#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
TMEM82	388595	broad.mit.edu	37	1	16069342	16069342	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:16069342C>T	ENST00000375782.1	+	2	239	c.101C>T	c.(100-102)gCc>gTc	p.A34V	RP11-169K16.4_ENST00000418525.1_RNA|TMEM82_ENST00000465575.1_Intron	NM_001013641.1	NP_001013663.1	A0PJX8	TMM82_HUMAN	transmembrane protein 82	34	Leu-rich.					integral component of membrane (GO:0016021)		p.A34V(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|lung(5)|prostate(1)|skin(1)	13		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTGATCGGGGCCCTTGGAGTC	0.642																																							uc001axc.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|central_nervous_system(1)	2						c.(100-102)GCC>GTC		transmembrane protein 82							27.0	24.0	25.0					1																	16069342		2201	4296	6497	SO:0001583	missense	388595					integral to membrane		g.chr1:16069342C>T		CCDS30608.1	1p36.13	2008-02-05				ENSG00000162460			32350	protein-coding gene	gene with protein product							Standard	NM_001013641		Approved		uc001axc.4	A0PJX8		ENST00000375782.1:c.101C>T	1.37:g.16069342C>T	ENSP00000364938:p.Ala34Val		Somatic					p.A34V	NM_001013641	NP_001013663	WXS	Illumina HiSeq	Unspecified	A0PJX8	TMM82_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	2	239	+		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)	34			Leu-rich.|Helical; (Potential).		B2RP27|Q5VVD4	Missense_Mutation	SNP	ENST00000375782.1	37	c.101C>T	CCDS30608.1	.	.	.	.	.	.	.	.	.	.	c	17.37	3.371420	0.61624	.	.	ENSG00000162460	ENST00000375782	T	0.56103	0.48	4.84	3.9	0.45041	.	0.000000	0.64402	D	0.000001	T	0.53818	0.1820	M	0.72894	2.215	0.44024	D	0.99674	P	0.40909	0.732	B	0.40256	0.324	T	0.61222	-0.7106	10	0.87932	D	0	-22.5826	13.2448	0.60018	0.0:0.8402:0.1597:0.0	.	34	A0PJX8	TMM82_HUMAN	V	34	ENSP00000364938:A34V	ENSP00000364938:A34V	A	+	2	0	TMEM82	15941929	0.997000	0.39634	0.853000	0.33588	0.695000	0.40330	1.891000	0.39738	1.117000	0.41842	0.556000	0.70494	GCC		0.642	TMEM82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008471.2	NM_001013641		13	35	0	0	0	0.105934	0	13	35				
ARHGEF10L	55160	broad.mit.edu	37	1	17949602	17949602	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:17949602A>T	ENST00000361221.3	+	12	1291	c.1132A>T	c.(1132-1134)Atc>Ttc	p.I378F	ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.I156F|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.I339F|ARHGEF10L_ENST00000375420.3_Missense_Mutation_p.I136F|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.I378F|ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.I156F|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.I339F	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	378	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I378F(4)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CATGTTCCAGATCGCCCTGTC	0.622																																							uc001ban.2		NA																	4	Substitution - Missense(4)		lung(4)	large_intestine(1)|ovary(1)|pancreas(1)	3						c.(1132-1134)ATC>TTC		Rho guanine nucleotide exchange factor (GEF)							114.0	101.0	105.0					1																	17949602		2203	4300	6503	SO:0001583	missense	55160				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity	g.chr1:17949602A>T	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.1132A>T	1.37:g.17949602A>T	ENSP00000355060:p.Ile378Phe		Somatic				ARHGEF10L_uc009vpe.1_Missense_Mutation_p.I339F|ARHGEF10L_uc001bao.2_Missense_Mutation_p.I339F|ARHGEF10L_uc001bap.2_Missense_Mutation_p.I339F|ARHGEF10L_uc010ocr.1_Missense_Mutation_p.I136F|ARHGEF10L_uc001baq.2_Missense_Mutation_p.I144F|ARHGEF10L_uc010ocs.1_Missense_Mutation_p.I156F|ARHGEF10L_uc001bar.2_Missense_Mutation_p.I156F|ARHGEF10L_uc009vpf.2_5'Flank	p.I378F	NM_018125	NP_060595	WXS	Illumina HiSeq	Unspecified	Q9HCE6	ARGAL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)	12	1291	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)	378			DH.		B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	ENST00000361221.3	37	c.1132A>T	CCDS182.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.722788	0.89298	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375420;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03;-0.03;-0.03	4.58	4.58	0.56647	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.79621	0.4477	M	0.85630	2.765	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.996;0.993;0.994;0.994;0.995;0.996;0.999;1.0	T	0.81212	-0.1035	10	0.44086	T	0.13	-28.3902	12.7723	0.57427	1.0:0.0:0.0:0.0	.	156;136;378;156;144;339;339;378	Q5VXI4;B4DTE2;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;.;ARGAL_HUMAN	F	378;339;378;339;136;156;156;156	ENSP00000355060:I378F;ENSP00000399401:I339F;ENSP00000394621:I378F;ENSP00000364564:I339F;ENSP00000364569:I136F;ENSP00000364557:I156F;ENSP00000167825:I156F	ENSP00000167825:I156F	I	+	1	0	ARHGEF10L	17822189	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.880000	0.92407	1.695000	0.51148	0.402000	0.26972	ATC		0.622	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125		40	54	0	0	0	0.104719	0	40	54				
PTPRF	5792	broad.mit.edu	37	1	44057085	44057085	+	Silent	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:44057085G>A	ENST00000359947.4	+	9	1732	c.1392G>A	c.(1390-1392)aaG>aaA	p.K464K	PTPRF_ENST00000438120.1_Silent_p.K464K|PTPRF_ENST00000422171.2_5'Flank|PTPRF_ENST00000372413.3_Silent_p.K464K|PTPRF_ENST00000372414.3_Silent_p.K464K	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	464	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.K454K(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCTGGCACAAGCACAACACCG	0.697																																							uc001cjr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10						c.(1390-1392)AAG>AAA		protein tyrosine phosphatase, receptor type, F							9.0	10.0	9.0					1																	44057085		2179	4264	6443	SO:0001819	synonymous_variant	5792				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity	g.chr1:44057085G>A	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.1392G>A	1.37:g.44057085G>A			Somatic				PTPRF_uc001cjs.2_Silent_p.K464K|PTPRF_uc001cju.2_Silent_p.K35K|PTPRF_uc009vwt.2_Silent_p.K35K|PTPRF_uc001cjv.2_Silent_p.K35K	p.K464K	NM_002840	NP_002831	WXS	Illumina HiSeq	Unspecified	P10586	PTPRF_HUMAN			9	1732	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	464			Extracellular (Potential).|Fibronectin type-III 2.		D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	c.1392G>A	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.871|9.871	1.199020|1.199020	0.22121|0.22121	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000412568|ENST00000429895	.|.	.|.	.|.	5.62|5.62	0.551|0.551	0.17225|0.17225	.|.	.|.	.|.	.|.	.|.	T|T	0.57315|0.57315	0.2045|0.2045	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.51293|0.51293	-0.8724|-0.8724	4|4	.|.	.|.	.|.	.|.	9.598|9.598	0.39587|0.39587	0.5129:0.0:0.4871:0.0|0.5129:0.0:0.4871:0.0	.|.	.|.	.|.	.|.	T|N	132|121	.|.	.|.	A|S	+|+	1|2	0|0	PTPRF|PTPRF	43829672|43829672	0.867000|0.867000	0.29959|0.29959	0.999000|0.999000	0.59377|0.59377	0.820000|0.820000	0.46376|0.46376	-0.070000|-0.070000	0.11523|0.11523	0.136000|0.136000	0.18733|0.18733	0.563000|0.563000	0.77884|0.77884	GCA|AGC		0.697	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1			5	11	0	0	0	0.021553	0	5	11				
LRRC7	57554	broad.mit.edu	37	1	70488886	70488886	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:70488886C>A	ENST00000035383.5	+	15	1539	c.1509C>A	c.(1507-1509)tgC>tgA	p.C503*	LRRC7_ENST00000415775.2_Intron|RP11-181B18.1_ENST00000425754.1_RNA|RP11-181B18.1_ENST00000414132.1_RNA|LRRC7_ENST00000310961.5_Nonsense_Mutation_p.C508*	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	503						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.C503*(2)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CTGGCGATTGCTGCACACCAT	0.582																																							uc001dep.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						c.(1507-1509)TGC>TGA		leucine rich repeat containing 7							77.0	69.0	72.0					1																	70488886		2203	4300	6503	SO:0001587	stop_gained	57554					centrosome|focal adhesion|nucleolus	protein binding	g.chr1:70488886C>A		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1509C>A	1.37:g.70488886C>A	ENSP00000035383:p.Cys503*		Somatic				LRRC7_uc009wbg.2_Intron	p.C503*	NM_020794	NP_065845	WXS	Illumina HiSeq	Unspecified	Q96NW7	LRRC7_HUMAN			15	1539	+			503					Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Nonsense_Mutation	SNP	ENST00000035383.5	37	c.1509C>A	CCDS645.1	.	.	.	.	.	.	.	.	.	.	C	38	6.677188	0.97755	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	.	.	.	5.86	5.86	0.93980	.	0.125530	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	15.6849	0.77402	0.0:1.0:0.0:0.0	.	.	.	.	X	508;503;326	.	ENSP00000035383:C503X	C	+	3	2	LRRC7	70261474	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.522000	0.53480	2.775000	0.95449	0.585000	0.79938	TGC		0.582	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		21	55	1	0	5.26018e-13	0.062417	6.56868e-13	21	55				
CLCA2	9635	broad.mit.edu	37	1	86898148	86898148	+	Silent	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:86898148C>T	ENST00000370565.4	+	5	843	c.681C>T	c.(679-681)acC>acT	p.T227T		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	227					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)	p.T227T(2)		NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		AAGGATGCACCTTTATCTACA	0.378																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	uc001dlr.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|breast(1)|skin(1)	3						c.(679-681)ACC>ACT		chloride channel accessory 2 precursor							145.0	143.0	144.0					1																	86898148		2203	4300	6503	SO:0001819	synonymous_variant	9635				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:86898148C>T		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.681C>T	1.37:g.86898148C>T			Somatic					p.T227T	NM_006536	NP_006527	WXS	Illumina HiSeq	Unspecified	Q9UQC9	CLCA2_HUMAN		all cancers(265;0.0233)|Epithelial(280;0.0452)	5	843	+		Lung NSC(277;0.238)	227			Extracellular (Potential).		A8K2T3|Q9Y6N2	Silent	SNP	ENST00000370565.4	37	c.681C>T	CCDS708.1																																																																																				0.378	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536		31	37	0	0	0	0.050027	0	31	37				
EVI5	7813	broad.mit.edu	37	1	93089858	93089858	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:93089858C>A	ENST00000370331.1	-	14	1663	c.1654G>T	c.(1654-1656)Gac>Tac	p.D552Y	EVI5_ENST00000491940.1_5'UTR|EVI5_ENST00000543509.1_Missense_Mutation_p.D563Y|EVI5_ENST00000540033.1_Missense_Mutation_p.D552Y	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	552	Dimerization.|Interaction with AURKB and INCENP.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.D552Y(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		TTGGGTGGGTCTTTCCATCTC	0.353																																							uc001dox.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1654-1656)GAC>TAC		ecotropic viral integration site 5							136.0	115.0	122.0					1																	93089858		2203	4300	6503	SO:0001583	missense	7813				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity	g.chr1:93089858C>A	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1654G>T	1.37:g.93089858C>A	ENSP00000359356:p.Asp552Tyr		Somatic				EVI5_uc010otf.1_Missense_Mutation_p.D563Y|EVI5_uc001doy.1_RNA	p.D552Y	NM_005665	NP_005656	WXS	Illumina HiSeq	Unspecified	O60447	EVI5_HUMAN		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)	14	1664	-		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)	552			Targeting to the centrosomes.|Potential.|Dimerization.|Interaction with AURKB and INCENP.		A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	ENST00000370331.1	37	c.1654G>T	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732530	0.89482	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509;ENST00000338689	T;T;T	0.32988	1.43;1.43;1.43	5.54	5.54	0.83059	.	0.108206	0.64402	D	0.000009	T	0.45756	0.1358	M	0.66939	2.045	0.80722	D	1	P;P	0.46327	0.876;0.804	P;P	0.58331	0.837;0.691	T	0.41233	-0.9520	10	0.72032	D	0.01	-3.1088	19.4693	0.94956	0.0:1.0:0.0:0.0	.	563;552	F5H4R0;O60447	.;EVI5_HUMAN	Y	552;552;563;251	ENSP00000359356:D552Y;ENSP00000440826:D552Y;ENSP00000445019:D563Y	ENSP00000345500:D251Y	D	-	1	0	EVI5	92862446	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.197000	0.77814	2.594000	0.87642	0.655000	0.94253	GAC		0.353	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665		5	40	1	0	8.12818e-05	0.02938	8.71869e-05	5	40				
COL11A1	1301	broad.mit.edu	37	1	103477982	103477982	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:103477982C>A	ENST00000370096.3	-	14	1928	c.1616G>T	c.(1615-1617)aGa>aTa	p.R539I	COL11A1_ENST00000353414.4_Missense_Mutation_p.R500I|COL11A1_ENST00000358392.2_Missense_Mutation_p.R551I|COL11A1_ENST00000512756.1_Missense_Mutation_p.R423I	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	539	Collagen-like 2.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.R539I(2)|p.R551I(2)|p.R539T(1)|p.R551T(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGGACCTGGTCTTCCAGTTAG	0.398																																							uc001dul.2		NA																	6	Substitution - Missense(6)		lung(6)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(1615-1617)AGA>ATA		alpha 1 type XI collagen isoform A							42.0	43.0	43.0					1																	103477982		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103477982C>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1616G>T	1.37:g.103477982C>A	ENSP00000359114:p.Arg539Ile		Somatic				COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.R551I|COL11A1_uc001dun.2_Missense_Mutation_p.R500I|COL11A1_uc009weh.2_Missense_Mutation_p.R423I	p.R539I	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	14	1934	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	539			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.1616G>T	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.218156	0.79464	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-2.18	5.94	5.94	0.96194	.	0.122706	0.64402	D	0.000014	D	0.93762	0.8006	L	0.28192	0.835	0.80722	D	1	D;D;D;D	0.76494	0.997;0.997;0.999;0.997	D;D;D;D	0.83275	0.996;0.994;0.996;0.996	D	0.93590	0.6920	10	0.48119	T	0.1	.	19.9503	0.97197	0.0:1.0:0.0:0.0	.	423;500;551;539	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	I	539;551;500;423;551	ENSP00000359114:R539I;ENSP00000351163:R551I;ENSP00000302551:R500I;ENSP00000426533:R423I;ENSP00000408640:R551I	ENSP00000302551:R500I	R	-	2	0	COL11A1	103250570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.192000	0.77771	2.812000	0.96745	0.557000	0.71058	AGA		0.398	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		4	17	1	0	1.024e-07	0.014758	1.17363e-07	4	17				
ZNF687	57592	broad.mit.edu	37	1	151259952	151259952	+	Silent	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:151259952G>A	ENST00000368879.2	+	2	1283	c.1185G>A	c.(1183-1185)agG>agA	p.R395R		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R395R(2)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ATGGTACAAGGCTGAAAGGCA	0.597																																							uc001exq.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(3)|ovary(1)	4						c.(1183-1185)AGG>AGA		zinc finger protein 687							69.0	61.0	64.0					1																	151259952		2203	4300	6503	SO:0001819	synonymous_variant	57592				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding	g.chr1:151259952G>A		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.1185G>A	1.37:g.151259952G>A			Somatic				ZNF687_uc001exp.1_Silent_p.R404R|ZNF687_uc009wmo.2_Silent_p.R395R|ZNF687_uc009wmp.2_Silent_p.R395R	p.R395R	NM_020832	NP_065883	WXS	Illumina HiSeq	Unspecified	Q8N1G0	ZN687_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)		2	1283	+	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		395					D3DV17|Q68DQ8|Q9H937|Q9P2A7	Silent	SNP	ENST00000368879.2	37	c.1185G>A																																																																																					0.597	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832		29	78	0	0	0	0.037714	0	29	78				
FLG	2312	broad.mit.edu	37	1	152286349	152286349	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:152286349G>T	ENST00000368799.1	-	3	1048	c.1013C>A	c.(1012-1014)tCc>tAc	p.S338Y	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	338	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S338Y(2)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCATCATGGGACCTGGGGTG	0.562									Ichthyosis																														uc001ezu.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(1012-1014)TCC>TAC		filaggrin							211.0	212.0	212.0					1																	152286349		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152286349G>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1013C>A	1.37:g.152286349G>T	ENSP00000357789:p.Ser338Tyr		Somatic				uc001ezv.2_RNA	p.S338Y	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1049	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		338			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.1013C>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	8.492	0.862181	0.17178	.	.	ENSG00000143631	ENST00000368799	T	0.01538	4.79	3.61	-7.21	0.01490	.	.	.	.	.	T	0.01976	0.0062	M	0.74881	2.28	0.09310	N	1	D	0.69078	0.997	D	0.80764	0.994	T	0.18023	-1.0350	9	0.66056	D	0.02	-0.0104	1.0642	0.01607	0.3102:0.1131:0.1429:0.4338	.	338	P20930	FILA_HUMAN	Y	338	ENSP00000357789:S338Y	ENSP00000357789:S338Y	S	-	2	0	FLG	150552973	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	0.805000	0.27112	-1.455000	0.01923	-1.141000	0.01876	TCC		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		120	168	1	0	1.34936e-44	0.048971	1.9135e-44	120	168				
KPRP	448834	broad.mit.edu	37	1	152733434	152733434	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:152733434T>C	ENST00000606109.1	+	1	1398	c.1370T>C	c.(1369-1371)aTt>aCt	p.I457T	KPRP_ENST00000368773.1_Missense_Mutation_p.I457T			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	457	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.I457T(1)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGTGTGAGATTCCAGAGCCA	0.622																																							uc001fal.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(1369-1371)ATT>ACT		keratinocyte proline-rich protein							141.0	141.0	141.0					1																	152733434		2203	4300	6503	SO:0001583	missense	448834					cytoplasm		g.chr1:152733434T>C	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1370T>C	1.37:g.152733434T>C	ENSP00000475216:p.Ile457Thr		Somatic					p.I457T	NM_001025231	NP_001020402	WXS	Illumina HiSeq	Unspecified	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	1428	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		457			Pro-rich.			Missense_Mutation	SNP	ENST00000606109.1	37	c.1370T>C	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.260540	0.23051	.	.	ENSG00000203786	ENST00000368773	T	0.10860	2.83	3.79	-7.58	0.01313	.	2.052200	0.02328	N	0.073687	T	0.00998	0.0033	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.39440	-0.9614	10	0.09590	T	0.72	2.9527	2.6913	0.05121	0.4335:0.3308:0.0998:0.1358	.	457	Q5T749	KPRP_HUMAN	T	457	ENSP00000357762:I457T	ENSP00000357762:I457T	I	+	2	0	KPRP	151000058	0.000000	0.05858	0.000000	0.03702	0.351000	0.29236	-1.548000	0.02184	-2.333000	0.00631	0.379000	0.24179	ATT		0.622	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		81	143	0	0	0	0.048971	0	81	143				
TDRD10	126668	broad.mit.edu	37	1	154516513	154516513	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:154516513G>T	ENST00000368480.3	+	9	663	c.578G>T	c.(577-579)cGt>cTt	p.R193L	TDRD10_ENST00000368482.4_Missense_Mutation_p.R193L|TDRD10_ENST00000479937.1_3'UTR			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	193							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R193L(2)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CATAGCGTCCGTGGGGAGGCG	0.617																																							uc009wow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(577-579)CGT>CTT		tudor domain containing 10 isoform a							139.0	117.0	124.0					1																	154516513		2203	4300	6503	SO:0001583	missense	126668						nucleotide binding|RNA binding	g.chr1:154516513G>T	AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.578G>T	1.37:g.154516513G>T	ENSP00000357465:p.Arg193Leu		Somatic				TDRD10_uc001ffd.2_Missense_Mutation_p.R193L|TDRD10_uc001ffe.2_Missense_Mutation_p.R114L	p.R193L	NM_001098475	NP_001091945	WXS	Illumina HiSeq	Unspecified	Q5VZ19	TDR10_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		9	1416	+	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		193					A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	ENST00000368480.3	37	c.578G>T	CCDS41406.1	.	.	.	.	.	.	.	.	.	.	G	2.233	-0.375633	0.05034	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	T;T	0.25579	1.8;1.79	4.47	-4.29	0.03721	.	1.720350	0.03817	N	0.266885	T	0.04907	0.0132	N	0.19112	0.55	0.09310	N	1	B;B	0.12013	0.003;0.005	B;B	0.06405	0.001;0.002	T	0.37526	-0.9702	10	0.59425	D	0.04	0.4588	5.7584	0.18186	0.5149:0.0:0.3529:0.1322	.	193;193	Q5VZ19;Q5VZ19-2	TDR10_HUMAN;.	L	193	ENSP00000357467:R193L;ENSP00000357465:R193L	ENSP00000357465:R193L	R	+	2	0	TDRD10	152783137	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.643000	0.05421	-1.241000	0.02526	-0.378000	0.06908	CGT		0.617	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499		80	125	1	0	1.47272e-24	0.048971	2.01996e-24	80	125				
RIT1	6016	broad.mit.edu	37	1	155874285	155874285	+	Missense_Mutation	SNP	A	A	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:155874285A>C	ENST00000368323.3	-	5	450	c.246T>G	c.(244-246)ttT>ttG	p.F82L	RIT1_ENST00000539040.1_Missense_Mutation_p.F46L|RIT1_ENST00000368322.3_Missense_Mutation_p.F99L	NM_006912.5	NP_008843.1	Q92963	RIT1_HUMAN	Ras-like without CAAX 1	82			F -> L (in NS8; results in increased ELK1 transcriptional activation). {ECO:0000269|PubMed:23791108}.|F -> V (probable disease-associated mutation found in patients with features of Noonan syndrome). {ECO:0000269|PubMed:23791108}.		GTP catabolic process (GO:0006184)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)	p.F82L(2)		breast(1)|kidney(1)|large_intestine(3)|lung(12)|skin(1)|urinary_tract(1)	19	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)			GCATGGCTGTAAACTCTGCCT	0.423																																							uc001fmh.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(244-246)TTT>TTG		Ras-like without CAAX 1							75.0	64.0	67.0					1																	155874285		2203	4300	6503	SO:0001583	missense	6016				nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity	g.chr1:155874285A>C	AF084462	CCDS1123.1, CCDS58037.1, CCDS58036.1	1q21.2	2014-05-09	2002-09-11	2002-09-13	ENSG00000143622	ENSG00000143622			10023	protein-coding gene	gene with protein product	"""Ric-like, expressed in many tissues"", ""GTP-binding protein Roc1"""	609591	"""Ric (Drosophila)-like, expressed in many tissues"""	RIT		8824319, 8918462	Standard	NM_006912		Approved	RIBB, ROC1, MGC125864, MGC125865	uc031pqc.1	Q92963	OTTHUMG00000014104	ENST00000368323.3:c.246T>G	1.37:g.155874285A>C	ENSP00000357306:p.Phe82Leu		Somatic				RIT1_uc010pgr.1_Missense_Mutation_p.F46L	p.F82L	NM_006912	NP_008843	WXS	Illumina HiSeq	Unspecified	Q92963	RIT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)		5	433	-	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		82					B4DQE8|O00646|O00720|Q5VY89|Q5VY90	Missense_Mutation	SNP	ENST00000368323.3	37	c.246T>G	CCDS1123.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.058955	0.76074	.	.	ENSG00000143622	ENST00000368323;ENST00000539040;ENST00000368322	D;D;D	0.81996	-1.56;-1.56;-1.56	5.76	2.12	0.27331	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85039	0.5606	M	0.81239	2.535	0.58432	D	0.999991	D	0.67145	0.996	D	0.68039	0.955	D	0.84144	0.0419	10	0.56958	D	0.05	.	7.4759	0.27376	0.571:0.0:0.429:0.0	.	82	Q92963	RIT1_HUMAN	L	82;46;99	ENSP00000357306:F82L;ENSP00000441950:F46L;ENSP00000357305:F99L	ENSP00000357305:F99L	F	-	3	2	RIT1	154140909	0.928000	0.31464	1.000000	0.80357	0.944000	0.59088	0.009000	0.13219	0.452000	0.26830	0.383000	0.25322	TTT		0.423	RIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039593.1	NM_006912		17	24	0	0	0	0.028581	0	17	24				
ARHGEF2	9181	broad.mit.edu	37	1	155935547	155935547	+	Silent	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:155935547G>A	ENST00000361247.4	-	5	444	c.345C>T	c.(343-345)acC>acT	p.T115T	ARHGEF2_ENST00000313695.7_Silent_p.T88T|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000368315.4_Silent_p.T116T|ARHGEF2_ENST00000368316.1_Silent_p.T88T|ARHGEF2_ENST00000313667.4_Silent_p.T115T|ARHGEF2_ENST00000462460.2_Silent_p.T160T	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	115					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.T88T(2)		breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GCTCCCGGATGGTTGCTGTGG	0.622																																					Melanoma(178;35 2768 6610 28839)	Melanoma(178;35 2768 6610 28839)	uc001fmt.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(343-345)ACC>ACT		Rho/Rac guanine nucleotide exchange factor 2							33.0	39.0	37.0					1																	155935547		2203	4300	6503	SO:0001819	synonymous_variant	9181				actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding	g.chr1:155935547G>A	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.345C>T	1.37:g.155935547G>A			Somatic				ARHGEF2_uc001fmr.2_Silent_p.T88T|ARHGEF2_uc001fms.2_Silent_p.T115T|ARHGEF2_uc001fmu.2_Silent_p.T160T|ARHGEF2_uc010pgt.1_Silent_p.T88T|ARHGEF2_uc010pgu.1_Silent_p.T160T	p.T115T	NM_001162383	NP_001155855	WXS	Illumina HiSeq	Unspecified	Q92974	ARHG2_HUMAN			5	463	-	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		115					D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Silent	SNP	ENST00000361247.4	37	c.345C>T	CCDS53376.1																																																																																				0.622	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723		24	40	0	0	0	0.069288	0	24	40				
SPTA1	6708	broad.mit.edu	37	1	158609691	158609691	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:158609691C>A	ENST00000368147.4	-	34	5024	c.4844G>T	c.(4843-4845)aGc>aTc	p.S1615I		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1615					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.S1615I(2)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTCCCGGATGCTTGTGTTGAA	0.448																																							uc001fst.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(4843-4845)AGC>ATC		spectrin, alpha, erythrocytic 1							198.0	185.0	189.0					1																	158609691		1920	4119	6039	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158609691C>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4844G>T	1.37:g.158609691C>A	ENSP00000357129:p.Ser1615Ile		Somatic					p.S1615I	NM_003126	NP_003117	WXS	Illumina HiSeq	Unspecified	P02549	SPTA1_HUMAN			34	5043	-	all_hematologic(112;0.0378)		1615			Spectrin 16.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.4844G>T	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.810918	0.70797	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.51071	0.72;0.72	5.53	4.6	0.57074	.	0.483164	0.15456	N	0.261372	T	0.42944	0.1225	L	0.43923	1.385	0.39979	D	0.974894	P	0.37370	0.592	P	0.49140	0.601	T	0.47699	-0.9097	10	0.59425	D	0.04	.	15.0696	0.72024	0.0:0.8573:0.1427:0.0	.	1615	P02549	SPTA1_HUMAN	I	1615	ENSP00000357130:S1615I;ENSP00000357129:S1615I	ENSP00000357129:S1615I	S	-	2	0	SPTA1	156876315	1.000000	0.71417	0.967000	0.41034	0.994000	0.84299	5.438000	0.66550	1.536000	0.49237	0.655000	0.94253	AGC		0.448	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		40	68	1	0	4.00102e-26	0.086207	5.54837e-26	40	68				
CADM3	57863	broad.mit.edu	37	1	159163801	159163801	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:159163801G>C	ENST00000368125.4	+	5	819	c.662G>C	c.(661-663)aGa>aCa	p.R221T	CADM3_ENST00000368124.4_Missense_Mutation_p.R255T|CTA-134P22.2_ENST00000415675.2_RNA	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	221	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.R255T(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					GGAGCTGACAGATCCACCTCT	0.502																																							uc001ftl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(661-663)AGA>ACA		cell adhesion molecule 3 isoform 2							132.0	125.0	127.0					1																	159163801		2203	4300	6503	SO:0001583	missense	57863				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity	g.chr1:159163801G>C	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.662G>C	1.37:g.159163801G>C	ENSP00000357107:p.Arg221Thr		Somatic				CADM3_uc009wsy.1_Intron|CADM3_uc001ftk.2_Missense_Mutation_p.R255T	p.R221T	NM_001127173	NP_001120645	WXS	Illumina HiSeq	Unspecified	Q8N126	CADM3_HUMAN			5	804	+	all_hematologic(112;0.0429)		221			Ig-like C2-type 1.|Extracellular (Potential).		Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	ENST00000368125.4	37	c.662G>C	CCDS44251.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686844	0.48097	.	.	ENSG00000162706	ENST00000368124;ENST00000368125	D;D	0.86164	-2.08;-2.08	5.03	5.03	0.67393	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.054971	0.64402	D	0.000002	T	0.76877	0.4049	L	0.38175	1.15	0.36311	D	0.857652	P;D	0.56035	0.761;0.974	B;P	0.50659	0.191;0.647	T	0.73714	-0.3896	10	0.15066	T	0.55	.	9.3037	0.37863	0.0949:0.0:0.9051:0.0	.	221;255	Q8N126;Q8N126-2	CADM3_HUMAN;.	T	255;221	ENSP00000357106:R255T;ENSP00000357107:R221T	ENSP00000357106:R255T	R	+	2	0	CADM3	157430425	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.616000	0.54174	2.608000	0.88229	0.655000	0.94253	AGA		0.502	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189		18	34	0	0	0	0.038395	0	18	34				
OLFML2B	25903	broad.mit.edu	37	1	161953812	161953812	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:161953812G>T	ENST00000294794.3	-	8	2329	c.1906C>A	c.(1906-1908)Ctg>Atg	p.L636M	OLFML2B_ENST00000367938.1_Missense_Mutation_p.L119M|OLFML2B_ENST00000367940.2_Missense_Mutation_p.L637M	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	636	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.L636M(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			TCATCGTCCAGGGCCGGGTAG	0.632																																							uc001gbu.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1906-1908)CTG>ATG		olfactomedin-like 2B precursor							70.0	62.0	65.0					1																	161953812		2203	4300	6503	SO:0001583	missense	25903							g.chr1:161953812G>T	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1906C>A	1.37:g.161953812G>T	ENSP00000294794:p.Leu636Met		Somatic				OLFML2B_uc001gbt.2_Missense_Mutation_p.L119M|OLFML2B_uc010pkq.1_Missense_Mutation_p.L637M	p.L636M	NM_015441	NP_056256	WXS	Illumina HiSeq	Unspecified	Q68BL8	OLM2B_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0172)		8	2330	-	all_hematologic(112;0.156)		636			Olfactomedin-like.		B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	37	c.1906C>A	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901176	0.52227	.	.	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	D;D;D	0.88896	-2.44;-2.44;-2.44	5.36	4.34	0.51931	Olfactomedin-like (3);	.	.	.	.	T	0.80969	0.4726	L	0.39245	1.2	0.32390	N	0.553335	P;P	0.46784	0.884;0.596	P;B	0.50537	0.643;0.324	T	0.79037	-0.1967	8	0.44086	T	0.13	.	6.6775	0.23102	0.0987:0.0:0.7323:0.169	.	637;636	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	M	636;637;119	ENSP00000294794:L636M;ENSP00000356917:L637M;ENSP00000356915:L119M	ENSP00000294794:L636M	L	-	1	2	OLFML2B	160220436	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.733000	0.47360	1.082000	0.41137	0.561000	0.74099	CTG		0.632	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441		24	64	1	0	6.32553e-13	0.099896	7.85994e-13	24	64				
ASTN1	460	broad.mit.edu	37	1	177001659	177001659	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:177001659G>T	ENST00000367654.3	-	3	1009	c.798C>A	c.(796-798)agC>agA	p.S266R	ASTN1_ENST00000361833.2_Missense_Mutation_p.S266R|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Missense_Mutation_p.S266R|ASTN1_ENST00000424564.2_Missense_Mutation_p.S266R	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	266					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.S266R(2)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GCGTGACCTGGCTGGCAAAGT	0.597																																							uc001glc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(796-798)AGC>AGA		astrotactin isoform 1							144.0	119.0	127.0					1																	177001659		2203	4300	6503	SO:0001583	missense	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:177001659G>T	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.798C>A	1.37:g.177001659G>T	ENSP00000356626:p.Ser266Arg		Somatic				ASTN1_uc001glb.1_Missense_Mutation_p.S266R|ASTN1_uc001gld.1_Missense_Mutation_p.S266R|ASTN1_uc009wwx.1_Missense_Mutation_p.S266R|ASTN1_uc001gle.3_RNA	p.S266R	NM_004319	NP_004310	WXS	Illumina HiSeq	Unspecified	O14525	ASTN1_HUMAN			3	1010	-			266					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37	c.798C>A		.	.	.	.	.	.	.	.	.	.	G	15.84	2.950571	0.53186	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.16073	2.37;2.78;2.78;2.37	5.62	3.39	0.38822	.	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	L	0.29908	0.895	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.994;0.994	D;D;D	0.80764	0.994;0.983;0.983	T	0.04191	-1.0970	10	0.87932	D	0	-21.1261	12.2958	0.54844	0.1669:0.0:0.8331:0.0	.	266;266;266	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	R	266	ENSP00000356629:S266R;ENSP00000354536:S266R;ENSP00000356626:S266R;ENSP00000395041:S266R	ENSP00000354536:S266R	S	-	3	2	ASTN1	175268282	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.247000	0.43151	1.320000	0.45209	0.655000	0.94253	AGC		0.597	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		69	108	1	0	5.26073e-25	0.048971	7.25518e-25	69	108				
RASAL2	9462	broad.mit.edu	37	1	178310735	178310735	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:178310735A>G	ENST00000462775.1	+	1	130	c.5A>G	c.(4-6)cAg>cGg	p.Q2R	RASAL2_ENST00000367649.3_Intron|RASAL2_ENST00000448150.3_Intron	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	2					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)	p.Q2R(2)		biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						CACACGATGCAGACCCCAGGT	0.428																																							uc001glr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(2)|large_intestine(1)	5						c.(4-6)CAG>CGG		RAS protein activator like 2 isoform 1							103.0	94.0	97.0					1																	178310735		2203	4300	6503	SO:0001583	missense	9462				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity	g.chr1:178310735A>G	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.5A>G	1.37:g.178310735A>G	ENSP00000420558:p.Gln2Arg		Somatic				RASAL2_uc009wxb.2_Intron|RASAL2_uc001glq.2_Intron	p.Q2R	NM_004841	NP_004832	WXS	Illumina HiSeq	Unspecified	Q9UJF2	NGAP_HUMAN			1	130	+			2					F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	37	c.5A>G	CCDS1322.1	.	.	.	.	.	.	.	.	.	.	A	6.307	0.424708	0.11987	.	.	ENSG00000075391	ENST00000462775	T	0.18338	2.22	5.89	5.89	0.94794	.	.	.	.	.	T	0.14527	0.0351	N	0.08118	0	0.80722	D	1	P	0.45126	0.851	P	0.55391	0.775	T	0.10132	-1.0643	9	0.02654	T	1	.	12.7027	0.57043	1.0:0.0:0.0:0.0	.	2	Q9UJF2	NGAP_HUMAN	R	2	ENSP00000420558:Q2R	ENSP00000420558:Q2R	Q	+	2	0	RASAL2	176577358	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	3.380000	0.52448	2.257000	0.74773	0.460000	0.39030	CAG		0.428	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692		5	21	0	0	0	0.021553	0	5	21				
RASAL2	9462	broad.mit.edu	37	1	178412214	178412214	+	Silent	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:178412214G>T	ENST00000462775.1	+	6	1013	c.888G>T	c.(886-888)ctG>ctT	p.L296L	RASAL2_ENST00000367649.3_Silent_p.L444L|RASAL2_ENST00000448150.3_Silent_p.L426L	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	296					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)	p.L426L(2)|p.L296L(2)|p.L444L(2)		biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TCACCATTCTGCCTATGGAGC	0.413																																							uc001glr.2		NA																	6	Substitution - coding silent(6)		lung(6)	ovary(2)|breast(2)|large_intestine(1)	5						c.(886-888)CTG>CTT		RAS protein activator like 2 isoform 1							111.0	109.0	110.0					1																	178412214		2203	4300	6503	SO:0001819	synonymous_variant	9462				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity	g.chr1:178412214G>T	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.888G>T	1.37:g.178412214G>T			Somatic				RASAL2_uc001glq.2_Silent_p.L444L	p.L296L	NM_004841	NP_004832	WXS	Illumina HiSeq	Unspecified	Q9UJF2	NGAP_HUMAN			6	1013	+			296					F8W755|O95174|Q2TB22|Q5TFU9	Silent	SNP	ENST00000462775.1	37	c.888G>T	CCDS1322.1																																																																																				0.413	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692		10	29	1	0	4.68919e-08	0.069234	5.4239e-08	10	29				
BRINP3	339479	broad.mit.edu	37	1	190067177	190067177	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:190067177C>G	ENST00000367462.3	-	8	2503	c.2272G>C	c.(2272-2274)Gat>Cat	p.D758H	BRINP3_ENST00000534846.1_Missense_Mutation_p.D656H	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	758					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.D758H(2)									GTGTCATAATCCATTGTGTTT	0.403																																							uc001gse.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(2272-2274)GAT>CAT		family with sequence similarity 5, member C							150.0	148.0	149.0					1																	190067177		2203	4300	6503	SO:0001583	missense	339479					extracellular region		g.chr1:190067177C>G	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2272G>C	1.37:g.190067177C>G	ENSP00000356432:p.Asp758His		Somatic				FAM5C_uc010pot.1_Missense_Mutation_p.D656H	p.D758H	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			8	2504	-	Prostate(682;0.198)		758					B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	c.2272G>C	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.699119	0.68501	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.20881	2.31;2.04	5.59	5.59	0.84812	.	0.106370	0.64402	D	0.000006	T	0.29850	0.0746	L	0.46157	1.445	0.80722	D	1	P;B	0.35656	0.514;0.38	B;B	0.43575	0.424;0.243	T	0.03112	-1.1071	10	0.87932	D	0	.	17.0858	0.86611	0.0:1.0:0.0:0.0	.	656;758	B7Z260;Q76B58	.;FAM5C_HUMAN	H	758;656	ENSP00000356432:D758H;ENSP00000438022:D656H	ENSP00000356432:D758H	D	-	1	0	FAM5C	188333800	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.734000	0.84928	2.626000	0.88956	0.557000	0.71058	GAT		0.403	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		29	52	0	0	0	0.034045	0	29	52				
BRINP3	339479	broad.mit.edu	37	1	190067891	190067891	+	Missense_Mutation	SNP	G	G	C	rs147799875		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:190067891G>C	ENST00000367462.3	-	8	1789	c.1558C>G	c.(1558-1560)Cgc>Ggc	p.R520G	BRINP3_ENST00000534846.1_Missense_Mutation_p.R418G	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	520					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.R520G(2)|p.R520S(1)									CTATTGAGGCGCATGTCATTG	0.453																																							uc001gse.1		NA																	3	Substitution - Missense(3)		lung(3)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(1558-1560)CGC>GGC		family with sequence similarity 5, member C							142.0	136.0	138.0					1																	190067891		2203	4300	6503	SO:0001583	missense	339479					extracellular region		g.chr1:190067891G>C	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1558C>G	1.37:g.190067891G>C	ENSP00000356432:p.Arg520Gly		Somatic				FAM5C_uc010pot.1_Missense_Mutation_p.R418G	p.R520G	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			8	1790	-	Prostate(682;0.198)		520					B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	c.1558C>G	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034536	0.54896	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.25749	2.03;1.78	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.49729	0.1574	M	0.73962	2.25	0.58432	D	0.999997	D;D	0.67145	0.996;0.987	D;D	0.76575	0.988;0.931	T	0.50233	-0.8852	10	0.66056	D	0.02	.	12.1722	0.54165	0.0:0.0:0.8293:0.1707	.	418;520	B7Z260;Q76B58	.;FAM5C_HUMAN	G	520;418	ENSP00000356432:R520G;ENSP00000438022:R418G	ENSP00000356432:R520G	R	-	1	0	FAM5C	188334514	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.617000	0.61204	2.653000	0.90120	0.591000	0.81541	CGC		0.453	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		59	94	0	0	0	0.048971	0	59	94				
ASPM	259266	broad.mit.edu	37	1	197072028	197072028	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:197072028C>A	ENST00000367409.4	-	18	6609	c.6353G>T	c.(6352-6354)aGg>aTg	p.R2118M	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2118	IQ 16. {ECO:0000255|PROSITE- ProRule:PRU00116}.|IQ 17. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.R2118M(2)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AGTGGCTGCCCTGTGCATGTG	0.328																																							uc001gtu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(2)	6						c.(6352-6354)AGG>ATG		asp (abnormal spindle)-like, microcephaly							132.0	135.0	134.0					1																	197072028		2203	4298	6501	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197072028C>A	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.6353G>T	1.37:g.197072028C>A	ENSP00000356379:p.Arg2118Met		Somatic				ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	p.R2118M	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			18	6610	-			2118			IQ 17.|IQ 16.		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.6353G>T	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	c	6.812	0.518991	0.13005	.	.	ENSG00000066279	ENST00000367409	T	0.73047	-0.71	5.59	-11.2	0.00127	.	0.879447	0.10099	N	0.716195	T	0.37892	0.1020	N	0.16368	0.405	0.09310	N	1	B	0.26318	0.146	B	0.24394	0.053	T	0.15122	-1.0448	10	0.30078	T	0.28	.	1.0549	0.01588	0.1407:0.2662:0.226:0.3672	.	2118	Q8IZT6	ASPM_HUMAN	M	2118	ENSP00000356379:R2118M	ENSP00000356379:R2118M	R	-	2	0	ASPM	195338651	0.000000	0.05858	0.001000	0.08648	0.820000	0.46376	-0.602000	0.05680	-1.417000	0.02017	-0.289000	0.09944	AGG		0.328	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		14	38	1	0	1.3612e-06	0.024245	1.52528e-06	14	38				
LRRN2	10446	broad.mit.edu	37	1	204588136	204588136	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:204588136G>A	ENST00000367175.1	-	1	3197	c.985C>T	c.(985-987)Cgc>Tgc	p.R329C	LRRN2_ENST00000367177.3_Missense_Mutation_p.R329C|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367176.3_Missense_Mutation_p.R329C|RP11-430C7.4_ENST00000453895.1_RNA			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	329					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R329C(2)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			TGGAAGGCGCGGGGGTGGATG	0.607																																							uc001hbe.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)	2						c.(985-987)CGC>TGC		leucine rich repeat neuronal 2 precursor							77.0	60.0	65.0					1																	204588136		2203	4300	6503	SO:0001583	missense	10446				cell adhesion	integral to membrane	receptor activity	g.chr1:204588136G>A	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.985C>T	1.37:g.204588136G>A	ENSP00000356143:p.Arg329Cys		Somatic				MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Missense_Mutation_p.R329C|LRRN2_uc009xbf.1_Missense_Mutation_p.R329C|MDM4_uc001hbc.2_Intron	p.R329C	NM_006338	NP_006329	WXS	Illumina HiSeq	Unspecified	O75325	LRRN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)		3	1373	-	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		329			LRR 11.|Extracellular (Potential).		B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	ENST00000367175.1	37	c.985C>T	CCDS1448.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.747070	0.30955	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.59083	0.29;0.29;0.29	5.69	5.69	0.88448	.	0.000000	0.43579	D	0.000542	T	0.64238	0.2580	L	0.45698	1.435	0.44789	D	0.997795	D	0.89917	1.0	D	0.66847	0.947	T	0.62604	-0.6819	10	0.36615	T	0.2	.	7.6963	0.28596	0.0801:0.0:0.7126:0.2073	.	329	O75325	LRRN2_HUMAN	C	329	ENSP00000356144:R329C;ENSP00000356145:R329C;ENSP00000356143:R329C	ENSP00000356143:R329C	R	-	1	0	LRRN2	202854759	0.996000	0.38824	1.000000	0.80357	0.992000	0.81027	2.343000	0.44001	2.688000	0.91661	0.563000	0.77884	CGC		0.607	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338		18	74	0	0	0	0.038395	0	18	74				
ITPKB	3707	broad.mit.edu	37	1	226924682	226924682	+	Missense_Mutation	SNP	C	C	A	rs573808314		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:226924682C>A	ENST00000272117.3	-	1	477	c.478G>T	c.(478-480)Gcc>Tcc	p.A160S	ITPKB_ENST00000366784.1_Missense_Mutation_p.A160S|ITPKB_ENST00000429204.1_Missense_Mutation_p.A160S			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	160					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.A160S(2)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				GCTTGAATGGCGGAGCTCTGT	0.652																																					Colon(84;110 1851 5306 33547)	Colon(84;110 1851 5306 33547)	uc010pvo.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)	5						c.(478-480)GCC>TCC		1D-myo-inositol-trisphosphate 3-kinase B							68.0	72.0	71.0					1																	226924682		2193	4278	6471	SO:0001583	missense	3707						ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity	g.chr1:226924682C>A	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.478G>T	1.37:g.226924682C>A	ENSP00000272117:p.Ala160Ser		Somatic				ITPKB_uc001hqh.2_Missense_Mutation_p.A160S	p.A160S	NM_002221	NP_002212	WXS	Illumina HiSeq	Unspecified	P27987	IP3KB_HUMAN			2	818	-		Prostate(94;0.0773)	160					Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	c.478G>T	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.388661	0.42308	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.28069	1.72;1.72;1.63	4.28	3.36	0.38483	.	0.131072	0.34986	N	0.003527	T	0.16300	0.0392	N	0.14661	0.345	0.26664	N	0.971861	B	0.24426	0.103	B	0.29267	0.1	T	0.25710	-1.0124	10	0.14252	T	0.57	.	8.3342	0.32204	0.0:0.8204:0.0:0.1796	.	160	P27987	IP3KB_HUMAN	S	160	ENSP00000272117:A160S;ENSP00000411152:A160S;ENSP00000355748:A160S	ENSP00000272117:A160S	A	-	1	0	ITPKB	224991305	0.744000	0.28250	0.711000	0.30485	0.982000	0.71751	2.049000	0.41288	0.989000	0.38761	0.561000	0.74099	GCC		0.652	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221		70	142	1	0	7.91278e-47	0.048971	1.13492e-46	70	142				
URB2	9816	broad.mit.edu	37	1	229779384	229779384	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:229779384A>T	ENST00000258243.2	+	5	3875	c.3739A>T	c.(3739-3741)Atg>Ttg	p.M1247L		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1247						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.M1247L(2)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GAGGCTGGTGATGCAGTGTAT	0.512																																							uc001hts.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|ovary(1)	3						c.(3739-3741)ATG>TTG		URB2 ribosome biogenesis 2 homolog							185.0	163.0	171.0					1																	229779384		2203	4300	6503	SO:0001583	missense	9816					nucleolus		g.chr1:229779384A>T	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3739A>T	1.37:g.229779384A>T	ENSP00000258243:p.Met1247Leu		Somatic				URB2_uc009xfd.1_Missense_Mutation_p.M1247L	p.M1247L	NM_014777	NP_055592	WXS	Illumina HiSeq	Unspecified	Q14146	URB2_HUMAN			5	3875	+			1247					Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	c.3739A>T	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.980253	0.00448	.	.	ENSG00000135763	ENST00000258243	T	0.19532	2.14	5.36	-3.88	0.04205	.	0.492741	0.24267	N	0.040028	T	0.07548	0.0190	N	0.11201	0.11	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30238	-0.9985	9	.	.	.	-7.559	7.268	0.26239	0.2556:0.5716:0.0662:0.1066	.	1247	Q14146	URB2_HUMAN	L	1247	ENSP00000258243:M1247L	.	M	+	1	0	URB2	227846007	0.799000	0.28903	0.002000	0.10522	0.004000	0.04260	0.352000	0.20113	-0.892000	0.03935	-0.321000	0.08615	ATG		0.512	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777		47	101	0	0	0	0.048971	0	47	101				
ACTN2	88	broad.mit.edu	37	1	236925779	236925779	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:236925779G>A	ENST00000366578.4	+	21	2711	c.2545G>A	c.(2545-2547)Gag>Aag	p.E849K	ACTN2_ENST00000546208.1_Missense_Mutation_p.E343K|ACTN2_ENST00000542672.1_Missense_Mutation_p.E849K	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	849					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.E849K(2)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CCTGGCGGAGGAGCTGCGTCG	0.537																																							uc001hyf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(1)	5						c.(2545-2547)GAG>AAG		actinin, alpha 2							49.0	51.0	51.0					1																	236925779		2203	4300	6503	SO:0001583	missense	88				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding	g.chr1:236925779G>A	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2545G>A	1.37:g.236925779G>A	ENSP00000355537:p.Glu849Lys		Somatic				ACTN2_uc001hyg.2_Missense_Mutation_p.E641K|ACTN2_uc009xgi.1_Missense_Mutation_p.E849K|ACTN2_uc010pxu.1_Missense_Mutation_p.E538K|ACTN2_uc001hyh.2_Missense_Mutation_p.E537K	p.E849K	NM_001103	NP_001094	WXS	Illumina HiSeq	Unspecified	P35609	ACTN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00168)		21	2749	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	849					B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	c.2545G>A	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	G	36	5.735546	0.96865	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.53640	0.61;0.61;0.61	5.43	5.43	0.79202	EF-hand, Ca insensitive (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.78298	0.4261	M	0.93854	3.465	0.80722	D	1	D;P;D;P	0.71674	0.998;0.926;0.998;0.944	D;P;D;D	0.87578	0.998;0.89;0.998;0.977	D	0.83766	0.0217	10	0.87932	D	0	.	19.6166	0.95636	0.0:0.0:1.0:0.0	.	634;849;619;849	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	K	849;849;343;618	ENSP00000443495:E849K;ENSP00000355537:E849K;ENSP00000438384:E343K	ENSP00000355537:E849K	E	+	1	0	ACTN2	234992402	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.680000	0.98651	2.721000	0.93114	0.655000	0.94253	GAG		0.537	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103		23	56	0	0	0	0.083992	0	23	56				
