532A|PDZRN3_uc010hoe.1_Silent_p.A573A|PDZRN3_uc011bgf.1_Silent_p.A592A|PDZRN3_uc011bgg.1_Silent_p.A595A	p.A875A	NM_015009	NP_055824	WXS	Illumina HiSeq	Unspecified	Q9UPQ7	PZRN3_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)	10	2721	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	875					A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	ENST00000263666.4	37	c.2625G>C	CCDS33789.1																																																																																				0.652	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363		6	30	0	0	0	0.00116845	0	6	30				
CNTN3	5067	broad.mit.edu	37	3	74347277	74347277	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:74347277C>A	ENST00000263665.6	-	17	2259	c.2232G>T	c.(2230-2232)ggG>ggT	p.G744G		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	744	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AGGTGGTAACCCCAAGAGGGC	0.453																																							uc003dpm.1		NA																	0				breast(3)|ovary(1)|skin(1)	5						c.(2230-2232)GGG>GGT		contactin 3 precursor							162.0	158.0	159.0					3																	74347277		2203	4300	6503	SO:0001819	synonymous_variant	5067				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr3:74347277C>A	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.2232G>T	3.37:g.74347277C>A			Somatic					p.G744G	NM_020872	NP_065923	WXS	Illumina HiSeq	Unspecified	Q9P232	CNTN3_HUMAN		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)	17	2312	-		Lung NSC(201;0.138)|Lung SC(41;0.21)	744			Fibronectin type-III 2.		B9EK50|Q9H039	Silent	SNP	ENST00000263665.6	37	c.2232G>T	CCDS33790.1																																																																																				0.453	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872		11	44	1	0	0.000978159	0.000978159	0.00289167	11	44				
CADM2	253559	broad.mit.edu	37	3	86010741	86010741	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:86010741G>T	ENST00000407528.2	+	7	949	c.887G>T	c.(886-888)tGt>tTt	p.C296F	CADM2_ENST00000383699.3_Missense_Mutation_p.C305F|CADM2_ENST00000405615.2_Missense_Mutation_p.C298F	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	296	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		ACATATCGATGTGAAGCCACA	0.413																																							uc003dqj.2		NA																	0				ovary(1)|lung(1)|kidney(1)|skin(1)	4						c.(886-888)TGT>TTT		immunoglobulin superfamily, member 4D							134.0	121.0	125.0					3																	86010741		2203	4300	6503	SO:0001583	missense	253559				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane		g.chr3:86010741G>T	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.887G>T	3.37:g.86010741G>T	ENSP00000384575:p.Cys296Phe		Somatic				CADM2_uc003dqk.2_Missense_Mutation_p.C305F|CADM2_uc003dql.2_Missense_Mutation_p.C298F	p.C296F	NM_153184	NP_694854	WXS	Illumina HiSeq	Unspecified	Q8N3J6	CADM2_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)	7	1513	+		Lung NSC(201;0.0148)	296			Ig-like C2-type 2.|Extracellular (Potential).		G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	c.887G>T	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306268	0.81247	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	D;D;D	0.92446	-3.04;-1.92;-1.92	5.46	5.46	0.80206	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.98112	0.9377	H	0.99169	4.455	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.996;0.999	D	0.99675	1.0997	10	0.87932	D	0	.	19.3022	0.94148	0.0:0.0:1.0:0.0	.	298;305;296	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	F	305;296;298	ENSP00000373200:C305F;ENSP00000384575:C296F;ENSP00000384193:C298F	ENSP00000373200:C305F	C	+	2	0	CADM2	86093431	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.444000	0.97578	2.549000	0.85964	0.650000	0.86243	TGT		0.413	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184		12	91	1	0	2.27111e-07	0.00136819	8.27027e-07	12	91				
DPPA4	55211	broad.mit.edu	37	3	109050872	109050872	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:109050872C>A	ENST00000335658.6	-	3	239	c.185G>T	c.(184-186)tGc>tTc	p.C62F	DPPA4_ENST00000478791.1_5'UTR	NM_018189.3	NP_060659.3	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	62					lung-associated mesenchyme development (GO:0060484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(17)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25						TTTCTTAGGGCAGAGCACTGA	0.378																																							uc003dxq.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(184-186)TGC>TTC		developmental pluripotency associated 4							135.0	135.0	135.0					3																	109050872		2203	4300	6503	SO:0001583	missense	55211					nucleus	protein binding	g.chr3:109050872C>A	AK001575	CCDS33814.1	3q13.13	2014-01-28			ENSG00000121570	ENSG00000121570			19200	protein-coding gene	gene with protein product		614125					Standard	NM_018189		Approved	FLJ10713	uc003dxq.4	Q7L190	OTTHUMG00000159222	ENST00000335658.6:c.185G>T	3.37:g.109050872C>A	ENSP00000335306:p.Cys62Phe		Somatic				DPPA4_uc011bho.1_Missense_Mutation_p.C62F|DPPA4_uc011bhp.1_Missense_Mutation_p.C62F	p.C62F	NM_018189	NP_060659	WXS	Illumina HiSeq	Unspecified	Q7L190	DPPA4_HUMAN			3	240	-			62					A8K4M7|Q9H9N5|Q9NVI6	Missense_Mutation	SNP	ENST00000335658.6	37	c.185G>T	CCDS33814.1	.	.	.	.	.	.	.	.	.	.	C	8.833	0.940290	0.18281	.	.	ENSG00000121570	ENST00000335658;ENST00000477303	T;T	0.69806	1.84;-0.43	4.7	-1.25	0.09405	.	1.692450	0.02876	N	0.132194	T	0.71854	0.3389	L	0.46157	1.445	0.09310	N	1	D;B;D	0.67145	0.996;0.025;0.974	P;B;P	0.59703	0.862;0.012;0.694	T	0.59558	-0.7432	9	.	.	.	0.4441	7.3136	0.26488	0.4363:0.2782:0.2855:0.0	.	52;62;62	B7Z5Q7;B7Z595;Q7L190	.;.;DPPA4_HUMAN	F	62;10	ENSP00000335306:C62F;ENSP00000418313:C10F	.	C	-	2	0	DPPA4	110533562	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	0.344000	0.19962	-0.026000	0.13895	0.650000	0.86243	TGC		0.378	DPPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353897.1	NM_018189		10	97	1	0	3.86212e-05	0.000673444	0.000124232	10	97				
CFAP44	55779	broad.mit.edu	37	3	113082352	113082352	+	Nonsense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:113082352C>A	ENST00000295868.2	-	20	2905	c.2743G>T	c.(2743-2745)Gaa>Taa	p.E915*	WDR52_ENST00000393845.2_Nonsense_Mutation_p.E915*	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TCAATGTCTTCTGGAATTGGC	0.363																																							uc003eae.1		NA																	0				central_nervous_system(1)	1						c.(2743-2745)GAA>TAA		WD repeat domain 52 isoform 2							74.0	73.0	73.0					3																	113082352		2203	4300	6503	SO:0001587	stop_gained	55779							g.chr3:113082352C>A																												ENST00000295868.2:c.2743G>T	3.37:g.113082352C>A	ENSP00000295868:p.Glu915*		Somatic				WDR52_uc003ead.1_Nonsense_Mutation_p.E96*	p.E915*	NM_018338	NP_060808	WXS	Illumina HiSeq	Unspecified	Q96MT7	WDR52_HUMAN			20	2789	-			915						Nonsense_Mutation	SNP	ENST00000295868.2	37	c.2743G>T	CCDS2972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.003349|6.003349	0.97189|0.97189	.|.	.|.	ENSG00000206530|ENSG00000206530	ENST00000393845;ENST00000295868|ENST00000465636	.|.	.|.	.|.	6.07|6.07	1.14|1.14	0.20703|0.20703	.|.	7.415920|.	0.00508|.	U|.	0.000177|.	.|T	.|0.41581	.|0.1165	.|.	.|.	.|.	0.33387|0.33387	D|D	0.575642|0.575642	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.49303	.|-0.8954	.|4	0.46703|.	T|.	0.11|.	-7.5243|-7.5243	6.9851|6.9851	0.24723|0.24723	0.0:0.6208:0.1718:0.2074|0.0:0.6208:0.1718:0.2074	.|.	.|.	.|.	.|.	X|I	915|51	.|.	ENSP00000295868:E915X|.	E|R	-|-	1|2	0|0	WDR52|WDR52	114565042|114565042	0.985000|0.985000	0.35326|0.35326	0.862000|0.862000	0.33874|0.33874	0.224000|0.224000	0.24922|0.24922	0.648000|0.648000	0.24828|0.24828	0.147000|0.147000	0.19030|0.19030	-0.157000|-0.157000	0.13467|0.13467	GAA|AGA		0.363	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3			8	45	1	0	0.00307968	0.00307968	0.00896691	8	45				
HCLS1	3059	broad.mit.edu	37	3	121350993	121350993	+	Missense_Mutation	SNP	C	C	A	rs112494135		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:121350993C>A	ENST00000314583.3	-	13	1370	c.1279G>T	c.(1279-1281)Gtg>Ttg	p.V427L	HCLS1_ENST00000428394.2_Missense_Mutation_p.V390L|HCLS1_ENST00000473883.1_5'UTR	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	427					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		CCCAGagccacagccccagcc	0.537																																							uc003eeh.3		NA																	0					0						c.(1279-1281)GTG>TTG		hematopoietic cell-specific Lyn substrate 1							49.0	54.0	53.0					3																	121350993		2203	4300	6503	SO:0001583	missense	3059				erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr3:121350993C>A		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.1279G>T	3.37:g.121350993C>A	ENSP00000320176:p.Val427Leu		Somatic				HCLS1_uc011bjj.1_Missense_Mutation_p.V390L	p.V427L	NM_005335	NP_005326	WXS	Illumina HiSeq	Unspecified	P14317	HCLS1_HUMAN		GBM - Glioblastoma multiforme(114;0.0912)	13	1404	-			427					B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	ENST00000314583.3	37	c.1279G>T	CCDS3003.1	.	.	.	.	.	.	.	.	.	.	-	2.387	-0.340761	0.05243	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	T;T	0.19532	2.16;2.14	.	.	.	.	5.977620	0.01040	N	0.004298	T	0.13970	0.0338	N	0.24115	0.695	0.09310	N	1	.;B	0.30068	.;0.267	.;B	0.28991	.;0.097	T	0.15954	-1.0419	8	0.26408	T	0.33	.	.	.	.	.	390;427	E7EVW7;P14317	.;HCLS1_HUMAN	L	427;390	ENSP00000320176:V427L;ENSP00000387645:V390L	ENSP00000320176:V427L	V	-	1	0	HCLS1	122833683	0.109000	0.22037	0.020000	0.16555	0.028000	0.11728	-0.265000	0.08644	0.000000	0.14550	0.000000	0.15137	GTG		0.537	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355144.1	NM_005335		9	48	1	0	0.000274275	0.00448238	0.00083082	9	48				
SRPRB	58477	broad.mit.edu	37	3	133524720	133524720	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:133524720G>A	ENST00000466490.2	+	2	313	c.28G>A	c.(28-30)Gca>Aca	p.A10T		NM_021203.3	NP_067026.3	Q9Y5M8	SRPRB_HUMAN	signal recognition particle receptor, B subunit	10					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|small GTPase mediated signal transduction (GO:0007264)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)			breast(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(2)	12						GCGCCGGGTGGCAGATGGCGG	0.682																																							uc003epx.1		NA																	0				ovary(1)	1						c.(28-30)GCA>ACA		signal recognition particle receptor, beta							44.0	46.0	45.0					3																	133524720		2203	4299	6502	SO:0001583	missense	58477					endoplasmic reticulum membrane|integral to membrane	GTP binding|protein binding|receptor activity	g.chr3:133524720G>A	AK075531	CCDS3081.1	3q22.1	2004-01-29			ENSG00000144867	ENSG00000144867			24085	protein-coding gene	gene with protein product						7844142, 10859309	Standard	NM_021203		Approved	APMCF1	uc003epx.2	Q9Y5M8	OTTHUMG00000159753	ENST00000466490.2:c.28G>A	3.37:g.133524720G>A	ENSP00000418401:p.Ala10Thr		Somatic					p.A10T	NM_021203	NP_067026	WXS	Illumina HiSeq	Unspecified	Q9Y5M8	SRPRB_HUMAN			1	44	+			10					Q6P595|Q8N2D8	Missense_Mutation	SNP	ENST00000466490.2	37	c.28G>A	CCDS3081.1	.	.	.	.	.	.	.	.	.	.	G	11.23	1.576646	0.28092	.	.	ENSG00000144867	ENST00000466490;ENST00000484684	T;T	0.46063	2.49;0.88	4.91	2.45	0.29901	.	0.636560	0.13193	U	0.406590	T	0.27169	0.0666	N	0.22421	0.69	0.09310	N	1	B	0.17667	0.023	B	0.23018	0.043	T	0.19844	-1.0293	10	0.35671	T	0.21	-4.1188	6.8244	0.23874	0.1151:0.1684:0.7165:0.0	.	10	Q9Y5M8	SRPRB_HUMAN	T	10	ENSP00000418401:A10T;ENSP00000417096:A10T	ENSP00000418401:A10T	A	+	1	0	SRPRB	135007410	0.015000	0.18098	0.002000	0.10522	0.118000	0.20060	1.638000	0.37165	0.628000	0.30357	0.650000	0.86243	GCA		0.682	SRPRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357170.2			6	30	0	0	0	0.00198382	0	6	30				
TRIM42	287015	broad.mit.edu	37	3	140409921	140409921	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:140409921G>A	ENST00000286349.3	+	4	2163	c.1972G>A	c.(1972-1974)Gac>Aac	p.D658N		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	658	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACAAATTCGGGACATAATGCA	0.443																																							uc003eto.1		NA																	0				lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						c.(1972-1974)GAC>AAC		tripartite motif-containing 42							162.0	153.0	156.0					3																	140409921		2203	4300	6503	SO:0001583	missense	287015					intracellular	zinc ion binding	g.chr3:140409921G>A	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1972G>A	3.37:g.140409921G>A	ENSP00000286349:p.Asp658Asn		Somatic					p.D658N	NM_152616	NP_689829	WXS	Illumina HiSeq	Unspecified	Q8IWZ5	TRI42_HUMAN			4	2163	+			658			Fibronectin type-III.		A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	37	c.1972G>A	CCDS3113.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.697415	0.88830	.	.	ENSG00000155890	ENST00000286349	T	0.58358	0.34	5.65	5.65	0.86999	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.177765	0.39475	N	0.001345	T	0.58250	0.2109	N	0.19112	0.55	0.37628	D	0.921551	D	0.89917	1.0	D	0.91635	0.999	T	0.61342	-0.7082	10	0.37606	T	0.19	-29.8665	15.2342	0.73416	0.0:0.0:1.0:0.0	.	658	Q8IWZ5	TRI42_HUMAN	N	658	ENSP00000286349:D658N	ENSP00000286349:D658N	D	+	1	0	TRIM42	141892611	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.429000	0.59901	2.672000	0.90937	0.650000	0.86243	GAC		0.443	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616		14	97	0	0	0	0.00185496	0	14	97				
PLSCR2	57047	broad.mit.edu	37	3	146176237	146176237	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:146176237C>A	ENST00000497985.1	-	5	719	c.280G>T	c.(280-282)Gat>Tat	p.D94Y	PLSCR2_ENST00000336685.2_Missense_Mutation_p.D21Y	NM_001199978.1	NP_001186907.1	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2	94					phospholipid scrambling (GO:0017121)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid scramblase activity (GO:0017128)			endometrium(2)|large_intestine(5)|lung(7)|stomach(1)	15						AGTATCATATCTATCTATTAT	0.234																																							uc003evv.1		NA																	0					0						c.(61-63)GAT>TAT		phospholipid scramblase 2							17.0	18.0	18.0					3																	146176237		2130	4208	6338	SO:0001583	missense	57047				phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity	g.chr3:146176237C>A		CCDS56284.1, CCDS3134.1, CCDS75029.1	3q24	2008-07-18			ENSG00000163746	ENSG00000163746			16494	protein-coding gene	gene with protein product		607610				10930526	Standard	NM_001199978		Approved		uc003evw.2	Q9NRY7	OTTHUMG00000159429	ENST00000497985.1:c.280G>T	3.37:g.146176237C>A	ENSP00000420132:p.Asp94Tyr		Somatic				PLSCR2_uc003evw.1_Missense_Mutation_p.D90Y	p.D21Y	NM_020359	NP_065092	WXS	Illumina HiSeq	Unspecified	Q9NRY7	PLS2_HUMAN			4	394	-			21			Cytoplasmic (By similarity).		B4DXC3|J3KR76|Q0VAQ1|Q6NSW9|Q7Z4L7	Missense_Mutation	SNP	ENST00000497985.1	37	c.61G>T	CCDS56284.1	.	.	.	.	.	.	.	.	.	.	.	14.21	2.465975	0.43839	.	.	ENSG00000163746	ENST00000336685;ENST00000535500;ENST00000497985;ENST00000489015	T;T;T	0.28454	1.61;1.61;1.61	3.69	2.8	0.32819	.	0.000000	0.37483	U	0.002071	T	0.63920	0.2552	H	0.96833	3.89	0.47659	D	0.999486	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	T	0.68036	-0.5515	10	0.87932	D	0	.	7.3597	0.26739	0.0:0.7372:0.1693:0.0935	.	114;21	Q7Z4L7;Q9NRY7	.;PLS2_HUMAN	Y	21;113;94;21	ENSP00000338707:D21Y;ENSP00000420132:D94Y;ENSP00000418444:D21Y	ENSP00000338707:D21Y	D	-	1	0	PLSCR2	147658927	1.000000	0.71417	0.316000	0.25252	0.019000	0.09904	3.742000	0.55097	0.852000	0.35287	0.655000	0.94253	GAT		0.234	PLSCR2-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000355264.1	NM_020359		4	14	1	0	1.23904e-05	0.000602214	4.04334e-05	4	14				
AGTR1	185	broad.mit.edu	37	3	148459034	148459034	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:148459034C>A	ENST00000497524.1	+	2	603	c.212C>A	c.(211-213)gCa>gAa	p.A71E	AGTR1_ENST00000404754.2_Missense_Mutation_p.A71E|AGTR1_ENST00000461609.1_Missense_Mutation_p.A71E|AGTR1_ENST00000349243.3_Missense_Mutation_p.A71E|AGTR1_ENST00000542281.1_Missense_Mutation_p.A71E|AGTR1_ENST00000418473.2_Missense_Mutation_p.A71E|AGTR1_ENST00000475347.1_Missense_Mutation_p.A71E|AGTR1_ENST00000474935.1_Missense_Mutation_p.A71E|AGTR1_ENST00000402260.1_Missense_Mutation_p.A71E	NM_009585.3	NP_033611.1	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	71					angiotensin-activated signaling pathway (GO:0038166)|calcium-mediated signaling (GO:0019722)|cell chemotaxis (GO:0060326)|G-protein coupled receptor signaling pathway (GO:0007186)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|phospholipase C-activating angiotensin-activated signaling pathway (GO:0086097)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of phospholipase A2 activity (GO:0032430)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|renin-angiotensin regulation of aldosterone production (GO:0002018)|Rho protein signal transduction (GO:0007266)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin type I receptor activity (GO:0001596)|angiotensin type II receptor activity (GO:0004945)|bradykinin receptor binding (GO:0031711)|protein heterodimerization activity (GO:0046982)			breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Azilsartan medoxomil(DB08822)|Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	TTGAATTTAGCACTGGCTGAC	0.408																																							uc003ewg.2		NA																	0					0						c.(211-213)GCA>GAA		angiotensin II receptor, type 1	Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Spironolactone(DB00421)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)						93.0	89.0	91.0					3																	148459034		2203	4300	6503	SO:0001583	missense	185				calcium-mediated signaling|cell chemotaxis|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|kidney development|low-density lipoprotein particle remodeling|positive regulation of cellular protein metabolic process|positive regulation of cholesterol esterification|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of phospholipase A2 activity|positive regulation of reactive oxygen species metabolic process|regulation of cell growth|regulation of cell proliferation|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|Rho protein signal transduction		acetyltransferase activator activity|angiotensin type I receptor activity|angiotensin type II receptor activity|bradykinin receptor binding|protein heterodimerization activity	g.chr3:148459034C>A	M87290	CCDS3137.1	3q24	2012-08-08	2002-02-20		ENSG00000144891	ENSG00000144891		"""GPCR / Class A : Angiotensin receptors"""	336	protein-coding gene	gene with protein product		106165	"""angiotensin receptor 1B"""	AGTR1B		1550596	Standard	NM_009585		Approved	AT1, AT2R1, AGTR1A, AT2R1A, HAT1R, AG2S, AT2R1B, AT1B	uc003ewh.4	P30556	OTTHUMG00000159503	ENST00000497524.1:c.212C>A	3.37:g.148459034C>A	ENSP00000419422:p.Ala71Glu		Somatic				AGTR1_uc003ewh.2_Missense_Mutation_p.A71E|AGTR1_uc003ewi.2_Missense_Mutation_p.A71E|AGTR1_uc003ewj.2_Missense_Mutation_p.A71E|AGTR1_uc003ewk.2_Missense_Mutation_p.A71E	p.A71E	NM_031850	NP_114038	WXS	Illumina HiSeq	Unspecified	P30556	AGTR1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		4	658	+			71			Helical; Name=2; (Potential).		Q13725|Q8TBK4	Missense_Mutation	SNP	ENST00000497524.1	37	c.212C>A	CCDS3137.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365336	0.82463	.	.	ENSG00000144891	ENST00000497524;ENST00000349243;ENST00000542281;ENST00000418473;ENST00000404754;ENST00000475347;ENST00000474935;ENST00000461609;ENST00000402260	T;T;T;T;T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42;0.42;0.42;0.42;0.42	4.95	4.95	0.65309	GPCR, rhodopsin-like superfamily (1);	0.113621	0.64402	D	0.000014	D	0.84826	0.5558	H	0.99286	4.5	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91543	0.5251	10	0.87932	D	0	-10.1884	18.3704	0.90405	0.0:1.0:0.0:0.0	.	71	P30556	AGTR1_HUMAN	E	71	ENSP00000419422:A71E;ENSP00000273430:A71E;ENSP00000443186:A71E;ENSP00000398832:A71E;ENSP00000385612:A71E;ENSP00000419783:A71E;ENSP00000418084:A71E;ENSP00000418851:A71E;ENSP00000385641:A71E	ENSP00000273430:A71E	A	+	2	0	AGTR1	149941724	1.000000	0.71417	0.989000	0.46669	0.988000	0.76386	7.647000	0.83462	2.562000	0.86427	0.655000	0.94253	GCA		0.408	AGTR1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355807.1			14	48	1	0	2.61681e-11	0.00244969	1.11877e-10	14	48				
ERICH6	131831	broad.mit.edu	37	3	150396332	150396332	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:150396332C>A	ENST00000295910.6	-	10	1173	c.1121G>T	c.(1120-1122)cGc>cTc	p.R374L	FAM194A_ENST00000491361.1_Missense_Mutation_p.R228L	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TGTTTTTAAGCGCTTTGAATC	0.269																																							uc003eyg.2		NA																	0				skin(2)|ovary(1)	3						c.(1120-1122)CGC>CTC		hypothetical protein LOC131831							55.0	53.0	53.0					3																	150396332		2201	4292	6493	SO:0001583	missense	131831							g.chr3:150396332C>A																												ENST00000295910.6:c.1121G>T	3.37:g.150396332C>A	ENSP00000295910:p.Arg374Leu		Somatic				FAM194A_uc003eyh.2_Missense_Mutation_p.R228L	p.R374L	NM_152394	NP_689607	WXS	Illumina HiSeq	Unspecified	Q7L0X2	F194A_HUMAN			10	1178	-			374						Missense_Mutation	SNP	ENST00000295910.6	37	c.1121G>T	CCDS3151.2	.	.	.	.	.	.	.	.	.	.	C	7.429	0.638414	0.14386	.	.	ENSG00000163645	ENST00000295910;ENST00000491361;ENST00000313811	T;T	0.13901	2.76;2.55	3.85	2.52	0.30459	.	0.774358	0.11167	N	0.592406	T	0.07773	0.0195	N	0.22421	0.69	0.34709	D	0.727598	B	0.25609	0.13	B	0.25140	0.058	T	0.31475	-0.9942	10	0.34782	T	0.22	-2.5408	0.779	0.01037	0.1835:0.1356:0.1883:0.4926	.	374	Q7L0X2	F194A_HUMAN	L	374;228;332	ENSP00000295910:R374L;ENSP00000419366:R228L	ENSP00000295910:R374L	R	-	2	0	FAM194A	151879022	0.002000	0.14202	0.003000	0.11579	0.336000	0.28762	0.259000	0.18405	0.518000	0.28383	-0.262000	0.10625	CGC		0.269	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1			11	32	1	0	6.40141e-05	0.000978159	0.00020349	11	32				
GPR149	344758	broad.mit.edu	37	3	154145425	154145425	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:154145425G>T	ENST00000389740.2	-	2	1153	c.1054C>A	c.(1054-1056)Ctg>Atg	p.L352M		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	352					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GTGGCCAGCAGGGTAAGTAGA	0.532																																							uc003faa.2		NA																	0				ovary(6)	6						c.(1054-1056)CTG>ATG		G protein-coupled receptor 149							75.0	78.0	77.0					3																	154145425		2032	4194	6226	SO:0001583	missense	344758					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr3:154145425G>T	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1054C>A	3.37:g.154145425G>T	ENSP00000374390:p.Leu352Met		Somatic					p.L352M	NM_001038705	NP_001033794	WXS	Illumina HiSeq	Unspecified	Q86SP6	GP149_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)		2	1154	-			352			Helical; Name=7; (Potential).			Missense_Mutation	SNP	ENST00000389740.2	37	c.1054C>A	CCDS43162.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934652	0.73442	.	.	ENSG00000174948	ENST00000389740	T	0.38077	1.16	6.03	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.080011	0.53938	D	0.000058	T	0.48223	0.1488	L	0.61218	1.895	0.39741	D	0.971755	D	0.76494	0.999	D	0.72338	0.977	T	0.55522	-0.8128	10	0.87932	D	0	-13.623	2.3858	0.04365	0.1693:0.1657:0.4954:0.1696	.	352	Q86SP6	GP149_HUMAN	M	352	ENSP00000374390:L352M	ENSP00000374390:L352M	L	-	1	2	GPR149	155628119	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.418000	0.44662	2.861000	0.98227	0.655000	0.94253	CTG		0.532	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580		6	23	1	0	5.9392e-07	0.00116845	2.12271e-06	6	23				
RFC4	5984	broad.mit.edu	37	3	186510311	186510311	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr3:186510311C>T	ENST00000392481.2	-	7	924	c.643G>A	c.(643-645)Gcc>Acc	p.A215T	RFC4_ENST00000296273.2_Missense_Mutation_p.A215T|RFC4_ENST00000433496.1_Missense_Mutation_p.A215T	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	215					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		TCCTTCTTGGCAATGTCTAGT	0.353																																							uc003fqz.2		NA																	0				breast(2)|upper_aerodigestive_tract(1)|ovary(1)|large_intestine(1)	5						c.(643-645)GCC>ACC		replication factor C 4							91.0	100.0	97.0					3																	186510311		2203	4300	6503	SO:0001583	missense	5984				cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|phosphatidylinositol-mediated signaling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding	g.chr3:186510311C>T		CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.643G>A	3.37:g.186510311C>T	ENSP00000376272:p.Ala215Thr		Somatic				RFC4_uc011bsc.1_Missense_Mutation_p.A215T|RFC4_uc011bsd.1_Missense_Mutation_p.A215T	p.A215T	NM_002916	NP_002907	WXS	Illumina HiSeq	Unspecified	P35249	RFC4_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)	7	866	-	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		215					B4DM41|D3DNV2|Q6FHX7	Missense_Mutation	SNP	ENST00000392481.2	37	c.643G>A	CCDS3283.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.388008	0.61956	.	.	ENSG00000163918	ENST00000433496;ENST00000392481;ENST00000296273	T;T;T	0.47869	0.83;0.83;0.83	5.95	4.01	0.46588	.	0.138647	0.64402	N	0.000003	T	0.52581	0.1743	M	0.88570	2.965	0.36108	D	0.8446	B;B	0.24092	0.097;0.087	B;B	0.29524	0.103;0.097	T	0.63646	-0.6590	10	0.72032	D	0.01	.	6.4498	0.21898	0.2855:0.6236:0.0:0.0909	.	215;215	B4DM41;P35249	.;RFC4_HUMAN	T	215	ENSP00000399769:A215T;ENSP00000376272:A215T;ENSP00000296273:A215T	ENSP00000296273:A215T	A	-	1	0	RFC4	187993005	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	3.196000	0.51020	1.531000	0.49152	-0.140000	0.14226	GCC		0.353	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344471.1	NM_002916		30	111	0	0	0	0.00106085	0	30	111				
CPZ	8532	broad.mit.edu	37	4	8607877	8607877	+	Missense_Mutation	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:8607877A>G	ENST00000360986.4	+	5	1045	c.871A>G	c.(871-873)Atg>Gtg	p.M291V	CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000382480.2_Missense_Mutation_p.M154V|CPZ_ENST00000315782.6_Missense_Mutation_p.M280V	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	291				M -> I (in Ref. 1; AAB58911). {ECO:0000305}.	proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GCTGCCCTCCATGAACCCTGA	0.617																																							uc003glm.2		NA																	0				ovary(2)|pancreas(1)	3						c.(871-873)ATG>GTG		carboxypeptidase Z isoform 1							84.0	63.0	70.0					4																	8607877		2203	4300	6503	SO:0001583	missense	8532				proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding	g.chr4:8607877A>G	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.871A>G	4.37:g.8607877A>G	ENSP00000354255:p.Met291Val		Somatic				CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Missense_Mutation_p.M154V|CPZ_uc003glo.2_Missense_Mutation_p.M280V|CPZ_uc003glp.2_RNA	p.M291V	NM_001014447	NP_001014447	WXS	Illumina HiSeq	Unspecified	Q66K79	CBPZ_HUMAN			5	997	+			291	M -> I (in Ref. 1; AAB58911).				O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	37	c.871A>G	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	a	17.65	3.443214	0.63067	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	T;T;T	0.09350	2.99;2.99;2.99	3.41	3.41	0.39046	Peptidase M14, carboxypeptidase A (1);	0.257045	0.38548	U	0.001656	T	0.12902	0.0313	L	0.54323	1.7	0.80722	D	1	P;P	0.50528	0.936;0.912	B;P	0.44518	0.323;0.452	T	0.02238	-1.1190	10	0.59425	D	0.04	-24.8712	9.3762	0.38283	0.8047:0.1952:0.0:0.0	.	280;291	Q66K79-2;Q66K79	.;CBPZ_HUMAN	V	291;154;280	ENSP00000354255:M291V;ENSP00000371920:M154V;ENSP00000315074:M280V	ENSP00000315074:M280V	M	+	1	0	CPZ	8658777	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	4.684000	0.61686	1.428000	0.47296	0.378000	0.23410	ATG		0.617	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652		3	12	0	0	0	0.00024832	0	3	12				
PI4K2B	55300	broad.mit.edu	37	4	25256887	25256887	+	Splice_Site	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:25256887G>T	ENST00000264864.6	+	3	813	c.624G>T	c.(622-624)aaG>aaT	p.K208N	PI4K2B_ENST00000512921.1_Splice_Site_p.K112N	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	208	PI3K/PI4K.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				CTAAAACAAAGGTAAGCCAGA	0.398																																							uc003grk.2		NA																	0				ovary(2)|skin(2)	4						c.(622-624)AAG>AAT		phosphatidylinositol 4-kinase type 2 beta							59.0	61.0	60.0					4																	25256887		2203	4300	6503	SO:0001630	splice_region_variant	55300					cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding	g.chr4:25256887G>T	AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.624+1G>T	4.37:g.25256887G>T			Somatic				PI4K2B_uc011bxs.1_Missense_Mutation_p.K112N	p.K208N	NM_018323	NP_060793	WXS	Illumina HiSeq	Unspecified	Q8TCG2	P4K2B_HUMAN			3	757	+		Breast(46;0.173)	208			PI3K/PI4K.		Q9NUW2	Missense_Mutation	SNP	ENST00000264864.6	37	c.624G>T	CCDS3433.1	.	.	.	.	.	.	.	.	.	.	G	16.17	3.048015	0.55110	.	.	ENSG00000038210	ENST00000512921;ENST00000264864;ENST00000537420	T;T	0.76578	-1.03;-1.03	5.83	5.83	0.93111	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.132837	0.64402	D	0.000002	D	0.88709	0.6510	M	0.85710	2.77	0.80722	D	1	D	0.57257	0.979	P	0.62298	0.9	D	0.87089	0.2171	10	0.36615	T	0.2	-7.9322	20.1184	0.97949	0.0:0.0:1.0:0.0	.	208	Q8TCG2	P4K2B_HUMAN	N	112;208;177	ENSP00000423373:K112N;ENSP00000264864:K208N	ENSP00000264864:K208N	K	+	3	2	PI4K2B	24865985	1.000000	0.71417	1.000000	0.80357	0.152000	0.21847	7.902000	0.87389	2.769000	0.95229	0.655000	0.94253	AAG		0.398	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250415.1	NM_018323	Missense_Mutation	12	26	1	0	0.000151284	0.00185496	0.000470934	12	26				
TBC1D19	55296	broad.mit.edu	37	4	26638832	26638832	+	Splice_Site	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:26638832G>T	ENST00000264866.4	+	5	572		c.e5-1		TBC1D19_ENST00000515568.1_Splice_Site|TBC1D19_ENST00000511789.1_Splice_Site|AC093807.1_ENST00000580172.1_RNA	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19								Rab GTPase activator activity (GO:0005097)			breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				TTATGTTTCAGGGAAGTTGGG	0.279																																							uc003gsf.3		NA																	0				breast(1)	1						c.e5-1		TBC1 domain family, member 19							58.0	61.0	60.0					4																	26638832		2202	4296	6498	SO:0001630	splice_region_variant	55296					intracellular	Rab GTPase activator activity	g.chr4:26638832G>T	AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.295-1G>T	4.37:g.26638832G>T			Somatic				TBC1D19_uc010iew.2_Splice_Site_p.G99_splice|TBC1D19_uc011bxu.1_Splice_Site_p.G34_splice	p.G99_splice	NM_018317	NP_060787	WXS	Illumina HiSeq	Unspecified	Q8N5T2	TBC19_HUMAN			5	565	+		Breast(46;0.0503)						B9A6M0|Q9NUX1	Splice_Site	SNP	ENST00000264866.4	37	c.295_splice	CCDS3439.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890516	0.52014	.	.	ENSG00000109680	ENST00000512840;ENST00000264866;ENST00000505206;ENST00000511789;ENST00000513596	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5611	0.87908	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TBC1D19	26247930	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	7.319000	0.79040	2.529000	0.85273	0.467000	0.42956	.		0.279	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2	NM_018317	Intron	17	35	1	0	2.35188e-11	0.00074312	1.0087e-10	17	35				
PCDH7	5099	broad.mit.edu	37	4	30726066	30726066	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:30726066C>A	ENST00000361762.2	+	1	4030	c.3022C>A	c.(3022-3024)Cat>Aat	p.H1008N	PCDH7_ENST00000543491.1_Missense_Mutation_p.H1008N	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	1008					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TGTTCAGCTTCATCCCCAGTC	0.517																																							uc003gsk.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						c.(3022-3024)CAT>AAT		protocadherin 7 isoform a precursor							96.0	97.0	97.0					4																	30726066		2203	4300	6503	SO:0001583	missense	5099				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chr4:30726066C>A	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.3022C>A	4.37:g.30726066C>A	ENSP00000355243:p.His1008Asn		Somatic				PCDH7_uc011bxw.1_Missense_Mutation_p.H961N|PCDH7_uc011bxx.1_Missense_Mutation_p.H1008N	p.H1008N	NM_002589	NP_002580	WXS	Illumina HiSeq	Unspecified	O60245	PCDH7_HUMAN			1	4030	+			1008			Cytoplasmic (Potential).		O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	c.3022C>A	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.23|15.23	2.771218|2.771218	0.49680|0.49680	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.29142|.	1.58;1.58|.	5.08|5.08	5.08|5.08	0.68730|0.68730	Protocadherin (1);|.	.|.	.|.	.|.	.|.	T|.	0.60599|.	0.2281|.	L|L	0.36672|0.36672	1.1|1.1	0.54753|0.54753	D|D	0.999987|0.999987	P;P;P|.	0.42161|.	0.73;0.73;0.772|.	P;P;P|.	0.45037|.	0.467;0.467;0.464|.	T|.	0.55237|.	-0.8172|.	9|.	0.72032|.	D|.	0.01|.	.|.	18.2504|18.2504	0.90000|0.90000	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1008;961;1008|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	N|X	1008;1008;961|697	ENSP00000355243:H1008N;ENSP00000441802:H1008N|.	ENSP00000330302:H961N|.	H|S	+|+	1|2	0|0	PCDH7|PCDH7	30335164|30335164	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	5.606000|5.606000	0.67641|0.67641	2.648000|2.648000	0.89879|0.89879	0.561000|0.561000	0.74099|0.74099	CAT|TCA		0.517	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589		11	29	1	0	5.50884e-06	0.00136819	1.84676e-05	11	29				
COX7B2	170712	broad.mit.edu	37	4	46737207	46737207	+	Start_Codon_SNP	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:46737207C>A	ENST00000396533.1	-	4	253	c.3G>T	c.(1-3)atG>atT	p.M1I	COX7B2_ENST00000543208.1_5'UTR|COX7B2_ENST00000355591.3_Start_Codon_SNP_p.M1I|COX7B2_ENST00000302930.5_Start_Codon_SNP_p.M1I			Q8TF08	CX7B2_HUMAN	cytochrome c oxidase subunit VIIb2	1						integral component of membrane (GO:0016021)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)			large_intestine(1)|lung(4)	5						AGGGAAACATCATGAAGGATT	0.403																																							uc003gxf.2		NA																	0					0						c.(1-3)ATG>ATT		cytochrome c oxidase subunit VIIb2 precursor							105.0	94.0	98.0					4																	46737207		2203	4300	6503	SO:0001582	initiator_codon_variant	170712					integral to membrane|mitochondrial respiratory chain	cytochrome-c oxidase activity	g.chr4:46737207C>A	AF125109	CCDS3472.2	4p12	2011-07-04			ENSG00000170516	ENSG00000170516		"""Mitochondrial respiratory chain complex / Complex IV"""	24381	protein-coding gene	gene with protein product		609811				15623157	Standard	NM_130902		Approved		uc003gxf.3	Q8TF08	OTTHUMG00000099423	ENST00000396533.1:c.3G>T	4.37:g.46737207C>A	ENSP00000379784:p.Met1Ile		Somatic				COX7B2_uc010ige.2_RNA	p.M1I	NM_130902	NP_570972	WXS	Illumina HiSeq	Unspecified	Q8TF08	CX7B2_HUMAN			3	183	-			1					Q32Q40	Missense_Mutation	SNP	ENST00000396533.1	37	c.3G>T	CCDS3472.2	.	.	.	.	.	.	.	.	.	.	C	5.573	0.290524	0.10567	.	.	ENSG00000170516	ENST00000355591;ENST00000396533;ENST00000302930;ENST00000505102	T;T;T;T	0.55234	0.94;0.94;0.94;0.53	4.22	-0.396	0.12427	.	0.666605	0.13289	N	0.399101	T	0.37625	0.1010	.	.	.	0.37033	D	0.896764	B	0.09022	0.002	B	0.04013	0.001	T	0.17653	-1.0362	9	0.42905	T	0.14	-14.9428	7.2044	0.25899	0.0:0.4907:0.0:0.5093	.	1	Q8TF08	CX7B2_HUMAN	I	1	ENSP00000347799:M1I;ENSP00000379784:M1I;ENSP00000305964:M1I;ENSP00000423519:M1I	ENSP00000305964:M1I	M	-	3	0	COX7B2	46431964	0.269000	0.24143	0.051000	0.19133	0.875000	0.50365	0.266000	0.18534	-0.122000	0.11766	-0.237000	0.12165	ATG		0.403	COX7B2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313899.1	NM_130902	Missense_Mutation	13	47	1	0	2.32078e-09	0.00316338	9.19466e-09	13	47				
NIPAL1	152519	broad.mit.edu	37	4	48032142	48032142	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:48032142G>A	ENST00000295461.5	+	3	385	c.319G>A	c.(319-321)Ggt>Agt	p.G107S	NIPAL1_ENST00000508180.1_3'UTR	NM_207330.1	NP_997213.1	Q6NVV3	NIPA3_HUMAN	NIPA-like domain containing 1	107						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|large_intestine(1)|lung(3)|skin(2)	8						TTTAGGACAAGGTGGACATTC	0.343																																							uc003gxw.2		NA																	0					0						c.(319-321)GGT>AGT		NIPA-like domain containing 1							94.0	91.0	92.0					4																	48032142		2203	4300	6503	SO:0001583	missense	152519					integral to membrane		g.chr4:48032142G>A	BC067881	CCDS3479.1	4p12	2009-03-24		2009-03-24	ENSG00000163293	ENSG00000163293			27194	protein-coding gene	gene with protein product				NPAL1			Standard	NM_207330		Approved	DKFZp686A06115	uc003gxw.3	Q6NVV3	OTTHUMG00000128622	ENST00000295461.5:c.319G>A	4.37:g.48032142G>A	ENSP00000295461:p.Gly107Ser		Somatic					p.G107S	NM_207330	NP_997213	WXS	Illumina HiSeq	Unspecified	Q6NVV3	NIPA3_HUMAN			3	385	+			107			Cytoplasmic (Potential).		B3KTB0|Q68DA9	Missense_Mutation	SNP	ENST00000295461.5	37	c.319G>A	CCDS3479.1	.	.	.	.	.	.	.	.	.	.	G	35	5.456284	0.96223	.	.	ENSG00000163293	ENST00000295461;ENST00000511123	D;D	0.90955	-2.76;-2.76	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.96352	0.8810	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96450	0.9333	10	0.87932	D	0	.	20.0313	0.97540	0.0:0.0:1.0:0.0	.	107	Q6NVV3	NIPA3_HUMAN	S	107;72	ENSP00000295461:G107S;ENSP00000422276:G72S	ENSP00000295461:G107S	G	+	1	0	NIPAL1	47726899	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.779000	0.99018	2.746000	0.94184	0.655000	0.94253	GGT		0.343	NIPAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250491.4	NM_207330		11	52	0	0	0	0.000978159	0	11	52				
PRR27	401137	broad.mit.edu	37	4	71024281	71024281	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:71024281C>A	ENST00000344526.5	+	3	501	c.312C>A	c.(310-312)ctC>ctA	p.L104L	C4orf40_ENST00000502294.1_Silent_p.L104L|C4orf40_ENST00000502441.2_Intron	NM_214711.3	NP_999876.2	Q6MZM9	PRR27_HUMAN		104	Ala/Pro-rich.					extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						TTCCTCCTCTCCCTCCTAGGG	0.527																																							uc003hfa.3		NA																	0					0						c.(310-312)CTC>CTA		hypothetical protein LOC401137 precursor							236.0	232.0	233.0					4																	71024281		2203	4300	6503	SO:0001819	synonymous_variant	401137					extracellular region		g.chr4:71024281C>A																												ENST00000344526.5:c.312C>A	4.37:g.71024281C>A			Somatic				C4orf40_uc003hfb.3_Silent_p.L104L	p.L104L	NM_214711	NP_999876	WXS	Illumina HiSeq	Unspecified	Q6MZM9	CD040_HUMAN			4	385	+			104					A8MXP0|Q6MZR6	Silent	SNP	ENST00000344526.5	37	c.312C>A	CCDS3535.1																																																																																				0.527	C4orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251558.1			33	125	1	0	9.04072e-19	0.00327116	4.30071e-18	33	125				
MUC7	4589	broad.mit.edu	37	4	71347308	71347308	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:71347308G>C	ENST00000304887.5	+	3	1037	c.847G>C	c.(847-849)Gcc>Ccc	p.A283P	MUC7_ENST00000456088.1_Missense_Mutation_p.A283P|MUC7_ENST00000413702.1_Missense_Mutation_p.A283P	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	283	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			GACCACAGCTGCCCCACCCAC	0.577																																							uc011cat.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(847-849)GCC>CCC		mucin 7, secreted precursor							410.0	369.0	383.0					4																	71347308		2203	4300	6503	SO:0001583	missense	4589					extracellular region	protein binding	g.chr4:71347308G>C	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.847G>C	4.37:g.71347308G>C	ENSP00000302021:p.Ala283Pro		Somatic				MUC7_uc011cau.1_Missense_Mutation_p.A283P|MUC7_uc003hfj.2_Missense_Mutation_p.A283P|uc011cav.1_Intron	p.A283P	NM_001145006	NP_001138478	WXS	Illumina HiSeq	Unspecified	Q8TAX7	MUC7_HUMAN	Lung(101;0.211)		4	1135	+			283			6.|Thr-rich.		Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	c.847G>C	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	G	6.793	0.515243	0.12944	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.60299	0.2;0.2;0.2	1.95	-0.0377	0.13883	.	.	.	.	.	T	0.51753	0.1693	N	0.19112	0.55	0.09310	N	1	D	0.71674	0.998	D	0.68943	0.961	T	0.37126	-0.9719	8	.	.	.	.	1.9398	0.03344	0.3427:0.0:0.3903:0.2669	.	283	Q8TAX7	MUC7_HUMAN	P	283	ENSP00000407422:A283P;ENSP00000400585:A283P;ENSP00000302021:A283P	.	A	+	1	0	MUC7	71381897	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.475000	0.06599	-0.060000	0.13132	0.603000	0.83216	GCC		0.577	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291		43	142	0	0	0	0.0025221	0	43	142				
PRKG2	5593	broad.mit.edu	37	4	82096055	82096055	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:82096055G>T	ENST00000395578.1	-	3	636	c.520C>A	c.(520-522)Cct>Act	p.P174T	RP11-100N20.1_ENST00000512502.1_RNA|PRKG2_ENST00000264399.1_Missense_Mutation_p.P174T|RP11-100N20.1_ENST00000505175.1_RNA|PRKG2_ENST00000418486.2_Missense_Mutation_p.P174T			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	174					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						ATCTGCTGAGGATCCAGTCTT	0.363																																							uc003hmh.2		NA																	0				breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						c.(520-522)CCT>ACT		protein kinase, cGMP-dependent, type II							163.0	160.0	161.0					4																	82096055		2203	4300	6503	SO:0001583	missense	5593				platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity	g.chr4:82096055G>T	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.520C>A	4.37:g.82096055G>T	ENSP00000378945:p.Pro174Thr		Somatic				PRKG2_uc011cch.1_Missense_Mutation_p.P174T	p.P174T	NM_006259	NP_006250	WXS	Illumina HiSeq	Unspecified	Q13237	KGP2_HUMAN			2	534	-			174			cGMP 1.		B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	37	c.520C>A	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	G	9.868	1.198062	0.22037	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	D;D;D	0.84660	-1.88;-1.88;-1.88	5.76	5.76	0.90799	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.450561	0.24479	N	0.038175	T	0.78515	0.4295	N	0.25890	0.77	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.14023	0.01;0.01	T	0.71497	-0.4575	10	0.15952	T	0.53	-11.631	19.5608	0.95371	0.0:0.0:1.0:0.0	.	174;174	E7EPE6;Q13237	.;KGP2_HUMAN	T	174	ENSP00000378945:P174T;ENSP00000264399:P174T;ENSP00000389038:P174T	ENSP00000264399:P174T	P	-	1	0	PRKG2	82315079	1.000000	0.71417	0.985000	0.45067	0.995000	0.86356	3.938000	0.56583	2.721000	0.93114	0.591000	0.81541	CCT		0.363	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259		31	124	1	0	1.06801e-11	0.00178596	4.65447e-11	31	124				
ARHGAP24	83478	broad.mit.edu	37	4	86491874	86491875	+	Splice_Site	DNP	GG	GG	TT			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:86491874_86491875GG>TT	ENST00000395184.1	+	2	646	c.180_180GG>TT	c.(178-180)ttGG>ttTTg	p.L60F	ARHGAP24_ENST00000506421.1_3'UTR|ARHGAP24_ENST00000503995.1_Splice_Site_p.L60F	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	60	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		CCAAGCCCTTGGTGAGTAGGAG	0.46																																							uc003hpk.2		NA																	0					0						c.e2+1		Rho GTPase activating protein 24 isoform 1																																				SO:0001630	splice_region_variant	83478				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding	g.chr4:86491874_86491875GG>TT	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	Exception_encountered	4.37:g.86491874_86491875delinsTT			Somatic				ARHGAP24_uc003hpi.1_Splice_Site_p.L60_splice|ARHGAP24_uc003hpj.2_Splice_Site_p.L60_splice	p.L60_splice	NM_001025616	NP_001020787	WXS	Illumina HiSeq	Unspecified	Q8N264	RHG24_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000571)	2	629	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)						Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Splice_Site	DNP	ENST00000395184.1	37	c.180_splice	CCDS34025.1																																																																																				0.460	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	Missense_Mutation	14	53	0	0	0	6.4e-05	0	14	53				
UBE2D3	7323	broad.mit.edu	37	4	103730964	103730964	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:103730964G>A	ENST00000453744.2	-	3	586	c.73C>T	c.(73-75)Cca>Tca	p.P25S	UBE2D3_ENST00000504211.1_5'UTR|UBE2D3_ENST00000513098.1_5'UTR|UBE2D3_ENST00000343106.5_Missense_Mutation_p.P25S|UBE2D3_ENST00000394804.2_Missense_Mutation_p.P25S|UBE2D3_ENST00000505207.1_5'UTR|UBE2D3_ENST00000349311.8_Missense_Mutation_p.P25S|UBE2D3_ENST00000507845.1_5'UTR|UBE2D3_ENST00000338145.3_Missense_Mutation_p.P25S|UBE2D3_ENST00000350435.7_Missense_Mutation_p.P19S|UBE2D3_ENST00000502404.1_5'UTR|UBE2D3_ENST00000357194.6_Missense_Mutation_p.P27S|UBE2D3_ENST00000321805.7_Missense_Mutation_p.P25S|UBE2D3_ENST00000394803.5_Missense_Mutation_p.P25S|UBE2D3_ENST00000394801.4_Missense_Mutation_p.P25S	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	25					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TCCCCAACTGGACCTGCAGAA	0.363																																							uc003hwk.2		NA																	0					0						c.(73-75)CCA>TCA		ubiquitin-conjugating enzyme E2D 3 isoform 1							111.0	114.0	113.0					4																	103730964		2203	4300	6503	SO:0001583	missense	7323				apoptosis|BMP signaling pathway|DNA repair|negative regulation of type I interferon production|proteasomal ubiquitin-dependent protein catabolic process|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein monoubiquitination|transforming growth factor beta receptor signaling pathway	endosome membrane|plasma membrane	ATP binding|protein binding|ubiquitin-protein ligase activity	g.chr4:103730964G>A	U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.73C>T	4.37:g.103730964G>A	ENSP00000396901:p.Pro25Ser		Somatic				UBE2D3_uc003hwi.2_Missense_Mutation_p.P25S|UBE2D3_uc003hwj.2_RNA|UBE2D3_uc003hwl.2_Missense_Mutation_p.P25S|UBE2D3_uc011cet.1_Missense_Mutation_p.P25S|UBE2D3_uc011ceu.1_Missense_Mutation_p.P25S|UBE2D3_uc003hwo.2_Missense_Mutation_p.P25S|UBE2D3_uc003hwp.2_Missense_Mutation_p.P25S|UBE2D3_uc003hwq.2_Missense_Mutation_p.P27S|UBE2D3_uc003hwr.2_Missense_Mutation_p.P25S	p.P25S	NM_181887	NP_871616	WXS	Illumina HiSeq	Unspecified	P61077	UB2D3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)	3	534	-		Hepatocellular(203;0.217)	25					A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Missense_Mutation	SNP	ENST00000453744.2	37	c.73C>T	CCDS3660.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.896093	0.91962	.	.	ENSG00000109332	ENST00000453744;ENST00000394801;ENST00000394803;ENST00000394804;ENST00000343106;ENST00000321805;ENST00000350435;ENST00000338145;ENST00000349311;ENST00000357194;ENST00000508238;ENST00000502690;ENST00000508249	T;T;T;T;T;T;T;T;T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27	5.58	5.58	0.84498	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.79488	0.4454	M	0.84433	2.695	0.80722	D	1	P;P;P	0.52061	0.95;0.931;0.95	D;D;P	0.65874	0.917;0.939;0.868	T	0.82076	-0.0636	10	0.87932	D	0	.	19.6572	0.95847	0.0:0.0:1.0:0.0	.	27;25;25	P61077-3;P61077;P61077-2	.;UB2D3_HUMAN;.	S	25;25;25;25;25;25;19;25;25;27;25;25;25	ENSP00000396901:P25S;ENSP00000378280:P25S;ENSP00000378282:P25S;ENSP00000378283:P25S;ENSP00000345285:P25S;ENSP00000318494:P25S;ENSP00000337262:P19S;ENSP00000337208:P25S;ENSP00000344069:P25S;ENSP00000349722:P27S;ENSP00000423487:P25S;ENSP00000425762:P25S;ENSP00000421310:P25S	ENSP00000318494:P25S	P	-	1	0	UBE2D3	103950075	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.494000	0.97962	2.630000	0.89119	0.650000	0.86243	CCA		0.363	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253791.2	NM_181893		16	93	0	0	0	0.00400662	0	16	93				
TACR3	6870	broad.mit.edu	37	4	104512718	104512718	+	Silent	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:104512718G>T	ENST00000304883.2	-	4	1151	c.1011C>A	c.(1009-1011)gtC>gtA	p.V337V	RP11-297P16.3_ENST00000512401.1_RNA|RP11-297P16.3_ENST00000502936.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	337					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		TAGCCAGGTAGACCTGCTGGA	0.398																																							uc003hxe.1		NA																	0				ovary(3)|lung(2)|breast(1)|skin(1)	7						c.(1009-1011)GTC>GTA		tachykinin receptor 3							157.0	152.0	154.0					4																	104512718		2203	4300	6503	SO:0001819	synonymous_variant	6870					integral to plasma membrane	tachykinin receptor activity	g.chr4:104512718G>T	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1011C>A	4.37:g.104512718G>T			Somatic					p.V337V	NM_001059	NP_001050	WXS	Illumina HiSeq	Unspecified	P29371	NK3R_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)	4	1154	-		Hepatocellular(203;0.217)	337			Helical; Name=7; (Potential).		Q0P510	Silent	SNP	ENST00000304883.2	37	c.1011C>A	CCDS3664.1																																																																																				0.398	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059		16	94	1	0	6.72482e-11	0.00316338	2.8215e-10	16	94				
ANK2	287	broad.mit.edu	37	4	114278909	114278909	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:114278909G>T	ENST00000357077.4	+	38	9188	c.9135G>T	c.(9133-9135)tgG>tgT	p.W3045C	ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.W3012C|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000394537.3_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3045					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTGATTCTTGGAGTGAAATTC	0.413																																							uc003ibe.3		NA																	0				central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(9133-9135)TGG>TGT		ankyrin 2 isoform 1							89.0	87.0	87.0					4																	114278909		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114278909G>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.9135G>T	4.37:g.114278909G>T	ENSP00000349588:p.Trp3045Cys		Somatic				ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.W347C|ANK2_uc011cgb.1_Missense_Mutation_p.W3060C	p.W3045C	NM_001148	NP_001139	WXS	Illumina HiSeq	Unspecified	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	9235	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	3012					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.9135G>T	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067273	0.55539	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	D;D;D	0.99778	-3.27;-3.3;-6.73	5.78	5.78	0.91487	.	0.000000	0.53938	D	0.000050	D	0.99757	0.9902	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.972;0.999	D	0.97737	1.0206	10	0.72032	D	0.01	.	20.0139	0.97470	0.0:0.0:1.0:0.0	.	3012;3045	Q01484;Q01484-4	ANK2_HUMAN;.	C	3045;3012;55	ENSP00000349588:W3045C;ENSP00000264366:W3012C;ENSP00000422498:W55C	ENSP00000264366:W3012C	W	+	3	0	ANK2	114498358	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.928000	0.87587	2.724000	0.93272	0.563000	0.77884	TGG		0.413	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		31	105	1	0	3.03874e-20	0.00327116	1.46619e-19	31	105				
LARP1B	55132	broad.mit.edu	37	4	129043061	129043061	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:129043061G>T	ENST00000326639.6	+	11	1453	c.1242G>T	c.(1240-1242)ttG>ttT	p.L414F	LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000427266.1_Missense_Mutation_p.L414F|LARP1B_ENST00000441387.1_Missense_Mutation_p.L414F|LARP1B_ENST00000512292.1_Missense_Mutation_p.L414F|LARP1B_ENST00000264584.5_Missense_Mutation_p.L367F	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	414						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						TTGATTTTTTGTTTGATGAAG	0.338																																							uc003iga.2		NA																	0					0						c.(1240-1242)TTG>TTT		La ribonucleoprotein domain family member 2							44.0	45.0	45.0					4																	129043061		2203	4300	6503	SO:0001583	missense	55132						RNA binding	g.chr4:129043061G>T		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.1242G>T	4.37:g.129043061G>T	ENSP00000321997:p.Leu414Phe		Somatic				LARP1B_uc003igc.2_5'UTR|LARP1B_uc003ifz.1_Missense_Mutation_p.L414F|LARP1B_uc003igb.1_Missense_Mutation_p.L129F	p.L414F	NM_018078	NP_060548	WXS	Illumina HiSeq	Unspecified	Q659C4	LAR1B_HUMAN			11	1373	+			414					Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	ENST00000326639.6	37	c.1242G>T	CCDS3738.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.24|12.24	1.879331|1.879331	0.33162|0.33162	.|.	.|.	ENSG00000138709|ENSG00000138709	ENST00000326639;ENST00000512292;ENST00000508819;ENST00000264584;ENST00000441387;ENST00000427266|ENST00000507377	T;T;T;T;T;T|.	0.33865|.	1.84;1.4;1.41;1.85;1.83;1.39|.	4.71|4.71	-1.81|-1.81	0.07882|0.07882	.|.	0.240382|.	0.30930|.	N|.	0.008592|.	T|T	0.50137|0.50137	0.1598|0.1598	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	B;B;B|.	0.24043|.	0.096;0.022;0.026|.	B;B;B|.	0.25614|.	0.062;0.049;0.025|.	T|T	0.41197|0.41197	-0.9522|-0.9522	10|5	0.54805|.	T|.	0.06|.	.|.	7.5122|7.5122	0.27579|0.27579	0.2103:0.1767:0.613:0.0|0.2103:0.1767:0.613:0.0	.|.	367;414;414|.	D6RJB0;Q659C4;G3XAJ5|.	.;LAR1B_HUMAN;.|.	F|F	414;414;367;367;414;414|383	ENSP00000321997:L414F;ENSP00000422850:L414F;ENSP00000427281:L367F;ENSP00000264584:L367F;ENSP00000396521:L414F;ENSP00000403586:L414F|.	ENSP00000264584:L367F|.	L|V	+|+	3|1	2|0	LARP1B|LARP1B	129262511|129262511	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.863000|0.863000	0.49368|0.49368	2.947000|2.947000	0.49058|0.49058	-0.210000|-0.210000	0.10140|0.10140	-0.482000|-0.482000	0.04802|0.04802	TTG|GTT		0.338	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078		10	46	1	0	1.76689e-08	0.000442599	6.83975e-08	10	46				
PCDH18	54510	broad.mit.edu	37	4	138451383	138451383	+	Silent	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:138451383T>A	ENST00000344876.4	-	1	2246	c.1860A>T	c.(1858-1860)atA>atT	p.I620I	PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Silent_p.I620I|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000507846.1_Silent_p.I400I	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	620	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TACCTGCTACTATGGCGCAGC	0.448																																							uc003ihe.3		NA																	0				pancreas(3)|skin(2)	5						c.(1858-1860)ATA>ATT		protocadherin 18 precursor							248.0	227.0	234.0					4																	138451383		2203	4300	6503	SO:0001819	synonymous_variant	54510				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:138451383T>A	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1860A>T	4.37:g.138451383T>A			Somatic				PCDH18_uc003ihf.3_Silent_p.I613I|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Silent_p.I400I|PCDH18_uc011cha.1_Intron	p.I620I	NM_019035	NP_061908	WXS	Illumina HiSeq	Unspecified	Q9HCL0	PCD18_HUMAN			1	2247	-	all_hematologic(180;0.24)		620			Cadherin 6.|Extracellular (Potential).		A8K7K3|B7ZKT1|Q52LS2	Silent	SNP	ENST00000344876.4	37	c.1860A>T	CCDS34064.1																																																																																				0.448	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035		60	212	0	0	0	0.00361006	0	60	212				
IL15	3600	broad.mit.edu	37	4	142643115	142643115	+	Missense_Mutation	SNP	G	G	T	rs200531127		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:142643115G>T	ENST00000296545.7	+	5	993	c.149G>T	c.(148-150)tGg>tTg	p.W50L	IL15_ENST00000514653.1_Missense_Mutation_p.W23L|IL15_ENST00000477265.1_Missense_Mutation_p.W23L|IL15_ENST00000320650.4_Missense_Mutation_p.W50L|IL15_ENST00000394159.1_Missense_Mutation_p.W23L|IL15_ENST00000529613.1_Missense_Mutation_p.W50L			P40933	IL15_HUMAN	interleukin 15	50					aging (GO:0007568)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|cellular response to vitamin D (GO:0071305)|extrathymic T cell selection (GO:0045062)|hyaluronan metabolic process (GO:0030212)|immune response (GO:0006955)|inflammatory response (GO:0006954)|lymph node development (GO:0048535)|natural killer cell differentiation (GO:0001779)|negative regulation of smooth muscle cell proliferation (GO:0048662)|NK T cell proliferation (GO:0001866)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immune response (GO:0050778)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of defense response to virus by host (GO:0050691)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_hematologic(180;0.158)					GAAGCCAACTGGGTGAATGTA	0.353																																					Pancreas(10;184 986 25902)	Pancreas(10;184 986 25902)	uc003iis.2		NA																	0					0						c.(148-150)TGG>TTG		interleukin 15 preproprotein							92.0	97.0	95.0					4																	142643115		2203	4300	6503	SO:0001583	missense	3600				cell-cell signaling|immune response|positive regulation of interleukin-17 production	endosome|extracellular space|Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	cytokine activity|cytokine receptor binding|signal transducer activity	g.chr4:142643115G>T	U14407	CCDS3755.1, CCDS3756.1	4q31	2011-07-14			ENSG00000164136	ENSG00000164136		"""Interleukins and interleukin receptors"""	5977	protein-coding gene	gene with protein product		600554				8178155	Standard	NM_000585		Approved	IL-15, MGC9721	uc003iis.3	P40933	OTTHUMG00000133418	ENST00000296545.7:c.149G>T	4.37:g.142643115G>T	ENSP00000296545:p.Trp50Leu		Somatic				IL15_uc003iit.2_Missense_Mutation_p.W50L|IL15_uc010iol.2_RNA|IL15_uc003iiu.2_RNA	p.W50L	NM_000585	NP_000576	WXS	Illumina HiSeq	Unspecified	P40933	IL15_HUMAN			5	518	+	all_hematologic(180;0.158)		50					D3DNZ2|O00440|O43512|Q495Z8|Q6FGX7|Q93058|Q9UBA3	Missense_Mutation	SNP	ENST00000296545.7	37	c.149G>T	CCDS3755.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.799916	0.50208	.	.	ENSG00000164136	ENST00000320650;ENST00000296545;ENST00000514653;ENST00000529613;ENST00000477265;ENST00000394159	.	.	.	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000014	T	0.80082	0.4558	M	0.82323	2.585	0.39846	D	0.973178	D	0.89917	1.0	D	0.91635	0.999	D	0.83890	0.0284	9	0.87932	D	0	.	14.2659	0.66118	0.0:0.0:1.0:0.0	.	50	P40933	IL15_HUMAN	L	50;50;23;50;23;23	.	ENSP00000296545:W50L	W	+	2	0	IL15	142862565	1.000000	0.71417	0.975000	0.42487	0.195000	0.23768	4.489000	0.60309	2.501000	0.84356	0.655000	0.94253	TGG		0.353	IL15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257278.2	NM_172175		16	102	1	0	2.4624e-09	0.00121646	9.72719e-09	16	102				
DCHS2	54798	broad.mit.edu	37	4	155191131	155191131	+	Silent	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:155191131A>G	ENST00000357232.4	-	19	5132	c.5133T>C	c.(5131-5133)ccT>ccC	p.P1711P		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1711	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GAATTGAGTCAGGAGCAAAAG	0.338																																							uc003inw.2		NA																	0				ovary(3)|pancreas(1)	4						c.(5131-5133)CCT>CCC		dachsous 2 isoform 1							75.0	74.0	74.0					4																	155191131		2203	4299	6502	SO:0001819	synonymous_variant	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155191131A>G	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5133T>C	4.37:g.155191131A>G			Somatic					p.P1711P	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	19	5133	-	all_hematologic(180;0.208)	Renal(120;0.0854)	1711			Cadherin 15.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	c.5133T>C	CCDS3785.1																																																																																				0.338	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		18	94	0	0	0	0.00152264	0	18	94				
NPY2R	4887	broad.mit.edu	37	4	156136118	156136118	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:156136118G>C	ENST00000329476.3	+	2	1516	c.1027G>C	c.(1027-1029)Gag>Cag	p.E343Q	NPY2R_ENST00000506608.1_Missense_Mutation_p.E343Q	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	343					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	CTTCCGCTGTGAGCAGCGGTT	0.512																																							uc003ioq.2		NA																	0				lung(2)|skin(1)	3						c.(1027-1029)GAG>CAG		neuropeptide Y receptor Y2							100.0	97.0	98.0					4																	156136118		2203	4300	6503	SO:0001583	missense	4887				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity	g.chr4:156136118G>C	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.1027G>C	4.37:g.156136118G>C	ENSP00000332591:p.Glu343Gln		Somatic				NPY2R_uc003ior.2_Missense_Mutation_p.E343Q	p.E343Q	NM_000910	NP_000901	WXS	Illumina HiSeq	Unspecified	P49146	NPY2R_HUMAN			2	1522	+	all_hematologic(180;0.24)	Renal(120;0.0854)	343			Cytoplasmic (Potential).		Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	37	c.1027G>C	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.399059	0.25291	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.60424	0.19;0.19	5.74	3.98	0.46160	.	0.496261	0.21625	N	0.071573	T	0.49270	0.1547	L	0.46157	1.445	0.35345	D	0.786863	B	0.02656	0.0	B	0.04013	0.001	T	0.51371	-0.8714	10	0.12766	T	0.61	.	15.4387	0.75165	0.0:0.2637:0.7363:0.0	.	343	P49146	NPY2R_HUMAN	Q	343	ENSP00000332591:E343Q;ENSP00000426366:E343Q	ENSP00000332591:E343Q	E	+	1	0	NPY2R	156355568	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.976000	0.49289	0.738000	0.32606	0.643000	0.83706	GAG		0.512	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910		6	88	0	0	0	0.00307968	0	6	88				
FSTL5	56884	broad.mit.edu	37	4	162697220	162697220	+	Missense_Mutation	SNP	T	T	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:162697220T>G	ENST00000306100.5	-	5	852	c.416A>C	c.(415-417)aAg>aCg	p.K139T	FSTL5_ENST00000427802.2_Missense_Mutation_p.K138T|FSTL5_ENST00000379164.4_Missense_Mutation_p.K138T|FSTL5_ENST00000536695.1_Missense_Mutation_p.K138T	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	139						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AGTCTTGCACTTATCTCCTGT	0.254																																							uc003iqh.2		NA																	0				ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8						c.(415-417)AAG>ACG		follistatin-like 5 isoform a							36.0	35.0	35.0					4																	162697220		2200	4290	6490	SO:0001583	missense	56884					extracellular region	calcium ion binding	g.chr4:162697220T>G	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.416A>C	4.37:g.162697220T>G	ENSP00000305334:p.Lys139Thr		Somatic				FSTL5_uc003iqi.2_Missense_Mutation_p.K138T|FSTL5_uc010iqv.2_Missense_Mutation_p.K138T	p.K139T	NM_020116	NP_064501	WXS	Illumina HiSeq	Unspecified	Q8N475	FSTL5_HUMAN		COAD - Colon adenocarcinoma(41;0.179)	5	852	-	all_hematologic(180;0.24)		139					E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	c.416A>C	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	T	6.706	0.498936	0.12762	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.73897	-0.77;-0.75;-0.79;-0.75	5.3	4.11	0.48088	.	0.346250	0.36303	N	0.002665	T	0.51856	0.1699	N	0.13098	0.295	0.27099	N	0.962669	B;B;B	0.18741	0.03;0.005;0.006	B;B;B	0.15870	0.014;0.012;0.008	T	0.33292	-0.9874	10	0.11182	T	0.66	.	8.1937	0.31383	0.0:0.1567:0.0:0.8433	.	138;138;139	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	T	139;138;138;138	ENSP00000305334:K139T;ENSP00000368462:K138T;ENSP00000389270:K138T;ENSP00000440409:K138T	ENSP00000305334:K139T	K	-	2	0	FSTL5	162916670	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	3.509000	0.53386	0.935000	0.37341	0.528000	0.53228	AAG		0.254	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116		3	28	0	0	0	0.00024832	0	3	28				
TKTL2	84076	broad.mit.edu	37	4	164393100	164393100	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:164393100A>T	ENST00000280605.3	-	1	1947	c.1787T>A	c.(1786-1788)gTg>gAg	p.V596E		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	596						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ACGTTGAGGCACTCCTGACAC	0.463																																							uc003iqp.3		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(1786-1788)GTG>GAG		transketolase-like 2							96.0	87.0	90.0					4																	164393100		2203	4300	6503	SO:0001583	missense	84076					cytoplasm	metal ion binding|transketolase activity	g.chr4:164393100A>T	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.1787T>A	4.37:g.164393100A>T	ENSP00000280605:p.Val596Glu		Somatic					p.V596E	NM_032136	NP_115512	WXS	Illumina HiSeq	Unspecified	Q9H0I9	TKTL2_HUMAN			1	1948	-	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)	596					A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	ENST00000280605.3	37	c.1787T>A	CCDS3805.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.343356	0.41498	.	.	ENSG00000151005	ENST00000280605	D	0.91295	-2.82	5.16	2.65	0.31530	Transketolase, C-terminal (1);Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (1);Transketolase-like, C-terminal (1);	0.230164	0.34725	N	0.003726	D	0.95198	0.8443	M	0.89785	3.06	0.36135	D	0.846427	D	0.63880	0.993	D	0.70716	0.97	D	0.95781	0.8817	10	0.56958	D	0.05	-7.9546	10.8292	0.46650	0.6985:0.3015:0.0:0.0	.	596	Q9H0I9	TKTL2_HUMAN	E	596	ENSP00000280605:V596E	ENSP00000280605:V596E	V	-	2	0	TKTL2	164612550	0.676000	0.27567	0.044000	0.18714	0.539000	0.34962	6.205000	0.72148	0.492000	0.27815	0.528000	0.53228	GTG		0.463	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365207.1	NM_032136		13	55	0	0	0	0.00244969	0	13	55				
DDX60	55601	broad.mit.edu	37	4	169158497	169158497	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:169158497C>A	ENST00000393743.3	-	32	4642	c.4351G>T	c.(4351-4353)Gtt>Ttt	p.V1451F		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1451					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CTGACAAAAACAAGATTAGAA	0.353																																							uc003irp.2		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(4351-4353)GTT>TTT		DEAD (Asp-Glu-Ala-Asp) box polypeptide 60							56.0	54.0	55.0					4																	169158497		2203	4299	6502	SO:0001583	missense	55601						ATP binding|ATP-dependent helicase activity|RNA binding	g.chr4:169158497C>A	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.4351G>T	4.37:g.169158497C>A	ENSP00000377344:p.Val1451Phe		Somatic					p.V1451F	NM_017631	NP_060101	WXS	Illumina HiSeq	Unspecified	Q8IY21	DDX60_HUMAN		GBM - Glioblastoma multiforme(119;0.0485)	32	4643	-		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)	1451					Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	c.4351G>T	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987377	0.74589	.	.	ENSG00000137628	ENST00000393743	T	0.19806	2.12	5.65	4.78	0.61160	.	0.120209	0.37348	N	0.002128	T	0.35653	0.0939	M	0.80028	2.48	0.41235	D	0.986601	P	0.52577	0.954	P	0.46758	0.526	T	0.40534	-0.9558	10	0.66056	D	0.02	.	16.2739	0.82634	0.0:0.8677:0.1323:0.0	.	1451	Q8IY21	DDX60_HUMAN	F	1451	ENSP00000377344:V1451F	ENSP00000377344:V1451F	V	-	1	0	DDX60	169395072	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.478000	0.45189	2.681000	0.91329	0.563000	0.77884	GTT		0.353	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631		11	34	1	0	1.58986e-06	0.000673444	5.52161e-06	11	34				
NEK1	4750	broad.mit.edu	37	4	170523765	170523765	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:170523765C>G	ENST00000439128.2	-	2	657	c.17G>C	c.(16-18)aGa>aCa	p.R6T	NEK1_ENST00000511633.1_Missense_Mutation_p.R6T|NEK1_ENST00000512193.1_Missense_Mutation_p.R6T|NEK1_ENST00000507142.1_Missense_Mutation_p.R6T|NEK1_ENST00000510533.1_Missense_Mutation_p.R6T	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	6	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		CTTCTGTAGTCTAACATACTT	0.308																																							uc003isb.1		NA																	0				lung(3)|ovary(2)|large_intestine(1)	6						c.(16-18)AGA>ACA		NIMA-related kinase 1							130.0	126.0	127.0					4																	170523765		1805	4069	5874	SO:0001583	missense	4750				cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr4:170523765C>G	AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.17G>C	4.37:g.170523765C>G	ENSP00000408020:p.Arg6Thr		Somatic				NEK1_uc003isc.1_Missense_Mutation_p.R6T|NEK1_uc003isd.1_Missense_Mutation_p.R6T|NEK1_uc003ise.1_Missense_Mutation_p.R6T|NEK1_uc003isf.1_Missense_Mutation_p.R6T	p.R6T	NM_012224	NP_036356	WXS	Illumina HiSeq	Unspecified	Q96PY6	NEK1_HUMAN		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)	2	509	-		Prostate(90;0.00601)|Renal(120;0.0183)	6			Protein kinase.		G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	ENST00000439128.2	37	c.17G>C	CCDS47162.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.426123	0.43020	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87	5.28	3.27	0.37495	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.181664	0.38217	N	0.001779	T	0.18257	0.0438	N	0.16656	0.425	0.30858	N	0.733874	P;P;P;P;P	0.44429	0.551;0.835;0.551;0.835;0.605	B;P;B;P;P	0.48227	0.366;0.571;0.433;0.571;0.568	T	0.05053	-1.0909	10	0.30854	T	0.27	.	6.205	0.20598	0.0:0.6532:0.0:0.3468	.	6;6;6;6;6	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	T	6	ENSP00000408020:R6T;ENSP00000423332:R6T;ENSP00000427653:R6T;ENSP00000424757:R6T;ENSP00000424938:R6T	ENSP00000408020:R6T	R	-	2	0	NEK1	170760340	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	1.956000	0.40382	1.211000	0.43351	0.591000	0.81541	AGA		0.308	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3			13	83	0	0	0	0.00244969	0	13	83				
ADAM29	11086	broad.mit.edu	37	4	175898063	175898063	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:175898063G>T	ENST00000359240.3	+	5	2057	c.1387G>T	c.(1387-1389)Gat>Tat	p.D463Y	ADAM29_ENST00000445694.1_Missense_Mutation_p.D463Y|ADAM29_ENST00000404450.4_Missense_Mutation_p.D463Y|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000514159.1_Missense_Mutation_p.D463Y	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	463	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CAATGAATGTGATCTTCCAGA	0.448																																					Ovarian(140;1727 1835 21805 25838 41440)	Ovarian(140;1727 1835 21805 25838 41440)	uc003iuc.2		NA																	0				skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16						c.(1387-1389)GAT>TAT		ADAM metallopeptidase domain 29 preproprotein							125.0	113.0	117.0					4																	175898063		2203	4300	6503	SO:0001583	missense	11086				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding	g.chr4:175898063G>T	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1387G>T	4.37:g.175898063G>T	ENSP00000352177:p.Asp463Tyr		Somatic				ADAM29_uc003iud.2_Missense_Mutation_p.D463Y|ADAM29_uc010irr.2_Missense_Mutation_p.D463Y|ADAM29_uc011cki.1_Missense_Mutation_p.D463Y	p.D463Y	NM_014269	NP_055084	WXS	Illumina HiSeq	Unspecified	Q9UKF5	ADA29_HUMAN		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)	5	2057	+		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	463			Disintegrin.|Extracellular (Potential).		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	c.1387G>T	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055458	0.36277	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.15487	2.42;2.42;2.42;2.42	3.69	3.69	0.42338	Blood coagulation inhibitor, Disintegrin (5);	0.000000	0.36815	U	0.002391	T	0.56775	0.2008	H	0.97829	4.085	0.33240	D	0.557047	D	0.89917	1.0	D	0.97110	1.0	T	0.78663	-0.2116	9	.	.	.	.	13.721	0.62728	0.0:0.0:1.0:0.0	.	463	Q9UKF5	ADA29_HUMAN	Y	463	ENSP00000352177:D463Y;ENSP00000414544:D463Y;ENSP00000384229:D463Y;ENSP00000423517:D463Y	.	D	+	1	0	ADAM29	176134638	1.000000	0.71417	0.997000	0.53966	0.064000	0.16182	6.797000	0.75150	2.351000	0.79841	0.643000	0.83706	GAT		0.448	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding				7	55	1	0	8.12818e-05	0.00198382	0.000254784	7	55				
ACSL1	2180	broad.mit.edu	37	4	185678789	185678789	+	Splice_Site	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:185678789C>A	ENST00000515030.1	-	20	2281	c.1956G>T	c.(1954-1956)caG>caT	p.Q652H	ACSL1_ENST00000454703.2_Splice_Site_p.Q481H|ACSL1_ENST00000437665.3_Splice_Site_p.Q481H|ACSL1_ENST00000281455.2_Splice_Site_p.Q652H|ACSL1_ENST00000504342.1_Splice_Site_p.Q652H|ACSL1_ENST00000513317.1_Splice_Site_p.Q652H|ACSL1_ENST00000507295.1_Splice_Site_p.Q618H			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	652					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AAGGTCATACCTGTTCAAATG	0.348																																							uc003iww.2		NA																	0				ovary(2)	2						c.(1954-1956)CAG>CAT		acyl-CoA synthetase long-chain family member 1	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						179.0	186.0	184.0					4																	185678789		2203	4300	6503	SO:0001630	splice_region_variant	2180				digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr4:185678789C>A	BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.1956+1G>T	4.37:g.185678789C>A			Somatic				ACSL1_uc011ckm.1_Missense_Mutation_p.Q481H|ACSL1_uc003iwt.1_Missense_Mutation_p.Q652H|ACSL1_uc003iwu.1_Missense_Mutation_p.Q652H|ACSL1_uc011ckn.1_Missense_Mutation_p.Q618H|ACSL1_uc003iws.1_Missense_Mutation_p.Q212H	p.Q652H	NM_001995	NP_001986	WXS	Illumina HiSeq	Unspecified	P33121	ACSL1_HUMAN		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	20	2250	-		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)	652			Cytoplasmic (Potential).		B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Missense_Mutation	SNP	ENST00000515030.1	37	c.1956G>T	CCDS3839.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663913	0.67700	.	.	ENSG00000151726	ENST00000454703;ENST00000515030;ENST00000503407;ENST00000281455;ENST00000507295;ENST00000437665;ENST00000504342;ENST00000513317	T;T;T;T;T;T;T;T	0.10860	2.83;2.83;2.83;2.83;2.83;2.83;2.83;2.83	4.72	3.88	0.44766	.	0.112377	0.64402	D	0.000005	T	0.38401	0.1039	M	0.91561	3.22	0.80722	D	1	D;D;D;D	0.76494	0.995;0.997;0.999;0.998	P;D;D;D	0.66847	0.664;0.926;0.926;0.947	T	0.48456	-0.9034	9	.	.	.	-5.002	12.9182	0.58216	0.0:0.9207:0.0:0.0793	.	618;652;652;642	E7EPM6;B7Z452;P33121;P33121-2	.;.;ACSL1_HUMAN;.	H	481;652;248;652;618;481;652;652	ENSP00000407165:Q481H;ENSP00000422607:Q652H;ENSP00000425098:Q248H;ENSP00000281455:Q652H;ENSP00000426244:Q618H;ENSP00000405687:Q481H;ENSP00000425006:Q652H;ENSP00000426150:Q652H	.	Q	-	3	2	ACSL1	185915783	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	4.873000	0.63057	0.972000	0.38314	0.591000	0.81541	CAG		0.348	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995	Missense_Mutation	55	174	1	0	1.14385e-22	0.00361006	5.63995e-22	55	174				
TLR3	7098	broad.mit.edu	37	4	186998018	186998018	+	Missense_Mutation	SNP	T	T	C	rs557548506		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:186998018T>C	ENST00000296795.3	+	2	349	c.245T>C	c.(244-246)gTa>gCa	p.V82A		NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	82					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		AGCTTGGATGTAGGATTTAAC	0.418													T|||	1	0.000199681	0.0008	0.0	5008	,	,		20603	0.0		0.0	False		,,,				2504	0.0						uc003iyq.2		NA																	0				ovary(2)|prostate(1)|lung(1)|breast(1)	5						c.(244-246)GTA>GCA		toll-like receptor 3 precursor							131.0	128.0	129.0					4																	186998018		2203	4300	6503	SO:0001583	missense	7098				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity	g.chr4:186998018T>C	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.245T>C	4.37:g.186998018T>C	ENSP00000296795:p.Val82Ala		Somatic					p.V82A	NM_003265	NP_003256	WXS	Illumina HiSeq	Unspecified	O15455	TLR3_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)	2	346	+		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)	82			LRR 2.|Lumenal (Potential).		B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	ENST00000296795.3	37	c.245T>C	CCDS3846.1	.	.	.	.	.	.	.	.	.	.	T	0.273	-0.991328	0.02162	.	.	ENSG00000164342	ENST00000296795;ENST00000513189;ENST00000542020	T;T	0.58652	0.33;0.32	5.47	1.52	0.23074	.	0.415292	0.27139	N	0.020748	T	0.42337	0.1198	N	0.26042	0.785	0.80722	D	1	B	0.06786	0.001	B	0.15870	0.014	T	0.16660	-1.0395	10	0.38643	T	0.18	.	12.1029	0.53794	0.0:0.5411:0.2477:0.2111	.	82	O15455	TLR3_HUMAN	A	82	ENSP00000296795:V82A;ENSP00000423386:V82A	ENSP00000296795:V82A	V	+	2	0	TLR3	187235012	0.962000	0.33011	0.994000	0.49952	0.710000	0.40934	0.604000	0.24164	0.024000	0.15214	-0.452000	0.05504	GTA		0.418	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4			19	91	0	0	0	0.00121646	0	19	91				
FAT1	2195	broad.mit.edu	37	4	187539651	187539651	+	Nonsense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr4:187539651C>A	ENST00000441802.2	-	10	8298	c.8089G>T	c.(8089-8091)Gaa>Taa	p.E2697*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2697	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E2700*(2)|p.E2697*(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AGCTGCATTTCCGGTGGAAGG	0.393										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	4	Substitution - Nonsense(4)		lung(2)|endometrium(2)	ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(8089-8091)GAA>TAA		FAT tumor suppressor 1 precursor							113.0	114.0	114.0					4																	187539651		1846	4085	5931	SO:0001587	stop_gained	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187539651C>A	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8089G>T	4.37:g.187539651C>A	ENSP00000406229:p.Glu2697*	HNSCC(5;0.00058)	Somatic					p.E2697*	NM_005245	NP_005236	WXS	Illumina HiSeq	Unspecified	Q14517	FAT1_HUMAN			10	8277	-			2697			Extracellular (Potential).|Cadherin 24.			Nonsense_Mutation	SNP	ENST00000441802.2	37	c.8089G>T	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	47	13.831360	0.99765	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	5.09	4.25	0.50352	.	0.048710	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	14.1861	0.65607	0.0:0.9277:0.0:0.0723	.	.	.	.	X	2697;2699	.	ENSP00000260147:E2699X	E	-	1	0	FAT1	187776645	1.000000	0.71417	0.105000	0.21289	0.032000	0.12392	7.651000	0.83577	1.509000	0.48786	0.655000	0.94253	GAA		0.393	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		17	152	1	0	5.3912e-06	0.00074312	1.83003e-05	17	152				
SEMA5A	9037	broad.mit.edu	37	5	9202174	9202174	+	Silent	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:9202174G>A	ENST00000382496.5	-	9	1490	c.825C>T	c.(823-825)cgC>cgT	p.R275R		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	275	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						AGCAGTTCAGGCGAGCCTTCA	0.522																																							uc003jek.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(823-825)CGC>CGT		semaphorin 5A precursor							90.0	83.0	86.0					5																	9202174		2203	4300	6503	SO:0001819	synonymous_variant	9037				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane		g.chr5:9202174G>A	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.825C>T	5.37:g.9202174G>A			Somatic					p.R275R	NM_003966	NP_003957	WXS	Illumina HiSeq	Unspecified	Q13591	SEM5A_HUMAN			9	1537	-			275			Sema.|Extracellular (Potential).		D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	37	c.825C>T	CCDS3875.1																																																																																				0.522	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2			22	45	0	0	0	0.00278032	0	22	45				
MARCH11	441061	broad.mit.edu	37	5	16067856	16067856	+	Silent	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:16067856G>T	ENST00000332432.8	-	4	1132	c.933C>A	c.(931-933)cgC>cgA	p.R311R		NM_001102562.1	NP_001096032.1	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11	311					protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)|urinary_tract(1)	20						CAGCTCGCCAGCGCTTAAACA	0.428																																							uc003jfo.2		NA																	0					0						c.(931-933)CGC>CGA		membrane-associated ring finger (C3HC4) 11							55.0	53.0	54.0					5																	16067856		1894	4133	6027	SO:0001819	synonymous_variant	441061					cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding	g.chr5:16067856G>T	BC150513	CCDS47192.1	5p15.1	2013-01-09			ENSG00000183654	ENSG00000183654		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	33609	protein-coding gene	gene with protein product		613338				17604280	Standard	NM_001102562		Approved	MARCH-XI	uc003jfo.2	A6NNE9	OTTHUMG00000161789	ENST00000332432.8:c.933C>A	5.37:g.16067856G>T			Somatic				MARCH11_uc010itw.1_Silent_p.R67R	p.R311R	NM_001102562	NP_001096032	WXS	Illumina HiSeq	Unspecified	A6NNE9	MARHB_HUMAN			4	1146	-			311					A7E2S6	Silent	SNP	ENST00000332432.8	37	c.933C>A	CCDS47192.1	.	.	.	.	.	.	.	.	.	.	G	9.821	1.185819	0.21870	.	.	ENSG00000183654	ENST00000507111	.	.	.	5.54	2.73	0.32206	.	.	.	.	.	T	0.51924	0.1703	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39663	-0.9603	4	.	.	.	-19.9747	4.7345	0.12981	0.2073:0.0:0.4177:0.375	.	.	.	.	M	51	.	.	L	-	1	2	MARCH11	16120856	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.820000	0.27323	0.352000	0.24053	0.655000	0.94253	CTG		0.428	MARCH11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000366096.2	NM_001102562		10	47	1	0	6.40141e-05	0.000978159	0.00020349	10	47				