RYR2	6262	broad.mit.edu	37	1	237880668	237880668	+	Splice_Site	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:237880668G>A	ENST00000366574.2	+	72	10811	c.10494G>A	c.(10492-10494)ctG>ctA	p.L3498L	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Splice_Site_p.L3482L|RYR2_ENST00000360064.6_Splice_Site_p.L3496L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3498					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.L3496L(2)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GATTTAGCCTGGTAAGTCTCC	0.478																																							uc001hyl.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(10492-10494)CTG>CTA		cardiac muscle ryanodine receptor							63.0	67.0	66.0					1																	237880668		1923	4131	6054	SO:0001630	splice_region_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237880668G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10494+1G>A	1.37:g.237880668G>A			Somatic				RYR2_uc010pxz.1_Silent_p.L453L	p.L3498L	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		72	10614	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3498					Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.10494G>A	CCDS55691.1																																																																																				0.478	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	Silent	6	19	0	0	0	0.02938	0	6	19				
AKT3	10000	broad.mit.edu	37	1	243809209	243809209	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:243809209G>A	ENST00000366539.1	-	5	615	c.415C>T	c.(415-417)Cat>Tat	p.H139Y	AKT3_ENST00000336199.5_Missense_Mutation_p.H139Y|AKT3_ENST00000263826.5_Missense_Mutation_p.H139Y|AKT3_ENST00000366540.1_Missense_Mutation_p.H139Y			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	139					mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.H139Y(6)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			CTTTTATGATGGGTTGTAGAG	0.378																																							uc001iab.1		NA																	6	Substitution - Missense(6)		lung(6)	stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(415-417)CAT>TAT		AKT3 kinase isoform 1							188.0	186.0	186.0					1																	243809209		2203	4300	6503	SO:0001583	missense	10000				signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr1:243809209G>A	AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.415C>T	1.37:g.243809209G>A	ENSP00000355497:p.His139Tyr		Somatic				AKT3_uc001hzz.1_Missense_Mutation_p.H139Y	p.H139Y	NM_005465	NP_005456	WXS	Illumina HiSeq	Unspecified	Q9Y243	AKT3_HUMAN	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)		4	496	-	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	139					Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Missense_Mutation	SNP	ENST00000366539.1	37	c.415C>T	CCDS31077.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.242886	0.58995	.	.	ENSG00000117020	ENST00000336199;ENST00000366540;ENST00000366539;ENST00000263826;ENST00000552631	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;2.2	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.28167	0.0695	N	0.08118	0	0.58432	D	0.999994	B;B	0.26547	0.109;0.152	B;B	0.22601	0.018;0.04	T	0.13388	-1.0511	10	0.62326	D	0.03	.	18.8415	0.92186	0.0:0.0:1.0:0.0	.	139;139	Q9Y243;Q9Y243-2	AKT3_HUMAN;.	Y	139	ENSP00000336943:H139Y;ENSP00000355498:H139Y;ENSP00000355497:H139Y;ENSP00000263826:H139Y;ENSP00000447820:H139Y	ENSP00000263826:H139Y	H	-	1	0	AKT3	241875832	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.276000	0.65580	2.442000	0.82660	0.591000	0.81541	CAT		0.378	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	NM_181690		12	26	0	0	0	0.09319	0	12	26				
OR2L8	391190	broad.mit.edu	37	1	248112482	248112482	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:248112482G>T	ENST00000357191.3	+	1	323	c.323G>T	c.(322-324)gGt>gTt	p.G108V	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G108V(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GCATTAGGAGGTGCAGAAGCA	0.438																																							uc001idt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(322-324)GGT>GTT		olfactory receptor, family 2, subfamily L,							323.0	262.0	282.0					1																	248112482		2203	4300	6503	SO:0001583	missense	391190				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248112482G>T	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.323G>T	1.37:g.248112482G>T	ENSP00000349719:p.Gly108Val		Somatic				OR2L13_uc001ids.2_Intron	p.G108V	NM_001001963	NP_001001963	WXS	Illumina HiSeq	Unspecified	Q8NGY9	OR2L8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	323	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		108			Helical; Name=3; (Potential).		Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	37	c.323G>T	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	6.669	0.491984	0.12702	.	.	ENSG00000196936	ENST00000357191	T	0.09817	2.94	1.64	-1.46	0.08800	GPCR, rhodopsin-like superfamily (1);	0.953435	0.08496	N	0.937241	T	0.06872	0.0175	N	0.20357	0.565	0.09310	N	0.999995	B	0.17465	0.022	B	0.23852	0.049	T	0.42548	-0.9445	10	0.56958	D	0.05	.	4.8194	0.13383	0.0:0.2477:0.4342:0.3182	.	108	Q8NGY9	OR2L8_HUMAN	V	108	ENSP00000349719:G108V	ENSP00000349719:G108V	G	+	2	0	OR2L8	246179105	0.000000	0.05858	0.705000	0.30386	0.131000	0.20780	-3.047000	0.00630	0.003000	0.14656	0.479000	0.44913	GGT		0.438	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2			19	212	1	0	8.00594e-06	0.043863	8.85238e-06	19	212				
OR2L3	391192	broad.mit.edu	37	1	248224306	248224306	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:248224306G>T	ENST00000359959.3	+	1	323	c.323G>T	c.(322-324)gGt>gTt	p.G108V	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G108V(2)		cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GCATTAGGAGGTGCAGAAGCA	0.438																																							uc001idx.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(322-324)GGT>GTT		olfactory receptor, family 2, subfamily L,							200.0	240.0	227.0					1																	248224306		2203	4300	6503	SO:0001583	missense	391192				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248224306G>T	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.323G>T	1.37:g.248224306G>T	ENSP00000353044:p.Gly108Val		Somatic				OR2L13_uc001ids.2_Intron	p.G108V	NM_001004687	NP_001004687	WXS	Illumina HiSeq	Unspecified	Q8NG85	OR2L3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	323	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		108			Helical; Name=3; (Potential).		B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	c.323G>T	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	.	4.097	0.016101	0.07959	.	.	ENSG00000198128	ENST00000359959	T	0.01313	5.02	2.05	-1.23	0.09465	GPCR, rhodopsin-like superfamily (1);	0.953435	0.08496	N	0.937241	T	0.01592	0.0051	L	0.41710	1.295	0.09310	N	0.999996	B	0.21606	0.058	B	0.27076	0.076	T	0.47560	-0.9108	10	0.56958	D	0.05	.	3.6445	0.08180	0.1067:0.1438:0.5476:0.2019	.	108	Q8NG85	OR2L3_HUMAN	V	108	ENSP00000353044:G108V	ENSP00000353044:G108V	G	+	2	0	OR2L3	246290929	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.889000	0.01614	-0.164000	0.10927	-1.348000	0.01239	GGT		0.438	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687		40	60	1	0	7.90463e-13	0.048971	9.77371e-13	40	60				
OR2T3	343173	broad.mit.edu	37	1	248636980	248636980	+	Missense_Mutation	SNP	T	T	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:248636980T>G	ENST00000359594.2	+	1	354	c.329T>G	c.(328-330)cTg>cGg	p.L110R		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L110R(2)		breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCTTCTACCTGACCCTGGCT	0.542																																							uc001iel.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(328-330)CTG>CGG		olfactory receptor, family 2, subfamily T,							141.0	128.0	133.0					1																	248636980		2194	4298	6492	SO:0001583	missense	343173				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248636980T>G		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.329T>G	1.37:g.248636980T>G	ENSP00000352604:p.Leu110Arg		Somatic					p.L110R	NM_001005495	NP_001005495	WXS	Illumina HiSeq	Unspecified	Q8NH03	OR2T3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	329	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		110			Helical; Name=3; (Potential).		B2RNJ1	Missense_Mutation	SNP	ENST00000359594.2	37	c.329T>G	CCDS31117.1	.	.	.	.	.	.	.	.	.	.	t	14.19	2.462109	0.43736	.	.	ENSG00000196539	ENST00000359594	T	0.00563	6.58	2.65	1.47	0.22746	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01765	0.0056	M	0.90542	3.125	0.09310	N	1	D	0.63046	0.992	P	0.59948	0.866	T	0.40440	-0.9563	9	0.87932	D	0	.	3.7995	0.08753	0.0:0.1467:0.4194:0.4339	.	110	Q8NH03	OR2T3_HUMAN	R	110	ENSP00000352604:L110R	ENSP00000352604:L110R	L	+	2	0	OR2T3	246703603	0.000000	0.05858	0.009000	0.14445	0.630000	0.37929	-0.269000	0.08596	0.967000	0.38186	0.156000	0.16432	CTG		0.542	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495		56	112	0	0	0	0.048971	0	56	112				
LARP4B	23185	broad.mit.edu	37	10	910104	910105	+	Missense_Mutation	DNP	CA	CA	AT			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:910104_910105CA>AT	ENST00000316157.3	-	3	287_288	c.247_248TG>AT	c.(247-249)TGg>ATg	p.W83M		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	83					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)	p.W83M(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						CACCTCCTCCCATGCAGCACTC	0.589																																							uc001ifs.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(247-249)TGG>ATG		La ribonucleoprotein domain family, member 4B																																				SO:0001583	missense	23185						nucleotide binding|RNA binding	g.chr10:910104_910105CA>AT	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.247_248delinsAT	10.37:g.910104_910105delinsAT	ENSP00000326128:p.Trp83Met		Somatic					p.W83M	NM_015155	NP_055970	WXS	Illumina HiSeq	Unspecified	Q92615	LAR4B_HUMAN			3	288_289	-			83					A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	DNP	ENST00000316157.3	37	c.247_248TG>AT	CCDS31131.1																																																																																				0.589	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155		27	14	0	0	0	0.004672	0	27	14				
TRDMT1	1787	broad.mit.edu	37	10	17195622	17195622	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:17195622T>C	ENST00000377799.3	-	10	1006	c.959A>G	c.(958-960)tAc>tGc	p.Y320C	TRDMT1_ENST00000488990.1_Missense_Mutation_p.Y197C|TRDMT1_ENST00000412821.3_Missense_Mutation_p.Y296C|TRDMT1_ENST00000377766.5_3'UTR|TRDMT1_ENST00000358282.7_3'UTR|TRDMT1_ENST00000351358.4_Missense_Mutation_p.Y274C|TRDMT1_ENST00000452380.2_5'UTR|TRDMT1_ENST00000457442.2_Missense_Mutation_p.Y239C	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1	320	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)	p.Y320C(2)		breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	AAGGGATTTGTAGATATTCTC	0.338																																							uc001iop.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(958-960)TAC>TGC		tRNA aspartic acid methyltransferase 1 isoform							102.0	99.0	100.0					10																	17195622		2203	4300	6503	SO:0001583	missense	1787				tRNA processing	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|RNA binding	g.chr10:17195622T>C	AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.959A>G	10.37:g.17195622T>C	ENSP00000367030:p.Tyr320Cys		Somatic				TRDMT1_uc001ioq.2_Missense_Mutation_p.Y296C|TRDMT1_uc001ior.2_Missense_Mutation_p.Y274C|TRDMT1_uc001ios.2_Missense_Mutation_p.Y249C|TRDMT1_uc009xjt.2_Missense_Mutation_p.Y239C|TRDMT1_uc010qcc.1_Missense_Mutation_p.Y249C|TRDMT1_uc010qcd.1_Missense_Mutation_p.Y197C	p.Y320C	NM_004412	NP_004403	WXS	Illumina HiSeq	Unspecified	O14717	TRDMT_HUMAN			10	1007	-			320					B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	Missense_Mutation	SNP	ENST00000377799.3	37	c.959A>G	CCDS7114.1	.	.	.	.	.	.	.	.	.	.	T	12.81	2.048362	0.36181	.	.	ENSG00000107614	ENST00000377799;ENST00000412821;ENST00000351358;ENST00000457442;ENST00000488990	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	5.62	5.62	0.85841	.	0.111748	0.64402	D	0.000007	T	0.74989	0.3789	M	0.68317	2.08	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.997;0.996;0.999	D;D;D;P;P;D	0.71414	0.969;0.973;0.956;0.849;0.793;0.961	T	0.77264	-0.2652	10	0.66056	D	0.02	-10.0337	11.0339	0.47789	0.1715:0.0:0.0:0.8285	.	197;249;239;274;296;320	B7Z8H2;B7Z1Y7;E7EMI8;O14717-3;O14717-2;O14717	.;.;.;.;.;TRDMT_HUMAN	C	320;296;274;239;197	ENSP00000367030:Y320C;ENSP00000409354:Y296C;ENSP00000324328:Y274C;ENSP00000412256:Y239C;ENSP00000419625:Y197C	ENSP00000324328:Y274C	Y	-	2	0	TRDMT1	17235628	1.000000	0.71417	1.000000	0.80357	0.243000	0.25628	3.471000	0.53107	2.260000	0.74910	0.528000	0.53228	TAC		0.338	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047024.3	NM_004412		7	10	0	0	0	0.02938	0	7	10				
SLC39A12	221074	broad.mit.edu	37	10	18289671	18289671	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:18289671T>C	ENST00000377369.2	+	11	1949	c.1676T>C	c.(1675-1677)aTa>aCa	p.I559T	SLC39A12_ENST00000539911.1_Missense_Mutation_p.I425T|SLC39A12_ENST00000377374.4_Missense_Mutation_p.I522T|SLC39A12_ENST00000377371.3_Missense_Mutation_p.I558T|SLC39A12-AS1_ENST00000445287.1_RNA|SLC39A12-AS1_ENST00000439319.1_RNA	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	559					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)	p.I522T(2)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						GGCCTAGCCATAGGAGCAGCC	0.438																																							uc001ipo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)	2						c.(1675-1677)ATA>ACA		solute carrier family 39 (zinc transporter),							160.0	138.0	145.0					10																	18289671		2203	4300	6503	SO:0001583	missense	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18289671T>C		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1676T>C	10.37:g.18289671T>C	ENSP00000366586:p.Ile559Thr		Somatic				SLC39A12_uc001ipn.2_Missense_Mutation_p.I522T|SLC39A12_uc001ipp.2_Missense_Mutation_p.I558T|SLC39A12_uc010qck.1_Missense_Mutation_p.I425T	p.I559T	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			11	1949	+			559			Helical; (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	37	c.1676T>C	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	T	18.74	3.688264	0.68271	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.78	5.78	0.91487	.	0.261463	0.44097	D	0.000499	T	0.78483	0.4290	H	0.94264	3.515	0.58432	D	0.999994	P;P;D	0.55800	0.953;0.936;0.973	P;P;P	0.60068	0.843;0.868;0.843	D	0.84916	0.0851	10	0.87932	D	0	-8.7848	16.3979	0.83621	0.0:0.0:0.0:1.0	.	558;559;522	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	T	559;522;558;425;479	ENSP00000366586:I559T;ENSP00000366591:I522T;ENSP00000366588:I558T;ENSP00000440445:I425T	ENSP00000366586:I559T	I	+	2	0	SLC39A12	18329677	1.000000	0.71417	0.579000	0.28588	0.512000	0.34134	7.997000	0.88414	2.333000	0.79357	0.533000	0.62120	ATA		0.438	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		24	38	0	0	0	0.045705	0	24	38				
ZNF438	220929	broad.mit.edu	37	10	31137569	31137569	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:31137569C>T	ENST00000361310.3	-	6	2094	c.1765G>A	c.(1765-1767)Gtg>Atg	p.V589M	ZNF438_ENST00000452305.1_Missense_Mutation_p.V579M|ZNF438_ENST00000444692.2_Missense_Mutation_p.V579M|ZNF438_ENST00000375311.1_Missense_Mutation_p.V153M|ZNF438_ENST00000442986.1_Missense_Mutation_p.V589M|ZNF438_ENST00000413025.1_Missense_Mutation_p.V589M|ZNF438_ENST00000538351.2_Missense_Mutation_p.V540M|ZNF438_ENST00000331737.6_Missense_Mutation_p.V579M|ZNF438_ENST00000436087.2_Missense_Mutation_p.V589M			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	589					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V589M(2)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				ACCCTATGCACTTCTTTCAGA	0.488																																							uc010qdz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)	2						c.(1765-1767)GTG>ATG		zinc finger protein 438 isoform a							133.0	121.0	125.0					10																	31137569		2203	4300	6503	SO:0001583	missense	220929				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:31137569C>T	AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.1765G>A	10.37:g.31137569C>T	ENSP00000354663:p.Val589Met		Somatic				ZNF438_uc001ivn.2_Missense_Mutation_p.V540M|ZNF438_uc010qdy.1_Missense_Mutation_p.V579M|ZNF438_uc001ivo.3_Missense_Mutation_p.V153M|ZNF438_uc009xlg.2_Missense_Mutation_p.V589M|ZNF438_uc001ivp.3_Missense_Mutation_p.V579M|ZNF438_uc010qea.1_Missense_Mutation_p.V589M|ZNF438_uc010qeb.1_Missense_Mutation_p.V589M|ZNF438_uc010qec.1_Missense_Mutation_p.V153M	p.V589M	NM_182755	NP_877432	WXS	Illumina HiSeq	Unspecified	Q7Z4V0	ZN438_HUMAN			7	2200	-		Prostate(175;0.0587)	589			C2H2-type 3.		A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	ENST00000361310.3	37	c.1765G>A	CCDS7168.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700513	0.88924	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351;ENST00000430896;ENST00000375311	T;T;T;T;T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78;2.78;2.78;2.78;2.78	5.24	5.24	0.73138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.34308	0.0893	M	0.72894	2.215	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.04650	-1.0936	10	0.66056	D	0.02	-19.8206	17.7921	0.88555	0.0:1.0:0.0:0.0	.	589;579	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	M	579;589;589;589;589;579;579;540;308;153	ENSP00000333571:V579M;ENSP00000354663:V589M;ENSP00000406934:V589M;ENSP00000412363:V589M;ENSP00000387546:V589M;ENSP00000413060:V579M;ENSP00000410898:V579M;ENSP00000445461:V540M;ENSP00000364460:V153M	ENSP00000333571:V579M	V	-	1	0	ZNF438	31177575	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	5.467000	0.66737	2.442000	0.82660	0.467000	0.42956	GTG		0.488	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277006.1	NM_182755		87	63	0	0	0	0.048971	0	87	63				
PCDH15	65217	broad.mit.edu	37	10	55587214	55587214	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:55587214G>A	ENST00000320301.6	-	32	4700	c.4306C>T	c.(4306-4308)Ccg>Tcg	p.P1436S	PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.P1396S|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.P1443S|PCDH15_ENST00000414778.1_Missense_Mutation_p.P1438S|PCDH15_ENST00000409834.1_Missense_Mutation_p.P1047S|PCDH15_ENST00000361849.3_Missense_Mutation_p.P1436S|PCDH15_ENST00000395438.1_Missense_Mutation_p.P1436S|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000437009.1_Missense_Mutation_p.P1365S|PCDH15_ENST00000395430.1_Missense_Mutation_p.P1433S|PCDH15_ENST00000395445.1_Missense_Mutation_p.P1443S|PCDH15_ENST00000395433.1_Missense_Mutation_p.P1411S	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1436	Poly-Pro.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.P1436S(4)|p.P1438S(2)|p.P1441S(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ggcggcggcgggggcgCTGCC	0.587										HNSCC(58;0.16)																													uc001jju.1		NA																	8	Substitution - Missense(8)		lung(8)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(4306-4308)CCG>TCG		protocadherin 15 isoform CD1-4 precursor							36.0	44.0	41.0					10																	55587214		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55587214G>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4306C>T	10.37:g.55587214G>A	ENSP00000322604:p.Pro1436Ser	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Missense_Mutation_p.P1441S|PCDH15_uc010qhr.1_Missense_Mutation_p.P1436S|PCDH15_uc010qhs.1_Missense_Mutation_p.P1448S|PCDH15_uc010qht.1_Missense_Mutation_p.P1443S|PCDH15_uc010qhu.1_Missense_Mutation_p.P1436S|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.P1433S|PCDH15_uc010qhw.1_Missense_Mutation_p.P1396S|PCDH15_uc010qhx.1_Missense_Mutation_p.P1365S|PCDH15_uc010qhy.1_Missense_Mutation_p.P1441S|PCDH15_uc010qhz.1_Missense_Mutation_p.P1436S|PCDH15_uc010qia.1_Missense_Mutation_p.P1414S|PCDH15_uc010qib.1_Missense_Mutation_p.P1411S	p.P1436S	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			32	4701	-		Melanoma(3;0.117)|Lung SC(717;0.238)	1436			Poly-Pro.|Cytoplasmic (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.4306C>T	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480516	0.63849	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;D	0.85629	-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-2.01	5.4	5.4	0.78164	.	.	.	.	.	T	0.76926	0.4056	N	0.12182	0.205	0.31280	N	0.690753	B;P;P;P;P;P;P;B;B;B;B;B;P	0.45078	0.444;0.752;0.752;0.594;0.85;0.848;0.848;0.049;0.329;0.329;0.146;0.179;0.757	B;B;B;B;B;B;B;B;B;B;B;B;B	0.43155	0.169;0.345;0.345;0.114;0.41;0.345;0.345;0.039;0.084;0.077;0.057;0.084;0.26	T	0.79147	-0.1923	9	0.51188	T	0.08	.	15.0276	0.71682	0.0:0.0:1.0:0.0	.	1411;1436;1436;1441;1365;1396;1433;1436;1443;1443;1436;1438;1436	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	S	1443;1438;1436;1436;1047;1443;1396;1436;1411;1436;1433;1441;1365	ENSP00000363076:P1443S;ENSP00000410304:P1438S;ENSP00000378826:P1436S;ENSP00000386693:P1047S;ENSP00000378832:P1443S;ENSP00000378820:P1396S;ENSP00000354950:P1436S;ENSP00000378821:P1411S;ENSP00000322604:P1436S;ENSP00000378818:P1433S;ENSP00000412628:P1365S	ENSP00000322604:P1436S	P	-	1	0	PCDH15	55257220	0.221000	0.23642	0.995000	0.50966	0.659000	0.38960	1.463000	0.35277	2.692000	0.91855	0.591000	0.81541	CCG		0.587	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		7	15	0	0	0	0.080935	0	7	15				
PCDH15	65217	broad.mit.edu	37	10	55721652	55721652	+	Splice_Site	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:55721652C>A	ENST00000320301.6	-	22	3263	c.2869G>T	c.(2869-2871)Gga>Tga	p.G957*	PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395432.2_Splice_Site_p.G920*|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373965.2_Splice_Site_p.G964*|PCDH15_ENST00000414778.1_Splice_Site_p.G962*|PCDH15_ENST00000409834.1_Splice_Site_p.G568*|PCDH15_ENST00000361849.3_Splice_Site_p.G957*|PCDH15_ENST00000395438.1_Splice_Site_p.G957*|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000437009.1_Splice_Site_p.G886*|PCDH15_ENST00000395430.1_Splice_Site_p.G957*|PCDH15_ENST00000395445.1_Splice_Site_p.G964*|PCDH15_ENST00000395433.1_Splice_Site_p.G935*	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	957	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.G957*(4)|p.G962*(4)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GCAGGTAATCCCtaaaataaa	0.313										HNSCC(58;0.16)																													uc001jju.1		NA																	8	Substitution - Nonsense(8)		lung(8)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(2869-2871)GGA>TGA		protocadherin 15 isoform CD1-4 precursor							53.0	54.0	53.0					10																	55721652		2203	4300	6503	SO:0001630	splice_region_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55721652C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2869-1G>T	10.37:g.55721652C>A		HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Nonsense_Mutation_p.G962*|PCDH15_uc010qhr.1_Nonsense_Mutation_p.G957*|PCDH15_uc010qhs.1_Nonsense_Mutation_p.G969*|PCDH15_uc010qht.1_Nonsense_Mutation_p.G964*|PCDH15_uc010qhu.1_Nonsense_Mutation_p.G957*|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Nonsense_Mutation_p.G957*|PCDH15_uc010qhw.1_Nonsense_Mutation_p.G920*|PCDH15_uc010qhx.1_Nonsense_Mutation_p.G886*|PCDH15_uc010qhy.1_Nonsense_Mutation_p.G962*|PCDH15_uc010qhz.1_Nonsense_Mutation_p.G957*|PCDH15_uc010qia.1_Nonsense_Mutation_p.G935*|PCDH15_uc010qib.1_Nonsense_Mutation_p.G935*	p.G957*	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			22	3264	-		Melanoma(3;0.117)|Lung SC(717;0.238)	957			Extracellular (Potential).|Cadherin 9.		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Nonsense_Mutation	SNP	ENST00000320301.6	37	c.2869G>T	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	43	10.334583	0.99385	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.0071	0.86396	0.0:1.0:0.0:0.0	.	.	.	.	X	964;962;957;957;568;964;920;957;935;957;957;962;886	.	ENSP00000322604:G957X	G	-	1	0	PCDH15	55391658	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	6.467000	0.73547	2.318000	0.78349	0.411000	0.27672	GGA		0.313	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	Nonsense_Mutation	10	15	1	0	2.17888e-05	0.058154	2.36752e-05	10	15				
PCDH15	65217	broad.mit.edu	37	10	55955474	55955474	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:55955474C>G	ENST00000320301.6	-	11	1668	c.1274G>C	c.(1273-1275)aGa>aCa	p.R425T	PCDH15_ENST00000373955.1_Missense_Mutation_p.R425T|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373957.3_Missense_Mutation_p.R403T|PCDH15_ENST00000395432.2_Missense_Mutation_p.R388T|PCDH15_ENST00000395440.1_Missense_Mutation_p.R425T|PCDH15_ENST00000373965.2_Missense_Mutation_p.R425T|PCDH15_ENST00000414778.1_Missense_Mutation_p.R430T|PCDH15_ENST00000409834.1_Missense_Mutation_p.R29T|PCDH15_ENST00000361849.3_Missense_Mutation_p.R425T|PCDH15_ENST00000395438.1_Missense_Mutation_p.R425T|PCDH15_ENST00000395446.1_Missense_Mutation_p.R425T|PCDH15_ENST00000437009.1_Missense_Mutation_p.R425T|PCDH15_ENST00000395430.1_Missense_Mutation_p.R425T|PCDH15_ENST00000395445.1_Missense_Mutation_p.R425T|PCDH15_ENST00000395433.1_Missense_Mutation_p.R403T	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	425	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.R430T(4)|p.R425T(4)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AGCTACTATTCTTAAAGGTGA	0.368										HNSCC(58;0.16)																													uc001jju.1		NA																	8	Substitution - Missense(8)		lung(8)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(1273-1275)AGA>ACA		protocadherin 15 isoform CD1-4 precursor							112.0	105.0	107.0					10																	55955474		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55955474C>G	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1274G>C	10.37:g.55955474C>G	ENSP00000322604:p.Arg425Thr	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Missense_Mutation_p.R430T|PCDH15_uc010qhr.1_Missense_Mutation_p.R425T|PCDH15_uc010qhs.1_Missense_Mutation_p.R430T|PCDH15_uc010qht.1_Missense_Mutation_p.R425T|PCDH15_uc010qhu.1_Missense_Mutation_p.R425T|PCDH15_uc001jjv.1_Missense_Mutation_p.R403T|PCDH15_uc010qhv.1_Missense_Mutation_p.R425T|PCDH15_uc010qhw.1_Missense_Mutation_p.R388T|PCDH15_uc010qhx.1_Missense_Mutation_p.R425T|PCDH15_uc010qhy.1_Missense_Mutation_p.R430T|PCDH15_uc010qhz.1_Missense_Mutation_p.R425T|PCDH15_uc010qia.1_Missense_Mutation_p.R403T|PCDH15_uc010qib.1_Missense_Mutation_p.R403T|PCDH15_uc001jjw.2_Missense_Mutation_p.R425T	p.R425T	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			11	1669	-		Melanoma(3;0.117)|Lung SC(717;0.238)	425			Cadherin 4.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.1274G>C	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223347	0.39300	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.60171	0.21;0.74;0.74;0.44;0.21;0.74;0.33;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.07	5.07	0.68467	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.52108	0.1714	L	0.40543	1.245	0.21822	N	0.999525	P;B;B;B;B;B;P;B;B;B;B;B;B;B;B	0.41188	0.741;0.409;0.409;0.043;0.404;0.409;0.741;0.173;0.243;0.243;0.409;0.409;0.062;0.409;0.409	P;B;B;B;B;B;P;B;B;B;B;B;B;B;B	0.48089	0.566;0.348;0.348;0.115;0.348;0.348;0.566;0.21;0.119;0.119;0.348;0.348;0.085;0.348;0.348	T	0.40194	-0.9576	9	0.14252	T	0.57	.	7.0096	0.24855	0.0:0.7787:0.0:0.2213	.	403;425;425;430;425;388;425;425;425;425;425;430;425;403;425	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	T	425;430;425;425;29;425;425;425;388;425;403;403;425;425;430;425;425	ENSP00000363076:R425T;ENSP00000410304:R430T;ENSP00000378826:R425T;ENSP00000386693:R29T;ENSP00000378832:R425T;ENSP00000378833:R425T;ENSP00000378827:R425T;ENSP00000378820:R388T;ENSP00000354950:R425T;ENSP00000378821:R403T;ENSP00000363068:R403T;ENSP00000322604:R425T;ENSP00000378818:R425T;ENSP00000412628:R425T;ENSP00000363066:R425T	ENSP00000322604:R425T	R	-	2	0	PCDH15	55625480	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	1.273000	0.33121	2.368000	0.80403	0.591000	0.81541	AGA		0.368	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		11	61	0	0	0	0.09319	0	11	61				
CDH23	64072	broad.mit.edu	37	10	73539147	73539147	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:73539147C>T	ENST00000224721.6	+	40	5331	c.5326C>T	c.(5326-5328)Cga>Tga	p.R1776*		NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	1771	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)	p.R1776*(1)		NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GGCCCATGACCGAGACTCAGG	0.622																																							uc001jrx.3		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(5)|large_intestine(4)|ovary(2)	11						c.(5311-5313)CGA>TGA		cadherin-like 23 isoform 1 precursor							44.0	43.0	43.0					10																	73539147		1992	4169	6161	SO:0001587	stop_gained	64072				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding	g.chr10:73539147C>T	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.5326C>T	10.37:g.73539147C>T	ENSP00000224721:p.Arg1776*		Somatic					p.R1771*	NM_022124	NP_071407	WXS	Illumina HiSeq	Unspecified	Q9H251	CAD23_HUMAN			39	5688	+			1771			Cadherin 17.|Extracellular (Potential).		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Nonsense_Mutation	SNP	ENST00000224721.6	37	c.5311C>T		.	.	.	.	.	.	.	.	.	.	C	48	14.139474	0.99781	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721	.	.	.	4.99	4.01	0.46588	.	0.590997	0.16806	N	0.198792	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	3.1122	0.06363	0.1535:0.5127:0.2327:0.1012	.	.	.	.	X	1776;1771;1774	.	ENSP00000224721:R1776X	R	+	1	2	CDH23	73209153	0.997000	0.39634	1.000000	0.80357	0.985000	0.73830	2.562000	0.45914	2.606000	0.88127	0.561000	0.74099	CGA		0.622	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		3	32	0	0	0	0.004672	0	3	32				
LRIT1	26103	broad.mit.edu	37	10	85991733	85991733	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:85991733G>A	ENST00000372105.3	-	4	1843	c.1822C>T	c.(1822-1824)Cag>Tag	p.Q608*		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	608						integral component of endoplasmic reticulum membrane (GO:0030176)		p.Q608*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						CCAAAGGCCTGAAAGTCCACA	0.572																																							uc001kcz.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1822-1824)CAG>TAG		retina specific protein PAL							78.0	60.0	66.0					10																	85991733		2203	4300	6503	SO:0001587	stop_gained	26103					integral to endoplasmic reticulum membrane		g.chr10:85991733G>A	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.1822C>T	10.37:g.85991733G>A	ENSP00000361177:p.Gln608*		Somatic					p.Q608*	NM_015613	NP_056428	WXS	Illumina HiSeq	Unspecified	Q9P2V4	LRIT1_HUMAN			4	1844	-			608			Cytoplasmic (Potential).		Q0QD41|Q9Y4N7	Nonsense_Mutation	SNP	ENST00000372105.3	37	c.1822C>T	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.147443	0.57151	.	.	ENSG00000148602	ENST00000372105	.	.	.	5.37	4.46	0.54185	.	0.239013	0.42053	D	0.000779	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.4884	0.61379	0.0:0.4254:0.5746:0.0	.	.	.	.	X	608	.	ENSP00000361177:Q608X	Q	-	1	0	LRIT1	85981713	0.981000	0.34729	0.501000	0.27601	0.108000	0.19459	2.348000	0.44045	1.470000	0.48102	0.591000	0.81541	CAG		0.572	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613		9	40	0	0	0	0.047766	0	9	40				
XPNPEP1	7511	broad.mit.edu	37	10	111642213	111642213	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:111642213C>A	ENST00000502935.1	-	10	1137	c.1018G>T	c.(1018-1020)Gct>Tct	p.A340S	XPNPEP1_ENST00000369683.1_Missense_Mutation_p.A226S|XPNPEP1_ENST00000430337.1_5'Flank|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.A340S|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.A297S					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble									p.A297S(2)|p.A340S(2)		endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TCGCTCACAGCATAGCTGGCC	0.577																																							uc001kyp.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|pancreas(1)	4						c.(889-891)GCT>TCT		X-prolyl aminopeptidase (aminopeptidase P) 1,							125.0	103.0	110.0					10																	111642213		2203	4300	6503	SO:0001583	missense	7511				bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity	g.chr10:111642213C>A		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1018G>T	10.37:g.111642213C>A	ENSP00000421566:p.Ala340Ser		Somatic				XPNPEP1_uc009xxt.1_Missense_Mutation_p.A340S|XPNPEP1_uc001kyq.1_Missense_Mutation_p.A226S|XPNPEP1_uc010qrb.1_Missense_Mutation_p.A340S|XPNPEP1_uc010qra.1_Missense_Mutation_p.A64S	p.A297S	NM_020383	NP_065116	WXS	Illumina HiSeq	Unspecified	Q9NQW7	XPP1_HUMAN		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)	10	1029	-		Breast(234;0.174)	297						Missense_Mutation	SNP	ENST00000502935.1	37	c.889G>T	CCDS7560.2	.	.	.	.	.	.	.	.	.	.	C	19.28	3.796669	0.70567	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680;ENST00000403138	.	.	.	5.82	5.82	0.92795	.	0.156761	0.56097	D	0.000023	T	0.75421	0.3847	M	0.68317	2.08	0.54753	D	0.99998	P;D;P	0.53745	0.589;0.962;0.891	P;P;P	0.59012	0.676;0.85;0.6	T	0.73658	-0.3913	9	0.42905	T	0.14	-16.3952	18.2859	0.90114	0.0:1.0:0.0:0.0	.	340;340;297	B4E2P4;G5E9Y2;Q9NQW7	.;.;XPP1_HUMAN	S	340;226;340;297;297	.	ENSP00000324011:A340S	A	-	1	0	XPNPEP1	111632203	1.000000	0.71417	0.959000	0.39883	0.992000	0.81027	5.221000	0.65272	2.757000	0.94681	0.655000	0.94253	GCT		0.577	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2			29	155	1	0	9.78306e-22	0.041601	1.31313e-21	29	155				
GPAM	57678	broad.mit.edu	37	10	113920368	113920368	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:113920368T>C	ENST00000348367.4	-	16	1950	c.1753A>G	c.(1753-1755)Atc>Gtc	p.I585V	GPAM_ENST00000423155.1_Missense_Mutation_p.I585V|GPAM_ENST00000369425.1_Missense_Mutation_p.I585V			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	585					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.I585V(2)		breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		ATACCTATGATGGCCTCCATG	0.393																																					Ovarian(161;1017 2606 18293 52943)	Ovarian(161;1017 2606 18293 52943)	uc009xxy.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1753-1755)ATC>GTC		mitochondrial glycerol 3-phosphate							91.0	86.0	88.0					10																	113920368		2203	4300	6503	SO:0001583	missense	57678				phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity	g.chr10:113920368T>C	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1753A>G	10.37:g.113920368T>C	ENSP00000265276:p.Ile585Val		Somatic				GPAM_uc001kzp.2_Missense_Mutation_p.I585V|GPAM_uc001kzq.1_Missense_Mutation_p.I585V	p.I585V	NM_020918	NP_065969	WXS	Illumina HiSeq	Unspecified	Q9HCL2	GPAT1_HUMAN		Epithelial(162;0.0306)|all cancers(201;0.123)	16	1951	-			585			Mitochondrial intermembrane (Potential).|Helical; (Potential).		Q5VW51|Q86TA3	Missense_Mutation	SNP	ENST00000348367.4	37	c.1753A>G	CCDS7570.1	.	.	.	.	.	.	.	.	.	.	T	2.942	-0.218768	0.06101	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	T;T;T	0.68765	-0.35;-0.35;-0.3	5.86	5.86	0.93980	.	0.118124	0.56097	D	0.000031	T	0.38480	0.1042	N	0.02247	-0.625	0.52501	D	0.999951	B;B	0.10296	0.003;0.001	B;B	0.06405	0.002;0.001	T	0.35450	-0.9788	10	0.23891	T	0.37	-23.2221	9.494	0.38978	0.0:0.085:0.0:0.915	.	585;585	Q5VW52;Q9HCL2	.;GPAT1_HUMAN	V	585	ENSP00000265276:I585V;ENSP00000409242:I585V;ENSP00000358433:I585V	ENSP00000265276:I585V	I	-	1	0	GPAM	113910358	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.053000	0.41326	2.241000	0.73720	0.533000	0.62120	ATC		0.393	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918		19	45	0	0	0	0.049695	0	19	45				
KCNK18	338567	broad.mit.edu	37	10	118969655	118969656	+	Missense_Mutation	DNP	CC	CC	GT			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr10:118969655_118969656CC>GT	ENST00000334549.1	+	3	1000_1001	c.1000_1001CC>GT	c.(1000-1002)CCt>GTt	p.P334V		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	334					cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)	p.P334V(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		TTTAGAACACCCTAACTTCTTC	0.421																																							uc010qsr.1		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)	1						c.(1000-1002)CCT>GTT		potassium channel, subfamily K, member 18																																				SO:0001583	missense	338567					integral to membrane|plasma membrane		g.chr10:118969655_118969656CC>GT	AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	Exception_encountered	10.37:g.118969655_118969656delinsGT	ENSP00000334650:p.Pro334Val		Somatic					p.P334V	NM_181840	NP_862823	WXS	Illumina HiSeq	Unspecified	Q7Z418	KCNKI_HUMAN		all cancers(201;0.0211)	3	1000_1001	+		Colorectal(252;0.19)	334					Q5SQQ8	Missense_Mutation	DNP	ENST00000334549.1	37	c.1000_1001CC>GT	CCDS7598.1																																																																																				0.421	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050562.2	NM_181840		42	102	0	0	0	0.004672	0	42	102				
LDHC	3948	broad.mit.edu	37	11	18434300	18434300	+	Silent	SNP	A	A	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr11:18434300A>G	ENST00000541669.1	+	2	147	c.36A>G	c.(34-36)ctA>ctG	p.L12L	LDHC_ENST00000544105.1_Silent_p.L12L|LDHC_ENST00000280704.4_Silent_p.L12L|LDHC_ENST00000535809.1_Silent_p.L12L|LDHC_ENST00000536880.1_Silent_p.L12L|LDHC_ENST00000537486.1_Silent_p.L12L|LDHC_ENST00000546146.1_Silent_p.L12L			P07864	LDHC_HUMAN	lactate dehydrogenase C	12					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)	p.L12L(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TTGAGAAGCTAATTGAGGATG	0.393																																							uc001mon.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(34-36)CTA>CTG		L-lactate dehydrogenase C	NADH(DB00157)						145.0	140.0	141.0					11																	18434300		2199	4293	6492	SO:0001819	synonymous_variant	3948				glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity	g.chr11:18434300A>G	AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.36A>G	11.37:g.18434300A>G			Somatic				LDHC_uc001mom.3_Silent_p.L12L|LDHC_uc009yhp.2_Silent_p.L12L|LDHC_uc001moo.3_5'UTR|LDHC_uc009yhq.2_RNA|LDHC_uc009yhr.2_5'UTR	p.L12L	NM_017448	NP_059144	WXS	Illumina HiSeq	Unspecified	P07864	LDHC_HUMAN			2	148	+			12					D3DQY4|Q6GSG8|Q7Z7J4	Silent	SNP	ENST00000541669.1	37	c.36A>G	CCDS7840.1																																																																																				0.393	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	NM_017448		31	20	0	0	0	0.041601	0	31	20				
NELL1	4745	broad.mit.edu	37	11	20968951	20968951	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr11:20968951C>A	ENST00000357134.5	+	11	1293	c.1141C>A	c.(1141-1143)Cct>Act	p.P381T	NELL1_ENST00000325319.5_Missense_Mutation_p.P324T|NELL1_ENST00000532434.1_Missense_Mutation_p.P381T|NELL1_ENST00000298925.5_Missense_Mutation_p.P409T	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	381					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.P381T(2)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TCACATTCTTCCTGAGAATCA	0.473																																							uc001mqe.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|large_intestine(1)	3						c.(1141-1143)CCT>ACT		nel-like 1 isoform 1 precursor							131.0	124.0	127.0					11																	20968951		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:20968951C>A	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1141C>A	11.37:g.20968951C>A	ENSP00000349654:p.Pro381Thr		Somatic				NELL1_uc001mqf.2_Missense_Mutation_p.P381T|NELL1_uc009yid.2_Missense_Mutation_p.P409T|NELL1_uc010rdo.1_Missense_Mutation_p.P324T|NELL1_uc010rdp.1_Missense_Mutation_p.P141T	p.P381T	NM_006157	NP_006148	WXS	Illumina HiSeq	Unspecified	Q92832	NELL1_HUMAN			11	1294	+			381			VWFC 2.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.1141C>A	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.678354	0.68042	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	6.17	6.17	0.99709	von Willebrand factor, type C (1);	0.000000	0.85682	D	0.000000	T	0.78329	0.4266	M	0.73962	2.25	0.52099	D	0.999943	D;D;D;D	0.89917	1.0;0.979;0.968;0.993	D;P;P;P	0.87578	0.998;0.758;0.79;0.787	T	0.70835	-0.4764	10	0.13853	T	0.58	-10.8602	19.0599	0.93085	0.0:1.0:0.0:0.0	.	324;409;381;381	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	T	409;381;324;381	ENSP00000298925:P409T;ENSP00000349654:P381T;ENSP00000317837:P324T;ENSP00000437170:P381T	ENSP00000298925:P409T	P	+	1	0	NELL1	20925527	1.000000	0.71417	0.985000	0.45067	0.970000	0.65996	5.436000	0.66538	2.941000	0.99782	0.655000	0.94253	CCT		0.473	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		40	18	1	0	1.41851e-31	0.080422	1.97804e-31	40	18				
DCDC1	341019	broad.mit.edu	37	11	30953319	30953319	+	Splice_Site	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr11:30953319G>T	ENST00000597505.1	-	20	2895	c.2896C>A	c.(2896-2898)Cag>Aag	p.Q966K	DCDC1_ENST00000406071.2_5'UTR|DCDC1_ENST00000339794.5_Splice_Site_p.Q45K|DCDC1_ENST00000437348.1_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	201					intracellular signal transduction (GO:0035556)			p.Q45K(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TGTTCTTACTGCGTTTTCCGT	0.363																																							uc009yjk.1		NA																	2	Substitution - Missense(2)		lung(2)		NA						c.(1240-1242)CAG>AAG		RecName: Full=Doublecortin domain-containing protein 5;							68.0	64.0	65.0					11																	30953319		2202	4299	6501	SO:0001630	splice_region_variant	0							g.chr11:30953319G>T	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2897+1C>A	11.37:g.30953319G>T			Somatic				uc009yjl.1_3'UTR	p.Q414K			WXS	Illumina HiSeq	Unspecified					10	1309	-								A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000597505.1	37	c.1240C>A		.	.	.	.	.	.	.	.	.	.	G	15.20	2.762427	0.49468	.	.	ENSG00000170959	ENST00000339794	D	0.93189	-3.18	4.62	3.69	0.42338	Doublecortin domain (3);	0.628442	0.14051	N	0.344779	D	0.89347	0.6689	L	0.50919	1.6	0.18873	N	0.999988	B	0.25667	0.131	B	0.22386	0.039	T	0.75144	-0.3421	10	0.10902	T	0.67	0.9647	12.285	0.54788	0.0:0.1903:0.8097:0.0	.	45	Q6ZRR9	DCDC5_HUMAN	K	45	ENSP00000341700:Q45K	ENSP00000341700:Q45K	Q	-	1	0	DCDC5	30909895	0.821000	0.29204	0.504000	0.27639	0.826000	0.46750	1.441000	0.35035	1.222000	0.43521	0.455000	0.32223	CAG		0.363	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	NM_181807	Missense_Mutation	4	1	1	0	0.00909568	0.009096	0.00931843	4	1				
SCYL1	57410	broad.mit.edu	37	11	65305955	65305955	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr11:65305955G>C	ENST00000270176.5	+	18	2422	c.2345G>C	c.(2344-2346)cGg>cCg	p.R782P	SCYL1_ENST00000524944.1_3'UTR|SCYL1_ENST00000525364.1_Missense_Mutation_p.G763R|SCYL1_ENST00000533862.1_Missense_Mutation_p.G770R|SCYL1_ENST00000534462.1_3'UTR|SCYL1_ENST00000420247.2_Missense_Mutation_p.R765P|SCYL1_ENST00000279270.6_Missense_Mutation_p.G764R|SCYL1_ENST00000527009.1_Missense_Mutation_p.R639P	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	782					peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)	p.R782P(1)		ovary(1)|skin(1)	2						CGCGAGGAGCGGCGGCGGGAG	0.701																																							uc001oea.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(2344-2346)CGG>CCG		SCY1-like 1 isoform A							10.0	19.0	16.0					11																	65305955		1966	4129	6095	SO:0001583	missense	57410				regulation of transcription, DNA-dependent|retrograde vesicle-mediated transport, Golgi to ER|transcription, DNA-dependent	cis-Golgi network|COPI vesicle coat|ER-Golgi intermediate compartment|microtubule organizing center|nucleus	ATP binding|DNA binding|protein tyrosine kinase activity	g.chr11:65305955G>C	AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.2345G>C	11.37:g.65305955G>C	ENSP00000270176:p.Arg782Pro		Somatic				SCYL1_uc009yqk.2_3'UTR|SCYL1_uc001oeb.1_Missense_Mutation_p.R765P|SCYL1_uc001oec.1_Missense_Mutation_p.G770R|SCYL1_uc001oed.1_Missense_Mutation_p.R639P|SCYL1_uc001oee.1_Missense_Mutation_p.G408R	p.R782P	NM_020680	NP_065731	WXS	Illumina HiSeq	Unspecified	Q96KG9	NTKL_HUMAN			18	2422	+			782			Potential.		A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	ENST00000270176.5	37	c.2345G>C	CCDS41672.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.95|19.95	3.921498|3.921498	0.73213|0.73213	.|.	.|.	ENSG00000142186|ENSG00000142186	ENST00000525364;ENST00000533862;ENST00000279270|ENST00000270176;ENST00000420247;ENST00000527630;ENST00000349495;ENST00000527009;ENST00000528545	T;T;T|T;T;T;T;T	0.25912|0.51325	2.78;1.77;2.77|2.33;1.98;2.06;1.23;0.71	4.82|4.82	4.82|4.82	0.62117|0.62117	.|.	.|0.117372	.|0.53938	.|D	.|0.000043	T|T	0.63177|0.63177	0.2489|0.2489	L|L	0.50333|0.50333	1.59|1.59	0.27995|0.27995	N|N	0.935499|0.935499	P;P|D;D	0.41131|0.89917	0.739;0.739|1.0;1.0	B;B|D;D	0.44133|0.85130	0.442;0.442|0.986;0.997	T|T	0.59434|0.59434	-0.7455|-0.7455	9|10	0.40728|0.66056	T|D	0.16|0.02	-7.9682|-7.9682	15.3806|15.3806	0.74651|0.74651	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	764;770|765;782	Q96KG9-4;Q96KG9-6|Q96KG9-2;Q96KG9	.;.|.;NTKL_HUMAN	R|P	763;770;764|782;765;681;681;639;254	ENSP00000431635:G763R;ENSP00000437254:G770R;ENSP00000279270:G764R|ENSP00000270176:R782P;ENSP00000408192:R765P;ENSP00000433450:R681P;ENSP00000436993:R639P;ENSP00000433604:R254P	ENSP00000279270:G764R|ENSP00000270176:R782P	G|R	+|+	1|2	0|0	SCYL1|SCYL1	65062531|65062531	1.000000|1.000000	0.71417|0.71417	0.403000|0.403000	0.26384|0.26384	0.992000|0.992000	0.81027|0.81027	8.817000|8.817000	0.91985|0.91985	2.236000|2.236000	0.73375|0.73375	0.462000|0.462000	0.41574|0.41574	GGC|CGG		0.701	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680		4	3	0	0	0	0.014758	0	4	3				
PC	5091	broad.mit.edu	37	11	66618624	66618624	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr11:66618624T>C	ENST00000393958.2	-	16	2203	c.2110A>G	c.(2110-2112)Atc>Gtc	p.I704V	PC_ENST00000393960.1_Missense_Mutation_p.I704V|PC_ENST00000393955.2_Missense_Mutation_p.I704V|PC_ENST00000529047.1_5'Flank|PC_ENST00000528224.1_5'Flank	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	704	Carboxyltransferase.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)	p.I704V(2)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GTGTATGAGATGGCAGCCTCC	0.612																																							uc001ojn.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|kidney(1)	4						c.(2110-2112)ATC>GTC		pyruvate carboxylase precursor	Biotin(DB00121)|Pyruvic acid(DB00119)						78.0	72.0	74.0					11																	66618624		2200	4295	6495	SO:0001583	missense	5091				gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity	g.chr11:66618624T>C	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.2110A>G	11.37:g.66618624T>C	ENSP00000377530:p.Ile704Val		Somatic				PC_uc001ojo.1_Missense_Mutation_p.I704V|PC_uc001ojp.1_Missense_Mutation_p.I704V|PC_uc001ojm.1_5'Flank	p.I704V	NM_022172	NP_071504	WXS	Illumina HiSeq	Unspecified	P11498	PYC_HUMAN		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	15	2159	-		Melanoma(852;0.0525)	704			Carboxyltransferase.		B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	c.2110A>G	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.112220	0.56398	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960	D;D;D	0.97959	-4.63;-4.63;-4.63	4.52	4.52	0.55395	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.97867	0.9299	M	0.73753	2.245	0.80722	D	1	P	0.43169	0.8	P	0.54815	0.761	D	0.97642	1.0149	10	0.45353	T	0.12	-29.1754	11.8757	0.52546	0.0:0.0:0.0:1.0	.	704	P11498	PYC_HUMAN	V	704	ENSP00000377527:I704V;ENSP00000377530:I704V;ENSP00000377532:I704V	ENSP00000377527:I704V	I	-	1	0	PC	66375200	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	2.873000	0.48475	1.909000	0.55274	0.533000	0.62120	ATC		0.612	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716		58	17	0	0	0	0.048971	0	58	17				
FAT3	120114	broad.mit.edu	37	11	92526040	92526040	+	Silent	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr11:92526040G>A	ENST00000298047.6	+	8	4736	c.4719G>A	c.(4717-4719)gcG>gcA	p.A1573A	FAT3_ENST00000525166.1_Silent_p.A1423A|FAT3_ENST00000409404.2_Silent_p.A1573A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1573	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A1573A(4)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGTATGAAGCGTCTGTGTTTG	0.438										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(4)|pancreas(1)	5						c.(4717-4719)GCG>GCA		FAT tumor suppressor homolog 3							153.0	158.0	157.0					11																	92526040		2001	4184	6185	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92526040G>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4719G>A	11.37:g.92526040G>A		TCGA Ovarian(4;0.039)	Somatic					p.A1573A	NM_001008781	NP_001008781	WXS	Illumina HiSeq	Unspecified	Q8TDW7	FAT3_HUMAN			8	4736	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	1573			Cadherin 15.|Extracellular (Potential).		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.4719G>A																																																																																					0.438	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		16	105	0	0	0	0.024245	0	16	105				
PGR	5241	broad.mit.edu	37	11	100998942	100998942	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr11:100998942G>T	ENST00000325455.5	-	1	2313	c.860C>A	c.(859-861)gCg>gAg	p.A287E	PGR_ENST00000263463.5_Missense_Mutation_p.A287E|PGR_ENST00000534013.1_Intron	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	287	Modulating, Pro-Rich.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.A287E(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	CGCCATCGGCGCGTCCTGCTC	0.697																																					Pancreas(124;2271 2354 21954 22882)	Pancreas(124;2271 2354 21954 22882)	uc001pgh.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4						c.(859-861)GCG>GAG		progesterone receptor	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)						9.0	11.0	10.0					11																	100998942		2055	4087	6142	SO:0001583	missense	5241				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr11:100998942G>T	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.860C>A	11.37:g.100998942G>T	ENSP00000325120:p.Ala287Glu		Somatic				PGR_uc001pgi.2_Missense_Mutation_p.A287E|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA|uc010rum.1_5'Flank	p.A287E	NM_000926	NP_000917	WXS	Illumina HiSeq	Unspecified	P06401	PRGR_HUMAN		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	1	1603	-		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)	287			Modulating, Pro-Rich.		A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	37	c.860C>A	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	G	13.74	2.328633	0.41197	.	.	ENSG00000082175	ENST00000325455;ENST00000263463;ENST00000537623	T;T	0.09538	2.97;2.97	4.22	2.19	0.27852	.	1.164800	0.06404	N	0.719319	T	0.17916	0.0430	M	0.74258	2.255	0.09310	N	1	P;P	0.39665	0.518;0.682	B;B	0.42653	0.17;0.394	T	0.30822	-0.9965	10	0.72032	D	0.01	.	5.7879	0.18343	0.1058:0.0:0.7013:0.1929	.	287;287	Q8TDS3;P06401	.;PRGR_HUMAN	E	287	ENSP00000325120:A287E;ENSP00000263463:A287E	ENSP00000263463:A287E	A	-	2	0	PGR	100504152	0.001000	0.12720	0.495000	0.27527	0.450000	0.32258	0.358000	0.20216	1.890000	0.54733	0.561000	0.74099	GCG		0.697	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1			48	12	1	0	3.48956e-15	0.048971	4.4014e-15	48	12				