CDH9	1007	broad.mit.edu	37	5	26881683	26881683	+	Silent	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:26881683A>T	ENST00000231021.4	-	12	2104	c.1932T>A	c.(1930-1932)ccT>ccA	p.P644P		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	644					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AAATTATCAGAGGTTCCTTTT	0.388																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	0				ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(1930-1932)CCT>CCA		cadherin 9, type 2 preproprotein							78.0	81.0	80.0					5																	26881683		2203	4300	6503	SO:0001819	synonymous_variant	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26881683A>T	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1932T>A	5.37:g.26881683A>T			Somatic				CDH9_uc011cnv.1_Silent_p.P237P	p.P644P	NM_016279	NP_057363	WXS	Illumina HiSeq	Unspecified	Q9ULB4	CADH9_HUMAN			12	2101	-			644			Cytoplasmic (Potential).		Q3B7I5	Silent	SNP	ENST00000231021.4	37	c.1932T>A	CCDS3893.1																																																																																				0.388	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		11	113	0	0	0	0.000978159	0	11	113				
ADAMTS12	81792	broad.mit.edu	37	5	33616098	33616098	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:33616098C>A	ENST00000504830.1	-	15	2558	c.2223G>T	c.(2221-2223)ctG>ctT	p.L741L	ADAMTS12_ENST00000352040.3_Silent_p.L656L|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	741	Spacer 1.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TCCTGATGGCCAGGAAGTTTC	0.438										HNSCC(64;0.19)																													uc003jia.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						c.(2221-2223)CTG>CTT		ADAM metallopeptidase with thrombospondin type 1							115.0	111.0	113.0					5																	33616098		2203	4300	6503	SO:0001819	synonymous_variant	81792				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:33616098C>A	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2223G>T	5.37:g.33616098C>A		HNSCC(64;0.19)	Somatic				ADAMTS12_uc010iuq.1_Silent_p.L656L	p.L741L	NM_030955	NP_112217	WXS	Illumina HiSeq	Unspecified	P58397	ATS12_HUMAN			15	2386	-			741			Spacer 1.		A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	37	c.2223G>T	CCDS34140.1																																																																																				0.438	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		11	74	1	0	7.03913e-09	0.00136819	2.75648e-08	11	74				
SKP2	6502	broad.mit.edu	37	5	36171762	36171762	+	Silent	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:36171762G>T	ENST00000274255.6	+	7	1024	c.828G>T	c.(826-828)gtG>gtT	p.V276V	SKP2_ENST00000274254.5_Silent_p.V276V|SKP2_ENST00000508514.1_Intron|SKP2_ENST00000546211.1_Silent_p.V62V	NM_005983.3	NP_005974.2	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2, E3 ubiquitin protein ligase	276					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|cellular response to cell-matrix adhesion (GO:0071460)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	identical protein binding (GO:0042802)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|ovary(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATGTACAGGTGGCTGTTGCGC	0.458																																							uc003jkc.1		NA																	0				central_nervous_system(2)|ovary(1)|breast(1)	4						c.(826-828)GTG>GTT		S-phase kinase-associated protein 2 isoform 1							189.0	180.0	183.0					5																	36171762		2203	4300	6503	SO:0001819	synonymous_variant	6502				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|G1/S transition of mitotic cell cycle|S phase of mitotic cell cycle	nucleoplasm|SCF ubiquitin ligase complex	protein binding	g.chr5:36171762G>T	U33761	CCDS3915.1, CCDS3916.1, CCDS58944.1	5p13	2012-02-23	2012-02-23		ENSG00000145604	ENSG00000145604		"""F-boxes / Leucine-rich repeats"""	10901	protein-coding gene	gene with protein product		601436	"""S-phase kinase-associated protein 2 (p45)"""			8646875	Standard	NM_005983		Approved	FBXL1, FBL1, p45	uc003jkc.2	Q13309	OTTHUMG00000131106	ENST00000274255.6:c.828G>T	5.37:g.36171762G>T			Somatic				SKP2_uc011cou.1_Silent_p.V62V|SKP2_uc003jkd.2_Silent_p.V276V	p.V276V	NM_005983	NP_005974	WXS	Illumina HiSeq	Unspecified	Q13309	SKP2_HUMAN	Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		7	1010	+	all_lung(31;5.63e-05)		276			LRR 6.		A8K5E0|B4DJT4|Q8TDZ0|Q8TDZ1|Q9BV69	Silent	SNP	ENST00000274255.6	37	c.828G>T	CCDS3916.1																																																																																				0.458	SKP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253769.2	NM_005983		83	140	1	0	4.47867e-22	0.00361006	2.19228e-21	83	140				
RANBP3L	202151	broad.mit.edu	37	5	36270074	36270074	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:36270074G>T	ENST00000296604.3	-	3	654	c.169C>A	c.(169-171)Ctg>Atg	p.L57M	RANBP3L_ENST00000515759.1_Missense_Mutation_p.L57M|RANBP3L_ENST00000502994.1_Missense_Mutation_p.L57M	NM_145000.3	NP_659437.3	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like	57					intracellular transport (GO:0046907)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	16	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			GCTTCATACAGGGTGTCTTCT	0.388																																							uc003jkh.2		NA																	0				ovary(1)	1						c.(169-171)CTG>ATG		RAN binding protein 3-like isoform 2							178.0	195.0	189.0					5																	36270074		2203	4300	6503	SO:0001583	missense	202151				intracellular transport			g.chr5:36270074G>T	BC047660	CCDS3918.1, CCDS54843.1	5p13.2	2008-02-05			ENSG00000164188	ENSG00000164188			26353	protein-coding gene	gene with protein product						12477932	Standard	NM_145000		Approved	FLJ25422	uc011cow.2	Q86VV4	OTTHUMG00000131110	ENST00000296604.3:c.169C>A	5.37:g.36270074G>T	ENSP00000296604:p.Leu57Met		Somatic				RANBP3L_uc011cow.1_Missense_Mutation_p.L57M	p.L57M	NM_145000	NP_659437	WXS	Illumina HiSeq	Unspecified	Q86VV4	RNB3L_HUMAN	Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)		3	662	-	all_lung(31;4.52e-05)		57					B7Z866|E9PGP9|Q96LK2	Missense_Mutation	SNP	ENST00000296604.3	37	c.169C>A	CCDS3918.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.813835	0.50527	.	.	ENSG00000164188	ENST00000296604;ENST00000502994;ENST00000515759;ENST00000505865	T;T;T;T	0.52526	1.72;1.7;1.72;0.66	5.61	-0.694	0.11294	.	0.638646	0.14552	N	0.312626	T	0.40956	0.1138	L	0.58101	1.795	0.09310	N	1	P;P	0.43578	0.811;0.771	P;B	0.46172	0.506;0.305	T	0.26155	-1.0111	10	0.36615	T	0.2	3.7838	1.3926	0.02253	0.3303:0.1343:0.3974:0.138	.	57;57	E9PGP9;Q86VV4	.;RNB3L_HUMAN	M	57	ENSP00000296604:L57M;ENSP00000421853:L57M;ENSP00000421149:L57M;ENSP00000427147:L57M	ENSP00000296604:L57M	L	-	1	2	RANBP3L	36305831	0.000000	0.05858	0.000000	0.03702	0.839000	0.47603	-0.107000	0.10873	-0.368000	0.08040	-0.263000	0.10527	CTG		0.388	RANBP3L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253773.2	NM_145000		69	183	1	0	1.25089e-41	0.00361006	6.45019e-41	69	183				
C7	730	broad.mit.edu	37	5	40947812	40947812	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:40947812C>T	ENST00000313164.9	+	8	1206	c.847C>T	c.(847-849)Ctc>Ttc	p.L283F		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	283	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				GCTTTCCCACCTCCCCTCTCT	0.448																																							uc003jmh.2		NA																	0					0						c.(847-849)CTC>TTC		complement component 7 precursor							85.0	82.0	83.0					5																	40947812		1849	4086	5935	SO:0001583	missense	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40947812C>T	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.847C>T	5.37:g.40947812C>T	ENSP00000322061:p.Leu283Phe		Somatic				C7_uc011cpn.1_Intron	p.L283F	NM_000587	NP_000578	WXS	Illumina HiSeq	Unspecified	P10643	CO7_HUMAN			8	961	+		Ovarian(839;0.0112)	283			MACPF.		Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	c.847C>T	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785469	0.90282	.	.	ENSG00000112936	ENST00000313164;ENST00000515157	D	0.91011	-2.77	5.9	5.9	0.94986	Membrane attack complex component/perforin (MACPF) domain (3);	0.000000	0.85682	D	0.000000	D	0.96084	0.8724	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96226	0.9164	10	0.87932	D	0	-24.4363	18.4666	0.90758	0.0:1.0:0.0:0.0	.	283	P10643	CO7_HUMAN	F	283	ENSP00000322061:L283F	ENSP00000322061:L283F	L	+	1	0	C7	40983569	0.999000	0.42202	0.994000	0.49952	0.992000	0.81027	4.556000	0.60775	2.786000	0.95864	0.650000	0.86243	CTC		0.448	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			18	31	0	0	0	0.00074312	0	18	31				
C7	730	broad.mit.edu	37	5	40958249	40958249	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:40958249C>T	ENST00000313164.9	+	11	1734	c.1375C>T	c.(1375-1377)Cct>Tct	p.P459S		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	459	EGF-like.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				TCATTGCCGGCCTTGTCAAAA	0.488																																							uc003jmh.2		NA																	0					0						c.(1375-1377)CCT>TCT		complement component 7 precursor							147.0	140.0	142.0					5																	40958249		1923	4126	6049	SO:0001583	missense	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40958249C>T	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1375C>T	5.37:g.40958249C>T	ENSP00000322061:p.Pro459Ser		Somatic				C7_uc011cpn.1_RNA	p.P459S	NM_000587	NP_000578	WXS	Illumina HiSeq	Unspecified	P10643	CO7_HUMAN			11	1489	+		Ovarian(839;0.0112)	459			EGF-like.		Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	c.1375C>T	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	C	33	5.244970	0.95272	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	T	0.68624	-0.34	5.87	5.87	0.94306	.	0.126977	0.56097	D	0.000038	D	0.83811	0.5335	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83937	0.0309	10	0.56958	D	0.05	-17.3482	20.2192	0.98319	0.0:1.0:0.0:0.0	.	459	P10643	CO7_HUMAN	S	459;299	ENSP00000322061:P459S	ENSP00000322061:P459S	P	+	1	0	C7	40994006	1.000000	0.71417	0.974000	0.42286	0.958000	0.62258	7.412000	0.80091	2.780000	0.95670	0.655000	0.94253	CCT		0.488	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			15	58	0	0	0	0.00244969	0	15	58				
MROH2B	133558	broad.mit.edu	37	5	41004995	41004995	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:41004995G>T	ENST00000399564.4	-	36	4342	c.3892C>A	c.(3892-3894)Cat>Aat	p.H1298N	MROH2B_ENST00000506092.2_Missense_Mutation_p.H853N	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1298																	AGATTCCCATGCTTCCAAAGG	0.527																																							uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(3892-3894)CAT>AAT		HEAT repeat family member 7B2							90.0	87.0	88.0					5																	41004995		1992	4166	6158	SO:0001583	missense	133558						binding	g.chr5:41004995G>T		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3892C>A	5.37:g.41004995G>T	ENSP00000382476:p.His1298Asn		Somatic				HEATR7B2_uc003jmi.3_Missense_Mutation_p.H853N	p.H1298N	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			36	4382	-			1298					Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	c.3892C>A	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315079	0.40996	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.63744	-0.06;-0.06	6.0	6.0	0.97389	Armadillo-type fold (1);	0.314345	0.28088	N	0.016655	T	0.58264	0.2110	L	0.44542	1.39	0.33686	D	0.612724	B	0.33637	0.42	B	0.39119	0.291	T	0.62553	-0.6830	10	0.17832	T	0.49	.	16.0001	0.80288	0.0:0.0:1.0:0.0	.	1298	Q7Z745	HTRB2_HUMAN	N	853;1003;1298	ENSP00000441504:H853N;ENSP00000382476:H1298N	ENSP00000296803:H1003N	H	-	1	0	HEATR7B2	41040752	1.000000	0.71417	0.993000	0.49108	0.666000	0.39218	3.178000	0.50879	2.856000	0.98102	0.643000	0.83706	CAT		0.527	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		7	25	1	0	0.000274275	0.00448238	0.00083082	7	25				
ITGA2	3673	broad.mit.edu	37	5	52371050	52371050	+	Splice_Site	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:52371050G>T	ENST00000296585.5	+	23	2884		c.e23-1			NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TCTTTCTATAGTGAAAGCCAA	0.353																																							uc003joy.2		NA																	0				lung(1)	1						c.e23-1		integrin alpha 2 precursor							66.0	70.0	68.0					5																	52371050		2203	4300	6503	SO:0001630	splice_region_variant	3673				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity	g.chr5:52371050G>T		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2742-1G>T	5.37:g.52371050G>T			Somatic				ITGA2_uc011cqa.1_Splice_Site|ITGA2_uc011cqb.1_Splice_Site|ITGA2_uc011cqc.1_Splice_Site_p.S838_splice|ITGA2_uc011cqd.1_Splice_Site|ITGA2_uc011cqe.1_Splice_Site	p.S914_splice	NM_002203	NP_002194	WXS	Illumina HiSeq	Unspecified	P17301	ITA2_HUMAN			23	2885	+		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)						Q14595	Splice_Site	SNP	ENST00000296585.5	37	c.2742_splice	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717625	0.68844	.	.	ENSG00000164171	ENST00000296585	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGA2	52406807	1.000000	0.71417	0.967000	0.41034	0.579000	0.36224	8.650000	0.91073	2.937000	0.99478	0.650000	0.86243	.		0.353	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	Intron	18	43	1	0	2.35188e-11	0.00074312	1.0087e-10	18	43				
SKIV2L2	23517	broad.mit.edu	37	5	54674315	54674315	+	Splice_Site	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:54674315G>T	ENST00000230640.5	+	17	2237		c.e17+1		SKIV2L2_ENST00000545714.1_Splice_Site	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)						maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TTTGGTAAAGGTATGTCATTG	0.274																																					Melanoma(2;92 134 23744 29976 33782)	Melanoma(2;92 134 23744 29976 33782)	uc003jpy.3		NA																	0				ovary(1)|skin(1)	2						c.e17+1		superkiller viralicidic activity 2-like 2							44.0	46.0	45.0					5																	54674315		2202	4295	6497	SO:0001630	splice_region_variant	23517				maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr5:54674315G>T	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.1983+1G>T	5.37:g.54674315G>T			Somatic				SKIV2L2_uc011cqi.1_Splice_Site_p.K560_splice	p.K661_splice	NM_015360	NP_056175	WXS	Illumina HiSeq	Unspecified	P42285	SK2L2_HUMAN			17	2249	+		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)						Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Splice_Site	SNP	ENST00000230640.5	37	c.1983_splice	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781217	0.90282	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9159	0.97061	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SKIV2L2	54710072	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.402000	0.97298	2.700000	0.92200	0.655000	0.94253	.		0.274	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		Intron	7	34	1	0	8.12818e-05	0.00198382	0.000254784	7	34				
VCAN	1462	broad.mit.edu	37	5	82836404	82836404	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:82836404G>C	ENST00000265077.3	+	8	8147	c.7582G>C	c.(7582-7584)Gag>Cag	p.E2528Q	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.E1541Q|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000512090.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2528	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CAGGGAATTCGAGGATTCCAC	0.408																																							uc003kii.3		NA																	0				ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16						c.(7582-7584)GAG>CAG		versican isoform 1 precursor							50.0	51.0	51.0					5																	82836404		2203	4300	6503	SO:0001583	missense	1462				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr5:82836404G>C	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7582G>C	5.37:g.82836404G>C	ENSP00000265077:p.Glu2528Gln		Somatic				VCAN_uc003kij.3_Missense_Mutation_p.E1541Q|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Missense_Mutation_p.E1192Q	p.E2528Q	NM_004385	NP_004376	WXS	Illumina HiSeq	Unspecified	P13611	CSPG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	8	7938	+		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)	2528			GAG-beta.		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	c.7582G>C	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	9.486	1.099330	0.20552	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.39787	1.06;1.06	5.91	1.14	0.20703	.	0.635877	0.15457	N	0.261324	T	0.48660	0.1512	L	0.59436	1.845	0.09310	N	1	D;D	0.62365	0.991;0.984	P;P	0.55615	0.78;0.607	T	0.37056	-0.9722	10	0.40728	T	0.16	.	9.1121	0.36734	0.3451:0.0:0.6549:0.0	.	1541;2528	P13611-2;P13611	.;CSPG2_HUMAN	Q	2528;1541	ENSP00000265077:E2528Q;ENSP00000340062:E1541Q	ENSP00000265077:E2528Q	E	+	1	0	VCAN	82872160	0.052000	0.20516	0.002000	0.10522	0.443000	0.32047	0.366000	0.20365	-0.075000	0.12798	0.655000	0.94253	GAG		0.408	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		12	50	0	0	0	0.000978159	0	12	50				
FBXL17	64839	broad.mit.edu	37	5	107559923	107559923	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:107559923C>A	ENST00000542267.1	-	5	1919	c.1513G>T	c.(1513-1515)Gat>Tat	p.D505Y	FBXL17_ENST00000496714.1_Missense_Mutation_p.D107Y|FBXL17_ENST00000359660.5_Missense_Mutation_p.D107Y	NM_001163315.2	NP_001156787.2	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17	505										endometrium(1)|large_intestine(4)|lung(1)	6		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		ACTGACTGATCTGTCACCTAG	0.433																																							uc011cvc.1		NA																	0					0						c.(1513-1515)GAT>TAT		F-box and leucine-rich repeat protein 17							92.0	83.0	86.0					5																	107559923		2202	4300	6502	SO:0001583	missense	64839							g.chr5:107559923C>A	AL133602	CCDS54886.1	5q21.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000145743	ENSG00000145743		"""F-boxes / Leucine-rich repeats"""	13615	protein-coding gene	gene with protein product		609083	"""F-box only protein 13"""	FBXO13			Standard	NM_001163315		Approved	DKFZP434C1715, Fbx13, Fbl17	uc011cvc.2	Q9UF56	OTTHUMG00000159785	ENST00000542267.1:c.1513G>T	5.37:g.107559923C>A	ENSP00000437464:p.Asp505Tyr		Somatic				FBXL17_uc003kon.3_Missense_Mutation_p.D107Y	p.D505Y	NM_001163315	NP_001156787	WXS	Illumina HiSeq	Unspecified	Q9UF56	FXL17_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)	5	1920	-		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)	505					A1A4E3	Missense_Mutation	SNP	ENST00000542267.1	37	c.1513G>T	CCDS54886.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.427510	0.83667	.	.	ENSG00000145743	ENST00000359660;ENST00000542267;ENST00000496714	T;T;T	0.19938	2.11;2.55;2.11	5.47	5.47	0.80525	.	0.298932	0.36665	N	0.002473	T	0.51007	0.1649	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.54036	-0.8353	10	0.87932	D	0	.	19.3264	0.94264	0.0:1.0:0.0:0.0	.	505;107	Q9UF56;Q9UF56-2	FXL17_HUMAN;.	Y	107;505;107	ENSP00000352683:D107Y;ENSP00000437464:D505Y;ENSP00000418111:D107Y	ENSP00000352683:D107Y	D	-	1	0	FBXL17	107587822	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.201000	0.77847	2.586000	0.87340	0.591000	0.81541	GAT		0.433	FBXL17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				16	28	1	0	2.32078e-09	0.00316338	9.19466e-09	16	28				
CAMK4	814	broad.mit.edu	37	5	110814169	110814169	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:110814169C>A	ENST00000282356.4	+	9	1190	c.792C>A	c.(790-792)ccC>ccA	p.P264P	CAMK4_ENST00000512453.1_Silent_p.P264P	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	264	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TTATCTCCCCCTGGTGGGATG	0.333																																							uc011cvj.1		NA																	0				ovary(3)|lung(2)	5						c.(790-792)CCC>CCA		calcium/calmodulin-dependent protein kinase IV							74.0	78.0	76.0					5																	110814169		2202	4299	6501	SO:0001819	synonymous_variant	814				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr5:110814169C>A	D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.792C>A	5.37:g.110814169C>A			Somatic				CAMK4_uc003kpf.2_Silent_p.P264P|CAMK4_uc010jbv.2_Silent_p.P67P	p.P264P	NM_001744	NP_001735	WXS	Illumina HiSeq	Unspecified	Q16566	KCC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)	10	891	+		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)	264			Protein kinase.		D3DSZ7	Silent	SNP	ENST00000282356.4	37	c.792C>A	CCDS4103.1																																																																																				0.333	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744		30	69	1	0	2.85442e-18	0.00209593	1.35309e-17	30	69				
YTHDC2	64848	broad.mit.edu	37	5	112849603	112849603	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:112849603C>G	ENST00000161863.4	+	1	224	c.11C>G	c.(10-12)cCg>cGg	p.P4R	YTHDC2_ENST00000515883.1_Missense_Mutation_p.P4R	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	4					ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		ATGTCCAGGCCGAGCAGCGTC	0.716																																							uc003kqn.2		NA																	0				skin(2)|central_nervous_system(1)	3						c.(10-12)CCG>CGG		YTH domain containing 2							6.0	7.0	7.0					5																	112849603		2112	4130	6242	SO:0001583	missense	64848						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr5:112849603C>G	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.11C>G	5.37:g.112849603C>G	ENSP00000161863:p.Pro4Arg		Somatic				YTHDC2_uc010jce.1_Missense_Mutation_p.P4R|YTHDC2_uc010jcf.1_5'UTR	p.P4R	NM_022828	NP_073739	WXS	Illumina HiSeq	Unspecified	Q9H6S0	YTDC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)	1	194	+		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)	4					B2RP66	Missense_Mutation	SNP	ENST00000161863.4	37	c.11C>G	CCDS4113.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444521	0.63178	.	.	ENSG00000047188	ENST00000161863;ENST00000515883	T;T	0.08370	4.09;3.1	4.6	4.6	0.57074	.	0.156285	0.29444	N	0.012136	T	0.07458	0.0188	N	0.19112	0.55	0.39635	D	0.970232	B	0.20368	0.044	B	0.19148	0.024	T	0.22591	-1.0212	10	0.87932	D	0	.	15.5455	0.76097	0.0:1.0:0.0:0.0	.	4	Q9H6S0	YTDC2_HUMAN	R	4	ENSP00000161863:P4R;ENSP00000423101:P4R	ENSP00000161863:P4R	P	+	2	0	YTHDC2	112877502	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.538000	0.60650	2.258000	0.74832	0.561000	0.74099	CCG		0.716	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828		5	8	0	0	0	0.00116845	0	5	8				
CSNK1G3	1456	broad.mit.edu	37	5	122927092	122927092	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:122927092A>T	ENST00000361991.2	+	9	1100	c.1070A>T	c.(1069-1071)cAa>cTa	p.Q357L	CSNK1G3_ENST00000360683.2_Missense_Mutation_p.Q357L|CSNK1G3_ENST00000521364.1_Missense_Mutation_p.Q357L|CSNK1G3_ENST00000511130.2_Missense_Mutation_p.Q245L|CSNK1G3_ENST00000395411.1_Missense_Mutation_p.Q357L|CSNK1G3_ENST00000395412.1_Missense_Mutation_p.Q357L|CSNK1G3_ENST00000512718.3_Missense_Mutation_p.Q282L|CSNK1G3_ENST00000510842.2_Missense_Mutation_p.Q358L|CSNK1G3_ENST00000345990.4_Missense_Mutation_p.Q357L			Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3	357					cellular protein modification process (GO:0006464)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(1)	15		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		GATAAGATGCAACAATCCAAA	0.383																																					Pancreas(187;2868 2964 4353 6297)	Pancreas(187;2868 2964 4353 6297)	uc003ktm.2		NA																	0					0						c.(1069-1071)CAA>CTA		casein kinase 1, gamma 3 isoform 1							103.0	89.0	94.0					5																	122927092		2203	4300	6503	SO:0001583	missense	1456				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr5:122927092A>T	AF049090	CCDS4135.1, CCDS34218.1, CCDS43355.1, CCDS59491.1, CCDS59492.1, CCDS59493.1	5q23	2013-01-17			ENSG00000151292	ENSG00000151292			2456	protein-coding gene	gene with protein product		604253				9925945	Standard	NM_004384		Approved		uc031skv.1	Q9Y6M4	OTTHUMG00000128923	ENST00000361991.2:c.1070A>T	5.37:g.122927092A>T	ENSP00000354942:p.Gln357Leu		Somatic				CSNK1G3_uc003ktl.2_Missense_Mutation_p.Q357L|CSNK1G3_uc003ktn.2_Missense_Mutation_p.Q357L|CSNK1G3_uc003kto.2_Missense_Mutation_p.Q357L|CSNK1G3_uc011cwr.1_Missense_Mutation_p.Q282L|CSNK1G3_uc011cws.1_Missense_Mutation_p.Q245L|CSNK1G3_uc010jda.2_Missense_Mutation_p.Q358L	p.Q357L	NM_004384	NP_004375	WXS	Illumina HiSeq	Unspecified	Q9Y6M4	KC1G3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)	10	1789	+		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	357					A8K040|B4DSH2|B7Z9Q4|E7EVD0|Q86WZ7|Q9Y6M3	Missense_Mutation	SNP	ENST00000361991.2	37	c.1070A>T	CCDS4135.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.59|10.59	1.391870|1.391870	0.25118|0.25118	.|.	.|.	ENSG00000151292|ENSG00000151292	ENST00000515322|ENST00000395412;ENST00000395411;ENST00000345990;ENST00000511130;ENST00000512718;ENST00000521364;ENST00000510842;ENST00000361991;ENST00000360683	.|T;T;T;T;T;T;T;T;T	.|0.52526	.|0.71;0.71;0.69;1.18;1.04;0.69;0.66;0.71;0.71	4.12|4.12	2.92|2.92	0.33932|0.33932	.|Casein kinase 1 gamma C-terminal (1);	.|1.351710	.|0.04890	.|N	.|0.449351	T|T	0.42223|0.42223	0.1193|0.1193	L|L	0.38175|0.38175	1.15|1.15	0.42799|0.42799	D|D	0.993923|0.993923	.|B;B;B;B;B;B	.|0.06786	.|0.001;0.0;0.0;0.0;0.001;0.0	.|B;B;B;B;B;B	.|0.12837	.|0.005;0.005;0.002;0.001;0.008;0.003	T|T	0.05716|0.05716	-1.0868|-1.0868	5|10	.|0.34782	.|T	.|0.22	.|.	11.0418|11.0418	0.47835|0.47835	0.8437:0.1563:0.0:0.0|0.8437:0.1563:0.0:0.0	.|.	.|282;358;245;357;357;357	.|B4DSH2;A8K040;E7EVD0;Q9Y6M4-3;Q9Y6M4;Q9Y6M4-2	.|.;.;.;.;KC1G3_HUMAN;.	Y|L	106|357;357;357;245;282;357;358;357;357	.|ENSP00000378807:Q357L;ENSP00000378806:Q357L;ENSP00000334735:Q357L;ENSP00000421385:Q245L;ENSP00000421998:Q282L;ENSP00000429412:Q357L;ENSP00000423838:Q358L;ENSP00000354942:Q357L;ENSP00000353904:Q357L	.|ENSP00000334735:Q357L	N|Q	+|+	1|2	0|0	CSNK1G3|CSNK1G3	122954991|122954991	0.991000|0.991000	0.36638|0.36638	0.999000|0.999000	0.59377|0.59377	0.954000|0.954000	0.61252|0.61252	3.063000|3.063000	0.49978|0.49978	0.878000|0.878000	0.35920|0.35920	0.528000|0.528000	0.53228|0.53228	AAC|CAA		0.383	CSNK1G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250900.1	NM_004384		7	32	0	0	0	0.00307968	0	7	32				
ADAMTS19	171019	broad.mit.edu	37	5	128958013	128958013	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:128958013C>A	ENST00000274487.4	+	10	1869	c.1724C>A	c.(1723-1725)cCa>cAa	p.P575Q	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	575	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CTTTTTGGGCCATTGGCTTCT	0.443																																							uc003kvb.1		NA																	0				ovary(5)|breast(2)|lung(1)|skin(1)	9						c.(1723-1725)CCA>CAA		ADAM metallopeptidase with thrombospondin type 1							142.0	121.0	128.0					5																	128958013		2203	4300	6503	SO:0001583	missense	171019				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:128958013C>A	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1724C>A	5.37:g.128958013C>A	ENSP00000274487:p.Pro575Gln		Somatic				ADAMTS19_uc010jdh.1_RNA	p.P575Q	NM_133638	NP_598377	WXS	Illumina HiSeq	Unspecified	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)	10	1724	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	575			Disintegrin.			Missense_Mutation	SNP	ENST00000274487.4	37	c.1724C>A	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.035232	0.35893	.	.	ENSG00000145808	ENST00000274487	T	0.65364	-0.15	4.42	3.55	0.40652	.	0.078553	0.51477	D	0.000090	T	0.68284	0.2984	L	0.47078	1.49	0.47862	D	0.99953	D	0.69078	0.997	P	0.59221	0.854	T	0.68481	-0.5397	9	.	.	.	.	14.8773	0.70504	0.1449:0.8551:0.0:0.0	.	575	Q8TE59	ATS19_HUMAN	Q	575	ENSP00000274487:P575Q	.	P	+	2	0	ADAMTS19	128985912	0.994000	0.37717	0.890000	0.34922	0.299000	0.27559	3.939000	0.56591	1.452000	0.47756	-0.238000	0.12139	CCA		0.443	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638		10	35	1	0	5.50884e-06	0.00136819	1.84676e-05	10	35				
SKP1	6500	broad.mit.edu	37	5	133509710	133509710	+	Missense_Mutation	SNP	G	G	A	rs201893651		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:133509710G>A	ENST00000353411.6	-	2	187	c.4C>T	c.(4-6)Cct>Tct	p.P2S	CTD-2410N18.5_ENST00000519718.1_Missense_Mutation_p.P36S|SKP1_ENST00000521216.1_Missense_Mutation_p.P2S|SKP1_ENST00000522855.1_Missense_Mutation_p.P2S|SKP1_ENST00000522552.1_Missense_Mutation_p.P2S|SKP1_ENST00000517625.1_Missense_Mutation_p.P2S	NM_170679.2	NP_733779.1	P63208	SKP1_HUMAN	S-phase kinase-associated protein 1	2					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H2A monoubiquitination (GO:0035518)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	Cul7-RING ubiquitin ligase complex (GO:0031467)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTAATTGAAGGCATCTAAAAA	0.338																																							uc003kzc.3		NA																	0					0						c.(4-6)CCT>TCT		S-phase kinase-associated protein 1 isoform b							55.0	49.0	51.0					5																	133509710		2203	4300	6503	SO:0001583	missense	6500				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|G1/S transition of mitotic cell cycle|histone H2A monoubiquitination|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|viral reproduction	cytosol|nucleoplasm|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr5:133509710G>A	U33760	CCDS4171.1, CCDS4172.1	5q31	2011-11-18	2007-11-13	2007-11-13	ENSG00000113558	ENSG00000113558			10899	protein-coding gene	gene with protein product		601434	"""S-phase kinase-associated protein 1A (p19A)"""	SKP1A		7553852, 8646875	Standard	NM_006930		Approved	EMC19, OCP2, TCEB1L, MGC34403, OCP-II, p19A	uc003kzc.4	P63208	OTTHUMG00000129117	ENST00000353411.6:c.4C>T	5.37:g.133509710G>A	ENSP00000231487:p.Pro2Ser		Somatic				SKP1_uc003kzd.3_Missense_Mutation_p.P2S|SKP1_uc010jdv.2_Missense_Mutation_p.P2S	p.P2S	NM_170679	NP_733779	WXS	Illumina HiSeq	Unspecified	P63208	SKP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		2	183	-			2					D3DQ97|D3DQ98|P34991|Q8TAY2	Missense_Mutation	SNP	ENST00000353411.6	37	c.4C>T	CCDS4171.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750433	0.69533	.	.	ENSG00000113558	ENST00000353411;ENST00000522552;ENST00000521216;ENST00000517625;ENST00000522855;ENST00000328392;ENST00000519321;ENST00000520417;ENST00000519718;ENST00000523359	T;T;T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.73	5.73	0.89815	BTB/POZ fold (2);SKP1 component, POZ (1);	0.000000	0.85682	U	0.000000	T	0.54013	0.1832	L	0.33624	1.015	0.80722	D	1	P;B;D	0.62365	0.912;0.141;0.991	P;B;D	0.68765	0.665;0.028;0.96	T	0.40213	-0.9575	10	0.26408	T	0.33	-1.7186	19.4877	0.95037	0.0:0.0:1.0:0.0	.	2;2;2	E5RJR5;P63208-2;P63208	.;.;SKP1_HUMAN	S	2;2;2;2;2;2;2;2;36;2	ENSP00000231487:P2S;ENSP00000429472:P2S;ENSP00000431067:P2S;ENSP00000429961:P2S;ENSP00000429686:P2S;ENSP00000331708:P2S;ENSP00000429415:P2S;ENSP00000429996:P2S;ENSP00000430774:P36S;ENSP00000428962:P2S	ENSP00000331708:P2S	P	-	1	0	SKP1	133537609	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.893000	0.92498	2.709000	0.92574	0.563000	0.77884	CCT		0.338	SKP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251162.2	NM_170679		13	42	0	0	0	0.00136819	0	13	42				
PCDHA4	56144	broad.mit.edu	37	5	140189029	140189029	+	Nonsense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:140189029C>T	ENST00000530339.1	+	1	2257	c.2257C>T	c.(2257-2259)Cag>Tag	p.Q753*	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Nonsense_Mutation_p.Q753*|PCDHA4_ENST00000356878.4_Nonsense_Mutation_p.Q753*|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	753	6 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATACTCGCAGCAGAGGAGGCC	0.667																																							uc003lhi.2		NA																	0				ovary(4)|skin(2)	6						c.(2257-2259)CAG>TAG		protocadherin alpha 4 isoform 1 precursor							79.0	81.0	81.0					5																	140189029		2203	4300	6503	SO:0001587	stop_gained	56144				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140189029C>T	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.2257C>T	5.37:g.140189029C>T	ENSP00000435300:p.Gln753*		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Nonsense_Mutation_p.Q753*|PCDHA4_uc011daa.1_Nonsense_Mutation_p.Q753*	p.Q753*	NM_018907	NP_061730	WXS	Illumina HiSeq	Unspecified	Q9UN74	PCDA4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2358	+			753			Cytoplasmic (Potential).|6 X 4 AA repeats of P-X-X-P.		O75285|Q2M253	Nonsense_Mutation	SNP	ENST00000530339.1	37	c.2257C>T	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	c	26.6	4.755882	0.89843	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	.	.	.	3.83	2.93	0.34026	.	0.000000	0.38720	U	0.001595	.	.	.	.	.	.	0.58432	D	0.99999	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	11.819	0.52228	0.0:0.8226:0.1774:0.0	.	.	.	.	X	753	.	ENSP00000349344:Q753X	Q	+	1	0	PCDHA4	140169213	0.000000	0.05858	0.429000	0.26710	0.742000	0.42306	0.720000	0.25896	0.718000	0.32166	0.484000	0.47621	CAG		0.667	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907		12	34	0	0	0	0.00136819	0	12	34				
PCDHB18	54660	broad.mit.edu	37	5	140615563	140615563	+	RNA	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:140615563C>A	ENST00000526308.1	+	0	1626					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						CAGACAGAGACTCAGGCACCA	0.652																																							uc003ljc.1		NA																	0				ovary(1)	1						c.(1276-1278)GAC>GAA		SubName: Full=Similar to protocadherin-3 (Pcdh3);																																						54660							g.chr5:140615563C>A	AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615563C>A			Somatic					p.D426E	NR_001281		WXS	Illumina HiSeq	Unspecified					1	1626	+								B3KTF8	Missense_Mutation	SNP	ENST00000526308.1	37	c.1278C>A																																																																																					0.652	PCDHB18-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000394776.1			35	88	1	0	5.91797e-21	0.0024448	2.87596e-20	35	88				
PCDHGA3	56112	broad.mit.edu	37	5	140725926	140725926	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:140725926G>A	ENST00000253812.6	+	1	2326	c.2326G>A	c.(2326-2328)Gcg>Acg	p.A776T	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	776					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCAACTATGCGGACACGCT	0.547																																							uc003ljm.1		NA																	0				breast(1)	1						c.(2326-2328)GCG>ACG		protocadherin gamma subfamily A, 3 isoform 1							75.0	83.0	80.0					5																	140725926		2202	4300	6502	SO:0001583	missense	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140725926G>A	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.2326G>A	5.37:g.140725926G>A	ENSP00000253812:p.Ala776Thr		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Missense_Mutation_p.A536T|PCDHGA3_uc011dap.1_Missense_Mutation_p.A776T	p.A776T	NM_018916	NP_061739	WXS	Illumina HiSeq	Unspecified	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2326	+			776			Cytoplasmic (Potential).		Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	c.2326G>A	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	11.82	1.754082	0.31046	.	.	ENSG00000254245	ENST00000253812	T	0.47177	0.85	5.24	4.31	0.51392	.	.	.	.	.	T	0.47414	0.1444	M	0.71036	2.16	0.09310	N	1	B;B	0.27416	0.035;0.178	B;B	0.34093	0.068;0.175	T	0.34576	-0.9823	9	0.27785	T	0.31	.	7.9487	0.30001	0.0808:0.0:0.6731:0.2461	.	776;776	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	T	776	ENSP00000253812:A776T	ENSP00000253812:A776T	A	+	1	0	PCDHGA3	140706110	0.153000	0.22777	0.024000	0.17045	0.740000	0.42216	1.371000	0.34250	2.598000	0.87819	0.563000	0.77884	GCG		0.547	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		25	69	0	0	0	0.00127121	0	25	69				
ABLIM3	22885	broad.mit.edu	37	5	148626046	148626046	+	Splice_Site	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:148626046G>T	ENST00000506113.1	+	16	1970	c.1488G>T	c.(1486-1488)gtG>gtT	p.V496V	ABLIM3_ENST00000326685.7_Splice_Site_p.V401V|RP11-331K21.1_ENST00000522685.1_RNA|AC012613.2_ENST00000523176.1_RNA|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000356541.3_Splice_Site_p.V385V|ABLIM3_ENST00000508983.1_Splice_Site_p.V463V|ABLIM3_ENST00000309868.7_Splice_Site_p.V496V|ABLIM3_ENST00000517451.1_5'UTR|ABLIM3_ENST00000504238.1_Splice_Site_p.V385V			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	496					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTGACAGTGCCCCGAGCCA	0.473																																							uc003lpy.2		NA																	0				ovary(2)|skin(1)	3						c.(1486-1488)GTG>GTT		actin binding LIM protein family, member 3							90.0	82.0	84.0					5																	148626046		2203	4300	6503	SO:0001630	splice_region_variant	22885				axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding	g.chr5:148626046G>T	AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.1487-1G>T	5.37:g.148626046G>T			Somatic				ABLIM3_uc003lpz.1_Silent_p.V496V|ABLIM3_uc003lqa.1_Silent_p.V393V|ABLIM3_uc003lqb.2_Silent_p.V385V|ABLIM3_uc003lqc.1_Silent_p.V463V|ABLIM3_uc003lqd.1_Silent_p.V401V|ABLIM3_uc003lqf.2_Silent_p.V385V|ABLIM3_uc003lqe.1_Silent_p.V385V	p.V496V	NM_014945	NP_055760	WXS	Illumina HiSeq	Unspecified	O94929	ABLM3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		17	1739	+			496					A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Silent	SNP	ENST00000506113.1	37	c.1488G>T	CCDS4294.1																																																																																				0.473	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373435.1	NM_014945	Silent	11	22	1	0	6.40141e-05	0.000978159	0.00020349	11	22				
SLC36A1	206358	broad.mit.edu	37	5	150858985	150858985	+	Missense_Mutation	SNP	G	G	T	rs555693703		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr5:150858985G>T	ENST00000243389.3	+	10	1317	c.1094G>T	c.(1093-1095)cGa>cTa	p.R365L	SLC36A1_ENST00000520701.1_Missense_Mutation_p.R365L|SLC36A1_ENST00000521925.1_Missense_Mutation_p.R365L|RNA5SP197_ENST00000363357.1_RNA	NM_078483.2	NP_510968.2	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 1	365					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen ion transmembrane transporter activity (GO:0015078)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)|symporter activity (GO:0015293)			endometrium(5)|kidney(9)|lung(8)|skin(2)|urinary_tract(1)	25		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Acamprosate(DB00659)|Glycine(DB00145)|Hydroxyproline(DB08847)|L-Alanine(DB00160)|Spaglumic Acid(DB08835)|Vigabatrin(DB01080)	TTTGTGTCCCGAGCGCCCGAG	0.507																																					Melanoma(151;1534 1860 12947 32979 37872)	Melanoma(151;1534 1860 12947 32979 37872)	uc003luc.2		NA																	0				skin(1)	1						c.(1093-1095)CGA>CTA		solute carrier family 36 member 1	Glycine(DB00145)|L-Alanine(DB00160)						156.0	133.0	141.0					5																	150858985		2203	4300	6503	SO:0001583	missense	206358				cellular nitrogen compound metabolic process|ion transport	endoplasmic reticulum|integral to membrane|lysosomal membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity	g.chr5:150858985G>T	AK057340	CCDS4316.1	5q33.1	2013-05-22			ENSG00000123643	ENSG00000123643		"""Solute carriers"""	18761	protein-coding gene	gene with protein product		606561				11959859, 11390972	Standard	NM_078483		Approved	LYAAT-1, PAT1, TRAMD3	uc003luc.3	Q7Z2H8	OTTHUMG00000130125	ENST00000243389.3:c.1094G>T	5.37:g.150858985G>T	ENSP00000243389:p.Arg365Leu		Somatic				GM2A_uc011dcs.1_Intron|SLC36A1_uc003lub.1_Missense_Mutation_p.R365L|SLC36A1_uc010jhw.1_Missense_Mutation_p.R365L	p.R365L	NM_078483	NP_510968	WXS	Illumina HiSeq	Unspecified	Q7Z2H8	S36A1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		10	1311	+		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	365			Cytoplasmic (Potential).		C9JI34|Q1LZ56|Q7Z7C0|Q86YK4|Q96M74	Missense_Mutation	SNP	ENST00000243389.3	37	c.1094G>T	CCDS4316.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.661467	0.67700	.	.	ENSG00000123643	ENST00000520701;ENST00000243389;ENST00000456739;ENST00000521925;ENST00000517628	T;T;T;T	0.02369	4.32;4.32;4.32;4.32	5.77	4.9	0.64082	.	0.232424	0.44688	D	0.000429	T	0.11452	0.0279	M	0.79123	2.44	0.46356	D	0.999003	D;P	0.58620	0.983;0.897	P;P	0.62649	0.905;0.73	T	0.01998	-1.1232	10	0.37606	T	0.19	.	9.1268	0.36821	0.2171:0.0:0.7829:0.0	.	365;365	E7EW39;Q7Z2H8	.;S36A1_HUMAN	L	365;365;365;365;124	ENSP00000428140:R365L;ENSP00000243389:R365L;ENSP00000430305:R365L;ENSP00000428738:R124L	ENSP00000243389:R365L	R	+	2	0	SLC36A1	150839178	0.976000	0.34144	0.804000	0.32291	0.404000	0.30871	3.215000	0.51169	1.435000	0.47434	0.561000	0.74099	CGA		0.507	SLC36A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252433.1	NM_078483		9	40	1	0	1.58986e-06	0.000673444	5.52161e-06	9	40				