VWF	7450	broad.mit.edu	37	12	6059022	6059022	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:6059022G>A	ENST00000261405.5	-	51	8437	c.8183C>T	c.(8182-8184)aCt>aTt	p.T2728I		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2728	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.T2728I(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CAGCCTGGCAGTGATGTCGTT	0.537																																							uc001qnn.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12						c.(8182-8184)ACT>ATT		von Willebrand factor preproprotein	Antihemophilic Factor(DB00025)						166.0	139.0	148.0					12																	6059022		2203	4300	6503	SO:0001583	missense	7450				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	g.chr12:6059022G>A		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.8183C>T	12.37:g.6059022G>A	ENSP00000261405:p.Thr2728Ile		Somatic				VWF_uc010set.1_Intron	p.T2728I	NM_000552	NP_000543	WXS	Illumina HiSeq	Unspecified	P04275	VWF_HUMAN			51	8433	-			2728			CTCK.		Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	c.8183C>T	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	G	4.107	0.018027	0.07959	.	.	ENSG00000110799	ENST00000261405	T	0.36699	1.24	5.67	0.739	0.18324	Cystine knot, C-terminal (2);	1.206380	0.06404	N	0.719433	T	0.30572	0.0769	L	0.46614	1.455	0.09310	N	0.99999	B	0.09022	0.002	B	0.06405	0.002	T	0.27673	-1.0067	10	0.40728	T	0.16	.	5.9382	0.19177	0.2957:0.1279:0.5764:0.0	.	2728	P04275	VWF_HUMAN	I	2728	ENSP00000261405:T2728I	ENSP00000261405:T2728I	T	-	2	0	VWF	5929283	0.000000	0.05858	0.170000	0.22879	0.028000	0.11728	-0.572000	0.05881	-0.124000	0.11724	-0.176000	0.13171	ACT		0.537	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		12	105	0	0	0	0.09319	0	12	105				
ITPR2	3709	broad.mit.edu	37	12	26596529	26596529	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:26596529C>T	ENST00000381340.3	-	46	6813	c.6397G>A	c.(6397-6399)Gat>Aat	p.D2133N		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2133					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.D2133N(2)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TCTCCTTCATCTGGATCCGAT	0.403																																							uc001rhg.2		NA																	2	Substitution - Missense(2)		lung(2)	kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(6397-6399)GAT>AAT		inositol 1,4,5-triphosphate receptor, type 2							175.0	173.0	174.0					12																	26596529		1929	4125	6054	SO:0001583	missense	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26596529C>T	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.6397G>A	12.37:g.26596529C>T	ENSP00000370744:p.Asp2133Asn		Somatic				ITPR2_uc009zjg.1_Missense_Mutation_p.D284N	p.D2133N	NM_002223	NP_002214	WXS	Illumina HiSeq	Unspecified	Q14571	ITPR2_HUMAN			46	6814	-	Colorectal(261;0.0847)		2133			Cytoplasmic (Potential).		O94773	Missense_Mutation	SNP	ENST00000381340.3	37	c.6397G>A	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190486	0.58017	.	.	ENSG00000123104	ENST00000381340	D	0.91521	-2.86	4.87	4.87	0.63330	.	0.617832	0.17365	N	0.176887	D	0.86744	0.6006	L	0.32530	0.975	0.80722	D	1	B	0.19445	0.036	B	0.17433	0.018	T	0.81504	-0.0903	10	0.35671	T	0.21	.	18.5753	0.91153	0.0:1.0:0.0:0.0	.	2133	Q14571	ITPR2_HUMAN	N	2133	ENSP00000370744:D2133N	ENSP00000370744:D2133N	D	-	1	0	ITPR2	26487796	0.971000	0.33674	0.997000	0.53966	0.980000	0.70556	2.677000	0.46892	2.692000	0.91855	0.655000	0.94253	GAT		0.403	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		12	19	0	0	0	0.020292	0	12	19				
PDZRN4	29951	broad.mit.edu	37	12	41967041	41967041	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:41967041G>T	ENST00000402685.2	+	10	2468	c.2460G>T	c.(2458-2460)gaG>gaT	p.E820D	PDZRN4_ENST00000298919.7_Missense_Mutation_p.E560D|PDZRN4_ENST00000539469.2_Missense_Mutation_p.E562D	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	820							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E562D(2)|p.E820D(2)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CTGATCAAGAGAAGGCAGTCA	0.488																																							uc010skn.1		NA																	4	Substitution - Missense(4)		lung(4)	lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11						c.(1861-1863)GAG>GAT		PDZ domain containing RING finger 4 isoform 2							169.0	171.0	171.0					12																	41967041		2203	4300	6503	SO:0001583	missense	29951						ubiquitin-protein ligase activity|zinc ion binding	g.chr12:41967041G>T	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2460G>T	12.37:g.41967041G>T	ENSP00000384197:p.Glu820Asp		Somatic				PDZRN4_uc001rmq.3_Missense_Mutation_p.E562D|PDZRN4_uc009zjz.2_Missense_Mutation_p.E560D|PDZRN4_uc001rmr.2_Missense_Mutation_p.E447D	p.E621D	NM_013377	NP_037509	WXS	Illumina HiSeq	Unspecified	Q6ZMN7	PZRN4_HUMAN			10	1931	+	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)	820					Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	c.1863G>T	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.874553	0.00542	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.47869	0.83;0.83;0.83	5.34	4.44	0.53790	.	1.764410	0.03063	N	0.156118	T	0.34716	0.0907	N	0.22421	0.69	0.24325	N	0.995022	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.002;0.003;0.002	T	0.25882	-1.0119	10	0.15066	T	0.55	-22.5967	6.4304	0.21794	0.1385:0.3202:0.5413:0.0	.	820;560;562	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	D	820;562;560	ENSP00000384197:E820D;ENSP00000439990:E562D;ENSP00000298919:E560D	ENSP00000298919:E560D	E	+	3	2	PDZRN4	40253308	0.272000	0.24172	0.601000	0.28877	0.032000	0.12392	0.289000	0.18957	1.566000	0.49654	0.650000	0.86243	GAG		0.488	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377		90	128	1	0	9.72016e-57	0.048971	1.41847e-56	90	128				
ADAMTS20	80070	broad.mit.edu	37	12	43825245	43825245	+	Missense_Mutation	SNP	T	T	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:43825245T>G	ENST00000389420.3	-	22	3150	c.3151A>C	c.(3151-3153)Aat>Cat	p.N1051H	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.N1051H|ADAMTS20_ENST00000395541.2_Missense_Mutation_p.N205H	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1051	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.N1051H(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TGATCTACATTCAGCTGACAC	0.413																																							uc010skx.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(3151-3153)AAT>CAT		a disintegrin-like and metalloprotease with							182.0	157.0	166.0					12																	43825245		2203	4300	6503	SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43825245T>G	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3151A>C	12.37:g.43825245T>G	ENSP00000374071:p.Asn1051His		Somatic				ADAMTS20_uc001rno.1_Missense_Mutation_p.N205H|ADAMTS20_uc001rnp.1_Missense_Mutation_p.N205H	p.N1051H	NM_025003	NP_079279	WXS	Illumina HiSeq	Unspecified	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	22	3151	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	1051			TSP type-1 5.		A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	c.3151A>C	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	t	13.00	2.105504	0.37145	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	4.34	3.15	0.36227	.	0.229900	0.29529	N	0.011891	T	0.60843	0.2300	L	0.42529	1.33	0.31062	N	0.713992	B;D	0.69078	0.02;0.997	B;D	0.69654	0.03;0.965	T	0.62863	-0.6764	10	0.41790	T	0.15	.	11.6406	0.51230	0.0:0.0:0.1612:0.8388	.	1051;205	P59510;E9PBD5	ATS20_HUMAN;.	H	1051;217;205;1051;1051	ENSP00000374071:N1051H;ENSP00000447427:N217H;ENSP00000378911:N205H;ENSP00000448341:N1051H	ENSP00000374068:N1051H	N	-	1	0	ADAMTS20	42111512	0.033000	0.19621	0.997000	0.53966	0.989000	0.77384	0.952000	0.29149	0.722000	0.32252	0.529000	0.55759	AAT		0.413	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		17	54	0	0	0	0.043863	0	17	54				
FAM186B	84070	broad.mit.edu	37	12	49998266	49998266	+	Missense_Mutation	SNP	C	C	T	rs544582250		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:49998266C>T	ENST00000257894.2	-	2	313	c.152G>A	c.(151-153)cGc>cAc	p.R51H	FAM186B_ENST00000551047.1_Missense_Mutation_p.R51H|FAM186B_ENST00000544141.1_5'UTR|PRPF40B_ENST00000508736.1_3'UTR	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	51						protein complex (GO:0043234)		p.R51H(2)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTCCTGGAAGCGGTTGATGAC	0.408													C|||	1	0.000199681	0.0	0.0	5008	,	,		19852	0.0		0.0	False		,,,				2504	0.001						uc001ruo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(151-153)CGC>CAC		hypothetical protein LOC84070							94.0	90.0	92.0					12																	49998266		2203	4300	6503	SO:0001583	missense	84070					protein complex		g.chr12:49998266C>T	AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.152G>A	12.37:g.49998266C>T	ENSP00000257894:p.Arg51His		Somatic				FAM186B_uc010smk.1_5'UTR	p.R51H	NM_032130	NP_115506	WXS	Illumina HiSeq	Unspecified	Q8IYM0	F186B_HUMAN			2	325	-			51					B4DZ15|Q8TCP7|Q9H0L3	Missense_Mutation	SNP	ENST00000257894.2	37	c.152G>A	CCDS8788.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.878976	0.51801	.	.	ENSG00000135436	ENST00000551047;ENST00000257894	T;T	0.61274	0.12;2.02	5.47	3.65	0.41850	.	0.169664	0.28630	N	0.014680	T	0.43055	0.1230	L	0.41961	1.31	0.80722	D	1	P	0.37398	0.593	B	0.32090	0.14	T	0.21861	-1.0233	9	.	.	.	-16.0971	8.5921	0.33693	0.0:0.8227:0.0:0.1773	.	51	Q8IYM0	F186B_HUMAN	H	51	ENSP00000448656:R51H;ENSP00000257894:R51H	.	R	-	2	0	FAM186B	48284533	0.950000	0.32346	0.998000	0.56505	0.989000	0.77384	0.999000	0.29757	0.808000	0.34231	0.563000	0.77884	CGC		0.408	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394583.2	NM_032130		9	66	0	0	0	0.058154	0	9	66				
SLC4A8	9498	broad.mit.edu	37	12	51868922	51868922	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:51868922T>A	ENST00000453097.2	+	16	2321	c.2104T>A	c.(2104-2106)Ttt>Att	p.F702I	SLC4A8_ENST00000358657.3_Missense_Mutation_p.F729I|SLC4A8_ENST00000514353.3_Missense_Mutation_p.F649I|SLC4A8_ENST00000394856.1_Missense_Mutation_p.F649I	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8									p.F702I(4)|p.F649I(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		CTGTATTCTCTTTTTCACCAC	0.483																																							uc001rys.1		NA																	6	Substitution - Missense(6)		lung(6)	ovary(3)|pancreas(1)|skin(1)	5						c.(2104-2106)TTT>ATT		solute carrier family 4, sodium bicarbonate							277.0	240.0	253.0					12																	51868922		2203	4300	6503	SO:0001583	missense	9498				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity	g.chr12:51868922T>A	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.2104T>A	12.37:g.51868922T>A	ENSP00000405812:p.Phe702Ile		Somatic				SLC4A8_uc001rym.2_Missense_Mutation_p.F649I|SLC4A8_uc001ryn.2_Missense_Mutation_p.F649I|SLC4A8_uc001ryo.2_Missense_Mutation_p.F649I|SLC4A8_uc010snj.1_Missense_Mutation_p.F729I|SLC4A8_uc001ryr.2_Missense_Mutation_p.F702I|SLC4A8_uc010snk.1_Missense_Mutation_p.F649I	p.F702I	NM_001039960	NP_001035049	WXS	Illumina HiSeq	Unspecified	Q2Y0W8	S4A8_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.15)	16	2282	+			702			Helical; (Potential).			Missense_Mutation	SNP	ENST00000453097.2	37	c.2104T>A	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	T	34	5.312489	0.95655	.	.	ENSG00000050438	ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.32	5.32	0.75619	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90745	0.7095	M	0.93283	3.4	0.80722	D	1	D;P;D;D	0.89917	0.997;0.936;1.0;0.996	D;P;D;D	0.97110	0.994;0.805;1.0;0.975	D	0.93034	0.6451	10	0.87932	D	0	.	14.5868	0.68331	0.0:0.0:0.0:1.0	.	649;729;702;702	E7EML0;Q2Y0W8-2;Q2Y0W8;Q2Y0W8-3	.;.;S4A8_HUMAN;.	I	729;702;649;702;649;649	ENSP00000351483:F729I;ENSP00000405812:F702I;ENSP00000378325:F649I;ENSP00000442561:F649I	ENSP00000315789:F702I	F	+	1	0	SLC4A8	50155189	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.166000	0.68216	0.460000	0.39030	TTT		0.483	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858		14	81	0	0	0	0.105934	0	14	81				
KRT79	338785	broad.mit.edu	37	12	53223860	53223860	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:53223860T>C	ENST00000330553.5	-	4	836	c.802A>G	c.(802-804)Aaa>Gaa	p.K268E		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	268	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)	p.K268E(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTGCCCACTTTGCCATGCAGA	0.552																																							uc001sbb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(802-804)AAA>GAA		keratin 6L							144.0	118.0	127.0					12																	53223860		2203	4300	6503	SO:0001583	missense	338785					keratin filament	structural molecule activity	g.chr12:53223860T>C	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.802A>G	12.37:g.53223860T>C	ENSP00000328358:p.Lys268Glu		Somatic				KRT79_uc001sba.2_Missense_Mutation_p.K39E	p.K268E	NM_175834	NP_787028	WXS	Illumina HiSeq	Unspecified	Q5XKE5	K2C79_HUMAN			4	835	-			268			Rod.|Coil 1B.		Q6P465|Q7Z793	Missense_Mutation	SNP	ENST00000330553.5	37	c.802A>G	CCDS8839.1	.	.	.	.	.	.	.	.	.	.	T	16.52	3.145811	0.57044	.	.	ENSG00000185640	ENST00000330553	D	0.90324	-2.65	4.54	0.577	0.17385	Filament (1);	1.165660	0.06425	N	0.723005	D	0.94644	0.8273	M	0.91818	3.245	0.26755	N	0.970119	P	0.43314	0.803	P	0.50378	0.639	D	0.85578	0.1238	10	0.87932	D	0	.	11.0849	0.48080	0.0:0.0:0.4532:0.5468	.	268	Q5XKE5	K2C79_HUMAN	E	268	ENSP00000328358:K268E	ENSP00000328358:K268E	K	-	1	0	KRT79	51510127	0.000000	0.05858	0.028000	0.17463	0.024000	0.10985	0.121000	0.15667	0.090000	0.17273	0.533000	0.62120	AAA		0.552	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834		18	88	0	0	0	0.043863	0	18	88				
IFNG	3458	broad.mit.edu	37	12	68549134	68549134	+	Nonstop_Mutation	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:68549134T>A	ENST00000229135.3	-	4	631	c.500A>T	c.(499-501)tAa>tTa	p.*167L	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	0					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)	p.*167L(2)		central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	GGACAACCATTACTGGGATGC	0.363																																							uc001stw.1		NA																	2	Nonstop extension(2)		lung(2)		0						c.(499-501)TAA>TTA		interferon, gamma precursor	Glucosamine(DB01296)|Interferon gamma-1b(DB00033)|Simvastatin(DB00641)						94.0	73.0	80.0					12																	68549134		2203	4300	6503	SO:0001578	stop_lost	3458				cell cycle arrest|interferon-gamma-mediated signaling pathway|negative regulation of interleukin-17 production|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of metanephric nephron tubule epithelial cell differentiation|negative regulation of smooth muscle cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity|positive regulation of fructose 1,6-bisphosphate metabolic process|positive regulation of interleukin-12 production|positive regulation of interleukin-23 production|positive regulation of killing of cells of other organism|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mesenchymal cell proliferation|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation of STAT protein|positive regulation of smooth muscle cell apoptosis|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|regulation of insulin secretion|regulation of interferon-gamma-mediated signaling pathway|response to virus	extracellular space	cytokine activity|interferon-gamma receptor binding	g.chr12:68549134T>A		CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.500A>T	12.37:g.68549134T>A			Somatic					p.*167L	NM_000619	NP_000610	WXS	Illumina HiSeq	Unspecified	P01579	IFNG_HUMAN	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	4	626	-			167					B5BU88|Q53ZV4	Nonstop_Mutation	SNP	ENST00000229135.3	37	c.500A>T	CCDS8980.1	.	.	.	.	.	.	.	.	.	.	T	6.002	0.368851	0.11352	.	.	ENSG00000111537	ENST00000229135	.	.	.	4.81	2.39	0.29439	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.448	0.11607	0.1725:0.0957:0.0:0.7317	.	.	.	.	L	167	.	.	X	-	2	2	IFNG	66835401	0.527000	0.26306	0.003000	0.11579	0.001000	0.01503	1.447000	0.35101	0.377000	0.24735	-0.256000	0.11100	TAA		0.363	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402301.1			4	14	0	0	0	0.009096	0	4	14				
KCNC2	3747	broad.mit.edu	37	12	75444442	75444442	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:75444442C>A	ENST00000549446.1	-	3	2023	c.1343G>T	c.(1342-1344)tGg>tTg	p.W448L	KCNC2_ENST00000341669.3_Missense_Mutation_p.W448L|KCNC2_ENST00000298972.1_Missense_Mutation_p.W448L|KCNC2_ENST00000350228.2_Missense_Mutation_p.W448L|KCNC2_ENST00000550433.1_Missense_Mutation_p.W448L|KCNC2_ENST00000393288.2_Missense_Mutation_p.W448L|KCNC2_ENST00000548243.1_5'UTR|KCNC2_ENST00000548513.1_Missense_Mutation_p.W448L|KCNC2_ENST00000540018.1_Missense_Mutation_p.W448L	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	448					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.W448L(5)		breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	CATGCCTGACCATGTTTGGGG	0.507																																							uc001sxg.1		NA																	5	Substitution - Missense(5)		lung(4)|liver(1)	breast(2)|pancreas(2)|skin(1)|lung(1)	6						c.(1342-1344)TGG>TTG		Shaw-related voltage-gated potassium channel							69.0	60.0	63.0					12																	75444442		2203	4300	6503	SO:0001583	missense	3747				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:75444442C>A	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1343G>T	12.37:g.75444442C>A	ENSP00000449253:p.Trp448Leu		Somatic				KCNC2_uc009zry.2_Missense_Mutation_p.W448L|KCNC2_uc001sxe.2_Missense_Mutation_p.W448L|KCNC2_uc001sxf.2_Missense_Mutation_p.W448L|KCNC2_uc010stw.1_Missense_Mutation_p.W448L	p.W448L	NM_139137	NP_631875	WXS	Illumina HiSeq	Unspecified	Q96PR1	KCNC2_HUMAN			3	1887	-			448					B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	37	c.1343G>T	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.491308	0.64074	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000350228;ENST00000540018;ENST00000393288	D;D;D;D;D;D;D;D	0.97186	-4.28;-4.28;-4.28;-4.28;-4.28;-4.28;-4.28;-4.28	6.06	6.06	0.98353	Ion transport (1);	0.000000	0.64402	D	0.000004	D	0.96204	0.8762	N	0.11845	0.185	0.80722	D	1	D;D;B;D;B	0.67145	0.964;0.996;0.238;0.996;0.009	P;D;B;D;B	0.65874	0.852;0.939;0.105;0.939;0.054	D	0.94595	0.7791	10	0.20519	T	0.43	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	448;448;448;448;448	F5H030;Q96PR1-2;Q96PR1;Q96PR1-4;Q96PR1-3	.;.;KCNC2_HUMAN;.;.	L	448	ENSP00000448301:W448L;ENSP00000449941:W448L;ENSP00000449253:W448L;ENSP00000340121:W448L;ENSP00000298972:W448L;ENSP00000319877:W448L;ENSP00000438423:W448L;ENSP00000376966:W448L	ENSP00000298972:W448L	W	-	2	0	KCNC2	73730709	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	3.990000	0.56965	2.880000	0.98712	0.650000	0.86243	TGG		0.507	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748		14	39	1	0	1.5842e-08	0.105934	1.8409e-08	14	39				
CFAP54	144535	broad.mit.edu	37	12	97158873	97158873	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:97158873G>T	ENST00000524981.4	+	60	8181	c.8158G>T	c.(8158-8160)Gca>Tca	p.A2720S				Q96N23	CL055_HUMAN		0								p.A1145S(2)									AGCTGTGCTGGCAATTAACTT	0.299																																							uc001tet.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(6)|ovary(1)	7						c.(3433-3435)GCA>TCA		hypothetical protein LOC374467							77.0	79.0	78.0					12																	97158873		2203	4299	6502	SO:0001583	missense	374467							g.chr12:97158873G>T																												ENST00000524981.4:c.8158G>T	12.37:g.97158873G>T	ENSP00000431759:p.Ala2720Ser		Somatic					p.A1145S	NM_198520	NP_940922	WXS	Illumina HiSeq	Unspecified	Q6ZTY8	CL063_HUMAN			27	3511	+			1145						Missense_Mutation	SNP	ENST00000524981.4	37	c.3433G>T		.	.	.	.	.	.	.	.	.	.	G	11.62	1.692231	0.30052	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	5.66	2.8	0.32819	.	0.095014	0.46145	N	0.000318	T	0.36220	0.0959	L	0.55481	1.735	0.20196	N	0.999922	B	0.27765	0.188	B	0.31547	0.132	T	0.28996	-1.0026	9	0.48119	T	0.1	-5.1612	7.0249	0.24934	0.1441:0.0:0.7169:0.139	.	1145	Q6ZTY8	CL063_HUMAN	S	2720;1145	.	ENSP00000345466:A1145S	A	+	1	0	C12orf63	95683004	0.996000	0.38824	0.459000	0.27081	0.714000	0.41099	1.963000	0.40452	0.315000	0.23110	0.305000	0.20034	GCA		0.299	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000395046.4			23	29	1	0	1.10923e-09	0.076483	1.30101e-09	23	29				
CKAP4	10970	broad.mit.edu	37	12	106632981	106632981	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr12:106632981T>C	ENST00000378026.4	-	2	1766	c.1630A>G	c.(1630-1632)Agc>Ggc	p.S544G	CKAP4_ENST00000552828.1_5'Flank	NM_006825.3	NP_006816.2	Q07065	CKAP4_HUMAN	cytoskeleton-associated protein 4	544						cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.S544G(2)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|pancreas(1)|urinary_tract(1)	20						TCCACTTGGCTGACTGAGGCT	0.532																																							uc001tlk.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1630-1632)AGC>GGC		cytoskeleton-associated protein 4							106.0	108.0	108.0					12																	106632981		2203	4300	6503	SO:0001583	missense	10970					ER-Golgi intermediate compartment membrane|integral to membrane|membrane fraction		g.chr12:106632981T>C	X69910	CCDS9103.1	12q23.3	2006-06-23				ENSG00000136026			16991	protein-coding gene	gene with protein product						8314870	Standard	NM_006825		Approved	P63, CLIMP-63, ERGIC-63	uc001tlk.3	Q07065		ENST00000378026.4:c.1630A>G	12.37:g.106632981T>C	ENSP00000367265:p.Ser544Gly		Somatic					p.S544G	NM_006825	NP_006816	WXS	Illumina HiSeq	Unspecified	Q07065	CKAP4_HUMAN			2	1714	-			544			Potential.		Q504S5|Q53ES6	Missense_Mutation	SNP	ENST00000378026.4	37	c.1630A>G	CCDS9103.1	.	.	.	.	.	.	.	.	.	.	T	10.10	1.257829	0.22965	.	.	ENSG00000136026	ENST00000378026	T	0.51071	0.72	5.51	4.37	0.52481	.	0.347798	0.38005	N	0.001847	T	0.35248	0.0925	L	0.39245	1.2	0.32274	N	0.568466	B	0.09022	0.002	B	0.09377	0.004	T	0.36890	-0.9729	10	0.31617	T	0.26	-24.3001	7.502	0.27524	0.0:0.2383:0.0:0.7617	.	544	Q07065	CKAP4_HUMAN	G	544	ENSP00000367265:S544G	ENSP00000367265:S544G	S	-	1	0	CKAP4	105157111	0.972000	0.33761	0.987000	0.45799	0.985000	0.73830	1.406000	0.34646	0.927000	0.37143	0.528000	0.53228	AGC		0.532	CKAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407196.1			54	76	0	0	0	0.048971	0	54	76				
MTUS2	23281	broad.mit.edu	37	13	29600241	29600241	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr13:29600241T>C	ENST00000431530.3	+	1	1494	c.1436T>C	c.(1435-1437)gTt>gCt	p.V479A		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	469						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.V479A(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AGTGTTATGGTTTTGGTGTTC	0.507																																							uc001usl.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1435-1437)GTT>GCT		hypothetical protein LOC23281 isoform a							89.0	97.0	94.0					13																	29600241		1974	4156	6130	SO:0001583	missense	23281					cytoplasm|microtubule	microtubule binding|protein homodimerization activity	g.chr13:29600241T>C	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.1436T>C	13.37:g.29600241T>C	ENSP00000392057:p.Val479Ala		Somatic					p.V479A	NM_001033602	NP_001028774	WXS	Illumina HiSeq	Unspecified	Q5JR59	MTUS2_HUMAN			1	1494	+			469					A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	c.1436T>C	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	t	10.71	1.426487	0.25726	.	.	ENSG00000132938	ENST00000431530	T	0.14144	2.53	5.21	-10.4	0.00318	.	2.807000	0.01665	N	0.025313	T	0.06416	0.0165	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.20174	-1.0283	9	.	.	.	.	3.633	0.08138	0.1056:0.3631:0.3243:0.207	.	469	Q5JR59	MTUS2_HUMAN	A	479	ENSP00000392057:V479A	.	V	+	2	0	MTUS2	28498241	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.018000	0.03626	-2.406000	0.00574	-1.117000	0.02048	GTT		0.507	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270		26	18	0	0	0	0.0918	0	26	18				
FNDC3A	22862	broad.mit.edu	37	13	49752748	49752748	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr13:49752748C>A	ENST00000492622.2	+	14	1880	c.1575C>A	c.(1573-1575)taC>taA	p.Y525*	FNDC3A_ENST00000541916.1_Nonsense_Mutation_p.Y525*|FNDC3A_ENST00000398316.3_Nonsense_Mutation_p.Y469*	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	525	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)	p.Y525*(2)		endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		ATCTTGCTTACACAGTGAAAA	0.343																																							uc001vcm.2		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(2)	2						c.(1573-1575)TAC>TAA		fibronectin type III domain containing 3A							113.0	114.0	114.0					13																	49752748		2203	4300	6503	SO:0001587	stop_gained	22862					Golgi membrane|integral to membrane		g.chr13:49752748C>A	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.1575C>A	13.37:g.49752748C>A	ENSP00000417257:p.Tyr525*		Somatic				FNDC3A_uc001vcn.2_Nonsense_Mutation_p.Y525*|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcp.1_Nonsense_Mutation_p.Y451*|FNDC3A_uc001vcq.2_Nonsense_Mutation_p.Y469*	p.Y525*	NM_001079673	NP_001073141	WXS	Illumina HiSeq	Unspecified	Q9Y2H6	FND3A_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)	14	1880	+		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	525			Fibronectin type-III 3.		B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Nonsense_Mutation	SNP	ENST00000492622.2	37	c.1575C>A	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	C	37	6.249678	0.97412	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	.	.	.	5.79	4.05	0.47172	.	0.103605	0.42548	D	0.000681	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0619	8.405	0.32610	0.0:0.7689:0.0:0.2311	.	.	.	.	X	525;461;525;469	.	ENSP00000338579:Y461X	Y	+	3	2	FNDC3A	48650749	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	1.148000	0.31614	1.439000	0.47511	0.655000	0.94253	TAC		0.343	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923		17	15	1	0	1.02788e-11	0.0333	1.22857e-11	17	15				
DACH1	1602	broad.mit.edu	37	13	72255950	72255950	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr13:72255950G>T	ENST00000359684.2	-	2	946	c.947C>A	c.(946-948)tCt>tAt	p.S316Y	DACH1_ENST00000305425.4_Missense_Mutation_p.S316Y|DACH1_ENST00000354591.4_Missense_Mutation_p.S316Y|DACH1_ENST00000313174.7_Missense_Mutation_p.S316Y			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	316	Interaction with SIX6 and HDAC3. {ECO:0000250}.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)	p.S316Y(2)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		TATCCCAGGAGACATGAGACC	0.438																																							uc010thn.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(940-942)TCT>TAT		dachshund homolog 1 isoform a							123.0	120.0	121.0					13																	72255950		1924	4138	6062	SO:0001583	missense	1602				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding	g.chr13:72255950G>T	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.947C>A	13.37:g.72255950G>T	ENSP00000352712:p.Ser316Tyr		Somatic				DACH1_uc010tho.1_Missense_Mutation_p.S314Y|DACH1_uc010thp.1_Missense_Mutation_p.S314Y	p.S314Y	NM_080759	NP_542937	WXS	Illumina HiSeq	Unspecified	Q9UI36	DACH1_HUMAN		GBM - Glioblastoma multiforme(99;0.00032)	3	1364	-		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)	314			Interaction with SIX6 and HDAC3 (By similarity).		D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37	c.941C>A		.	.	.	.	.	.	.	.	.	.	G	19.98	3.927445	0.73327	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;T	0.39592	1.07;1.18;1.26;1.09	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.65688	0.2715	M	0.65498	2.005	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.996;0.996	T	0.67146	-0.5744	10	0.87932	D	0	-10.0658	19.7401	0.96223	0.0:0.0:1.0:0.0	.	314;314;314	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	Y	316	ENSP00000304994:S316Y;ENSP00000318506:S316Y;ENSP00000346604:S316Y;ENSP00000352712:S316Y	ENSP00000304994:S316Y	S	-	2	0	DACH1	71153951	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.420000	0.97426	2.741000	0.93983	0.557000	0.71058	TCT		0.438	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392		8	14	1	0	0.00307968	0.038147	0.00319421	8	14				
FSCB	84075	broad.mit.edu	37	14	44973886	44973886	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr14:44973886G>A	ENST00000340446.4	-	1	2596	c.2305C>T	c.(2305-2307)Cca>Tca	p.P769S	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	769						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)	p.P769S(2)		breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		TTTACTGCTGGAATTCCTGCC	0.408																																							uc001wvn.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9						c.(2305-2307)CCA>TCA		fibrous sheath CABYR binding protein							79.0	86.0	83.0					14																	44973886		2203	4299	6502	SO:0001583	missense	84075					cilium		g.chr14:44973886G>A	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.2305C>T	14.37:g.44973886G>A	ENSP00000344579:p.Pro769Ser		Somatic					p.P769S	NM_032135	NP_115511	WXS	Illumina HiSeq	Unspecified	Q5H9T9	FSCB_HUMAN		GBM - Glioblastoma multiforme(112;0.128)	1	2614	-			769					Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	c.2305C>T	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.252635	0.39797	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.13307	2.6	4.85	0.128	0.14733	.	.	.	.	.	T	0.07324	0.0185	L	0.32530	0.975	0.09310	N	1	B	0.32573	0.376	B	0.27887	0.084	T	0.39542	-0.9609	9	0.09084	T	0.74	-0.3379	5.604	0.17369	0.2448:0.2995:0.4557:0.0	.	769	Q5H9T9	FSCB_HUMAN	S	769;662	ENSP00000344579:P769S	ENSP00000344579:P769S	P	-	1	0	FSCB	44043636	0.006000	0.16342	0.000000	0.03702	0.038000	0.13279	0.010000	0.13242	-0.187000	0.10516	0.484000	0.47621	CCA		0.408	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		16	71	0	0	0	0.038395	0	16	71				
CNIH1	10175	broad.mit.edu	37	14	54896978	54896978	+	Splice_Site	SNP	C	C	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr14:54896978C>G	ENST00000216416.4	-	4	511		c.e4+1		CNIH1_ENST00000557690.1_Splice_Site|CNIH1_ENST00000553660.1_Splice_Site|CNIH1_ENST00000395573.4_Intron|CNIH1_ENST00000556113.1_Silent_p.G136G	NM_005776.2	NP_005767.1	O95406	CNIH1_HUMAN	cornichon family AMPA receptor auxiliary protein 1						immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.?(2)									TTTCAACTTACCCATATAGGT	0.328																																							uc001xat.1		NA																	2	Unknown(2)		lung(2)		0						c.e4+1		cornichon-like							85.0	80.0	82.0					14																	54896978		2203	4300	6503	SO:0001630	splice_region_variant	10175				immune response|intracellular signal transduction|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane|integral to membrane		g.chr14:54896978C>G	AF031379	CCDS9717.1	14q22.1	2013-08-28	2013-08-28	2013-08-28	ENSG00000100528	ENSG00000100528			19431	protein-coding gene	gene with protein product		611287	"""cornichon homolog (Drosophila)"""	CNIH		10209299	Standard	NM_005776		Approved	TGAM77, CNIL	uc001xat.1	O95406	OTTHUMG00000152335	ENST00000216416.4:c.407+1G>C	14.37:g.54896978C>G			Somatic				CNIH_uc001xav.1_Intron	p.G136_splice	NM_005776	NP_005767	WXS	Illumina HiSeq	Unspecified	O95406	CNIH_HUMAN		GBM - Glioblastoma multiforme(112;0.00341)	4	510	-								Q3SYM7	Splice_Site	SNP	ENST00000216416.4	37	c.407_splice	CCDS9717.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.984192	0.74474	.	.	ENSG00000100528	ENST00000216416;ENST00000553660;ENST00000557690	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1096	0.93312	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CNIH	53966728	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	7.278000	0.78587	2.817000	0.96982	0.563000	0.77884	.		0.328	CNIH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276896.2	NM_005776	Intron	6	24	0	0	0	0.021553	0	6	24				
DACT1	51339	broad.mit.edu	37	14	59113521	59113521	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr14:59113521C>A	ENST00000335867.4	+	4	2204	c.2180C>A	c.(2179-2181)tCg>tAg	p.S727*	DACT1_ENST00000395153.3_Nonsense_Mutation_p.S690*|DACT1_ENST00000556859.1_Nonsense_Mutation_p.S446*|DACT1_ENST00000541264.2_Nonsense_Mutation_p.S446*			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	727					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)	p.S727*(2)		endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						TCCGAGTACTCGGCCGAGTGC	0.662																																							uc001xdw.2		NA																	2	Substitution - Nonsense(2)		lung(2)	large_intestine(2)|lung(2)|ovary(1)	5						c.(2179-2181)TCG>TAG		dapper 1 isoform 1							60.0	59.0	59.0					14																	59113521		2203	4300	6503	SO:0001587	stop_gained	51339				multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus		g.chr14:59113521C>A	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.2180C>A	14.37:g.59113521C>A	ENSP00000337439:p.Ser727*		Somatic				DACT1_uc010trv.1_Nonsense_Mutation_p.S446*|DACT1_uc001xdx.2_Nonsense_Mutation_p.S690*|DACT1_uc010trw.1_Nonsense_Mutation_p.S446*	p.S727*	NM_016651	NP_057735	WXS	Illumina HiSeq	Unspecified	Q9NYF0	DACT1_HUMAN			4	2344	+			727					A8MYJ2|Q86TY0	Nonsense_Mutation	SNP	ENST00000335867.4	37	c.2180C>A	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	C	38	6.640521	0.97726	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	.	.	.	5.58	4.69	0.59074	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.8293	14.2945	0.66302	0.0:0.9288:0.0:0.0712	.	.	.	.	X	446;446;690;727;446	.	ENSP00000337439:S727X	S	+	2	0	DACT1	58183274	1.000000	0.71417	0.998000	0.56505	0.851000	0.48451	5.682000	0.68182	1.352000	0.45808	0.563000	0.77884	TCG		0.662	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651		51	46	1	0	3.31993e-32	0.048971	4.65532e-32	51	46				
WDR89	112840	broad.mit.edu	37	14	64065716	64065716	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr14:64065716G>C	ENST00000394942.2	-	2	1033	c.945C>G	c.(943-945)agC>agG	p.S315R	CTD-2302E22.2_ENST00000553983.1_lincRNA|WDR89_ENST00000267522.3_Missense_Mutation_p.S315R	NM_001008726.2|NM_001258272.1|NM_080666.3	NP_001008726.1|NP_001245201.1|NP_542397.1	Q96FK6	WDR89_HUMAN	WD repeat domain 89	315								p.S315R(2)		endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.00543)|all cancers(60;0.0181)|BRCA - Breast invasive adenocarcinoma(234;0.101)		CTCCCTGAAGGCTAGTCACAT	0.438																																							uc001xgh.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(943-945)AGC>AGG		WD repeat domain 89							216.0	169.0	185.0					14																	64065716		2203	4300	6503	SO:0001583	missense	112840							g.chr14:64065716G>C	AF115513	CCDS9759.1	14q23.2	2013-01-09		2006-07-07	ENSG00000140006	ENSG00000140006		"""WD repeat domain containing"""	20489	protein-coding gene	gene with protein product				C14orf150			Standard	NM_080666		Approved	MGC9907	uc001xgi.4	Q96FK6	OTTHUMG00000140340	ENST00000394942.2:c.945C>G	14.37:g.64065716G>C	ENSP00000378399:p.Ser315Arg		Somatic				WDR89_uc001xgi.2_Missense_Mutation_p.S315R	p.S315R	NM_001008726	NP_001008726	WXS	Illumina HiSeq	Unspecified	Q96FK6	WDR89_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00543)|all cancers(60;0.0181)|BRCA - Breast invasive adenocarcinoma(234;0.101)	3	1191	-			315						Missense_Mutation	SNP	ENST00000394942.2	37	c.945C>G	CCDS9759.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101363	0.56183	.	.	ENSG00000140006	ENST00000394942;ENST00000267522	T;T	0.65364	-0.15;-0.15	5.51	0.365	0.16131	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.211582	0.49305	D	0.000155	T	0.49779	0.1577	N	0.20610	0.595	0.37353	D	0.910903	P	0.51147	0.942	P	0.55455	0.776	T	0.50783	-0.8787	10	0.11485	T	0.65	.	6.1471	0.20291	0.2905:0.1232:0.5862:0.0	.	315	Q96FK6	WDR89_HUMAN	R	315	ENSP00000378399:S315R;ENSP00000267522:S315R	ENSP00000267522:S315R	S	-	3	2	WDR89	63135469	0.993000	0.37304	0.508000	0.27688	0.853000	0.48598	1.513000	0.35823	-0.215000	0.10063	0.591000	0.81541	AGC		0.438	WDR89-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411879.2	NM_080666		31	33	0	0	0	0.041601	0	31	33				
MAP3K9	4293	broad.mit.edu	37	14	71267478	71267478	+	Silent	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr14:71267478C>A	ENST00000554752.2	-	2	725	c.726G>T	c.(724-726)ctG>ctT	p.L242L	MAP3K9_ENST00000381250.4_Silent_p.L242L|MAP3K9_ENST00000555993.2_Silent_p.L242L	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	242	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.L242L(2)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		CCCAATTCACCAGGATGTCTG	0.493																																					GBM(114;411 1587 13539 28235 50070)	GBM(114;411 1587 13539 28235 50070)	uc001xmm.2		NA																	2	Substitution - coding silent(2)		lung(2)	stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5						c.(724-726)CTG>CTT		mitogen-activated protein kinase kinase kinase							103.0	94.0	97.0					14																	71267478		2203	4300	6503	SO:0001819	synonymous_variant	4293				activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity	g.chr14:71267478C>A	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.726G>T	14.37:g.71267478C>A			Somatic				MAP3K9_uc001xml.2_Silent_p.L242L	p.L242L	NM_033141	NP_149132	WXS	Illumina HiSeq	Unspecified	P80192	M3K9_HUMAN		all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)	2	726	-			242			Protein kinase.		A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Silent	SNP	ENST00000554752.2	37	c.726G>T																																																																																					0.493	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2			26	76	1	0	4.26978e-12	0.083992	5.15247e-12	26	76				
PCNX	22990	broad.mit.edu	37	14	71444881	71444881	+	Silent	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr14:71444881T>C	ENST00000304743.2	+	6	2273	c.1827T>C	c.(1825-1827)agT>agC	p.S609S	PCNX_ENST00000439984.3_Silent_p.S609S|PCNX_ENST00000238570.5_Silent_p.S609S	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	609	Ser-rich.					integral component of membrane (GO:0016021)		p.S609S(2)		NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GTGACTTGAGTAGAGCATCAA	0.473																																							uc001xmo.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1825-1827)AGT>AGC		pecanex-like 1							108.0	97.0	101.0					14																	71444881		2203	4300	6503	SO:0001819	synonymous_variant	22990					integral to membrane		g.chr14:71444881T>C	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.1827T>C	14.37:g.71444881T>C			Somatic				PCNX_uc001xmn.3_Silent_p.S609S|PCNX_uc010are.1_Silent_p.S609S	p.S609S	NM_014982	NP_055797	WXS	Illumina HiSeq	Unspecified	Q96RV3	PCX1_HUMAN	KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)	6	2273	+			609			Ser-rich.		B2RTR6|O94897|Q96AI7|Q9Y2J9	Silent	SNP	ENST00000304743.2	37	c.1827T>C	CCDS9806.1																																																																																				0.473	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982		38	36	0	0	0	0.069456	0	38	36				
RGS6	9628	broad.mit.edu	37	14	72945023	72945023	+	Silent	SNP	C	C	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr14:72945023C>G	ENST00000553530.1	+	12	1047	c.840C>G	c.(838-840)tcC>tcG	p.S280S	RGS6_ENST00000434263.2_Silent_p.S211S|RGS6_ENST00000556437.1_Silent_p.S280S|RGS6_ENST00000407322.4_Silent_p.S280S|RGS6_ENST00000555571.1_Silent_p.S280S|RGS6_ENST00000406236.4_Silent_p.S280S|RGS6_ENST00000404301.2_Silent_p.S280S|RGS6_ENST00000402788.2_Silent_p.S280S|RGS6_ENST00000554782.1_Silent_p.S141S|RGS6_ENST00000343854.6_Silent_p.S280S|RGS6_ENST00000553525.1_Silent_p.S280S|RGS6_ENST00000355512.6_Silent_p.S280S	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	280	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.S280S(2)		endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		TGAAAATGTCCAAAGTGGCTG	0.318																																					Ovarian(143;1926 2468 21071 48641)	Ovarian(143;1926 2468 21071 48641)	uc001xna.3		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(1)|lung(1)|skin(1)	3						c.(838-840)TCC>TCG		regulator of G-protein signalling 6							120.0	117.0	118.0					14																	72945023		2203	4299	6502	SO:0001819	synonymous_variant	9628				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity	g.chr14:72945023C>G	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.840C>G	14.37:g.72945023C>G			Somatic				RGS6_uc010ttn.1_Silent_p.S280S|RGS6_uc001xmx.3_Silent_p.S280S|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Silent_p.S280S|RGS6_uc010ttp.1_Silent_p.S211S|RGS6_uc001xmz.1_Silent_p.S141S	p.S280S	NM_004296	NP_004287	WXS	Illumina HiSeq	Unspecified	P49758	RGS6_HUMAN		all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)	12	1363	+			280			G protein gamma.		C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Silent	SNP	ENST00000553530.1	37	c.840C>G	CCDS9808.1																																																																																				0.318	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2			3	12	0	0	0	0.004672	0	3	12				
AHNAK2	113146	broad.mit.edu	37	14	105407783	105407783	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr14:105407783C>T	ENST00000333244.5	-	7	14124	c.14005G>A	c.(14005-14007)Gaa>Aaa	p.E4669K	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4669						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.E4669K(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACAACAGATTCCACAATGGGA	0.413																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(14005-14007)GAA>AAA		AHNAK nucleoprotein 2							46.0	48.0	47.0					14																	105407783		1909	4115	6024	SO:0001583	missense	113146					nucleus		g.chr14:105407783C>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.14005G>A	14.37:g.105407783C>T	ENSP00000353114:p.Glu4669Lys		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.E4569K	p.E4669K	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	14125	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	4669					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.14005G>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	C	9.544	1.114217	0.20795	.	.	ENSG00000185567	ENST00000333244	T	0.00976	5.48	2.39	0.219	0.15274	.	.	.	.	.	T	0.00580	0.0019	N	0.12569	0.235	0.09310	N	1	B	0.20052	0.041	B	0.20767	0.031	T	0.45396	-0.9264	9	0.05721	T	0.95	.	7.2334	0.26055	0.179:0.6007:0.2203:0.0	.	4669	Q8IVF2	AHNK2_HUMAN	K	4669	ENSP00000353114:E4669K	ENSP00000353114:E4669K	E	-	1	0	AHNAK2	104478828	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.126000	0.10563	-0.366000	0.08064	0.196000	0.17591	GAA		0.413	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		12	32	0	0	0	0.080935	0	12	32				
MKRN3	7681	broad.mit.edu	37	15	23810997	23810997	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr15:23810997C>T	ENST00000314520.3	+	1	544	c.68C>T	c.(67-69)gCa>gTa	p.A23V	MKRN3_ENST00000568252.1_Missense_Mutation_p.A23V|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Missense_Mutation_p.A23V	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	23					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.A23V(2)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GCTGAGGCAGCAAGGGAGGGT	0.667																																							uc001ywh.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(6)|large_intestine(2)|ovary(2)	10						c.(67-69)GCA>GTA		makorin ring finger protein 3							24.0	31.0	29.0					15																	23810997		2203	4298	6501	SO:0001583	missense	7681					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding	g.chr15:23810997C>T	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.68C>T	15.37:g.23810997C>T	ENSP00000313881:p.Ala23Val		Somatic				MKRN3_uc001ywi.2_Missense_Mutation_p.A23V|MKRN3_uc010ayi.1_Missense_Mutation_p.A23V	p.A23V	NM_005664	NP_005655	WXS	Illumina HiSeq	Unspecified	Q13064	MKRN3_HUMAN		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)	1	544	+		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)	23						Missense_Mutation	SNP	ENST00000314520.3	37	c.68C>T	CCDS10013.1	.	.	.	.	.	.	.	.	.	.	c	17.82	3.482872	0.63962	.	.	ENSG00000179455	ENST00000314520	T	0.35048	1.33	2.97	0.91	0.19337	.	.	.	.	.	T	0.32496	0.0831	N	0.08118	0	0.09310	N	1	D;D	0.76494	0.999;0.983	D;P	0.66847	0.947;0.637	T	0.19582	-1.0301	9	0.38643	T	0.18	.	7.4468	0.27215	0.4659:0.5341:0.0:0.0	.	23;23	Q6NSB6;Q13064	.;MKRN3_HUMAN	V	23	ENSP00000313881:A23V	ENSP00000313881:A23V	A	+	2	0	MKRN3	21362090	0.000000	0.05858	0.004000	0.12327	0.842000	0.47809	0.016000	0.13377	0.239000	0.21243	0.563000	0.77884	GCA		0.667	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	NM_005664		38	34	0	0	0	0.092188	0	38	34				
LTK	4058	broad.mit.edu	37	15	41799788	41799788	+	Silent	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr15:41799788G>A	ENST00000263800.6	-	10	1413	c.1317C>T	c.(1315-1317)ctC>ctT	p.L439L	LTK_ENST00000355166.5_Silent_p.L378L|LTK_ENST00000561619.1_Silent_p.L121L|LTK_ENST00000453182.2_Silent_p.L378L	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	439					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L439L(2)|p.L378L(2)		NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		ACACCATAAGGAGGCTCAGTG	0.577										TSP Lung(18;0.14)																													uc001zoa.3		NA																	4	Substitution - coding silent(4)		lung(4)	lung(6)|central_nervous_system(1)	7						c.(1315-1317)CTC>CTT		leukocyte receptor tyrosine kinase isoform 1							82.0	70.0	74.0					15																	41799788		2203	4300	6503	SO:0001819	synonymous_variant	4058				apoptosis|cell proliferation|phosphatidylinositol 3-kinase cascade|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:41799788G>A	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1317C>T	15.37:g.41799788G>A		TSP Lung(18;0.14)	Somatic				LTK_uc001zob.3_Silent_p.L378L|LTK_uc010ucx.1_Silent_p.L378L|LTK_uc010bcg.2_Silent_p.L121L	p.L439L	NM_002344	NP_002335	WXS	Illumina HiSeq	Unspecified	P29376	LTK_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)	10	1495	-		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)	439			Helical; (Potential).		A6NNJ8|B4DL89|E9PFX4	Silent	SNP	ENST00000263800.6	37	c.1317C>T	CCDS10077.1																																																																																				0.577	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2			23	12	0	0	0	0.069288	0	23	12				
CSNK1G1	53944	broad.mit.edu	37	15	64495340	64495340	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr15:64495340T>C	ENST00000303052.7	-	10	1471	c.1048A>G	c.(1048-1050)Act>Gct	p.T350A	CSNK1G1_ENST00000607537.1_Missense_Mutation_p.T350A|CTD-2116N17.1_ENST00000606793.1_Missense_Mutation_p.T332A|CSNK1G1_ENST00000303032.6_Missense_Mutation_p.T350A	NM_022048.3	NP_071331.2	Q9HCP0	KC1G1_HUMAN	casein kinase 1, gamma 1	350					Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T350A(4)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	13						CTTTCTCGAGTTATTGCAGAT	0.453																																							uc002anf.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(1048-1050)ACT>GCT		casein kinase 1, gamma 1							224.0	177.0	193.0					15																	64495340		2203	4300	6503	SO:0001583	missense	53944				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr15:64495340T>C	AB042562	CCDS10192.2	15q22.1-q22.31	2013-01-17			ENSG00000169118	ENSG00000169118			2454	protein-coding gene	gene with protein product		606274				11124537	Standard	NM_022048		Approved	CK1gamma1	uc002anf.3	Q9HCP0	OTTHUMG00000133019	ENST00000303052.7:c.1048A>G	15.37:g.64495340T>C	ENSP00000305777:p.Thr350Ala		Somatic				CSNK1G1_uc002ane.2_RNA|CSNK1G1_uc002ang.1_Missense_Mutation_p.T350A|CSNK1G1_uc002anh.1_Missense_Mutation_p.T350A|CSNK1G1_uc002anj.2_Missense_Mutation_p.T332A	p.T350A	NM_022048	NP_071331	WXS	Illumina HiSeq	Unspecified	Q9HCP0	KC1G1_HUMAN			10	1528	-			350					Q5JPH1|Q96AE9|Q9HCP1	Missense_Mutation	SNP	ENST00000303052.7	37	c.1048A>G	CCDS10192.2	.	.	.	.	.	.	.	.	.	.	T	16.10	3.027385	0.54683	.	.	ENSG00000169118	ENST00000303052;ENST00000447727;ENST00000303032	T;T	0.06142	3.34;3.34	5.14	5.14	0.70334	Casein kinase 1 gamma C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.14960	0.0361	L	0.43152	1.355	0.80722	D	1	D;B;B;B	0.63046	0.992;0.108;0.152;0.003	D;B;B;B	0.76071	0.987;0.089;0.232;0.009	T	0.11518	-1.0584	10	0.07813	T	0.8	.	14.4429	0.67330	0.0:0.0:0.0:1.0	.	208;350;350;350	Q9H5M4;Q9HCP0-2;Q8IXA3;Q9HCP0	.;.;.;KC1G1_HUMAN	A	350;306;350	ENSP00000305777:T350A;ENSP00000307753:T350A	ENSP00000307753:T350A	T	-	1	0	CSNK1G1	62282393	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.351000	0.79395	2.072000	0.62099	0.460000	0.39030	ACT		0.453	CSNK1G1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256605.1	NM_022048		41	15	0	0	0	0.09836	0	41	15				
CILP	8483	broad.mit.edu	37	15	65499310	65499310	+	Silent	SNP	G	G	A	rs146845325	byFrequency	TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr15:65499310G>A	ENST00000261883.4	-	4	400	c.234C>T	c.(232-234)cgC>cgT	p.R78R		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	78					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.R78R(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						CATAGTAGAAGCGAATGGCGT	0.602													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18538	0.0		0.0	False		,,,				2504	0.0						uc002aon.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(2)|skin(1)	7						c.(232-234)CGC>CGT		cartilage intermediate layer protein		G		2,4400	4.2+/-10.8	0,2,2199	51.0	42.0	45.0		234	-1.1	1.0	15	dbSNP_134	45	0,8598		0,0,4299	no	coding-synonymous	CILP	NM_003613.3		0,2,6498	AA,AG,GG		0.0,0.0454,0.0154		78/1185	65499310	2,12998	2201	4299	6500	SO:0001819	synonymous_variant	8483				negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix		g.chr15:65499310G>A	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.234C>T	15.37:g.65499310G>A			Somatic					p.R78R	NM_003613	NP_003604	WXS	Illumina HiSeq	Unspecified	O75339	CILP1_HUMAN			4	415	-			78					B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	ENST00000261883.4	37	c.234C>T	CCDS10203.1																																																																																				0.602	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613		5	38	0	0	0	0.014758	0	5	38				