DEK	7913	broad.mit.edu	37	6	18258558	18258558	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:18258558C>G	ENST00000397239.3	-	3	671	c.224G>C	c.(223-225)aGa>aCa	p.R75T	DEK_ENST00000244776.7_Intron	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	75					chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			AAATGGCTCTCTCTGTAAGGA	0.353			T	NUP214	AML																																		uc003ncr.1		NA		Dom	yes		6	6p23	7913	T	DEK oncogene (DNA binding)			L	NUP214		AML		0				kidney(1)	1						c.(223-225)AGA>ACA		DEK oncogene isoform 1							141.0	133.0	135.0					6																	18258558		2203	4300	6503	SO:0001583	missense	7913				chromatin modification|regulation of transcription from RNA polymerase II promoter|signal transduction|transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|histone binding	g.chr6:18258558C>G	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.224G>C	6.37:g.18258558C>G	ENSP00000380414:p.Arg75Thr		Somatic				DEK_uc011djf.1_Intron|DEK_uc011djg.1_Intron	p.R75T	NM_003472	NP_003463	WXS	Illumina HiSeq	Unspecified	P35659	DEK_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)		3	417	-	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	75					B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	37	c.224G>C	CCDS34344.1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.794398	0.70452	.	.	ENSG00000124795	ENST00000397239;ENST00000503715;ENST00000515742	T;T;T	0.49139	0.99;0.79;0.92	5.84	4.97	0.65823	.	0.131946	0.64402	D	0.000002	T	0.13114	0.0318	N	0.14661	0.345	0.80722	D	1	B	0.23058	0.079	B	0.18263	0.021	T	0.08086	-1.0739	10	0.29301	T	0.29	-10.5305	7.6594	0.28394	0.0:0.7786:0.0:0.2214	.	75	P35659	DEK_HUMAN	T	75;8;80	ENSP00000380414:R75T;ENSP00000425399:R8T;ENSP00000423553:R80T	ENSP00000380414:R75T	R	-	2	0	DEK	18366537	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.188000	0.32102	1.452000	0.47756	0.591000	0.81541	AGA		0.353	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039962.4			12	93	0	0	0	0.00136819	0	12	93				
TNXB	7148	broad.mit.edu	37	6	32036389	32036389	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:32036389G>A	ENST00000375244.3	-	17	6199	c.5998C>T	c.(5998-6000)Cct>Tct	p.P2000S	TNXB_ENST00000375247.2_Missense_Mutation_p.P2000S			P22105	TENX_HUMAN	tenascin XB	2082	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AGGGAGTCAGGGGTGGCATCT	0.632																																							uc003nzl.2		NA																	0					0						c.(5998-6000)CCT>TCT		tenascin XB isoform 1 precursor							47.0	52.0	50.0					6																	32036389		2002	4154	6156	SO:0001583	missense	7148				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding	g.chr6:32036389G>A	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5998C>T	6.37:g.32036389G>A	ENSP00000364393:p.Pro2000Ser		Somatic					p.P2000S	NM_019105	NP_061978	WXS	Illumina HiSeq	Unspecified	P22105	TENX_HUMAN			17	6200	-			2082			Fibronectin type-III 13.		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37	c.5998C>T		.	.	.	.	.	.	.	.	.	.	G	11.64	1.698909	0.30142	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.54279	0.58;0.58	5.33	3.2	0.36748	.	0.497517	0.17745	N	0.163429	T	0.20618	0.0496	L	0.31207	0.915	0.09310	N	1	P	0.43607	0.812	P	0.45449	0.481	T	0.03898	-1.0994	10	0.17369	T	0.5	.	5.2908	0.15725	0.1947:0.0:0.6381:0.1673	.	2000	P22105-3	.	S	2000	ENSP00000364393:P2000S;ENSP00000364396:P2000S	ENSP00000364393:P2000S	P	-	1	0	TNXB	32144367	0.923000	0.31300	0.700000	0.30305	0.532000	0.34746	1.128000	0.31369	1.251000	0.43983	0.655000	0.94253	CCT		0.632	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		7	17	0	0	0	0.00448238	0	7	17				
CRISP3	10321	broad.mit.edu	37	6	49696489	49696489	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:49696489C>A	ENST00000393666.1	-	7	698	c.692G>T	c.(691-693)aGg>aTg	p.R231M	CRISP3_ENST00000433368.2_Missense_Mutation_p.R254M|CRISP3_ENST00000371159.4_Missense_Mutation_p.R262M|CRISP3_ENST00000423399.2_Missense_Mutation_p.R141M|CRISP3_ENST00000263045.4_Missense_Mutation_p.R244M			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	231	ShKT. {ECO:0000255|PROSITE- ProRule:PRU01005}.				defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			GCAACTGTCCCTGACCAACTG	0.388																																							uc003ozs.2		NA																	0				skin(2)	2						c.(691-693)AGG>ATG		cysteine-rich secretory protein 3 precursor							175.0	158.0	164.0					6																	49696489		2203	4300	6503	SO:0001583	missense	10321				innate immune response	proteinaceous extracellular matrix|specific granule		g.chr6:49696489C>A	X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.692G>T	6.37:g.49696489C>A	ENSP00000377274:p.Arg231Met		Somatic					p.R231M	NM_006061	NP_006052	WXS	Illumina HiSeq	Unspecified	P54108	CRIS3_HUMAN	KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)		8	707	-	Lung NSC(77;0.0161)		231					A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Missense_Mutation	SNP	ENST00000393666.1	37	c.692G>T		.	.	.	.	.	.	.	.	.	.	C	10.69	1.420880	0.25639	.	.	ENSG00000096006	ENST00000263045;ENST00000433368;ENST00000393666;ENST00000423399;ENST00000371159	T;T;T;T;T	0.15139	3.02;3.01;3.03;2.45;3.01	4.55	0.584	0.17422	Cysteine-rich secretory protein (1);	0.648698	0.13481	U	0.384702	T	0.07728	0.0194	N	0.21282	0.65	0.09310	N	1	P	0.49253	0.921	P	0.54270	0.747	T	0.15752	-1.0426	10	0.59425	D	0.04	.	6.8191	0.23847	0.0:0.307:0.0:0.693	.	231	P54108	CRIS3_HUMAN	M	244;254;231;141;262	ENSP00000263045:R244M;ENSP00000389026:R254M;ENSP00000377274:R231M;ENSP00000410469:R141M;ENSP00000360201:R262M	ENSP00000263045:R244M	R	-	2	0	CRISP3	49804448	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.040000	0.13905	-0.067000	0.12976	-0.320000	0.08662	AGG		0.388	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006061		30	89	1	0	1.7881e-09	0.001512	7.16832e-09	30	89				
GSTA1	2938	broad.mit.edu	37	6	52657758	52657758	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:52657758G>T	ENST00000334575.5	-	6	597	c.442C>A	c.(442-444)Ctt>Att	p.L148I	GSTA1_ENST00000493331.1_5'UTR	NM_145740.3	NP_665683.1	P08263	GSTA1_HUMAN	glutathione S-transferase alpha 1	148	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|metabolic process (GO:0008152)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	12	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Glutathione(DB00143)	TTGCCAACAAGGTAGTCTTGT	0.527																																							uc003paz.2		NA																	0				ovary(1)	1						c.(442-444)CTT>ATT		glutathione S-transferase alpha 1	Amsacrine(DB00276)|Busulfan(DB01008)|Glutathione(DB00143)						173.0	155.0	161.0					6																	52657758		2203	4300	6503	SO:0001583	missense	2938				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity	g.chr6:52657758G>T		CCDS4945.1	6p12.2	2012-06-21	2008-11-26		ENSG00000243955	ENSG00000243955	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4626	protein-coding gene	gene with protein product		138359	"""glutathione S-transferase A1"""			9503014	Standard	NM_145740		Approved		uc003paz.3	P08263	OTTHUMG00000014861	ENST00000334575.5:c.442C>A	6.37:g.52657758G>T	ENSP00000335620:p.Leu148Ile		Somatic					p.L148I	NM_145740	NP_665683	WXS	Illumina HiSeq	Unspecified	P08263	GSTA1_HUMAN			6	554	-	Lung NSC(77;0.118)		148			GST C-terminal.		Q14750|Q5GHF8|Q5SZC1	Missense_Mutation	SNP	ENST00000334575.5	37	c.442C>A	CCDS4945.1	.	.	.	.	.	.	.	.	.	.	g	14.00	2.404331	0.42613	.	.	ENSG00000243955	ENST00000334575	T	0.03358	3.96	2.43	2.43	0.29744	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.082428	0.49916	D	0.000127	T	0.09423	0.0232	M	0.74389	2.26	0.42095	D	0.991314	D	0.64830	0.994	D	0.77557	0.99	T	0.02238	-1.1190	10	0.87932	D	0	.	12.6198	0.56597	0.0:0.0:1.0:0.0	.	148	P08263	GSTA1_HUMAN	I	148	ENSP00000335620:L148I	ENSP00000335620:L148I	L	-	1	0	GSTA1	52765717	0.875000	0.30112	0.988000	0.46212	0.331000	0.28603	2.170000	0.42443	1.043000	0.40175	0.195000	0.17529	CTT		0.527	GSTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040922.1			28	73	1	0	7.01153e-11	0.00127121	2.93269e-10	28	73				
BAI3	577	broad.mit.edu	37	6	69349230	69349230	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:69349230C>A	ENST00000370598.1	+	3	1484	c.663C>A	c.(661-663)ccC>ccA	p.P221P		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	221					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TGGTGTTACCCCTGAATGAGC	0.522																																							uc003pev.3		NA																	0				lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(661-663)CCC>CCA		brain-specific angiogenesis inhibitor 3							40.0	40.0	40.0					6																	69349230		2203	4300	6503	SO:0001819	synonymous_variant	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:69349230C>A	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.663C>A	6.37:g.69349230C>A			Somatic				BAI3_uc010kak.2_Silent_p.P221P	p.P221P	NM_001704	NP_001695	WXS	Illumina HiSeq	Unspecified	O60242	BAI3_HUMAN			3	1111	+		all_lung(197;0.212)	221			Extracellular (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	ENST00000370598.1	37	c.663C>A	CCDS4968.1																																																																																				0.522	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			12	20	1	0	3.07112e-06	0.000978159	1.05307e-05	12	20				
MYO6	4646	broad.mit.edu	37	6	76599836	76599837	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:76599836_76599837GG>TT	ENST00000369977.3	+	26	2860_2861	c.2721_2722GG>TT	c.(2719-2724)gaGGaa>gaTTaa	p.907_908EE>D*	MYO6_ENST00000369985.4_Nonsense_Mutation_p.907_908EE>D*|MYO6_ENST00000369981.3_Nonsense_Mutation_p.907_908EE>D*|MYO6_ENST00000369975.1_Nonsense_Mutation_p.907_908EE>D*	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	907					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AAAGCTCAGAGGAACTCCTCAG	0.366																																							uc003pih.1		NA																	0				kidney(1)|pancreas(1)	2						c.(2719-2724)GAGGAA>GATTAA		myosin VI																																				SO:0001587	stop_gained	4646				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding	g.chr6:76599836_76599837GG>TT	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	Exception_encountered	6.37:g.76599836_76599837delinsTT	ENSP00000358994:p.E907_E908delinsD*		Somatic				MYO6_uc003pig.1_Nonsense_Mutation_p.907_908EE>D*|MYO6_uc003pii.1_Nonsense_Mutation_p.907_908EE>D*	p.907_908EE>D*	NM_004999	NP_004990	WXS	Illumina HiSeq	Unspecified	Q9UM54	MYO6_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.223)	26	3000_3001	+		all_hematologic(105;0.189)	907_908			Potential.		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Nonsense_Mutation	DNP	ENST00000369977.3	37	c.2721_2722GG>TT	CCDS34487.1																																																																																				0.366	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999		21	67	0	0	0	6.4e-05	0	21	67				
PNISR	25957	broad.mit.edu	37	6	99854038	99854038	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:99854038C>G	ENST00000369239.5	-	8	1075	c.871G>C	c.(871-873)Gat>Cat	p.D291H	PNISR_ENST00000438806.1_Missense_Mutation_p.D291H	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	291						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TCTTCCTCATCACTATCCTAT	0.373																																							uc003ppo.3		NA																	0					0						c.(871-873)GAT>CAT		splicing factor, arginine/serine-rich 130							144.0	130.0	135.0					6																	99854038		2203	4300	6503	SO:0001583	missense	25957					nuclear speck		g.chr6:99854038C>G	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.871G>C	6.37:g.99854038C>G	ENSP00000358242:p.Asp291His		Somatic				SFRS18_uc003ppp.3_Missense_Mutation_p.D291H|SFRS18_uc011eag.1_Missense_Mutation_p.D291H	p.D291H	NM_032870	NP_116259	WXS	Illumina HiSeq	Unspecified	Q8TF01	PNISR_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0631)	8	1099	-		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)	291					A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	ENST00000369239.5	37	c.871G>C	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.709913	0.89018	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	T;T	0.47528	0.84;0.84	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.67720	0.2923	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69793	-0.5049	10	0.87932	D	0	.	20.1169	0.97940	0.0:1.0:0.0:0.0	.	291	Q8TF01	PNISR_HUMAN	H	291	ENSP00000358242:D291H;ENSP00000387997:D291H	ENSP00000358242:D291H	D	-	1	0	PNISR	99960759	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.030000	0.70903	2.835000	0.97688	0.591000	0.81541	GAT		0.373	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870		14	26	0	0	0	0.00244969	0	14	26				
GRIK2	2898	broad.mit.edu	37	6	102503354	102503354	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:102503354G>T	ENST00000421544.1	+	15	2951	c.2461G>T	c.(2461-2463)Ggt>Tgt	p.G821C	GRIK2_ENST00000318991.6_Missense_Mutation_p.G821C|GRIK2_ENST00000369137.3_Missense_Mutation_p.G745C|GRIK2_ENST00000413795.1_Missense_Mutation_p.G821C|GRIK2_ENST00000369134.4_Missense_Mutation_p.G772C|GRIK2_ENST00000369138.1_Missense_Mutation_p.G821C	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	821					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TCAGAATATTGGTGGCATCTT	0.468																																							uc003pqp.3		NA																	0				ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(2461-2463)GGT>TGT		glutamate receptor, ionotropic, kainate 2	L-Glutamic Acid(DB00142)						113.0	120.0	118.0					6																	102503354		2203	4300	6503	SO:0001583	missense	2898				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr6:102503354G>T		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2461G>T	6.37:g.102503354G>T	ENSP00000397026:p.Gly821Cys		Somatic				GRIK2_uc003pqo.3_Missense_Mutation_p.G821C|GRIK2_uc010kcw.2_Missense_Mutation_p.G821C	p.G821C	NM_021956	NP_068775	WXS	Illumina HiSeq	Unspecified	Q13002	GRIK2_HUMAN		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	15	2710	+		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)	821			Helical; (Potential).		A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	37	c.2461G>T	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711354	0.89112	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000369134;ENST00000540076	T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54	5.68	5.68	0.88126	Ionotropic glutamate receptor (1);	0.097775	0.64402	D	0.000001	T	0.75547	0.3864	M	0.89287	3.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.996	T	0.79692	-0.1697	10	0.87932	D	0	.	19.8555	0.96756	0.0:0.0:1.0:0.0	.	821;821;821	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	C	821;821;821;745;821;772;596	ENSP00000397026:G821C;ENSP00000405596:G821C;ENSP00000358134:G821C;ENSP00000358133:G745C;ENSP00000313276:G821C;ENSP00000358130:G772C	ENSP00000313276:G821C	G	+	1	0	GRIK2	102610047	1.000000	0.71417	0.997000	0.53966	0.955000	0.61496	9.869000	0.99810	2.694000	0.91930	0.585000	0.79938	GGT		0.468	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1			31	61	1	0	3.67414e-24	0.0024448	1.82491e-23	31	61				
SMPDL3A	10924	broad.mit.edu	37	6	123122474	123122474	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:123122474C>A	ENST00000368440.4	+	4	668	c.491C>A	c.(490-492)aCc>aAc	p.T164N	SMPDL3A_ENST00000539041.1_Missense_Mutation_p.T33N	NM_006714.3	NP_006705.1	Q92484	ASM3A_HUMAN	sphingomyelin phosphodiesterase, acid-like 3A	164					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|cervix(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	10				GBM - Glioblastoma multiforme(226;0.236)		CCTGTAGTCACCAGTAAAGTG	0.373																																							uc003pzg.2		NA																	0					0						c.(490-492)ACC>AAC		acid sphingomyelinase-like phosphodiesterase 3A							156.0	147.0	150.0					6																	123122474		2203	4300	6503	SO:0001583	missense	10924				sphingomyelin catabolic process	extracellular space	hydrolase activity, acting on glycosyl bonds|protein binding|sphingomyelin phosphodiesterase activity	g.chr6:123122474C>A	AK000184	CCDS5128.1, CCDS69190.1	6q22.32	2006-04-12			ENSG00000172594	ENSG00000172594			17389	protein-coding gene	gene with protein product	"""acid sphingomyelinase-like phosphodiesterase 3a"""	610728				12442002	Standard	XM_005266798		Approved	FLJ20177, ASM3A, ASML3a, yR36GH4.1	uc003pzg.3	Q92484	OTTHUMG00000015490	ENST00000368440.4:c.491C>A	6.37:g.123122474C>A	ENSP00000357425:p.Thr164Asn		Somatic				SMPDL3A_uc003pzh.2_Missense_Mutation_p.T33N	p.T164N	NM_006714	NP_006705	WXS	Illumina HiSeq	Unspecified	Q92484	ASM3A_HUMAN		GBM - Glioblastoma multiforme(226;0.236)	4	1012	+			164					B7Z729|Q8WV13	Missense_Mutation	SNP	ENST00000368440.4	37	c.491C>A	CCDS5128.1	.	.	.	.	.	.	.	.	.	.	C	2.856	-0.237214	0.05944	.	.	ENSG00000172594	ENST00000368440;ENST00000539041	D;D	0.84730	-1.89;-1.89	5.72	2.77	0.32553	Metallophosphoesterase domain (1);	0.561471	0.21455	N	0.074271	T	0.54464	0.1860	N	0.13327	0.33	0.30895	N	0.729945	B	0.17038	0.02	B	0.24155	0.051	T	0.34601	-0.9822	10	0.18276	T	0.48	-4.9364	11.0896	0.48108	0.3614:0.5219:0.1168:0.0	.	164	Q92484	ASM3A_HUMAN	N	164;33	ENSP00000357425:T164N;ENSP00000442152:T33N	ENSP00000357425:T164N	T	+	2	0	SMPDL3A	123164173	0.947000	0.32204	0.930000	0.37139	0.063000	0.16089	0.852000	0.27764	0.843000	0.35070	0.650000	0.86243	ACC		0.373	SMPDL3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042039.1	NM_006714		38	97	1	0	2.84425e-11	0.00285205	1.21217e-10	38	97				
PTPRK	5796	broad.mit.edu	37	6	128312532	128312532	+	Silent	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:128312532G>A	ENST00000368215.3	-	20	2882	c.2883C>T	c.(2881-2883)ccC>ccT	p.P961P	PTPRK_ENST00000368207.3_Silent_p.P994P|PTPRK_ENST00000368227.3_Silent_p.P979P|PTPRK_ENST00000368226.4_Silent_p.P962P|PTPRK_ENST00000368213.5_Silent_p.P968P|PTPRK_ENST00000368210.3_Silent_p.P980P|PTPRK_ENST00000532331.1_Silent_p.P984P			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	961	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TTTCATGAACGGGACCTACAA	0.338																																							uc003qbk.2		NA																	0				ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8						c.(2881-2883)CCC>CCT		protein tyrosine phosphatase, receptor type, K							70.0	65.0	67.0					6																	128312532		2203	4300	6503	SO:0001819	synonymous_variant	5796				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr6:128312532G>A	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2883C>T	6.37:g.128312532G>A			Somatic				PTPRK_uc003qbj.2_Silent_p.P962P|PTPRK_uc010kfc.2_Silent_p.P968P|PTPRK_uc011ebu.1_Silent_p.P984P	p.P961P	NM_002844	NP_002835	WXS	Illumina HiSeq	Unspecified	Q15262	PTPRK_HUMAN		all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)	20	3250	-			961			Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).		B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Silent	SNP	ENST00000368215.3	37	c.2883C>T		.	.	.	.	.	.	.	.	.	.	G	7.245	0.602121	0.13939	.	.	ENSG00000152894	ENST00000415046	T	0.60548	0.18	5.92	0.718	0.18202	.	0.000000	0.85682	D	0.000000	T	0.48370	0.1496	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51795	-0.8660	7	0.87932	D	0	.	6.7871	0.23679	0.0:0.1279:0.2482:0.6238	.	.	.	.	L	255	ENSP00000406825:P255L	ENSP00000406825:P255L	P	-	2	0	PTPRK	128354225	0.989000	0.36119	0.998000	0.56505	0.842000	0.47809	0.223000	0.17719	-0.085000	0.12573	-0.271000	0.10264	CCG		0.338	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1			13	24	0	0	0	0.00185496	0	13	24				
LAMA2	3908	broad.mit.edu	37	6	129636648	129636648	+	Silent	SNP	C	C	T	rs1063373		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:129636648C>T	ENST00000421865.2	+	25	3632	c.3583C>T	c.(3583-3585)Cta>Tta	p.L1195L		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1195	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GCAGACCATTCTACCCCTGGT	0.463																																							uc003qbn.2		NA																	0				ovary(8)|breast(1)|skin(1)	10						c.(3583-3585)CTA>TTA		laminin alpha 2 subunit isoform a precursor							105.0	99.0	101.0					6																	129636648		2203	4300	6503	SO:0001819	synonymous_variant	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129636648C>T	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.3583C>T	6.37:g.129636648C>T			Somatic				LAMA2_uc003qbo.2_Silent_p.L1195L	p.L1195L	NM_000426	NP_000417	WXS	Illumina HiSeq	Unspecified	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	25	3688	+			1195			Laminin IV type A 2.		Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	37	c.3583C>T	CCDS5138.1																																																																																				0.463	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			19	46	0	0	0	0.00152264	0	19	46				
TAAR9	134860	broad.mit.edu	37	6	132859864	132859864	+	RNA	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:132859864G>T	ENST00000434551.1	+	0	436					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)					Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		CAAGTTTACTGTGTCAGTTTC	0.393																																					Colon(10;433 445 15992 45047 47213)	Colon(10;433 445 15992 45047 47213)	uc011eci.1		NA																	0					0						c.(436-438)GTG>TTG		trace amine associated receptor 9							126.0	118.0	121.0					6																	132859864		1940	4140	6080			134860					plasma membrane	G-protein coupled receptor activity	g.chr6:132859864G>T	AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		6.37:g.132859864G>T			Somatic					p.V146L	NM_175057	NP_778227	WXS	Illumina HiSeq	Unspecified	Q96RI9	TAAR9_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)	2	438	+	Breast(56;0.112)		146			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000434551.1	37	c.436G>T																																																																																					0.393	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000042254.2	NM_175057		14	34	1	0	9.31168e-06	0.00185496	3.09854e-05	14	34				
ZDHHC14	79683	broad.mit.edu	37	6	158014053	158014053	+	Missense_Mutation	SNP	G	G	C	rs537665521		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:158014053G>C	ENST00000359775.5	+	3	1329	c.440G>C	c.(439-441)cGc>cCc	p.R147P	ZDHHC14_ENST00000414563.2_Missense_Mutation_p.R147P|ZDHHC14_ENST00000341375.8_3'UTR			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	147					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		GGGGGGTACCGCCCGCCTCCC	0.567																																							uc003qqt.2		NA																	0				ovary(1)|skin(1)	2						c.(439-441)CGC>CCC		zinc finger, DHHC-type containing 14 isoform 1							86.0	85.0	85.0					6																	158014053		2203	4296	6499	SO:0001583	missense	79683					integral to membrane	acyltransferase activity|zinc ion binding	g.chr6:158014053G>C	AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.440G>C	6.37:g.158014053G>C	ENSP00000352821:p.Arg147Pro		Somatic				ZDHHC14_uc003qqs.2_Missense_Mutation_p.R147P|ZDHHC14_uc010kjm.1_Missense_Mutation_p.R42P	p.R147P	NM_024630	NP_078906	WXS	Illumina HiSeq	Unspecified	Q8IZN3	ZDH14_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)	3	937	+		Breast(66;0.00586)|Ovarian(120;0.123)	147					A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Missense_Mutation	SNP	ENST00000359775.5	37	c.440G>C	CCDS5252.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.229543|5.229543	0.95173|0.95173	.|.	.|.	ENSG00000175048|ENSG00000175048	ENST00000340347|ENST00000359775;ENST00000414563;ENST00000538483	.|T;T	.|0.25085	.|1.82;1.82	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46964|0.46964	0.1420|0.1420	M|M	0.75085|0.75085	2.285|2.285	0.80722|0.80722	D|D	1|1	.|P;D;P	.|0.89917	.|0.895;1.0;0.94	.|P;D;P	.|0.87578	.|0.498;0.998;0.681	T|T	0.33189|0.33189	-0.9878|-0.9878	5|9	.|.	.|.	.|.	-21.0434|-21.0434	19.8579|19.8579	0.96771|0.96771	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|151;147;147	.|A4FVA9;Q8IZN3;Q8IZN3-2	.|.;ZDH14_HUMAN;.	P|P	5|147;147;151	.|ENSP00000352821:R147P;ENSP00000410713:R147P	.|.	A|R	+|+	1|2	0|0	ZDHHC14|ZDHHC14	157934041|157934041	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.348000|9.348000	0.97062|0.97062	2.687000|2.687000	0.91594|0.91594	0.655000|0.655000	0.94253|0.94253	GCC|CGC		0.567	ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042841.2	NM_153746		16	38	0	0	0	0.00400662	0	16	38				
LPA	4018	broad.mit.edu	37	6	160969685	160969685	+	Silent	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr6:160969685C>T	ENST00000316300.5	-	31	5024	c.4980G>A	c.(4978-4980)ctG>ctA	p.L1660L	LPA_ENST00000447678.1_Silent_p.L1660L			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4168	Kringle 15. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	AGTTCATTGTCAGGCCACTGG	0.478																																							uc003qtl.2		NA																	0				ovary(3)|skin(2)|pancreas(1)	6						c.(4978-4980)CTG>CTA		lipoprotein Lp(a) precursor	Aminocaproic Acid(DB00513)						58.0	64.0	62.0					6																	160969685		2203	4300	6503	SO:0001819	synonymous_variant	4018				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	g.chr6:160969685C>T	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4980G>A	6.37:g.160969685C>T			Somatic					p.L1660L	NM_005577	NP_005568	WXS	Illumina HiSeq	Unspecified	P08519	APOA_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	32	5100	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	4168			Kringle 37.		Q5VTD7|Q9UD88	Silent	SNP	ENST00000316300.5	37	c.4980G>A	CCDS43523.1																																																																																				0.478	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		13	36	0	0	0	0.00244969	0	13	36				
PDE1C	5137	broad.mit.edu	37	7	31867932	31867932	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:31867932G>T	ENST00000396191.1	-	12	1714	c.1259C>A	c.(1258-1260)tCc>tAc	p.S420Y	PDE1C_ENST00000396184.3_Missense_Mutation_p.S420Y|PDE1C_ENST00000396182.2_Missense_Mutation_p.S420Y|PDE1C_ENST00000396193.1_Missense_Mutation_p.S480Y|PDE1C_ENST00000321453.7_Missense_Mutation_p.S420Y	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	420	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	AACCATAGTGGACTTTCGGTC	0.468																																							uc003tcm.1		NA																	0				skin(3)|central_nervous_system(1)	4						c.(1258-1260)TCC>TAC		phosphodiesterase 1C							85.0	77.0	80.0					7																	31867932		2203	4300	6503	SO:0001583	missense	5137				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr7:31867932G>T	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1259C>A	7.37:g.31867932G>T	ENSP00000379494:p.Ser420Tyr		Somatic				PDE1C_uc003tcn.1_Missense_Mutation_p.S420Y|PDE1C_uc003tco.1_Missense_Mutation_p.S480Y|PDE1C_uc003tcr.2_Missense_Mutation_p.S420Y|PDE1C_uc003tcs.2_Missense_Mutation_p.S420Y	p.S420Y	NM_005020	NP_005011	WXS	Illumina HiSeq	Unspecified	Q14123	PDE1C_HUMAN	GBM - Glioblastoma multiforme(11;0.216)		12	1728	-			420			Catalytic (By similarity).		B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	37	c.1259C>A	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	G	34	5.341870	0.95783	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13	5.61	5.61	0.85477	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.89012	0.6594	M	0.81341	2.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72982	0.965;0.979;0.964	D	0.89610	0.3841	10	0.87932	D	0	.	19.5946	0.95530	0.0:0.0:1.0:0.0	.	420;480;420	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	Y	480;420;420;420;420	ENSP00000379496:S480Y;ENSP00000379494:S420Y;ENSP00000318105:S420Y;ENSP00000379487:S420Y;ENSP00000379485:S420Y	ENSP00000318105:S420Y	S	-	2	0	PDE1C	31834457	1.000000	0.71417	0.970000	0.41538	0.993000	0.82548	9.747000	0.98863	2.813000	0.96785	0.655000	0.94253	TCC		0.468	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1			8	34	1	0	1.06961e-07	0.00307968	3.98085e-07	8	34				
VPS41	27072	broad.mit.edu	37	7	38857421	38857421	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:38857421T>A	ENST00000310301.4	-	7	500	c.446A>T	c.(445-447)aAg>aTg	p.K149M	VPS41_ENST00000395969.2_Missense_Mutation_p.K124M	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	149					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						ACTTACCTTCTTCCCTCCGGT	0.433																																							uc003tgy.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(445-447)AAG>ATG		vacuolar protein sorting 41 isoform 1							218.0	185.0	196.0					7																	38857421		2203	4300	6503	SO:0001583	missense	27072				Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding	g.chr7:38857421T>A	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.446A>T	7.37:g.38857421T>A	ENSP00000309457:p.Lys149Met		Somatic				VPS41_uc003tgz.2_Missense_Mutation_p.K124M|VPS41_uc010kxn.2_Missense_Mutation_p.K149M	p.K149M	NM_014396	NP_055211	WXS	Illumina HiSeq	Unspecified	P49754	VPS41_HUMAN			7	472	-			149					E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	ENST00000310301.4	37	c.446A>T	CCDS5457.1	.	.	.	.	.	.	.	.	.	.	T	18.96	3.733962	0.69189	.	.	ENSG00000006715	ENST00000310301;ENST00000395969;ENST00000413141;ENST00000414632;ENST00000418457	T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5	4.94	4.94	0.65067	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.101335	0.64402	D	0.000002	T	0.36413	0.0966	N	0.17474	0.49	0.42985	D	0.994476	P;P;P	0.39624	0.681;0.681;0.681	B;B;B	0.37601	0.254;0.254;0.254	T	0.27226	-1.0080	10	0.34782	T	0.22	-19.8082	13.1727	0.59609	0.0:0.0:0.0:1.0	.	149;124;149	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	M	149;124;75;136;99	ENSP00000309457:K149M;ENSP00000379297:K124M;ENSP00000412974:K75M;ENSP00000411919:K136M;ENSP00000407835:K99M	ENSP00000265745:K149M	K	-	2	0	VPS41	38823946	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	6.034000	0.70933	1.852000	0.53769	0.332000	0.21555	AAG		0.433	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3			21	60	0	0	0	0.00278032	0	21	60				
CDC14C	168448	broad.mit.edu	37	7	48964526	48964526	+	IGR	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:48964526G>T								AC004899.1 (73305 upstream) : AC010971.1 (305206 downstream)																							TGTTAAGGAAGAAAATTGTTC	0.378																																							uc010kyv.1		NA																	0					0						c.(256-258)AAG>AAT		SubName: Full=Putative uncharacterized protein MGC26484;																																				SO:0001628	intergenic_variant	168448							g.chr7:48964526G>T																													7.37:g.48964526G>T			Somatic					p.K86N	NR_003595		WXS	Illumina HiSeq	Unspecified					1	370	+									Missense_Mutation	SNP		37	c.258G>T																																																																																				0	0.378									9	61	1	0	0.000219431	0.00244969	0.000672226	9	61				
Unknown	0	broad.mit.edu	37	7	63680250	63680250	+	IGR	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:63680250G>C								GUSBP6 (69151 upstream) : ZNF679 (8601 downstream)																							TGTGAAGAATGTGGCCAAGCC	0.453																																							uc011kdn.1		NA																	0					0						c.(820-822)TGT>TCT		zinc finger protein 735							20.0	19.0	19.0					7																	63680250		692	1591	2283	SO:0001628	intergenic_variant	730291				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:63680250G>C																													7.37:g.63680250G>C			Somatic					p.C274S	NM_001159524	NP_001152996	WXS	Illumina HiSeq	Unspecified	P0CB33	ZN735_HUMAN			4	821	+			274			C2H2-type 5.			Missense_Mutation	SNP		37	c.821G>C																																																																																				0	0.453									12	35	0	0	0	0.00136819	0	12	35				
RABGEF1	27342	broad.mit.edu	37	7	66240365	66240365	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:66240365G>A	ENST00000284957.5	+	3	408	c.331G>A	c.(331-333)Gtc>Atc	p.V111I	RABGEF1_ENST00000450873.2_Missense_Mutation_p.V111I|RABGEF1_ENST00000439720.2_Missense_Mutation_p.V124I|KCTD7_ENST00000510829.2_Missense_Mutation_p.V111I|KCTD7_ENST00000380828.2_Missense_Mutation_p.V151I|RABGEF1_ENST00000484547.2_3'UTR|KCTD7_ENST00000451741.2_Missense_Mutation_p.V111I|RABGEF1_ENST00000437078.2_Missense_Mutation_p.V125I			Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	289					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein targeting to membrane (GO:0006612)	early endosome (GO:0005769)	DNA binding (GO:0003677)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|stomach(1)	27						ATCTTCCAGGGTCGGATCAAA	0.443																																							uc011kee.1		NA																	0				ovary(1)	1						c.(373-375)GTC>ATC		RAB guanine nucleotide exchange factor (GEF) 1							63.0	61.0	62.0					7																	66240365		2203	4300	6503	SO:0001583	missense	27342				endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding	g.chr7:66240365G>A	AJ250042	CCDS5535.1, CCDS69308.1, CCDS75610.1	7q11.21	2010-07-09			ENSG00000154710	ENSG00000154710			17676	protein-coding gene	gene with protein product		609700				12505986, 11098082	Standard	NM_014504		Approved	rabex-5, RABEX5	uc003tvh.3	Q9UJ41	OTTHUMG00000129547	ENST00000284957.5:c.331G>A	7.37:g.66240365G>A	ENSP00000284957:p.Val111Ile		Somatic				RABGEF1_uc003tvf.2_5'UTR|RABGEF1_uc003tvg.2_5'UTR|RABGEF1_uc010lag.2_Missense_Mutation_p.V111I|RABGEF1_uc003tvh.2_Missense_Mutation_p.V111I|RABGEF1_uc003tvi.2_5'UTR	p.V125I	NM_014504	NP_055319	WXS	Illumina HiSeq	Unspecified	Q9UJ41	RABX5_HUMAN			3	537	+			289					B4DZM7|Q3HKR2|Q3HKR3|Q53FG0	Missense_Mutation	SNP	ENST00000284957.5	37	c.373G>A	CCDS5535.1	.	.	.	.	.	.	.	.	.	.	.	12.19	1.863826	0.32884	.	.	ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000154710;ENSG00000154710;ENSG00000154710;ENSG00000154710	ENST00000380827;ENST00000380828;ENST00000510829;ENST00000451741;ENST00000539561;ENST00000284957;ENST00000450873;ENST00000439720;ENST00000437078	T;T;T;T;T;T;T	0.42131	1.72;0.99;0.99;0.99;0.99;0.98;0.98	5.42	5.42	0.78866	.	0.650168	0.14466	N	0.317917	T	0.26702	0.0653	N	0.14661	0.345	0.09310	N	1	B	0.15141	0.012	B	0.14023	0.01	T	0.08229	-1.0732	10	0.37606	T	0.19	-7.9546	9.9277	0.41503	0.1551:0.0:0.8449:0.0	.	125	B4DZM7	.	I	156;151;111;111;111;111;111;124;125	ENSP00000370208:V151I;ENSP00000421124:V111I;ENSP00000398177:V111I;ENSP00000284957:V111I;ENSP00000415815:V111I;ENSP00000403429:V124I;ENSP00000390480:V125I	ENSP00000370207:V156I	V	+	1	0	RABGEF1;KCTD7	65877800	0.918000	0.31147	0.995000	0.50966	0.895000	0.52256	3.974000	0.56852	2.529000	0.85273	0.650000	0.86243	GTC		0.443	RABGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251737.3	NM_014504		13	50	0	0	0	0.00244969	0	13	50				
GTF2IRD2P1	401375	broad.mit.edu	37	7	72657661	72657661	+	RNA	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:72657661C>A	ENST00000425256.1	-	0	2250									GTF2I repeat domain containing 2 pseudogene 1																		ggaattcggtcttgagttccg	0.483																																							uc003txs.1		NA																	0					0						c.(1321-1323)AAG>AAT		RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;																																						401375							g.chr7:72657661C>A	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72657661C>A			Somatic				FKBP6_uc003twz.2_Intron	p.K441N	NR_002164		WXS	Illumina HiSeq	Unspecified					13	2251	-									Missense_Mutation	SNP	ENST00000425256.1	37	c.1323G>T																																																																																					0.483	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345921.1	NR_002164		19	69	1	0	1.36615e-20	0.00283554	6.61528e-20	19	69				
SEMA3C	10512	broad.mit.edu	37	7	80427413	80427413	+	Nonsense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:80427413C>A	ENST00000265361.3	-	11	1687	c.1126G>T	c.(1126-1128)Gga>Tga	p.G376*	SEMA3C_ENST00000419255.2_Nonsense_Mutation_p.G376*|SEMA3C_ENST00000544525.1_Nonsense_Mutation_p.G394*|SEMA3C_ENST00000536800.1_Nonsense_Mutation_p.G228*	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	376	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						CTTACAGTTCCAGGGCGAGGA	0.388																																							uc003uhj.2		NA																	0				ovary(1)	1						c.(1126-1128)GGA>TGA		semaphorin 3C precursor							52.0	53.0	53.0					7																	80427413		2203	4300	6503	SO:0001587	stop_gained	10512				immune response|response to drug	membrane	receptor activity	g.chr7:80427413C>A	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.1126G>T	7.37:g.80427413C>A	ENSP00000265361:p.Gly376*		Somatic				SEMA3C_uc011kgw.1_Nonsense_Mutation_p.G394*|SEMA3C_uc011kgx.1_Nonsense_Mutation_p.G228*	p.G376*	NM_006379	NP_006370	WXS	Illumina HiSeq	Unspecified	Q99985	SEM3C_HUMAN			11	1688	-			376			Sema.		B4DRL8	Nonsense_Mutation	SNP	ENST00000265361.3	37	c.1126G>T	CCDS5596.1	.	.	.	.	.	.	.	.	.	.	C	45	11.730386	0.99596	.	.	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525;ENST00000536800	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.2302	0.98348	0.0:1.0:0.0:0.0	.	.	.	.	X	376;376;394;228	.	ENSP00000265361:G376X	G	-	1	0	SEMA3C	80265349	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.773000	0.85462	2.859000	0.98148	0.591000	0.81541	GGA		0.388	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1	NM_006379		12	33	1	0	0.00316338	0.00316338	0.00919081	12	33				
ABCB1	5243	broad.mit.edu	37	7	87175280	87175280	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:87175280C>G	ENST00000265724.3	-	16	2203	c.1786G>C	c.(1786-1788)Gac>Cac	p.D596H	ABCB1_ENST00000543898.1_Missense_Mutation_p.D532H	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	596	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	GCGATGACGTCAGCATTACGA	0.393																																							uc003uiz.1		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(1786-1788)GAC>CAC		ATP-binding cassette, subfamily B, member 1	Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)						150.0	131.0	137.0					7																	87175280		2203	4300	6503	SO:0001583	missense	5243				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity	g.chr7:87175280C>G	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.1786G>C	7.37:g.87175280C>G	ENSP00000265724:p.Asp596His		Somatic				ABCB1_uc011khc.1_Missense_Mutation_p.D532H	p.D596H	NM_000927	NP_000918	WXS	Illumina HiSeq	Unspecified	P08183	MDR1_HUMAN			16	2204	-	Esophageal squamous(14;0.00164)		596			ABC transporter 1.|Cytoplasmic (Potential).		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	c.1786G>C	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.608444	0.87258	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	T;T	0.81247	-1.47;-1.47	5.73	5.73	0.89815	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.044974	0.85682	D	0.000000	D	0.90662	0.7071	M	0.86502	2.82	0.80722	D	1	P;D	0.76494	0.818;0.999	P;P	0.62184	0.636;0.899	D	0.90784	0.4681	10	0.56958	D	0.05	-17.8997	20.2786	0.98501	0.0:1.0:0.0:0.0	.	532;596	B5AK60;P08183	.;MDR1_HUMAN	H	377;596;532	ENSP00000265724:D596H;ENSP00000444095:D532H	ENSP00000265724:D596H	D	-	1	0	ABCB1	87013216	1.000000	0.71417	0.996000	0.52242	0.638000	0.38207	7.752000	0.85141	2.868000	0.98415	0.557000	0.71058	GAC		0.393	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927		4	88	0	0	0	0.00024832	0	4	88				