RPL4	6124	broad.mit.edu	37	15	66795413	66795413	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr15:66795413G>C	ENST00000307961.6	-	3	357	c.265C>G	c.(265-267)Cag>Gag	p.Q89E	RPL4_ENST00000568588.1_5'UTR|SNORD18B_ENST00000365659.1_RNA|ZWILCH_ENST00000446801.2_5'Flank|ZWILCH_ENST00000307897.5_5'Flank|RPL4_ENST00000564517.1_5'Flank|ZWILCH_ENST00000535141.2_5'Flank|SNORD16_ENST00000362803.1_RNA|SNORD18C_ENST00000362704.1_RNA|ZWILCH_ENST00000565627.1_5'Flank|SNORD18A_ENST00000363753.1_RNA	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	89					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.Q89E(2)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						AAAGCACCCTGGCCAGAGCGG	0.493																																							uc002apv.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(265-267)CAG>GAG		ribosomal protein L4							35.0	36.0	36.0					15																	66795413		2201	4299	6500	SO:0001583	missense	6124				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome	g.chr15:66795413G>C	AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.265C>G	15.37:g.66795413G>C	ENSP00000311430:p.Gln89Glu		Somatic				RPL4_uc010bhr.2_5'UTR|RPL4_uc002apw.2_Intron|RPL4_uc002apx.2_5'UTR|RPL4_uc010ujq.1_Missense_Mutation_p.Q89E|SNORD18C_uc010bhs.1_5'Flank|SNORD18B_uc002apy.1_5'Flank|SNORD16_uc010bht.2_5'Flank|ZWILCH_uc010bhu.1_5'Flank|ZWILCH_uc002aqb.2_5'Flank|ZWILCH_uc002aqa.2_5'Flank|ZWILCH_uc010bhv.2_5'Flank	p.Q89E	NM_000968	NP_000959	WXS	Illumina HiSeq	Unspecified	P36578	RL4_HUMAN			3	321	-			89					A8K502|P39029|Q4VBR0|Q969Z9	Missense_Mutation	SNP	ENST00000307961.6	37	c.265C>G	CCDS10218.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541644	0.85917	.	.	ENSG00000174444	ENST00000307961;ENST00000449253;ENST00000432669	.	.	.	4.88	4.88	0.63580	Ribosomal protein L4 domain (2);	0.000000	0.85682	D	0.000000	T	0.81245	0.4782	M	0.90369	3.11	0.80722	D	1	B;P	0.48640	0.184;0.913	P;P	0.51833	0.467;0.681	D	0.86029	0.1512	9	0.87932	D	0	-17.697	18.2674	0.90056	0.0:0.0:1.0:0.0	.	89;89	B4DFI6;P36578	.;RL4_HUMAN	E	89	.	ENSP00000311430:Q89E	Q	-	1	0	RPL4	64582467	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.588000	0.82629	2.538000	0.85594	0.650000	0.86243	CAG		0.493	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256903.2	NM_000968		14	34	0	0	0	0.105934	0	14	34				
FAM154B	283726	broad.mit.edu	37	15	82574915	82574915	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr15:82574915G>T	ENST00000339465.5	+	3	778	c.709G>T	c.(709-711)Gag>Tag	p.E237*	FAM154B_ENST00000565501.1_3'UTR|FAM154B_ENST00000427381.2_Nonsense_Mutation_p.E222*	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B	237								p.E237*(2)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						GAAAGTACCAGAGTATGTGCC	0.473																																							uc002bgv.2		NA																	2	Substitution - Nonsense(2)		lung(2)	skin(2)	2						c.(709-711)GAG>TAG		hypothetical protein LOC283726							94.0	90.0	91.0					15																	82574915		2203	4300	6503	SO:0001587	stop_gained	283726							g.chr15:82574915G>T	AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.709G>T	15.37:g.82574915G>T	ENSP00000340445:p.Glu237*		Somatic				FAM154B_uc010unr.1_Nonsense_Mutation_p.E222*|FAM154B_uc010uns.1_RNA	p.E237*	NM_001008226	NP_001008227	WXS	Illumina HiSeq	Unspecified	Q658L1	F154B_HUMAN			3	778	+			237					B4E2M2	Nonsense_Mutation	SNP	ENST00000339465.5	37	c.709G>T	CCDS32310.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548715	0.45383	.	.	ENSG00000188659	ENST00000339465;ENST00000427381	.	.	.	3.9	1.81	0.25067	.	0.072482	0.52532	D	0.000071	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-10.9633	9.3216	0.37968	0.086:0.1454:0.7686:0.0	.	.	.	.	X	237;222	.	ENSP00000340445:E237X	E	+	1	0	FAM154B	80361970	1.000000	0.71417	0.145000	0.22337	0.472000	0.32918	3.897000	0.56273	0.973000	0.38340	0.536000	0.68110	GAG		0.473	FAM154B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419644.1	NM_001008226		7	55	1	0	2.0095e-06	0.02938	2.24171e-06	7	55				
AEN	64782	broad.mit.edu	37	15	89172497	89172497	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr15:89172497C>T	ENST00000332810.3	+	3	732	c.581C>T	c.(580-582)gCg>gTg	p.A194V	AEN_ENST00000379231.3_Missense_Mutation_p.A194V	NM_022767.3	NP_073604.3	Q8WTP8	AEN_HUMAN	apoptosis enhancing nuclease	194	Exonuclease.				intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)	p.A194V(1)		NS(1)|kidney(1)|large_intestine(1)|lung(4)	7						GTGGGGCACGCGCTGCACAAC	0.612																																							uc002bmt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(580-582)GCG>GTG		interferon stimulated exonuclease gene							102.0	99.0	100.0					15																	89172497		2200	4299	6499	SO:0001583	missense	64782				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|response to ionizing radiation	nucleolus|nucleoplasm	exonuclease activity|nucleic acid binding	g.chr15:89172497C>T	BC020988	CCDS10344.1	15q26.1	2008-07-15	2008-07-15	2008-07-15	ENSG00000181026	ENSG00000181026			25722	protein-coding gene	gene with protein product		610177	"""interferon stimulated exonuclease gene 20kDa-like 1"""	ISG20L1		18264133, 16171785	Standard	NM_022767		Approved	FLJ12484, FLJ12562	uc002bmt.2	Q8WTP8	OTTHUMG00000148681	ENST00000332810.3:c.581C>T	15.37:g.89172497C>T	ENSP00000331944:p.Ala194Val		Somatic				AEN_uc010bnm.1_Missense_Mutation_p.A194V	p.A194V	NM_022767	NP_073604	WXS	Illumina HiSeq	Unspecified	Q8WTP8	AEN_HUMAN			3	732	+			194			Exonuclease.		C9J571|Q9BSA5|Q9H9X7	Missense_Mutation	SNP	ENST00000332810.3	37	c.581C>T	CCDS10344.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.852244	0.91355	.	.	ENSG00000181026	ENST00000332810;ENST00000379231	T;T	0.30981	1.51;1.51	5.4	5.4	0.78164	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.000000	0.64402	D	0.000009	T	0.70684	0.3252	H	0.96889	3.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.81786	-0.0773	10	0.87932	D	0	-5.7033	18.1529	0.89679	0.0:1.0:0.0:0.0	.	194;194	Q8WTP8-2;Q8WTP8	.;AEN_HUMAN	V	194	ENSP00000331944:A194V;ENSP00000368533:A194V	ENSP00000331944:A194V	A	+	2	0	AEN	86973501	1.000000	0.71417	0.430000	0.26722	0.624000	0.37722	7.224000	0.78042	2.517000	0.84864	0.655000	0.94253	GCG		0.612	AEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309071.1	NM_022767		8	264	0	0	0	0.069234	0	8	264				
TICRR	90381	broad.mit.edu	37	15	90168849	90168849	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr15:90168849T>A	ENST00000268138.7	+	20	5413	c.5308T>A	c.(5308-5310)Ttg>Atg	p.L1770M	KIF7_ENST00000558928.1_Intron|TICRR_ENST00000560985.1_Missense_Mutation_p.L1769M			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1770					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.L1770M(2)									ACAGTTTGGGTTGAGTTCCAG	0.537																																							uc002boe.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(2)|skin(1)	7						c.(5308-5310)TTG>ATG		leucine-rich repeat kinase 1							48.0	53.0	51.0					15																	90168849		2200	4299	6499	SO:0001583	missense	90381				cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding	g.chr15:90168849T>A	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.5308T>A	15.37:g.90168849T>A	ENSP00000268138:p.Leu1770Met		Somatic				C15orf42_uc010upv.1_RNA	p.L1770M	NM_152259	NP_689472	WXS	Illumina HiSeq	Unspecified	Q7Z2Z1	TICRR_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.128)		20	5308	+	Lung NSC(78;0.0237)|all_lung(78;0.0478)		1770					B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	c.5308T>A	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	T	15.28	2.785859	0.49997	.	.	ENSG00000140534	ENST00000268138	T	0.18810	2.19	5.41	-6.06	0.02165	.	0.828177	0.10345	N	0.685878	T	0.36635	0.0974	M	0.71581	2.175	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.27773	-1.0064	10	0.87932	D	0	2.0E-4	7.5166	0.27604	0.2023:0.4919:0.0:0.3059	.	1770	Q7Z2Z1	TICRR_HUMAN	M	1770	ENSP00000268138:L1770M	ENSP00000268138:L1770M	L	+	1	2	C15orf42	87969853	0.001000	0.12720	0.058000	0.19502	0.519000	0.34347	-1.133000	0.03232	-1.049000	0.03234	-0.290000	0.09829	TTG		0.537	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259		35	76	0	0	0	0.069456	0	35	76				
SLCO3A1	28232	broad.mit.edu	37	15	92459353	92459353	+	Missense_Mutation	SNP	A	A	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr15:92459353A>C	ENST00000318445.6	+	2	525	c.311A>C	c.(310-312)cAc>cCc	p.H104P	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.H104P	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	104					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GCACGCGGGCACCGGCCGCGC	0.667																																							uc002bqx.2		NA																	0				skin(1)	1						c.(310-312)CAC>CCC		solute carrier organic anion transporter family,							25.0	20.0	22.0					15																	92459353		2183	4250	6433	SO:0001583	missense	28232				sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity	g.chr15:92459353A>C	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.311A>C	15.37:g.92459353A>C	ENSP00000320634:p.His104Pro		Somatic				SLCO3A1_uc002bqy.2_Missense_Mutation_p.H104P|SLCO3A1_uc010boc.1_RNA|SLCO3A1_uc002bqz.1_Missense_Mutation_p.H46P	p.H104P	NM_013272	NP_037404	WXS	Illumina HiSeq	Unspecified	Q9UIG8	SO3A1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0841)		2	512	+	Lung NSC(78;0.0158)|all_lung(78;0.0255)		104			Cytoplasmic (Potential).		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	c.311A>C	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.706856	0.89018	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000553304	T;T;T	0.80393	-1.37;-1.37;0.39	5.22	5.22	0.72569	Major facilitator superfamily domain, general substrate transporter (1);	0.141046	0.64402	D	0.000004	D	0.91446	0.7300	M	0.91300	3.195	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.974;0.996;0.999	D	0.93290	0.6667	10	0.87932	D	0	.	14.5834	0.68308	1.0:0.0:0.0:0.0	.	46;104;104	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	P	104;104;46	ENSP00000320634:H104P;ENSP00000387846:H104P;ENSP00000450559:H46P	ENSP00000320634:H104P	H	+	2	0	SLCO3A1	90260357	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	8.951000	0.93025	2.111000	0.64477	0.533000	0.62120	CAC		0.667	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272		7	21	0	0	0	0.034045	0	7	21				
LUC7L	55692	broad.mit.edu	37	16	242974	242974	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:242974C>T	ENST00000293872.8	-	7	838	c.728G>A	c.(727-729)cGc>cAc	p.R243H	LUC7L_ENST00000397783.1_Missense_Mutation_p.R243H|LUC7L_ENST00000337351.4_Missense_Mutation_p.R243H|LUC7L_ENST00000397780.1_Missense_Mutation_p.R190H	NM_201412.1	NP_958815.1	Q9NQ29	LUC7L_HUMAN	LUC7-like (S. cerevisiae)	243	Arg/Ser-rich.				mRNA splice site selection (GO:0006376)|negative regulation of striated muscle tissue development (GO:0045843)	U1 snRNP (GO:0005685)	identical protein binding (GO:0042802)|mRNA binding (GO:0003729)	p.R243H(4)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	11		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)				CCTCCTCAAGCGATCCTGATT	0.507																																							uc002cgc.1		NA																	4	Substitution - Missense(4)		lung(4)	central_nervous_system(1)	1						c.(727-729)CGC>CAC		LUC7-like isoform b							272.0	255.0	261.0					16																	242974		2203	4300	6503	SO:0001583	missense	55692						metal ion binding	g.chr16:242974C>T	AY005111	CCDS10401.1, CCDS32348.1	16p13.3	2010-01-25	2001-11-28		ENSG00000007392	ENSG00000007392			6723	protein-coding gene	gene with protein product		607782	"""LUC7 (S. cerevisiae)-like"""				Standard	NM_201412		Approved	LUC7B1, hLuc7B1, Luc7	uc002cgc.1	Q9NQ29	OTTHUMG00000060730	ENST00000293872.8:c.728G>A	16.37:g.242974C>T	ENSP00000293872:p.Arg243His		Somatic				LUC7L_uc002cga.1_Missense_Mutation_p.R243H|LUC7L_uc002cgd.1_RNA|LUC7L_uc002cge.1_Missense_Mutation_p.R243H|LUC7L_uc002cgb.1_Missense_Mutation_p.R157H	p.R243H	NM_201412	NP_958815	WXS	Illumina HiSeq	Unspecified	Q9NQ29	LUC7L_HUMAN			7	839	-		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)	243			Potential.|Arg/Ser-rich.		B8ZZ13|Q96S32|Q9NPH4	Missense_Mutation	SNP	ENST00000293872.8	37	c.728G>A	CCDS32348.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971846	0.74246	.	.	ENSG00000007392	ENST00000337351;ENST00000293872;ENST00000397783;ENST00000429378;ENST00000397780;ENST00000430864	T;T;T;T	0.59502	0.93;0.93;0.26;3.13	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.73187	0.3555	M	0.73319	2.225	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.68112	-0.5495	10	0.15952	T	0.53	.	17.5027	0.87736	0.0:1.0:0.0:0.0	.	243	Q9NQ29	LUC7L_HUMAN	H	243;243;243;42;190;157	ENSP00000337507:R243H;ENSP00000380885:R243H;ENSP00000413033:R42H;ENSP00000380882:R190H	ENSP00000293872:R243H	R	-	2	0	LUC7L	182975	1.000000	0.71417	0.972000	0.41901	0.996000	0.88848	5.669000	0.68081	2.549000	0.85964	0.462000	0.41574	CGC		0.507	LUC7L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134239.1			79	173	0	0	0	0.048971	0	79	173				
AXIN1	8312	broad.mit.edu	37	16	343556	343556	+	Silent	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:343556C>T	ENST00000262320.3	-	8	2489	c.2118G>A	c.(2116-2118)caG>caA	p.Q706Q	AXIN1_ENST00000354866.3_Silent_p.Q706Q	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	706	Interaction with HIPK2. {ECO:0000250}.|Interaction with PPP2CA.|Interaction with RNF111.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)	p.Q706Q(3)		biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CCTCCTCCAGCTGGGTTAGGG	0.682																																							uc002cgp.1		NA																	3	Substitution - coding silent(3)		lung(2)|ovary(1)	breast(1)|liver(1)	2						c.(2116-2118)CAG>CAA		axin 1 isoform a							54.0	72.0	65.0					16																	343556		2197	4299	6496	SO:0001819	synonymous_variant	8312				activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding	g.chr16:343556C>T	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.2118G>A	16.37:g.343556C>T			Somatic				AXIN1_uc002cgq.1_Silent_p.Q706Q	p.Q706Q	NM_003502	NP_003493	WXS	Illumina HiSeq	Unspecified	O15169	AXIN1_HUMAN			8	2295	-		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)	706			Interaction with RNF111.|Interaction with PPP2CA.|Interaction with HIPK2 (By similarity).		Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Silent	SNP	ENST00000262320.3	37	c.2118G>A	CCDS10405.1																																																																																				0.682	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3			83	136	0	0	0	0.048971	0	83	136				
BAIAP3	8938	broad.mit.edu	37	16	1392740	1392740	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:1392740G>T	ENST00000324385.5	+	13	1349	c.1191G>T	c.(1189-1191)caG>caT	p.Q397H	BAIAP3_ENST00000397489.1_Missense_Mutation_p.Q379H|BAIAP3_ENST00000562208.1_Missense_Mutation_p.Q339H|BAIAP3_ENST00000421665.2_Missense_Mutation_p.Q326H|BAIAP3_ENST00000397488.2_Missense_Mutation_p.Q379H|BAIAP3_ENST00000426824.3_Missense_Mutation_p.Q362H|BAIAP3_ENST00000568887.1_Missense_Mutation_p.Q334H	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	397					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)	p.Q397H(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CCATGAGCCAGCGCGGGCGAT	0.667																																							uc002clk.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1189-1191)CAG>CAT		BAI1-associated protein 3							31.0	30.0	30.0					16																	1392740		2193	4297	6490	SO:0001583	missense	8938				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding	g.chr16:1392740G>T	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.1191G>T	16.37:g.1392740G>T	ENSP00000324510:p.Gln397His		Somatic				BAIAP3_uc002clj.2_Missense_Mutation_p.Q379H|BAIAP3_uc010uuz.1_Missense_Mutation_p.Q362H|BAIAP3_uc010uva.1_Missense_Mutation_p.Q334H|BAIAP3_uc010uvc.1_Missense_Mutation_p.Q326H	p.Q397H	NM_003933	NP_003924	WXS	Illumina HiSeq	Unspecified	O94812	BAIP3_HUMAN			13	1191	+		Hepatocellular(780;0.0893)	397					A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	ENST00000324385.5	37	c.1191G>T	CCDS10434.1	.	.	.	.	.	.	.	.	.	.	G	9.416	1.081889	0.20309	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000440627;ENST00000421665	T;T;T;T;T	0.72505	-0.65;-0.66;-0.66;-0.66;-0.61	4.34	3.35	0.38373	.	0.639420	0.15399	N	0.264387	T	0.60353	0.2262	L	0.40543	1.245	0.33877	D	0.635657	B;B;B;B	0.09022	0.002;0.001;0.001;0.001	B;B;B;B	0.09377	0.004;0.001;0.002;0.003	T	0.62511	-0.6839	10	0.29301	T	0.29	-8.2373	11.7328	0.51748	0.0:0.1802:0.8198:0.0	.	326;339;397;379	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	H	362;379;397;379;3;326	ENSP00000407242:Q362H;ENSP00000380625:Q379H;ENSP00000324510:Q397H;ENSP00000380626:Q379H;ENSP00000409533:Q326H	ENSP00000324510:Q397H	Q	+	3	2	BAIAP3	1332741	0.815000	0.29118	0.876000	0.34364	0.358000	0.29455	1.186000	0.32078	1.001000	0.39076	0.591000	0.81541	CAG		0.667	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3			11	40	1	0	3.07112e-06	0.080935	3.41084e-06	11	40				
CDIP1	29965	broad.mit.edu	37	16	4563767	4563767	+	Silent	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:4563767C>A	ENST00000399599.3	-	3	719	c.171G>T	c.(169-171)ccG>ccT	p.P57P	CDIP1_ENST00000564828.1_Silent_p.P22P|CDIP1_ENST00000563507.1_Silent_p.P57P|CDIP1_ENST00000563332.2_Silent_p.P57P|CDIP1_ENST00000567695.1_Silent_p.P57P|CDIP1_ENST00000562334.1_Intron			Q9H305	CDIP1_HUMAN	cell death-inducing p53 target 1	57	Pro-rich.				apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	nucleus (GO:0005634)		p.P57P(2)									TTGGGTGACCCGGCGGCTCAT	0.652																																							uc002cwu.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(169-171)CCG>CCT		cell death inducing protein							53.0	60.0	58.0					16																	4563767		2043	4182	6225	SO:0001819	synonymous_variant	29965				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|tumor necrosis factor-mediated signaling pathway	nucleus		g.chr16:4563767C>A	AF131218	CCDS42114.1, CCDS58419.1, CCDS58420.1	16p13.3	2012-11-14	2012-11-14	2012-11-14	ENSG00000089486	ENSG00000089486			13234	protein-coding gene	gene with protein product	"""cell death involved p53-target"", ""lipopolysaccharide-induced TNF factor-like"""	610503	"""chromosome 16 open reading frame 5"""	C16orf5		10570909, 17599062	Standard	NM_013399		Approved	CDIP, LITAFL	uc002cww.3	Q9H305	OTTHUMG00000177172	ENST00000399599.3:c.171G>T	16.37:g.4563767C>A			Somatic				C16orf5_uc002cwv.2_Silent_p.P57P|C16orf5_uc002cww.2_Silent_p.P57P|C16orf5_uc010uxl.1_Silent_p.P57P|C16orf5_uc010uxm.1_Intron|C16orf5_uc010btu.2_RNA	p.P57P	NM_013399	NP_037531	WXS	Illumina HiSeq	Unspecified	Q9H305	LITFL_HUMAN			3	466	-		Ovarian(90;0.17)	57			Pro-rich.		A8K7M1|B4DFU1|B4DY75|D3DUD6|Q96ID8|Q9H0Q4|Q9P112	Silent	SNP	ENST00000399599.3	37	c.171G>T	CCDS42114.1																																																																																				0.652	CDIP1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435718.2	NM_013399		64	85	1	0	2.94687e-45	0.048971	4.20264e-45	64	85				
GRIN2A	2903	broad.mit.edu	37	16	10032335	10032336	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:10032335_10032336TG>CT	ENST00000396573.2	-	4	796_797	c.487_488CA>AG	c.(487-489)CAg>AGg	p.Q163R	GRIN2A_ENST00000396575.2_Missense_Mutation_p.Q163R|GRIN2A_ENST00000330684.3_Missense_Mutation_p.Q163R|GRIN2A_ENST00000562109.1_Missense_Mutation_p.Q163R|GRIN2A_ENST00000535259.1_Missense_Mutation_p.Q6R|GRIN2A_ENST00000566670.1_5'UTR|GRIN2A_ENST00000404927.2_Missense_Mutation_p.Q163R	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	163					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.Q163R(2)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTCATAATCCTGCATGATCTTC	0.5																																							uc002czo.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(487-489)CAG>AGG		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)																																			SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:10032335_10032336TG>CT		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.487_488delinsCT	16.37:g.10032335_10032336delinsCT	ENSP00000379818:p.Gln163Arg		Somatic				GRIN2A_uc010uym.1_Missense_Mutation_p.Q163R|GRIN2A_uc010uyn.1_Missense_Mutation_p.Q6R|GRIN2A_uc002czr.3_Missense_Mutation_p.Q163R	p.Q163R	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			3	1035_1036	-			163			Extracellular (Potential).		O00669|Q17RZ6	Missense_Mutation	DNP	ENST00000396573.2	37	c.487_488CA>AG	CCDS10539.1																																																																																				0.500	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			46	88	0	0	0	0.004672	0	46	88				
TXNDC11	51061	broad.mit.edu	37	16	11827847	11827847	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:11827847T>C	ENST00000356957.3	-	3	667	c.560A>G	c.(559-561)tAt>tGt	p.Y187C	TXNDC11_ENST00000283033.5_Missense_Mutation_p.Y187C			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	187	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)	p.Y187C(2)		endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						CCTCCGATGATACAGATATAT	0.333																																							uc010buu.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(559-561)TAT>TGT		thioredoxin domain containing 11							68.0	74.0	72.0					16																	11827847		2197	4300	6497	SO:0001583	missense	51061				cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane		g.chr16:11827847T>C	BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.560A>G	16.37:g.11827847T>C	ENSP00000349439:p.Tyr187Cys		Somatic				TXNDC11_uc002dbg.1_Missense_Mutation_p.Y187C	p.Y187C	NM_015914	NP_056998	WXS	Illumina HiSeq	Unspecified	Q6PKC3	TXD11_HUMAN			3	622	-			187			Thioredoxin 1.		O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Missense_Mutation	SNP	ENST00000356957.3	37	c.560A>G		.	.	.	.	.	.	.	.	.	.	T	18.61	3.661434	0.67700	.	.	ENSG00000153066	ENST00000356957;ENST00000283033;ENST00000436567	T;T	0.26810	1.71;1.71	5.86	5.86	0.93980	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.056447	0.64402	D	0.000001	T	0.53449	0.1797	M	0.79614	2.46	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.58008	-0.7712	10	0.87932	D	0	-16.1027	15.4291	0.75077	0.0:0.0:0.0:1.0	.	187;187	Q6PKC3;Q6PKC3-2	TXD11_HUMAN;.	C	187;187;130	ENSP00000349439:Y187C;ENSP00000283033:Y187C	ENSP00000283033:Y187C	Y	-	2	0	TXNDC11	11735348	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.161000	0.58170	2.241000	0.73720	0.533000	0.62120	TAT		0.333	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000437057.1	NM_015914		13	17	0	0	0	0.09319	0	13	17				
KIAA0430	9665	broad.mit.edu	37	16	15729639	15729639	+	Silent	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:15729639C>T	ENST00000396368.3	-	3	911	c.705G>A	c.(703-705)ggG>ggA	p.G235G	KIAA0430_ENST00000602337.1_Silent_p.G235G|KIAA0430_ENST00000344181.3_Silent_p.G57G|KIAA0430_ENST00000551742.1_Silent_p.G235G|KIAA0430_ENST00000540441.2_Silent_p.G235G|KIAA0430_ENST00000548025.1_Silent_p.G235G	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	235					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G235G(2)		breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						CTTCCAAATGCCCTGGAGCCC	0.522																																							uc002ddr.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(703-705)GGG>GGA		limkain b1							65.0	67.0	66.0					16																	15729639		1958	4142	6100	SO:0001819	synonymous_variant	9665					peroxisome	nucleotide binding|RNA binding	g.chr16:15729639C>T	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.705G>A	16.37:g.15729639C>T			Somatic				KIAA0430_uc002ddq.2_Silent_p.G234G|KIAA0430_uc010uzv.1_Silent_p.G234G|KIAA0430_uc010uzw.1_Silent_p.G234G|KIAA0430_uc010uzx.1_Silent_p.G234G	p.G235G	NM_014647	NP_055462	WXS	Illumina HiSeq	Unspecified	Q9Y4F3	LKAP_HUMAN			3	898	-			234					A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Silent	SNP	ENST00000396368.3	37	c.705G>A	CCDS10562.2																																																																																				0.522	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647		28	45	0	0	0	0.030593	0	28	45				
ABCC6P1	653190	broad.mit.edu	37	16	18597207	18597207	+	RNA	SNP	C	C	G	rs565295853		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:18597207C>G	ENST00000546162.2	+	0	947					NR_003569.1				ATP-binding cassette, sub-family C, member 6 pseudogene 1 (functional)																		CTCAGAAGAACTTGTTTCCCG	0.557																																							uc002dfg.2		NA																	0					0						c.(571-573)CTT>GTT		SubName: Full=cDNA FLJ51267, highly similar to Multidrug resistance-associated protein 6;																																						653190							g.chr16:18597207C>G	BC075833		16p12.3	2014-09-11	2014-05-09		ENSG00000256340	ENSG00000256340		"""-"""	33352	pseudogene	pseudogene			"""ATP-binding cassette, sub-family C, member 6 pseudogene 1"""			18405356, 22873774	Standard	NR_003569		Approved		uc002dfg.3		OTTHUMG00000177192		16.37:g.18597207C>G			Somatic				ABCC6P1_uc010vam.1_Missense_Mutation_p.L134V	p.L191V	NR_003569		WXS	Illumina HiSeq	Unspecified					7	771	+									Missense_Mutation	SNP	ENST00000546162.2	37	c.571C>G		.	.	.	.	.	.	.	.	.	.	.	3.034	-0.199048	0.06219	.	.	ENSG00000256340	ENST00000546162	.	.	.	3.02	1.92	0.25849	.	.	.	.	.	T	0.19725	0.0474	.	.	.	.	.	.	P;P	0.52463	0.953;0.921	P;B	0.47470	0.548;0.346	T	0.11542	-1.0583	6	0.02654	T	1	.	6.5858	0.22620	0.2853:0.7146:0.0:0.0	.	134;248	B7Z554;A2RRN8	.;.	V	134	.	ENSP00000443361:L134V	L	+	1	0	ABCC6P1	18504708	1.000000	0.71417	0.955000	0.39395	0.014000	0.08584	1.147000	0.31602	1.672000	0.50884	0.407000	0.27541	CTT		0.557	ABCC6P1-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000435772.2	NR_003569		14	141	0	0	0	0.043863	0	14	141				
GTF3C1	2975	broad.mit.edu	37	16	27510036	27510036	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:27510036G>C	ENST00000356183.4	-	13	2095	c.2080C>G	c.(2080-2082)Ccg>Gcg	p.P694A	GTF3C1_ENST00000561623.1_Missense_Mutation_p.P694A	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	694					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.P694A(1)		breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						TCCATGGACGGGTGCACCACC	0.577																																							uc002dov.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(2080-2082)CCG>GCG		general transcription factor IIIC, polypeptide							143.0	123.0	130.0					16																	27510036		2197	4300	6497	SO:0001583	missense	2975					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr16:27510036G>C	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.2080C>G	16.37:g.27510036G>C	ENSP00000348510:p.Pro694Ala		Somatic				GTF3C1_uc002dou.2_Missense_Mutation_p.P694A	p.P694A	NM_001520	NP_001511	WXS	Illumina HiSeq	Unspecified	Q12789	TF3C1_HUMAN			13	2120	-			694					B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	c.2080C>G	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526480	0.85600	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.27890	1.64	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.60353	0.2262	M	0.80847	2.515	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.65278	-0.6207	10	0.72032	D	0.01	-21.7448	18.584	0.91182	0.0:0.0:1.0:0.0	.	694;694	Q12789;Q12789-3	TF3C1_HUMAN;.	A	694;692	ENSP00000348510:P694A	ENSP00000348510:P694A	P	-	1	0	GTF3C1	27417537	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	9.281000	0.95811	2.478000	0.83669	0.563000	0.77884	CCG		0.577	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520		55	120	0	0	0	0.048971	0	55	120				
HEATR3	55027	broad.mit.edu	37	16	50134194	50134194	+	Missense_Mutation	SNP	T	T	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:50134194T>G	ENST00000299192.7	+	13	1844	c.1653T>G	c.(1651-1653)agT>agG	p.S551R	RNY4P3_ENST00000365254.1_RNA|RP11-429P3.5_ENST00000566770.1_RNA|HEATR3_ENST00000285767.4_Missense_Mutation_p.S465R	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	551								p.S551R(2)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						TTCATAGTAGTAATGTCGGGG	0.378																																							uc002efw.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1651-1653)AGT>AGG		HEAT repeat containing 3							126.0	113.0	117.0					16																	50134194		2198	4300	6498	SO:0001583	missense	55027						binding	g.chr16:50134194T>G	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.1653T>G	16.37:g.50134194T>G	ENSP00000299192:p.Ser551Arg		Somatic				HEATR3_uc002efx.2_Missense_Mutation_p.S465R	p.S551R	NM_182922	NP_891552	WXS	Illumina HiSeq	Unspecified	Q7Z4Q2	HEAT3_HUMAN			13	1815	+			551					A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Missense_Mutation	SNP	ENST00000299192.7	37	c.1653T>G	CCDS10739.1	.	.	.	.	.	.	.	.	.	.	T	9.313	1.056188	0.19907	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	T;T	0.65549	-0.16;-0.16	5.81	-1.6	0.08426	Armadillo-type fold (1);	0.259420	0.52532	D	0.000080	T	0.48077	0.1480	L	0.50333	1.59	0.18873	N	0.999986	P;P	0.45078	0.85;0.638	B;B	0.40285	0.325;0.125	T	0.48317	-0.9046	10	0.27785	T	0.31	.	8.3307	0.32184	0.1184:0.4916:0.0:0.39	.	465;551	B7WNW7;Q7Z4Q2	.;HEAT3_HUMAN	R	465;551	ENSP00000285767:S465R;ENSP00000299192:S551R	ENSP00000285767:S465R	S	+	3	2	HEATR3	48691695	0.403000	0.25319	0.011000	0.14972	0.057000	0.15508	-0.516000	0.06282	-0.334000	0.08463	0.533000	0.62120	AGT		0.378	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922		20	40	0	0	0	0.043863	0	20	40				
RPGRIP1L	23322	broad.mit.edu	37	16	53682886	53682886	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:53682886T>C	ENST00000379925.3	-	16	2344	c.2294A>G	c.(2293-2295)cAt>cGt	p.H765R	RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.H765R|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.H765R|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.H765R	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	765					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)	p.H765R(2)		endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CGACTGCATATGCTCTGGCCC	0.353																																							uc002ehp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2293-2295)CAT>CGT		RPGRIP1-like isoform a							103.0	95.0	97.0					16																	53682886		2198	4300	6498	SO:0001583	missense	23322				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding	g.chr16:53682886T>C		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.2294A>G	16.37:g.53682886T>C	ENSP00000369257:p.His765Arg		Somatic				RPGRIP1L_uc002eho.3_Missense_Mutation_p.H765R|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.H765R|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.H765R|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.H765R	p.H765R	NM_015272	NP_056087	WXS	Illumina HiSeq	Unspecified	Q68CZ1	FTM_HUMAN			16	2358	-		all_cancers(37;0.0973)	765					A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	c.2294A>G	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	T	6.674	0.492884	0.12702	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.75589	-0.75;-0.95	6.08	4.99	0.66335	.	0.895729	0.09806	N	0.753458	T	0.55433	0.1920	N	0.08118	0	0.51233	D	0.999911	B;B;B;B	0.12013	0.0;0.0;0.002;0.005	B;B;B;B	0.04013	0.0;0.0;0.001;0.001	T	0.38672	-0.9650	10	0.24483	T	0.36	-4.3782	10.0795	0.42381	0.0:0.0768:0.0:0.9232	.	765;765;765;765	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	R	765	ENSP00000369257:H765R;ENSP00000262135:H765R	ENSP00000262135:H765R	H	-	2	0	RPGRIP1L	52240387	1.000000	0.71417	0.453000	0.27007	0.156000	0.22039	2.722000	0.47269	1.117000	0.41842	0.482000	0.46254	CAT		0.353	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272		35	51	0	0	0	0.086207	0	35	51				
MMP2	4313	broad.mit.edu	37	16	55530913	55530913	+	Silent	SNP	C	C	T	rs41521545	byFrequency	TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:55530913C>T	ENST00000219070.4	+	10	2057	c.1548C>T	c.(1546-1548)ctC>ctT	p.L516L	MMP2_ENST00000543485.1_Silent_p.L440L|MMP2_ENST00000570308.1_Silent_p.L440L|MMP2_ENST00000437642.2_Silent_p.L466L	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	516	Required for inhibitor TIMP2 binding.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.L516L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	GGCCTGAGCTCCCGGAAAAGA	0.612													C|||	3	0.000599042	0.0023	0.0	5008	,	,		17162	0.0		0.0	False		,,,				2504	0.0						uc002ehz.3		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11						c.(1546-1548)CTC>CTT		matrix metalloproteinase 2 isoform a	Marimastat(DB00786)|Sulindac(DB00605)	C	,	17,4379	26.2+/-53.5	0,17,2181	84.0	79.0	81.0		1398,1548	-2.7	1.0	16	dbSNP_127	81	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	MMP2	NM_001127891.1,NM_004530.4	,	0,17,6481	TT,TC,CC		0.0,0.3867,0.1308	,	466/611,516/661	55530913	17,12979	2198	4300	6498	SO:0001819	synonymous_variant	4313				angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding	g.chr16:55530913C>T		CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.1548C>T	16.37:g.55530913C>T			Somatic				MMP2_uc010vhd.1_Silent_p.L440L|MMP2_uc010ccc.2_Silent_p.L466L|MMP2_uc002eia.3_Silent_p.L13L	p.L516L	NM_004530	NP_004521	WXS	Illumina HiSeq	Unspecified	P08253	MMP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	10	1859	+		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)	516			Required for inhibitor TIMP2 binding.|Hemopexin-like 1.		B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Silent	SNP	ENST00000219070.4	37	c.1548C>T	CCDS10752.1																																																																																				0.612	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3			11	130	0	0	0	0.080935	0	11	130				
HSF4	3299	broad.mit.edu	37	16	67200263	67200263	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:67200263C>G	ENST00000521374.1	+	5	526	c.526C>G	c.(526-528)Cag>Gag	p.Q176E	HSF4_ENST00000264009.8_Missense_Mutation_p.Q176E|HSF4_ENST00000584272.1_Missense_Mutation_p.Q176E|HSF4_ENST00000421453.1_Missense_Mutation_p.Q176E|HSF4_ENST00000517867.1_3'UTR			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	176	Hydrophobic repeat HR-A/B.				camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.Q176E(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GACACTTCGGCAGAGCCACGG	0.637																																							uc002erl.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(526-528)CAG>GAG		heat shock transcription factor 4 isoform b							34.0	43.0	40.0					16																	67200263		2109	4200	6309	SO:0001583	missense	3299				response to stress	nucleus	sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr16:67200263C>G	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.526C>G	16.37:g.67200263C>G	ENSP00000430947:p.Gln176Glu		Somatic				HSF4_uc002erm.1_Missense_Mutation_p.Q176E|HSF4_uc002ern.1_RNA|HSF4_uc010cec.1_RNA	p.Q176E	NM_001040667	NP_001035757	WXS	Illumina HiSeq	Unspecified	Q9ULV5	HSF4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)	7	1491	+		Ovarian(137;0.0563)	176			Hydrophobic repeat HR-A/B.		Q99472|Q9ULV6	Missense_Mutation	SNP	ENST00000521374.1	37	c.526C>G	CCDS42175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.88|17.88	3.497330|3.497330	0.64186|0.64186	.|.	.|.	ENSG00000102878|ENSG00000102878	ENST00000517750|ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374;ENST00000517729	.|.	.|.	.|.	4.74|4.74	4.74|4.74	0.60224|0.60224	.|.	.|0.058093	.|0.64402	.|D	.|0.000001	T|T	0.76256|0.76256	0.3962|0.3962	M|M	0.67397|0.67397	2.05|2.05	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D	.|0.59767	.|0.986;0.969	.|D;D	.|0.72338	.|0.977;0.93	T|T	0.74500|0.74500	-0.3645|-0.3645	5|9	.|0.33141	.|T	.|0.24	-2.233|-2.233	16.4689|16.4689	0.84094|0.84094	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|176;176	.|Q9ULV5-2;Q9ULV5	.|.;HSF4_HUMAN	G|E	22|176;176;176;176;113	.|.	.|ENSP00000264009:Q176E	A|Q	+|+	2|1	0|0	HSF4|HSF4	65757764|65757764	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.755000|0.755000	0.42902|0.42902	6.577000|6.577000	0.74027|0.74027	2.428000|2.428000	0.82296|0.82296	0.655000|0.655000	0.94253|0.94253	GCA|CAG		0.637	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375080.1	NM_001538		7	17	0	0	0	0.02938	0	7	17				
CDT1	81620	broad.mit.edu	37	16	88871952	88871952	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr16:88871952G>T	ENST00000301019.4	+	4	1212	c.593G>T	c.(592-594)cGc>cTc	p.R198L		NM_030928.3	NP_112190.2			chromatin licensing and DNA replication factor 1									p.R198L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(80;0.0476)		GAGATGTTCCGCAGCATGGAC	0.662																																					Melanoma(159;511 3380 30971)	Melanoma(159;511 3380 30971)	uc002flu.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(592-594)CGC>CTC		chromatin licensing and DNA replication factor							53.0	57.0	56.0					16																	88871952		2198	4300	6498	SO:0001583	missense	81620				DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|regulation of DNA-dependent DNA replication initiation|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	DNA binding|protein binding	g.chr16:88871952G>T	AF070552	CCDS32510.1	16q24.3	2014-08-12			ENSG00000167513	ENSG00000167513			24576	protein-coding gene	gene with protein product		605525				11896191, 11555648	Standard	NM_030928		Approved	DUP, RIS2	uc002flu.3	Q9H211	OTTHUMG00000173467	ENST00000301019.4:c.593G>T	16.37:g.88871952G>T	ENSP00000301019:p.Arg198Leu		Somatic					p.R198L	NM_030928	NP_112190	WXS	Illumina HiSeq	Unspecified	Q9H211	CDT1_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0476)	4	647	+			198						Missense_Mutation	SNP	ENST00000301019.4	37	c.593G>T	CCDS32510.1	.	.	.	.	.	.	.	.	.	.	G	35	5.597643	0.96602	.	.	ENSG00000167513	ENST00000301019	T	0.32515	1.45	4.48	4.48	0.54585	.	0.114350	0.56097	D	0.000030	T	0.59224	0.2178	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.63033	-0.6727	10	0.39692	T	0.17	-21.2709	17.5159	0.87773	0.0:0.0:1.0:0.0	.	198	Q9H211	CDT1_HUMAN	L	198	ENSP00000301019:R198L	ENSP00000301019:R198L	R	+	2	0	CDT1	87399453	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.575000	0.98187	2.206000	0.71126	0.448000	0.29417	CGC		0.662	CDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000423215.1	NM_030928		65	86	1	0	2.79145e-41	0.048971	3.93626e-41	65	86				
OR1D5	8386	broad.mit.edu	37	17	2966252	2966252	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:2966252G>A	ENST00000575751.1	-	1	649	c.650C>T	c.(649-651)tCc>tTc	p.S217F		NM_014566.1	NP_055381.1	P58170	OR1D5_HUMAN	olfactory receptor, family 1, subfamily D, member 5	217					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S217F(4)|p.S217Y(2)		kidney(1)|lung(10)	11						ACGTACATAGGATGTGGTCAT	0.507																																							uc010vra.1		NA																	6	Substitution - Missense(6)		lung(6)		0						c.(703-705)TCC>TTC		olfactory receptor, family 1, subfamily D,							67.0	78.0	74.0					17																	2966252		2161	4280	6441	SO:0001583	missense	8385							g.chr17:2966252G>A	AF087923	CCDS58499.1	17p13.3	2012-10-09			ENSG00000262628	ENSG00000262628		"""GPCR / Class A : Olfactory receptors"""	8186	protein-coding gene	gene with protein product						10673334	Standard	NM_014566		Approved	OR17-31	uc021tns.1	P58170	OTTHUMG00000177676	ENST00000575751.1:c.650C>T	17.37:g.2966252G>A	ENSP00000459028:p.Ser217Phe		Somatic					p.S235F	NM_003552	NP_003543	WXS	Illumina HiSeq	Unspecified					1	704	-								Q96RA6	Missense_Mutation	SNP	ENST00000575751.1	37	c.704C>T	CCDS58499.1																																																																																				0.507	OR1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438410.2	NM_014566		12	13	0	0	0	0.020292	0	12	13				
TP53	7157	broad.mit.edu	37	17	7577097	7577097	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:7577097C>A	ENST00000269305.4	-	8	1030	c.841G>T	c.(841-843)Gac>Tac	p.D281Y	TP53_ENST00000445888.2_Missense_Mutation_p.D281Y|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.D281Y|TP53_ENST00000359597.4_Missense_Mutation_p.D281Y|TP53_ENST00000455263.2_Missense_Mutation_p.D281Y|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	281	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D281N(25)|p.D281H(19)|p.D281Y(16)|p.0?(8)|p.?(2)|p.R280_D281delRD(2)|p.D281>AGPY(2)|p.A276_R283delACPGRDRR(1)|p.D281R(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGCGCCGGTCTCTCCCAGGA	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		86	Substitution - Missense(61)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(2)|Complex - insertion inframe(2)	p.D281E(25)|p.D281H(19)|p.D281N(18)|p.D281G(10)|p.0?(7)|p.D281Y(6)|p.D281D(5)|p.D281V(3)|p.D281fs*63(2)|p.?(2)|p.R280_D281delRD(2)|p.D281A(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.G279fs*59(1)|p.F270_D281del12(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.D281R(1)|p.D281_R282delDR(1)	lung(14)|breast(13)|upper_aerodigestive_tract(8)|haematopoietic_and_lymphoid_tissue(8)|urinary_tract(8)|large_intestine(6)|ovary(5)|bone(5)|liver(5)|stomach(4)|central_nervous_system(3)|kidney(2)|skin(2)|biliary_tract(1)|endometrium(1)|oesophagus(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM076566	TP53	M		c.(841-843)GAC>TAC	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							80.0	69.0	73.0					17																	7577097		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577097C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.841G>T	17.37:g.7577097C>A	ENSP00000269305:p.Asp281Tyr	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.D281Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.D149Y|TP53_uc010cng.1_Missense_Mutation_p.D149Y|TP53_uc002gii.1_Missense_Mutation_p.D149Y|TP53_uc010cnh.1_Missense_Mutation_p.D281Y|TP53_uc010cni.1_Missense_Mutation_p.D281Y|TP53_uc002gij.2_Missense_Mutation_p.D281Y	p.D281Y	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1035	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	281		D -> Y (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> A (in sporadic cancers; somatic mutation).|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.841G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892841	0.91889	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	M	0.92649	3.33	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	0.997;1.0;0.997;0.997	D	0.96400	0.9296	10	0.87932	D	0	-25.6697	16.1198	0.81342	0.0:1.0:0.0:0.0	.	281;281;281;281	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	Y	281;281;281;281;281;270;149	ENSP00000352610:D281Y;ENSP00000269305:D281Y;ENSP00000398846:D281Y;ENSP00000391127:D281Y;ENSP00000391478:D281Y;ENSP00000425104:D149Y	ENSP00000269305:D281Y	D	-	1	0	TP53	7517822	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GAC		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		31	15	1	0	7.68411e-24	0.037714	1.04821e-23	31	15				
MYH8	4626	broad.mit.edu	37	17	10297637	10297637	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:10297637C>A	ENST00000403437.2	-	35	5189	c.5095G>T	c.(5095-5097)Gag>Tag	p.E1699*	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1699					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.E1699*(2)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CTGCTTCTCTCTGTCTGTTCC	0.587									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	2	Substitution - Nonsense(2)		lung(2)	skin(6)|ovary(3)|breast(2)	11						c.(5095-5097)GAG>TAG		myosin, heavy chain 8, skeletal muscle,							125.0	112.0	116.0					17																	10297637		2203	4300	6503	SO:0001587	stop_gained	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10297637C>A		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.5095G>T	17.37:g.10297637C>A	ENSP00000384330:p.Glu1699*		Somatic				uc002gml.1_Intron	p.E1699*	NM_002472	NP_002463	WXS	Illumina HiSeq	Unspecified	P13535	MYH8_HUMAN			35	5190	-			1699			Potential.		Q14910	Nonsense_Mutation	SNP	ENST00000403437.2	37	c.5095G>T	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	45	11.378156	0.99554	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	.	.	.	5.06	4.09	0.47781	.	0.000000	0.42172	U	0.000755	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.3659	0.60684	0.0:0.9244:0.0:0.0756	.	.	.	.	X	1699	.	ENSP00000252173:E1699X	E	-	1	0	MYH8	10238362	1.000000	0.71417	0.908000	0.35775	0.929000	0.56500	7.609000	0.82925	1.363000	0.46019	0.650000	0.86243	GAG		0.587	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		55	34	1	0	8.43275e-48	0.048971	1.22348e-47	55	34				
UBBP4	23666	broad.mit.edu	37	17	21731144	21731144	+	Missense_Mutation	SNP	T	T	G	rs375625296		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:21731144T>G	ENST00000578713.1	+	1	450	c.446T>G	c.(445-447)cTg>cGg	p.L149R	UBBP4_ENST00000584755.1_Missense_Mutation_p.L149R|UBBP4_ENST00000584398.1_3'UTR|UBBP4_ENST00000583708.1_3'UTR					ubiquitin B pseudogene 4									p.L149R(18)		endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						GTCCTGCGTCTGAGAGGTGGT	0.542																																							uc002gyy.3		NA																	18	Substitution - Missense(18)		endometrium(12)|prostate(6)		NA						c.(445-447)CTG>CGG		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001583	missense	0							g.chr17:21731144T>G	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.446T>G	17.37:g.21731144T>G	ENSP00000464265:p.Leu149Arg		Somatic					p.L149R			WXS	Illumina HiSeq	Unspecified					2	571	+									Missense_Mutation	SNP	ENST00000578713.1	37	c.446T>G																																																																																					0.542	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444589.2			5	98	0	0	0	0.014758	0	5	98				
RAB11FIP4	84440	broad.mit.edu	37	17	29849412	29849412	+	Splice_Site	SNP	C	C	T	rs140513474		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:29849412C>T	ENST00000325874.8	+	7	1157	c.928C>T	c.(928-930)Cgg>Tgg	p.R310W	RAB11FIP4_ENST00000394744.2_Splice_Site_p.R208W	NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	310	Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				GGCCTTTGGACGGTAAGGCCC	0.607																																							uc002hgn.1		NA																	0				skin(1)	1						c.(928-930)CGG>TGG		RAB11 family interacting protein 4 (class II)		C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	117.0	105.0	109.0		928	2.4	1.0	17	dbSNP_134	109	0,8600		0,0,4300	no	missense-near-splice	RAB11FIP4	NM_032932.3	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	310/638	29849412	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	84440				cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding	g.chr17:29849412C>T	AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.929+1C>T	17.37:g.29849412C>T			Somatic				RAB11FIP4_uc002hgo.2_Missense_Mutation_p.R208W	p.R310W	NM_032932	NP_116321	WXS	Illumina HiSeq	Unspecified	Q86YS3	RFIP4_HUMAN			7	1157	+		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)	310			Potential.|Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.		Q52LI1|Q8N829|Q8NDT7|Q969D8	Missense_Mutation	SNP	ENST00000325874.8	37	c.928C>T	CCDS11267.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977841	0.74360	2.27E-4	0.0	ENSG00000131242	ENST00000325874;ENST00000394744	.	.	.	5.62	2.43	0.29744	.	0.000000	0.85682	D	0.000000	T	0.77170	0.4091	M	0.79258	2.445	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.992	T	0.76547	-0.2919	8	.	.	.	-25.8059	12.9659	0.58483	0.5954:0.4046:0.0:0.0	.	208;310	Q86YS3-2;Q86YS3	.;RFIP4_HUMAN	W	310	.	.	R	+	1	2	RAB11FIP4	26873532	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	1.696000	0.37773	0.254000	0.21573	0.655000	0.94253	CGG		0.607	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256195.2	NM_032932	Missense_Mutation	5	142	0	0	0	0.014758	0	5	142				
MARCH10	162333	broad.mit.edu	37	17	60814179	60814179	+	Missense_Mutation	SNP	A	A	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:60814179A>C	ENST00000311269.5	-	6	1324	c.1050T>G	c.(1048-1050)agT>agG	p.S350R	RP11-156L14.1_ENST00000582564.1_RNA|RP11-156L14.1_ENST00000584597.1_RNA|MARCH10_ENST00000544856.2_Missense_Mutation_p.S349R|MARCH10_ENST00000583600.1_Missense_Mutation_p.S388R|MARCH10_ENST00000456609.2_Missense_Mutation_p.S350R|RP11-156L14.1_ENST00000577270.1_RNA|RP11-156L14.1_ENST00000579201.1_RNA	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	350					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.S350R(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						ATGAGCCATGACTGGGCTCAC	0.483																																							uc010ddr.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1048-1050)AGT>AGG		ring finger protein 190							81.0	82.0	81.0					17																	60814179		2203	4300	6503	SO:0001583	missense	162333						ligase activity|zinc ion binding	g.chr17:60814179A>C	AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.1050T>G	17.37:g.60814179A>C	ENSP00000311496:p.Ser350Arg		Somatic				MARCH10_uc002jag.3_Missense_Mutation_p.S350R|MARCH10_uc010dds.2_Missense_Mutation_p.S388R|MARCH10_uc002jah.2_Missense_Mutation_p.S349R|uc002jaj.1_RNA|uc002jak.2_RNA	p.S350R	NM_001100875	NP_001094345	WXS	Illumina HiSeq	Unspecified	Q8NA82	MARHA_HUMAN			6	1288	-			350					D3DU09|Q8IYS7|Q8N7Z7	Missense_Mutation	SNP	ENST00000311269.5	37	c.1050T>G	CCDS11635.1	.	.	.	.	.	.	.	.	.	.	A	0.369	-0.935095	0.02340	.	.	ENSG00000173838	ENST00000456609;ENST00000311269;ENST00000544856	T;T;T	0.35973	1.28;1.28;1.28	5.17	-4.99	0.03010	.	0.557977	0.17848	N	0.159950	T	0.19446	0.0467	L	0.40543	1.245	0.09310	N	1	B;B;B	0.10296	0.002;0.003;0.002	B;B;B	0.11329	0.003;0.006;0.003	T	0.09862	-1.0655	10	0.33141	T	0.24	-0.3621	2.0751	0.03623	0.3821:0.2164:0.2949:0.1067	.	349;349;350	B3KVK0;G3V1Q5;Q8NA82	.;.;MARHA_HUMAN	R	350;350;349	ENSP00000416177:S350R;ENSP00000311496:S350R;ENSP00000443746:S349R	ENSP00000311496:S350R	S	-	3	2	MARCH10	58167911	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.256000	0.08757	-2.018000	0.00943	-2.862000	0.00101	AGT		0.483	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1	NM_152598		53	155	0	0	0	0.048971	0	53	155				
HELZ	9931	broad.mit.edu	37	17	65103287	65103287	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:65103287C>T	ENST00000358691.5	-	31	5405	c.5239G>A	c.(5239-5241)Gag>Aag	p.E1747K	HELZ_ENST00000580168.1_Missense_Mutation_p.E1748K	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1747						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E1747K(2)		NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ACATTTACCTCTTCTAAGCTA	0.328																																							uc010wqk.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(5242-5244)GAG>AAG		helicase with zinc finger domain							110.0	106.0	108.0					17																	65103287		1876	4112	5988	SO:0001583	missense	9931							g.chr17:65103287C>T	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.5239G>A	17.37:g.65103287C>T	ENSP00000351524:p.Glu1747Lys		Somatic				HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.E1747K	p.E1748K	NM_014877	NP_055692	WXS	Illumina HiSeq	Unspecified					31	5429	-	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)							I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	c.5242G>A	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861902	0.51482	.	.	ENSG00000198265	ENST00000358691	D	0.86627	-2.15	5.09	5.09	0.68999	.	0.102711	0.64402	D	0.000004	D	0.90198	0.6936	L	0.32530	0.975	0.58432	D	0.999999	D;D	0.63880	0.993;0.993	D;D	0.70935	0.971;0.971	D	0.91520	0.5234	10	0.72032	D	0.01	-15.3451	18.5132	0.90925	0.0:1.0:0.0:0.0	.	1748;1747	B7ZLW2;P42694	.;HELZ_HUMAN	K	1747	ENSP00000351524:E1747K	ENSP00000351524:E1747K	E	-	1	0	HELZ	62533749	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.773000	0.68898	2.352000	0.79861	0.573000	0.79308	GAG		0.328	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877		42	46	0	0	0	0.092188	0	42	46				
TNRC6C	57690	broad.mit.edu	37	17	76060902	76060902	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:76060902C>T	ENST00000588061.1	+	6	3222	c.2495C>T	c.(2494-2496)gCa>gTa	p.A832V	TNRC6C_ENST00000335749.4_Missense_Mutation_p.A829V|TNRC6C_ENST00000544502.1_Missense_Mutation_p.A829V|TNRC6C_ENST00000588847.1_Missense_Mutation_p.A829V|RNU6-625P_ENST00000459412.1_RNA|TNRC6C_ENST00000541771.1_Missense_Mutation_p.A832V|TNRC6C_ENST00000301624.4_Missense_Mutation_p.A832V			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	832	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.A829V(2)|p.A832V(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AATGGCACAGCAGCATGGGGG	0.577																																							uc002jud.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(1)|central_nervous_system(1)	2						c.(2494-2496)GCA>GTA		trinucleotide repeat containing 6C isoform 2							53.0	56.0	55.0					17																	76060902		1931	4143	6074	SO:0001583	missense	57690				gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding	g.chr17:76060902C>T	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2495C>T	17.37:g.76060902C>T	ENSP00000468647:p.Ala832Val		Somatic				TNRC6C_uc002juf.2_Missense_Mutation_p.A829V|TNRC6C_uc002jue.2_Missense_Mutation_p.A829V	p.A832V	NM_018996	NP_061869	WXS	Illumina HiSeq	Unspecified	Q9HCJ0	TNR6C_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)		5	3095	+			832			Sufficient for interaction with argonaute family proteins.		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	37	c.2495C>T	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	C	34	5.343405	0.95783	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	5.66	5.66	0.87406	Argonaute hook domain (1);	0.059228	0.64402	D	0.000002	T	0.54382	0.1855	L	0.50333	1.59	0.53688	D	0.999975	P;P;P	0.41929	0.765;0.73;0.656	B;B;B	0.41440	0.357;0.286;0.312	T	0.59343	-0.7472	10	0.87932	D	0	-5.6062	19.7234	0.96151	0.0:1.0:0.0:0.0	.	829;832;832	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	V	832;829;829;832;832;829	ENSP00000336783:A829V;ENSP00000301624:A832V;ENSP00000440310:A832V;ENSP00000442421:A829V	ENSP00000301624:A832V	A	+	2	0	TNRC6C	73572497	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.395000	0.79876	2.668000	0.90789	0.655000	0.94253	GCA		0.577	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996		20	21	0	0	0	0.055883	0	20	21				
CBX2	84733	broad.mit.edu	37	17	77755587	77755587	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:77755587G>A	ENST00000310942.4	+	4	379	c.275G>A	c.(274-276)cGc>cAc	p.R92H	CBX2_ENST00000269399.5_Missense_Mutation_p.R92H	NM_005189.2	NP_005180.1	Q14781	CBX2_HUMAN	chromobox homolog 2	92	Ser-rich.				cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|development of primary sexual characteristics (GO:0045137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R92H(4)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TGCAGCCGGCGCTCCAAGCTC	0.657																																							uc002jxc.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(274-276)CGC>CAC		chromobox homolog 2 isoform 1							45.0	54.0	51.0					17																	77755587		2203	4300	6503	SO:0001583	missense	84733				cell differentiation|chromatin modification|development of primary sexual characteristics|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	PcG protein complex	DNA binding	g.chr17:77755587G>A	BC004252, BG354579	CCDS11764.1, CCDS32757.1	17q25.3	2010-07-06	2010-06-24		ENSG00000173894	ENSG00000173894			1552	protein-coding gene	gene with protein product	"""Pc class homolog (Drosophila)"""	602770	"""chromobox homolog 2 (Drosophila Pc class)"", ""cell division cycle associated 6"""	CDCA6		7782071, 2477932	Standard	NM_005189		Approved	MGC10561	uc002jxc.3	Q14781		ENST00000310942.4:c.275G>A	17.37:g.77755587G>A	ENSP00000308750:p.Arg92His		Somatic				CBX2_uc002jxb.1_Missense_Mutation_p.R92H	p.R92H	NM_005189	NP_005180	WXS	Illumina HiSeq	Unspecified	Q14781	CBX2_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		4	317	+			92			Ser-rich.		Q0VDA5|Q9BTB1	Missense_Mutation	SNP	ENST00000310942.4	37	c.275G>A	CCDS32757.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.575644	0.28092	.	.	ENSG00000173894	ENST00000310942;ENST00000269399	.	.	.	5.25	4.24	0.50183	.	.	.	.	.	T	0.20618	0.0496	N	0.19112	0.55	0.25214	N	0.989954	B;B	0.21688	0.001;0.059	B;B	0.12837	0.001;0.008	T	0.14980	-1.0453	8	0.37606	T	0.19	0.2376	3.72	0.08453	0.1461:0.0:0.6118:0.2421	.	92;92	Q14781;Q14781-2	CBX2_HUMAN;.	H	92	.	ENSP00000269399:R92H	R	+	2	0	CBX2	75370182	0.975000	0.34042	0.972000	0.41901	0.073000	0.16967	1.359000	0.34113	1.054000	0.40438	0.655000	0.94253	CGC		0.657	CBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437040.1	NM_032647		26	71	0	0	0	0.108266	0	26	71				
SPIRE1	56907	broad.mit.edu	37	18	12506572	12506572	+	Silent	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr18:12506572C>A	ENST00000409402.4	-	6	1143	c.876G>T	c.(874-876)cgG>cgT	p.R292R	SPIRE1_ENST00000309836.5_Silent_p.R95R|SPIRE1_ENST00000410092.3_Silent_p.R292R|SPIRE1_ENST00000383356.2_Silent_p.R133R|SPIRE1_ENST00000453447.2_Silent_p.R172R	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1									p.R292R(2)|p.R133R(2)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						GGTTGTACTGCCGCTCTTGGA	0.443																																							uc002kre.2		NA																	4	Substitution - coding silent(4)		lung(4)		0						c.(874-876)CGG>CGT		spire homolog 1 isoform a							258.0	221.0	234.0					18																	12506572		2203	4300	6503	SO:0001819	synonymous_variant	56907					cytoskeleton|perinuclear region of cytoplasm	actin binding	g.chr18:12506572C>A	AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.876G>T	18.37:g.12506572C>A			Somatic				SPIRE1_uc002krc.2_RNA|SPIRE1_uc010wzw.1_Silent_p.R172R|SPIRE1_uc010wzx.1_Silent_p.R95R|SPIRE1_uc010wzy.1_Silent_p.R292R	p.R292R	NM_001128626	NP_001122098	WXS	Illumina HiSeq	Unspecified	Q08AE8	SPIR1_HUMAN			6	923	-			292						Silent	SNP	ENST00000409402.4	37	c.876G>T	CCDS45829.1																																																																																				0.443	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333109.2	XM_290818		22	65	1	0	2.32416e-17	0.069288	2.97634e-17	22	65				
KLHL14	57565	broad.mit.edu	37	18	30349754	30349754	+	Silent	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr18:30349754G>T	ENST00000359358.4	-	2	1239	c.801C>A	c.(799-801)gcC>gcA	p.A267A	AC012123.1_ENST00000426194.1_5'Flank|KLHL14_ENST00000358095.4_Silent_p.A267A	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	267	BACK.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)		p.A267A(2)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						CCGGGATGAGGGCGAAGCGGA	0.652																																							uc002kxm.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(799-801)GCC>GCA		kelch-like 14							39.0	43.0	42.0					18																	30349754		2202	4298	6500	SO:0001819	synonymous_variant	57565					cytosol|endoplasmic reticulum membrane		g.chr18:30349754G>T	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.801C>A	18.37:g.30349754G>T			Somatic					p.A267A	NM_020805	NP_065856	WXS	Illumina HiSeq	Unspecified	Q9P2G3	KLH14_HUMAN			2	1189	-			267			BACK.		A6NNW1|B4DHA0|Q8WU41	Silent	SNP	ENST00000359358.4	37	c.801C>A	CCDS32813.1																																																																																				0.652	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1			20	39	1	0	4.35082e-09	0.055883	5.07933e-09	20	39				
CCDC178	374864	broad.mit.edu	37	18	30804833	30804833	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr18:30804833A>G	ENST00000383096.3	-	17	1906	c.1724T>C	c.(1723-1725)aTa>aCa	p.I575T	CCDC178_ENST00000402325.1_Missense_Mutation_p.I575T|CCDC178_ENST00000406524.2_Missense_Mutation_p.I575T|CCDC178_ENST00000300227.8_Missense_Mutation_p.I575T|CCDC178_ENST00000579947.1_Missense_Mutation_p.I575T|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000403303.1_Missense_Mutation_p.I575T|CCDC178_ENST00000583930.1_Missense_Mutation_p.I575T			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	575								p.I575T(4)									CATGGCACATATTGCTCTATT	0.378																																							uc002kxn.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(1)	1						c.(1723-1725)ATA>ACA		hypothetical protein LOC374864 isoform 1							88.0	80.0	83.0					18																	30804833		2202	4299	6501	SO:0001583	missense	374864							g.chr18:30804833A>G	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.1724T>C	18.37:g.30804833A>G	ENSP00000372576:p.Ile575Thr		Somatic				C18orf34_uc010dme.1_Missense_Mutation_p.I89T|C18orf34_uc010xbr.1_Missense_Mutation_p.I575T|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Missense_Mutation_p.I575T|C18orf34_uc002kxp.2_Missense_Mutation_p.I575T	p.I575T	NM_001105528	NP_001098998	WXS	Illumina HiSeq	Unspecified	Q5BJE1	CR034_HUMAN			16	1866	-			575					A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	c.1724T>C	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	A	4.960	0.178331	0.09443	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325	T;T;T;T;T	0.16897	2.39;2.39;2.31;2.37;2.31	4.48	0.768	0.18487	.	.	.	.	.	T	0.10165	0.0249	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B	0.19583	0.037;0.021;0.037;0.037;0.037	B;B;B;B;B	0.18871	0.012;0.023;0.012;0.012;0.012	T	0.41324	-0.9515	9	0.14252	T	0.57	-0.7737	6.2002	0.20571	0.6669:0.0:0.3331:0.0	.	575;575;575;575;575	F8W7A7;Q5BJE1-3;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;.;CR034_HUMAN	T	575	ENSP00000385591:I575T;ENSP00000372576:I575T;ENSP00000300227:I575T;ENSP00000385867:I575T;ENSP00000385234:I575T	ENSP00000300227:I575T	I	-	2	0	C18orf34	29058831	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.901000	0.28445	0.133000	0.18654	0.528000	0.53228	ATA		0.378	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		9	15	0	0	0	0.047766	0	9	15				
DCC	1630	broad.mit.edu	37	18	50278670	50278670	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr18:50278670G>C	ENST00000442544.2	+	2	954	c.338G>C	c.(337-339)gGa>gCa	p.G113A	DCC_ENST00000412726.1_5'UTR	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	113	Ig-like C2-type 1.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.G113A(2)|p.G113V(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CCAGATGAGGGACTTTACCAA	0.448																																							uc002lfe.1		NA																	3	Substitution - Missense(3)		lung(3)	skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17						c.(337-339)GGA>GCA		netrin receptor DCC precursor							144.0	133.0	137.0					18																	50278670		2203	4300	6503	SO:0001583	missense	1630				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane		g.chr18:50278670G>C	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.338G>C	18.37:g.50278670G>C	ENSP00000389140:p.Gly113Ala		Somatic				DCC_uc010xdr.1_5'UTR	p.G113A	NM_005215	NP_005206	WXS	Illumina HiSeq	Unspecified	P43146	DCC_HUMAN		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)	2	925	+		all_cancers(7;0.11)|all_epithelial(6;0.00126)	113			Extracellular (Potential).|Ig-like C2-type 1.			Missense_Mutation	SNP	ENST00000442544.2	37	c.338G>C	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.590475	0.46214	.	.	ENSG00000187323	ENST00000442544;ENST00000304775	T	0.10005	2.92	5.3	5.3	0.74995	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.40670	0.1126	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.45175	-0.9279	10	0.87932	D	0	.	17.7261	0.88365	0.0:0.0:1.0:0.0	.	113	P43146	DCC_HUMAN	A	113;46	ENSP00000389140:G113A	ENSP00000304146:G46A	G	+	2	0	DCC	48532668	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.457000	0.97630	2.471000	0.83476	0.655000	0.94253	GGA		0.448	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215		20	14	0	0	0	0.055883	0	20	14				
STK11	6794	broad.mit.edu	37	19	1220629	1220629	+	Missense_Mutation	SNP	C	C	T	rs397518442		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr19:1220629C>T	ENST00000326873.7	+	5	1820	c.647C>T	c.(646-648)tCc>tTc	p.S216F		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	216	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		S -> F (in sporadic cancer; somatic mutation; impairs heterotrimeric complex assembly with STRADA and CAB39).		activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.S216F(3)|p.?(2)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCCAGGGCTCCCCGGCTTTC	0.711		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		25	Whole gene deletion(20)|Substitution - Missense(3)|Unknown(2)	p.0?(19)|p.S216F(2)|p.?(2)|p.S216P(1)	cervix(15)|lung(6)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266						c.(646-648)TCC>TTC		serine/threonine protein kinase 11							12.0	17.0	15.0					19																	1220629		1952	4124	6076	SO:0001583	missense	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1220629C>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.647C>T	19.37:g.1220629C>T	ENSP00000324856:p.Ser216Phe	TSP Lung(3;<1E-08)	Somatic					p.S216F	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	5	1762	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	216		S -> F (in sporadic cancer; somatic mutation; impairs heterotrimeric complex assembly with STRADA and CAB39).	Protein kinase.		B2RBX7|E7EW76	Missense_Mutation	SNP	ENST00000326873.7	37	c.647C>T	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	C	35	5.592178	0.96590	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	D	0.84944	-1.92	5.56	5.56	0.83823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92371	0.7579	M	0.73753	2.245	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92857	0.6302	10	0.87932	D	0	-47.3338	18.5793	0.91165	0.0:1.0:0.0:0.0	.	216	Q15831	STK11_HUMAN	F	216	ENSP00000324856:S216F	ENSP00000324856:S216F	S	+	2	0	STK11	1171629	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	7.709000	0.84645	2.640000	0.89533	0.556000	0.70494	TCC		0.711	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		8	3	0	0	0	0.038147	0	8	3				
STK11	6794	broad.mit.edu	37	19	1220706	1220706	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr19:1220706G>T	ENST00000326873.7	+	5	1897	c.724G>T	c.(724-726)Ggg>Tgg	p.G242W		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	242	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(2)|p.G242W(1)|p.G242R(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGTCGGCTGGGGTCACCCT	0.706		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		24	Whole gene deletion(20)|Substitution - Missense(2)|Unknown(2)	p.0?(19)|p.?(2)|p.G242V(1)|p.G242R(1)	cervix(14)|lung(6)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CM011965	STK11	M		c.(724-726)GGG>TGG		serine/threonine protein kinase 11							21.0	28.0	26.0					19																	1220706		1999	4136	6135	SO:0001583	missense	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1220706G>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.724G>T	19.37:g.1220706G>T	ENSP00000324856:p.Gly242Trp	TSP Lung(3;<1E-08)	Somatic					p.G242W	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	5	1839	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	242			Protein kinase.		B2RBX7|E7EW76	Missense_Mutation	SNP	ENST00000326873.7	37	c.724G>T	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.798207	0.90538	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	D	0.97114	-4.25	5.6	5.6	0.85130	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99296	0.9754	H	0.99573	4.635	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98468	1.0599	10	0.87932	D	0	-58.9317	18.5988	0.91240	0.0:0.0:1.0:0.0	.	242	Q15831	STK11_HUMAN	W	242	ENSP00000324856:G242W	ENSP00000324856:G242W	G	+	1	0	STK11	1171706	1.000000	0.71417	0.991000	0.47740	0.617000	0.37484	9.729000	0.98795	2.644000	0.89710	0.561000	0.74099	GGG		0.706	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		19	10	1	0	5.35267e-07	0.043863	6.05189e-07	19	10				
SMARCA4	6597	broad.mit.edu	37	19	11135100	11135100	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr19:11135100G>C	ENST00000429416.3	+	22	3348	c.3067G>C	c.(3067-3069)Gag>Cag	p.E1023Q	SMARCA4_ENST00000358026.2_Missense_Mutation_p.E1023Q|SMARCA4_ENST00000590574.1_Missense_Mutation_p.E1023Q|SMARCA4_ENST00000344626.4_Missense_Mutation_p.E1023Q|SMARCA4_ENST00000541122.2_Missense_Mutation_p.E1023Q|SMARCA4_ENST00000444061.3_Missense_Mutation_p.E1023Q|SMARCA4_ENST00000450717.3_Missense_Mutation_p.E1023Q|SMARCA4_ENST00000589677.1_Missense_Mutation_p.E1023Q|SMARCA4_ENST00000413806.3_Missense_Mutation_p.E1023Q	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1023					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.E1023Q(4)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TGATGGCTCCGAGAAGGACAA	0.632			"""F, N, Mis"""		NSCLC																																		uc002mqf.3		NA		Rec	yes		19	19p13.2	6597	F|N|Mis	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""			E			NSCLC		5	Substitution - Missense(4)|Unknown(1)	p.?(1)	lung(5)	lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67						c.(3067-3069)GAG>CAG		SWI/SNF-related matrix-associated							65.0	54.0	58.0					19																	11135100		2203	4300	6503	SO:0001583	missense	6597	Rhabdoid_Predisposition_syndrome			chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	g.chr19:11135100G>C	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3067G>C	19.37:g.11135100G>C	ENSP00000395654:p.Glu1023Gln		Somatic				SMARCA4_uc010dxp.2_Missense_Mutation_p.E1023Q|SMARCA4_uc010dxo.2_Missense_Mutation_p.E1023Q|SMARCA4_uc002mqg.1_Missense_Mutation_p.E1023Q|SMARCA4_uc010dxq.2_Missense_Mutation_p.E1023Q|SMARCA4_uc010dxr.2_Missense_Mutation_p.E1023Q|SMARCA4_uc002mqj.3_Missense_Mutation_p.E1023Q|SMARCA4_uc010dxs.2_Missense_Mutation_p.E1023Q|SMARCA4_uc010dxt.1_Missense_Mutation_p.E243Q|SMARCA4_uc002mqh.3_Missense_Mutation_p.E146Q|SMARCA4_uc002mqi.1_Missense_Mutation_p.E226Q	p.E1023Q	NM_003072	NP_003063	WXS	Illumina HiSeq	Unspecified	P51532	SMCA4_HUMAN			21	3351	+		all_lung(6;0.0512)|Lung NSC(9;0.0568)	1023					B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	c.3067G>C	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401575	0.83120	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89	4.62	4.62	0.57501	SNF2-related (1);	0.000000	0.85682	D	0.000000	T	0.73682	0.3618	N	0.25485	0.75	0.53688	D	0.999977	P;P;P;P;P;B;P;P	0.52577	0.808;0.906;0.906;0.803;0.646;0.023;0.954;0.954	P;P;P;P;B;B;P;P	0.53722	0.548;0.665;0.665;0.693;0.348;0.039;0.733;0.733	T	0.78054	-0.2354	10	0.72032	D	0.01	-38.0999	16.3871	0.83514	0.0:0.0:1.0:0.0	.	1023;1023;1023;1023;1023;243;1023;1023	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	Q	1023;1023;1087;1023;1023;1023;1023;1023	ENSP00000395654:E1023Q;ENSP00000350720:E1023Q;ENSP00000343896:E1023Q;ENSP00000445036:E1023Q;ENSP00000392837:E1023Q;ENSP00000397783:E1023Q;ENSP00000414727:E1023Q	ENSP00000343896:E1023Q	E	+	1	0	SMARCA4	10996100	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	9.411000	0.97342	2.398000	0.81561	0.561000	0.74099	GAG		0.632	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		22	21	0	0	0	0.069288	0	22	21				
MAN2B1	4125	broad.mit.edu	37	19	12761005	12761005	+	Missense_Mutation	SNP	A	A	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr19:12761005A>C	ENST00000456935.2	-	17	2118	c.2078T>G	c.(2077-2079)tTc>tGc	p.F693C	MAN2B1_ENST00000221363.4_Missense_Mutation_p.F692C|CTD-2192J16.22_ENST00000597692.1_5'Flank	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	693					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.F693C(2)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCAAGCTGAGAAGTTCTGGTG	0.612																																							uc002mub.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(2)	6						c.(2077-2079)TTC>TGC		mannosidase, alpha, class 2B, member 1							130.0	110.0	117.0					19																	12761005		2203	4300	6503	SO:0001583	missense	4125				protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding	g.chr19:12761005A>C		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.2078T>G	19.37:g.12761005A>C	ENSP00000395473:p.Phe693Cys		Somatic				MAN2B1_uc010dyv.1_Missense_Mutation_p.F692C	p.F693C	NM_000528	NP_000519	WXS	Illumina HiSeq	Unspecified	O00754	MA2B1_HUMAN			17	2154	-			693					G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	ENST00000456935.2	37	c.2078T>G	CCDS32919.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.513643	0.85389	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	D;D	0.84800	-1.9;-1.9	4.91	4.91	0.64330	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.46442	D	0.000287	D	0.93510	0.7929	M	0.92649	3.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.94450	0.7666	10	0.62326	D	0.03	-22.6807	12.5412	0.56172	1.0:0.0:0.0:0.0	.	692;693	G5E928;O00754	.;MA2B1_HUMAN	C	693;632;692	ENSP00000395473:F693C;ENSP00000221363:F692C	ENSP00000221363:F692C	F	-	2	0	MAN2B1	12622005	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.388000	0.90170	2.073000	0.62155	0.454000	0.30748	TTC		0.612	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1			101	44	0	0	0	0.048971	0	101	44				
UNC13A	23025	broad.mit.edu	37	19	17746954	17746954	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr19:17746954C>T	ENST00000519716.2	-	26	3093	c.3094G>A	c.(3094-3096)Gaa>Aaa	p.E1032K	UNC13A_ENST00000551649.1_Missense_Mutation_p.E1032K|UNC13A_ENST00000552293.1_Missense_Mutation_p.E1032K|UNC13A_ENST00000252773.7_Missense_Mutation_p.E1032K|UNC13A_ENST00000428389.2_Missense_Mutation_p.E1120K|UNC13A_ENST00000550896.1_Missense_Mutation_p.E1030K	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1032					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.E1032K(1)|p.E1120K(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GGGAGAACTTCCCCCTTCTTG	0.498																																							uc002nhd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(3358-3360)GAA>AAA		unc-13 homolog A							62.0	59.0	60.0					19																	17746954		1916	4138	6054	SO:0001583	missense	23025				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr19:17746954C>T	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.3094G>A	19.37:g.17746954C>T	ENSP00000429562:p.Glu1032Lys		Somatic					p.E1120K	NM_001080421	NP_001073890	WXS	Illumina HiSeq	Unspecified	Q9UPW8	UN13A_HUMAN			26	3358	-			1032					E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	37	c.3358G>A	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014173	0.35511	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.35;-1.34;-1.46	3.34	3.34	0.38264	Calcium-dependent secretion activator (1);	0.236693	0.32655	U	0.005809	T	0.63593	0.2524	N	0.11427	0.14	0.38364	D	0.944681	B	0.17465	0.022	B	0.25987	0.065	T	0.59989	-0.7350	10	0.20046	T	0.44	-11.7517	12.1977	0.54307	0.0:1.0:0.0:0.0	.	1032	Q9UPW8	UN13A_HUMAN	K	1032;1120;1032;1032;1032;1030	ENSP00000429562:E1032K;ENSP00000400409:E1120K;ENSP00000252773:E1032K;ENSP00000447236:E1032K;ENSP00000447572:E1032K;ENSP00000446831:E1030K	ENSP00000252773:E1032K	E	-	1	0	UNC13A	17607954	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	4.616000	0.61197	1.702000	0.51228	0.305000	0.20034	GAA		0.498	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604		8	3	0	0	0	0.038147	0	8	3				
DLL3	10683	broad.mit.edu	37	19	39991296	39991296	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr19:39991296A>T	ENST00000205143.4	+	3	400	c.393A>T	c.(391-393)ttA>ttT	p.L131F	DLL3_ENST00000356433.5_Missense_Mutation_p.L131F	NM_016941.3	NP_058637.1	Q9NYJ7	DLL3_HUMAN	delta-like 3 (Drosophila)	131					compartment pattern specification (GO:0007386)|negative regulation of neurogenesis (GO:0050768)|Notch signaling pathway (GO:0007219)|paraxial mesoderm development (GO:0048339)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)	integral component of membrane (GO:0016021)	Notch binding (GO:0005112)	p.L131F(2)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)	19	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GAGAGGAGTTAGGAGACCAGA	0.517																																							uc002olx.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|breast(1)	3						c.(391-393)TTA>TTT		delta-like 3 protein isoform 1 precursor							141.0	134.0	137.0					19																	39991296		2203	4300	6503	SO:0001583	missense	10683				Notch signaling pathway|skeletal system development	integral to membrane	Notch binding	g.chr19:39991296A>T	AF241373	CCDS12537.1, CCDS12538.1	19q13.2	2008-05-14	2001-12-03			ENSG00000090932			2909	protein-coding gene	gene with protein product		602768	"""delta (Drosophila)-like 3"""			10364530, 10742114	Standard	NM_203486		Approved	SCDO1	uc002olx.2	Q9NYJ7		ENST00000205143.4:c.393A>T	19.37:g.39991296A>T	ENSP00000205143:p.Leu131Phe		Somatic				DLL3_uc010egq.2_Missense_Mutation_p.L131F|DLL3_uc002olw.2_Missense_Mutation_p.L131F	p.L131F	NM_016941	NP_058637	WXS	Illumina HiSeq	Unspecified	Q9NYJ7	DLL3_HUMAN	Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)		3	451	+	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		131			Extracellular (Potential).		E9PFG2|Q8NBS4	Missense_Mutation	SNP	ENST00000205143.4	37	c.393A>T	CCDS12538.1	.	.	.	.	.	.	.	.	.	.	A	14.87	2.665774	0.47677	.	.	ENSG00000090932	ENST00000356433;ENST00000205143	D;D	0.89123	-2.41;-2.47	4.3	0.883	0.19177	.	1.006700	0.08013	N	0.990667	D	0.90528	0.7032	L	0.51422	1.61	0.28300	N	0.923134	D;D;D	0.69078	0.989;0.989;0.997	P;P;D	0.63597	0.648;0.648;0.916	T	0.79867	-0.1622	9	.	.	.	.	6.4171	0.21721	0.5946:0.0:0.4054:0.0	.	131;131;131	Q8NBS4;Q9NYJ7;E9PFG2	.;DLL3_HUMAN;.	F	131	ENSP00000348810:L131F;ENSP00000205143:L131F	.	L	+	3	2	DLL3	44683136	.	.	0.781000	0.31783	0.994000	0.84299	.	.	0.293000	0.22520	0.459000	0.35465	TTA		0.517	DLL3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464958.1			27	14	0	0	0	0.108266	0	27	14				
PHLDB3	653583	broad.mit.edu	37	19	44006275	44006275	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr19:44006275T>A	ENST00000292140.5	-	3	734	c.374A>T	c.(373-375)cAg>cTg	p.Q125L	PHLDB3_ENST00000599242.1_Missense_Mutation_p.Q125L	NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	125							enzyme binding (GO:0019899)	p.Q125L(2)		breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				CTCCTTCCTCTGGCGCTGTAG	0.652																																							uc002own.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(373-375)CAG>CTG		pleckstrin homology-like domain, family B,							26.0	28.0	27.0					19																	44006275		2202	4295	6497	SO:0001583	missense	653583							g.chr19:44006275T>A		CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.374A>T	19.37:g.44006275T>A	ENSP00000292140:p.Gln125Leu		Somatic				PHLDB3_uc002owo.2_Missense_Mutation_p.Q125L	p.Q125L	NM_198850	NP_942147	WXS	Illumina HiSeq	Unspecified	Q6NSJ2	PHLB3_HUMAN			3	633	-		Prostate(69;0.0153)	125			Potential.		Q8N7Z4	Missense_Mutation	SNP	ENST00000292140.5	37	c.374A>T	CCDS12621.2	.	.	.	.	.	.	.	.	.	.	T	17.19	3.325380	0.60743	.	.	ENSG00000176531	ENST00000292140	T	0.57273	0.41	4.11	4.11	0.48088	.	0.430804	0.20086	N	0.099547	T	0.68769	0.3037	M	0.75615	2.305	0.28178	N	0.928291	D;D	0.58268	0.981;0.982	D;P	0.70487	0.969;0.744	T	0.63060	-0.6721	10	0.87932	D	0	.	9.8353	0.40966	0.0:0.0:0.0:1.0	.	125;125	Q6NSJ2-2;Q6NSJ2	.;PHLB3_HUMAN	L	125	ENSP00000292140:Q125L	ENSP00000292140:Q125L	Q	-	2	0	PHLDB3	48698115	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	3.738000	0.55067	1.658000	0.50742	0.254000	0.18369	CAG		0.652	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319643.2			3	4	0	0	0	0.004672	0	3	4				
PEG3	5178	broad.mit.edu	37	19	57327504	57327504	+	Missense_Mutation	SNP	T	T	C	rs574516590	byFrequency	TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr19:57327504T>C	ENST00000326441.9	-	10	2669	c.2306A>G	c.(2305-2307)tAt>tGt	p.Y769C	ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.Y769C|PEG3_ENST00000593695.1_Missense_Mutation_p.Y643C|PEG3_ENST00000598410.1_Missense_Mutation_p.Y645C|ZIM2_ENST00000601070.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	769					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.Y769C(4)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TTTTGCCTCATAGACATTTTC	0.418													T|||	3	0.000599042	0.0	0.0	5008	,	,		20989	0.0		0.0	False		,,,				2504	0.0031						uc002qnu.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(2305-2307)TAT>TGT		paternally expressed 3 isoform 1							166.0	165.0	165.0					19																	57327504		2203	4300	6503	SO:0001583	missense	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57327504T>C	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2306A>G	19.37:g.57327504T>C	ENSP00000326581:p.Tyr769Cys		Somatic				ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.Y740C|PEG3_uc002qnv.2_Missense_Mutation_p.Y769C|PEG3_uc002qnw.2_Missense_Mutation_p.Y645C|PEG3_uc002qnx.2_Missense_Mutation_p.Y643C|PEG3_uc010etr.2_Missense_Mutation_p.Y769C	p.Y769C	NM_001146186	NP_001139658	WXS	Illumina HiSeq	Unspecified	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	2657	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	769					A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	c.2306A>G	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	T	7.023	0.559062	0.13436	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02682	4.2;4.2	3.96	-7.92	0.01160	.	1.344690	0.05035	N	0.475245	T	0.02888	0.0086	L	0.56396	1.775	.	.	.	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.35699	-0.9778	9	0.46703	T	0.11	1.0972	0.9237	0.01320	0.2745:0.3221:0.1925:0.2109	.	645;769;704	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	C	769	ENSP00000326581:Y769C;ENSP00000403051:Y769C	ENSP00000326581:Y769C	Y	-	2	0	ZIM2	62019316	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-2.568000	0.00915	-3.189000	0.00220	-0.361000	0.07541	TAT		0.418	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			105	43	0	0	0	0.048971	0	105	43				
ZNF530	348327	broad.mit.edu	37	19	58111475	58111475	+	Start_Codon_SNP	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr19:58111475G>T	ENST00000332854.6	+	1	223	c.3G>T	c.(1-3)atG>atT	p.M1I	ZNF530_ENST00000597864.1_5'UTR	NM_020880.3	NP_065931.3	Q6P9A1	ZN530_HUMAN	zinc finger protein 530	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M1I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(6)|skin(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGAGTCCGATGGCGGCGGCAC	0.716																																							uc002qpk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1-3)ATG>ATT		zinc finger protein 530							5.0	7.0	6.0					19																	58111475		2105	4179	6284	SO:0001582	initiator_codon_variant	348327				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58111475G>T	AK096831	CCDS12955.1	19q13.43	2013-01-08				ENSG00000183647		"""Zinc fingers, C2H2-type"", ""-"""	29297	protein-coding gene	gene with protein product						10819331	Standard	NM_020880		Approved	KIAA1508	uc002qpk.2	Q6P9A1		ENST00000332854.6:c.3G>T	19.37:g.58111475G>T	ENSP00000332861:p.Met1Ile		Somatic				ZNF547_uc002qpm.3_Intron|ZNF530_uc002qpl.2_RNA	p.M1I	NM_020880	NP_065931	WXS	Illumina HiSeq	Unspecified	Q6P9A1	ZN530_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	1	223	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)	1					O43340|Q9P220	Missense_Mutation	SNP	ENST00000332854.6	37	c.3G>T	CCDS12955.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923509	0.33908	.	.	ENSG00000183647	ENST00000332854	T	0.05649	3.41	1.06	1.06	0.20224	.	.	.	.	.	T	0.04998	0.0134	.	.	.	0.80722	D	1	B	0.21225	0.053	B	0.15052	0.012	T	0.31447	-0.9943	8	0.87932	D	0	.	4.3161	0.10993	0.0:0.0:0.6088:0.3912	.	1	Q6P9A1	ZN530_HUMAN	I	1	ENSP00000332861:M1I	ENSP00000332861:M1I	M	+	3	0	ZNF530	62803287	0.043000	0.20138	0.012000	0.15200	0.071000	0.16799	2.896000	0.48656	0.888000	0.36160	0.313000	0.20887	ATG		0.716	ZNF530-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466797.1	NM_020880	Missense_Mutation	3	3	1	0	0.004672	0.004672	0.00482581	3	3				
SLC4A5	57835	broad.mit.edu	37	2	74477490	74477490	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr2:74477490C>A	ENST00000377634.4	-	17	2032	c.1633G>T	c.(1633-1635)Gat>Tat	p.D545Y	RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.D545Y|SLC4A5_ENST00000346834.4_Missense_Mutation_p.D545Y|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000423644.1_Missense_Mutation_p.D545Y|SLC4A5_ENST00000357822.5_Missense_Mutation_p.D545Y|SLC4A5_ENST00000359484.4_Missense_Mutation_p.D481Y|SLC4A5_ENST00000394019.2_Missense_Mutation_p.D545Y|SLC4A5_ENST00000358683.4_Missense_Mutation_p.D481Y					solute carrier family 4 (sodium bicarbonate cotransporter), member 5									p.D545Y(4)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TCGGTGGCATCCCCCAGAAGC	0.527											OREG0014716	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002sko.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						c.(1633-1635)GAT>TAT		sodium bicarbonate transporter 4 isoform a							98.0	95.0	96.0					2																	74477490		2203	4300	6503	SO:0001583	missense	57835					apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity	g.chr2:74477490C>A	AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.1633G>T	2.37:g.74477490C>A	ENSP00000366861:p.Asp545Tyr		Somatic	OREG0014716	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1153	SLC4A5_uc002skl.2_RNA|SLC4A5_uc002skn.2_Missense_Mutation_p.D545Y|SLC4A5_uc010ffc.1_Missense_Mutation_p.D545Y|SLC4A5_uc002skp.1_Missense_Mutation_p.D481Y|SLC4A5_uc002sks.1_Missense_Mutation_p.D545Y	p.D545Y	NM_021196	NP_067019	WXS	Illumina HiSeq	Unspecified	Q9BY07	S4A5_HUMAN			12	1635	-			545			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000377634.4	37	c.1633G>T	CCDS1936.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811903	0.90707	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000423644;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249	T;T;T;T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	5.65	5.65	0.86999	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92166	0.7516	M	0.93106	3.38	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.97110	0.99;1.0;1.0;1.0;0.993	D	0.93260	0.6642	10	0.87932	D	0	.	17.2626	0.87075	0.0:1.0:0.0:0.0	.	545;545;481;545;545	Q9BY07-4;E7EQT3;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;.;S4A5_HUMAN;.	Y	545;545;545;481;545;481;545;545;545;545	ENSP00000377587:D545Y;ENSP00000251768:D545Y;ENSP00000352461:D481Y;ENSP00000395804:D545Y;ENSP00000351513:D481Y;ENSP00000350475:D545Y;ENSP00000366859:D545Y;ENSP00000366861:D545Y;ENSP00000405678:D545Y	ENSP00000251768:D545Y	D	-	1	0	SLC4A5	74330998	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.651000	0.83577	2.941000	0.99782	0.655000	0.94253	GAT		0.527	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3			30	50	1	0	6.00712e-18	0.050027	7.7721e-18	30	50				
MRPL19	9801	broad.mit.edu	37	2	75881899	75881899	+	Silent	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr2:75881899C>T	ENST00000393909.2	+	5	538	c.513C>T	c.(511-513)gtC>gtT	p.V171V	MRPL19_ENST00000409374.1_Silent_p.V171V|MRPL19_ENST00000358788.6_Intron	NM_014763.3	NP_055578.2	P49406	RM19_HUMAN	mitochondrial ribosomal protein L19	171					translation (GO:0006412)	mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)	p.V171V(2)		kidney(1)|large_intestine(1)|lung(6)	8						ATCCTCGGGTCCAGGAGATTC	0.378																																							uc002snl.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(511-513)GTC>GTT		mitochondrial ribosomal protein L19 precursor							124.0	117.0	119.0					2																	75881899		1854	4088	5942	SO:0001819	synonymous_variant	9801				translation	mitochondrion|nuclear membrane|ribosome	structural constituent of ribosome	g.chr2:75881899C>T	AB051621	CCDS1960.2	2p11.1-q11.2	2012-09-13			ENSG00000115364	ENSG00000115364		"""Mitochondrial ribosomal proteins / large subunits"""	14052	protein-coding gene	gene with protein product	"""39S ribosomal protein L19"""	611832				11543634, 17309879	Standard	XM_006712155		Approved	MRP-L15, RPML15, KIAA0104, RLX1	uc002snl.3	P49406	OTTHUMG00000129990	ENST00000393909.2:c.513C>T	2.37:g.75881899C>T			Somatic				MRPL19_uc002snm.1_Silent_p.V171V	p.V171V	NM_014763	NP_055578	WXS	Illumina HiSeq	Unspecified	P49406	RM19_HUMAN			5	538	+			171					Q53TX9|Q96Q52	Silent	SNP	ENST00000393909.2	37	c.513C>T	CCDS1960.2																																																																																				0.378	MRPL19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252256.1	NM_014763		7	41	0	0	0	0.02938	0	7	41				
LRP1B	53353	broad.mit.edu	37	2	141032086	141032086	+	Missense_Mutation	SNP	C	C	A	rs200243152		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr2:141032086C>A	ENST00000389484.3	-	85	14020	c.13049G>T	c.(13048-13050)cGc>cTc	p.R4350L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4350	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.R4350L(2)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCCTTCATAGCGCGTTGGACA	0.423										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(13048-13050)CGC>CTC		low density lipoprotein-related protein 1B							179.0	143.0	156.0					2																	141032086		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141032086C>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13049G>T	2.37:g.141032086C>A	ENSP00000374135:p.Arg4350Leu	TSP Lung(27;0.18)	Somatic					p.R4350L	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	85	14021	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4350			Extracellular (Potential).|EGF-like 13.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.13049G>T	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.949621|3.949621	0.73787|0.73787	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000437977;ENST00000442974|ENST00000389484;ENST00000544579	.|D	.|0.89939	.|-2.59	5.36|5.36	5.36|5.36	0.76844|0.76844	.|Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	.|0.000000	.|0.64402	.|U	.|0.000001	D|D	0.92126|0.92126	0.7504|0.7504	L|L	0.51422|0.51422	1.61|1.61	0.50632|0.50632	D|D	0.999884|0.999884	.|D	.|0.63880	.|0.993	.|D	.|0.74023	.|0.982	D|D	0.89621|0.89621	0.3848|0.3848	5|10	.|0.21540	.|T	.|0.41	.|.	17.2537|17.2537	0.87049|0.87049	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|4350	.|Q9NZR2	.|LRP1B_HUMAN	S|L	582;82|4350;4288	.|ENSP00000374135:R4350L	.|ENSP00000374135:R4350L	A|R	-|-	1|2	0|0	LRP1B|LRP1B	140748556|140748556	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.971000|4.971000	0.63749|0.63749	2.499000|2.499000	0.84300|0.84300	0.655000|0.655000	0.94253|0.94253	GCT|CGC		0.423	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		14	23	1	0	4.14922e-12	0.028581	5.03118e-12	14	23				
LRP1B	53353	broad.mit.edu	37	2	141122289	141122289	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr2:141122289C>T	ENST00000389484.3	-	72	12043	c.11072G>A	c.(11071-11073)tGg>tAg	p.W3691*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3691	LDL-receptor class A 30. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.W3691*(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATCACACACCCAGAAATGTAG	0.383										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(11071-11073)TGG>TAG		low density lipoprotein-related protein 1B							127.0	127.0	127.0					2																	141122289		2203	4299	6502	SO:0001587	stop_gained	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141122289C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.11072G>A	2.37:g.141122289C>T	ENSP00000374135:p.Trp3691*	TSP Lung(27;0.18)	Somatic					p.W3691*	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	72	12044	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3691			Extracellular (Potential).|LDL-receptor class A 30.		Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	ENST00000389484.3	37	c.11072G>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	56	27.049806	0.99970	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9311	0.97118	0.0:1.0:0.0:0.0	.	.	.	.	X	3691;3629	.	ENSP00000374135:W3691X	W	-	2	0	LRP1B	140838759	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.407000	0.80029	2.782000	0.95742	0.655000	0.94253	TGG		0.383	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		3	23	0	0	0	0.004672	0	3	23				
LRP1B	53353	broad.mit.edu	37	2	141773418	141773419	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr2:141773418_141773419GG>TT	ENST00000389484.3	-	13	3007_3008	c.2036_2037CC>AA	c.(2035-2037)gCC>gAA	p.A679E		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	679					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.A679E(2)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATCCATCCAGGCCTTCTCAAT	0.411										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(2035-2037)GCC>GAA		low density lipoprotein-related protein 1B																																				SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141773418_141773419GG>TT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2036_2037delinsTT	2.37:g.141773418_141773419delinsTT	ENSP00000374135:p.Ala679Glu	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Intron	p.A679E	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	13	3008_3009	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	679			Extracellular (Potential).|LDL-receptor class B 7.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	DNP	ENST00000389484.3	37	c.2036_2037CC>AA	CCDS2182.1																																																																																				0.411	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		23	49	0	0	0	0.004672	0	23	49				
LRP1B	53353	broad.mit.edu	37	2	141819657	141819658	+	Missense_Mutation	DNP	TG	TG	AT			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr2:141819657_141819658TG>AT	ENST00000389484.3	-	8	2169_2170	c.1198_1199CA>AT	c.(1198-1200)CAa>ATa	p.Q400I		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	400					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.Q400I(2)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATTTTTTCCTTGATAGTCCACT	0.391										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(1198-1200)CAA>ATA		low density lipoprotein-related protein 1B																																				SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141819657_141819658TG>AT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1198_1199delinsAT	2.37:g.141819657_141819658delinsAT	ENSP00000374135:p.Gln400Ile	TSP Lung(27;0.18)	Somatic				LRP1B_uc010fnl.1_Intron	p.Q400I	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	8	2170_2171	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	400			Extracellular (Potential).|LDL-receptor class B 4.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	DNP	ENST00000389484.3	37	c.1198_1199CA>AT	CCDS2182.1																																																																																				0.391	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		16	39	0	0	0	0.004672	0	16	39				
SCN3A	6328	broad.mit.edu	37	2	166010962	166010962	+	Splice_Site	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr2:166010962C>T	ENST00000360093.3	-	11	1871	c.1380G>A	c.(1378-1380)caG>caA	p.Q460Q	SCN3A_ENST00000409101.3_Splice_Site_p.Q460Q|SCN3A_ENST00000283254.7_Splice_Site_p.Q460Q	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	460					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.Q460Q(4)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CACTCAGTACCTGAGCTTCTT	0.368																																							uc002ucx.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(1378-1380)CAG>CAA		sodium channel, voltage-gated, type III, alpha	Lamotrigine(DB00555)						97.0	93.0	94.0					2																	166010962		2203	4299	6502	SO:0001630	splice_region_variant	6328					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166010962C>T	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1380+1G>A	2.37:g.166010962C>T			Somatic				SCN3A_uc002ucy.2_Silent_p.Q460Q|SCN3A_uc002ucz.2_Silent_p.Q460Q|SCN3A_uc002uda.1_Silent_p.Q329Q|SCN3A_uc002udb.1_Silent_p.Q329Q	p.Q460Q	NM_006922	NP_008853	WXS	Illumina HiSeq	Unspecified	Q9NY46	SCN3A_HUMAN			11	1872	-			460					Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37	c.1380G>A																																																																																					0.368	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	Silent	6	29	0	0	0	0.021553	0	6	29				
TTN	7273	broad.mit.edu	37	2	179600341	179600341	+	Silent	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr2:179600341T>A	ENST00000591111.1	-	48	14105	c.13881A>T	c.(13879-13881)acA>acT	p.T4627T	TTN_ENST00000589042.1_Silent_p.T4944T|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Silent_p.T3700T|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12379	Ig-like 26.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T3700T(2)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAATCTCAAGTGTTGCTATTT	0.433																																							uc010zfg.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(11098-11100)ACA>ACT		titin isoform N2-A							67.0	65.0	66.0					2																	179600341		1839	4082	5921	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179600341T>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.13881A>T	2.37:g.179600341T>A			Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.T361T	p.T3700T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		47	11324	-			4627					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.11100A>T																																																																																					0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		12	20	0	0	0	0.080935	0	12	20				
CERKL	375298	broad.mit.edu	37	2	182521630	182521630	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr2:182521630G>T	ENST00000339098.5	-	1	103	c.104C>A	c.(103-105)tCc>tAc	p.S35Y	CERKL_ENST00000409440.3_Missense_Mutation_p.S35Y|CERKL_ENST00000410087.3_Missense_Mutation_p.S35Y|CERKL_ENST00000374970.2_Missense_Mutation_p.S35Y|CERKL_ENST00000374969.2_Missense_Mutation_p.S35Y|CERKL_ENST00000479558.1_Intron			Q49MI3	CERKL_HUMAN	ceramide kinase-like	35					negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.S35Y(4)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CTGCTGCGGGGACGTTAACAG	0.711																																							uc002unx.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)|kidney(1)|skin(1)	4						c.(103-105)TCC>TAC		ceramide kinase-like isoform b							18.0	23.0	21.0					2																	182521630		2195	4283	6478	SO:0001583	missense	375298				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity	g.chr2:182521630G>T	BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.104C>A	2.37:g.182521630G>T	ENSP00000341159:p.Ser35Tyr		Somatic				CERKL_uc002uny.2_Missense_Mutation_p.S35Y|CERKL_uc010zfm.1_Missense_Mutation_p.S35Y|CERKL_uc002unz.2_5'UTR|CERKL_uc002uoa.2_Missense_Mutation_p.S35Y|CERKL_uc002uob.2_5'UTR|CERKL_uc002uoc.2_Missense_Mutation_p.S35Y|CERKL_uc010frk.2_RNA|CERKL_uc002uod.1_Intron|CERKL_uc002uoe.2_Missense_Mutation_p.S35Y	p.S35Y	NM_001030311	NP_001025482	WXS	Illumina HiSeq	Unspecified	Q49MI3	CERKL_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.088)		1	205	-			35					B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	ENST00000339098.5	37	c.104C>A	CCDS42789.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.183041	0.38511	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000374969;ENST00000339098;ENST00000374970	T;T;T;T;T	0.33865	2.11;2.39;1.39;2.4;1.39	4.42	3.54	0.40534	.	4.449170	0.00575	N	0.000318	T	0.27594	0.0678	N	0.08118	0	0.09310	N	1	P;P;P;P;P	0.42785	0.79;0.729;0.785;0.785;0.79	B;B;B;B;B	0.41946	0.143;0.371;0.367;0.189;0.276	T	0.38373	-0.9664	10	0.66056	D	0.02	.	9.6811	0.40070	0.1001:0.0:0.8999:0.0	.	35;35;35;35;35	B4DEY1;Q49MI3-4;Q49MI3-3;Q49MI3-2;Q49MI3	.;.;.;.;CERKL_HUMAN	Y	35	ENSP00000386725:S35Y;ENSP00000387080:S35Y;ENSP00000364108:S35Y;ENSP00000341159:S35Y;ENSP00000364109:S35Y	ENSP00000341159:S35Y	S	-	2	0	CERKL	182229875	0.000000	0.05858	0.002000	0.10522	0.032000	0.12392	0.299000	0.19138	1.092000	0.41356	0.555000	0.69702	TCC		0.711	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334811.1			10	30	1	0	8.34094e-07	0.049695	9.38823e-07	10	30				
CALCRL	10203	broad.mit.edu	37	2	188216867	188216867	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr2:188216867T>C	ENST00000409998.1	-	14	1883	c.1102A>G	c.(1102-1104)Atc>Gtc	p.I368V	CALCRL_ENST00000392370.3_Missense_Mutation_p.I368V|CALCRL_ENST00000410068.1_Missense_Mutation_p.I368V|AC007319.1_ENST00000412276.1_RNA|AC007319.1_ENST00000453517.1_RNA			Q16602	CALRL_HUMAN	calcitonin receptor-like	368					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)	p.I368V(2)		endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			ATGTGCATGATGTAGTCATAT	0.413																																							uc002upv.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(1)	4						c.(1102-1104)ATC>GTC		calcitonin receptor-like precursor							107.0	94.0	98.0					2																	188216867		2203	4299	6502	SO:0001583	missense	10203					integral to plasma membrane		g.chr2:188216867T>C	U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.1102A>G	2.37:g.188216867T>C	ENSP00000386972:p.Ile368Val		Somatic				CALCRL_uc010frt.2_Missense_Mutation_p.I368V	p.I368V	NM_005795	NP_005786	WXS	Illumina HiSeq	Unspecified	Q16602	CALRL_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)		13	1650	-			368			Helical; Name=7; (Potential).		A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	ENST00000409998.1	37	c.1102A>G	CCDS2293.1	.	.	.	.	.	.	.	.	.	.	T	8.561	0.877823	0.17395	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	T;T;T	0.37058	1.22;1.22;1.22	5.63	1.93	0.25924	GPCR, family 2-like (1);	0.212121	0.32301	N	0.006299	T	0.15219	0.0367	N	0.17312	0.475	0.32977	D	0.523187	B	0.02656	0.0	B	0.11329	0.006	T	0.35375	-0.9791	10	0.02654	T	1	.	4.7062	0.12851	0.0:0.3391:0.1639:0.4969	.	368	Q16602	CALRL_HUMAN	V	368	ENSP00000376177:I368V;ENSP00000386972:I368V;ENSP00000387190:I368V	ENSP00000376177:I368V	I	-	1	0	CALCRL	187925112	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	1.537000	0.36083	0.084000	0.17077	-1.136000	0.01936	ATC		0.413	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795		5	14	0	0	0	0.014758	0	5	14				