GTPBP10	85865	broad.mit.edu	37	7	90014350	90014350	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:90014350A>T	ENST00000222511.6	+	10	1112	c.1046A>T	c.(1045-1047)cAg>cTg	p.Q349L	GTPBP10_ENST00000257659.8_Missense_Mutation_p.Q270L	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	349					ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						CAGGCCAACCAGGAAAATGAT	0.388																																							uc003ukm.1		NA																	0					0						c.(1045-1047)CAG>CTG		GTP-binding protein 10 isoform 2							129.0	128.0	128.0					7																	90014350		2203	4300	6503	SO:0001583	missense	85865				ribosome biogenesis	chromosome|nucleolus	GTP binding|GTPase activity|magnesium ion binding	g.chr7:90014350A>T		CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.1046A>T	7.37:g.90014350A>T	ENSP00000222511:p.Gln349Leu		Somatic				GTPBP10_uc003ukn.1_Missense_Mutation_p.Q270L|GTPBP10_uc003uko.1_Missense_Mutation_p.Q159L|CLDN12_uc003ukp.2_5'UTR|CLDN12_uc003ukq.2_5'UTR	p.Q349L	NM_033107	NP_149098	WXS	Illumina HiSeq	Unspecified	A4D1E9	GTPBA_HUMAN			10	1112	+			349					B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Missense_Mutation	SNP	ENST00000222511.6	37	c.1046A>T	CCDS5617.1	.	.	.	.	.	.	.	.	.	.	A	13.24	2.177279	0.38413	.	.	ENSG00000105793	ENST00000257659;ENST00000222511	T;T	0.14893	2.47;2.47	5.74	3.38	0.38709	.	0.624285	0.17127	N	0.185978	T	0.18299	0.0439	M	0.73598	2.24	0.21064	N	0.999799	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.25916	-1.0118	9	.	.	.	-5.4817	5.41	0.16342	0.7364:0.0:0.1355:0.1281	.	270;349	A4D1E9-2;A4D1E9	.;GTPBA_HUMAN	L	270;349	ENSP00000257659:Q270L;ENSP00000222511:Q349L	.	Q	+	2	0	GTPBP10	89852286	0.782000	0.28689	0.199000	0.23439	0.972000	0.66771	1.422000	0.34826	0.448000	0.26722	0.533000	0.62120	CAG		0.388	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059976.3	NM_033107		26	121	0	0	0	0.000878237	0	26	121				
SAMD9	54809	broad.mit.edu	37	7	92733058	92733058	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:92733058C>A	ENST00000379958.2	-	3	2622	c.2353G>T	c.(2353-2355)Gca>Tca	p.A785S		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	785						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CGGTTCATTGCCCCATAGGTG	0.388																																							uc003umf.2		NA																	0				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(2353-2355)GCA>TCA		sterile alpha motif domain containing 9							124.0	120.0	122.0					7																	92733058		2203	4299	6502	SO:0001583	missense	54809					cytoplasm		g.chr7:92733058C>A	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2353G>T	7.37:g.92733058C>A	ENSP00000369292:p.Ala785Ser		Somatic				SAMD9_uc003umg.2_Missense_Mutation_p.A785S	p.A785S	NM_017654	NP_060124	WXS	Illumina HiSeq	Unspecified	Q5K651	SAMD9_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		3	2609	-	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		785					A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	c.2353G>T	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	C	0.512	-0.866234	0.02590	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.81078	-1.45;-1.45	4.44	-4.77	0.03219	.	1.126930	0.06791	U	0.786924	T	0.72637	0.3485	M	0.67953	2.075	0.09310	N	1	B	0.15930	0.015	B	0.12156	0.007	T	0.54476	-0.8288	10	0.27785	T	0.31	.	4.9884	0.14202	0.2184:0.3128:0.0:0.4688	.	785	Q5K651	SAMD9_HUMAN	S	785	ENSP00000369292:A785S;ENSP00000414529:A785S	ENSP00000369292:A785S	A	-	1	0	SAMD9	92570994	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	-0.700000	0.05081	-0.815000	0.04346	-0.192000	0.12808	GCA		0.388	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654		28	130	1	0	3.99451e-17	0.00178596	1.87381e-16	28	130				
MUC17	140453	broad.mit.edu	37	7	100679317	100679317	+	Silent	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:100679317C>G	ENST00000306151.4	+	3	4684	c.4620C>G	c.(4618-4620)gtC>gtG	p.V1540V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1540	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTCCTGCTGTCACCAGCACAC	0.478																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(4618-4620)GTC>GTG		mucin 17 precursor							252.0	227.0	235.0					7																	100679317		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100679317C>G	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4620C>G	7.37:g.100679317C>G			Somatic				MUC17_uc010lho.1_RNA	p.V1540V	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	4673	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1540			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|23.		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.4620C>G	CCDS34711.1																																																																																				0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		56	220	0	0	0	0.00361006	0	56	220				
MUC17	140453	broad.mit.edu	37	7	100682907	100682907	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:100682907A>T	ENST00000306151.4	+	3	8274	c.8210A>T	c.(8209-8211)gAa>gTa	p.E2737V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2737	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACAACTGCTGAAGGTACCAGC	0.502																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(8209-8211)GAA>GTA		mucin 17 precursor							258.0	257.0	257.0					7																	100682907		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100682907A>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8210A>T	7.37:g.100682907A>T	ENSP00000302716:p.Glu2737Val		Somatic				MUC17_uc010lho.1_RNA	p.E2737V	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	8263	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2737			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|44.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.8210A>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	A	5.959	0.361016	0.11296	.	.	ENSG00000169876	ENST00000306151	T	0.02140	4.43	0.861	-0.995	0.10222	.	.	.	.	.	T	0.02494	0.0076	N	0.19112	0.55	0.09310	N	1	P	0.51653	0.947	P	0.55965	0.788	T	0.41840	-0.9486	9	0.23302	T	0.38	.	1.7098	0.02890	0.3777:0.0:0.3348:0.2875	.	2737	Q685J3	MUC17_HUMAN	V	2737	ENSP00000302716:E2737V	ENSP00000302716:E2737V	E	+	2	0	MUC17	100469627	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-0.919000	0.04017	-0.386000	0.07821	0.113000	0.15668	GAA		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		60	296	0	0	0	0.00361006	0	60	296				
RELN	5649	broad.mit.edu	37	7	103290776	103290776	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:103290776C>A	ENST00000428762.1	-	16	2106	c.1947G>T	c.(1945-1947)agG>agT	p.R649S	RELN_ENST00000424685.2_Missense_Mutation_p.R649S|RELN_ENST00000343529.5_Missense_Mutation_p.R649S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	649					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCCAGCGAATCCTGGTGTTCC	0.423																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(1945-1947)AGG>AGT		reelin isoform a							256.0	213.0	227.0					7																	103290776		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103290776C>A		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.1947G>T	7.37:g.103290776C>A	ENSP00000392423:p.Arg649Ser		Somatic				RELN_uc010liz.2_Missense_Mutation_p.R649S	p.R649S	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	16	2107	-			649					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.1947G>T	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798881	0.70567	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.21543	2.0;2.02;2.01	6.08	4.18	0.49190	.	0.000000	0.85682	D	0.000000	T	0.46229	0.1382	M	0.79011	2.435	0.50313	D	0.999862	D;D	0.69078	0.997;0.987	D;D	0.79784	0.993;0.942	T	0.46830	-0.9163	10	0.87932	D	0	.	12.3633	0.55215	0.0:0.8974:0.0:0.1026	.	649;649	P78509-2;P78509	.;RELN_HUMAN	S	649	ENSP00000392423:R649S;ENSP00000345694:R649S;ENSP00000388446:R649S	ENSP00000345694:R649S	R	-	3	2	RELN	103078012	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.166000	0.31834	0.778000	0.33520	0.591000	0.81541	AGG		0.423	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		20	51	1	0	1.50039e-11	0.00188189	6.49688e-11	20	51				
KMT2E	55904	broad.mit.edu	37	7	104719376	104719376	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:104719376G>T	ENST00000311117.3	+	12	1759	c.1214G>T	c.(1213-1215)cGa>cTa	p.R405L	KMT2E_ENST00000257745.4_Missense_Mutation_p.R405L|KMT2E_ENST00000334877.4_Missense_Mutation_p.R405L|KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000476671.1_Missense_Mutation_p.R405L	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	405	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										AATGAGGCTCGATTCATCAGG	0.423																																							uc003vcm.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1213-1215)CGA>CTA		myeloid/lymphoid or mixed-lineage leukemia 5							157.0	148.0	151.0					7																	104719376		2203	4300	6503	SO:0001583	missense	55904				cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding	g.chr7:104719376G>T	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.1214G>T	7.37:g.104719376G>T	ENSP00000312379:p.Arg405Leu		Somatic				MLL5_uc010lja.1_Missense_Mutation_p.R259L|MLL5_uc010ljb.1_Missense_Mutation_p.R405L|MLL5_uc003vcl.2_Missense_Mutation_p.R405L|MLL5_uc010ljc.2_Missense_Mutation_p.R405L|MLL5_uc003vco.1_Intron|MLL5_uc010ljd.1_Missense_Mutation_p.R43L	p.R405L	NM_182931	NP_891847	WXS	Illumina HiSeq	Unspecified	Q8IZD2	MLL5_HUMAN			12	1748	+			405			SET.		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	c.1214G>T	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427852	0.83667	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000478990;ENST00000476671;ENST00000537308	D;D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08;-2.08	5.67	5.67	0.87782	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.95893	0.8663	H	0.95402	3.665	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.997;0.997;0.999	D	0.96672	0.9497	10	0.87932	D	0	.	19.7557	0.96287	0.0:0.0:1.0:0.0	.	39;405;405	Q86W16;Q8IZD2;Q8IZD2-3	.;MLL5_HUMAN;.	L	405;405;405;405;405;263;405;339	ENSP00000312379:R405L;ENSP00000335599:R405L;ENSP00000257745:R405L;ENSP00000419883:R263L;ENSP00000417888:R405L	ENSP00000257745:R405L	R	+	2	0	MLL5	104506612	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.869000	0.99810	2.681000	0.91329	0.313000	0.20887	CGA		0.423	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1			22	70	1	0	5.35356e-11	0.00278032	2.25316e-10	22	70				
LAMB1	3912	broad.mit.edu	37	7	107575913	107575913	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:107575913C>G	ENST00000222399.6	-	27	4365	c.4135G>C	c.(4135-4137)Gat>Cat	p.D1379H	LAMB1_ENST00000393561.1_Missense_Mutation_p.D1403H|LAMB1_ENST00000474380.1_5'UTR	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1379	Domain II.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GCCAGTTCATCAAGGAGGCGA	0.512																																							uc003vew.2		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(4135-4137)GAT>CAT		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						235.0	210.0	219.0					7																	107575913		2203	4300	6503	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107575913C>G	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4135G>C	7.37:g.107575913C>G	ENSP00000222399:p.Asp1379His		Somatic				LAMB1_uc003vev.2_Missense_Mutation_p.D1403H	p.D1379H	NM_002291	NP_002282	WXS	Illumina HiSeq	Unspecified	P07942	LAMB1_HUMAN			27	4470	-			1379			Potential.|Domain II.		Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.4135G>C	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000656	0.74818	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.33438	1.41;1.41	5.19	4.29	0.51040	.	.	.	.	.	T	0.52008	0.1708	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	0.982;1.0	D;D	0.83275	0.914;0.996	T	0.52109	-0.8619	9	0.42905	T	0.14	.	15.1028	0.72296	0.1425:0.8575:0.0:0.0	.	1379;1403	P07942;G3XAI2	LAMB1_HUMAN;.	H	1403;1379	ENSP00000377191:D1403H;ENSP00000222399:D1379H	ENSP00000222399:D1379H	D	-	1	0	LAMB1	107363149	1.000000	0.71417	0.959000	0.39883	0.991000	0.79684	4.485000	0.60279	1.385000	0.46445	0.655000	0.94253	GAT		0.512	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		20	162	0	0	0	0.00152264	0	20	162				
LAMB1	3912	broad.mit.edu	37	7	107580657	107580657	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:107580657G>T	ENST00000222399.6	-	25	3768	c.3538C>A	c.(3538-3540)Cac>Aac	p.H1180N	CTB-13F3.1_ENST00000608515.1_RNA|LAMB1_ENST00000393561.1_Missense_Mutation_p.H1204N	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1180	Domain II.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						AAGCACTGGTGGCAGGGTGTG	0.577																																							uc003vew.2		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(3538-3540)CAC>AAC		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						135.0	111.0	119.0					7																	107580657		2203	4300	6503	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107580657G>T	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3538C>A	7.37:g.107580657G>T	ENSP00000222399:p.His1180Asn		Somatic				LAMB1_uc003vev.2_Missense_Mutation_p.H1204N	p.H1180N	NM_002291	NP_002282	WXS	Illumina HiSeq	Unspecified	P07942	LAMB1_HUMAN			25	3873	-			1180			Domain II.		Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.3538C>A	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.802340	0.90538	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.33216	1.42;1.44	5.4	5.4	0.78164	EGF-like, laminin (1);	.	.	.	.	T	0.47021	0.1423	L	0.39898	1.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.09271	-1.0682	9	0.17832	T	0.49	.	19.3711	0.94488	0.0:0.0:1.0:0.0	.	1180;1204	P07942;G3XAI2	LAMB1_HUMAN;.	N	1204;1180	ENSP00000377191:H1204N;ENSP00000222399:H1180N	ENSP00000222399:H1180N	H	-	1	0	LAMB1	107367893	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.263000	0.95617	2.814000	0.96858	0.563000	0.77884	CAC		0.577	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		9	48	1	0	1.12685e-05	0.00448238	3.70408e-05	9	48				
PNPLA8	50640	broad.mit.edu	37	7	108128275	108128275	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:108128275C>G	ENST00000422087.1	-	10	2212	c.1806G>C	c.(1804-1806)tgG>tgC	p.W602C	PNPLA8_ENST00000388728.5_Intron|PNPLA8_ENST00000436062.1_Missense_Mutation_p.W602C|PNPLA8_ENST00000257694.8_Missense_Mutation_p.W602C|PNPLA8_ENST00000453144.1_Missense_Mutation_p.W502C|PNPLA8_ENST00000426128.2_Intron	NM_015723.3	NP_056538.1	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	602	Patatin.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|cell death (GO:0008219)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|linoleic acid metabolic process (GO:0043651)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine catabolic process (GO:0034638)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylethanolamine catabolic process (GO:0046338)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)			breast(5)|endometrium(1)|kidney(3)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(3)	29						TAATGGCCTGCCACATTTTAT	0.388																																							uc003vff.1		NA																	0				breast(2)	2						c.(1804-1806)TGG>TGC		patatin-like phospholipase domain containing 8							76.0	73.0	74.0					7																	108128275		2203	4300	6503	SO:0001583	missense	50640				fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity	g.chr7:108128275C>G	AF217519	CCDS34733.1, CCDS59075.1, CCDS59508.1	7q31	2012-07-31			ENSG00000135241	ENSG00000135241		"""Patatin-like phospholipase domain containing"""	28900	protein-coding gene	gene with protein product		612123				10744668, 10833412, 16799181, 19029121	Standard	NM_015723		Approved	IPLA2G, IPLA2-2, iPLA2gamma	uc003vfj.2	Q9NP80	OTTHUMG00000154870	ENST00000422087.1:c.1806G>C	7.37:g.108128275C>G	ENSP00000410804:p.Trp602Cys		Somatic				PNPLA8_uc003vfg.1_RNA|PNPLA8_uc003vfh.1_Missense_Mutation_p.W602C|PNPLA8_uc003vfi.1_Missense_Mutation_p.W502C|PNPLA8_uc003vfj.1_Missense_Mutation_p.W602C|PNPLA8_uc003vfk.1_Missense_Mutation_p.W502C	p.W602C	NM_015723	NP_056538	WXS	Illumina HiSeq	Unspecified	Q9NP80	PLPL8_HUMAN			10	2213	-			602			Patatin.		A4D0S1|C9JZI4|O95035|Q8N3I3|Q9H7T5|Q9NR17|Q9NUN2|Q9NZ79	Missense_Mutation	SNP	ENST00000422087.1	37	c.1806G>C	CCDS34733.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539903	0.85917	.	.	ENSG00000135241	ENST00000257694;ENST00000422087;ENST00000453144;ENST00000436062;ENST00000453085	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	5.97	5.97	0.96955	Acyl transferase/acyl hydrolase/lysophospholipase (1);Patatin/Phospholipase A2-related (1);	0.000000	0.85682	D	0.000000	D	0.88145	0.6358	M	0.86178	2.8	0.80722	D	1	D	0.55385	0.971	P	0.56563	0.801	D	0.88712	0.3223	10	0.66056	D	0.02	.	20.4135	0.99023	0.0:1.0:0.0:0.0	.	602	Q9NP80	PLPL8_HUMAN	C	602;602;502;602;502	ENSP00000257694:W602C;ENSP00000410804:W602C;ENSP00000387789:W502C;ENSP00000406779:W602C;ENSP00000402274:W502C	ENSP00000257694:W602C	W	-	3	0	PNPLA8	107915511	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.440000	0.80464	2.835000	0.97688	0.591000	0.81541	TGG		0.388	PNPLA8-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337475.1	NM_015723		11	47	0	0	0	0.000978159	0	11	47				
CPED1	79974	broad.mit.edu	37	7	120935629	120935629	+	Missense_Mutation	SNP	C	C	T	rs147434701	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:120935629C>T	ENST00000310396.5	+	23	3471	c.3004C>T	c.(3004-3006)Cat>Tat	p.H1002Y		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	1002						endoplasmic reticulum (GO:0005783)											ATCGCCATATCATGTCAGAGG	0.378																																							uc003vjq.3		NA																	0				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(3004-3006)CAT>TAT		hypothetical protein LOC79974 isoform 1		C	TYR/HIS	13,4393	20.2+/-43.8	0,13,2190	107.0	102.0	104.0		3004	5.7	1.0	7	dbSNP_134	104	0,8600		0,0,4300	yes	missense	C7orf58	NM_024913.4	83	0,13,6490	TT,TC,CC		0.0,0.2951,0.1	possibly-damaging	1002/1027	120935629	13,12993	2203	4300	6503	SO:0001583	missense	79974					endoplasmic reticulum		g.chr7:120935629C>T		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.3004C>T	7.37:g.120935629C>T	ENSP00000309772:p.His1002Tyr		Somatic					p.H1002Y	NM_024913	NP_079189	WXS	Illumina HiSeq	Unspecified	A4D0V7	CG058_HUMAN			23	3451	+	all_neural(327;0.117)		1002					A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	c.3004C>T	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373173	0.82573	0.002951	0.0	ENSG00000106034	ENST00000310396	D	0.87729	-2.29	5.65	5.65	0.86999	.	0.119316	0.56097	D	0.000027	D	0.92909	0.7744	M	0.67953	2.075	0.80722	D	1	D	0.76494	0.999	D	0.68483	0.958	D	0.92935	0.6367	10	0.87932	D	0	.	20.0965	0.97849	0.0:1.0:0.0:0.0	.	1002	A4D0V7	CG058_HUMAN	Y	1002	ENSP00000309772:H1002Y	ENSP00000309772:H1002Y	H	+	1	0	C7orf58	120722865	1.000000	0.71417	0.997000	0.53966	0.783000	0.44284	3.725000	0.54970	2.824000	0.97209	0.655000	0.94253	CAT		0.378	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		23	103	0	0	0	0.000878237	0	23	103				
POT1	25913	broad.mit.edu	37	7	124503463	124503463	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:124503463C>A	ENST00000357628.3	-	8	1085	c.487G>T	c.(487-489)Gac>Tac	p.D163Y	POT1_ENST00000393329.1_Missense_Mutation_p.D32Y	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	163					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						CAAGTCAGGTCAAAATACTGC	0.403																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	uc003vlm.2		NA																	0				central_nervous_system(1)	1						c.(487-489)GAC>TAC		protection of telomeres 1 isoform 1							129.0	119.0	122.0					7																	124503463		2203	4300	6503	SO:0001583	missense	25913				DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity	g.chr7:124503463C>A	AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.487G>T	7.37:g.124503463C>A	ENSP00000350249:p.Asp163Tyr		Somatic				POT1_uc011koe.1_RNA|POT1_uc003vlk.2_RNA|POT1_uc003vll.2_RNA|POT1_uc003vlo.2_Missense_Mutation_p.D32Y|POT1_uc003vln.2_RNA	p.D163Y	NM_015450	NP_056265	WXS	Illumina HiSeq	Unspecified	Q9NUX5	POTE1_HUMAN			8	1088	-			163					O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	ENST00000357628.3	37	c.487G>T	CCDS5793.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.352462	0.82132	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391	T;T	0.61980	0.06;0.12	5.47	5.47	0.80525	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.79799	0.4508	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.81844	-0.0746	10	0.87932	D	0	-8.3439	18.3303	0.90267	0.0:1.0:0.0:0.0	.	163	Q9NUX5	POTE1_HUMAN	Y	163;32;163;163;163;162	ENSP00000350249:D163Y;ENSP00000377002:D32Y	ENSP00000265391:D162Y	D	-	1	0	POT1	124290699	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.372000	0.59530	2.559000	0.86315	0.650000	0.86243	GAC		0.403	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347861.1			21	97	1	0	1.10513e-12	0.00229938	4.8952e-12	21	97				
EXOC4	60412	broad.mit.edu	37	7	133160178	133160178	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:133160178G>A	ENST00000253861.4	+	8	1308	c.1279G>A	c.(1279-1281)Gcc>Acc	p.A427T	EXOC4_ENST00000539845.1_Missense_Mutation_p.A326T|EXOC4_ENST00000393161.2_Missense_Mutation_p.A427T	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	427					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				AGAGTTTGCAGCCTTTTTTGC	0.378																																							uc003vrk.2		NA																	0				ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9						c.(1279-1281)GCC>ACC		SEC8 protein isoform a							126.0	129.0	128.0					7																	133160178		2203	4300	6503	SO:0001583	missense	60412				vesicle docking involved in exocytosis	exocyst	protein N-terminus binding	g.chr7:133160178G>A	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1279G>A	7.37:g.133160178G>A	ENSP00000253861:p.Ala427Thr		Somatic				EXOC4_uc011kpo.1_Missense_Mutation_p.A326T|EXOC4_uc003vri.2_Missense_Mutation_p.A427T|EXOC4_uc003vrj.2_Missense_Mutation_p.A427T	p.A427T	NM_021807	NP_068579	WXS	Illumina HiSeq	Unspecified	Q96A65	EXOC4_HUMAN			8	1314	+		Esophageal squamous(399;0.129)	427					E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	c.1279G>A	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978191	0.53720	.	.	ENSG00000131558	ENST00000253861;ENST00000393161;ENST00000546185;ENST00000539845	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.43545	0.1252	L	0.29908	0.895	0.80722	D	1	B;B	0.32781	0.141;0.384	B;B	0.23716	0.031;0.048	T	0.36504	-0.9745	9	0.12430	T	0.62	.	18.6365	0.91380	0.0:0.0:1.0:0.0	.	427;427	Q96A65;Q8TAR2	EXOC4_HUMAN;.	T	427;427;46;326	.	ENSP00000253861:A427T	A	+	1	0	EXOC4	132810718	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	5.964000	0.70379	2.485000	0.83878	0.557000	0.71058	GCC		0.378	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807		30	136	0	0	0	0.00375469	0	30	136				
CALD1	800	broad.mit.edu	37	7	134613555	134613555	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:134613555G>A	ENST00000361675.2	+	4	351	c.122G>A	c.(121-123)cGg>cAg	p.R41Q	CALD1_ENST00000361901.2_Missense_Mutation_p.R41Q|CALD1_ENST00000361388.2_Missense_Mutation_p.R41Q|CALD1_ENST00000495522.1_Missense_Mutation_p.R35Q|CALD1_ENST00000422748.1_Missense_Mutation_p.R41Q|CALD1_ENST00000424922.1_Missense_Mutation_p.R35Q|CALD1_ENST00000393118.2_Missense_Mutation_p.R35Q|CALD1_ENST00000417172.1_Missense_Mutation_p.R41Q|CALD1_ENST00000543443.1_Missense_Mutation_p.R46Q			Q05682	CALD1_HUMAN	caldesmon 1	41	Myosin and calmodulin-binding. {ECO:0000250}.|Poly-Arg.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						GCCCGGGAACGGCGCCGCCGA	0.587																																							uc003vrz.2		NA																	0					0						c.(121-123)CGG>CAG		caldesmon 1 isoform 1							51.0	48.0	49.0					7																	134613555		2203	4300	6503	SO:0001583	missense	800				cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding	g.chr7:134613555G>A	M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.122G>A	7.37:g.134613555G>A	ENSP00000354826:p.Arg41Gln		Somatic				CALD1_uc003vry.2_Missense_Mutation_p.R41Q|CALD1_uc003vsa.2_Missense_Mutation_p.R41Q|CALD1_uc003vsb.2_Missense_Mutation_p.R41Q|CALD1_uc010lmm.2_Missense_Mutation_p.R41Q|CALD1_uc011kpt.1_5'UTR|CALD1_uc003vsc.2_Missense_Mutation_p.R35Q|CALD1_uc003vsd.2_Missense_Mutation_p.R35Q|CALD1_uc011kpu.1_Missense_Mutation_p.R46Q|CALD1_uc011kpv.1_5'UTR	p.R41Q	NM_033138	NP_149129	WXS	Illumina HiSeq	Unspecified	Q05682	CALD1_HUMAN			4	581	+			41			Poly-Arg.|Myosin and calmodulin-binding (By similarity).		A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	ENST00000361675.2	37	c.122G>A	CCDS5835.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495489	0.85069	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000454108;ENST00000361675;ENST00000361901;ENST00000445569;ENST00000435928;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15	5.46	5.46	0.80206	.	0.000000	0.42548	D	0.000696	T	0.73048	0.3537	M	0.64567	1.98	0.27640	N	0.947764	D;D;D;D;D;D;D;D	0.67145	0.986;0.989;0.986;0.986;0.986;0.986;0.996;0.978	P;P;P;P;P;P;P;P	0.57776	0.535;0.665;0.535;0.535;0.535;0.535;0.827;0.665	T	0.67573	-0.5636	10	0.37606	T	0.19	-14.0062	17.4764	0.87660	0.0:0.0:1.0:0.0	.	46;41;35;35;41;41;41;41	F5H1Z9;A8K0X1;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;CALD1_HUMAN;.	Q	41;41;41;41;41;41;41;55;41;35;35;35;46	ENSP00000398826:R41Q;ENSP00000411476:R41Q;ENSP00000355000:R41Q;ENSP00000395710:R41Q;ENSP00000401988:R41Q;ENSP00000354826:R41Q;ENSP00000354513:R41Q;ENSP00000390926:R55Q;ENSP00000416611:R41Q;ENSP00000376826:R35Q;ENSP00000393621:R35Q;ENSP00000419673:R35Q;ENSP00000445641:R46Q	ENSP00000355000:R41Q	R	+	2	0	CALD1	134264095	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.297000	0.65704	2.552000	0.86080	0.491000	0.48974	CGG		0.587	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	NM_033138		6	26	0	0	0	0.00307968	0	6	26				
TAS2R4	50832	broad.mit.edu	37	7	141478324	141478324	+	Silent	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:141478324C>T	ENST00000247881.2	+	1	83	c.36C>T	c.(34-36)gcC>gcT	p.A12A	SSBP1_ENST00000465582.1_Intron	NM_016944.1	NP_058640.1	Q9NYW5	TA2R4_HUMAN	taste receptor, type 2, member 4	12					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|respiratory gaseous exchange (GO:0007585)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|large_intestine(4)|lung(2)	7	Melanoma(164;0.0171)			BRCA - Breast invasive adenocarcinoma(188;0.196)		CTATTATTGCCTCAGTTATTT	0.353																																							uc003vwq.1		NA																	0					0						c.(34-36)GCC>GCT		taste receptor T2R4							83.0	82.0	82.0					7																	141478324		2203	4300	6503	SO:0001819	synonymous_variant	50832				sensory perception of taste	cilium membrane	taste receptor activity	g.chr7:141478324C>T	AF227131	CCDS5868.1	7q31.3-q32	2012-08-22			ENSG00000127364	ENSG00000127364		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14911	protein-coding gene	gene with protein product		604869				10761934, 10761935	Standard	NM_016944		Approved	T2R4	uc003vwq.1	Q9NYW5	OTTHUMG00000157634	ENST00000247881.2:c.36C>T	7.37:g.141478324C>T			Somatic					p.A12A	NM_016944	NP_058640	WXS	Illumina HiSeq	Unspecified	Q9NYW5	TA2R4_HUMAN		BRCA - Breast invasive adenocarcinoma(188;0.196)	1	36	+	Melanoma(164;0.0171)		12			Helical; Name=1; (Potential).		Q645W5|Q75MV8	Silent	SNP	ENST00000247881.2	37	c.36C>T	CCDS5868.1																																																																																				0.353	TAS2R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349285.1			12	50	0	0	0	0.000978159	0	12	50				
OR9A4	130075	broad.mit.edu	37	7	141619587	141619587	+	Silent	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:141619587G>C	ENST00000548136.1	+	1	971	c.912G>C	c.(910-912)ggG>ggC	p.G304G	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					TTCGGGATGGGGTGAAACGCT	0.423																																							uc003vwu.1		NA																	0				skin(1)	1						c.(910-912)GGG>GGC		olfactory receptor, family 9, subfamily A,							95.0	97.0	96.0					7																	141619587		2060	4243	6303	SO:0001819	synonymous_variant	130075				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:141619587G>C		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.912G>C	7.37:g.141619587G>C			Somatic					p.G304G	NM_001001656	NP_001001656	WXS	Illumina HiSeq	Unspecified	Q8NGU2	OR9A4_HUMAN			1	912	+	Melanoma(164;0.0171)		304			Cytoplasmic (Potential).		B9EGV6|Q6IFI4	Silent	SNP	ENST00000548136.1	37	c.912G>C	CCDS43661.1																																																																																				0.423	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	NM_001001656		12	57	0	0	0	0.00136819	0	12	57				
OR6V1	346517	broad.mit.edu	37	7	142749748	142749748	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:142749748C>A	ENST00000418316.1	+	1	332	c.311C>A	c.(310-312)tCc>tAc	p.S104Y		NM_001001667.1	NP_001001667.1	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V, member 1	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	20	Melanoma(164;0.059)					TTCCACTTTTCCCTGGGGTCC	0.562																																							uc011ksv.1		NA																	0				ovary(1)	1						c.(310-312)TCC>TAC		olfactory receptor, family 6, subfamily V,							153.0	158.0	156.0					7																	142749748		2141	4270	6411	SO:0001583	missense	346517				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:142749748C>A		CCDS47728.1	7q34	2014-05-06			ENSG00000225781	ENSG00000225781		"""GPCR / Class A : Olfactory receptors"""	15090	protein-coding gene	gene with protein product						12732197	Standard	NM_001001667		Approved	GPR138	uc011ksv.2	Q8N148	OTTHUMG00000158385	ENST00000418316.1:c.311C>A	7.37:g.142749748C>A	ENSP00000396085:p.Ser104Tyr		Somatic					p.S104Y	NM_001001667	NP_001001667	WXS	Illumina HiSeq	Unspecified	Q8N148	OR6V1_HUMAN			1	311	+	Melanoma(164;0.059)		104			Helical; Name=3; (Potential).		A4D2I0|B9EH48|Q6IF70	Missense_Mutation	SNP	ENST00000418316.1	37	c.311C>A	CCDS47728.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.302156	0.40694	.	.	ENSG00000225781	ENST00000418316	T	0.01397	4.94	4.53	2.72	0.32119	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02807	0.0084	L	0.58969	1.84	0.09310	N	1	D	0.58620	0.983	P	0.48982	0.597	T	0.46414	-0.9193	9	0.46703	T	0.11	.	6.3151	0.21186	0.0:0.6951:0.0:0.3049	.	104	Q8N148	OR6V1_HUMAN	Y	104	ENSP00000396085:S104Y	ENSP00000396085:S104Y	S	+	2	0	OR6V1	142459870	0.001000	0.12720	0.174000	0.22961	0.920000	0.55202	1.056000	0.30480	0.527000	0.28560	0.655000	0.94253	TCC		0.562	OR6V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350860.1			14	73	1	0	1.36491e-13	0.00185496	6.20874e-13	14	73				
OR2A5	393046	broad.mit.edu	37	7	143748240	143748240	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:143748240G>T	ENST00000408906.2	+	1	780	c.746G>T	c.(745-747)gGa>gTa	p.G249V		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					TGCATGGTGGGACTCTTCTTT	0.587																																							uc011ktw.1		NA																	0				ovary(3)	3						c.(745-747)GGA>GTA		olfactory receptor, family 2, subfamily A,							97.0	97.0	97.0					7																	143748240		2033	4192	6225	SO:0001583	missense	393046				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143748240G>T	U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.746G>T	7.37:g.143748240G>T	ENSP00000386208:p.Gly249Val		Somatic					p.G249V	NM_012365	NP_036497	WXS	Illumina HiSeq	Unspecified	Q96R48	OR2A5_HUMAN			1	746	+	Melanoma(164;0.0783)		249			Helical; Name=6; (Potential).		B9EGX2|O43885|O43888	Missense_Mutation	SNP	ENST00000408906.2	37	c.746G>T	CCDS43668.1	.	.	.	.	.	.	.	.	.	.	G	8.368	0.834645	0.16820	.	.	ENSG00000221836	ENST00000408906	T	0.29142	1.58	5.37	5.37	0.77165	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32416	U	0.006126	T	0.28962	0.0719	N	0.13168	0.305	0.40880	D	0.983986	P	0.44044	0.825	P	0.54924	0.764	T	0.03473	-1.1033	10	0.18276	T	0.48	.	11.5247	0.50573	0.0:0.0:0.8216:0.1784	.	249	Q96R48	OR2A5_HUMAN	V	249	ENSP00000386208:G249V	ENSP00000386208:G249V	G	+	2	0	OR2A5	143379173	0.000000	0.05858	0.945000	0.38365	0.179000	0.23085	0.816000	0.27267	2.797000	0.96272	0.650000	0.86243	GGA		0.587	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349986.1			9	68	1	0	5.4927e-09	0.00448238	2.15716e-08	9	68				
CDK5	1020	broad.mit.edu	37	7	150752397	150752397	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:150752397T>A	ENST00000485972.1	-	8	1228	c.547A>T	c.(547-549)Atc>Ttc	p.I183F	CDK5_ENST00000297518.4_Missense_Mutation_p.I151F|SLC4A2_ENST00000485713.1_5'Flank	NM_004935.3	NP_004926.1	Q00535	CDK5_HUMAN	cyclin-dependent kinase 5	183	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|behavioral response to cocaine (GO:0048148)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|central nervous system neuron development (GO:0021954)|cerebellar cortex formation (GO:0021697)|corpus callosum development (GO:0022038)|cortical actin cytoskeleton organization (GO:0030866)|dendrite morphogenesis (GO:0048813)|embryo development (GO:0009790)|hippocampus development (GO:0021766)|intracellular protein transport (GO:0006886)|layer formation in cerebral cortex (GO:0021819)|motor neuron axon guidance (GO:0008045)|negative regulation of axon extension (GO:0030517)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of proteolysis (GO:0045861)|negative regulation of synaptic plasticity (GO:0031914)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|nucleocytoplasmic transport (GO:0006913)|oligodendrocyte differentiation (GO:0048709)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphorylation (GO:0016310)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein targeting to membrane (GO:0090314)|protein autophosphorylation (GO:0046777)|protein localization to synapse (GO:0035418)|receptor catabolic process (GO:0032801)|receptor clustering (GO:0043113)|regulated secretory pathway (GO:0045055)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|rhythmic process (GO:0048511)|Schwann cell development (GO:0014044)|sensory perception of pain (GO:0019233)|serine phosphorylation of STAT3 protein (GO:0033136)|skeletal muscle tissue development (GO:0007519)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)|visual learning (GO:0008542)	axon (GO:0030424)|cell junction (GO:0030054)|cyclin-dependent protein kinase 5 holoenzyme complex (GO:0016533)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activator activity (GO:0030549)|ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|ErbB-2 class receptor binding (GO:0005176)|ErbB-3 class receptor binding (GO:0043125)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			central_nervous_system(1)|endometrium(2)|lung(5)|urinary_tract(1)	9		Breast(660;0.159)|Ovarian(593;0.182)	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.008)|Lung(243;0.00942)|BRCA - Breast invasive adenocarcinoma(188;0.242)		CACATGTCGATGGACGTGGAG	0.582																																							uc003wir.1		NA																	0				lung(1)|central_nervous_system(1)	2						c.(547-549)ATC>TTC		cyclin-dependent kinase 5 isoform 1							60.0	67.0	65.0					7																	150752397		2046	4183	6229	SO:0001583	missense	1020				activation of pro-apoptotic gene products|blood coagulation|cell division|cell proliferation|embryo development|negative regulation of transcription, DNA-dependent|positive regulation of neuron apoptosis	axon|cytosol|dendrite|growth cone|lamellipodium|membrane|neuromuscular junction|neuronal cell body	acetylcholine receptor activator activity|ATP binding|cyclin-dependent protein kinase activity|ErbB-2 class receptor binding|ErbB-3 class receptor binding|tau-protein kinase activity	g.chr7:150752397T>A	X66364	CCDS47748.1, CCDS55184.1	7q36	2011-11-08			ENSG00000164885	ENSG00000164885		"""Cyclin-dependent kinases"""	1774	protein-coding gene	gene with protein product		123831				8275715, 1639063	Standard	NM_001164410		Approved	PSSALRE	uc003wir.2	Q00535	OTTHUMG00000158414	ENST00000485972.1:c.547A>T	7.37:g.150752397T>A	ENSP00000419782:p.Ile183Phe		Somatic				CDK5_uc003wis.1_Missense_Mutation_p.I151F	p.I183F	NM_004935	NP_004926	WXS	Illumina HiSeq	Unspecified	Q00535	CDK5_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.008)|Lung(243;0.00942)|BRCA - Breast invasive adenocarcinoma(188;0.242)	8	608	-		Breast(660;0.159)|Ovarian(593;0.182)	183			Protein kinase.		A1XKG3	Missense_Mutation	SNP	ENST00000485972.1	37	c.547A>T	CCDS47748.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.674694	0.88445	.	.	ENSG00000164885	ENST00000485972;ENST00000297518	T;T	0.48836	0.8;0.8	4.63	4.63	0.57726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69088	0.3072	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79108	0.985;0.992	T	0.74423	-0.3670	10	0.87932	D	0	-12.8864	12.2949	0.54840	0.0:0.0:0.0:1.0	.	151;183	Q00535-2;Q00535	.;CDK5_HUMAN	F	183;151	ENSP00000419782:I183F;ENSP00000297518:I151F	ENSP00000297518:I151F	I	-	1	0	CDK5	150383330	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.503000	0.53340	2.062000	0.61559	0.459000	0.35465	ATC		0.582	CDK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350965.3			7	23	0	0	0	0.00448238	0	7	23				
KMT2C	58508	broad.mit.edu	37	7	151856020	151856020	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:151856020C>G	ENST00000262189.6	-	44	11816	c.11598G>C	c.(11596-11598)aaG>aaC	p.K3866N	KMT2C_ENST00000355193.2_Missense_Mutation_p.K3866N	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3866					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTTTCCTTTTCTTTGAGCGAG	0.483																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(11596-11598)AAG>AAC		myeloid/lymphoid or mixed-lineage leukemia 3							339.0	304.0	316.0					7																	151856020		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151856020C>G	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11598G>C	7.37:g.151856020C>G	ENSP00000262189:p.Lys3866Asn		Somatic				MLL3_uc003wkz.2_Missense_Mutation_p.K2927N|MLL3_uc003wkx.2_5'Flank|MLL3_uc003wky.2_Missense_Mutation_p.K1375N	p.K3866N	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	44	11817	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	3866					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.11598G>C	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.45|15.45	2.836239|2.836239	0.50951|0.50951	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000360104|ENST00000262189;ENST00000355193;ENST00000424877	.|D;D;D	.|0.93426	.|-2.45;-2.43;-3.22	5.56|5.56	3.74|3.74	0.42951|0.42951	.|.	.|0.000000	.|0.45361	.|U	.|0.000363	D|D	0.95421|0.95421	0.8513|0.8513	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.999;1.0;1.0	.|D;D;D	.|0.91635	.|0.994;0.997;0.999	D|D	0.94893|0.94893	0.8049|0.8049	5|10	.|0.62326	.|D	.|0.03	.|.	9.173|9.173	0.37093|0.37093	0.0:0.7813:0.0:0.2187|0.0:0.7813:0.0:0.2187	.|.	.|3866;2927;3866	.|Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	.|MLL3_HUMAN;.;.	Q|N	1372|3866;3866;452	.|ENSP00000262189:K3866N;ENSP00000347325:K3866N;ENSP00000410411:K452N	.|ENSP00000262189:K3866N	E|K	-|-	1|3	0|2	MLL3|MLL3	151486953|151486953	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	1.636000|1.636000	0.37144|0.37144	1.494000|1.494000	0.48533|0.48533	-0.218000|-0.218000	0.12543|0.12543	GAA|AAG		0.483	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			16	149	0	0	0	0.00316338	0	16	149				
KMT2C	58508	broad.mit.edu	37	7	151945133	151945133	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr7:151945133T>A	ENST00000262189.6	-	14	2604	c.2386A>T	c.(2386-2388)Atg>Ttg	p.M796L	KMT2C_ENST00000355193.2_Missense_Mutation_p.M796L	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	796					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTATGCAGCATGTCATGCGAA	0.448																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(2386-2388)ATG>TTG		myeloid/lymphoid or mixed-lineage leukemia 3							515.0	463.0	480.0					7																	151945133		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151945133T>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2386A>T	7.37:g.151945133T>A	ENSP00000262189:p.Met796Leu		Somatic					p.M796L	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	14	2605	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	796					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.2386A>T	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	T	8.020	0.759480	0.15846	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.81739	-1.53;-1.53	5.68	-0.694	0.11294	.	0.604139	0.14731	N	0.301764	T	0.59280	0.2182	N	0.24115	0.695	0.24296	N	0.995142	B	0.02656	0.0	B	0.01281	0.0	T	0.45205	-0.9277	10	0.02654	T	1	.	7.5068	0.27549	0.0:0.4289:0.1281:0.443	.	796	Q8NEZ4	MLL3_HUMAN	L	796	ENSP00000262189:M796L;ENSP00000347325:M796L	ENSP00000262189:M796L	M	-	1	0	MLL3	151576066	0.000000	0.05858	0.147000	0.22382	0.562000	0.35680	-0.737000	0.04877	-0.116000	0.11893	0.528000	0.53228	ATG		0.448	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			27	561	0	0	0	0.001512	0	27	561				
RP1L1	94137	broad.mit.edu	37	8	10467395	10467395	+	Missense_Mutation	SNP	C	C	T	rs199653359	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:10467395C>T	ENST00000382483.3	-	4	4436	c.4213G>A	c.(4213-4215)Gtc>Atc	p.V1405I		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1485	8 X 16 AA approximate tandem repeats of T-E-E-G-L-Q-E-E-G-V-Q-L-E-E-T-K.		Missing (in allele RP1L1-1).|Missing (in allele RP1L1-2).|Missing (in allele RP1L1-3).|Missing (in allele RP1L1-4).|Missing (in allele RP1L1-5).		cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.V1405I(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TGCCCGTGGACGCTTCCTTCT	0.562													c|||	3	0.000599042	0.0	0.0014	5008	,	,		18752	0.0		0.001	False		,,,				2504	0.001						uc003wtc.2		NA																	1	Substitution - Missense(1)	p.V1405I(1)	breast(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(4213-4215)GTC>ATC		retinitis pigmentosa 1-like 1							343.0	368.0	360.0					8																	10467395		1987	4152	6139	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10467395C>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4213G>A	8.37:g.10467395C>T	ENSP00000371923:p.Val1405Ile		Somatic					p.V1405I	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	4442	-			1405					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.4213G>A	CCDS43708.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	c	4.600	0.111503	0.08831	.	.	ENSG00000183638	ENST00000382483	T	0.05649	3.41	4.35	-3.2	0.05156	.	.	.	.	.	T	0.04634	0.0126	L	0.32530	0.975	0.09310	N	1	B	0.25312	0.123	B	0.10450	0.005	T	0.36866	-0.9730	9	0.49607	T	0.09	-0.0388	7.2686	0.26244	0.0:0.4456:0.1122:0.4421	.	1405	A6NKC6	.	I	1405	ENSP00000371923:V1405I	ENSP00000371923:V1405I	V	-	1	0	RP1L1	10504805	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.072000	0.03434	-0.583000	0.05921	-0.334000	0.08254	GTC		0.562	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			64	211	0	0	0	0.00361006	0	64	211				
DLC1	10395	broad.mit.edu	37	8	12943362	12943362	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:12943362G>C	ENST00000276297.4	-	18	4954	c.4545C>G	c.(4543-4545)ttC>ttG	p.F1515L	DLC1_ENST00000520226.1_Missense_Mutation_p.F1004L|DLC1_ENST00000512044.2_Missense_Mutation_p.F1112L|DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000358919.2_Missense_Mutation_p.F1078L	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1515	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TCTGGTTACTGAAGGAATCCC	0.433																																							uc003wwm.2		NA																	0				ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						c.(4543-4545)TTC>TTG		deleted in liver cancer 1 isoform 1							205.0	182.0	190.0					8																	12943362		2203	4300	6503	SO:0001583	missense	10395				actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding	g.chr8:12943362G>C	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.4545C>G	8.37:g.12943362G>C	ENSP00000276297:p.Phe1515Leu		Somatic				DLC1_uc003wwk.1_Missense_Mutation_p.F1078L|DLC1_uc003wwl.1_Missense_Mutation_p.F1112L|DLC1_uc011kxx.1_Missense_Mutation_p.F1004L	p.F1515L	NM_182643	NP_872584	WXS	Illumina HiSeq	Unspecified	Q96QB1	RHG07_HUMAN			18	4989	-			1515			START.		B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	c.4545C>G	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025689	0.75390	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23	5.17	4.29	0.51040	Lipid-binding START (2);	0.000000	0.85682	D	0.000000	D	0.85995	0.5827	M	0.76574	2.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.976	D	0.86958	0.2090	10	0.87932	D	0	.	10.2361	0.43284	0.1508:0.0:0.8492:0.0	.	1515;1112;1078	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	L	1515;1078;454;1112;1004	ENSP00000276297:F1515L;ENSP00000351797:F1078L;ENSP00000422595:F1112L;ENSP00000428028:F1004L	ENSP00000276297:F1515L	F	-	3	2	DLC1	12987733	1.000000	0.71417	0.967000	0.41034	0.994000	0.84299	3.443000	0.52907	1.551000	0.49450	0.655000	0.94253	TTC		0.433	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094		4	67	0	0	0	0.00024832	0	4	67				
UNC5D	137970	broad.mit.edu	37	8	35608192	35608192	+	Nonsense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:35608192T>A	ENST00000404895.2	+	13	2356	c.2028T>A	c.(2026-2028)taT>taA	p.Y676*	UNC5D_ENST00000287272.2_Nonsense_Mutation_p.Y607*|UNC5D_ENST00000420357.1_Nonsense_Mutation_p.Y609*|UNC5D_ENST00000449677.1_Nonsense_Mutation_p.Y252*|UNC5D_ENST00000416672.1_Nonsense_Mutation_p.Y681*|UNC5D_ENST00000453357.2_Nonsense_Mutation_p.Y671*	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	676					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TTGGGACCTATGCGCTCACTG	0.512																																							uc003xjr.1		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6						c.(2026-2028)TAT>TAA		unc-5 homolog D precursor							257.0	214.0	228.0					8																	35608192		2203	4300	6503	SO:0001587	stop_gained	137970				apoptosis|axon guidance	integral to membrane	receptor activity	g.chr8:35608192T>A	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2028T>A	8.37:g.35608192T>A	ENSP00000385143:p.Tyr676*		Somatic				UNC5D_uc003xjs.1_Nonsense_Mutation_p.Y671*|UNC5D_uc003xju.1_Nonsense_Mutation_p.Y252*	p.Y676*	NM_080872	NP_543148	WXS	Illumina HiSeq	Unspecified	Q6UXZ4	UNC5D_HUMAN		READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)	13	2356	+			676			Cytoplasmic (Potential).		Q8WYP7	Nonsense_Mutation	SNP	ENST00000404895.2	37	c.2028T>A	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	T	31	5.071642	0.93950	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	.	.	.	5.9	-5.5	0.02576	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.4481	13.9945	0.64388	0.0:0.4423:0.0:0.5577	.	.	.	.	X	676;609;607;681;671;252	.	ENSP00000287272:Y607X	Y	+	3	2	UNC5D	35727734	0.988000	0.35896	0.405000	0.26409	0.764000	0.43329	0.173000	0.16724	-1.037000	0.03283	0.533000	0.62120	TAT		0.512	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			13	78	0	0	0	0.00185496	0	13	78				
SNTG1	54212	broad.mit.edu	37	8	51314850	51314850	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:51314850G>T	ENST00000522124.1	+	4	769	c.108G>T	c.(106-108)ttG>ttT	p.L36F	SNTG1_ENST00000517473.1_Missense_Mutation_p.L36F|SNTG1_ENST00000518864.1_Missense_Mutation_p.L36F|SNTG1_ENST00000276467.5_Missense_Mutation_p.L36F	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	36					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				AAGACATTTTGATGATCCAGG	0.383																																							uc010lxy.1		NA																	0				ovary(5)	5						c.(106-108)TTG>TTT		syntrophin, gamma 1							215.0	212.0	213.0					8																	51314850		2203	4300	6503	SO:0001583	missense	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51314850G>T	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.108G>T	8.37:g.51314850G>T	ENSP00000429842:p.Leu36Phe		Somatic				SNTG1_uc003xqs.1_Missense_Mutation_p.L36F|SNTG1_uc010lxz.1_Missense_Mutation_p.L36F|SNTG1_uc011ldl.1_RNA	p.L36F	NM_018967	NP_061840	WXS	Illumina HiSeq	Unspecified	Q9NSN8	SNTG1_HUMAN			5	479	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)	36					Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	c.108G>T	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.931445	0.73442	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000523085;ENST00000276467	T;T;T;T	0.37584	1.19;1.19;1.92;1.92	4.96	4.96	0.65561	PDZ/DHR/GLGF (1);	0.000000	0.64402	D	0.000001	T	0.62696	0.2449	M	0.79123	2.44	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.91635	0.999;0.979	T	0.68281	-0.5450	10	0.87932	D	0	.	17.204	0.86913	0.0:0.0:1.0:0.0	.	36;36	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	F	36	ENSP00000429276:L36F;ENSP00000429842:L36F;ENSP00000431123:L36F;ENSP00000276467:L36F	ENSP00000276467:L36F	L	+	3	2	SNTG1	51477403	1.000000	0.71417	0.992000	0.48379	0.976000	0.68499	4.660000	0.61511	2.314000	0.78098	0.655000	0.94253	TTG		0.383	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			25	121	1	0	6.32553e-13	0.00465635	2.82973e-12	25	121				
MCMDC2	157777	broad.mit.edu	37	8	67790844	67790844	+	Missense_Mutation	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:67790844A>G	ENST00000422365.2	+	6	688	c.517A>G	c.(517-519)Aca>Gca	p.T173A	MCMDC2_ENST00000313616.5_Missense_Mutation_p.T173A|MCMDC2_ENST00000492775.1_Missense_Mutation_p.T173A|MCMDC2_ENST00000396592.3_Missense_Mutation_p.T173A|MCMDC2_ENST00000469823.1_3'UTR|MCMDC2_ENST00000541540.1_Missense_Mutation_p.T110A	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	173					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						GCCTGGTGCTACAGAATCTGC	0.333																																							uc003xwz.3		NA																	0				ovary(1)	1						c.(517-519)ACA>GCA		minichromosome maintenance complex							144.0	148.0	147.0					8																	67790844		2203	4300	6503	SO:0001583	missense	157777				DNA replication		ATP binding|DNA binding	g.chr8:67790844A>G	BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.517A>G	8.37:g.67790844A>G	ENSP00000413632:p.Thr173Ala		Somatic				C8orf45_uc003xwv.2_Missense_Mutation_p.T173A|C8orf45_uc011lev.1_Missense_Mutation_p.T173A|C8orf45_uc011lew.1_Missense_Mutation_p.T104A|C8orf45_uc011lex.1_5'UTR|C8orf45_uc003xwy.3_Missense_Mutation_p.T173A	p.T173A	NM_173518	NP_775789	WXS	Illumina HiSeq	Unspecified	Q4G0Z9	CH045_HUMAN	Epithelial(68;0.00384)|OV - Ovarian serous cystadenocarcinoma(28;0.00913)|all cancers(69;0.0175)|BRCA - Breast invasive adenocarcinoma(89;0.206)		6	688	+	Breast(64;0.186)		173					B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Missense_Mutation	SNP	ENST00000422365.2	37	c.517A>G	CCDS6197.2	.	.	.	.	.	.	.	.	.	.	A	24.7	4.556274	0.86231	.	.	ENSG00000178460	ENST00000379356;ENST00000396592;ENST00000422365;ENST00000492775;ENST00000313616;ENST00000541540	T;T;T;T;T	0.24908	3.68;3.68;3.68;3.68;1.83	5.47	5.47	0.80525	.	0.050517	0.85682	D	0.000000	T	0.45696	0.1355	M	0.64997	1.995	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.83275	0.996;0.991;0.991;0.996	T	0.33007	-0.9885	10	0.12103	T	0.63	-15.3627	15.5503	0.76145	1.0:0.0:0.0:0.0	.	110;173;173;173	Q4G0Z9-4;Q4G0Z9;B4DXX4;G3XAN3	.;CH045_HUMAN;.;.	A	45;173;173;173;173;110	ENSP00000379837:T173A;ENSP00000413632:T173A;ENSP00000428037:T173A;ENSP00000317234:T173A;ENSP00000445629:T110A	ENSP00000317234:T173A	T	+	1	0	C8orf45	67953398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.519000	0.90563	2.064000	0.61679	0.482000	0.46254	ACA		0.333	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347350.1	NM_173518		28	102	0	0	0	0.00178596	0	28	102				
SULF1	23213	broad.mit.edu	37	8	70539471	70539471	+	Missense_Mutation	SNP	T	T	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:70539471T>C	ENST00000260128.4	+	16	2594	c.1877T>C	c.(1876-1878)aTc>aCc	p.I626T	SULF1_ENST00000402687.4_Missense_Mutation_p.I626T|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000458141.2_Missense_Mutation_p.I626T|SULF1_ENST00000419716.3_Missense_Mutation_p.I626T	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	626					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			AATGACTCTATCCATTGTGAG	0.388																																							uc010lza.1		NA																	0				central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7						c.(1876-1878)ATC>ACC		sulfatase 1 precursor							166.0	150.0	155.0					8																	70539471		2203	4300	6503	SO:0001583	missense	23213				apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding	g.chr8:70539471T>C	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1877T>C	8.37:g.70539471T>C	ENSP00000260128:p.Ile626Thr		Somatic				SULF1_uc003xyd.2_Missense_Mutation_p.I626T|SULF1_uc003xye.2_Missense_Mutation_p.I626T|SULF1_uc003xyf.2_Missense_Mutation_p.I626T|SULF1_uc003xyg.2_Missense_Mutation_p.I626T|SULF1_uc003xyh.1_RNA|SULF1_uc003xyi.1_5'Flank	p.I626T	NM_015170	NP_055985	WXS	Illumina HiSeq	Unspecified	Q8IWU6	SULF1_HUMAN	Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)		16	2594	+	Breast(64;0.0654)		626					Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	c.1877T>C	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.549897	0.86127	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	D;D;D;D	0.99186	-5.53;-5.53;-5.53;-5.53	6.04	6.04	0.98038	Extracellular sulfatase, C-terminal (1);Alkaline-phosphatase-like, core domain (1);	0.051713	0.85682	D	0.000000	D	0.98726	0.9572	M	0.63428	1.95	0.48452	D	0.999659	D	0.56746	0.977	P	0.54174	0.744	D	0.99734	1.1013	10	0.87932	D	0	.	16.5885	0.84745	0.0:0.0:0.0:1.0	.	626	Q8IWU6	SULF1_HUMAN	T	626	ENSP00000403040:I626T;ENSP00000260128:I626T;ENSP00000385704:I626T;ENSP00000390315:I626T	ENSP00000260128:I626T	I	+	2	0	SULF1	70702025	1.000000	0.71417	0.998000	0.56505	0.690000	0.40134	7.903000	0.87398	2.317000	0.78254	0.460000	0.39030	ATC		0.388	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170		4	32	0	0	0	0.00024832	0	4	32				
SLCO5A1	81796	broad.mit.edu	37	8	70667841	70667841	+	Missense_Mutation	SNP	A	A	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:70667841A>C	ENST00000260126.4	-	4	1782	c.1076T>G	c.(1075-1077)tTt>tGt	p.F359C	SLCO5A1_ENST00000530307.1_Missense_Mutation_p.F359C|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.F359C	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	359						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TATCACAAGAAACATTGCAAT	0.343																																							uc003xyl.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(1075-1077)TTT>TGT		solute carrier organic anion transporter family,							56.0	58.0	57.0					8																	70667841		2203	4300	6503	SO:0001583	missense	81796					integral to membrane|plasma membrane	transporter activity	g.chr8:70667841A>C	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1076T>G	8.37:g.70667841A>C	ENSP00000260126:p.Phe359Cys		Somatic				SLCO5A1_uc010lzb.2_Missense_Mutation_p.F359C|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Missense_Mutation_p.F359C|SLCO5A1_uc010lzc.2_Missense_Mutation_p.F359C	p.F359C	NM_030958	NP_112220	WXS	Illumina HiSeq	Unspecified	Q9H2Y9	SO5A1_HUMAN	Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)		4	1783	-	Breast(64;0.0654)		359			Helical; Name=6; (Potential).		A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	c.1076T>G	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.956220	0.73902	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.59772	0.24;0.24;0.24	5.29	5.29	0.74685	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.064498	0.64402	D	0.000005	T	0.62853	0.2462	L	0.33668	1.02	0.40769	D	0.983072	P;P;D;P	0.54207	0.948;0.822;0.965;0.936	P;P;P;P	0.59288	0.748;0.575;0.855;0.694	T	0.64305	-0.6439	10	0.44086	T	0.13	.	15.3968	0.74801	1.0:0.0:0.0:0.0	.	359;359;359;359	B4DR09;E9PKK5;Q9H2Y9;G3V1C0	.;.;SO5A1_HUMAN;.	C	359	ENSP00000260126:F359C;ENSP00000434422:F359C;ENSP00000431611:F359C	ENSP00000260126:F359C	F	-	2	0	SLCO5A1	70830395	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.297000	0.78799	2.215000	0.71742	0.460000	0.39030	TTT		0.343	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958		7	44	0	0	0	0.000673444	0	7	44				
ZFHX4	79776	broad.mit.edu	37	8	77765873	77765873	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:77765873G>T	ENST00000521891.2	+	10	7164	c.6716G>T	c.(6715-6717)aGg>aTg	p.R2239M	ZFHX4_ENST00000455469.2_Missense_Mutation_p.R2194M|ZFHX4_ENST00000050961.6_Missense_Mutation_p.R2194M|ZFHX4_ENST00000518282.1_Missense_Mutation_p.R2213M	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TACCAGCTTAGGGTTCTGCAA	0.398										HNSCC(33;0.089)																													uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(6580-6582)AGG>ATG		zinc finger homeodomain 4							64.0	61.0	62.0					8																	77765873		1869	4101	5970	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77765873G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6716G>T	8.37:g.77765873G>T	ENSP00000430497:p.Arg2239Met	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.R2239M|ZFHX4_uc003yaw.1_Missense_Mutation_p.R2194M	p.R2194M	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	6968	+			2194			Homeobox 2.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.6581G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	16.46	3.130488	0.56828	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	D;D;D;D	0.96365	-3.99;-3.99;-3.99;-3.99	4.05	4.05	0.47172	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.42964	U	0.000637	D	0.96880	0.8981	L	0.39566	1.225	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.997	D	0.97786	1.0235	10	0.87932	D	0	.	16.7528	0.85490	0.0:0.0:1.0:0.0	.	2194;2194;2239	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	M	2239;2223;2194;2194;2213	ENSP00000430497:R2239M;ENSP00000399605:R2194M;ENSP00000050961:R2194M;ENSP00000430848:R2213M	ENSP00000050961:R2194M	R	+	2	0	ZFHX4	77928428	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	9.522000	0.98032	2.270000	0.75569	0.555000	0.69702	AGG		0.398	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		17	20	1	0	3.41278e-10	0.000566183	1.39295e-09	17	20				
RUNX1T1	862	broad.mit.edu	37	8	92998434	92998434	+	Silent	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:92998434G>T	ENST00000523629.1	-	9	1651	c.1197C>A	c.(1195-1197)gcC>gcA	p.A399A	RUNX1T1_ENST00000360348.2_Silent_p.A362A|RUNX1T1_ENST00000436581.2_Silent_p.A410A|RUNX1T1_ENST00000396218.1_Silent_p.A372A|RUNX1T1_ENST00000520724.1_Silent_p.A362A|RUNX1T1_ENST00000422361.2_Silent_p.A362A|RUNX1T1_ENST00000518844.1_Silent_p.A372A|RUNX1T1_ENST00000265814.3_Silent_p.A399A	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	399					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TTAAGTCCTCGGCGTCACTGT	0.512																																							uc003yfd.2		NA																	0				lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16						c.(1195-1197)GCC>GCA		acute myelogenous leukemia 1 translocation 1							105.0	109.0	108.0					8																	92998434		2203	4300	6503	SO:0001819	synonymous_variant	862				generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:92998434G>T	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1197C>A	8.37:g.92998434G>T			Somatic				RUNX1T1_uc003yfc.1_Silent_p.A372A|RUNX1T1_uc003yfe.1_Silent_p.A362A|RUNX1T1_uc010mao.2_Silent_p.A372A|RUNX1T1_uc011lgi.1_Silent_p.A410A|RUNX1T1_uc010man.1_5'UTR|RUNX1T1_uc003yfb.1_Silent_p.A362A	p.A399A	NM_175634	NP_783552	WXS	Illumina HiSeq	Unspecified	Q06455	MTG8_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0141)		8	1281	-			399					B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Silent	SNP	ENST00000523629.1	37	c.1197C>A	CCDS6256.1																																																																																				0.512	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635		49	90	1	0	3.86236e-30	0.00361006	1.94703e-29	49	90				
VPS13B	157680	broad.mit.edu	37	8	100148930	100148930	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:100148930G>T	ENST00000358544.2	+	12	1712	c.1601G>T	c.(1600-1602)gGg>gTg	p.G534V	VPS13B_ENST00000355155.1_Missense_Mutation_p.G534V|VPS13B_ENST00000357162.2_Missense_Mutation_p.G534V|VPS13B_ENST00000395996.1_Missense_Mutation_p.G534V	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	534					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CAACGGTTTGGGGCTTTTTAT	0.368																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(1600-1602)GGG>GTG		vacuolar protein sorting 13B isoform 5							260.0	252.0	255.0					8																	100148930		2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100148930G>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1601G>T	8.37:g.100148930G>T	ENSP00000351346:p.Gly534Val		Somatic				VPS13B_uc003yiw.2_Missense_Mutation_p.G534V|VPS13B_uc003yit.2_Missense_Mutation_p.G534V|VPS13B_uc003yiu.1_Missense_Mutation_p.G534V|VPS13B_uc003yix.1_Missense_Mutation_p.G5V	p.G534V	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		12	1712	+	Breast(36;3.73e-07)		534					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.1601G>T	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968439	0.74131	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996	T;T;T;T	0.80304	-1.36;-0.72;-0.71;-0.4	5.1	5.1	0.69264	.	0.179117	0.38164	N	0.001786	D	0.85418	0.5692	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0	D	0.86779	0.1978	10	0.59425	D	0.04	.	18.5289	0.90984	0.0:0.0:1.0:0.0	.	534;534;534;534;534	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4	.;.;VP13B_HUMAN;.;.	V	534	ENSP00000347281:G534V;ENSP00000349685:G534V;ENSP00000351346:G534V;ENSP00000379318:G534V	ENSP00000347281:G534V	G	+	2	0	VPS13B	100218106	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	9.199000	0.95003	2.377000	0.81083	0.460000	0.39030	GGG		0.368	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		41	183	1	0	3.77016e-25	0.00321405	1.88648e-24	41	183				
VPS13B	157680	broad.mit.edu	37	8	100182324	100182324	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:100182324C>T	ENST00000358544.2	+	16	2377	c.2266C>T	c.(2266-2268)Cct>Tct	p.P756S	VPS13B_ENST00000355155.1_Missense_Mutation_p.P756S|VPS13B_ENST00000521932.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.P756S|VPS13B_ENST00000395996.1_Missense_Mutation_p.P756S	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	756					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTACTGCTTACCTGTACCAGT	0.393																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(2266-2268)CCT>TCT		vacuolar protein sorting 13B isoform 5							186.0	161.0	169.0					8																	100182324		2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100182324C>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.2266C>T	8.37:g.100182324C>T	ENSP00000351346:p.Pro756Ser		Somatic				VPS13B_uc003yiw.2_Missense_Mutation_p.P756S|VPS13B_uc003yit.2_Missense_Mutation_p.P756S|VPS13B_uc003yiu.1_Missense_Mutation_p.P756S|VPS13B_uc003yix.1_Missense_Mutation_p.P227S	p.P756S	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		16	2377	+	Breast(36;3.73e-07)		756					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.2266C>T	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.642747	0.67244	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996	T;T;T;T	0.80393	-1.37;-0.59;-0.6;-0.36	5.47	5.47	0.80525	.	0.085531	0.50627	D	0.000108	T	0.78502	0.4293	L	0.29908	0.895	0.47737	D	0.9995	P;P;P;P;P	0.46142	0.763;0.873;0.799;0.763;0.763	P;P;B;B;B	0.47346	0.463;0.544;0.343;0.288;0.288	T	0.77747	-0.2472	10	0.39692	T	0.17	.	19.6887	0.95989	0.0:1.0:0.0:0.0	.	756;756;756;756;756	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4	.;.;VP13B_HUMAN;.;.	S	756	ENSP00000347281:P756S;ENSP00000349685:P756S;ENSP00000351346:P756S;ENSP00000379318:P756S	ENSP00000347281:P756S	P	+	1	0	VPS13B	100251500	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.269000	0.72558	2.722000	0.93159	0.557000	0.71058	CCT		0.393	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		8	103	0	0	0	0.000442599	0	8	103				
KLHL38	340359	broad.mit.edu	37	8	124664033	124664033	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:124664033G>T	ENST00000325995.7	-	1	1157	c.1134C>A	c.(1132-1134)agC>agA	p.S378R	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	378										breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						TATGGGCAGTGCTTCTGTGGG	0.552																																							uc003yqs.1		NA																	0					0						c.(1132-1134)AGC>AGA		kelch-like 38							72.0	72.0	72.0					8																	124664033		2008	4178	6186	SO:0001583	missense	340359							g.chr8:124664033G>T		CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.1134C>A	8.37:g.124664033G>T	ENSP00000321475:p.Ser378Arg		Somatic					p.S378R	NM_001081675	NP_001075144	WXS	Illumina HiSeq	Unspecified	Q2WGJ6	KLH38_HUMAN			1	1158	-			378			Kelch 2.		A0PK12	Missense_Mutation	SNP	ENST00000325995.7	37	c.1134C>A	CCDS43766.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617764	0.46736	.	.	ENSG00000175946	ENST00000325995	T	0.78481	-1.18	5.18	3.36	0.38483	Kelch-type beta propeller (1);	0.114600	0.85682	D	0.000000	D	0.88451	0.6440	M	0.92604	3.325	0.41351	D	0.987362	D	0.64830	0.994	D	0.68943	0.961	D	0.88912	0.3360	10	0.56958	D	0.05	.	8.9235	0.35625	0.2939:0.0:0.7061:0.0	.	378	Q2WGJ6	KLH38_HUMAN	R	378	ENSP00000321475:S378R	ENSP00000321475:S378R	S	-	3	2	KLHL38	124733214	0.997000	0.39634	0.959000	0.39883	0.989000	0.77384	0.927000	0.28818	1.317000	0.45149	0.561000	0.74099	AGC		0.552	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381288.1			6	34	1	0	8.12818e-05	0.00198382	0.000254784	6	34				
PHF20L1	51105	broad.mit.edu	37	8	133837560	133837560	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr8:133837560A>T	ENST00000395386.2	+	14	1987	c.1688A>T	c.(1687-1689)cAc>cTc	p.H563L	PHF20L1_ENST00000220847.7_5'UTR|PHF20L1_ENST00000395390.2_Missense_Mutation_p.H538L|CTC-137K3.1_ENST00000602328.1_RNA	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	563	Lys-rich.						zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			gacaaagaTCACTACAGACCA	0.313																																							uc003ytt.2		NA																	0				ovary(2)	2						c.(1687-1689)CAC>CTC		PHD finger protein 20-like 1 isoform 1							16.0	16.0	16.0					8																	133837560		1975	4183	6158	SO:0001583	missense	51105						nucleic acid binding|zinc ion binding	g.chr8:133837560A>T	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.1688A>T	8.37:g.133837560A>T	ENSP00000378784:p.His563Leu		Somatic				PHF20L1_uc003yts.2_3'UTR|PHF20L1_uc011lja.1_Missense_Mutation_p.H537L|PHF20L1_uc003ytu.1_RNA	p.H563L	NM_016018	NP_057102	WXS	Illumina HiSeq	Unspecified	A8MW92	P20L1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;4.46e-05)		14	2013	+	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		563			Lys-rich.		A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	37	c.1688A>T	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	A	11.29	1.595158	0.28445	.	.	ENSG00000129292	ENST00000395386;ENST00000395390	T;T	0.28666	1.6;1.6	5.66	5.66	0.87406	.	.	.	.	.	T	0.36635	0.0974	N	0.17082	0.46	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.75484	0.986;0.969	T	0.15665	-1.0429	9	0.27785	T	0.31	-8.3518	12.2779	0.54747	1.0:0.0:0.0:0.0	.	538;563	F8W9L8;A8MW92	.;P20L1_HUMAN	L	563;538	ENSP00000378784:H563L;ENSP00000378788:H538L	ENSP00000378784:H563L	H	+	2	0	PHF20L1	133906742	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.213000	0.51153	2.156000	0.67533	0.533000	0.62120	CAC		0.313	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018		7	23	0	0	0	0.00198382	0	7	23				
TEK	7010	broad.mit.edu	37	9	27185554	27185554	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:27185554C>A	ENST00000380036.4	+	9	1696	c.1254C>A	c.(1252-1254)gaC>gaA	p.D418E	TEK_ENST00000406359.4_Missense_Mutation_p.D375E|TEK_ENST00000519097.1_Missense_Mutation_p.D271E	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	418	Ig-like C2-type 2.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	TCCCCCCTGACTCAGGAGTTT	0.428																																							uc003zqi.3		NA																	0				ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12						c.(1252-1254)GAC>GAA		TEK tyrosine kinase, endothelial precursor							134.0	128.0	130.0					9																	27185554		2203	4300	6503	SO:0001583	missense	7010				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr9:27185554C>A	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.1254C>A	9.37:g.27185554C>A	ENSP00000369375:p.Asp418Glu		Somatic				TEK_uc011lno.1_Missense_Mutation_p.D375E|TEK_uc011lnp.1_Missense_Mutation_p.D271E|TEK_uc003zqj.1_Missense_Mutation_p.D352E	p.D418E	NM_000459	NP_000450	WXS	Illumina HiSeq	Unspecified	Q02763	TIE2_HUMAN		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	9	1696	+		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)	418			Extracellular (Potential).|Ig-like C2-type 2.		A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	c.1254C>A	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.172595	0.57584	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000346448;ENST00000406359;ENST00000519080	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	6.08	4.18	0.49190	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000063	T	0.63965	0.2556	L	0.58101	1.795	0.31390	N	0.677957	D;P;D;P	0.63046	0.984;0.898;0.992;0.695	D;P;D;B	0.79108	0.967;0.459;0.992;0.258	T	0.66056	-0.6018	10	0.42905	T	0.14	.	8.1172	0.30950	0.0:0.692:0.0:0.308	.	271;451;375;418	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	E	271;418;375;375;228	ENSP00000430686:D271E;ENSP00000369375:D418E;ENSP00000383977:D375E;ENSP00000428337:D228E	ENSP00000343716:D375E	D	+	3	2	TEK	27175554	0.990000	0.36364	1.000000	0.80357	0.994000	0.84299	0.068000	0.14531	1.520000	0.48965	0.591000	0.81541	GAC		0.428	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3			18	63	1	0	1.15919e-05	0.00121646	3.80112e-05	18	63				
DDX58	23586	broad.mit.edu	37	9	32500928	32500928	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:32500928T>A	ENST00000379883.2	-	2	273	c.116A>T	c.(115-117)cAg>cTg	p.Q39L	DDX58_ENST00000545044.1_5'UTR|DDX58_ENST00000379882.1_Intron|DDX58_ENST00000379868.1_5'UTR|DDX58_ENST00000542096.1_5'UTR	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	39	CARD 1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		CTGAATATACTGCACCTCTTC	0.443																																							uc003zra.2		NA																	0				ovary(2)|liver(1)|pancreas(1)	4						c.(115-117)CAG>CTG		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide							94.0	94.0	94.0					9																	32500928		2203	4300	6503	SO:0001583	missense	23586				detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding	g.chr9:32500928T>A	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.116A>T	9.37:g.32500928T>A	ENSP00000369213:p.Gln39Leu		Somatic				DDX58_uc010mjj.2_RNA|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_5'UTR|DDX58_uc010mji.2_5'UTR	p.Q39L	NM_014314	NP_055129	WXS	Illumina HiSeq	Unspecified	O95786	DDX58_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)	2	274	-			39			CARD 1.		A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	ENST00000379883.2	37	c.116A>T	CCDS6526.1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.984473	0.53934	.	.	ENSG00000107201	ENST00000379883;ENST00000542960	T	0.05025	3.51	4.42	4.42	0.53409	.	0.268702	0.25011	N	0.033837	T	0.10423	0.0255	M	0.72479	2.2	0.80722	D	1	P	0.45531	0.86	B	0.42030	0.373	T	0.01600	-1.1315	10	0.87932	D	0	-12.7139	10.2414	0.43314	0.0:0.0:0.0:1.0	.	39	O95786	DDX58_HUMAN	L	39	ENSP00000369213:Q39L	ENSP00000369213:Q39L	Q	-	2	0	DDX58	32490928	0.970000	0.33590	0.972000	0.41901	0.924000	0.55760	3.207000	0.51106	1.997000	0.58415	0.533000	0.62120	CAG		0.443	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314		17	72	0	0	0	0.000958276	0	17	72				
TAF1L	138474	broad.mit.edu	37	9	32630111	32630112	+	Missense_Mutation	DNP	CA	CA	AT			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:32630111_32630112CA>AT	ENST00000242310.4	-	1	5555_5556	c.5466_5467TG>AT	c.(5464-5469)gaTGgg>gaATgg	p.1822_1823DG>EW		NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1822					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.G1823W(1)|p.G1823R(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTTCCGTGCCCATCCTTGTGTT	0.495																																							uc003zrg.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|kidney(1)	lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(5464-5469)GATGGG>GAATGG		TBP-associated factor RNA polymerase 1-like																																				SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32630111_32630112CA>AT	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.5466_5467delinsAT	9.37:g.32630111_32630112delinsAT	ENSP00000418379:p.D1822_G1823delinsEW		Somatic					p.1822_1823DG>EW	NM_153809	NP_722516	WXS	Illumina HiSeq	Unspecified	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	5556_5557	-			1822_1823					Q0VG57	Missense_Mutation	DNP	ENST00000242310.4	37	c.5466_5467TG>AT	CCDS35003.1																																																																																				0.495	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			6	31	0	0	0	6.4e-05	0	6	31				
FRMPD1	22844	broad.mit.edu	37	9	37745609	37745609	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:37745609C>A	ENST00000539465.1	+	16	4173	c.3580C>A	c.(3580-3582)Cag>Aag	p.Q1194K	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.Q1194K			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1194						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GCAAGGCTGCCAGGCTCAAGA	0.522																																							uc004aag.1		NA																	0				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(3580-3582)CAG>AAG		FERM and PDZ domain containing 1							69.0	74.0	72.0					9																	37745609		2203	4300	6503	SO:0001583	missense	22844					cytoskeleton|cytosol|plasma membrane		g.chr9:37745609C>A	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3580C>A	9.37:g.37745609C>A	ENSP00000444411:p.Gln1194Lys		Somatic				FRMPD1_uc004aah.1_Missense_Mutation_p.Q1194K	p.Q1194K	NM_014907	NP_055722	WXS	Illumina HiSeq	Unspecified	Q5SYB0	FRPD1_HUMAN		GBM - Glioblastoma multiforme(29;0.00655)	16	3624	+			1194					B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	c.3580C>A	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	C	6.589	0.476949	0.12521	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.07114	3.22;3.22	4.96	4.05	0.47172	.	1.223500	0.05368	N	0.534954	T	0.06962	0.0177	N	0.24115	0.695	0.21473	N	0.999671	B	0.22800	0.075	B	0.19148	0.024	T	0.37502	-0.9703	10	0.07175	T	0.84	-0.8577	11.3244	0.49440	0.0:0.8158:0.1842:0.0	.	1194	Q5SYB0	FRPD1_HUMAN	K	1194	ENSP00000366995:Q1194K;ENSP00000444411:Q1194K	ENSP00000366995:Q1194K	Q	+	1	0	FRMPD1	37735609	0.001000	0.12720	0.136000	0.22124	0.145000	0.21501	0.355000	0.20163	1.064000	0.40671	-0.305000	0.09177	CAG		0.522	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		7	61	1	0	5.18039e-06	0.00307968	1.7629e-05	7	61				
TRPM6	140803	broad.mit.edu	37	9	77357520	77357520	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:77357520C>A	ENST00000360774.1	-	33	5394	c.5157G>T	c.(5155-5157)atG>atT	p.M1719I	TRPM6_ENST00000376864.4_Missense_Mutation_p.M1723I|TRPM6_ENST00000449912.2_Missense_Mutation_p.M1714I|TRPM6_ENST00000376872.3_Missense_Mutation_p.M674I|TRPM6_ENST00000451710.3_Missense_Mutation_p.M1723I|TRPM6_ENST00000376871.3_Missense_Mutation_p.M556I|TRPM6_ENST00000361255.3_Missense_Mutation_p.M1714I	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1719					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GAGAAAGCCTCATTAAATTAT	0.373																																							uc004ajl.1		NA																	0				lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(5155-5157)ATG>ATT		transient receptor potential cation channel,							117.0	112.0	114.0					9																	77357520		2203	4300	6503	SO:0001583	missense	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77357520C>A	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5157G>T	9.37:g.77357520C>A	ENSP00000354006:p.Met1719Ile		Somatic				TRPM6_uc004ajk.1_Missense_Mutation_p.M1714I|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.M670I|TRPM6_uc010mpd.1_Missense_Mutation_p.M552I|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Missense_Mutation_p.M675I	p.M1719I	NM_017662	NP_060132	WXS	Illumina HiSeq	Unspecified	Q9BX84	TRPM6_HUMAN			33	5395	-			1719			Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	c.5157G>T	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549195	0.86127	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376864	T;T;T;T;T;T;T	0.59083	3.34;3.34;0.29;0.29;3.34;3.34;3.34	5.74	5.74	0.90152	Protein kinase-like domain (1);	0.073855	0.85682	D	0.000000	T	0.70684	0.3252	L	0.39245	1.2	0.80722	D	1	D;D;P;P;P	0.76494	0.998;0.999;0.862;0.554;0.915	D;D;B;B;P	0.73380	0.931;0.98;0.287;0.141;0.48	T	0.72037	-0.4411	10	0.87932	D	0	.	19.9214	0.97087	0.0:1.0:0.0:0.0	.	552;670;1719;1714;1714	Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;TRPM6_HUMAN;.;.	I	1719;1723;674;556;1714;1714;1723	ENSP00000354006:M1719I;ENSP00000407341:M1723I;ENSP00000366068:M674I;ENSP00000366067:M556I;ENSP00000396672:M1714I;ENSP00000354962:M1714I;ENSP00000366060:M1723I	ENSP00000354006:M1719I	M	-	3	0	TRPM6	76547340	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.441000	0.80485	2.716000	0.92895	0.563000	0.77884	ATG		0.373	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		10	39	1	0	2.27111e-07	0.00136819	8.27027e-07	10	39				
PSAT1	29968	broad.mit.edu	37	9	80916926	80916926	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:80916926G>T	ENST00000376588.3	+	3	246	c.178G>T	c.(178-180)Gtg>Ttg	p.V60L	PSAT1_ENST00000347159.2_Missense_Mutation_p.V60L	NM_058179.2	NP_478059.1	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1	60					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-serine biosynthetic process (GO:0006564)|pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	O-phospho-L-serine:2-oxoglutarate aminotransferase activity (GO:0004648)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	20						AGAGAATCTTGTGCGGGAATT	0.328																																					Colon(34;187 791 10662 18313 37609)	Colon(34;187 791 10662 18313 37609)	uc004ala.2		NA																	0				ovary(1)	1						c.(178-180)GTG>TTG		phosphoserine aminotransferase 1 isoform 1	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)						115.0	114.0	114.0					9																	80916926		2203	4300	6503	SO:0001583	missense	29968				L-serine biosynthetic process|pyridoxine biosynthetic process		O-phospho-L-serine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding	g.chr9:80916926G>T	BC004863	CCDS6659.1, CCDS6660.1	9q21.2	2008-08-11			ENSG00000135069	ENSG00000135069			19129	protein-coding gene	gene with protein product		610936				12633500, 3651428	Standard	NM_058179		Approved	PSA	uc004ala.3	Q9Y617	OTTHUMG00000020066	ENST00000376588.3:c.178G>T	9.37:g.80916926G>T	ENSP00000365773:p.Val60Leu		Somatic				PSAT1_uc004alb.2_Missense_Mutation_p.V60L	p.V60L	NM_058179	NP_478059	WXS	Illumina HiSeq	Unspecified	Q9Y617	SERC_HUMAN			3	246	+			60					Q5T7G5|Q5T7G6|Q96AW2|Q9BQ12	Missense_Mutation	SNP	ENST00000376588.3	37	c.178G>T	CCDS6660.1	.	.	.	.	.	.	.	.	.	.	G	0.107	-1.144148	0.01728	.	.	ENSG00000135069	ENST00000347159;ENST00000376588	T;T	0.57752	0.38;0.38	5.42	3.56	0.40772	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.349704	0.30235	N	0.010090	T	0.11495	0.0280	N	0.00268	-1.735	0.36495	D	0.86868	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.27365	-1.0076	10	0.02654	T	1	-7.8381	2.1218	0.03728	0.132:0.1349:0.3202:0.4129	.	60;60	Q9Y617-2;Q9Y617	.;SERC_HUMAN	L	60	ENSP00000317606:V60L;ENSP00000365773:V60L	ENSP00000317606:V60L	V	+	1	0	PSAT1	80106746	0.987000	0.35691	1.000000	0.80357	0.642000	0.38348	1.498000	0.35660	1.269000	0.44280	-0.181000	0.13052	GTG		0.328	PSAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052777.1	NM_021154		15	34	1	0	6.31663e-08	0.00316338	2.36392e-07	15	34				
SPATA31D1	389763	broad.mit.edu	37	9	84605877	84605877	+	Silent	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:84605877T>A	ENST00000344803.2	+	4	539	c.492T>A	c.(490-492)tcT>tcA	p.S164S		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	164					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTTCGGCTTCTGCGACTGAGT	0.572																																							uc004amn.2		NA																	0					0						c.(490-492)TCT>TCA		hypothetical protein LOC389763							120.0	119.0	119.0					9																	84605877		2008	4167	6175	SO:0001819	synonymous_variant	389763					integral to membrane		g.chr9:84605877T>A		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.492T>A	9.37:g.84605877T>A			Somatic					p.S164S	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	539	+			164						Silent	SNP	ENST00000344803.2	37	c.492T>A	CCDS47986.1																																																																																				0.572	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		7	47	0	0	0	0.00198382	0	7	47				