RSPO4	343637	broad.mit.edu	37	20	947922	947922	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr20:947922C>T	ENST00000217260.4	-	3	400	c.304G>A	c.(304-306)Gac>Aac	p.D102N	RSPO4_ENST00000400634.2_Missense_Mutation_p.D102N	NM_001029871.3	NP_001025042.2	Q2I0M5	RSPO4_HUMAN	R-spondin 4	102					Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	heparin binding (GO:0008201)	p.D102N(2)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						ATGCAGAAGTCCTGGCTGAAG	0.602																																							uc002wej.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(304-306)GAC>AAC		R-spondin family, member 4 isoform 1 precursor							83.0	83.0	83.0					20																	947922		1978	4169	6147	SO:0001583	missense	343637				Wnt receptor signaling pathway	extracellular region	heparin binding	g.chr20:947922C>T	AK122609	CCDS42845.1, CCDS42846.1	20p13	2014-01-30	2011-06-29	2005-08-08	ENSG00000101282	ENSG00000101282		"""Endogenous ligands"""	16175	protein-coding gene	gene with protein product		610573	"""chromosome 20 open reading frame 182"", ""R-spondin family, member 4"""	C20orf182		15469841	Standard	NM_001029871		Approved	dJ824F16.3	uc002wej.3	Q2I0M5	OTTHUMG00000031651	ENST00000217260.4:c.304G>A	20.37:g.947922C>T	ENSP00000217260:p.Asp102Asn		Somatic				RSPO4_uc002wek.2_Missense_Mutation_p.D102N	p.D102N	NM_001029871	NP_001025042	WXS	Illumina HiSeq	Unspecified	Q2I0M5	RSPO4_HUMAN			3	401	-			102			FU.		A2A2I6|Q9UGB2	Missense_Mutation	SNP	ENST00000217260.4	37	c.304G>A	CCDS42846.1	.	.	.	.	.	.	.	.	.	.	C	5.894	0.349000	0.11182	.	.	ENSG00000101282	ENST00000217260;ENST00000400634	T;T	0.70516	-0.49;-0.49	5.34	4.4	0.53042	Growth factor, receptor (1);	0.000000	0.64402	D	0.000001	T	0.69124	0.3076	N	0.22421	0.69	0.40607	D	0.981637	P;D	0.89917	0.873;1.0	B;D	0.87578	0.319;0.998	T	0.65446	-0.6166	10	0.02654	T	1	-19.1198	12.7835	0.57491	0.0:0.9204:0.0:0.0796	.	102;102	Q2I0M5-2;Q2I0M5	.;RSPO4_HUMAN	N	102	ENSP00000217260:D102N;ENSP00000383475:D102N	ENSP00000217260:D102N	D	-	1	0	RSPO4	895922	1.000000	0.71417	0.999000	0.59377	0.166000	0.22503	3.596000	0.54024	1.259000	0.44117	-0.266000	0.10368	GAC		0.602	RSPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077492.3	XM_297816		33	94	0	0	0	0.080422	0	33	94				
SLX4IP	128710	broad.mit.edu	37	20	10603806	10603806	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr20:10603806G>T	ENST00000334534.5	+	8	1186	c.1006G>T	c.(1006-1008)Gct>Tct	p.A336S		NM_001009608.1	NP_001009608.1	Q5VYV7	SLX4I_HUMAN	SLX4 interacting protein	336								p.A336S(2)									GGTTTTGCCAGCTTCAGAGTT	0.443																																							uc010zre.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1006-1008)GCT>TCT		hypothetical protein LOC128710							68.0	79.0	75.0					20																	10603806		2203	4300	6503	SO:0001583	missense	128710						protein binding	g.chr20:10603806G>T	AL035456	CCDS33439.1	20p12	2012-10-30	2012-10-30	2012-10-30	ENSG00000149346	ENSG00000149346			16225	protein-coding gene	gene with protein product		615958	"""chromosome 20 open reading frame 94"""	C20orf94		19596235	Standard	XM_005260664		Approved	dJ1099D15.3	uc010zre.2	Q5VYV7	OTTHUMG00000031873	ENST00000334534.5:c.1006G>T	20.37:g.10603806G>T	ENSP00000335557:p.Ala336Ser		Somatic					p.A336S	NM_001009608	NP_001009608	WXS	Illumina HiSeq	Unspecified	Q5VYV7	CT094_HUMAN			8	1186	+			336					Q05CG2|Q05CT9	Missense_Mutation	SNP	ENST00000334534.5	37	c.1006G>T	CCDS33439.1	.	.	.	.	.	.	.	.	.	.	G	8.025	0.760509	0.15914	.	.	ENSG00000149346	ENST00000334534	T	0.46451	0.87	6.08	-8.38	0.00973	.	1.197610	0.05865	N	0.623708	T	0.32912	0.0845	L	0.47716	1.5	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.26538	-1.0100	10	0.33141	T	0.24	3.2298	12.7814	0.57479	0.1669:0.0:0.6278:0.2053	.	336	Q5VYV7	CT094_HUMAN	S	336	ENSP00000335557:A336S	ENSP00000335557:A336S	A	+	1	0	C20orf94	10551806	0.002000	0.14202	0.000000	0.03702	0.343000	0.28985	-0.385000	0.07379	-1.557000	0.01692	-0.806000	0.03193	GCT		0.443	SLX4IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078000.3	NM_001009608		37	61	1	0	6.90743e-12	0.064281	8.29552e-12	37	61				
SEC23B	10483	broad.mit.edu	37	20	18523047	18523047	+	Splice_Site	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr20:18523047G>A	ENST00000336714.3	+	13	1943		c.e13+1		SEC23B_ENST00000377475.3_Splice_Site|SEC23B_ENST00000377465.1_Splice_Site|SEC23B_ENST00000262544.2_Splice_Site	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)						ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.?(2)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						TCGCCCGAAAGTAAGCAGCCC	0.488																																							uc002wqz.1		NA																	2	Unknown(2)		lung(2)	ovary(1)	1						c.e13+1		Sec23 homolog B							119.0	107.0	111.0					20																	18523047		2203	4300	6503	SO:0001630	splice_region_variant	10483				ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding	g.chr20:18523047G>A	X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.1511+1G>A	20.37:g.18523047G>A			Somatic				SEC23B_uc002wra.1_Splice_Site_p.N504_splice|SEC23B_uc002wrb.1_Splice_Site_p.N504_splice|SEC23B_uc010zsb.1_Splice_Site_p.N486_splice|SEC23B_uc002wrc.1_Splice_Site_p.N504_splice	p.N504_splice	NM_006363	NP_006354	WXS	Illumina HiSeq	Unspecified	Q15437	SC23B_HUMAN			13	1954	+								D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Splice_Site	SNP	ENST00000336714.3	37	c.1511_splice	CCDS13137.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236451	0.79800	.	.	ENSG00000101310	ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465;ENST00000422877	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1113	0.86675	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEC23B	18471047	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.657000	0.98554	2.520000	0.84964	0.655000	0.94253	.		0.488	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5		Intron	100	168	0	0	0	0.048971	0	100	168				
HM13	81502	broad.mit.edu	37	20	30136919	30136919	+	Splice_Site	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr20:30136919T>C	ENST00000340852.5	+	5	664		c.e5+2		HM13_ENST00000335574.5_Splice_Site|HM13_ENST00000398174.3_Splice_Site|HM13_ENST00000492709.1_Splice_Site|HM13_ENST00000376127.3_Splice_Site	NM_030789.2	NP_110416.1	Q8TCT9	HM13_HUMAN	histocompatibility (minor) 13						membrane protein proteolysis (GO:0033619)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			CTGAGGAAGGTGAGTAGTCAG	0.572																																							uc002wwe.2		NA																	0				breast(1)	1						c.e5+2		minor histocompatibility antigen 13 isoform 1							228.0	219.0	222.0					20																	30136919		2203	4300	6503	SO:0001630	splice_region_variant	81502				membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding	g.chr20:30136919T>C	AL110115	CCDS13182.1, CCDS13183.1, CCDS42861.1	20q11.21	2012-02-21			ENSG00000101294	ENSG00000101294			16435	protein-coding gene	gene with protein product	"""signal peptide peptidase beta"", ""presenilin-like protein 3"", ""intramembrane protease"", ""signal peptide peptidase like 1"""	607106				12077416, 14704149	Standard	NM_030789		Approved	H13, dJ324O17.1, SPP, PSL3, IMP1, IMPAS, PSENL3, SPPL1	uc002wwc.3	Q8TCT9	OTTHUMG00000032175	ENST00000340852.5:c.540+2T>C	20.37:g.30136919T>C			Somatic				HM13_uc002wwc.2_Splice_Site_p.K180_splice|HM13_uc002wwd.2_Splice_Site_p.K180_splice|HM13_uc002wwf.2_Splice_Site_p.K56_splice|HM13_uc010gdu.2_Splice_Site_p.K56_splice	p.K180_splice	NM_030789	NP_110416	WXS	Illumina HiSeq	Unspecified	Q8TCT9	HM13_HUMAN	all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)		5	654	+	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)							B2RAY5|E1P5L3|Q15K36|Q540H8|Q5JWP2|Q5JWP3|Q5JWP4|Q5JWP5|Q7Z4F2|Q86Y35|Q95H87|Q9H110|Q9H111	Splice_Site	SNP	ENST00000340852.5	37	c.540_splice	CCDS13182.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.442182	0.63067	.	.	ENSG00000101294	ENST00000335574;ENST00000340852;ENST00000398174;ENST00000376127;ENST00000344042	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5616	0.56283	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HM13	29600580	1.000000	0.71417	0.922000	0.36590	0.890000	0.51754	7.486000	0.81215	2.146000	0.66826	0.533000	0.62120	.		0.572	HM13-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078527.2	NM_178580	Intron	15	415	0	0	0	0.024245	0	15	415				
PTPRT	11122	broad.mit.edu	37	20	40980917	40980917	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr20:40980917G>T	ENST00000373187.1	-	10	1568	c.1569C>A	c.(1567-1569)taC>taA	p.Y523*	PTPRT_ENST00000356100.2_Nonsense_Mutation_p.Y523*|PTPRT_ENST00000373201.1_Nonsense_Mutation_p.Y523*|PTPRT_ENST00000373198.4_Nonsense_Mutation_p.Y523*|PTPRT_ENST00000373193.3_Nonsense_Mutation_p.Y523*|PTPRT_ENST00000373190.1_Nonsense_Mutation_p.Y523*|PTPRT_ENST00000373184.1_Nonsense_Mutation_p.Y523*			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	523	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.Y523*(2)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CGACAGCCTTGTAGTTGATCT	0.532																																							uc002xkg.2		NA																	2	Substitution - Nonsense(2)		lung(2)	skin(8)|ovary(7)|lung(5)	20						c.(1567-1569)TAC>TAA		protein tyrosine phosphatase, receptor type, T							56.0	61.0	60.0					20																	40980917		1961	4143	6104	SO:0001587	stop_gained	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40980917G>T	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1569C>A	20.37:g.40980917G>T	ENSP00000362283:p.Tyr523*		Somatic				PTPRT_uc010ggj.2_Nonsense_Mutation_p.Y523*	p.Y523*	NM_007050	NP_008981	WXS	Illumina HiSeq	Unspecified	O14522	PTPRT_HUMAN			10	1753	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	523			Extracellular (Potential).|Fibronectin type-III 3.		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Nonsense_Mutation	SNP	ENST00000373187.1	37	c.1569C>A	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	G	41	8.860807	0.98980	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	.	.	.	5.88	3.96	0.45880	.	0.193752	0.46442	D	0.000286	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7385	0.57238	0.1311:0.0:0.8689:0.0	.	.	.	.	X	523	.	ENSP00000348408:Y523X	Y	-	3	2	PTPRT	40414331	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.627000	0.46469	0.832000	0.34804	0.551000	0.68910	TAC		0.532	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			12	48	1	0	0.00244969	0.020292	0.00255134	12	48				
ZNF831	128611	broad.mit.edu	37	20	57829576	57829576	+	Silent	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr20:57829576C>T	ENST00000371030.2	+	5	4812	c.4812C>T	c.(4810-4812)ccC>ccT	p.P1604P		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1604							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.P1604P(3)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TGACTGTCCCCTGCCCCTCTT	0.493																																							uc002yan.2		NA																	3	Substitution - coding silent(3)		lung(2)|large_intestine(1)	skin(13)|ovary(1)	14						c.(4810-4812)CCC>CCT		zinc finger protein 831							84.0	81.0	82.0					20																	57829576		1899	4123	6022	SO:0001819	synonymous_variant	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57829576C>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4812C>T	20.37:g.57829576C>T			Somatic					p.P1604P	NM_178457	NP_848552	WXS	Illumina HiSeq	Unspecified	Q5JPB2	ZN831_HUMAN			5	4812	+	all_lung(29;0.0085)		1604					Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	37	c.4812C>T	CCDS42894.1																																																																																				0.493	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		24	138	0	0	0	0.076483	0	24	138				
ZNF512B	57473	broad.mit.edu	37	20	62630480	62630480	+	Intron	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr20:62630480G>C	ENST00000450537.1	-	2	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Missense_Mutation_p.G285A			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G285A(2)		NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CCGACACACGGAGGAGACATC	0.502																																							uc002yho.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(853-855)GGA>GCA		PRP6 pre-mRNA processing factor 6 homolog							74.0	61.0	65.0					20																	62630480		2203	4300	6503	SO:0001627	intron_variant	24148				assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity	g.chr20:62630480G>C	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-31172C>G	20.37:g.62630480G>C			Somatic				PRPF6_uc002yhp.2_Missense_Mutation_p.G285A	p.G285A	NM_012469	NP_036601	WXS	Illumina HiSeq	Unspecified	O94906	PRP6_HUMAN			7	1022	+	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)		285					Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	c.854G>C	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.701790	0.30142	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.76448	-1.02;-1.02	5.64	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.74688	0.3749	L	0.58302	1.8	0.80722	D	1	B;B	0.18166	0.001;0.026	B;B	0.18871	0.007;0.023	T	0.69818	-0.5042	10	0.27785	T	0.31	.	16.652	0.85219	0.0:0.1299:0.8701:0.0	.	285;285	O94906-2;O94906	.;PRP6_HUMAN	A	285	ENSP00000266079:G285A;ENSP00000446216:G285A	ENSP00000266079:G285A	G	+	2	0	PRPF6	62100924	1.000000	0.71417	0.282000	0.24776	0.310000	0.27922	9.152000	0.94680	1.375000	0.46248	-0.182000	0.12963	GGA		0.502	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713		10	57	0	0	0	0.058154	0	10	57				
LIPI	149998	broad.mit.edu	37	21	15561369	15561369	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr21:15561369T>C	ENST00000536861.1	-	2	417	c.418A>G	c.(418-420)Att>Gtt	p.I140V	LIPI_ENST00000344577.2_Missense_Mutation_p.I161V			Q6XZB0	LIPI_HUMAN	lipase, member I	140					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)	p.I161V(2)		endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		AGATTTTTAATGTGCACACTC	0.328																																							uc002yjm.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(481-483)ATT>GTT		lipase, member I							37.0	42.0	40.0					21																	15561369		2201	4295	6496	SO:0001583	missense	149998				lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity	g.chr21:15561369T>C	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.418A>G	21.37:g.15561369T>C	ENSP00000440381:p.Ile140Val		Somatic				LIPI_uc010gkw.1_Missense_Mutation_p.I94V	p.I161V	NM_198996	NP_945347	WXS	Illumina HiSeq	Unspecified	Q6XZB0	LIPI_HUMAN		Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)	2	491	-			140					G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	ENST00000536861.1	37	c.481A>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.96|15.96	2.987814|2.987814	0.53934|0.53934	.|.	.|.	ENSG00000188992|ENSG00000188992	ENST00000400211|ENST00000344577;ENST00000536861;ENST00000382981	D|D;D	0.90676|0.91295	-2.71|-2.82;-2.82	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	.|0.225865	.|0.44483	.|D	.|0.000451	D|D	0.90528|0.90528	0.7032|0.7032	L|L	0.49350|0.49350	1.555|1.555	0.27989|0.27989	N|N	0.935752|0.935752	.|P;P	.|0.49447	.|0.924;0.924	.|P;P	.|0.53593	.|0.73;0.73	D|D	0.84540|0.84540	0.0638|0.0638	7|10	0.48119|0.29301	T|T	0.1|0.29	.|.	10.7316|10.7316	0.46100|0.46100	0.0:0.0771:0.0:0.9229|0.0:0.0771:0.0:0.9229	.|.	.|140;161	.|G1JSG6;Q6XZB0-2	.|.;.	R|V	19|161;140;35	ENSP00000383072:H19R|ENSP00000343331:I161V;ENSP00000440381:I140V	ENSP00000383072:H19R|ENSP00000343331:I161V	H|I	-|-	2|1	0|0	LIPI|LIPI	14483240|14483240	0.996000|0.996000	0.38824|0.38824	0.857000|0.857000	0.33713|0.33713	0.924000|0.924000	0.55760|0.55760	2.391000|2.391000	0.44424|0.44424	2.136000|2.136000	0.66102|0.66102	0.528000|0.528000	0.53228|0.53228	CAT|ATT		0.328	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996		4	18	0	0	0	0.014758	0	4	18				
ADAMTS1	9510	broad.mit.edu	37	21	28212371	28212371	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr21:28212371G>T	ENST00000284984.3	-	6	2129	c.1675C>A	c.(1675-1677)Cat>Aat	p.H559N		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	559	Disintegrin.|TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.H559N(2)|p.H559Y(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		CAGCTTCCATGAAAAGGCGTC	0.463																																							uc002ymf.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(3)|large_intestine(2)|central_nervous_system(1)	6						c.(1675-1677)CAT>AAT		ADAM metallopeptidase with thrombospondin type 1							59.0	54.0	56.0					21																	28212371		2203	4300	6503	SO:0001583	missense	9510				integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding	g.chr21:28212371G>T	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1675C>A	21.37:g.28212371G>T	ENSP00000284984:p.His559Asn		Somatic					p.H559N	NM_006988	NP_008919	WXS	Illumina HiSeq	Unspecified	Q9UHI8	ATS1_HUMAN		Lung(58;0.215)	6	2130	-		Breast(209;0.000962)	559			Disintegrin.|TSP type-1 1.		D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	37	c.1675C>A	CCDS33524.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371141	0.42003	.	.	ENSG00000154734	ENST00000284984	T	0.59638	0.25	4.89	4.89	0.63831	.	.	.	.	.	T	0.47600	0.1454	L	0.28014	0.82	0.58432	D	0.999991	B	0.14438	0.01	B	0.13407	0.009	T	0.33394	-0.9870	9	0.33141	T	0.24	.	18.6024	0.91253	0.0:0.0:1.0:0.0	.	559	Q9UHI8	ATS1_HUMAN	N	559	ENSP00000284984:H559N	ENSP00000284984:H559N	H	-	1	0	ADAMTS1	27134242	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.673000	0.68109	2.709000	0.92574	0.655000	0.94253	CAT		0.463	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2			14	22	1	0	2.61681e-11	0.020292	3.11289e-11	14	22				
KRTAP13-1	140258	broad.mit.edu	37	21	31768627	31768627	+	Missense_Mutation	SNP	C	C	A	rs574290651		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr21:31768627C>A	ENST00000355459.2	+	1	236	c.223C>A	c.(223-225)Ccc>Acc	p.P75T		NM_181599.2	NP_853630.2	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	75	5 X 10 AA approximate repeats.					intermediate filament (GO:0005882)		p.P75T(2)		endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGAGTCCAGCCCCTGCCAGAC	0.612																																							uc002yoa.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(223-225)CCC>ACC		keratin associated protein 13-1							61.0	62.0	62.0					21																	31768627		2203	4300	6503	SO:0001583	missense	140258					intermediate filament		g.chr21:31768627C>A	AJ457066	CCDS13590.2	21q22.11	2013-06-20			ENSG00000198390	ENSG00000198390		"""Keratin associated proteins"""	18924	protein-coding gene	gene with protein product		608718				12359730	Standard	NM_181599		Approved	KAP13.1	uc002yoa.3	Q8IUC0	OTTHUMG00000057800	ENST00000355459.2:c.223C>A	21.37:g.31768627C>A	ENSP00000347635:p.Pro75Thr		Somatic					p.P75T	NM_181599	NP_853630	WXS	Illumina HiSeq	Unspecified	Q8IUC0	KR131_HUMAN			1	236	+			75			3.|5 X 10 AA approximate repeats.		Q14D20|Q3LI79	Missense_Mutation	SNP	ENST00000355459.2	37	c.223C>A	CCDS13590.2	.	.	.	.	.	.	.	.	.	.	C	13.35	2.210046	0.39003	.	.	ENSG00000198390	ENST00000355459	T	0.03272	3.99	4.51	0.196	0.15159	.	0.188804	0.25299	N	0.031661	T	0.11110	0.0271	M	0.78801	2.425	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.21586	-1.0241	10	0.18276	T	0.48	.	4.3324	0.11069	0.0:0.3573:0.1743:0.4684	.	75	Q8IUC0	KR131_HUMAN	T	75	ENSP00000347635:P75T	ENSP00000347635:P75T	P	+	1	0	KRTAP13-1	30690498	0.000000	0.05858	0.010000	0.14722	0.029000	0.11900	0.221000	0.17680	0.014000	0.14944	-0.259000	0.10710	CCC		0.612	KRTAP13-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128252.3			29	41	1	0	1.88708e-17	0.037714	2.42902e-17	29	41				
DGCR14	8220	broad.mit.edu	37	22	19124931	19124931	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr22:19124931G>A	ENST00000252137.6	-	8	983	c.940C>T	c.(940-942)Ccg>Tcg	p.P314S		NM_022719.2	NP_073210.1	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region gene 14	314					mRNA splicing, via spliceosome (GO:0000398)|nervous system development (GO:0007399)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)		p.P314S(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	16	Colorectal(54;0.0993)					GTCATCATCGGGGACTCGTTC	0.592																																							uc002zou.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(940-942)CCG>TCG		DiGeorge syndrome critical region protein 14							169.0	143.0	152.0					22																	19124931		2203	4300	6503	SO:0001583	missense	8220				nervous system development	catalytic step 2 spliceosome		g.chr22:19124931G>A	L77566	CCDS13756.1	22q11.21	2007-02-20			ENSG00000100056	ENSG00000100056			16817	protein-coding gene	gene with protein product		601755	"""DiGeorge syndrome critical region gene 13"""	DGCR13		8776594, 9063747	Standard	NM_022719		Approved	DGSI, Es2el, ES2, DGS-H	uc002zou.3	Q96DF8	OTTHUMG00000150119	ENST00000252137.6:c.940C>T	22.37:g.19124931G>A	ENSP00000252137:p.Pro314Ser		Somatic				DGCR14_uc002zot.2_Missense_Mutation_p.P235S|DGCR14_uc002zov.2_RNA	p.P314S	NM_022719	NP_073210	WXS	Illumina HiSeq	Unspecified	Q96DF8	DGC14_HUMAN			8	977	-	Colorectal(54;0.0993)		314					Q49AH7|Q9BTZ4	Missense_Mutation	SNP	ENST00000252137.6	37	c.940C>T	CCDS13756.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466998	0.63625	.	.	ENSG00000100056	ENST00000252137	T	0.61980	0.06	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	D	0.82793	0.5114	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86443	0.1768	10	0.59425	D	0.04	-17.9282	17.2171	0.86947	0.0:0.0:1.0:0.0	.	314	Q96DF8	DGC14_HUMAN	S	314	ENSP00000252137:P314S	ENSP00000252137:P314S	P	-	1	0	DGCR14	17504931	1.000000	0.71417	0.904000	0.35570	0.194000	0.23727	8.851000	0.92205	2.394000	0.81467	0.484000	0.47621	CCG		0.592	DGCR14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316432.2			93	139	0	0	0	0.048971	0	93	139				
CYTH4	27128	broad.mit.edu	37	22	37708205	37708205	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr22:37708205G>T	ENST00000248901.6	+	12	1289	c.1102G>T	c.(1102-1104)Gag>Tag	p.E368*		NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	368	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)	p.E368*(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						CCAGTGGATCGAGTCCATCCG	0.607																																							uc003arf.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)	2						c.(1102-1104)GAG>TAG		cytohesin 4							93.0	85.0	88.0					22																	37708205		2203	4300	6503	SO:0001587	stop_gained	27128				regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity	g.chr22:37708205G>T	AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.1102G>T	22.37:g.37708205G>T	ENSP00000248901:p.Glu368*		Somatic				CYTH4_uc011amw.1_Nonsense_Mutation_p.E311*|CYTH4_uc010gxe.2_RNA	p.E368*	NM_013385	NP_037517	WXS	Illumina HiSeq	Unspecified	Q9UIA0	CYH4_HUMAN			12	1218	+			368			PH.		Q5R3F9|Q9UGT6	Nonsense_Mutation	SNP	ENST00000248901.6	37	c.1102G>T	CCDS13946.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.372|9.372	1.070759|1.070759	0.20147|0.20147	.|.	.|.	ENSG00000100055|ENSG00000100055	ENST00000248901;ENST00000404204|ENST00000446506	.|.	.|.	.|.	4.71|4.71	-8.48|-8.48	0.00935|0.00935	.|.	0.639623|.	0.15979|.	N|.	0.235372|.	.|T	.|0.45094	.|0.1325	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.52109	.|-0.8619	.|4	0.02654|.	T|.	1|.	.|.	7.076|7.076	0.25205|0.25205	0.4453:0.3035:0.2512:0.0|0.4453:0.3035:0.2512:0.0	.|.	.|.	.|.	.|.	X|L	368;27|120	.|.	ENSP00000248901:E368X|.	E|R	+|+	1|2	0|0	CYTH4|CYTH4	36038151|36038151	0.000000|0.000000	0.05858|0.05858	0.781000|0.781000	0.31783|0.31783	0.024000|0.024000	0.10985|0.10985	-2.309000|-2.309000	0.01130|0.01130	-1.211000|-1.211000	0.02624|0.02624	-0.224000|-0.224000	0.12420|0.12420	GAG|CGA		0.607	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318917.1			23	58	1	0	2.4375e-19	0.034045	3.2032e-19	23	58				
ELFN2	114794	broad.mit.edu	37	22	37770139	37770139	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr22:37770139T>C	ENST00000402918.2	-	3	2221	c.1436A>G	c.(1435-1437)gAg>gGg	p.E479G	RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.5_ENST00000430883.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	479					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					GGGCAGCTTCTCCCCGATCAT	0.667																																							uc003asq.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1435-1437)GAG>GGG		leucine rich repeat containing 62							61.0	63.0	62.0					22																	37770139		2203	4299	6502	SO:0001583	missense	114794					cell surface|integral to membrane		g.chr22:37770139T>C	BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.1436A>G	22.37:g.37770139T>C	ENSP00000385277:p.Glu479Gly		Somatic					p.E479G	NM_052906	NP_443138	WXS	Illumina HiSeq	Unspecified	Q5R3F8	LRFN6_HUMAN			3	2222	-	Melanoma(58;0.0574)		479			Cytoplasmic (Potential).		Q96PY3	Missense_Mutation	SNP	ENST00000402918.2	37	c.1436A>G	CCDS33642.1	.	.	.	.	.	.	.	.	.	.	T	10.17	1.277215	0.23307	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.55234	0.53;0.53	4.77	4.77	0.60923	.	0.157917	0.43919	D	0.000518	T	0.48607	0.1509	M	0.68593	2.085	0.48040	D	0.999572	B	0.30326	0.276	B	0.22880	0.042	T	0.46610	-0.9179	10	0.25106	T	0.35	-35.5224	14.2967	0.66318	0.0:0.0:0.0:1.0	.	479	Q5R3F8	PPR29_HUMAN	G	479	ENSP00000300147:E479G;ENSP00000385277:E479G	ENSP00000300147:E479G	E	-	2	0	ELFN2	36100085	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	2.279000	0.43435	1.776000	0.52262	0.496000	0.49642	GAG		0.667	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318900.2	NM_052906		13	183	0	0	0	0.105934	0	13	183				
RANGAP1	5905	broad.mit.edu	37	22	41657502	41657502	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr22:41657502C>T	ENST00000455915.2	-	5	2032	c.563G>A	c.(562-564)gGc>gAc	p.G188D	RANGAP1_ENST00000405486.1_Missense_Mutation_p.G188D|RANGAP1_ENST00000407260.4_Intron|RANGAP1_ENST00000356244.3_Missense_Mutation_p.G188D			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	188					mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACGGTTTCTGCCAGCCACAAA	0.582																																							uc003azs.2		NA																	0					0						c.(562-564)GGC>GAC		Ran GTPase activating protein 1							84.0	78.0	80.0					22																	41657502		2203	4300	6503	SO:0001583	missense	5905				mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity	g.chr22:41657502C>T	X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.563G>A	22.37:g.41657502C>T	ENSP00000401470:p.Gly188Asp		Somatic				RANGAP1_uc003azt.2_Missense_Mutation_p.G188D|RANGAP1_uc003azu.2_Missense_Mutation_p.G188D|RANGAP1_uc011aoz.1_Intron	p.G188D	NM_002883	NP_002874	WXS	Illumina HiSeq	Unspecified	P46060	RAGP1_HUMAN			5	2033	-			188					Q96JJ2	Missense_Mutation	SNP	ENST00000455915.2	37	c.563G>A	CCDS14012.1	.	.	.	.	.	.	.	.	.	.	C	33	5.200231	0.94997	.	.	ENSG00000100401	ENST00000405486;ENST00000356244;ENST00000405383;ENST00000455915	T;T;T	0.54071	0.59;0.59;0.59	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.72630	0.3484	M	0.69463	2.115	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72523	-0.4267	10	0.52906	T	0.07	-24.341	19.6224	0.95663	0.0:1.0:0.0:0.0	.	188	P46060	RAGP1_HUMAN	D	188	ENSP00000385866:G188D;ENSP00000348577:G188D;ENSP00000401470:G188D	ENSP00000348577:G188D	G	-	2	0	RANGAP1	39987448	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	7.770000	0.85390	2.630000	0.89119	0.655000	0.94253	GGC		0.582	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320606.1	NM_002883		4	85	0	0	0	0.009096	0	4	85				
WNT7B	7477	broad.mit.edu	37	22	46345933	46345933	+	Silent	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr22:46345933C>A	ENST00000339464.4	-	2	539	c.165G>T	c.(163-165)cgG>cgT	p.R55R	WNT7B_ENST00000410089.1_Silent_p.R39R|WNT7B_ENST00000410058.1_Silent_p.R55R|WNT7B_ENST00000409496.3_Silent_p.R59R	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	55					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.R55R(2)		endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		TGGCATCGGGCCGACTCTGGC	0.627																																							uc003bgo.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(1)	1						c.(163-165)CGG>CGT		wingless-type MMTV integration site family,							49.0	49.0	49.0					22																	46345933		2203	4300	6503	SO:0001819	synonymous_variant	7477				activation of JUN kinase activity|anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|central nervous system vasculogenesis|chorio-allantoic fusion|developmental growth involved in morphogenesis|embryonic placenta morphogenesis|establishment or maintenance of polarity of embryonic epithelium|fibroblast proliferation|forebrain regionalization|inner medullary collecting duct development|lens fiber cell development|lobar bronchus development|lung epithelium development|lung morphogenesis|lung-associated mesenchyme development|mammary gland epithelium development|metanephric collecting duct development|metanephric loop of Henle development|metanephros morphogenesis|negative regulation of smoothened signaling pathway|outer medullary collecting duct development|oxygen homeostasis|positive regulation of JNK cascade|positive regulation of osteoblast differentiation|renal inner medulla development|renal outer medulla development|stem cell proliferation|synapse organization|trachea cartilage morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled binding|signal transducer activity	g.chr22:46345933C>A	AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.165G>T	22.37:g.46345933C>A			Somatic				WNT7B_uc010haa.2_Silent_p.R59R	p.R55R	NM_058238	NP_478679	WXS	Illumina HiSeq	Unspecified	P56706	WNT7B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)	2	539	-		Ovarian(80;0.00965)|all_neural(38;0.0416)	55					B8A596|Q96Q12	Silent	SNP	ENST00000339464.4	37	c.165G>T	CCDS33667.1																																																																																				0.627	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336418.1	NM_058238		15	45	1	0	1.37285e-15	0.028581	1.74033e-15	15	45				
ARPP21	10777	broad.mit.edu	37	3	35750491	35750491	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr3:35750491A>G	ENST00000187397.4	+	11	1282	c.826A>G	c.(826-828)Aga>Gga	p.R276G	ARPP21_ENST00000444190.1_Intron|ARPP21_ENST00000458225.1_Intron|ARPP21_ENST00000417925.1_Intron|ARPP21_ENST00000337271.5_Intron	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	276	SUZ. {ECO:0000255|PROSITE- ProRule:PRU01009}.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)	p.R276G(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TAGAGATGACAGACGAAGTAA	0.378																																							uc003cgb.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(826-828)AGA>GGA		cyclic AMP-regulated phosphoprotein, 21 kD							141.0	138.0	139.0					3																	35750491		2203	4300	6503	SO:0001583	missense	10777					cytoplasm	nucleic acid binding	g.chr3:35750491A>G	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.826A>G	3.37:g.35750491A>G	ENSP00000187397:p.Arg276Gly		Somatic				ARPP21_uc003cga.2_Intron|ARPP21_uc011axy.1_Intron|ARPP21_uc003cgf.2_Intron	p.R276G	NM_016300	NP_057384	WXS	Illumina HiSeq	Unspecified	Q9UBL0	ARP21_HUMAN			11	1090	+			276					B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	c.826A>G	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	A	18.66	3.672747	0.67928	.	.	ENSG00000172995	ENST00000187397	T	0.49720	0.77	6.03	6.03	0.97812	SUZ domain (1);	0.282271	0.33253	N	0.005105	T	0.50360	0.1611	M	0.72894	2.215	0.80722	D	1	P	0.35493	0.505	B	0.33121	0.158	T	0.55952	-0.8059	10	0.87932	D	0	.	16.6082	0.84836	1.0:0.0:0.0:0.0	.	276	Q9UBL0	ARP21_HUMAN	G	276	ENSP00000187397:R276G	ENSP00000187397:R276G	R	+	1	2	ARPP21	35725495	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.231000	0.65327	2.319000	0.78375	0.524000	0.50904	AGA		0.378	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		3	10	0	0	0	0.004672	0	3	10				
SLC26A6	65010	broad.mit.edu	37	3	48670747	48670747	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr3:48670747G>A	ENST00000395550.2	-	3	306	c.259C>T	c.(259-261)Cgt>Tgt	p.R87C	SLC26A6_ENST00000455886.2_Missense_Mutation_p.R87C|SLC26A6_ENST00000358747.6_Missense_Mutation_p.R66C|SLC26A6_ENST00000383733.3_Missense_Mutation_p.R87C|SLC26A6_ENST00000482282.1_5'UTR|SLC26A6_ENST00000337000.8_Missense_Mutation_p.R87C|SLC26A6_ENST00000420764.2_Missense_Mutation_p.R87C			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	87					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.R87C(1)	SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		AGCCAGTCACGCACAGGATAC	0.607																																					NSCLC(13;369 479 28271 30152 44026)		uc003cuf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11						c.(10441-10443)CGT>TGT		cadherin EGF LAG seven-pass G-type receptor 3							41.0	50.0	47.0					3																	48670747		2052	4198	6250	SO:0001583	missense	1951				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr3:48670747G>A	AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.259C>T	3.37:g.48670747G>A	ENSP00000378920:p.Arg87Cys		Somatic				SLC26A6_uc003cug.2_Missense_Mutation_p.R66C|SLC26A6_uc003cuh.2_Missense_Mutation_p.R87C|SLC26A6_uc010hke.2_5'UTR|SLC26A6_uc003cuk.2_Missense_Mutation_p.R87C|SLC26A6_uc003cui.2_Missense_Mutation_p.R87C|SLC26A6_uc003cuj.2_Missense_Mutation_p.R87C|SLC26A6_uc011bbp.1_Missense_Mutation_p.R87C	p.R3481C	NM_001407	NP_001398	WXS	Illumina HiSeq	Unspecified	Q9NYQ7	CELR3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)	38	10441	-			Error:Variant_position_missing_in_Q9NYQ7_after_alignment					B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Missense_Mutation	SNP	ENST00000395550.2	37	c.10441C>T	CCDS43087.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205590	0.79127	.	.	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000337000;ENST00000447978;ENST00000358747;ENST00000455886;ENST00000431739;ENST00000426599	D;D;D;D;D;D;D;D	0.93547	-3.09;-3.09;-3.09;-3.24;-3.09;-3.09;-3.09;-3.09	5.02	5.02	0.67125	.	.	.	.	.	D	0.96744	0.8937	M	0.89030	3	0.42635	D	0.993399	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.83275	0.995;0.992;0.977;0.996;0.996;0.963	D	0.97000	0.9728	9	0.87932	D	0	.	11.3909	0.49813	0.0:0.0:0.6937:0.3063	.	87;87;87;87;87;3481	B4DMZ1;G3XAC1;Q9BXS9-2;Q548A7;Q9BXS9;Q5Y190	.;.;.;.;S26A6_HUMAN;.	C	87;87;87;87;87;66;87;87;87	ENSP00000404684:R87C;ENSP00000378920:R87C;ENSP00000373239:R87C;ENSP00000337648:R87C;ENSP00000351597:R66C;ENSP00000401066:R87C;ENSP00000401813:R87C;ENSP00000405872:R87C	ENSP00000307089:R87C	R	-	1	0	SLC26A6	48645751	1.000000	0.71417	0.999000	0.59377	0.855000	0.48748	4.254000	0.58798	2.612000	0.88384	0.655000	0.94253	CGT		0.607	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345040.1	NM_022911		11	21	0	0	0	0.105934	0	11	21				
SFMBT1	51460	broad.mit.edu	37	3	52940182	52940182	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr3:52940182G>A	ENST00000394752.3	-	20	2789	c.2407C>T	c.(2407-2409)Cgg>Tgg	p.R803W	SFMBT1_ENST00000296295.6_Intron|SFMBT1_ENST00000358080.2_Missense_Mutation_p.R803W|SFMBT1_ENST00000394750.1_Missense_Mutation_p.R803W	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	803	SAM.				cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		CTGATGAACCGCACAACGTCT	0.418																																							uc003dgf.2		NA																	0				ovary(1)	1						c.(2407-2409)CGG>TGG		Scm-like with four mbt domains 1							149.0	129.0	136.0					3																	52940182		2203	4300	6503	SO:0001583	missense	51460				regulation of transcription, DNA-dependent	nucleus		g.chr3:52940182G>A	AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.2407C>T	3.37:g.52940182G>A	ENSP00000378235:p.Arg803Trp		Somatic				SFMBT1_uc010hmr.2_Intron|SFMBT1_uc003dgg.2_Missense_Mutation_p.R803W|SFMBT1_uc003dgh.2_Missense_Mutation_p.R803W	p.R803W	NM_001005159	NP_001005159	WXS	Illumina HiSeq	Unspecified	Q9UHJ3	SMBT1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)	21	2976	-			803			SAM.		Q402F7|Q96C73|Q9Y4Q9	Missense_Mutation	SNP	ENST00000394752.3	37	c.2407C>T	CCDS2867.1	.	.	.	.	.	.	.	.	.	.	G	34	5.412970	0.96072	.	.	ENSG00000163935	ENST00000394752;ENST00000358080;ENST00000394750	T;T;T	0.50813	0.73;0.73;0.73	5.85	5.85	0.93711	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.64549	0.2608	L	0.45352	1.415	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.64816	-0.6318	10	0.87932	D	0	.	20.1649	0.98147	0.0:0.0:1.0:0.0	.	803	Q9UHJ3	SMBT1_HUMAN	W	803	ENSP00000378235:R803W;ENSP00000350789:R803W;ENSP00000378233:R803W	ENSP00000350789:R803W	R	-	1	2	SFMBT1	52915222	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	6.624000	0.74243	2.753000	0.94483	0.655000	0.94253	CGG		0.418	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353040.3	NM_016329		3	36	0	0	0	0.009096	0	3	36				
MAGI1	9223	broad.mit.edu	37	3	65456009	65456009	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr3:65456009G>T	ENST00000497477.2	-	5	907	c.908C>A	c.(907-909)cCt>cAt	p.P303H	MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000483466.1_Missense_Mutation_p.P303H|MAGI1_ENST00000402939.2_Missense_Mutation_p.P303H|MAGI1_ENST00000330909.8_Missense_Mutation_p.P303H			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	303	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.P303H(4)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CCAGTTTTCAGGTAGAGGACC	0.413																																							uc003dmn.2		NA																	4	Substitution - Missense(4)		lung(4)	lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6						c.(907-909)CCT>CAT		membrane associated guanylate kinase, WW and PDZ							101.0	99.0	100.0					3																	65456009		2203	4300	6503	SO:0001583	missense	9223				cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding	g.chr3:65456009G>T	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.908C>A	3.37:g.65456009G>T	ENSP00000424369:p.Pro303His		Somatic				MAGI1_uc003dmm.2_Missense_Mutation_p.P303H|MAGI1_uc003dmo.2_Missense_Mutation_p.P303H|MAGI1_uc003dmp.2_Missense_Mutation_p.P303H|MAGI1_uc010hny.2_Missense_Mutation_p.P188H|MAGI1_uc003dmr.2_Missense_Mutation_p.P304H	p.P303H	NM_001033057	NP_001028229	WXS	Illumina HiSeq	Unspecified	Q96QZ7	MAGI1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)	5	1434	-		Lung NSC(201;0.0016)	303			WW 1.		A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000497477.2	37	c.908C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.2|22.2	4.260234|4.260234	0.80246|0.80246	.|.	.|.	ENSG00000151276|ENSG00000151276	ENST00000460329|ENST00000402939;ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466;ENST00000497477;ENST00000472257;ENST00000479287	.|D;D;D;D;D;D;D	.|0.88586	.|-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4	5.73|5.73	4.87|4.87	0.63330|0.63330	.|WW/Rsp5/WWP (5);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96886|0.96886	0.8983|0.8983	H|H	0.98901|0.98901	4.365|4.365	0.80722|0.80722	D|D	1|1	.|D;D;P;D;D;D	.|0.89917	.|1.0;1.0;0.944;1.0;1.0;1.0	.|D;D;P;D;D;D	.|0.97110	.|0.998;1.0;0.563;0.994;1.0;0.998	D|D	0.98333|0.98333	1.0534|1.0534	5|10	.|0.87932	.|D	.|0	-11.0193|-11.0193	14.9693|14.9693	0.71220|0.71220	0.0686:0.0:0.9314:0.0|0.0686:0.0:0.9314:0.0	.|.	.|303;303;303;303;303;303	.|Q96QZ7-6;Q96QZ7;Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5	.|.;MAGI1_HUMAN;.;.;.;.	M|H	184|303;303;199;178;303;303;89;65	.|ENSP00000385450:P303H;ENSP00000331157:P303H;ENSP00000418177:P178H;ENSP00000420323:P303H;ENSP00000424369:P303H;ENSP00000420796:P89H;ENSP00000418044:P65H	.|ENSP00000331157:P303H	L|P	-|-	1|2	2|0	MAGI1|MAGI1	65431049|65431049	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	7.653000|7.653000	0.83643|0.83643	1.437000|1.437000	0.47472|0.47472	-0.252000|-0.252000	0.11476|0.11476	CTG|CCT		0.413	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742		18	9	1	0	1.64113e-05	0.055883	1.79098e-05	18	9				
MYLK	4638	broad.mit.edu	37	3	123375980	123375980	+	Silent	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr3:123375980T>C	ENST00000475616.1	-	21	4280	c.4281A>G	c.(4279-4281)aaA>aaG	p.K1427K	MYLK_ENST00000360304.3_Silent_p.K1427K|MYLK_ENST00000360772.3_Silent_p.K1427K|MYLK_ENST00000346322.5_Silent_p.K1358K|MYLK_ENST00000354792.5_Silent_p.K227K|MYLK_ENST00000359169.1_Silent_p.K1427K			Q15746	MYLK_HUMAN	myosin light chain kinase	1427	Actin-binding (calcium/calmodulin- insensitive). {ECO:0000250}.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.K1427K(2)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TACCTTCAGGTTTCTCTCCTA	0.478																																							uc003ego.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(6)|skin(2)|stomach(1)	9						c.(4279-4281)AAA>AAG		myosin light chain kinase isoform 1							132.0	123.0	126.0					3																	123375980		2203	4300	6503	SO:0001819	synonymous_variant	4638				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity	g.chr3:123375980T>C	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.4281A>G	3.37:g.123375980T>C			Somatic				MYLK_uc010hrr.2_5'UTR|MYLK_uc011bjv.1_Silent_p.K227K|MYLK_uc011bjw.1_Silent_p.K1427K|MYLK_uc003egp.2_Silent_p.K1358K|MYLK_uc003egq.2_Silent_p.K1427K|MYLK_uc003egr.2_Silent_p.K1358K|MYLK_uc003egs.2_Silent_p.K1251K	p.K1427K	NM_053025	NP_444253	WXS	Illumina HiSeq	Unspecified	Q15746	MYLK_HUMAN		GBM - Glioblastoma multiforme(114;0.0736)	24	4563	-		Lung NSC(201;0.0496)	1427			Actin-binding (calcium/calmodulin- insensitive) (By similarity).		B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	ENST00000475616.1	37	c.4281A>G	CCDS46896.1																																																																																				0.478	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025		39	44	0	0	0	0.09836	0	39	44				
RP11-93K22.13	0	broad.mit.edu	37	3	129811966	129811966	+	lincRNA	SNP	C	C	T	rs558997184		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr3:129811966C>T	ENST00000514010.1	-	0	157				ALG1L2_ENST00000507643.1_RNA																							TGACTCTTGACGGACAGAACC	0.413													c|||	1	0.000199681	0.0008	0.0	5008	,	,		15335	0.0		0.0	False		,,,				2504	0.0						uc011bld.1		NA																	0					0						c.(274-276)GAC>GAT		asparagine-linked glycosylation 1-like 2							67.0	54.0	58.0					3																	129811966		692	1591	2283			644974				biosynthetic process		transferase activity, transferring glycosyl groups	g.chr3:129811966C>T																													3.37:g.129811966C>T			Somatic				ALG1L2_uc010hth.2_RNA	p.D92D	NM_001136152	NP_001129624	WXS	Illumina HiSeq	Unspecified	C9J202	AG1L2_HUMAN			4	462	+			92						Silent	SNP	ENST00000514010.1	37	c.276C>T																																																																																					0.413	RP11-93K22.13-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000358040.1			14	70	0	0	0	0.0333	0	14	70				
COL6A6	131873	broad.mit.edu	37	3	130292827	130292827	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr3:130292827T>A	ENST00000358511.6	+	7	3036	c.3005T>A	c.(3004-3006)gTt>gAt	p.V1002D	COL6A6_ENST00000453409.2_Missense_Mutation_p.V1002D	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1002	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.V1002D(2)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GTAGATCTTGTTTTCCTTATG	0.358																																							uc010htl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|central_nervous_system(1)|pancreas(1)	8						c.(3004-3006)GTT>GAT		collagen type VI alpha 6 precursor							88.0	81.0	83.0					3																	130292827		1858	4101	5959	SO:0001583	missense	131873				axon guidance|cell adhesion	collagen		g.chr3:130292827T>A	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.3005T>A	3.37:g.130292827T>A	ENSP00000351310:p.Val1002Asp		Somatic					p.V1002D	NM_001102608	NP_001096078	WXS	Illumina HiSeq	Unspecified	A6NMZ7	CO6A6_HUMAN			7	3036	+			1002			Nonhelical region.|VWFA 6.		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	c.3005T>A	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	T	19.61	3.860699	0.71834	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.86956	-2.19;-2.19	5.23	5.23	0.72850	von Willebrand factor, type A (3);	0.000000	0.49305	D	0.000155	D	0.95354	0.8492	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.96696	0.9514	10	0.87932	D	0	.	15.07	0.72026	0.0:0.0:0.0:1.0	.	1002	A6NMZ7	CO6A6_HUMAN	D	1002	ENSP00000351310:V1002D;ENSP00000399236:V1002D	ENSP00000351310:V1002D	V	+	2	0	COL6A6	131775517	1.000000	0.71417	0.090000	0.20809	0.801000	0.45260	5.828000	0.69307	2.096000	0.63516	0.402000	0.26972	GTT		0.358	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		18	18	0	0	0	0.0333	0	18	18				
TRPC1	7220	broad.mit.edu	37	3	142503717	142503717	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr3:142503717A>T	ENST00000476941.1	+	7	1618	c.1132A>T	c.(1132-1134)Aga>Tga	p.R378*	TRPC1_ENST00000273482.6_Nonsense_Mutation_p.R344*	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	378					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)	p.R344*(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						TCAGTTTGGCAGAATCATTCA	0.368																																							uc003evc.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)	2						c.(1132-1134)AGA>TGA		transient receptor potential cation channel,							146.0	136.0	139.0					3																	142503717		2203	4300	6503	SO:0001587	stop_gained	7220				axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chr3:142503717A>T	X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1132A>T	3.37:g.142503717A>T	ENSP00000419313:p.Arg378*		Somatic				TRPC1_uc003evb.2_Nonsense_Mutation_p.R344*	p.R378*	NM_003304	NP_003295	WXS	Illumina HiSeq	Unspecified	P48995	TRPC1_HUMAN			7	1268	+			378			Cytoplasmic (Potential).		Q14CE4	Nonsense_Mutation	SNP	ENST00000476941.1	37	c.1132A>T	CCDS58856.1	.	.	.	.	.	.	.	.	.	.	A	40	8.521881	0.98848	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	.	.	.	5.9	4.79	0.61399	.	0.096903	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-5.1772	11.098	0.48157	0.6185:0.3815:0.0:0.0	.	.	.	.	X	378;344	.	ENSP00000273482:R344X	R	+	1	2	TRPC1	143986407	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.220000	0.72237	2.254000	0.74563	0.482000	0.46254	AGA		0.368	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354520.1	NM_003304		12	43	0	0	0	0.020292	0	12	43				
ATP13A5	344905	broad.mit.edu	37	3	193019010	193019010	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr3:193019010A>T	ENST00000342358.4	-	24	2882	c.2765T>A	c.(2764-2766)cTg>cAg	p.L922Q	ATP13A5_ENST00000495496.1_5'UTR	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	922						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.L922Q(2)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		CCAATAGAGCAGTAATGCACT	0.353																																							uc011bsq.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|skin(4)|large_intestine(2)	11						c.(2764-2766)CTG>CAG		ATPase type 13A5							120.0	127.0	125.0					3																	193019010		2203	4300	6503	SO:0001583	missense	344905				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:193019010A>T	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2765T>A	3.37:g.193019010A>T	ENSP00000341942:p.Leu922Gln		Somatic					p.L922Q	NM_198505	NP_940907	WXS	Illumina HiSeq	Unspecified	Q4VNC0	AT135_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)	24	2765	-	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		922			Helical; (Potential).		Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	c.2765T>A	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.154468	0.57259	.	.	ENSG00000187527	ENST00000342358	D	0.89343	-2.5	6.13	6.13	0.99165	.	0.101185	0.42964	D	0.000639	D	0.93835	0.8028	M	0.77103	2.36	0.50313	D	0.999868	D	0.89917	1.0	D	0.76071	0.987	D	0.92731	0.6200	10	0.31617	T	0.26	-9.5221	14.7582	0.69583	1.0:0.0:0.0:0.0	.	922	Q4VNC0	AT135_HUMAN	Q	922	ENSP00000341942:L922Q	ENSP00000341942:L922Q	L	-	2	0	ATP13A5	194501704	1.000000	0.71417	1.000000	0.80357	0.172000	0.22775	8.881000	0.92415	2.367000	0.80283	0.529000	0.55759	CTG		0.353	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505		43	45	0	0	0	0.042209	0	43	45				
RNF212	285498	broad.mit.edu	37	4	1066945	1066945	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr4:1066945C>A	ENST00000433731.2	-	10	672	c.611G>T	c.(610-612)tGg>tTg	p.W204L	RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212	204					chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.W204L(2)		endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAAGGTCAACCATGGGATGAA	0.552											OREG0016028	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003gcj.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(610-612)TGG>TTG		ring finger protein 212 isoform a							80.0	70.0	73.0					4																	1066945		2203	4300	6503	SO:0001583	missense	285498						zinc ion binding	g.chr4:1066945C>A	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.611G>T	4.37:g.1066945C>A	ENSP00000389709:p.Trp204Leu		Somatic	OREG0016028	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	593	RNF212_uc003gch.2_Intron|RNF212_uc003gci.2_Intron|RNF212_uc010ibp.2_Intron|RNF212_uc010ibq.2_3'UTR	p.W204L	NM_001131034	NP_001124506	WXS	Illumina HiSeq	Unspecified	Q495C1	RN212_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)	10	941	-			204					C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	Missense_Mutation	SNP	ENST00000433731.2	37	c.611G>T	CCDS46996.1	.	.	.	.	.	.	.	.	.	.	C	3.807	-0.040499	0.07497	.	.	ENSG00000178222	ENST00000433731	T	0.53206	0.63	1.13	1.13	0.20643	.	.	.	.	.	T	0.24275	0.0588	N	0.08118	0	0.18873	N	0.999985	B	0.22604	0.072	B	0.14578	0.011	T	0.17198	-1.0377	9	0.56958	D	0.05	3.0614	5.6391	0.17554	0.0:1.0:0.0:0.0	.	204	Q495C1	RN212_HUMAN	L	204	ENSP00000389709:W204L	ENSP00000389709:W204L	W	-	2	0	RNF212	1056945	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.016000	0.13377	0.924000	0.37069	0.655000	0.94253	TGG		0.552	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359124.2	NM_194439		38	78	1	0	9.8876e-21	0.074837	1.31312e-20	38	78				