SPATA31C2	645961	broad.mit.edu	37	9	90746020	90746020	+	IGR	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:90746020C>A								U6 (132770 upstream) : U3 (243163 downstream)																							CTCCCAGCACCTGCTGAGTAC	0.537																																							uc011lti.1		NA																	0					NA						c.(1930-1932)CAG>CAT		SubName: Full=cDNA FLJ59639;							31.0	27.0	29.0					9																	90746020		692	1591	2283	SO:0001628	intergenic_variant	0							g.chr9:90746020C>A																													9.37:g.90746020C>A			Somatic					p.Q644H			WXS	Illumina HiSeq	Unspecified					4	1961	-									Missense_Mutation	SNP		37	c.1932G>T																																																																																				0	0.537									22	85	1	0	1.10923e-09	0.00278032	4.47335e-09	22	85				
TEX10	54881	broad.mit.edu	37	9	103092397	103092397	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:103092397T>A	ENST00000374902.4	-	6	1481	c.1305A>T	c.(1303-1305)ttA>ttT	p.L435F	TEX10_ENST00000537512.1_Missense_Mutation_p.L370F|TEX10_ENST00000535814.1_Missense_Mutation_p.L438F	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	435						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		CAGACAGTGTTAAATTCAGTA	0.388																																							uc004bas.2		NA																	0				ovary(1)|skin(1)	2						c.(1303-1305)TTA>TTT		testis expressed 10 isoform 1							132.0	124.0	127.0					9																	103092397		2203	4300	6503	SO:0001583	missense	54881					integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding	g.chr9:103092397T>A	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1305A>T	9.37:g.103092397T>A	ENSP00000364037:p.Leu435Phe		Somatic				TEX10_uc011lvf.1_Missense_Mutation_p.L274F|TEX10_uc011lvg.1_Missense_Mutation_p.L438F|TEX10_uc011lvh.1_Missense_Mutation_p.L370F	p.L435F	NM_017746	NP_060216	WXS	Illumina HiSeq	Unspecified	Q9NXF1	TEX10_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;0.157)	6	1520	-		Acute lymphoblastic leukemia(62;0.0527)	435					B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	ENST00000374902.4	37	c.1305A>T	CCDS6748.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.197712	0.79015	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730;ENST00000429235;ENST00000537512	T;T;T	0.65732	-0.17;-0.17;-0.17	5.18	5.18	0.71444	Armadillo-type fold (1);	0.145638	0.48767	D	0.000165	T	0.75236	0.3822	L	0.54323	1.7	0.49389	D	0.999787	D;D;D;D	0.89917	0.997;0.997;1.0;0.997	D;D;D;D	0.91635	0.916;0.916;0.999;0.916	T	0.77638	-0.2513	10	0.66056	D	0.02	-5.7742	15.3466	0.74343	0.0:0.0:0.0:1.0	.	370;438;303;435	B7Z9D5;B4DYV2;E7ERG2;Q9NXF1	.;.;.;TEX10_HUMAN	F	438;435;303;80;370	ENSP00000444555:L438F;ENSP00000364037:L435F;ENSP00000438120:L370F	ENSP00000364037:L435F	L	-	3	2	TEX10	102132218	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.815000	0.62634	2.084000	0.62774	0.533000	0.62120	TTA		0.388	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746		39	133	0	0	0	0.00148497	0	39	133				
CYLC2	1539	broad.mit.edu	37	9	105767379	105767379	+	Missense_Mutation	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:105767379G>A	ENST00000374798.3	+	5	536	c.466G>A	c.(466-468)Gat>Aat	p.D156N	CYLC2_ENST00000487798.1_Missense_Mutation_p.D156N	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	156	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.D156Y(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				agaaaagctagatgcaaagaa	0.353																																							uc004bbs.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(466-468)GAT>AAT		cylicin 2							63.0	59.0	60.0					9																	105767379		2202	4300	6502	SO:0001583	missense	1539				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton	g.chr9:105767379G>A	Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.466G>A	9.37:g.105767379G>A	ENSP00000420256:p.Asp156Asn		Somatic					p.D156N	NM_001340	NP_001331	WXS	Illumina HiSeq	Unspecified	Q14093	CYLC2_HUMAN			5	536	+		all_hematologic(171;0.125)	156			31 X 3 AA repeats of K-K-X.		B2R8F4|Q5VVJ9	Missense_Mutation	SNP	ENST00000374798.3	37	c.466G>A	CCDS35085.1	.	.	.	.	.	.	.	.	.	.	G	8.030	0.761633	0.15914	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.15952	2.38;2.38	4.03	3.14	0.36123	.	1.082360	0.07200	N	0.857290	T	0.15132	0.0365	L	0.48642	1.525	0.09310	N	1	B	0.29716	0.255	B	0.26416	0.069	T	0.32428	-0.9907	10	0.18276	T	0.48	8.0E-4	7.7136	0.28692	0.1157:0.0:0.8843:0.0	.	156	Q14093	CYLC2_HUMAN	N	156	ENSP00000420256:D156N;ENSP00000417674:D156N	ENSP00000420256:D156N	D	+	1	0	CYLC2	104807200	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	1.213000	0.32407	1.050000	0.40346	0.591000	0.81541	GAT		0.353	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053463.3	NM_001340		5	28	0	0	0	0.000602214	0	5	28				
OR13C4	138804	broad.mit.edu	37	9	107289036	107289037	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:107289036_107289037CC>AA	ENST00000277216.3	-	1	453_454	c.454_455GG>TT	c.(454-456)GGt>TTt	p.G152F		NM_001001919.1	NP_001001919.1	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C, member 4	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(2)|lung(14)|skin(1)	18						ATTGATTCCACCAGAAAGCCAT	0.426																																							uc011lvn.1		NA																	0				skin(1)	1						c.(454-456)GGT>TTT		olfactory receptor, family 13, subfamily C,																																				SO:0001583	missense	138804				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107289036_107289037CC>AA		CCDS35088.1	9q31.1	2013-09-24			ENSG00000148136	ENSG00000148136		"""GPCR / Class A : Olfactory receptors"""	14722	protein-coding gene	gene with protein product							Standard	NM_001001919		Approved		uc011lvn.2	Q8NGS5	OTTHUMG00000020407	ENST00000277216.3:c.454_455delinsAA	9.37:g.107289036_107289037delinsAA	ENSP00000277216:p.Gly152Phe		Somatic					p.G152F	NM_001001919	NP_001001919	WXS	Illumina HiSeq	Unspecified	Q8NGS5	O13C4_HUMAN			1	454_455	-			152			Helical; Name=4; (Potential).		Q6IF51|Q96R41	Missense_Mutation	DNP	ENST00000277216.3	37	c.454_455GG>TT	CCDS35088.1																																																																																				0.426	OR13C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053478.1			18	99	0	0	0	6.4e-05	0	18	99				
ABCA1	19	broad.mit.edu	37	9	107595033	107595033	+	Missense_Mutation	SNP	T	T	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:107595033T>C	ENST00000374736.3	-	12	1725	c.1331A>G	c.(1330-1332)gAc>gGc	p.D444G	ABCA1_ENST00000494467.1_5'Flank	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	444					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GTGGTCATTGTCCCTGCTGTC	0.458																																							uc004bcl.2		NA																	0				large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17						c.(1330-1332)GAC>GGC		ATP-binding cassette, sub-family A member 1	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						166.0	131.0	143.0					9																	107595033		2203	4300	6503	SO:0001583	missense	19				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding	g.chr9:107595033T>C	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.1331A>G	9.37:g.107595033T>C	ENSP00000363868:p.Asp444Gly		Somatic					p.D444G	NM_005502	NP_005493	WXS	Illumina HiSeq	Unspecified	O95477	ABCA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;0.023)	12	1644	-			444			Extracellular.		Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	c.1331A>G	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	T	4.383	0.070606	0.08436	.	.	ENSG00000165029	ENST00000374736	D	0.84516	-1.86	5.61	1.16	0.20824	.	0.643780	0.16694	N	0.203409	T	0.55800	0.1943	N	0.01109	-1.01	0.50467	D	0.999874	B	0.02656	0.0	B	0.01281	0.0	T	0.34204	-0.9838	10	0.20046	T	0.44	.	4.7373	0.12995	0.1305:0.5985:0.1154:0.1556	.	444	O95477	ABCA1_HUMAN	G	444	ENSP00000363868:D444G	ENSP00000363868:D444G	D	-	2	0	ABCA1	106634854	0.715000	0.27946	0.931000	0.37212	0.274000	0.26718	0.140000	0.16056	0.312000	0.23038	-0.230000	0.12252	GAC		0.458	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502		12	48	0	0	0	0.00316338	0	12	48				
ASTN2	23245	broad.mit.edu	37	9	120053783	120053783	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:120053783C>A	ENST00000313400.4	-	2	552	c.452G>T	c.(451-453)gGc>gTc	p.G151V	ASTN2_ENST00000373996.3_Missense_Mutation_p.G151V|ASTN2_ENST00000361209.2_Missense_Mutation_p.G151V|ASTN2_ENST00000361477.3_5'UTR			O75129	ASTN2_HUMAN	astrotactin 2	151					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CGCTGCTGTGCCAGACATCTC	0.602																																							uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(451-453)GGC>GTC		astrotactin 2 isoform c							44.0	40.0	41.0					9																	120053783		2203	4300	6503	SO:0001583	missense	23245					integral to membrane		g.chr9:120053783C>A	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.452G>T	9.37:g.120053783C>A	ENSP00000314038:p.Gly151Val		Somatic				ASTN2_uc004bjr.1_Missense_Mutation_p.G151V|ASTN2_uc004bjt.1_Missense_Mutation_p.G151V	p.G151V	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			2	553	-			151			Extracellular (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.452G>T		.	.	.	.	.	.	.	.	.	.	C	29.5	5.007536	0.93287	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.33438	1.62;1.61;1.41	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.51483	0.1677	L	0.46157	1.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.984	T	0.24905	-1.0147	9	.	.	.	-36.5691	20.3473	0.98799	0.0:1.0:0.0:0.0	.	151;151;151	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	V	151	ENSP00000314038:G151V;ENSP00000363108:G151V;ENSP00000354504:G151V	.	G	-	2	0	ASTN2	119093604	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.752000	0.85141	2.884000	0.98904	0.655000	0.94253	GGC		0.602	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		5	29	1	0	0.000602214	0.000602214	0.00178811	5	29				
TLR4	7099	broad.mit.edu	37	9	120470921	120470921	+	Silent	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:120470921C>T	ENST00000355622.6	+	2	275	c.174C>T	c.(172-174)aaC>aaT	p.N58N	RNU6-1082P_ENST00000364574.1_RNA|TLR4_ENST00000472304.1_Intron|TLR4_ENST00000394487.4_Silent_p.N18N	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	58					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	CAACCAAGAACCTGGACCTGA	0.443																																							uc004bjz.2		NA																	0				lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(172-174)AAC>AAT		toll-like receptor 4 precursor							156.0	159.0	158.0					9																	120470921		2203	4300	6503	SO:0001819	synonymous_variant	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120470921C>T	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.174C>T	9.37:g.120470921C>T			Somatic				TLR4_uc004bka.2_Silent_p.N18N|TLR4_uc004bkb.2_Intron	p.N58N	NM_138554	NP_612564	WXS	Illumina HiSeq	Unspecified	O00206	TLR4_HUMAN			2	465	+			58			LRR 1.|Extracellular (Potential).		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Silent	SNP	ENST00000355622.6	37	c.174C>T	CCDS6818.1																																																																																				0.443	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		20	127	0	0	0	0.00152264	0	20	127				
OR5C1	392391	broad.mit.edu	37	9	125552135	125552135	+	Silent	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:125552135C>A	ENST00000373680.2	+	1	986	c.924C>A	c.(922-924)acC>acA	p.T308T		NM_001001923.1	NP_001001923.1	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C, member 1	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(5)|skin(1)	20						TCAGGCAGACCTGGAGCCGAT	0.582																																							uc011lzd.1		NA																	0				pancreas(1)	1						c.(922-924)ACC>ACA		olfactory receptor, family 5, subfamily C,							61.0	53.0	56.0					9																	125552135		2203	4300	6503	SO:0001819	synonymous_variant	392391				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125552135C>A	AF399514	CCDS35131.1	9q34.2	2012-08-09			ENSG00000148215	ENSG00000148215		"""GPCR / Class A : Olfactory receptors"""	8331	protein-coding gene	gene with protein product				OR5C2P			Standard	NM_001001923		Approved	OR9-F, hRPK-465_F_21	uc011lzd.2	Q8NGR4	OTTHUMG00000020622	ENST00000373680.2:c.924C>A	9.37:g.125552135C>A			Somatic					p.T308T	NM_001001923	NP_001001923	WXS	Illumina HiSeq	Unspecified	Q8NGR4	OR5C1_HUMAN			1	924	+			308			Cytoplasmic (Potential).		B2RN54|B9EGT0|Q96RC4	Silent	SNP	ENST00000373680.2	37	c.924C>A	CCDS35131.1																																																																																				0.582	OR5C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053953.1			8	39	1	0	0.000274275	0.00448238	0.00083082	8	39				
DNM1	1759	broad.mit.edu	37	9	130984836	130984836	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:130984836C>G	ENST00000372923.3	+	8	1181	c.1089C>G	c.(1087-1089)aaC>aaG	p.N363K	DNM1_ENST00000341179.7_Missense_Mutation_p.N363K|DNM1_ENST00000393594.3_Missense_Mutation_p.N363K|DNM1_ENST00000486160.1_Missense_Mutation_p.N363K|DNM1_ENST00000475805.1_Missense_Mutation_p.N363K	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	363					endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						CCCGCATTAACCGAATCTTCC	0.592																																					GBM(113;146 1575 2722 28670 29921)	GBM(113;146 1575 2722 28670 29921)	uc011mau.1		NA																	0				ovary(2)	2						c.(1087-1089)AAC>AAG		dynamin 1 isoform 1							89.0	90.0	90.0					9																	130984836		2203	4300	6503	SO:0001583	missense	1759				receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity	g.chr9:130984836C>G	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1089C>G	9.37:g.130984836C>G	ENSP00000362014:p.Asn363Lys		Somatic				DNM1_uc010mxr.2_Missense_Mutation_p.N363K|DNM1_uc011mat.1_Missense_Mutation_p.N363K	p.N363K	NM_004408	NP_004399	WXS	Illumina HiSeq	Unspecified	Q05193	DYN1_HUMAN			8	1176	+			363					A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	ENST00000372923.3	37	c.1089C>G	CCDS6895.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917627	0.52546	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66	5.88	3.7	0.42460	Dynamin central domain (1);	0.000000	0.85682	D	0.000000	D	0.83866	0.5347	M	0.84683	2.71	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.83275	0.996;0.994;0.996	D	0.85446	0.1158	10	0.52906	T	0.07	-16.2891	12.1108	0.53838	0.1233:0.8052:0.0:0.0715	.	363;363;363	Q05193;Q05193-3;Q05193-2	DYN1_HUMAN;.;.	K	363;363;363;358;363;363	ENSP00000419225:N363K;ENSP00000345680:N363K;ENSP00000362014:N363K;ENSP00000377219:N363K;ENSP00000420045:N363K	ENSP00000345680:N363K	N	+	3	2	DNM1	130024657	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	1.647000	0.37260	1.487000	0.48415	0.555000	0.69702	AAC		0.592	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1	NM_004408		6	45	0	0	0	0.00448238	0	6	45				
TBC1D13	54662	broad.mit.edu	37	9	131568291	131568291	+	Missense_Mutation	SNP	A	A	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:131568291A>G	ENST00000372648.5	+	10	1222	c.1072A>G	c.(1072-1074)Atg>Gtg	p.M358V	TBC1D13_ENST00000539497.1_Missense_Mutation_p.M177V|TBC1D13_ENST00000223865.8_Missense_Mutation_p.M233V	NM_018201.3	NP_060671.3	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	358							Rab GTPase activator activity (GO:0005097)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6						CTGCTGCGCCATGCTCATGTG	0.622																																							uc010myj.2		NA																	0					0						c.(1072-1074)ATG>GTG		TBC1 domain family, member 13							93.0	65.0	74.0					9																	131568291		2203	4300	6503	SO:0001583	missense	54662					intracellular	Rab GTPase activator activity	g.chr9:131568291A>G	AK001605	CCDS6911.1, CCDS69677.1	9q34.13	2013-07-09			ENSG00000107021	ENSG00000107021			25571	protein-coding gene	gene with protein product						22762500	Standard	XM_005252060		Approved	FLJ10743	uc010myj.3	Q9NVG8	OTTHUMG00000020760	ENST00000372648.5:c.1072A>G	9.37:g.131568291A>G	ENSP00000361731:p.Met358Val		Somatic				TBC1D13_uc010myk.2_Missense_Mutation_p.M233V|TBC1D13_uc010myl.2_Missense_Mutation_p.M177V	p.M358V	NM_018201	NP_060671	WXS	Illumina HiSeq	Unspecified	Q9NVG8	TBC13_HUMAN			10	1195	+			358					A7E2E7|B3KW04|B9EGJ8|Q5T270|Q5T271	Missense_Mutation	SNP	ENST00000372648.5	37	c.1072A>G	CCDS6911.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.626064	0.87560	.	.	ENSG00000107021	ENST00000372648;ENST00000539497;ENST00000223865	T;T;T	0.23754	1.89;1.89;1.89	5.09	5.09	0.68999	Rab-GAP/TBC domain (3);	0.092424	0.85682	D	0.000000	T	0.54615	0.1869	M	0.90198	3.095	0.80722	D	1	P;P	0.51791	0.811;0.948	P;P	0.60068	0.828;0.868	T	0.64202	-0.6463	10	0.62326	D	0.03	-36.2589	14.2083	0.65748	1.0:0.0:0.0:0.0	.	233;358	Q9NVG8-2;Q9NVG8	.;TBC13_HUMAN	V	358;177;233	ENSP00000361731:M358V;ENSP00000437751:M177V;ENSP00000223865:M233V	ENSP00000223865:M233V	M	+	1	0	TBC1D13	130608112	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.020000	0.93667	2.146000	0.66826	0.459000	0.35465	ATG		0.622	TBC1D13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054496.1	NM_018201		7	21	0	0	0	0.00198382	0	7	21				
CAMSAP1	157922	broad.mit.edu	37	9	138719314	138719314	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:138719314C>T	ENST00000389532.4	-	8	1226	c.1162G>A	c.(1162-1164)Gtg>Atg	p.V388M	CAMSAP1_ENST00000409386.3_Missense_Mutation_p.V399M|CAMSAP1_ENST00000312405.6_Missense_Mutation_p.V110M|CAMSAP1_ENST00000483991.1_5'Flank	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	388					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GGCAGCTGCACGGGGGGCTGC	0.597																																							uc004cgr.3		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(1162-1164)GTG>ATG		calmodulin regulated spectrin-associated protein							53.0	47.0	49.0					9																	138719314		2203	4300	6503	SO:0001583	missense	157922					cytoplasm|microtubule		g.chr9:138719314C>T	AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.1162G>A	9.37:g.138719314C>T	ENSP00000374183:p.Val388Met		Somatic				CAMSAP1_uc004cgq.3_Missense_Mutation_p.V278M|CAMSAP1_uc010nbg.2_Missense_Mutation_p.V110M	p.V388M	NM_015447	NP_056262	WXS	Illumina HiSeq	Unspecified	Q5T5Y3	CAMP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)	8	1162	-			388					A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	c.1162G>A	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	C	3.535	-0.094931	0.07010	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.14893	2.48;2.47;2.47	3.59	-3.49	0.04724	.	1.170160	0.06243	N	0.690827	T	0.11707	0.0285	L	0.29908	0.895	0.09310	N	1	P;B	0.51147	0.942;0.168	B;B	0.38056	0.264;0.035	T	0.32241	-0.9914	10	0.87932	D	0	-7.5879	10.301	0.43653	0.0:0.4565:0.0:0.5435	.	388;399	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	M	388;110;399	ENSP00000374183:V388M;ENSP00000312463:V110M;ENSP00000386420:V399M	ENSP00000312463:V110M	V	-	1	0	CAMSAP1	137859135	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.499000	0.06413	-1.565000	0.01676	-0.736000	0.03550	GTG		0.597	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857		5	18	0	0	0	0.000602214	0	5	18				
TLR8	51311	broad.mit.edu	37	X	12939365	12939365	+	Missense_Mutation	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:12939365A>T	ENST00000218032.6	+	2	2293	c.2206A>T	c.(2206-2208)Agt>Tgt	p.S736C	TLR8_ENST00000311912.5_Missense_Mutation_p.S754C	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	736					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	TTCTGAAGTCAGTAGTCTGAA	0.413																																							uc004cve.2		NA																	0				ovary(4)|lung(2)|large_intestine(1)	7						c.(2206-2208)AGT>TGT		toll-like receptor 8 precursor							124.0	118.0	120.0					X																	12939365		2203	4300	6503	SO:0001583	missense	51311				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity	g.chrX:12939365A>T	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.2206A>T	X.37:g.12939365A>T	ENSP00000218032:p.Ser736Cys		Somatic				TLR8_uc004cvd.2_Missense_Mutation_p.S754C	p.S736C	NM_138636	NP_619542	WXS	Illumina HiSeq	Unspecified	Q9NR97	TLR8_HUMAN			2	2274	+			736			Extracellular (Potential).		B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	37	c.2206A>T	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	A	5.083	0.200916	0.09652	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.60040	0.22;0.22	5.82	3.26	0.37387	.	0.947625	0.08739	N	0.900811	T	0.67392	0.2888	M	0.73372	2.23	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.63113	0.911;0.911	T	0.52275	-0.8597	10	0.39692	T	0.17	.	2.0526	0.03574	0.4516:0.2458:0.0736:0.229	.	736;754	Q9NR97;D1CS70	TLR8_HUMAN;.	C	736;754	ENSP00000218032:S736C;ENSP00000312082:S754C	ENSP00000218032:S736C	S	+	1	0	TLR8	12849286	0.000000	0.05858	0.241000	0.24154	0.001000	0.01503	0.697000	0.25556	0.812000	0.34326	-0.377000	0.06932	AGT		0.413	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610		15	127	0	0	0	0.00316338	0	15	127				
SMS	6611	broad.mit.edu	37	X	21996187	21996187	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:21996187G>T	ENST00000404933.2	+	6	867	c.615G>T	c.(613-615)ttG>ttT	p.L205F	SMS_ENST00000379404.1_Missense_Mutation_p.L152F|SMS_ENST00000415881.2_Missense_Mutation_p.L109F	NM_004595.4	NP_004586.2	P52788	SPSY_HUMAN	spermine synthase	205	PABS. {ECO:0000255|PROSITE- ProRule:PRU00354}.				cellular nitrogen compound metabolic process (GO:0034641)|methionine metabolic process (GO:0006555)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	spermidine synthase activity (GO:0004766)|spermine synthase activity (GO:0016768)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(2)	14					Spermine(DB00127)	GAGGCATATTGTGTGAAATAG	0.428																																							uc004dag.2		NA																	0				ovary(1)	1						c.(613-615)TTG>TTT		spermine synthase	Spermine(DB00127)						131.0	113.0	119.0					X																	21996187		2203	4300	6503	SO:0001583	missense	6611				methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity	g.chrX:21996187G>T	AD001528	CCDS14203.1, CCDS59161.1	Xp22.1	2014-05-16			ENSG00000102172	ENSG00000102172			11123	protein-coding gene	gene with protein product		300105	"""Snyder-Robinson X-linked mental retardation syndrome"""	SRS		7546290, 9299240, 14508504	Standard	NM_004595		Approved	SPMSY, SpS, MRSR	uc004dag.4	P52788	OTTHUMG00000021239	ENST00000404933.2:c.615G>T	X.37:g.21996187G>T	ENSP00000385746:p.Leu205Phe		Somatic				SMS_uc011mjq.1_Missense_Mutation_p.L109F|SMS_uc004daf.1_Missense_Mutation_p.L152F|SMS_uc010nfs.2_5'Flank|SMS_uc010nft.2_5'Flank	p.L205F	NM_004595	NP_004586	WXS	Illumina HiSeq	Unspecified	P52788	SPSY_HUMAN			6	716	+			205					A6NHA7|A6NI34|B2R9M0|O00544|Q9UQS1	Missense_Mutation	SNP	ENST00000404933.2	37	c.615G>T	CCDS14203.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.14|13.14	2.149594|2.149594	0.37923|0.37923	.|.	.|.	ENSG00000102172|ENSG00000102172	ENST00000404933;ENST00000379404;ENST00000415881|ENST00000457085	T;T;T|.	0.80994|.	-1.44;-1.44;-1.44|.	5.56|5.56	1.56|1.56	0.23342|0.23342	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.65238|0.65238	0.2672|0.2672	M|M	0.86573|0.86573	2.825|2.825	0.53688|0.53688	D|D	0.999973|0.999973	D;B|.	0.89917|.	1.0;0.079|.	D;B|.	0.91635|.	0.999;0.068|.	T|T	0.61888|0.61888	-0.6970|-0.6970	10|5	0.87932|.	D|.	0|.	-27.1416|-27.1416	1.1383|1.1383	0.01759|0.01759	0.3406:0.1632:0.3342:0.162|0.3406:0.1632:0.3342:0.162	.|.	205;152|.	P52788;P52788-2|.	SPSY_HUMAN;.|.	F|L	205;152;109|297	ENSP00000385746:L205F;ENSP00000368714:L152F;ENSP00000388906:L109F|.	ENSP00000368714:L152F|.	L|V	+|+	3|1	2|0	SMS|SMS	21906108|21906108	0.221000|0.221000	0.23642|0.23642	0.998000|0.998000	0.56505|0.56505	0.332000|0.332000	0.28634|0.28634	-0.496000|-0.496000	0.06436|0.06436	0.235000|0.235000	0.21160|0.21160	-0.340000|-0.340000	0.08031|0.08031	TTG|GTG		0.428	SMS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056032.1	NM_004595		15	59	1	0	6.31663e-08	0.00316338	2.36392e-07	15	59				
FAM47A	158724	broad.mit.edu	37	X	34149860	34149860	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:34149860G>T	ENST00000346193.3	-	1	587	c.536C>A	c.(535-537)cCt>cAt	p.P179H		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	179	Pro-rich.									NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ATGTTTACCAGGCTCAGTGGG	0.577																																							uc004ddg.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(535-537)CCT>CAT		hypothetical protein LOC158724							67.0	68.0	67.0					X																	34149860		2202	4300	6502	SO:0001583	missense	158724							g.chrX:34149860G>T	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.536C>A	X.37:g.34149860G>T	ENSP00000345029:p.Pro179His		Somatic					p.P179H	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	569	-			179			Pro-rich.		A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.536C>A	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	G	1.912	-0.450431	0.04572	.	.	ENSG00000185448	ENST00000346193	T	0.15256	2.44	1.1	-0.114	0.13564	.	.	.	.	.	T	0.12347	0.0300	L	0.52573	1.65	0.09310	N	1	B	0.30511	0.282	B	0.29598	0.104	T	0.31668	-0.9935	9	0.25106	T	0.35	.	2.8586	0.05579	0.6625:0.0:0.3375:0.0	.	179	Q5JRC9	FA47A_HUMAN	H	179	ENSP00000345029:P179H	ENSP00000345029:P179H	P	-	2	0	FAM47A	34059781	0.034000	0.19679	0.001000	0.08648	0.002000	0.02628	0.856000	0.27818	-0.083000	0.12618	-0.523000	0.04350	CCT		0.577	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		5	24	1	0	1.6384e-10	0.00198382	6.76905e-10	5	24				
FAM47C	442444	broad.mit.edu	37	X	37028698	37028698	+	Missense_Mutation	SNP	C	C	T	rs144392292		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:37028698C>T	ENST00000358047.3	+	1	2267	c.2215C>T	c.(2215-2217)Cgc>Tgc	p.R739C		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	739										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GTCCCATCTCCGCCCAGAGCC	0.637																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(2215-2217)CGC>TGC		hypothetical protein LOC442444		C	CYS/ARG	1,3832		0,1,1630,571	48.0	46.0	47.0		2215	0.9	0.0	X	dbSNP_134	47	1,6727		0,1,2427,1872	no	missense	FAM47C	NM_001013736.2	180	0,2,4057,2443	TT,TC,CC,C		0.0149,0.0261,0.0189	probably-damaging	739/1036	37028698	2,10559	2202	4300	6502	SO:0001583	missense	442444							g.chrX:37028698C>T	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2215C>T	X.37:g.37028698C>T	ENSP00000367913:p.Arg739Cys		Somatic					p.R739C	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	2229	+			739					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.2215C>T	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	7.053	0.564827	0.13498	2.61E-4	1.49E-4	ENSG00000198173	ENST00000358047	T	0.21543	2.0	0.929	0.929	0.19449	.	.	.	.	.	T	0.15478	0.0373	L	0.28556	0.865	0.22866	N	0.998633	D	0.60160	0.987	P	0.46389	0.515	T	0.13019	-1.0525	9	0.42905	T	0.14	.	3.882	0.09082	0.0:0.6818:0.0:0.3182	.	739	Q5HY64	FA47C_HUMAN	C	739	ENSP00000367913:R739C	ENSP00000367913:R739C	R	+	1	0	FAM47C	36938619	0.002000	0.14202	0.006000	0.13384	0.007000	0.05969	0.537000	0.23144	0.253000	0.21552	0.257000	0.18616	CGC		0.637	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		12	41	0	0	0	0.00185496	0	12	41				
ATP6AP2	10159	broad.mit.edu	37	X	40458862	40458862	+	Silent	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:40458862C>T	ENST00000378438.4	+	7	765	c.607C>T	c.(607-609)Cta>Tta	p.L203L	ATP6AP2_ENST00000486558.1_3'UTR|ATP6AP2_ENST00000544975.1_Silent_p.L127L|ATP6AP2_ENST00000535777.1_Silent_p.L125L|ATP6AP2_ENST00000535539.1_Silent_p.L171L	NM_005765.2	NP_005756.2	O75787	RENR_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 2	203					angiotensin maturation (GO:0002003)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|eye pigmentation (GO:0048069)|head morphogenesis (GO:0060323)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of Wnt signaling pathway (GO:0030177)|proteolysis (GO:0006508)|regulation of MAPK cascade (GO:0043408)|rostrocaudal neural tube patterning (GO:0021903)	cell body (GO:0044297)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(2)	4						TCATAAGCATCTAGCCAAGGA	0.408																																							uc004det.2		NA																	0					0						c.(607-609)CTA>TTA		ATPase, H+ transporting, lysosomal accessory							122.0	109.0	114.0					X																	40458862		2203	4300	6503	SO:0001819	synonymous_variant	10159				angiotensin maturation|positive regulation of transforming growth factor-beta1 production|regulation of MAPKKK cascade	external side of plasma membrane|integral to membrane	protein binding|receptor activity	g.chrX:40458862C>T	AF248966	CCDS14252.1	Xp11.4	2014-06-17	2003-08-28	2003-08-29	ENSG00000182220	ENSG00000182220			18305	protein-coding gene	gene with protein product	"""prorenin receptor"", ""renin receptor"""	300556	"""ATPase, H+ transporting, lysosomal interacting protein 2"""	ATP6IP2		9556572, 11590366	Standard	NM_005765		Approved	M8-9, APT6M8-9, ATP6M8-9, PRR, RENR	uc004det.3	O75787	OTTHUMG00000024103	ENST00000378438.4:c.607C>T	X.37:g.40458862C>T			Somatic				ATP6AP2_uc010nhc.2_RNA|ATP6AP2_uc011mkl.1_Silent_p.L127L|ATP6AP2_uc011mkm.1_Silent_p.L171L|ATP6AP2_uc011mkn.1_Silent_p.L125L|ATP6AP2_uc004deu.1_Silent_p.L68L	p.L203L	NM_005765	NP_005756	WXS	Illumina HiSeq	Unspecified	O75787	RENR_HUMAN			7	709	+			203			Extracellular (Potential).		B7Z9I3|Q5QTQ7|Q6T7F5|Q8NBP3|Q8NG15|Q96FV6|Q96LB5|Q9H2P8|Q9UG89	Silent	SNP	ENST00000378438.4	37	c.607C>T	CCDS14252.1	.	.	.	.	.	.	.	.	.	.	C	9.033	0.987681	0.18966	.	.	ENSG00000182220	ENST00000423649	.	.	.	5.23	4.37	0.52481	.	.	.	.	.	T	0.55529	0.1926	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52373	-0.8584	4	.	.	.	-18.8334	6.2644	0.20917	0.0:0.6477:0.0:0.3523	.	.	.	.	F	143	.	.	S	+	2	0	ATP6AP2	40343806	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	0.789000	0.26886	1.104000	0.41587	0.594000	0.82650	TCT		0.408	ATP6AP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060679.1	NM_005765		6	71	0	0	0	0.00307968	0	6	71				
JADE3	9767	broad.mit.edu	37	X	46917717	46917717	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:46917717C>G	ENST00000218343.4	+	11	2008	c.1710C>G	c.(1708-1710)agC>agG	p.S570R	PHF16_ENST00000397189.1_Missense_Mutation_p.S570R	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						CTGACAGCAGCTCATCTGTTC	0.458																																							uc004dgx.2		NA																	0					0						c.(1708-1710)AGC>AGG		PHD finger protein 16							109.0	88.0	95.0					X																	46917717		2203	4300	6503	SO:0001583	missense	9767				histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding	g.chrX:46917717C>G																												ENST00000218343.4:c.1710C>G	X.37:g.46917717C>G	ENSP00000218343:p.Ser570Arg		Somatic				PHF16_uc004dgy.2_Missense_Mutation_p.S570R	p.S570R	NM_001077445	NP_001070913	WXS	Illumina HiSeq	Unspecified	Q92613	JADE3_HUMAN			11	1761	+			570						Missense_Mutation	SNP	ENST00000218343.4	37	c.1710C>G	CCDS14271.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444412	0.25987	.	.	ENSG00000102221	ENST00000397189;ENST00000218343	T;T	0.54279	0.58;0.58	5.88	5.01	0.66863	.	1.836030	0.02909	N	0.136438	T	0.42944	0.1225	N	0.24115	0.695	0.44345	D	0.997238	B	0.28713	0.22	B	0.24006	0.05	T	0.09707	-1.0662	10	0.42905	T	0.14	.	8.56	0.33505	0.0:0.7648:0.0:0.2352	.	570	Q92613	JADE3_HUMAN	R	570	ENSP00000380373:S570R;ENSP00000218343:S570R	ENSP00000218343:S570R	S	+	3	2	PHF16	46802661	0.246000	0.23909	0.798000	0.32154	0.737000	0.42083	0.821000	0.27338	1.223000	0.43536	0.600000	0.82982	AGC		0.458	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056376.1			8	53	0	0	0	0.000442599	0	8	53				
XAGE5	170627	broad.mit.edu	37	X	52844149	52844149	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:52844149C>A	ENST00000375501.1	+	3	212	c.212C>A	c.(211-213)tCt>tAt	p.S71Y	XAGE5_ENST00000425386.1_Missense_Mutation_p.S71Y|XAGE5_ENST00000445860.2_3'UTR|XAGE5_ENST00000375503.3_3'UTR|XAGE5_ENST00000351072.1_Missense_Mutation_p.S71Y			Q8WWM1	XAGE5_HUMAN	X antigen family, member 5	71										endometrium(1)|large_intestine(1)|lung(5)|ovary(1)	8						CAGGAGCTGTCTCAGTCAAAG	0.443																																							uc004drd.1		NA																	0				ovary(1)	1						c.(211-213)TCT>TAT		X antigen family, member 5							60.0	51.0	55.0					X																	52844149		2203	4300	6503	SO:0001583	missense	170627							g.chrX:52844149C>A	BC069129	CCDS14346.1	Xp11.23	2010-10-19		2005-01-27	ENSG00000171405	ENSG00000171405			30930	protein-coding gene	gene with protein product	"""cancer/testis antigen family 12, member 5"""		"""G antigen, family D, 5"""	GAGED5		12477932	Standard	NM_130775		Approved	XAGE-5, CT12.5	uc004drd.1	Q8WWM1	OTTHUMG00000021589	ENST00000375501.1:c.212C>A	X.37:g.52844149C>A	ENSP00000364651:p.Ser71Tyr		Somatic					p.S71Y	NM_130775	NP_570131	WXS	Illumina HiSeq	Unspecified	Q8WWM1	GAGD5_HUMAN			4	277	+			71					Q5JS81	Missense_Mutation	SNP	ENST00000375501.1	37	c.212C>A	CCDS14346.1	.	.	.	.	.	.	.	.	.	.	c	10.79	1.449811	0.26074	.	.	ENSG00000171405	ENST00000351072;ENST00000425386;ENST00000375501	T;T;T	0.10763	2.84;2.84;2.84	0.785	0.785	0.18584	.	.	.	.	.	T	0.22322	0.0538	L	0.52573	1.65	0.09310	N	1	D	0.65815	0.995	D	0.68621	0.959	T	0.06481	-1.0824	8	0.72032	D	0.01	.	.	.	.	.	71	Q8WWM1	GAGD5_HUMAN	Y	71	ENSP00000342240:S71Y;ENSP00000392864:S71Y;ENSP00000364651:S71Y	ENSP00000342240:S71Y	S	+	2	0	XAGE5	52860874	0.001000	0.12720	0.005000	0.12908	0.093000	0.18481	-0.144000	0.10280	0.685000	0.31468	0.279000	0.19357	TCT		0.443	XAGE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056689.1	NM_130775		10	44	1	0	0.000442599	0.000442599	0.0013229	10	44				
KLF8	11279	broad.mit.edu	37	X	56296679	56296679	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:56296679C>A	ENST00000468660.1	+	5	1111	c.823C>A	c.(823-825)Caa>Aaa	p.Q275K	KLF8_ENST00000374928.3_Intron	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	275					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						ACGGATTCACCAATGTGACTT	0.493																																							uc004dur.2		NA																	0				ovary(1)	1						c.(823-825)CAA>AAA		Kruppel-like factor 8 isoform 1							148.0	103.0	118.0					X																	56296679		2203	4300	6503	SO:0001583	missense	11279				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:56296679C>A	U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.823C>A	X.37:g.56296679C>A	ENSP00000417303:p.Gln275Lys		Somatic				KLF8_uc011mop.1_Intron|KLF8_uc010nkh.2_RNA	p.Q275K	NM_007250	NP_009181	WXS	Illumina HiSeq	Unspecified	O95600	KLF8_HUMAN			5	1769	+			275			C2H2-type 1.		B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	ENST00000468660.1	37	c.823C>A	CCDS14373.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.295052	0.60086	.	.	ENSG00000102349	ENST00000468660	T	0.05580	3.42	3.77	3.77	0.43336	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000021	T	0.04227	0.0117	N	0.16708	0.43	0.80722	D	1	P	0.34724	0.465	B	0.30572	0.117	T	0.54662	-0.8260	10	0.28530	T	0.3	.	12.9402	0.58337	0.0:1.0:0.0:0.0	.	275	O95600	KLF8_HUMAN	K	275	ENSP00000417303:Q275K	ENSP00000417303:Q275K	Q	+	1	0	KLF8	56313404	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	3.199000	0.51043	1.819000	0.53055	0.541000	0.68203	CAA		0.493	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056887.2	NM_007250		8	53	1	0	1.12685e-05	0.00448238	3.70408e-05	8	53				
ZXDB	158586	broad.mit.edu	37	X	57620764	57620764	+	Silent	SNP	A	A	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:57620764A>T	ENST00000374888.1	+	1	2496	c.2283A>T	c.(2281-2283)gtA>gtT	p.V761V		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	761					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						AGTGGAACGTACATCCTGACT	0.473																																							uc004dvd.2		NA																	0					0						c.(2281-2283)GTA>GTT		zinc finger, X-linked, duplicated B							174.0	134.0	148.0					X																	57620764		2203	4300	6503	SO:0001819	synonymous_variant	158586				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chrX:57620764A>T	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.2283A>T	X.37:g.57620764A>T			Somatic					p.V761V	NM_007157	NP_009088	WXS	Illumina HiSeq	Unspecified	P98169	ZXDB_HUMAN			1	2496	+			761					A8K151|Q9UBB3	Silent	SNP	ENST00000374888.1	37	c.2283A>T	CCDS35313.1																																																																																				0.473	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157		11	83	0	0	0	0.000673444	0	11	83				
ZC3H12B	340554	broad.mit.edu	37	X	64722958	64722958	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:64722958C>G	ENST00000338957.4	+	5	2447	c.2380C>G	c.(2380-2382)Cag>Gag	p.Q794E	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.Q783E	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	794							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACACCAGTATCAGACCTACAA	0.498																																							uc010nko.2		NA																	0				lung(1)|kidney(1)|pancreas(1)	3						c.(2347-2349)CAG>GAG		zinc finger CCCH-type containing 12B							110.0	103.0	105.0					X																	64722958		2007	4169	6176	SO:0001583	missense	340554						endonuclease activity|nucleic acid binding|zinc ion binding	g.chrX:64722958C>G	BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.2380C>G	X.37:g.64722958C>G	ENSP00000340839:p.Gln794Glu		Somatic					p.Q783E	NM_001010888	NP_001010888	WXS	Illumina HiSeq	Unspecified	Q5HYM0	ZC12B_HUMAN			5	2356	+			783					B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	ENST00000338957.4	37	c.2347C>G	CCDS48131.2	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531860	0.64972	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.23348	1.91;1.91	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.48040	0.1478	L	0.60455	1.87	0.54753	D	0.999987	D	0.58268	0.982	D	0.67548	0.952	T	0.34850	-0.9812	10	0.51188	T	0.08	-12.9073	17.5371	0.87835	0.0:1.0:0.0:0.0	.	783	Q5HYM0	ZC12B_HUMAN	E	794;783;730	ENSP00000340839:Q794E;ENSP00000408077:Q783E	ENSP00000218172:Q730E	Q	+	1	0	ZC3H12B	64639683	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.001000	0.70685	2.468000	0.83385	0.506000	0.49869	CAG		0.498	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378734.2	XM_293334		5	45	0	0	0	0.000602214	0	5	45				
EDA	1896	broad.mit.edu	37	X	69255360	69255360	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:69255360G>T	ENST00000374552.4	+	8	1319	c.1077G>T	c.(1075-1077)aaG>aaT	p.K359N	EDA_ENST00000374553.2_Missense_Mutation_p.K357N|EDA_ENST00000524573.1_Missense_Mutation_p.K354N	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	359					cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						CCCGGCAGAAGATCGCCGTCA	0.577																																							uc004dxs.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(1075-1077)AAG>AAT		ectodysplasin A isoform EDA-A1							100.0	70.0	80.0					X																	69255360		2203	4300	6503	SO:0001583	missense	1896				cell differentiation|ectoderm development|immune response|positive regulation of NF-kappaB transcription factor activity|signal transduction	collagen|cytoskeleton|membrane fraction	tumor necrosis factor receptor binding	g.chrX:69255360G>T	U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.1077G>T	X.37:g.69255360G>T	ENSP00000363680:p.Lys359Asn		Somatic				EDA_uc004dxr.2_Missense_Mutation_p.K357N|EDA_uc011mpj.1_Missense_Mutation_p.K354N	p.K359N	NM_001399	NP_001390	WXS	Illumina HiSeq	Unspecified	Q92838	EDA_HUMAN			8	1319	+			359			Extracellular (Potential).		A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Missense_Mutation	SNP	ENST00000374552.4	37	c.1077G>T	CCDS14394.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283828	0.80803	.	.	ENSG00000158813	ENST00000374552;ENST00000374553;ENST00000524573	D;D;D	0.94828	-3.53;-3.53;-3.53	5.42	4.54	0.55810	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.118758	0.56097	D	0.000027	D	0.95560	0.8557	L	0.50333	1.59	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.68483	0.93;0.958;0.93	D	0.95312	0.8413	10	0.87932	D	0	-11.3271	11.762	0.51910	0.0879:0.0:0.9121:0.0	.	354;359;357	Q92838-9;Q92838;Q92838-3	.;EDA_HUMAN;.	N	359;357;354	ENSP00000363680:K359N;ENSP00000363681:K357N;ENSP00000432585:K354N	ENSP00000363680:K359N	K	+	3	2	EDA	69172085	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	4.177000	0.58276	1.035000	0.39972	0.529000	0.55759	AAG		0.577	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057048.2	NM_001399		7	39	1	0	8.12818e-05	0.00198382	0.000254784	7	39				