CC2D2A	57545	broad.mit.edu	37	4	15569349	15569349	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr4:15569349A>G	ENST00000503292.1	+	27	3518	c.3338A>G	c.(3337-3339)cAt>cGt	p.H1113R	CC2D2A_ENST00000389652.5_Missense_Mutation_p.H1064R|CC2D2A_ENST00000413206.1_Missense_Mutation_p.H1113R|CC2D2A_ENST00000424120.1_Missense_Mutation_p.H1113R	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	1113	C2.				cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)		p.H1113R(2)|p.H1064R(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						ACAGTTTGCCATACGACTACG	0.363																																							uc010idv.2		NA																	4	Substitution - Missense(4)		lung(4)	pancreas(2)|ovary(1)	3						c.(3337-3339)CAT>CGT		coiled-coil and C2 domain containing 2A isoform							82.0	78.0	79.0					4																	15569349		1859	4104	5963	SO:0001583	missense	57545				cell projection organization	cilium|microtubule basal body		g.chr4:15569349A>G	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.3338A>G	4.37:g.15569349A>G	ENSP00000421809:p.His1113Arg		Somatic				CC2D2A_uc003gnx.2_Missense_Mutation_p.H1064R|CC2D2A_uc003gnz.1_RNA|CC2D2A_uc003goa.1_RNA	p.H1113R	NM_001080522	NP_001073991	WXS	Illumina HiSeq	Unspecified	Q9P2K1	C2D2A_HUMAN			27	3583	+			1113			C2.		A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	37	c.3338A>G	CCDS47026.1	.	.	.	.	.	.	.	.	.	.	A	1.504	-0.551243	0.03996	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000503292;ENST00000389652	D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39	6.08	0.636	0.17729	C2 calcium-dependent membrane targeting (1);	0.258257	0.40818	N	0.001020	T	0.76449	0.3989	N	0.04959	-0.14	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.09377	0.004;0.002	T	0.65512	-0.6150	10	0.02654	T	1	.	1.9837	0.03432	0.5284:0.1263:0.2223:0.1229	.	1113;1064	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	R	1113;1113;1064;1064;1113;1064	ENSP00000403465:H1113R;ENSP00000398391:H1113R;ENSP00000421809:H1113R;ENSP00000374303:H1064R	ENSP00000374303:H1064R	H	+	2	0	CC2D2A	15178447	1.000000	0.71417	0.923000	0.36655	0.706000	0.40770	3.523000	0.53488	0.142000	0.18901	0.533000	0.62120	CAT		0.363	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522		6	15	0	0	0	0.02938	0	6	15				
PROL1	58503	broad.mit.edu	37	4	71275347	71275347	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr4:71275347G>T	ENST00000399575.2	+	3	476	c.302G>T	c.(301-303)gGt>gTt	p.G101V	PROL1_ENST00000514338.1_3'UTR	NM_021225.4	NP_067048.4	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	101	Pro-rich.				negative regulation of endopeptidase activity (GO:0010951)|regulation of sensory perception of pain (GO:0051930)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)|peptidase inhibitor activity (GO:0030414)	p.G101V(2)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	15		all_hematologic(202;0.196)				CTCTTTCCGGGTTATCCAAAC	0.403																																							uc003hfi.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)	1						c.(301-303)GGT>GTT		proline rich, lacrimal 1							209.0	197.0	201.0					4																	71275347		1856	4100	5956	SO:0001583	missense	58503				regulation of sensory perception of pain	extracellular region	endopeptidase inhibitor activity	g.chr4:71275347G>T	S83198	CCDS43235.1	4q13.3	2011-10-28	2005-02-07		ENSG00000171199	ENSG00000171199			17279	protein-coding gene	gene with protein product		608936	"""proline rich 1"""			8670737	Standard	NM_021225		Approved	BPLP, PRL1, opiorphin	uc003hfi.3	Q99935	OTTHUMG00000160845	ENST00000399575.2:c.302G>T	4.37:g.71275347G>T	ENSP00000382485:p.Gly101Val		Somatic					p.G101V	NM_021225	NP_067048	WXS	Illumina HiSeq	Unspecified	Q99935	PROL1_HUMAN			3	476	+		all_hematologic(202;0.196)	101			Pro-rich.		A8MZ07|P85047	Missense_Mutation	SNP	ENST00000399575.2	37	c.302G>T	CCDS43235.1	.	.	.	.	.	.	.	.	.	.	G	6.068	0.380887	0.11466	.	.	ENSG00000171199	ENST00000399575	T	0.31510	1.49	1.81	-0.149	0.13420	.	3.599270	0.01209	N	0.007786	T	0.21509	0.0518	L	0.39898	1.24	0.09310	N	1	P	0.38455	0.632	B	0.28991	0.097	T	0.19910	-1.0291	10	0.87932	D	0	.	2.1418	0.03777	0.2004:0.0:0.4906:0.3091	.	101	Q99935	PROL1_HUMAN	V	101	ENSP00000382485:G101V	ENSP00000382485:G101V	G	+	2	0	PROL1	71309936	0.001000	0.12720	0.000000	0.03702	0.025000	0.11179	0.251000	0.18257	-0.084000	0.12595	0.591000	0.81541	GGT		0.403	PROL1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362639.1	NM_021225		76	115	1	0	1.31311e-47	0.048971	1.89419e-47	76	115				
ADAMTS3	9508	broad.mit.edu	37	4	73149140	73149140	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr4:73149140C>T	ENST00000286657.4	-	22	3367	c.3331G>A	c.(3331-3333)Ggt>Agt	p.G1111S		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	1111					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G1111S(2)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCATTTGGACCTCCCACTGAA	0.463																																					NSCLC(168;1941 2048 2918 13048 43078)	NSCLC(168;1941 2048 2918 13048 43078)	uc003hgk.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)	2						c.(3331-3333)GGT>AGT		ADAM metallopeptidase with thrombospondin type 1							107.0	99.0	102.0					4																	73149140		2203	4300	6503	SO:0001583	missense	9508				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding	g.chr4:73149140C>T	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.3331G>A	4.37:g.73149140C>T	ENSP00000286657:p.Gly1111Ser		Somatic					p.G1111S	NM_014243	NP_055058	WXS	Illumina HiSeq	Unspecified	O15072	ATS3_HUMAN	Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		22	3368	-			1111					A1L3U9|Q9BXZ8	Missense_Mutation	SNP	ENST00000286657.4	37	c.3331G>A	CCDS3553.1	.	.	.	.	.	.	.	.	.	.	C	1.894	-0.454797	0.04540	.	.	ENSG00000156140	ENST00000286657	T	0.59906	0.23	5.56	2.19	0.27852	.	0.950360	0.08765	N	0.897086	T	0.33818	0.0876	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.21965	-1.0230	10	0.05620	T	0.96	.	7.4645	0.27314	0.0:0.6191:0.1282:0.2527	.	1111	O15072	ATS3_HUMAN	S	1111	ENSP00000286657:G1111S	ENSP00000286657:G1111S	G	-	1	0	ADAMTS3	73368004	0.082000	0.21442	0.010000	0.14722	0.026000	0.11368	0.892000	0.28322	0.605000	0.29947	0.591000	0.81541	GGT		0.463	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2			15	98	0	0	0	0.028581	0	15	98				
BBS7	55212	broad.mit.edu	37	4	122782798	122782798	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr4:122782798T>A	ENST00000264499.4	-	4	385	c.202A>T	c.(202-204)Agg>Tgg	p.R68W	BBS7_ENST00000506636.1_Missense_Mutation_p.R68W	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	68					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)	p.R68W(2)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						AGTTCCAGCCTTGCAATCTTC	0.398									Bardet-Biedl syndrome																														uc003ied.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(202-204)AGG>TGG		Bardet-Biedl syndrome 7 protein isoform a							72.0	71.0	71.0					4																	122782798		2203	4300	6503	SO:0001583	missense	55212	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	cilium morphogenesis|digestive tract morphogenesis|fat cell differentiation|heart looping|melanosome transport|pigment granule aggregation in cell center|response to stimulus|visual perception	BBSome|centrosome|cilium membrane	protein binding	g.chr4:122782798T>A	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.202A>T	4.37:g.122782798T>A	ENSP00000264499:p.Arg68Trp		Somatic				BBS7_uc003iee.1_Missense_Mutation_p.R68W|BBS7_uc010inq.1_Missense_Mutation_p.R24W	p.R68W	NM_176824	NP_789794	WXS	Illumina HiSeq	Unspecified	Q8IWZ6	BBS7_HUMAN			4	376	-			68					Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	ENST00000264499.4	37	c.202A>T	CCDS3724.1	.	.	.	.	.	.	.	.	.	.	T	16.77	3.214769	0.58452	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	D;D	0.93659	-3.26;-3.26	5.46	4.23	0.50019	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.96390	0.8822	M	0.80982	2.52	0.53688	D	0.999978	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.984	D	0.96855	0.9628	10	0.72032	D	0.01	-18.3416	14.1534	0.65401	0.0:0.0:0.2156:0.7844	.	68;68	Q8IWZ6-2;Q8IWZ6	.;BBS7_HUMAN	W	68	ENSP00000264499:R68W;ENSP00000423626:R68W	ENSP00000264499:R68W	R	-	1	2	BBS7	123002248	1.000000	0.71417	0.958000	0.39756	0.665000	0.39181	1.587000	0.36622	2.066000	0.61787	0.477000	0.44152	AGG		0.398	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256716.1			9	7	0	0	0	0.047766	0	9	7				
SNX25	83891	broad.mit.edu	37	4	186244912	186244912	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr4:186244912A>T	ENST00000504273.1	+	9	1509	c.1215A>T	c.(1213-1215)gaA>gaT	p.E405D	SNX25_ENST00000512853.1_3'UTR|SNX25_ENST00000264694.8_Missense_Mutation_p.E405D			Q9H3E2	SNX25_HUMAN	sorting nexin 25	405					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.E405D(2)		NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TAAAAGAGGAAGAAAAACATG	0.338																																							uc003ixh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(2)|pancreas(1)	5						c.(1213-1215)GAA>GAT		sorting nexin 25							56.0	54.0	55.0					4																	186244912		2203	4298	6501	SO:0001583	missense	83891				cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity	g.chr4:186244912A>T	AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.1215A>T	4.37:g.186244912A>T	ENSP00000426255:p.Glu405Asp		Somatic				SNX25_uc010ish.2_Missense_Mutation_p.E176D|SNX25_uc003ixi.2_Translation_Start_Site	p.E405D	NM_031953	NP_114159	WXS	Illumina HiSeq	Unspecified	Q9H3E2	SNX25_HUMAN		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)	9	1404	+		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)	405					Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	c.1215A>T	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	.	13.14	2.148397	0.37923	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.12039	2.72;2.72	5.81	-5.58	0.02512	.	0.272846	0.41001	N	0.000968	T	0.07413	0.0187	L	0.49350	1.555	0.32255	N	0.570846	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.27502	-1.0072	10	0.20519	T	0.43	-5.7053	1.6053	0.02682	0.3754:0.1065:0.3116:0.2065	.	176;405	Q8N6K3;Q9H3E2	.;SNX25_HUMAN	D	405	ENSP00000426255:E405D;ENSP00000264694:E405D	ENSP00000264694:E405D	E	+	3	2	SNX25	186481906	0.992000	0.36948	0.272000	0.24630	0.767000	0.43475	0.329000	0.19698	-1.252000	0.02491	0.454000	0.30748	GAA		0.338	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953		5	12	0	0	0	0.021553	0	5	12				
IRX1	79192	broad.mit.edu	37	5	3599727	3599727	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr5:3599727A>T	ENST00000302006.3	+	2	717	c.665A>T	c.(664-666)gAg>gTg	p.E222V	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	222					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.E222V(2)		biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GACGACGAGGAGATCGACCTG	0.632																																							uc003jde.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(664-666)GAG>GTG		iroquois homeobox protein 1							68.0	61.0	64.0					5																	3599727		2203	4300	6503	SO:0001583	missense	79192					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:3599727A>T	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.665A>T	5.37:g.3599727A>T	ENSP00000305244:p.Glu222Val		Somatic					p.E222V	NM_024337	NP_077313	WXS	Illumina HiSeq	Unspecified	P78414	IRX1_HUMAN			2	717	+			222					Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	c.665A>T	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.155606	0.78114	.	.	ENSG00000170549	ENST00000302006	T	0.62364	0.03	4.71	4.71	0.59529	.	0.356618	0.32190	N	0.006459	T	0.65037	0.2653	L	0.59436	1.845	0.58432	D	0.999999	P	0.41366	0.747	P	0.45971	0.499	T	0.67102	-0.5755	10	0.46703	T	0.11	.	14.2065	0.65737	1.0:0.0:0.0:0.0	.	222	P78414	IRX1_HUMAN	V	222	ENSP00000305244:E222V	ENSP00000305244:E222V	E	+	2	0	IRX1	3652727	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	8.968000	0.93407	1.727000	0.51537	0.533000	0.62120	GAG		0.632	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337		7	60	0	0	0	0.02938	0	7	60				
PRDM9	56979	broad.mit.edu	37	5	23524575	23524575	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr5:23524575C>A	ENST00000296682.3	+	10	1265	c.1083C>A	c.(1081-1083)taC>taA	p.Y361*		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	361					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.Y361*(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGGATGAATACGGCCAGGAAC	0.512										HNSCC(3;0.000094)																													uc003jgo.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(1081-1083)TAC>TAA		PR domain containing 9							126.0	126.0	126.0					5																	23524575		1932	4133	6065	SO:0001587	stop_gained	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23524575C>A	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1083C>A	5.37:g.23524575C>A	ENSP00000296682:p.Tyr361*	HNSCC(3;0.000094)	Somatic					p.Y361*	NM_020227	NP_064612	WXS	Illumina HiSeq	Unspecified	Q9NQV7	PRDM9_HUMAN			10	1265	+			361			SET.		B4DX22|Q27Q50	Nonsense_Mutation	SNP	ENST00000296682.3	37	c.1083C>A	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	c	15.55	2.866628	0.51588	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	.	.	.	4.23	-8.45	0.00946	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1245	14.1838	0.65592	0.0:0.2525:0.0:0.7475	.	.	.	.	X	361;155	.	ENSP00000253473:Y155X	Y	+	3	2	PRDM9	23560332	0.285000	0.24296	0.678000	0.29963	0.068000	0.16541	-1.368000	0.02580	-2.276000	0.00678	-2.771000	0.00119	TAC		0.512	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		42	65	1	0	5.34276e-22	0.048971	7.24882e-22	42	65				
CDH9	1007	broad.mit.edu	37	5	26915812	26915812	+	Missense_Mutation	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr5:26915812T>C	ENST00000231021.4	-	3	621	c.449A>G	c.(448-450)cAt>cGt	p.H150R		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	150	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H150R(2)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ATTGATATCATGTATTTTAAT	0.388																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(448-450)CAT>CGT		cadherin 9, type 2 preproprotein							101.0	100.0	100.0					5																	26915812		2203	4300	6503	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26915812T>C	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.449A>G	5.37:g.26915812T>C	ENSP00000231021:p.His150Arg		Somatic				CDH9_uc010iug.2_Missense_Mutation_p.H150R	p.H150R	NM_016279	NP_057363	WXS	Illumina HiSeq	Unspecified	Q9ULB4	CADH9_HUMAN			3	618	-			150			Extracellular (Potential).|Cadherin 1.		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.449A>G	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.179587	0.78564	.	.	ENSG00000113100	ENST00000231021	T	0.60299	0.2	4.62	4.62	0.57501	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.62417	0.2426	M	0.62723	1.935	0.54753	D	0.999981	P	0.52692	0.955	P	0.50082	0.63	T	0.64214	-0.6460	9	.	.	.	.	13.1548	0.59511	0.0:0.0:0.0:1.0	.	150	Q9ULB4	CADH9_HUMAN	R	150	ENSP00000231021:H150R	.	H	-	2	0	CDH9	26951569	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.910000	0.87451	1.846000	0.53633	0.528000	0.53228	CAT		0.388	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		27	39	0	0	0	0.099896	0	27	39				
ALDH7A1	501	broad.mit.edu	37	5	125912853	125912853	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr5:125912853T>A	ENST00000409134.3	-	6	787	c.568A>T	c.(568-570)Atc>Ttc	p.I190F	ALDH7A1_ENST00000553117.1_Missense_Mutation_p.I190F|ALDH7A1_ENST00000413020.1_5'UTR|ALDH7A1_ENST00000447989.2_Missense_Mutation_p.I217F	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	190					cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)	p.I162F(2)|p.I217F(2)		endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		GCCGTGATGATTCCAACCAGG	0.483																																							uc003ktx.2		NA																	4	Substitution - Missense(4)		lung(4)	kidney(2)|ovary(1)	3						c.(568-570)ATC>TTC		aldehyde dehydrogenase 7 family, member A1	NADH(DB00157)|Pyridoxine(DB00165)						114.0	94.0	101.0					5																	125912853		2203	4300	6503	SO:0001583	missense	501				cellular aldehyde metabolic process|lysine catabolic process|sensory perception of sound	cytosol|mitochondrial matrix|nucleus	aldehyde dehydrogenase (NAD) activity|betaine-aldehyde dehydrogenase activity|L-aminoadipate-semialdehyde dehydrogenase activity	g.chr5:125912853T>A	S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.568A>T	5.37:g.125912853T>A	ENSP00000387123:p.Ile190Phe		Somatic				ALDH7A1_uc003kty.2_RNA|ALDH7A1_uc011cxa.1_Missense_Mutation_p.I217F|ALDH7A1_uc003ktz.2_Missense_Mutation_p.I217F	p.I190F	NM_001182	NP_001173	WXS	Illumina HiSeq	Unspecified	P49419	AL7A1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)	6	760	-		all_cancers(142;0.24)|Prostate(80;0.081)	190					B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	Missense_Mutation	SNP	ENST00000409134.3	37	c.568A>T	CCDS4137.2	.	.	.	.	.	.	.	.	.	.	T	16.24	3.066917	0.55539	.	.	ENSG00000164904	ENST00000409134;ENST00000553117;ENST00000447989;ENST00000510111	D;D;D;D	0.91295	-2.82;-2.82;-2.82;-2.82	5.2	2.8	0.32819	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.049087	0.85682	D	0.000000	D	0.94125	0.8116	M	0.83312	2.635	0.80722	D	1	D;D;D	0.63880	0.992;0.993;0.988	D;D;P	0.66847	0.944;0.947;0.888	D	0.93011	0.6432	10	0.87932	D	0	.	8.7946	0.34872	0.0:0.2202:0.0:0.7798	.	217;217;190	E7EPT3;B4DMA0;P49419	.;.;AL7A1_HUMAN	F	190;190;217;161	ENSP00000387123:I190F;ENSP00000448593:I190F;ENSP00000414132:I217F;ENSP00000447388:I161F	ENSP00000387123:I190F	I	-	1	0	ALDH7A1	125940752	1.000000	0.71417	0.829000	0.32907	0.385000	0.30292	2.036000	0.41165	0.524000	0.28502	-0.290000	0.09829	ATC		0.483	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250921.2	NM_001182		24	16	0	0	0	0.083992	0	24	16				
HARS	3035	broad.mit.edu	37	5	140070879	140070879	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr5:140070879C>A	ENST00000504156.1	-	1	730	c.11G>T	c.(10-12)cGt>cTt	p.R4L	HARS2_ENST00000230771.3_5'Flank|HARS_ENST00000457527.2_Missense_Mutation_p.R4L|HARS_ENST00000438307.2_Missense_Mutation_p.R4L|HARS_ENST00000448240.1_5'UTR|HARS2_ENST00000432671.2_5'Flank|HARS2_ENST00000435019.2_5'Flank|HARS2_ENST00000508522.1_5'Flank|HARS_ENST00000307633.3_Missense_Mutation_p.R4L|HARS_ENST00000431330.2_Missense_Mutation_p.R4L|HARS_ENST00000415192.2_Missense_Mutation_p.R4L|HARS2_ENST00000448069.2_5'Flank|HARS2_ENST00000437649.2_5'Flank	NM_002109.4	NP_002100.2	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	4	WHEP-TRS.				gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)	p.R4L(4)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)	CAGCGCCGCACGCTCTGCCAT	0.652																																							uc003lgv.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(1)|skin(1)	2						c.(10-12)CGT>CTT		histidyl-tRNA synthetase	L-Histidine(DB00117)						28.0	25.0	26.0					5																	140070879		2202	4300	6502	SO:0001583	missense	3035				histidyl-tRNA aminoacylation	cytosol	ATP binding|histidine-tRNA ligase activity	g.chr5:140070879C>A	AK000498	CCDS4237.1, CCDS58976.1, CCDS58977.1, CCDS58978.1, CCDS75323.1, CCDS75324.1	5q31.3	2012-10-02			ENSG00000170445	ENSG00000170445	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4816	protein-coding gene	gene with protein product	"""histidine tRNA ligase 1, cytoplasmic"""	142810					Standard	XM_005268428		Approved		uc003lgv.4	P12081	OTTHUMG00000129502	ENST00000504156.1:c.11G>T	5.37:g.140070879C>A	ENSP00000425634:p.Arg4Leu		Somatic				HARS_uc011czm.1_Missense_Mutation_p.R4L|HARS_uc003lgw.2_Missense_Mutation_p.R4L|HARS_uc011czn.1_Missense_Mutation_p.R4L|HARS_uc010jfu.2_Missense_Mutation_p.R4L|HARS_uc011czo.1_Missense_Mutation_p.R4L|HARS_uc011czp.1_Missense_Mutation_p.R4L|HARS_uc011czq.1_Missense_Mutation_p.R4L|HARS2_uc010jfv.1_5'Flank|HARS2_uc003lgx.2_5'Flank|HARS2_uc011czr.1_5'Flank|HARS2_uc011czs.1_5'Flank|HARS2_uc011czt.1_5'Flank	p.R4L	NM_002109	NP_002100	WXS	Illumina HiSeq	Unspecified	P12081	SYHC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	93	-			4			WHEP-TRS.		B4DHQ1|B4DY73|D6REN6|J3KNE5	Missense_Mutation	SNP	ENST00000504156.1	37	c.11G>T	CCDS4237.1	.	.	.	.	.	.	.	.	.	.	c	19.28	3.796563	0.70567	.	.	ENSG00000170445	ENST00000504156;ENST00000457527;ENST00000431330;ENST00000307633;ENST00000438307;ENST00000415192;ENST00000507746	T;T;T;T;T;T;T	0.37915	1.48;1.48;1.17;1.21;1.21;1.27;1.47	5.65	5.65	0.86999	WHEP-TRS (1);S15/NS1, RNA-binding (2);	0.427648	0.26297	N	0.025187	T	0.28101	0.0693	N	0.25890	0.77	0.80722	D	1	P;P;P;B;P;B;P;P	0.43701	0.815;0.649;0.649;0.055;0.499;0.081;0.649;0.499	B;B;B;B;B;B;B;B	0.35073	0.195;0.184;0.184;0.024;0.091;0.01;0.091;0.091	T	0.10428	-1.0630	10	0.66056	D	0.02	-3.8994	18.6545	0.91445	0.0:1.0:0.0:0.0	.	4;4;4;4;4;4;4;4	B4DEA2;B4E1C5;B4DDD8;B4DHQ1;B4DY73;Q52NV4;D6REN6;P12081	.;.;.;.;.;.;.;SYHC_HUMAN	L	4	ENSP00000425634:R4L;ENSP00000387893:R4L;ENSP00000393244:R4L;ENSP00000304668:R4L;ENSP00000411511:R4L;ENSP00000411085:R4L;ENSP00000425889:R4L	ENSP00000304668:R4L	R	-	2	0	HARS	140051063	0.002000	0.14202	0.156000	0.22583	0.139000	0.21198	1.043000	0.30316	2.941000	0.99782	0.655000	0.94253	CGT		0.652	HARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251673.2	NM_002109		16	7	1	0	4.14922e-12	0.028581	5.03118e-12	16	7				
SPRY4	81848	broad.mit.edu	37	5	141693948	141693948	+	Silent	SNP	G	G	A	rs145360326	byFrequency	TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr5:141693948G>A	ENST00000434127.2	-	2	969	c.726C>T	c.(724-726)tcC>tcT	p.S242S	SPRY4_ENST00000503582.1_5'Flank|SPRY4_ENST00000344120.4_Silent_p.S265S	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	242	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.S265S(3)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGCACCACGGAGAGAGCAC	0.682									Testicular Cancer, Familial Clustering of																														uc003lml.2		NA																	3	Substitution - coding silent(3)		lung(2)|large_intestine(1)	ovary(1)|lung(1)	2						c.(724-726)TCC>TCT		sprouty homolog 4 isoform 2		G	,	2,4404	4.2+/-10.8	0,2,2201	60.0	60.0	60.0		726,795	0.7	1.0	5	dbSNP_134	60	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous,coding-synonymous	SPRY4	NM_001127496.1,NM_030964.3	,	0,7,6496	AA,AG,GG		0.0581,0.0454,0.0538	,	242/300,265/323	141693948	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	81848	Testicular_Cancer_Familial_Clustering_of	Familial Cancer Database		multicellular organismal development	cytoplasm|ruffle membrane	protein binding	g.chr5:141693948G>A	AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.726C>T	5.37:g.141693948G>A			Somatic				SPRY4_uc010jgi.1_Silent_p.S265S	p.S242S	NM_001127496	NP_001120968	WXS	Illumina HiSeq	Unspecified	Q9C004	SPY4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		2	985	-		all_hematologic(541;0.118)	242			Cys-rich.|SPR.		A4FVB2|A4FVB3|Q6QIX2|Q9C003	Silent	SNP	ENST00000434127.2	37	c.726C>T	CCDS47296.1																																																																																				0.682	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370652.1			8	24	0	0	0	0.047766	0	8	24				
HIST1H4E	8367	broad.mit.edu	37	6	26204930	26204930	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr6:26204930C>A	ENST00000360441.4	+	1	73	c.58C>A	c.(58-60)Cgt>Agt	p.R20S		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	20					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.R20S(2)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				TAAGCGTCACCGTAAGGTCCT	0.547																																							uc003ngy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(58-60)CGT>AGT		histone cluster 1, H4e							85.0	84.0	85.0					6																	26204930		2203	4300	6503	SO:0001583	missense	8367				CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26204930C>A	Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.58C>A	6.37:g.26204930C>A	ENSP00000353624:p.Arg20Ser		Somatic					p.R20S	NM_003545	NP_003536	WXS	Illumina HiSeq	Unspecified	P62805	H4_HUMAN			1	58	+		all_hematologic(11;0.196)	20					A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000360441.4	37	c.58C>A	CCDS4593.1	.	.	.	.	.	.	.	.	.	.	.	10.77	1.444878	0.25987	.	.	ENSG00000198518	ENST00000360441	.	.	.	2.2	2.2	0.27929	.	0.000000	0.64402	U	0.000001	T	0.53530	0.1802	.	.	.	0.54753	D	0.999985	.	.	.	.	.	.	T	0.60047	-0.7339	6	0.87932	D	0	.	8.2328	0.31608	0.2384:0.7616:0.0:0.0	.	.	.	.	S	20	.	ENSP00000353624:R20S	R	+	1	0	HIST1H4E	26312909	1.000000	0.71417	0.411000	0.26484	0.005000	0.04900	4.403000	0.59729	1.521000	0.48983	0.655000	0.94253	CGT		0.547	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040104.1	NM_003545		26	110	1	0	7.88262e-20	0.083992	1.04134e-19	26	110				
DAAM2	23500	broad.mit.edu	37	6	39869182	39869182	+	Silent	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr6:39869182G>C	ENST00000398904.2	+	24	3098	c.2916G>C	c.(2914-2916)cgG>cgC	p.R972R	DAAM2_ENST00000538976.1_Silent_p.R971R|RP11-61I13.3_ENST00000437947.1_RNA|DAAM2_ENST00000274867.4_Silent_p.R972R			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	972	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)			p.R971R(2)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					CAGAGGCCCGGCAGGATCTAG	0.607																																							uc003oow.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(1)	3						c.(2914-2916)CGG>CGC		dishevelled associated activator of							66.0	70.0	69.0					6																	39869182		1994	4171	6165	SO:0001819	synonymous_variant	23500				actin cytoskeleton organization		actin binding|Rho GTPase binding	g.chr6:39869182G>C	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.2916G>C	6.37:g.39869182G>C			Somatic				DAAM2_uc003oox.2_Silent_p.R971R	p.R972R	NM_015345	NP_056160	WXS	Illumina HiSeq	Unspecified	Q86T65	DAAM2_HUMAN			24	3072	+	Ovarian(28;0.0355)|Colorectal(47;0.196)		972			FH2.		G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Silent	SNP	ENST00000398904.2	37	c.2916G>C	CCDS56426.1																																																																																				0.607	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1			38	77	0	0	0	0.074837	0	38	77				
HMGCLL1	54511	broad.mit.edu	37	6	55364093	55364093	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr6:55364093C>A	ENST00000398661.2	-	7	768	c.637G>T	c.(637-639)Gtg>Ttg	p.V213L	HMGCLL1_ENST00000508459.1_Intron|HMGCLL1_ENST00000274901.4_Missense_Mutation_p.V183L|HMGCLL1_ENST00000308161.4_Missense_Mutation_p.V151L|HMGCLL1_ENST00000370850.2_Intron	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	213					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)	p.V213L(2)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			GCACAAGACACATACCTAAAT	0.323																																					Ovarian(35;840 893 7837 15538 42887)	Ovarian(35;840 893 7837 15538 42887)	uc003pcn.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)|pancreas(1)	4						c.(637-639)GTG>TTG		3-hydroxymethyl-3-methylglutaryl-Coenzyme A							101.0	99.0	100.0					6																	55364093		1844	4093	5937	SO:0001583	missense	54511						hydroxymethylglutaryl-CoA lyase activity|metal ion binding	g.chr6:55364093C>A	AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.637G>T	6.37:g.55364093C>A	ENSP00000381654:p.Val213Leu		Somatic				HMGCLL1_uc003pco.2_Missense_Mutation_p.V183L|HMGCLL1_uc010jzx.2_Missense_Mutation_p.V84L|HMGCLL1_uc011dxc.1_Missense_Mutation_p.V151L|HMGCLL1_uc011dxd.1_Intron|HMGCLL1_uc011dxe.1_Intron	p.V213L	NM_019036	NP_061909	WXS	Illumina HiSeq	Unspecified	Q8TB92	HMGC2_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		7	796	-	Lung NSC(77;0.0875)		213					B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	ENST00000398661.2	37	c.637G>T	CCDS43475.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399270	0.62177	.	.	ENSG00000146151	ENST00000274901;ENST00000398661;ENST00000308161	D;D;D	0.97924	-4.61;-4.61;-4.61	5.72	5.72	0.89469	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.187424	0.45361	D	0.000378	D	0.95962	0.8685	L	0.53561	1.675	0.80722	D	1	B;B;B	0.23128	0.054;0.02;0.08	B;B;B	0.32624	0.149;0.086;0.149	D	0.93049	0.6464	10	0.41790	T	0.15	-19.9046	19.8965	0.96963	0.0:1.0:0.0:0.0	.	151;183;213	F8W793;Q8TB92-2;Q8TB92	.;.;HMGC2_HUMAN	L	183;213;151	ENSP00000274901:V183L;ENSP00000381654:V213L;ENSP00000309737:V151L	ENSP00000274901:V183L	V	-	1	0	HMGCLL1	55472052	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	4.952000	0.63618	2.717000	0.92951	0.655000	0.94253	GTG		0.323	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360290.1	XM_166383		5	20	1	0	0.000602214	0.014758	0.000629816	5	20				
EPHA7	2045	broad.mit.edu	37	6	93956601	93956601	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr6:93956601C>T	ENST00000369303.4	-	15	2819	c.2635G>A	c.(2635-2637)Gaa>Aaa	p.E879K		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	879	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.E879K(2)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TTTGGCCTTTCAGCACGCTCC	0.418																																							uc003poe.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28						c.(2635-2637)GAA>AAA		ephrin receptor EphA7 precursor							119.0	114.0	116.0					6																	93956601		2203	4300	6503	SO:0001583	missense	2045					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr6:93956601C>T	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2635G>A	6.37:g.93956601C>T	ENSP00000358309:p.Glu879Lys		Somatic				EPHA7_uc003pof.2_Missense_Mutation_p.E874K|EPHA7_uc011eac.1_Missense_Mutation_p.E875K	p.E879K	NM_004440	NP_004431	WXS	Illumina HiSeq	Unspecified	Q15375	EPHA7_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0847)	15	2876	-		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)	879			Cytoplasmic (Potential).|Protein kinase.		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	c.2635G>A	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531789	0.85706	.	.	ENSG00000135333	ENST00000369303	D	0.82344	-1.6	5.74	5.74	0.90152	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.050665	0.85682	D	0.000000	T	0.67878	0.2940	N	0.13003	0.285	0.80722	D	1	B;P;P	0.42961	0.069;0.756;0.795	B;B;B	0.44278	0.025;0.317;0.445	T	0.68945	-0.5275	10	0.22706	T	0.39	.	19.9265	0.97104	0.0:1.0:0.0:0.0	.	875;874;879	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	K	879	ENSP00000358309:E879K	ENSP00000358309:E879K	E	-	1	0	EPHA7	94013322	1.000000	0.71417	0.960000	0.40013	0.988000	0.76386	4.842000	0.62831	2.723000	0.93209	0.591000	0.81541	GAA		0.418	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			27	15	0	0	0	0.099896	0	27	15				
PTPRK	5796	broad.mit.edu	37	6	128404945	128404945	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr6:128404945G>C	ENST00000368215.3	-	9	1489	c.1490C>G	c.(1489-1491)tCt>tGt	p.S497C	RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000368207.3_Missense_Mutation_p.S497C|PTPRK_ENST00000368210.3_Missense_Mutation_p.S497C|PTPRK_ENST00000368226.4_Missense_Mutation_p.S497C|PTPRK_ENST00000368227.3_Missense_Mutation_p.S497C|PTPRK_ENST00000532331.1_Missense_Mutation_p.S497C|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368213.5_Missense_Mutation_p.S497C			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	497	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.S497C(2)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TCCTTGAAGAGATTTTACTGG	0.338																																							uc003qbk.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8						c.(1489-1491)TCT>TGT		protein tyrosine phosphatase, receptor type, K							89.0	90.0	89.0					6																	128404945		2203	4299	6502	SO:0001583	missense	5796				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr6:128404945G>C	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1490C>G	6.37:g.128404945G>C	ENSP00000357198:p.Ser497Cys		Somatic				PTPRK_uc003qbj.2_Missense_Mutation_p.S497C|PTPRK_uc010kfc.2_Missense_Mutation_p.S497C|PTPRK_uc011ebu.1_Missense_Mutation_p.S497C|PTPRK_uc003qbl.1_Missense_Mutation_p.S367C|PTPRK_uc011ebv.1_Missense_Mutation_p.S497C	p.S497C	NM_002844	NP_002835	WXS	Illumina HiSeq	Unspecified	Q15262	PTPRK_HUMAN		all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)	9	1857	-			497			Extracellular (Potential).|Fibronectin type-III 3.		B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	37	c.1490C>G		.	.	.	.	.	.	.	.	.	.	G	19.96	3.923896	0.73213	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000427676	T;T;T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49;0.49;0.49	6.02	6.02	0.97574	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.056943	0.64402	D	0.000001	T	0.71558	0.3354	M	0.82056	2.57	0.45852	D	0.998712	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.99;1.0;0.999;0.994;0.977;0.96	T	0.68462	-0.5402	10	0.41790	T	0.15	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	497;497;497;354;497;497	B4DHC3;B7ZMG0;Q15262-3;F5GWP2;Q15262;Q15262-2	.;.;.;.;PTPRK_HUMAN;.	C	497;497;497;497;497;497;497;354	ENSP00000357209:S497C;ENSP00000357210:S497C;ENSP00000432973:S497C;ENSP00000357196:S497C;ENSP00000357193:S497C;ENSP00000357198:S497C;ENSP00000357190:S497C	ENSP00000357190:S497C	S	-	2	0	PTPRK	128446638	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	6.389000	0.73199	2.850000	0.98022	0.650000	0.86243	TCT		0.338	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1			4	18	0	0	0	0.009096	0	4	18				
THBS2	7058	broad.mit.edu	37	6	169621556	169621556	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr6:169621556G>C	ENST00000366787.3	-	21	3589	c.3340C>G	c.(3340-3342)Ctg>Gtg	p.L1114V	THBS2_ENST00000488355.1_5'UTR|XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	1114	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.L1114V(2)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CTGTGAGTCAGGTGCCACCTA	0.547																																					Esophageal Squamous(91;219 1934 18562 44706)	Esophageal Squamous(91;219 1934 18562 44706)	uc003qwt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)	5						c.(3340-3342)CTG>GTG		thrombospondin 2 precursor							163.0	137.0	146.0					6																	169621556		2203	4300	6503	SO:0001583	missense	7058				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity	g.chr6:169621556G>C		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.3340C>G	6.37:g.169621556G>C	ENSP00000355751:p.Leu1114Val		Somatic					p.L1114V	NM_003247	NP_003238	WXS	Illumina HiSeq	Unspecified	P35442	TSP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)	21	3588	-		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)	1114			TSP C-terminal.		A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	c.3340C>G	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323201	0.81580	.	.	ENSG00000186340	ENST00000366787;ENST00000392099	D	0.94613	-3.47	4.92	4.92	0.64577	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.32218	U	0.006418	D	0.93387	0.7891	M	0.73962	2.25	0.49582	D	0.999805	D	0.58620	0.983	P	0.51055	0.657	D	0.93226	0.6613	10	0.51188	T	0.08	-30.145	9.535	0.39218	0.1319:0.0:0.8681:0.0	.	1114	P35442	TSP2_HUMAN	V	1114;372	ENSP00000355751:L1114V	ENSP00000355751:L1114V	L	-	1	2	THBS2	169363481	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	4.790000	0.62453	2.267000	0.75376	0.579000	0.79373	CTG		0.547	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		47	43	0	0	0	0.048971	0	47	43				
THSD7A	221981	broad.mit.edu	37	7	11501681	11501681	+	Missense_Mutation	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr7:11501681C>T	ENST00000423059.4	-	10	2709	c.2458G>A	c.(2458-2460)Gaa>Aaa	p.E820K	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	820	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E820K(2)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GCCTTCTCTTCATAGAGGGGA	0.542										HNSCC(18;0.044)																													uc003ssf.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(2458-2460)GAA>AAA		thrombospondin, type I, domain containing 7A							190.0	183.0	185.0					7																	11501681		1971	4152	6123	SO:0001583	missense	221981					integral to membrane		g.chr7:11501681C>T		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2458G>A	7.37:g.11501681C>T	ENSP00000406482:p.Glu820Lys	HNSCC(18;0.044)	Somatic					p.E820K	NM_015204	NP_056019	WXS	Illumina HiSeq	Unspecified	Q9UPZ6	THS7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	10	2710	-			820			TSP type-1 8.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000423059.4	37	c.2458G>A	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.828547	0.71258	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.22539	1.95	5.27	5.27	0.74061	.	0.157526	0.64402	D	0.000008	T	0.46946	0.1419	M	0.83483	2.645	0.49798	D	0.999828	P	0.45986	0.87	P	0.57057	0.812	T	0.37502	-0.9703	10	0.48119	T	0.1	.	17.6166	0.88069	0.0:1.0:0.0:0.0	.	820	Q9UPZ6	THS7A_HUMAN	K	820	ENSP00000406482:E820K	ENSP00000262042:E820K	E	-	1	0	THSD7A	11468206	0.992000	0.36948	1.000000	0.80357	0.269000	0.26545	2.673000	0.46858	2.902000	0.99343	0.650000	0.86243	GAA		0.542	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		61	103	0	0	0	0.048971	0	61	103				
THSD7A	221981	broad.mit.edu	37	7	11633039	11633039	+	Silent	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr7:11633039G>T	ENST00000423059.4	-	3	1364	c.1113C>A	c.(1111-1113)ccC>ccA	p.P371P		NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	371	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P371P(2)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TTTTTGAGCAGGGGCTCCACT	0.517										HNSCC(18;0.044)																													uc003ssf.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(1111-1113)CCC>CCA		thrombospondin, type I, domain containing 7A							103.0	101.0	102.0					7																	11633039		1940	4153	6093	SO:0001819	synonymous_variant	221981					integral to membrane		g.chr7:11633039G>T		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.1113C>A	7.37:g.11633039G>T		HNSCC(18;0.044)	Somatic					p.P371P	NM_015204	NP_056019	WXS	Illumina HiSeq	Unspecified	Q9UPZ6	THS7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	3	1365	-			371			TSP type-1 3.|Extracellular (Potential).			Silent	SNP	ENST00000423059.4	37	c.1113C>A	CCDS47543.1																																																																																				0.517	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		23	55	1	0	0.000229342	0.062417	0.000244956	23	55				
ZNF479	90827	broad.mit.edu	37	7	57188680	57188680	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr7:57188680A>G	ENST00000331162.4	-	5	712	c.442T>C	c.(442-444)Tgt>Cgt	p.C148R		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C148R(2)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			GTTGACAAACATTGGTTAACT	0.308																																							uc010kzo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(1)	4						c.(442-444)TGT>CGT		zinc finger protein 479							86.0	81.0	82.0					7																	57188680		1856	4107	5963	SO:0001583	missense	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57188680A>G	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.442T>C	7.37:g.57188680A>G	ENSP00000333776:p.Cys148Arg		Somatic					p.C148R	NM_033273	NP_150376	WXS	Illumina HiSeq	Unspecified	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	713	-			148						Missense_Mutation	SNP	ENST00000331162.4	37	c.442T>C	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	a	6.966	0.548124	0.13312	.	.	ENSG00000185177	ENST00000331162	T	0.54479	0.57	1.6	-3.21	0.05140	.	.	.	.	.	T	0.46308	0.1386	M	0.67625	2.065	0.09310	N	1	P	0.45902	0.868	P	0.44860	0.462	T	0.32798	-0.9893	9	0.45353	T	0.12	.	2.5969	0.04856	0.474:0.0:0.3103:0.2157	.	148	Q96JC4	ZN479_HUMAN	R	148	ENSP00000333776:C148R	ENSP00000333776:C148R	C	-	1	0	ZNF479	57192622	0.003000	0.15002	0.001000	0.08648	0.011000	0.07611	-0.211000	0.09332	-1.840000	0.01184	-1.273000	0.01405	TGT		0.308	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		24	25	0	0	0	0.099896	0	24	25				
AUTS2	26053	broad.mit.edu	37	7	70255663	70255663	+	Missense_Mutation	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr7:70255663G>A	ENST00000342771.4	+	19	3782	c.3461G>A	c.(3460-3462)cGc>cAc	p.R1154H	AUTS2_ENST00000406775.2_Missense_Mutation_p.R1130H	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1154	His-rich.							p.R1154H(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GAGCGGGAGCGCTTGCACATG	0.692																																							uc003tvw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(3460-3462)CGC>CAC		autism susceptibility candidate 2 isoform 1							35.0	40.0	38.0					7																	70255663		2203	4299	6502	SO:0001583	missense	26053							g.chr7:70255663G>A	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3461G>A	7.37:g.70255663G>A	ENSP00000344087:p.Arg1154His		Somatic				AUTS2_uc003tvx.3_Missense_Mutation_p.R1130H|AUTS2_uc011keg.1_Missense_Mutation_p.R606H	p.R1154H	NM_015570	NP_056385	WXS	Illumina HiSeq	Unspecified	Q8WXX7	AUTS2_HUMAN		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)	19	4204	+		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)	1154			His-rich.		A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	c.3461G>A	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.635493	0.87760	.	.	ENSG00000158321	ENST00000406775;ENST00000342771	T;T	0.65364	-0.15;-0.15	5.15	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.74291	0.3697	L	0.57536	1.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.996	T	0.73839	-0.3856	9	.	.	.	-29.3997	13.5374	0.61653	0.0756:0.0:0.9244:0.0	.	606;1130;1154	B4DLG0;Q8WXX7-2;Q8WXX7	.;.;AUTS2_HUMAN	H	1130;1154	ENSP00000385263:R1130H;ENSP00000344087:R1154H	.	R	+	2	0	AUTS2	69893599	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	9.294000	0.96088	1.177000	0.42855	0.655000	0.94253	CGC		0.692	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2			7	59	0	0	0	0.038147	0	7	59				
WBSCR17	64409	broad.mit.edu	37	7	70853343	70853343	+	Missense_Mutation	SNP	A	A	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr7:70853343A>G	ENST00000333538.5	+	3	1179	c.545A>G	c.(544-546)cAc>cGc	p.H182R	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	182	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.H182R(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ACGCCCACACACCTGCTGAAG	0.557																																							uc003tvy.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7						c.(544-546)CAC>CGC		UDP-GalNAc:polypeptide							138.0	102.0	114.0					7																	70853343		2203	4300	6503	SO:0001583	missense	64409					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr7:70853343A>G	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.545A>G	7.37:g.70853343A>G	ENSP00000329654:p.His182Arg		Somatic				WBSCR17_uc003tvz.2_5'UTR	p.H182R	NM_022479	NP_071924	WXS	Illumina HiSeq	Unspecified	Q6IS24	GLTL3_HUMAN			3	545	+		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)	182			Catalytic subdomain A.|Lumenal (Potential).		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	c.545A>G	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	A	14.10	2.433621	0.43224	.	.	ENSG00000185274	ENST00000333538;ENST00000447516	T;T	0.58506	0.33;0.33	5.58	5.58	0.84498	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.48978	0.1530	L	0.41236	1.265	0.58432	D	0.999998	B	0.14012	0.009	B	0.17979	0.02	T	0.43343	-0.9397	10	0.40728	T	0.16	.	12.4063	0.55441	0.8602:0.1398:0.0:0.0	.	182	Q6IS24	GLTL3_HUMAN	R	182;160	ENSP00000329654:H182R;ENSP00000392019:H160R	ENSP00000329654:H182R	H	+	2	0	WBSCR17	70491279	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	6.241000	0.72369	2.246000	0.74042	0.533000	0.62120	CAC		0.557	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479		36	50	0	0	0	0.080422	0	36	50				
CHRM2	1129	broad.mit.edu	37	7	136699878	136699878	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr7:136699878G>C	ENST00000445907.2	+	3	794	c.266G>C	c.(265-267)tGg>tCg	p.W89S	hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.W89S|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.W89S|CHRM2_ENST00000320658.5_Missense_Mutation_p.W89S|CHRM2_ENST00000401861.1_Missense_Mutation_p.W89S|CHRM2_ENST00000453373.1_Missense_Mutation_p.W89S	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	89					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)	p.W89S(2)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	ATTGGTTACTGGCCTTTGGGA	0.463																																							uc003vtf.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)	5						c.(265-267)TGG>TCG		cholinergic receptor, muscarinic 2	Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)						202.0	189.0	193.0					7																	136699878		2203	4300	6503	SO:0001583	missense	1129				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding	g.chr7:136699878G>C		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.266G>C	7.37:g.136699878G>C	ENSP00000399745:p.Trp89Ser		Somatic				CHRM2_uc003vtg.1_Missense_Mutation_p.W89S|CHRM2_uc003vtj.1_Missense_Mutation_p.W89S|CHRM2_uc003vtk.1_Missense_Mutation_p.W89S|CHRM2_uc003vtl.1_Missense_Mutation_p.W89S|CHRM2_uc003vtm.1_Missense_Mutation_p.W89S|CHRM2_uc003vti.1_Missense_Mutation_p.W89S|CHRM2_uc003vto.1_Missense_Mutation_p.W89S|CHRM2_uc003vtn.1_Missense_Mutation_p.W89S|uc003vtp.1_Intron	p.W89S	NM_001006630	NP_001006631	WXS	Illumina HiSeq	Unspecified	P08172	ACM2_HUMAN			4	889	+			89			Extracellular (By similarity).		Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	37	c.266G>C	CCDS5843.1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.702488	0.68501	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08;-1.08	5.72	5.72	0.89469	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.92509	0.7621	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94227	0.7473	10	0.87932	D	0	-18.0747	19.9401	0.97155	0.0:0.0:1.0:0.0	.	89	P08172	ACM2_HUMAN	S	89	ENSP00000399745:W89S;ENSP00000415386:W89S;ENSP00000319984:W89S;ENSP00000380733:W89S;ENSP00000384937:W89S;ENSP00000384401:W89S	ENSP00000319984:W89S	W	+	2	0	CHRM2	136350418	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.807000	0.99171	2.712000	0.92718	0.650000	0.86243	TGG		0.463	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1			38	72	0	0	0	0.074837	0	38	72				
CA8	767	broad.mit.edu	37	8	61193624	61193624	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:61193624T>A	ENST00000317995.4	-	1	347	c.83A>T	c.(82-84)gAg>gTg	p.E28V		NM_004056.4	NP_004047.3	P35219	CAH8_HUMAN	carbonic anhydrase VIII	28	Glu-rich (acidic).				one-carbon metabolic process (GO:0006730)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasm (GO:0005737)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.E28V(1)		endometrium(2)|large_intestine(5)|lung(6)|prostate(2)|skin(1)	16		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)			Zonisamide(DB00909)	GTAGCCCCACTCCACACcctc	0.677																																							uc003xtz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(82-84)GAG>GTG		carbonic anhydrase VIII							111.0	90.0	97.0					8																	61193624		2198	4300	6498	SO:0001583	missense	767				one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding	g.chr8:61193624T>A	L04656	CCDS6174.1	8q12.1	2012-08-21			ENSG00000178538	ENSG00000178538		"""Carbonic anhydrases"""	1382	protein-coding gene	gene with protein product		114815		CALS		17219437	Standard	NM_004056		Approved	CARP	uc003xtz.1	P35219	OTTHUMG00000165325	ENST00000317995.4:c.83A>T	8.37:g.61193624T>A	ENSP00000314407:p.Glu28Val		Somatic				CA8_uc003xua.1_Missense_Mutation_p.E28V|CA8_uc003xub.2_Missense_Mutation_p.E28V	p.E28V	NM_004056	NP_004047	WXS	Illumina HiSeq	Unspecified	P35219	CAH8_HUMAN			1	331	-		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)	28			Glu-rich (acidic).		A8K0A5|B3KQZ7|Q32MY2	Missense_Mutation	SNP	ENST00000317995.4	37	c.83A>T	CCDS6174.1	.	.	.	.	.	.	.	.	.	.	T	15.58	2.874505	0.51695	.	.	ENSG00000178538	ENST00000317995	T	0.55588	0.51	3.78	3.78	0.43462	Carbonic anhydrase, alpha-class, catalytic domain (3);	0.475878	0.20651	N	0.088201	T	0.42426	0.1202	L	0.37850	1.14	0.47862	D	0.99953	B	0.17038	0.02	B	0.13407	0.009	T	0.33471	-0.9867	10	0.40728	T	0.16	.	12.5003	0.55952	0.0:0.0:0.0:1.0	.	28	P35219	CAH8_HUMAN	V	28	ENSP00000314407:E28V	ENSP00000314407:E28V	E	-	2	0	CA8	61356178	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.226000	0.58606	1.501000	0.48654	0.379000	0.24179	GAG		0.677	CA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383445.1			32	29	0	0	0	0.045705	0	32	29				
ARFGEF1	10565	broad.mit.edu	37	8	68139538	68139538	+	Silent	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:68139538T>A	ENST00000262215.3	-	27	4139	c.3750A>T	c.(3748-3750)ccA>ccT	p.P1250P	ARFGEF1_ENST00000518230.1_Silent_p.P88P|ARFGEF1_ENST00000520381.1_Silent_p.P704P	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1250					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.P1250P(2)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CTCGAATTGTTGGAGACCTAA	0.368																																							uc003xxo.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8						c.(3748-3750)CCA>CCT		brefeldin A-inhibited guanine							104.0	108.0	107.0					8																	68139538		2203	4300	6503	SO:0001819	synonymous_variant	10565				exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding	g.chr8:68139538T>A	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.3750A>T	8.37:g.68139538T>A			Somatic				ARFGEF1_uc003xxl.1_Silent_p.P704P|ARFGEF1_uc003xxn.1_Silent_p.P233P	p.P1250P	NM_006421	NP_006412	WXS	Illumina HiSeq	Unspecified	Q9Y6D6	BIG1_HUMAN	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)		27	4140	-	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	1250					Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	ENST00000262215.3	37	c.3750A>T	CCDS6199.1																																																																																				0.368	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421		15	34	0	0	0	0.020292	0	15	34				