TEX11	56159	broad.mit.edu	37	X	69774579	69774579	+	Missense_Mutation	SNP	C	C	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:69774579C>A	ENST00000395889.2	-	27	2412	c.2257G>T	c.(2257-2259)Gat>Tat	p.D753Y	TEX11_ENST00000374333.2_Missense_Mutation_p.D738Y|TEX11_ENST00000344304.3_Missense_Mutation_p.D753Y|TEX11_ENST00000374320.2_Missense_Mutation_p.D428Y	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	753					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					AGTAATGGATCATTCAATTTG	0.363																																							uc004dyl.2		NA																	0				ovary(3)|breast(1)|skin(1)	5						c.(2257-2259)GAT>TAT		testis expressed sequence 11 isoform 1							89.0	77.0	81.0					X																	69774579		2203	4299	6502	SO:0001583	missense	56159						protein binding	g.chrX:69774579C>A	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.2257G>T	X.37:g.69774579C>A	ENSP00000379226:p.Asp753Tyr		Somatic				TEX11_uc004dyk.2_Missense_Mutation_p.D428Y|TEX11_uc004dym.2_Missense_Mutation_p.D738Y	p.D753Y	NM_001003811	NP_001003811	WXS	Illumina HiSeq	Unspecified	Q8IYF3	TEX11_HUMAN			27	2419	-	Renal(35;0.156)		753					A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	37	c.2257G>T	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761938	0.49468	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.55930	1.05;1.07;0.49;1.07	4.09	3.22	0.36961	.	0.142933	0.44902	D	0.000419	T	0.65249	0.2673	M	0.65498	2.005	0.36547	D	0.871618	D;D	0.89917	1.0;1.0	D;D	0.70935	0.971;0.97	T	0.69339	-0.5171	9	.	.	.	-5.7008	8.8759	0.35345	0.0:0.8841:0.0:0.1159	.	738;753	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	Y	738;753;428;753	ENSP00000363453:D738Y;ENSP00000379226:D753Y;ENSP00000363440:D428Y;ENSP00000340995:D753Y	.	D	-	1	0	TEX11	69691304	1.000000	0.71417	0.720000	0.30636	0.772000	0.43724	2.635000	0.46537	0.859000	0.35456	0.556000	0.70494	GAT		0.363	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1			17	44	1	0	9.16793e-09	0.000566183	3.56942e-08	17	44				
ZMYM3	9203	broad.mit.edu	37	X	70465222	70465222	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:70465222G>C	ENST00000353904.2	-	18	3161	c.2974C>G	c.(2974-2976)Cct>Gct	p.P992A	ZMYM3_ENST00000373988.1_Missense_Mutation_p.P994A|ZMYM3_ENST00000373984.3_Missense_Mutation_p.P994A|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000314425.5_Missense_Mutation_p.P992A|ZMYM3_ENST00000373998.1_Missense_Mutation_p.P980A	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	992					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TCTTGCCCAGGCTCATCCAAG	0.547																																							uc004dzh.1		NA																	0				ovary(1)	1						c.(2974-2976)CCT>GCT		zinc finger protein 261							119.0	82.0	94.0					X																	70465222		2203	4300	6503	SO:0001583	missense	9203				multicellular organismal development	nucleus	DNA binding|zinc ion binding	g.chrX:70465222G>C	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.2974C>G	X.37:g.70465222G>C	ENSP00000343909:p.Pro992Ala		Somatic				BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Missense_Mutation_p.P992A|ZMYM3_uc004dzj.1_Missense_Mutation_p.P980A	p.P992A	NM_201599	NP_963893	WXS	Illumina HiSeq	Unspecified	Q14202	ZMYM3_HUMAN			18	3061	-	Renal(35;0.156)		992					D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	ENST00000353904.2	37	c.2974C>G	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	g	22.0	4.224366	0.79576	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988	T;T;T;T;T	0.51817	1.25;0.69;1.25;1.23;1.25	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000001	T	0.65883	0.2734	L	0.54323	1.7	0.52099	D	0.999941	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.67469	-0.5663	10	0.66056	D	0.02	-8.3492	18.1693	0.89740	0.0:0.0:1.0:0.0	.	980;992	Q14202-2;Q14202	.;ZMYM3_HUMAN	A	992;980;992;994;994	ENSP00000322845:P992A;ENSP00000363110:P980A;ENSP00000343909:P992A;ENSP00000363096:P994A;ENSP00000363100:P994A	ENSP00000322845:P992A	P	-	1	0	ZMYM3	70381947	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.367000	0.73099	2.571000	0.86741	0.597000	0.82753	CCT		0.547	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599		4	25	0	0	0	0.00024832	0	4	25				
PHKA1	5255	broad.mit.edu	37	X	71840645	71840645	+	Missense_Mutation	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:71840645G>C	ENST00000373542.4	-	19	2226	c.2067C>G	c.(2065-2067)ttC>ttG	p.F689L	PHKA1_ENST00000541944.1_Intron|PHKA1_ENST00000339490.3_Missense_Mutation_p.F689L|PHKA1_ENST00000373539.3_Missense_Mutation_p.F689L|PHKA1_ENST00000373545.3_Intron	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	689					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					CAGCAGCTTGGAACCGATCTA	0.512																																							uc004eax.3		NA																	0				ovary(3)|skin(1)	4						c.(2065-2067)TTC>TTG		phosphorylase kinase, alpha 1 (muscle) isoform							141.0	97.0	112.0					X																	71840645		2203	4300	6503	SO:0001583	missense	5255				glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:71840645G>C		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2067C>G	X.37:g.71840645G>C	ENSP00000362643:p.Phe689Leu		Somatic				PHKA1_uc004eay.3_Missense_Mutation_p.F689L|PHKA1_uc011mqi.1_Intron	p.F689L	NM_002637	NP_002628	WXS	Illumina HiSeq	Unspecified	P46020	KPB1_HUMAN			19	2368	-	Renal(35;0.156)		689					B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	c.2067C>G	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.728695	0.30593	.	.	ENSG00000067177	ENST00000373542;ENST00000339490;ENST00000373539	D;D;D	0.90444	-2.67;-2.65;-2.65	5.58	2.89	0.33648	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.82843	0.5125	L	0.36672	1.1	0.80722	D	1	B;B	0.11235	0.003;0.004	B;B	0.20384	0.007;0.029	T	0.68708	-0.5337	10	0.15499	T	0.54	-19.2332	7.2979	0.26403	0.3625:0.0:0.6375:0.0	.	689;689	P46020-2;P46020	.;KPB1_HUMAN	L	689	ENSP00000362643:F689L;ENSP00000342469:F689L;ENSP00000362640:F689L	ENSP00000342469:F689L	F	-	3	2	PHKA1	71757370	1.000000	0.71417	0.990000	0.47175	0.773000	0.43773	2.215000	0.42862	0.175000	0.19841	-0.192000	0.12808	TTC		0.512	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1			5	33	0	0	0	0.000602214	0	5	33				
ATRX	546	broad.mit.edu	37	X	76845317	76845317	+	Silent	SNP	G	G	C			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:76845317G>C	ENST00000373344.5	-	27	6418	c.6204C>G	c.(6202-6204)ccC>ccG	p.P2068P	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Silent_p.P2030P	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2068	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with MECP2.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TATAAATAAGGGGTTTATCTT	0.308			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		1	Unknown(1)		bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(6202-6204)CCC>CCG		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						53.0	51.0	52.0					X																	76845317		2203	4293	6496	SO:0001819	synonymous_variant	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76845317G>C	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6204C>G	X.37:g.76845317G>C			Somatic				ATRX_uc004ecq.3_Silent_p.P2030P|ATRX_uc004eco.3_Silent_p.P1853P	p.P2068P	NM_000489	NP_000480	WXS	Illumina HiSeq	Unspecified	P46100	ATRX_HUMAN			27	6436	-			2068			Helicase C-terminal.		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Silent	SNP	ENST00000373344.5	37	c.6204C>G	CCDS14434.1																																																																																				0.308	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		5	40	0	0	0	0.00116845	0	5	40				
ZCCHC5	203430	broad.mit.edu	37	X	77912566	77912567	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:77912566_77912567GG>TT	ENST00000321110.1	-	2	1646_1647	c.1351_1352CC>AA	c.(1351-1353)CCt>AAt	p.P451N		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	451							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						AAAATGACCAGGATAACCACAG	0.554																																							uc004edc.1		NA																	0				ovary(1)	1						c.(1351-1353)CCT>AAT		zinc finger, CCHC domain containing 5																																				SO:0001583	missense	203430						nucleic acid binding|zinc ion binding	g.chrX:77912566_77912567GG>TT	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.1351_1352delinsTT	X.37:g.77912566_77912567delinsTT	ENSP00000316794:p.Pro451Asn		Somatic					p.P451N	NM_152694	NP_689907	WXS	Illumina HiSeq	Unspecified	Q8N8U3	ZCHC5_HUMAN			2	1647_1648	-			451			CCHC-type.		B2RMZ0|Q5JQE9	Missense_Mutation	DNP	ENST00000321110.1	37	c.1351_1352CC>AA	CCDS14440.1																																																																																				0.554	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		5	22	0	0	0	6.4e-05	0	5	22				
TBX22	50945	broad.mit.edu	37	X	79279561	79279562	+	Splice_Site	DNP	GG	GG	TT			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:79279561_79279562GG>TT	ENST00000373294.5	+	3	384_385	c.356_357GG>TT	c.(355-357)aGG>aTT	p.R119I	TBX22_ENST00000373296.3_Splice_Site_p.R119I|TBX22_ENST00000442340.1_5'UTR|TBX22_ENST00000373291.1_5'UTR	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	119					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CTTTCTTACAGGCGGATGTTCC	0.48																																							uc010nmg.1		NA																	0				lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						c.e4-1		T-box 22 isoform 1																																				SO:0001630	splice_region_variant	50945				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:79279561_79279562GG>TT	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	Exception_encountered	X.37:g.79279561_79279562delinsTT			Somatic				TBX22_uc004edi.1_Splice_Site|TBX22_uc004edj.1_Splice_Site_p.R119_splice	p.R119_splice	NM_001109878	NP_001103348	WXS	Illumina HiSeq	Unspecified	Q9Y458	TBX22_HUMAN			4	491	+								Q5JZ06|Q96LC0|Q9HBF1	Splice_Site	DNP	ENST00000373294.5	37	c.357_splice	CCDS14445.1																																																																																				0.480	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954	Missense_Mutation	7	61	0	0	0	6.4e-05	0	7	61				
BRWD3	254065	broad.mit.edu	37	X	79978262	79978262	+	Missense_Mutation	SNP	T	T	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:79978262T>A	ENST00000373275.4	-	17	1891	c.1675A>T	c.(1675-1677)Acg>Tcg	p.T559S	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	559					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						CGATAATCCGTGTGGAAGAAC	0.388																																							uc004edt.2		NA																	0				ovary(4)	4						c.(1675-1677)ACG>TCG		bromodomain and WD repeat domain containing 3							95.0	86.0	89.0					X																	79978262		2203	4300	6503	SO:0001583	missense	254065							g.chrX:79978262T>A		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1675A>T	X.37:g.79978262T>A	ENSP00000362372:p.Thr559Ser		Somatic				BRWD3_uc004edo.2_Missense_Mutation_p.T155S|BRWD3_uc004edp.2_Missense_Mutation_p.T388S|BRWD3_uc004edq.2_Missense_Mutation_p.T155S|BRWD3_uc010nmj.1_Missense_Mutation_p.T155S|BRWD3_uc004edr.2_Missense_Mutation_p.T229S|BRWD3_uc004eds.2_Missense_Mutation_p.T155S|BRWD3_uc004edu.2_Missense_Mutation_p.T229S|BRWD3_uc004edv.2_Missense_Mutation_p.T155S|BRWD3_uc004edw.2_Missense_Mutation_p.T155S|BRWD3_uc004edx.2_Missense_Mutation_p.T155S|BRWD3_uc004edy.2_Missense_Mutation_p.T155S|BRWD3_uc004edz.2_Missense_Mutation_p.T229S|BRWD3_uc004eea.2_Missense_Mutation_p.T229S|BRWD3_uc004eeb.2_Missense_Mutation_p.T155S	p.T559S	NM_153252	NP_694984	WXS	Illumina HiSeq	Unspecified	Q6RI45	BRWD3_HUMAN			17	1938	-			559					C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	c.1675A>T	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.919445	0.73098	.	.	ENSG00000165288	ENST00000373275	T	0.50813	0.73	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.56411	0.1983	M	0.70275	2.135	0.53005	D	0.999965	P	0.51147	0.942	P	0.50352	0.638	T	0.59558	-0.7432	9	.	.	.	-7.2216	13.5575	0.61768	0.0:0.0:0.0:1.0	.	559	Q6RI45	BRWD3_HUMAN	S	559	ENSP00000362372:T559S	.	T	-	1	0	BRWD3	79864918	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.482000	0.81143	1.843000	0.53566	0.441000	0.28932	ACG		0.388	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252		26	68	0	0	0	0.00127121	0	26	68				
SATL1	340562	broad.mit.edu	37	X	84363384	84363384	+	Silent	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:84363384G>A	ENST00000395409.3	-	1	590	c.30C>T	c.(28-30)ggC>ggT	p.G10G	SATL1_ENST00000332921.5_Silent_p.G10G|SATL1_ENST00000509231.1_Silent_p.G197G			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	10	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						GTTGTTGCACGCCTGGTTGCC	0.572																																							uc011mqx.1		NA																	0				breast(2)	2						c.(589-591)GGC>GGT		spermidine/spermine N1-acetyl transferase-like 1							242.0	158.0	187.0					X																	84363384		2203	4300	6503	SO:0001819	synonymous_variant	340562						N-acetyltransferase activity	g.chrX:84363384G>A	BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.30C>T	X.37:g.84363384G>A			Somatic				SATL1_uc004een.2_Silent_p.G197G	p.G197G	NM_001163541	NP_001157013	WXS	Illumina HiSeq	Unspecified	Q86VE3	SATL1_HUMAN			1	591	-			10			Gln-rich.		A0AVK7|E9PB72|Q5H8V9	Silent	SNP	ENST00000395409.3	37	c.591C>T																																																																																					0.572	SATL1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_291339		19	75	0	0	0	0.000958276	0	19	75				
SEPT6	23157	broad.mit.edu	37	X	118767439	118767439	+	Missense_Mutation	SNP	C	C	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:118767439C>T	ENST00000343984.5	-	8	1237	c.973G>A	c.(973-975)Gag>Aag	p.E325K	SEPT6_ENST00000354416.3_Missense_Mutation_p.E325K|SEPT6_ENST00000489216.1_Missense_Mutation_p.E325K|SEPT6_ENST00000360156.7_Missense_Mutation_p.E325K|SEPT6_ENST00000394617.2_Missense_Mutation_p.E355K|SEPT6_ENST00000467310.1_5'Flank|SEPT6_ENST00000394610.1_Missense_Mutation_p.E325K|SEPT6_ENST00000394616.4_Missense_Mutation_p.E267K|SEPT6_ENST00000354228.4_Missense_Mutation_p.E325K	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6	325					cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						CTTTTGGCCTCATATGTCTCC	0.448			T	MLL	AML																																		uc004erv.2		NA		Dom	yes		X	Xq24	23157		septin 6			L					0				lung(1)|ovary(1)|prostate(1)|kidney(1)	4						c.(973-975)GAG>AAG		septin 6 isoform B							217.0	200.0	206.0					X																	118767439		2203	4300	6503	SO:0001583	missense	23157				cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding	g.chrX:118767439C>T	D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.973G>A	X.37:g.118767439C>T	ENSP00000341524:p.Glu325Lys		Somatic				SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Missense_Mutation_p.E325K|SEPT6_uc004ert.2_Missense_Mutation_p.E325K|SEPT6_uc004eru.2_Missense_Mutation_p.E325K|SEPT6_uc004erw.2_Missense_Mutation_p.E267K|SEPT6_uc011mtv.1_Missense_Mutation_p.E267K|SEPT6_uc011mtw.1_Missense_Mutation_p.E355K	p.E325K	NM_015129	NP_055944	WXS	Illumina HiSeq	Unspecified	Q14141	SEPT6_HUMAN			8	1238	-			325			Potential.		Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	Missense_Mutation	SNP	ENST00000343984.5	37	c.973G>A	CCDS14584.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.825613	0.71143	.	.	ENSG00000125354	ENST00000360156;ENST00000354228;ENST00000489216;ENST00000354416;ENST00000394610;ENST00000343984;ENST00000394616;ENST00000394617	D;D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.83926	0.5360	M	0.76574	2.34	0.80722	D	1	B;B;B;B	0.34214	0.043;0.005;0.075;0.442	B;B;B;B	0.34242	0.026;0.021;0.05;0.178	D	0.85372	0.1114	10	0.87932	D	0	.	17.254	0.87050	0.0:1.0:0.0:0.0	.	355;267;325;325	F5H1J5;B4E049;Q14141;Q548C9	.;.;SEPT6_HUMAN;.	K	325;325;325;325;325;325;267;355	ENSP00000353278:E325K;ENSP00000346169:E325K;ENSP00000418715:E325K;ENSP00000346397:E325K;ENSP00000378108:E325K;ENSP00000341524:E325K;ENSP00000378114:E267K;ENSP00000378115:E355K	ENSP00000341524:E325K	E	-	1	0	SEPT6	118651467	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	7.471000	0.80985	2.286000	0.76751	0.556000	0.70494	GAG		0.448	SEPT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058059.1	NM_145802		62	119	0	0	0	0.00361006	0	62	119				
SPANXN2	494119	broad.mit.edu	37	X	142795247	142795247	+	Missense_Mutation	SNP	G	G	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:142795247G>T	ENST00000370498.1	-	2	1184	c.431C>A	c.(430-432)tCt>tAt	p.S144Y		NM_001009615.1	NP_001009615.1	Q5MJ10	SPXN2_HUMAN	SPANX family, member N2	144										NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)					AGATCCTTCAGATGAGTCCAG	0.522																																							uc004fbz.2		NA																	0				ovary(1)	1						c.(430-432)TCT>TAT		SPANX-N2 protein							206.0	192.0	197.0					X																	142795247		2203	4300	6503	SO:0001583	missense	494119							g.chrX:142795247G>T		CCDS35419.1	Xq27.3	2012-06-12			ENSG00000203924	ENSG00000268988			33175	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 7"""	300665				14973187, 17012309	Standard	NM_001009615		Approved	SPANX-N2, CT11.7	uc004fbz.3	Q5MJ10	OTTHUMG00000022583	ENST00000370498.1:c.431C>A	X.37:g.142795247G>T	ENSP00000359529:p.Ser144Tyr		Somatic					p.S144Y	NM_001009615	NP_001009615	WXS	Illumina HiSeq	Unspecified	Q5MJ10	SPXN2_HUMAN			2	1185	-	Acute lymphoblastic leukemia(192;6.56e-05)		144					Q0ZNM2	Missense_Mutation	SNP	ENST00000370498.1	37	c.431C>A	CCDS35419.1	.	.	.	.	.	.	.	.	.	.	N	0.001	-3.313143	0.00018	.	.	ENSG00000203924	ENST00000370498	T	0.08193	3.12	0.763	-1.53	0.08611	.	.	.	.	.	T	0.02727	0.0082	L	0.38531	1.155	0.09310	N	1	P	0.50156	0.932	B	0.28385	0.089	T	0.48468	-0.9033	8	0.02654	T	1	.	.	.	.	.	144	Q5MJ10	SPXN2_HUMAN	Y	144	ENSP00000359529:S144Y	ENSP00000359529:S144Y	S	-	2	0	SPANXN2	142622913	0.006000	0.16342	0.000000	0.03702	0.001000	0.01503	0.855000	0.27805	-2.089000	0.00860	-0.609000	0.04063	TCT		0.522	SPANXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058621.2	NM_001009615		72	176	1	0	5.0909e-33	0.00361006	2.5954e-32	72	176				
AFF2	2334	broad.mit.edu	37	X	147744018	147744018	+	Missense_Mutation	SNP	C	C	G			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:147744018C>G	ENST00000370460.2	+	3	1249	c.770C>G	c.(769-771)tCt>tGt	p.S257C	AFF2_ENST00000370457.5_Missense_Mutation_p.S253C|AFF2_ENST00000370458.1_Missense_Mutation_p.S253C|AFF2_ENST00000342251.3_Missense_Mutation_p.S253C	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	257					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GTGGCTTCCTCTTTATTAGCT	0.478																																							uc004fcp.2		NA																	0				ovary(3)|pancreas(2)	5						c.(769-771)TCT>TGT		fragile X mental retardation 2							105.0	112.0	110.0					X																	147744018		2203	4300	6503	SO:0001583	missense	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:147744018C>G	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.770C>G	X.37:g.147744018C>G	ENSP00000359489:p.Ser257Cys		Somatic				AFF2_uc004fco.2_Missense_Mutation_p.S253C|AFF2_uc004fcq.2_Missense_Mutation_p.S253C|AFF2_uc004fcr.2_Missense_Mutation_p.S253C|AFF2_uc011mxb.1_Missense_Mutation_p.S257C|AFF2_uc004fcs.2_Missense_Mutation_p.S253C	p.S257C	NM_002025	NP_002016	WXS	Illumina HiSeq	Unspecified	P51816	AFF2_HUMAN			3	1249	+	Acute lymphoblastic leukemia(192;6.56e-05)		257					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	c.770C>G	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.894086	0.52121	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.71	5.71	0.89125	.	0.064453	0.64402	D	0.000005	T	0.74160	0.3680	L	0.39245	1.2	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.83275	0.983;0.983;0.983;0.983;0.99;0.996	T	0.76418	-0.2966	10	0.87932	D	0	.	18.814	0.92070	0.0:1.0:0.0:0.0	.	257;253;253;253;257;253	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	C	257;253;253;253	ENSP00000359489:S257C;ENSP00000359486:S253C;ENSP00000345459:S253C;ENSP00000359487:S253C	ENSP00000345459:S253C	S	+	2	0	AFF2	147551710	1.000000	0.71417	0.952000	0.39060	0.930000	0.56654	7.272000	0.78516	2.389000	0.81357	0.600000	0.82982	TCT		0.478	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		7	138	0	0	0	0.00198382	0	7	138				
CNGA2	1260	broad.mit.edu	37	X	150911608	150911608	+	Silent	SNP	G	G	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chrX:150911608G>A	ENST00000329903.4	+	6	666	c.633G>A	c.(631-633)ctG>ctA	p.L211L		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	211					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					CCAAGAAACTGCGAGACAACT	0.493																																							uc004fey.1		NA																	0				breast(3)	3						c.(631-633)CTG>CTA		cyclic nucleotide gated channel alpha 2							123.0	92.0	102.0					X																	150911608		2203	4300	6503	SO:0001819	synonymous_variant	1260				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity	g.chrX:150911608G>A	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.633G>A	X.37:g.150911608G>A			Somatic					p.L211L	NM_005140	NP_005131	WXS	Illumina HiSeq	Unspecified	Q16280	CNGA2_HUMAN			7	857	+	Acute lymphoblastic leukemia(192;6.56e-05)		211			Cytoplasmic (Potential).		A0AVD0	Silent	SNP	ENST00000329903.4	37	c.633G>A	CCDS14701.1																																																																																				0.493	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140		10	34	0	0	0	0.000673444	0	10	34				
ACADM	34	broad.mit.edu	37	1	76211563	76211563	+	Frame_Shift_Del	DEL	G	G	-			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:76211563delG	ENST00000370841.4	+	8	1109	c.672delG	c.(670-672)gtgfs	p.V224fs	ACADM_ENST00000541113.1_Frame_Shift_Del_p.V188fs|ACADM_ENST00000543667.1_Frame_Shift_Del_p.V35fs|ACADM_ENST00000420607.2_Frame_Shift_Del_p.V228fs|ACADM_ENST00000370834.5_Frame_Shift_Del_p.V257fs	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	224					cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)			breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	GATTCATTGTGGAAGCAGATA	0.343																																							uc001dgw.3		NA																	0				breast(2)|ovary(1)|skin(1)	4						c.(670-672)GTGfs		medium-chain acyl-CoA dehydrogenase isoform a							85.0	87.0	86.0					1																	76211563		2203	4300	6503	SO:0001589	frameshift_variant	34				carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity	g.chr1:76211563delG	M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.672delG	1.37:g.76211563delG	ENSP00000359878:p.Val224fs		Somatic				ACADM_uc010ord.1_Frame_Shift_Del_p.V138fs|ACADM_uc009wbp.2_Frame_Shift_Del_p.V228fs|ACADM_uc009wbr.2_Frame_Shift_Del_p.V257fs|ACADM_uc010ore.1_Frame_Shift_Del_p.V188fs|ACADM_uc010orf.1_Frame_Shift_Del_p.V35fs|ACADM_uc001dgx.3_Frame_Shift_Del_p.V138fs|ACADM_uc010org.1_Frame_Shift_Del_p.V94fs|ACADM_uc009wbs.1_RNA	p.V224fs	NM_000016	NP_000007	WXS	Illumina HiSeq	Unspecified	P11310	ACADM_HUMAN			8	1102	+			224					Q5T4U4|Q9NYF1	Frame_Shift_Del	DEL	ENST00000370841.4	37	c.672delG	CCDS668.1																																																																																				0.343	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026967.1			13	97	NA	NA	NA	NA	NA	13	97	---	---	---	---
RBM34	23029	broad.mit.edu	37	1	235324345	235324345	+	Frame_Shift_Del	DEL	C	C	-			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:235324345delC	ENST00000408888.3	-	2	321	c.91delG	c.(91-93)gaafs	p.E31fs	RBM34_ENST00000366606.3_Frame_Shift_Del_p.E26fs			P42696	RBM34_HUMAN	RNA binding motif protein 34	31						nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			CTGTAGTCTTCCGGCGGACTC	0.607																																							uc001hwn.2		NA																	0				central_nervous_system(1)	1						c.(91-93)GAAfs		RNA binding motif protein 34 isoform 1							36.0	43.0	41.0					1																	235324345		2014	4158	6172	SO:0001589	frameshift_variant	23029					nucleolus	nucleotide binding|RNA binding	g.chr1:235324345delC		CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.91delG	1.37:g.235324345delC	ENSP00000386226:p.Glu31fs		Somatic				RBM34_uc001hwo.2_RNA|ARID4B_uc001hwp.2_RNA|RBM34_uc010pxp.1_Frame_Shift_Del_p.E31fs	p.E31fs	NM_015014	NP_055829	WXS	Illumina HiSeq	Unspecified	P42696	RBM34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)		2	121	-	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	31					A8K8J7|Q8N2Z8|Q9H5A1	Frame_Shift_Del	DEL	ENST00000408888.3	37	c.91delG	CCDS41477.2																																																																																				0.607	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100146.1	NM_015014		12	18	NA	NA	NA	NA	NA	12	18	---	---	---	---
OR2B11	127623	broad.mit.edu	37	1	247614468	247614468	+	Frame_Shift_Del	DEL	C	C	-			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr1:247614468delC	ENST00000318749.6	-	1	840	c.817delG	c.(817-819)gagfs	p.E273fs		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TTGCCCTGCTCTTGGGAGTAG	0.493																																							uc010pyx.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(817-819)GAGfs		olfactory receptor, family 2, subfamily B,							152.0	160.0	157.0					1																	247614468		2203	4300	6503	SO:0001589	frameshift_variant	127623				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247614468delC		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.817delG	1.37:g.247614468delC	ENSP00000325682:p.Glu273fs		Somatic					p.E273fs	NM_001004492	NP_001004492	WXS	Illumina HiSeq	Unspecified	Q5JQS5	OR2BB_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	817	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	273			Extracellular (Potential).		B2RP03	Frame_Shift_Del	DEL	ENST00000318749.6	37	c.817delG	CCDS31090.1																																																																																				0.493	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492		17	126	NA	NA	NA	NA	NA	17	126	---	---	---	---
MICALCL	84953	broad.mit.edu	37	11	12316384	12316389	+	In_Frame_Del	DEL	CTCCTA	CTCCTA	-	rs3812754|rs542581403|rs199786165	byFrequency	TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	CTCCTA	CTCCTA	-	-	CTCCTA	CTCCTA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:12316384_12316389delCTCCTA	ENST00000256186.2	+	3	1697_1702	c.1406_1411delCTCCTA	c.(1405-1413)cctcctaca>cca	p.PT470del		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	470	Poly-Pro.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.T471delT(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		cctcctcctcctcctACAGCGGGAGG	0.573																																							uc001mkg.1		NA																	2	Deletion - In frame(2)		upper_aerodigestive_tract(1)|skin(1)	skin(1)	1						c.(1405-1413)CCTCCTACA>CCA		MICAL C-terminal like				494,2594		71,352,1121						-0.7	0.0		dbSNP_107	5	1955,4965		272,1411,1777	no	coding	MICALCL	NM_032867.2		343,1763,2898	A1A1,A1R,RR		28.2514,15.9974,24.4704				2449,7559				SO:0001651	inframe_deletion	84953				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	mitogen-activated protein kinase binding	g.chr11:12316384_12316389delCTCCTA	BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1406_1411delCTCCTA	11.37:g.12316384_12316389delCTCCTA	ENSP00000256186:p.Pro470_Thr471del		Somatic					p.PT470del	NM_032867	NP_116256	WXS	Illumina HiSeq	Unspecified	Q6ZW33	MICLK_HUMAN		Epithelial(150;0.00177)	3	1697_1702	+			470_471					Q7RTP7|Q96JU6	In_Frame_Del	DEL	ENST00000256186.2	37	c.1406_1411delCTCCTA	CCDS41620.1																																																																																				0.573	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867		4	2	NA	NA	NA	NA	NA	4	2	---	---	---	---
OR5D14	219436	broad.mit.edu	37	11	55563619	55563619	+	Frame_Shift_Del	DEL	C	C	-	rs201698382		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr11:55563619delC	ENST00000335605.1	+	1	588	c.588delC	c.(586-588)atcfs	p.I196fs		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				ATATACTCATCCCCCACCTGC	0.418																																							uc010rim.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(586-588)ATCfs		olfactory receptor, family 5, subfamily D,							209.0	201.0	204.0					11																	55563619		2200	4296	6496	SO:0001589	frameshift_variant	219436				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55563619delC	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.588delC	11.37:g.55563619delC	ENSP00000334456:p.Ile196fs		Somatic					p.I196fs	NM_001004735	NP_001004735	WXS	Illumina HiSeq	Unspecified	Q8NGL3	OR5DE_HUMAN			1	588	+		all_epithelial(135;0.196)	196			Extracellular (Potential).		Q6IF69|Q6IFD4|Q96RB5	Frame_Shift_Del	DEL	ENST00000335605.1	37	c.588delC	CCDS31508.1																																																																																				0.418	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735		19	181	NA	NA	NA	NA	NA	19	181	---	---	---	---
PABPC3	5042	broad.mit.edu	37	13	25671273	25671273	+	Frame_Shift_Del	DEL	G	G	-	rs376589131		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr13:25671273delG	ENST00000281589.3	+	1	974	c.937delG	c.(937-939)gcgfs	p.A313fs		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	313	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TCTCCGGAAAGCGTTTTCTCC	0.408																																							uc001upy.2		NA																	0				ovary(3)|skin(1)	4						c.(937-939)GCGfs		poly(A) binding protein, cytoplasmic 3							213.0	213.0	213.0					13																	25671273		2203	4300	6503	SO:0001589	frameshift_variant	5042				mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding	g.chr13:25671273delG	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.937delG	13.37:g.25671273delG	ENSP00000281589:p.Ala313fs		Somatic					p.A313fs	NM_030979	NP_112241	WXS	Illumina HiSeq	Unspecified	Q9H361	PABP3_HUMAN		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)	1	998	+		Lung SC(185;0.0225)|Breast(139;0.0602)	313			RRM 4.		Q8NHV0|Q9H086	Frame_Shift_Del	DEL	ENST00000281589.3	37	c.937delG	CCDS9311.1																																																																																				0.408	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979		7	292	NA	NA	NA	NA	NA	7	292	---	---	---	---
NID2	22795	broad.mit.edu	37	14	52526841	52526841	+	Splice_Site	DEL	C	C	-			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr14:52526841delC	ENST00000216286.5	-	3	767		c.e3+1		NID2_ENST00000541773.1_Splice_Site	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)						basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.?(1)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					ATGTTACTTACTGATAGAGAT	0.418																																							uc001wzo.2		NA																	1	Unknown(1)	p.?(1)	breast(1)	pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7						c.e3+1		nidogen 2 precursor							45.0	44.0	45.0					14																	52526841		2203	4300	6503	SO:0001630	splice_region_variant	22795					basement membrane	calcium ion binding|collagen binding	g.chr14:52526841delC	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.767+1G>-	14.37:g.52526841delC			Somatic				NID2_uc010tqs.1_Splice_Site_p.Q256_splice|NID2_uc010tqt.1_Splice_Site_p.Q256_splice|NID2_uc001wzp.2_Splice_Site_p.Q256_splice	p.Q256_splice	NM_007361	NP_031387	WXS	Illumina HiSeq	Unspecified	Q14112	NID2_HUMAN			3	1001	-	Breast(41;0.0639)|all_epithelial(31;0.123)							A8K6I7|B4DU19|O43710	Splice_Site	DEL	ENST00000216286.5	37	c.767_splice	CCDS9706.1																																																																																				0.418	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		Intron	7	35	NA	NA	NA	NA	NA	7	35	---	---	---	---
KIF2B	84643	broad.mit.edu	37	17	51901016	51901016	+	Frame_Shift_Del	DEL	C	C	-			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr17:51901016delC	ENST00000268919.4	+	1	778	c.622delC	c.(622-624)cccfs	p.P209fs		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	209					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AGTCCTGGAGCCCCCGCAAGA	0.552																																							uc002iua.2		NA																	0				ovary(5)|skin(3)	8						c.(622-624)CCCfs		kinesin family member 2B							74.0	63.0	67.0					17																	51901016		2203	4300	6503	SO:0001589	frameshift_variant	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51901016delC	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.622delC	17.37:g.51901016delC	ENSP00000268919:p.Pro209fs		Somatic				uc010wna.1_RNA	p.P208fs	NM_032559	NP_115948	WXS	Illumina HiSeq	Unspecified	Q8N4N8	KIF2B_HUMAN			1	778	+			208					Q96MA2|Q9BXG6	Frame_Shift_Del	DEL	ENST00000268919.4	37	c.622delC	CCDS32685.1																																																																																				0.552	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		8	26	NA	NA	NA	NA	NA	8	26	---	---	---	---
CARD8	22900	broad.mit.edu	37	19	48733883	48733883	+	Frame_Shift_Del	DEL	G	G	-	rs148180647		TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr19:48733883delG	ENST00000359009.4	-	6	841	c.529delC	c.(529-531)cggfs	p.R177fs	CARD8_ENST00000391898.3_Frame_Shift_Del_p.R283fs|CARD8_ENST00000520753.1_Frame_Shift_Del_p.R283fs|CARD8_ENST00000521613.1_Frame_Shift_Del_p.R233fs|ZNF114_ENST00000597695.1_Intron|CARD8_ENST00000520153.1_Frame_Shift_Del_p.R233fs|CARD8_ENST00000519940.1_Frame_Shift_Del_p.R283fs|CARD8_ENST00000447740.2_Frame_Shift_Del_p.R233fs|CARD8_ENST00000520015.1_Frame_Shift_Del_p.R283fs|CARD8_ENST00000357778.5_Frame_Shift_Del_p.R8fs			Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8	177					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)|NLRP3 inflammasome complex (GO:0072559)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|NACHT domain binding (GO:0032089)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	15		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		GGCTCCACCCGGGCTGGATGC	0.577																																							uc002pie.3		NA																	0					0						c.(529-531)CGGfs		caspase recruitment domain family, member 8							99.0	101.0	101.0					19																	48733883		2203	4300	6503	SO:0001589	frameshift_variant	22900				negative regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion	cytoplasm|nucleus	caspase activator activity|NACHT domain binding|protein homodimerization activity	g.chr19:48733883delG	AB023172	CCDS12712.1, CCDS12712.2, CCDS54287.1, CCDS54288.1, CCDS54289.1	19q13.33	2011-05-24			ENSG00000105483	ENSG00000105483			17057	protein-coding gene	gene with protein product		609051				10231032, 11408476	Standard	NM_001184900		Approved	TUCAN, KIAA0955, CARDINAL, NDPP, Dakar	uc010xzj.2	Q9Y2G2	OTTHUMG00000165047	ENST00000359009.4:c.529delC	19.37:g.48733883delG	ENSP00000351901:p.Arg177fs		Somatic				CARD8_uc002pii.3_Frame_Shift_Del_p.R283fs|CARD8_uc010xzi.1_Frame_Shift_Del_p.R178fs|CARD8_uc010els.2_Frame_Shift_Del_p.R216fs|CARD8_uc010xzj.1_Frame_Shift_Del_p.R283fs|CARD8_uc010xzk.1_Frame_Shift_Del_p.R202fs|CARD8_uc002pif.3_Frame_Shift_Del_p.R177fs|CARD8_uc002pig.3_Frame_Shift_Del_p.R8fs|CARD8_uc002pih.3_Frame_Shift_Del_p.R233fs|CARD8_uc010xzl.1_Frame_Shift_Del_p.R233fs|CARD8_uc010xzm.1_Frame_Shift_Del_p.R283fs	p.R177fs	NM_014959	NP_055774	WXS	Illumina HiSeq	Unspecified	Q9Y2G2	CARD8_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)	6	842	-		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)	177					B5KVR6|B7Z496|B7Z4A2|E9PEM7|G3XAM9|Q6PGP8|Q96P82	Frame_Shift_Del	DEL	ENST00000359009.4	37	c.529delC																																																																																					0.577	CARD8-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014959		11	75	NA	NA	NA	NA	NA	11	75	---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170134449	170134450	+	Frame_Shift_Ins	INS	-	-	A			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr2:170134449_170134450insA	ENST00000263816.3	-	13	1862_1863	c.1577_1578insT	c.(1576-1578)ttcfs	p.F526fs	LRP2_ENST00000443831.1_Intron	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	526					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CCCAATCTGAGAAAAATAAATA	0.391																																							uc002ues.2		NA																	0				ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(1576-1578)TTCfs		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)																																			SO:0001589	frameshift_variant	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170134449_170134450insA		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.1578dupT	2.37:g.170134454_170134454dupA	ENSP00000263816:p.Phe526fs		Somatic				LRP2_uc010zdf.1_Intron	p.F526fs	NM_004525	NP_004516	WXS	Illumina HiSeq	Unspecified	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	13	1790_1791	-			526			LDL-receptor class B 3.|Extracellular (Potential).		O00711|Q16215	Frame_Shift_Ins	INS	ENST00000263816.3	37	c.1577_1578insT	CCDS2232.1																																																																																				0.391	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		16	73	NA	NA	NA	NA	NA	16	73	---	---	---	---
TMPRSS15	5651	broad.mit.edu	37	21	19770237	19770238	+	Frame_Shift_Ins	INS	-	-	T			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr21:19770237_19770238insT	ENST00000284885.3	-	3	335_336	c.302_303insA	c.(301-303)aatfs	p.N101fs		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	101	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CATTCTTCAGATTGCTTGATAG	0.243																																							uc002ykw.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(301-303)AATfs		enterokinase precursor																																				SO:0001589	frameshift_variant	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19770237_19770238insT		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.303dupA	21.37:g.19770239_19770239dupT	ENSP00000284885:p.Asn101fs		Somatic					p.N101fs	NM_002772	NP_002763	WXS	Illumina HiSeq	Unspecified	P98073	ENTK_HUMAN			3	333_334	-			101			Extracellular (Potential).|SEA.		Q2NKL7	Frame_Shift_Ins	INS	ENST00000284885.3	37	c.302_303insA	CCDS13571.1																																																																																				0.243	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		7	28	NA	NA	NA	NA	NA	7	28	---	---	---	---
TBC1D2	55357	broad.mit.edu	37	9	100971254	100971254	+	Frame_Shift_Del	DEL	C	C	-			TCGA-53-7626-01A-12D-2063-08	TCGA-53-7626-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	0dc05a31-557a-4026-af11-f2dfdb91d5f3	5eea1eb3-ae16-4285-a8cb-d71ebfaa362b	g.chr9:100971254delC	ENST00000375064.1	-	9	1884	c.1846delG	c.(1846-1848)gccfs	p.A616fs	TBC1D2_ENST00000342112.5_Frame_Shift_Del_p.A398fs|TBC1D2_ENST00000375066.5_Frame_Shift_Del_p.A616fs|TBC1D2_ENST00000493589.2_5'UTR|TBC1D2_ENST00000375063.1_Frame_Shift_Del_p.A156fs	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	616					positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		TTGAGCTCGGCTGAGGGCACA	0.672																																							uc011lvb.1		NA																	0				ovary(3)	3						c.(1846-1848)GCCfs		TBC1 domain family, member 2							59.0	64.0	62.0					9																	100971254		2203	4300	6503	SO:0001589	frameshift_variant	55357					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity	g.chr9:100971254delC	AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.1846delG	9.37:g.100971254delC	ENSP00000364205:p.Ala616fs		Somatic				TBC1D2_uc004ayp.2_Frame_Shift_Del_p.A156fs|TBC1D2_uc004ayq.2_Frame_Shift_Del_p.A616fs|TBC1D2_uc004ayr.2_Frame_Shift_Del_p.A398fs|TBC1D2_uc004ayo.3_Frame_Shift_Del_p.A616fs	p.A616fs	NM_018421	NP_060891	WXS	Illumina HiSeq	Unspecified	Q9BYX2	TBD2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)	9	2026	-		Myeloproliferative disorder(762;0.0255)	616					B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Frame_Shift_Del	DEL	ENST00000375064.1	37	c.1846delG																																																																																					0.672	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053366.1	NM_018421		7	42	NA	NA	NA	NA	NA	7	42	---	---	---	---