SULF1	23213	broad.mit.edu	37	8	70539460	70539460	+	Silent	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:70539460C>A	ENST00000260128.4	+	16	2583	c.1866C>A	c.(1864-1866)ccC>ccA	p.P622P	SULF1_ENST00000402687.4_Silent_p.P622P|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000458141.2_Silent_p.P622P|SULF1_ENST00000419716.3_Silent_p.P622P	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	622					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.P622P(2)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TTATTCTTCCCAATGACTCTA	0.378																																							uc010lza.1		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7						c.(1864-1866)CCC>CCA		sulfatase 1 precursor							172.0	157.0	162.0					8																	70539460		2203	4300	6503	SO:0001819	synonymous_variant	23213				apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding	g.chr8:70539460C>A	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1866C>A	8.37:g.70539460C>A			Somatic				SULF1_uc003xyd.2_Silent_p.P622P|SULF1_uc003xye.2_Silent_p.P622P|SULF1_uc003xyf.2_Silent_p.P622P|SULF1_uc003xyg.2_Silent_p.P622P|SULF1_uc003xyh.1_RNA|SULF1_uc003xyi.1_5'Flank	p.P622P	NM_015170	NP_055985	WXS	Illumina HiSeq	Unspecified	Q8IWU6	SULF1_HUMAN	Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)		16	2583	+	Breast(64;0.0654)		622					Q86YV8|Q8NCA2|Q9UPS5	Silent	SNP	ENST00000260128.4	37	c.1866C>A	CCDS6204.1																																																																																				0.378	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170		14	45	1	0	4.3838e-07	0.105934	4.97889e-07	14	45				
SLCO5A1	81796	broad.mit.edu	37	8	70594557	70594557	+	Missense_Mutation	SNP	A	A	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:70594557A>C	ENST00000260126.4	-	7	2350	c.1644T>G	c.(1642-1644)caT>caG	p.H548Q	SLCO5A1_ENST00000524945.1_Missense_Mutation_p.H548Q|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.H493Q	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	548						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.H548Q(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TCAGATTCCTATGGGGCATGG	0.388																																							uc003xyl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(1642-1644)CAT>CAG		solute carrier organic anion transporter family,							126.0	116.0	119.0					8																	70594557		2203	4300	6503	SO:0001583	missense	81796					integral to membrane|plasma membrane	transporter activity	g.chr8:70594557A>C	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1644T>G	8.37:g.70594557A>C	ENSP00000260126:p.His548Gln		Somatic				SLCO5A1_uc010lzb.2_Missense_Mutation_p.H493Q|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Missense_Mutation_p.H548Q	p.H548Q	NM_030958	NP_112220	WXS	Illumina HiSeq	Unspecified	Q9H2Y9	SO5A1_HUMAN	Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)		7	2351	-	Breast(64;0.0654)		548			Extracellular (Potential).		A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	c.1644T>G	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.523719	0.44866	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.38401	1.14;1.14;1.14	6.04	-6.36	0.01969	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.38272	U	0.001759	T	0.16428	0.0395	N	0.14661	0.345	0.41091	D	0.985595	B;B;B	0.22080	0.064;0.059;0.03	B;B;B	0.22152	0.038;0.029;0.017	T	0.18147	-1.0346	10	0.11485	T	0.65	.	15.0839	0.72135	0.1386:0.1183:0.7432:0.0	.	493;548;548	E9PKK5;Q9H2Y9;G3V1C0	.;SO5A1_HUMAN;.	Q	548;548;493	ENSP00000260126:H548Q;ENSP00000434422:H548Q;ENSP00000431611:H493Q	ENSP00000260126:H548Q	H	-	3	2	SLCO5A1	70757111	1.000000	0.71417	0.602000	0.28890	0.998000	0.95712	0.976000	0.29462	-1.053000	0.03218	0.459000	0.35465	CAT		0.388	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958		24	90	0	0	0	0.037714	0	24	90				
ZFHX4	79776	broad.mit.edu	37	8	77763566	77763566	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:77763566G>T	ENST00000521891.2	+	10	4857	c.4409G>T	c.(4408-4410)tGg>tTg	p.W1470L	ZFHX4_ENST00000050961.6_Missense_Mutation_p.W1425L|ZFHX4_ENST00000455469.2_Missense_Mutation_p.W1425L|ZFHX4_ENST00000518282.1_Missense_Mutation_p.W1444L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1425					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.W1470L(2)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GGAGAACTGTGGGCAGAGAGC	0.502										HNSCC(33;0.089)																													uc003yav.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(4273-4275)TGG>TTG		zinc finger homeodomain 4							44.0	42.0	43.0					8																	77763566		2010	4179	6189	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77763566G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4409G>T	8.37:g.77763566G>T	ENSP00000430497:p.Trp1470Leu	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.W1470L|ZFHX4_uc003yaw.1_Missense_Mutation_p.W1425L	p.W1425L	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	4661	+			1425					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.4274G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978903	0.34942	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.42513	0.98;1.01;0.98;0.97	5.05	5.05	0.67936	.	0.000000	0.42053	U	0.000761	T	0.29223	0.0727	N	0.11427	0.14	0.50039	D	0.999844	P;P;P	0.50528	0.895;0.936;0.936	B;P;P	0.47673	0.351;0.554;0.554	T	0.07028	-1.0794	10	0.02654	T	1	.	18.5796	0.91166	0.0:0.0:1.0:0.0	.	1425;1425;1470	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	L	1470;1470;1425;1425;1444	ENSP00000430497:W1470L;ENSP00000399605:W1425L;ENSP00000050961:W1425L;ENSP00000430848:W1444L	ENSP00000050961:W1425L	W	+	2	0	ZFHX4	77926121	1.000000	0.71417	0.998000	0.56505	0.875000	0.50365	5.963000	0.70372	2.629000	0.89072	0.555000	0.69702	TGG		0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		12	35	1	0	2.27111e-07	0.09319	2.59113e-07	12	35				
CNGB3	54714	broad.mit.edu	37	8	87591351	87591351	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:87591351G>C	ENST00000320005.5	-	16	1958	c.1911C>G	c.(1909-1911)atC>atG	p.I637M		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	637					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.I637M(2)		NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						TCTTCATGAGGATCCTTTCAG	0.408																																							uc003ydx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(1909-1911)ATC>ATG		cyclic nucleotide gated channel beta 3							125.0	130.0	128.0					8																	87591351		2203	4300	6503	SO:0001583	missense	54714				signal transduction|visual perception	integral to membrane	cGMP binding	g.chr8:87591351G>C	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.1911C>G	8.37:g.87591351G>C	ENSP00000316605:p.Ile637Met		Somatic				CNGB3_uc010maj.2_Missense_Mutation_p.I494M	p.I637M	NM_019098	NP_061971	WXS	Illumina HiSeq	Unspecified	Q9NQW8	CNGB3_HUMAN			16	1957	-			637			Cytoplasmic (Potential).|cGMP (By similarity).		C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	c.1911C>G	CCDS6244.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.038055	0.35989	.	.	ENSG00000170289	ENST00000517327;ENST00000320005	T;D	0.96774	-1.29;-4.12	5.6	0.122	0.14702	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (1);	0.072840	0.56097	D	0.000033	D	0.88698	0.6507	N	0.08118	0	0.40400	D	0.979638	B;B	0.26975	0.165;0.103	B;B	0.31869	0.137;0.065	T	0.78620	-0.2133	10	0.37606	T	0.19	.	7.0613	0.25127	0.2168:0.3324:0.4509:0.0	.	632;637	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	M	28;637	ENSP00000428329:I28M;ENSP00000316605:I637M	ENSP00000316605:I637M	I	-	3	3	CNGB3	87660467	0.883000	0.30277	0.998000	0.56505	0.936000	0.57629	-0.042000	0.12063	-0.001000	0.14495	0.563000	0.77884	ATC		0.408	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098		107	99	0	0	0	0.048971	0	107	99				
GEM	2669	broad.mit.edu	37	8	95265333	95265333	+	Silent	SNP	T	T	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:95265333T>C	ENST00000297596.2	-	3	603	c.339A>G	c.(337-339)acA>acG	p.T113T	GEM_ENST00000396194.2_Silent_p.T113T	NM_005261.3	NP_005252.1	P55040	GEM_HUMAN	GTP binding protein overexpressed in skeletal muscle	113					cell surface receptor signaling pathway (GO:0007166)|chromosome organization (GO:0051276)|immune response (GO:0006955)|metaphase plate congression (GO:0051310)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic side of plasma membrane (GO:0009898)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle midzone (GO:0051233)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)	p.T113T(2)		endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	22	Breast(36;4.65e-06)	Myeloproliferative disorder(644;0.204)	BRCA - Breast invasive adenocarcinoma(8;0.00691)			TTCGTTCATATGTATCTTCTA	0.403																																					GBM(125;80 1653 28655 32188 47338)|Esophageal Squamous(19;97 579 13602 49091 51766)	GBM(125;80 1653 28655 32188 47338)|Esophageal Squamous(19;97 579 13602 49091 51766)	uc003ygj.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(1)	1						c.(337-339)ACA>ACG		GTP-binding mitogen-induced T-cell protein							145.0	127.0	133.0					8																	95265333		2203	4300	6503	SO:0001819	synonymous_variant	2669				cell surface receptor linked signaling pathway|immune response|small GTPase mediated signal transduction	internal side of plasma membrane	calmodulin binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding	g.chr8:95265333T>C		CCDS6261.1	8q13-q21	2014-05-09	2001-11-28		ENSG00000164949	ENSG00000164949			4234	protein-coding gene	gene with protein product	"""kinase-inducible Ras-like protein"""	600164	"""GTP-binding protein overexpressed in skeletal muscle"""			7912851, 11956230	Standard	NM_005261		Approved	KIR	uc003ygj.3	P55040	OTTHUMG00000164392	ENST00000297596.2:c.339A>G	8.37:g.95265333T>C			Somatic				GEM_uc003ygi.2_Silent_p.T113T	p.T113T	NM_005261	NP_005252	WXS	Illumina HiSeq	Unspecified	P55040	GEM_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00691)		3	588	-	Breast(36;4.65e-06)	Myeloproliferative disorder(644;0.204)	113					B2RA31	Silent	SNP	ENST00000297596.2	37	c.339A>G	CCDS6261.1																																																																																				0.403	GEM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378566.1	NM_181702		26	68	0	0	0	0.030593	0	26	68				
DPYS	1807	broad.mit.edu	37	8	105459557	105459557	+	Missense_Mutation	SNP	C	C	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:105459557C>A	ENST00000351513.2	-	3	730	c.598G>T	c.(598-600)Gca>Tca	p.A200S		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	200					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)	p.A200S(2)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CGTACCTCTGCAATTAAGTCT	0.453																																							uc003yly.3		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(598-600)GCA>TCA		dihydropyrimidinase							104.0	96.0	99.0					8																	105459557		2203	4300	6503	SO:0001583	missense	1807				protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding	g.chr8:105459557C>A	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.598G>T	8.37:g.105459557C>A	ENSP00000276651:p.Ala200Ser		Somatic					p.A200S	NM_001385	NP_001376	WXS	Illumina HiSeq	Unspecified	Q14117	DPYS_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		3	727	-			200						Missense_Mutation	SNP	ENST00000351513.2	37	c.598G>T	CCDS6302.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.208527	0.58343	.	.	ENSG00000147647	ENST00000351513;ENST00000521573	D;D	0.90788	-2.73;-2.62	6.02	6.02	0.97574	Amidohydrolase 1 (1);	0.052262	0.85682	D	0.000000	D	0.89068	0.6610	L	0.41710	1.295	0.52099	D	0.999946	B	0.17038	0.02	B	0.33042	0.157	D	0.84447	0.0586	10	0.48119	T	0.1	-20.1536	16.7947	0.85598	0.1293:0.8707:0.0:0.0	.	200	Q14117	DPYS_HUMAN	S	200;147	ENSP00000276651:A200S;ENSP00000430246:A147S	ENSP00000276651:A200S	A	-	1	0	DPYS	105528733	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	5.764000	0.68826	2.850000	0.98022	0.650000	0.86243	GCA		0.453	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385		10	30	1	0	0.000442599	0.058154	0.000468744	10	30				
ZFPM2	23414	broad.mit.edu	37	8	106813655	106813655	+	Missense_Mutation	SNP	C	C	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:106813655C>G	ENST00000407775.2	+	8	1595	c.1345C>G	c.(1345-1347)Ctc>Gtc	p.L449V	ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.L317V|ZFPM2_ENST00000517361.1_Missense_Mutation_p.L317V|ZFPM2_ENST00000378472.4_Missense_Mutation_p.L180V|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000520594.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	449					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.L449V(2)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TCAGCTCTTTCTCACGAACCA	0.463																																							uc003ymd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(1)	5						c.(1345-1347)CTC>GTC		zinc finger protein, multitype 2							62.0	67.0	65.0					8																	106813655		1907	4126	6033	SO:0001583	missense	23414				blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding	g.chr8:106813655C>G	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1345C>G	8.37:g.106813655C>G	ENSP00000384179:p.Leu449Val		Somatic				ZFPM2_uc011lhs.1_Missense_Mutation_p.L180V|uc003yme.1_5'Flank	p.L449V	NM_012082	NP_036214	WXS	Illumina HiSeq	Unspecified	Q8WW38	FOG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)		8	1368	+			449					Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	c.1345C>G	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.046185	0.36085	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.20200	2.09;2.57;2.57;3.78	5.97	5.1	0.69264	.	0.060987	0.64402	D	0.000002	T	0.17492	0.0420	L	0.40543	1.245	0.80722	D	1	B	0.32573	0.376	B	0.30401	0.115	T	0.03662	-1.1015	10	0.13470	T	0.59	.	14.9487	0.71054	0.0:0.9321:0.0:0.0679	.	449	Q8WW38	FOG2_HUMAN	V	449;317;317;180	ENSP00000384179:L449V;ENSP00000430757:L317V;ENSP00000428720:L317V;ENSP00000367733:L180V	ENSP00000367733:L180V	L	+	1	0	ZFPM2	106882831	0.996000	0.38824	0.985000	0.45067	0.265000	0.26407	3.221000	0.51215	1.540000	0.49301	0.655000	0.94253	CTC		0.463	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			7	61	0	0	0	0.02938	0	7	61				
PKHD1L1	93035	broad.mit.edu	37	8	110477349	110477349	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:110477349G>T	ENST00000378402.5	+	49	8392	c.8288G>T	c.(8287-8289)tGt>tTt	p.C2763F		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2763					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.C2765F(2)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCTGGAGTTTGTAATGACAGA	0.468										HNSCC(38;0.096)																													uc003yne.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(8287-8289)TGT>TTT		fibrocystin L precursor							126.0	127.0	126.0					8																	110477349		1933	4130	6063	SO:0001583	missense	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110477349G>T	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8288G>T	8.37:g.110477349G>T	ENSP00000367655:p.Cys2763Phe	HNSCC(38;0.096)	Somatic					p.C2763F	NM_177531	NP_803875	WXS	Illumina HiSeq	Unspecified	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		49	8392	+			2763			Extracellular (Potential).		Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	c.8288G>T	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.296687	0.81025	.	.	ENSG00000205038	ENST00000378402	D	0.87966	-2.32	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.91479	0.7310	M	0.83483	2.645	0.51767	D	0.999933	D	0.55605	0.972	P	0.52793	0.709	D	0.89751	0.3940	10	0.27082	T	0.32	.	17.61	0.88050	0.0:0.0:1.0:0.0	.	2763	Q86WI1	PKHL1_HUMAN	F	2763	ENSP00000367655:C2763F	ENSP00000367655:C2763F	C	+	2	0	PKHD1L1	110546525	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.378000	0.90144	2.757000	0.94681	0.563000	0.77884	TGT		0.468	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		36	90	1	0	4.4194e-11	0.054565	5.23241e-11	36	90				
CSMD3	114788	broad.mit.edu	37	8	113246674	113246674	+	Silent	SNP	A	A	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:113246674A>G	ENST00000297405.5	-	68	10904	c.10660T>C	c.(10660-10662)Tta>Cta	p.L3554L	CSMD3_ENST00000352409.3_Silent_p.L3484L|CSMD3_ENST00000455883.2_Silent_p.L3385L|CSMD3_ENST00000343508.3_Silent_p.L3514L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3554						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L3514L(2)|p.L3554L(2)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TATATGCGTAACATTAGGCGA	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(10660-10662)TTA>CTA		CUB and Sushi multiple domains 3 isoform 1							160.0	157.0	158.0					8																	113246674		2203	4299	6502	SO:0001819	synonymous_variant	114788					integral to membrane|plasma membrane		g.chr8:113246674A>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10660T>C	8.37:g.113246674A>G		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Silent_p.L2756L|CSMD3_uc003ynt.2_Silent_p.L3514L|CSMD3_uc011lhx.1_Silent_p.L3385L	p.L3554L	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			68	10819	-			3554			Extracellular (Potential).		Q96PZ3	Silent	SNP	ENST00000297405.5	37	c.10660T>C	CCDS6315.1																																																																																				0.318	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		24	92	0	0	0	0.069288	0	24	92				
CSMD3	114788	broad.mit.edu	37	8	113254006	113254006	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:113254006T>A	ENST00000297405.5	-	66	10655	c.10411A>T	c.(10411-10413)Aaa>Taa	p.K3471*	CSMD3_ENST00000352409.3_Nonsense_Mutation_p.K3401*|CSMD3_ENST00000455883.2_Nonsense_Mutation_p.K3302*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.K3431*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3471						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.K3471*(2)|p.K3431*(2)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACCAATATTTTAGAACCAGCT	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	4	Substitution - Nonsense(4)		lung(4)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(10411-10413)AAA>TAA		CUB and Sushi multiple domains 3 isoform 1							107.0	115.0	112.0					8																	113254006		2203	4300	6503	SO:0001587	stop_gained	114788					integral to membrane|plasma membrane		g.chr8:113254006T>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10411A>T	8.37:g.113254006T>A	ENSP00000297405:p.Lys3471*	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Nonsense_Mutation_p.K2673*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.K3431*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.K3302*	p.K3471*	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			66	10570	-			3471			Extracellular (Potential).		Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	37	c.10411A>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	53	20.135024	0.99927	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.68	4.68	0.58851	.	0.150070	0.41712	D	0.000839	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	14.5814	0.68295	0.0:0.0:0.0:1.0	.	.	.	.	X	3431;3471;2741;3302;3401	.	ENSP00000297405:K3471X	K	-	1	0	CSMD3	113323182	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.828000	0.69307	2.097000	0.63578	0.482000	0.46254	AAA		0.378	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		40	30	0	0	0	0.104719	0	40	30				
TAF2	6873	broad.mit.edu	37	8	120814149	120814149	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:120814149G>C	ENST00000378164.2	-	6	975	c.677C>G	c.(676-678)aCt>aGt	p.T226S		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	226					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.T226S(4)		NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CATATCATGAGTATACACTGT	0.378																																							uc003you.2		NA																	4	Substitution - Missense(4)		lung(4)	large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6						c.(676-678)ACT>AGT		TBP-associated factor 2							144.0	124.0	131.0					8																	120814149		2203	4300	6503	SO:0001583	missense	6873				G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr8:120814149G>C	AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.677C>G	8.37:g.120814149G>C	ENSP00000367406:p.Thr226Ser		Somatic					p.T226S	NM_003184	NP_003175	WXS	Illumina HiSeq	Unspecified	Q6P1X5	TAF2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00185)		6	947	-	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		226					B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	ENST00000378164.2	37	c.677C>G	CCDS34937.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570410	0.86542	.	.	ENSG00000064313	ENST00000378164	T	0.04275	3.66	5.89	5.89	0.94794	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.08670	0.0215	L	0.31845	0.965	0.80722	D	1	P	0.41498	0.752	P	0.46479	0.518	T	0.43228	-0.9404	10	0.22109	T	0.4	-9.4009	20.2576	0.98430	0.0:0.0:1.0:0.0	.	226	Q6P1X5	TAF2_HUMAN	S	226	ENSP00000367406:T226S	ENSP00000367406:T226S	T	-	2	0	TAF2	120883330	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	9.814000	0.99346	2.783000	0.95769	0.655000	0.94253	ACT		0.378	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184		26	58	0	0	0	0.083992	0	26	58				
DENND3	22898	broad.mit.edu	37	8	142170817	142170817	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr8:142170817G>T	ENST00000262585.2	+	9	1321	c.1043G>T	c.(1042-1044)cGg>cTg	p.R348L	DENND3_ENST00000519811.1_Missense_Mutation_p.R428L|DENND3_ENST00000424248.1_Intron	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	348					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R348L(2)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCCACCGGCGGTCCTGGCAG	0.617																																							uc003yvy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1042-1044)CGG>CTG		DENN/MADD domain containing 3							34.0	31.0	32.0					8																	142170817		2203	4300	6503	SO:0001583	missense	22898							g.chr8:142170817G>T	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1043G>T	8.37:g.142170817G>T	ENSP00000262585:p.Arg348Leu		Somatic				DENND3_uc010mep.2_Intron|DENND3_uc003yvz.1_Intron	p.R348L	NM_014957	NP_055772	WXS	Illumina HiSeq	Unspecified	A2RUS2	DEND3_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.105)		9	1321	+	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		348					B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	37	c.1043G>T	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986595	0.74589	.	.	ENSG00000105339	ENST00000262585;ENST00000519811	T;T	0.11277	2.8;2.79	5.11	5.11	0.69529	.	0.150378	0.64402	N	0.000020	T	0.33177	0.0854	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.01596	-1.1316	10	0.49607	T	0.09	-19.0418	18.8977	0.92430	0.0:0.0:1.0:0.0	.	348	A2RUS2	DEND3_HUMAN	L	348;428	ENSP00000262585:R348L;ENSP00000428714:R428L	ENSP00000262585:R348L	R	+	2	0	DENND3	142239999	1.000000	0.71417	0.575000	0.28536	0.209000	0.24338	7.271000	0.78506	2.550000	0.86006	0.655000	0.94253	CGG		0.617	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957		13	37	1	0	5.26018e-13	0.062417	6.56868e-13	13	37				
IFNA2	3440	broad.mit.edu	37	9	21385084	21385084	+	Missense_Mutation	SNP	A	A	T	rs150636116		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr9:21385084A>T	ENST00000380206.2	-	1	312	c.245T>A	c.(244-246)aTg>aAg	p.M82K		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	82					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)	p.M82K(2)		breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		CTGCTGGATCATCTCATGGAG	0.483																																							uc003zpb.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(244-246)ATG>AAG		interferon, alpha 2 precursor	Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)						129.0	125.0	126.0					9																	21385084		2203	4300	6503	SO:0001583	missense	3440				blood coagulation|cell-cell signaling|induction of apoptosis|inflammatory response|negative regulation of interleukin-13 secretion|negative regulation of interleukin-5 secretion|negative regulation of T cell differentiation|negative regulation of T-helper 2 cell cytokine production|negative regulation of transcription, DNA-dependent|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding	g.chr9:21385084A>T		CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.245T>A	9.37:g.21385084A>T	ENSP00000369554:p.Met82Lys		Somatic					p.M82K	NM_000605	NP_000596	WXS	Illumina HiSeq	Unspecified	P01563	IFNA2_HUMAN		Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)	1	313	-			82					H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Missense_Mutation	SNP	ENST00000380206.2	37	c.245T>A	CCDS6506.1	.	.	.	.	.	.	.	.	.	.	A	19.08	3.758203	0.69763	.	.	ENSG00000188379	ENST00000380206	T	0.03951	3.75	3.24	3.24	0.37175	.	0.450432	0.25469	N	0.030453	T	0.25158	0.0611	M	0.92604	3.325	0.09310	N	1	D	0.71674	0.998	D	0.83275	0.996	T	0.06215	-1.0839	10	0.87932	D	0	.	9.1528	0.36973	1.0:0.0:0.0:0.0	.	82	Q6DJX8	.	K	82	ENSP00000369554:M82K	ENSP00000369554:M82K	M	-	2	0	IFNA2	21375084	0.001000	0.12720	0.002000	0.10522	0.805000	0.45488	1.220000	0.32491	1.347000	0.45714	0.397000	0.26171	ATG		0.483	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051903.1	NM_000605		22	64	0	0	0	0.055883	0	22	64				
TAF1L	138474	broad.mit.edu	37	9	32631306	32631306	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr9:32631306G>T	ENST00000242310.4	-	1	4361	c.4272C>A	c.(4270-4272)ttC>ttA	p.F1424L	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1424	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.F1424L(2)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CTGGAGTGTGGAAAGGGTGTG	0.473																																							uc003zrg.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(4270-4272)TTC>TTA		TBP-associated factor RNA polymerase 1-like							318.0	273.0	288.0					9																	32631306		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32631306G>T	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.4272C>A	9.37:g.32631306G>T	ENSP00000418379:p.Phe1424Leu		Somatic				uc003zrh.1_5'Flank	p.F1424L	NM_153809	NP_722516	WXS	Illumina HiSeq	Unspecified	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	4362	-			1424			Bromo 1.		Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.4272C>A	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495516	0.64186	.	.	ENSG00000122728	ENST00000242310	T	0.68181	-0.31	0.658	-0.508	0.11980	Bromodomain (5);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.81749	0.4888	H	0.96604	3.85	0.48087	D	0.999588	D	0.65815	0.995	D	0.64042	0.921	T	0.76069	-0.3094	10	0.56958	D	0.05	.	3.8793	0.09071	0.563:0.0:0.437:0.0	.	1424	Q8IZX4	TAF1L_HUMAN	L	1424	ENSP00000418379:F1424L	ENSP00000418379:F1424L	F	-	3	2	TAF1L	32621306	1.000000	0.71417	0.990000	0.47175	0.621000	0.37620	1.258000	0.32944	-0.263000	0.09378	0.195000	0.17529	TTC		0.473	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			81	50	1	0	3.9908e-21	0.048971	5.32814e-21	81	50				
FAM214B	80256	broad.mit.edu	37	9	35107649	35107650	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr9:35107649_35107650CC>AA	ENST00000378561.1	-	2	3677_3678	c.622_623GG>TT	c.(622-624)GGg>TTg	p.G208L	FAM214B_ENST00000378557.1_Missense_Mutation_p.G208L|FAM214B_ENST00000378554.2_Missense_Mutation_p.G208L|FAM214B_ENST00000603301.1_Missense_Mutation_p.G208L|FAM214B_ENST00000605392.1_5'Flank|FAM214B_ENST00000322813.5_Missense_Mutation_p.G208L|FAM214B_ENST00000378566.1_Intron|FAM214B_ENST00000488109.2_Missense_Mutation_p.G208L|FAM214B_ENST00000605244.1_Missense_Mutation_p.G208L			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	208						nucleus (GO:0005634)		p.G208L(2)									GAGGCTACCCCCATTGCCCACC	0.658																																							uc003zwl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(622-624)GGG>TTG		hypothetical protein LOC80256																																				SO:0001583	missense	80256					nucleus		g.chr9:35107649_35107650CC>AA	AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.622_623delinsAA	9.37:g.35107649_35107650delinsAA	ENSP00000367823:p.Gly208Leu		Somatic				KIAA1539_uc003zwm.2_Missense_Mutation_p.G208L|KIAA1539_uc003zwn.2_Intron|KIAA1539_uc003zwo.2_Missense_Mutation_p.G208L|KIAA1539_uc003zwp.1_Missense_Mutation_p.G208L|KIAA1539_uc010mkk.1_Intron	p.G208L	NM_025182	NP_079458	WXS	Illumina HiSeq	Unspecified	Q7L5A3	K1539_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)		3	947_948	-	all_epithelial(49;0.217)		208					B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Missense_Mutation	DNP	ENST00000378561.1	37	c.622_623GG>TT	CCDS6578.1																																																																																				0.658	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052261.1	NM_025182		19	32	0	0	0	0.004672	0	19	32				
IARS	3376	broad.mit.edu	37	9	94973152	94973152	+	Silent	SNP	G	G	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr9:94973152G>A	ENST00000375643.3	-	34	3992	c.3726C>T	c.(3724-3726)ccC>ccT	p.P1242P	IARS_ENST00000375629.3_3'UTR|IARS_ENST00000443024.2_Silent_p.P1242P|IARS_ENST00000447699.2_Silent_p.P1132P|RP11-62C3.6_ENST00000457003.1_RNA	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	1242					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)	p.P1242P(2)		breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	AAGTCTTCACGGGGATGTCTT	0.353																																							uc004art.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(3724-3726)CCC>CCT		isoleucine tRNA synthetase	L-Isoleucine(DB00167)						142.0	133.0	136.0					9																	94973152		2203	4300	6503	SO:0001819	synonymous_variant	3376				isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding	g.chr9:94973152G>A	AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.3726C>T	9.37:g.94973152G>A			Somatic				IARS_uc004ars.1_Silent_p.P1035P|IARS_uc004aru.3_Silent_p.P1242P|IARS_uc010mqr.2_Silent_p.P1132P|IARS_uc004arr.1_RNA	p.P1242P	NM_013417	NP_038203	WXS	Illumina HiSeq	Unspecified	P41252	SYIC_HUMAN			34	3983	-			1242					A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Silent	SNP	ENST00000375643.3	37	c.3726C>T	CCDS6694.1	.	.	.	.	.	.	.	.	.	.	G	7.997	0.754522	0.15778	.	.	ENSG00000196305	ENST00000375660	.	.	.	5.09	-2.5	0.06384	.	0.276927	0.42548	D	0.000692	T	0.56529	0.1991	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.55159	-0.8184	6	0.87932	D	0	-7.6798	5.1945	0.15230	0.5374:0.0:0.3056:0.157	.	.	.	.	L	1242	.	ENSP00000364811:P1242L	P	-	2	0	IARS	94012973	0.993000	0.37304	0.854000	0.33618	0.960000	0.62799	0.177000	0.16801	-0.367000	0.08052	-0.140000	0.14226	CCG		0.353	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2	NM_002161		20	19	0	0	0	0.049695	0	20	19				
PHF2	5253	broad.mit.edu	37	9	96416742	96416742	+	Silent	SNP	C	C	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr9:96416742C>G	ENST00000359246.4	+	7	1204	c.837C>G	c.(835-837)tcC>tcG	p.S279S	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	279	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.S279S(2)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CCAACATCTCCCTGTATGAGC	0.602																																							uc004aub.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(835-837)TCC>TCG		PHD finger protein 2							82.0	75.0	78.0					9																	96416742		2203	4300	6503	SO:0001819	synonymous_variant	5253				liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr9:96416742C>G	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.837C>G	9.37:g.96416742C>G			Somatic				PHF2_uc011lug.1_Silent_p.S162S	p.S279S	NM_005392	NP_005383	WXS	Illumina HiSeq	Unspecified	O75151	PHF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)	7	984	+		Myeloproliferative disorder(762;0.0255)	279			JmjC.		Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	37	c.837C>G	CCDS35069.1																																																																																				0.602	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392		27	18	0	0	0	0.0918	0	27	18				
FKBP15	23307	broad.mit.edu	37	9	115965313	115965313	+	Silent	SNP	A	A	G	rs369443598		TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr9:115965313A>G	ENST00000238256.3	-	5	444	c.327T>C	c.(325-327)taT>taC	p.Y109Y	FKBP15_ENST00000493847.1_5'Flank	NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	109	Important for function in growth cone organization. {ECO:0000250}.				endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)		p.Y134Y(2)|p.Y109Y(2)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						GAAGAATCCTATACTGTAGAC	0.328																																							uc004bgs.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(3)	3						c.(325-327)TAT>TAC		FK506 binding protein 15, 133kDa		A		1,3681		0,1,1840	63.0	56.0	58.0		327	3.0	1.0	9		58	0,8192		0,0,4096	no	coding-synonymous	FKBP15	NM_015258.1		0,1,5936	GG,GA,AA		0.0,0.0272,0.0084		109/1220	115965313	1,11873	1841	4096	5937	SO:0001819	synonymous_variant	23307				endocytosis|protein folding	axon|early endosome	actin binding	g.chr9:115965313A>G	AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.327T>C	9.37:g.115965313A>G			Somatic				FKBP15_uc010muu.1_Silent_p.Y173Y|FKBP15_uc011lxd.1_Silent_p.Y41Y|FKBP15_uc010mut.1_5'UTR|FKBP15_uc004bgt.2_Silent_p.Y109Y	p.Y109Y	NM_015258	NP_056073	WXS	Illumina HiSeq	Unspecified	Q5T1M5	FKB15_HUMAN			5	445	-			109			Important for function in growth cone organization (By similarity).		Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Silent	SNP	ENST00000238256.3	37	c.327T>C	CCDS48007.1																																																																																				0.328	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015258		5	3	0	0	0	0.014758	0	5	3				
CSF2RA	1438	broad.mit.edu	37	X	1424363	1424363	+	Silent	SNP	C	C	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chrX:1424363C>T	ENST00000381524.3	+	12	1254	c.1068C>T	c.(1066-1068)ttC>ttT	p.F356F	CSF2RA_ENST00000381500.1_Missense_Mutation_p.S324F|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000501036.2_Silent_p.F223F|CSF2RA_ENST00000432318.2_Silent_p.F356F|CSF2RA_ENST00000355432.3_Intron|CSF2RA_ENST00000498153.1_3'UTR|CSF2RA_ENST00000355805.2_Missense_Mutation_p.S224F|CSF2RA_ENST00000381509.3_Silent_p.F356F|CSF2RA_ENST00000361536.3_Missense_Mutation_p.S324F|CSF2RA_ENST00000417535.2_Silent_p.F390F|CSF2RA_ENST00000381529.3_Silent_p.F356F			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	356					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	AGCGGCTGTTCCCGCCAGTTC	0.542																																					Esophageal Squamous(131;723 1707 25334 40494 41806)	Esophageal Squamous(131;723 1707 25334 40494 41806)	uc010nct.2		NA																	0				ovary(2)	2						c.(1066-1068)TTC>TTT		colony stimulating factor 2 receptor alpha chain	Sargramostim(DB00020)						149.0	140.0	143.0					X																	1424363		2203	4296	6499	SO:0001819	synonymous_variant	1438					extracellular region|integral to plasma membrane	cytokine receptor activity	g.chrX:1424363C>T	M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.1068C>T	X.37:g.1424363C>T			Somatic				CSF2RA_uc011mhb.1_Silent_p.F356F|CSF2RA_uc004cpq.2_Missense_Mutation_p.S224F|CSF2RA_uc004cpn.2_Silent_p.F356F|CSF2RA_uc004cpo.2_Silent_p.F356F|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_Silent_p.F223F|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Silent_p.F390F|CSF2RA_uc004cpr.2_Missense_Mutation_p.S324F	p.F356F	NM_001161529	NP_001155001	WXS	Illumina HiSeq	Unspecified	P15509	CSF2R_HUMAN			13	1390	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	356			Cytoplasmic (Potential).|Box 1 motif.		A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Silent	SNP	ENST00000381524.3	37	c.1068C>T	CCDS35191.1	.	.	.	.	.	.	.	.	.	.	.	6.449	0.450991	0.12223	.	.	ENSG00000198223	ENST00000361536;ENST00000355805;ENST00000381500	D;T;D	0.94330	-3.4;0.78;-3.4	0.598	0.598	0.17512	.	.	.	.	.	D	0.91680	0.7370	.	.	.	0.09310	N	1	D;D	0.58970	0.984;0.984	D;D	0.63877	0.919;0.919	T	0.82348	-0.0502	7	0.06625	T	0.88	.	.	.	.	.	324;224	P15509-3;P15509-6	.;.	F	324;224;324	ENSP00000354836:S324F;ENSP00000348058:S224F;ENSP00000370911:S324F	ENSP00000348058:S224F	S	+	2	0	CSF2RA	1384363	0.002000	0.14202	0.018000	0.16275	0.114000	0.19823	0.090000	0.15025	0.594000	0.29761	0.110000	0.15639	TCC		0.542	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000035013.2			8	64	0	0	0	0.080935	0	8	64				
MAGEB10	139422	broad.mit.edu	37	X	27839787	27839787	+	Missense_Mutation	SNP	T	T	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chrX:27839787T>A	ENST00000356790.2	+	3	609	c.364T>A	c.(364-366)Ttg>Atg	p.L122M		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	122	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.L122M(2)|p.L122V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						GGTGCATTACTTGCTGTACAA	0.428																																							uc004dbw.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(1)|breast(1)|central_nervous_system(1)	3						c.(364-366)TTG>ATG		melanoma antigen family B, 10							58.0	52.0	54.0					X																	27839787		2202	4300	6502	SO:0001583	missense	139422							g.chrX:27839787T>A		CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.364T>A	X.37:g.27839787T>A	ENSP00000368304:p.Leu122Met		Somatic					p.L122M	NM_182506	NP_872312	WXS	Illumina HiSeq	Unspecified	Q96LZ2	MAGBA_HUMAN			3	591	+			122			MAGE.		Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	ENST00000356790.2	37	c.364T>A	CCDS35221.1	.	.	.	.	.	.	.	.	.	.	T	12.24	1.877597	0.33162	.	.	ENSG00000177689	ENST00000356790	T	0.06768	3.26	2.49	-1.97	0.07503	.	0.206477	0.31909	U	0.006869	T	0.16854	0.0405	M	0.71920	2.185	0.09310	N	1	D	0.71674	0.998	D	0.75020	0.985	T	0.09796	-1.0658	10	0.40728	T	0.16	.	2.4175	0.04439	0.2433:0.4168:0.0:0.3399	.	122	Q96LZ2	MAGBA_HUMAN	M	122	ENSP00000368304:L122M	ENSP00000368304:L122M	L	+	1	2	MAGEB10	27749708	0.027000	0.19231	0.002000	0.10522	0.164000	0.22412	-0.165000	0.09968	-0.571000	0.06014	0.242000	0.17961	TTG		0.428	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106216.1	NM_182506		26	3	0	0	0	0.083992	0	26	3				
DGKK	139189	broad.mit.edu	37	X	50213554	50213554	+	RNA	SNP	C	C	G			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chrX:50213554C>G	ENST00000376025.2	-	0	183							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					agcggcggagccggcggcgga	0.706																																							uc010njr.1		NA																	0				ovary(1)|kidney(1)	2						c.(124-126)GCT>CCT		diacylglycerol kinase kappa							12.0	16.0	15.0					X																	50213554		1830	4002	5832			139189				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chrX:50213554C>G	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50213554C>G			Somatic					p.A42P	NM_001013742	NP_001013764	WXS	Illumina HiSeq	Unspecified	Q5KSL6	DGKK_HUMAN			1	184	-	Ovarian(276;0.236)		42					B2RP91	Missense_Mutation	SNP	ENST00000376025.2	37	c.124G>C																																																																																					0.706	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742		18	1	0	0	0	0.083992	0	18	1				
BMP15	9210	broad.mit.edu	37	X	50659489	50659489	+	Missense_Mutation	SNP	G	G	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chrX:50659489G>T	ENST00000252677.3	+	2	1061	c.1061G>T	c.(1060-1062)cGg>cTg	p.R354L		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	354					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.R354L(2)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					AGTGTCCCCCGGCCCTCCTGT	0.463																																							uc011mnw.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1060-1062)CGG>CTG		bone morphogenetic protein 15 precursor							89.0	81.0	84.0					X																	50659489		2203	4299	6502	SO:0001583	missense	9210				female gamete generation|granulosa cell development|ovarian follicle development	extracellular space	cytokine activity|growth factor activity	g.chrX:50659489G>T	AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.1061G>T	X.37:g.50659489G>T	ENSP00000252677:p.Arg354Leu		Somatic					p.R354L	NM_005448	NP_005439	WXS	Illumina HiSeq	Unspecified	O95972	BMP15_HUMAN			2	1061	+	Ovarian(276;0.236)		354					Q17RM6|Q5JST1|Q9UMS1	Missense_Mutation	SNP	ENST00000252677.3	37	c.1061G>T	CCDS14334.1	.	.	.	.	.	.	.	.	.	.	g	11.11	1.543607	0.27563	.	.	ENSG00000130385	ENST00000252677	D	0.83914	-1.78	5.47	-3.33	0.04958	Transforming growth factor-beta, C-terminal (3);	0.407837	0.27631	N	0.018517	T	0.79021	0.4376	L	0.43923	1.385	0.09310	N	1	D	0.54207	0.965	P	0.56343	0.796	T	0.70905	-0.4745	10	0.72032	D	0.01	.	3.6913	0.08347	0.1972:0.1496:0.5025:0.1507	.	354	O95972	BMP15_HUMAN	L	354	ENSP00000252677:R354L	ENSP00000252677:R354L	R	+	2	0	BMP15	50676229	0.031000	0.19500	0.279000	0.24732	0.005000	0.04900	0.535000	0.23114	-0.691000	0.05135	-1.417000	0.01113	CGG		0.463	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448		32	11	1	0	9.65021e-13	0.045705	1.18735e-12	32	11				
DIAPH2	1730	broad.mit.edu	37	X	96330222	96330222	+	Missense_Mutation	SNP	G	G	C			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chrX:96330222G>C	ENST00000324765.8	+	19	2556	c.2209G>C	c.(2209-2211)Gag>Cag	p.E737Q	DIAPH2_ENST00000373061.3_Missense_Mutation_p.E737Q|DIAPH2_ENST00000355827.4_Missense_Mutation_p.E737Q|DIAPH2_ENST00000373054.4_Missense_Mutation_p.E733Q|DIAPH2_ENST00000373049.4_Missense_Mutation_p.E737Q			O60879	DIAP2_HUMAN	diaphanous-related formin 2	737	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)	p.E737Q(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						CGTTATTCTGGAGGTTAATGA	0.313																																							uc004efu.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(1)	4						c.(2209-2211)GAG>CAG		diaphanous 2 isoform 156							127.0	114.0	118.0					X																	96330222		2203	4298	6501	SO:0001583	missense	1730				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding	g.chrX:96330222G>C	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2209G>C	X.37:g.96330222G>C	ENSP00000321348:p.Glu737Gln		Somatic				DIAPH2_uc004eft.3_Missense_Mutation_p.E737Q	p.E737Q	NM_006729	NP_006720	WXS	Illumina HiSeq	Unspecified	O60879	DIAP2_HUMAN			19	2605	+			737			FH2.		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	37	c.2209G>C	CCDS14467.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.879404	0.33162	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2	5.17	5.17	0.71159	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000001	T	0.26484	0.0647	L	0.61036	1.89	0.41847	D	0.990151	B;B	0.12013	0.005;0.004	B;B	0.10450	0.005;0.003	T	0.04065	-1.0980	10	0.51188	T	0.08	.	16.6711	0.85267	0.0:0.0:1.0:0.0	.	737;737	O60879;O60879-2	DIAP2_HUMAN;.	Q	737;733;737;737;737;744	ENSP00000362152:E737Q;ENSP00000362145:E733Q;ENSP00000348082:E737Q;ENSP00000362140:E737Q;ENSP00000321348:E737Q	ENSP00000321348:E737Q	E	+	1	0	DIAPH2	96216878	1.000000	0.71417	0.726000	0.30738	0.022000	0.10575	4.878000	0.63093	2.282000	0.76494	0.422000	0.28245	GAG		0.313	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309		13	5	0	0	0	0.09319	0	13	5				
GABRQ	55879	broad.mit.edu	37	X	151821395	151821395	+	Missense_Mutation	SNP	A	A	T			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chrX:151821395A>T	ENST00000370306.2	+	9	1570	c.1550A>T	c.(1549-1551)aAg>aTg	p.K517M		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	517					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.K517M(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCCAGTGGGAAGCCCATGCTT	0.547																																							uc004ffp.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(1549-1551)AAG>ATG		gamma-aminobutyric acid (GABA) receptor, theta							82.0	69.0	73.0					X																	151821395		2203	4300	6503	SO:0001583	missense	55879					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity	g.chrX:151821395A>T	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1550A>T	X.37:g.151821395A>T	ENSP00000359329:p.Lys517Met		Somatic					p.K517M	NM_018558	NP_061028	WXS	Illumina HiSeq	Unspecified	Q9UN88	GBRT_HUMAN			9	1570	+	Acute lymphoblastic leukemia(192;6.56e-05)		517					A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	c.1550A>T	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	A	8.616	0.890172	0.17613	.	.	ENSG00000147402	ENST00000370306	D	0.86030	-2.06	4.56	-9.11	0.00711	Neurotransmitter-gated ion-channel transmembrane domain (2);	.	.	.	.	T	0.59018	0.2163	N	0.02011	-0.69	0.09310	N	1	B	0.10296	0.003	B	0.16722	0.016	T	0.56896	-0.7903	9	0.45353	T	0.12	.	6.8705	0.24119	0.5728:0.0:0.1364:0.2908	.	517	Q9UN88	GBRT_HUMAN	M	517	ENSP00000359329:K517M	ENSP00000359329:K517M	K	+	2	0	GABRQ	151572051	0.011000	0.17503	0.000000	0.03702	0.039000	0.13416	-0.334000	0.07883	-2.826000	0.00341	-1.525000	0.00928	AAG		0.547	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558		65	67	0	0	0	0.048971	0	65	67				
ATP8B2	57198	broad.mit.edu	37	1	154315767	154315767	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr1:154315767delG	ENST00000368489.3	+	16	1731	c.1731delG	c.(1729-1731)atgfs	p.M577fs		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	563					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GCAAGCGGATGTCGGTCATAG	0.582																																							uc001fex.2		NA																	0				ovary(1)|skin(1)	2						c.(1729-1731)ATGfs		ATPase, class I, type 8B, member 2 isoform a							35.0	33.0	34.0					1																	154315767		2203	4300	6503	SO:0001589	frameshift_variant	57198				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr1:154315767delG	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1731delG	1.37:g.154315767delG	ENSP00000357475:p.Met577fs		Somatic					p.M577fs	NM_020452	NP_065185	WXS	Illumina HiSeq	Unspecified	P98198	AT8B2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		16	1731	+	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		563			Cytoplasmic (Potential).		B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Frame_Shift_Del	DEL	ENST00000368489.3	37	c.1731delG	CCDS1066.1																																																																																				0.582	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452		17	88	NA	NA	NA	NA	NA	17	88	---	---	---	---
OR10G9	219870	broad.mit.edu	37	11	123893833	123893833	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr11:123893833delG	ENST00000375024.1	+	1	114	c.114delG	c.(112-114)ctgfs	p.L38fs		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCACTGTGCTGGGGAACCTCC	0.572																																							uc010sad.1		NA																	0				skin(2)	2						c.(112-114)CTGfs		olfactory receptor, family 10, subfamily G,							133.0	121.0	125.0					11																	123893833		2201	4297	6498	SO:0001589	frameshift_variant	219870				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123893833delG	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.114delG	11.37:g.123893833delG	ENSP00000364164:p.Leu38fs		Somatic					p.L38fs	NM_001001953	NP_001001953	WXS	Illumina HiSeq	Unspecified	Q8NGN4	O10G9_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	114	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	38			Helical; Name=1; (Potential).			Frame_Shift_Del	DEL	ENST00000375024.1	37	c.114delG	CCDS31703.1																																																																																				0.572	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953		237	149	NA	NA	NA	NA	NA	237	149	---	---	---	---
OR10G7	390265	broad.mit.edu	37	11	123909592	123909592	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr11:123909592delC	ENST00000330487.5	-	1	125	c.117delG	c.(115-117)gggfs	p.G39fs		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TGAGGAGGTTCCCCAGCACAG	0.567																																							uc001pzq.1		NA																	0				ovary(2)	2						c.(115-117)GGGfs		olfactory receptor, family 10, subfamily G,							53.0	50.0	51.0					11																	123909592		2200	4292	6492	SO:0001589	frameshift_variant	390265				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123909592delC	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.117delG	11.37:g.123909592delC	ENSP00000329689:p.Gly39fs		Somatic					p.G39fs	NM_001004463	NP_001004463	WXS	Illumina HiSeq	Unspecified	Q8NGN6	O10G7_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	117	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	39			Helical; Name=1; (Potential).		Q6IFE8	Frame_Shift_Del	DEL	ENST00000330487.5	37	c.117delG	CCDS31705.1																																																																																				0.567	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463		30	217	NA	NA	NA	NA	NA	30	217	---	---	---	---
MYH13	8735	broad.mit.edu	37	17	10213124	10213124	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:10213124delG	ENST00000418404.3	-	33	4843	c.4680delC	c.(4678-4680)agcfs	p.S1560fs	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Frame_Shift_Del_p.S1560fs			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1560					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GCAAGATCTTGCTCTCCTCGT	0.488																																							uc002gmk.1		NA																	0				ovary(4)|skin(2)	6						c.(4678-4680)AGCfs		myosin, heavy polypeptide 13, skeletal muscle							27.0	27.0	27.0					17																	10213124		2020	4184	6204	SO:0001589	frameshift_variant	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10213124delG	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4680delC	17.37:g.10213124delG	ENSP00000404570:p.Ser1560fs		Somatic					p.S1560fs	NM_003802	NP_003793	WXS	Illumina HiSeq	Unspecified	Q9UKX3	MYH13_HUMAN			34	4770	-			1560			Potential.		O95252|Q9P0U8	Frame_Shift_Del	DEL	ENST00000418404.3	37	c.4680delC	CCDS45613.1																																																																																				0.488	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		5	3	NA	NA	NA	NA	NA	5	3	---	---	---	---
NOTUM	147111	broad.mit.edu	37	17	79916813	79916814	+	Frame_Shift_Ins	INS	-	-	A			TCGA-55-1596-01A-01D-1040-01	TCGA-55-1596-11A-01D-1040-01	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	30f9f0d3-2500-42e9-ae46-f6fabd818d73	f913dee6-7139-469b-b458-bd84986e2295	g.chr17:79916813_79916814insA	ENST00000409678.3	-	4	913_914	c.530_531insT	c.(529-531)atgfs	p.M177fs		NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)	177						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CCCCTTACACCATGTTTGCGTT	0.599																																							uc010wvg.1		NA																	0					0						c.(529-531)ATGfs		notum pectinacetylesterase homolog precursor																																				SO:0001589	frameshift_variant	147111					extracellular region	hydrolase activity	g.chr17:79916813_79916814insA	BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269			27106	protein-coding gene	gene with protein product		609847					Standard	NM_178493		Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.531dupT	17.37:g.79916814_79916814dupA	ENSP00000387310:p.Met177fs		Somatic					p.M177fs	NM_178493	NP_848588	WXS	Illumina HiSeq	Unspecified	Q6P988	NOTUM_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		4	802_803	-	all_neural(118;0.0878)|Ovarian(332;0.12)		177					Q8N410|Q8NI82	Frame_Shift_Ins	INS	ENST00000409678.3	37	c.530_531insT	CCDS32771.2																																																																																				0.599	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335123.2	NM_178493		17	85	NA	NA	NA	NA	NA	17	85	---	---	---	---
