#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
DNAJC16	23341	broad.mit.edu	37	1	15890542	15890542	+	Missense_Mutation	SNP	G	G	T	rs181472401	byFrequency	TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:15890542G>T	ENST00000375847.3	+	10	1621	c.1457G>T	c.(1456-1458)cGt>cTt	p.R486L	RP4-680D5.8_ENST00000606186.1_RNA|DNAJC16_ENST00000483270.1_3'UTR|DNAJC16_ENST00000375849.1_Missense_Mutation_p.R486L|DNAJC16_ENST00000375838.1_Missense_Mutation_p.R486L	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	486					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GACCAGCTGCGTAAAGATCCA	0.542																																							uc001aws.2		NA																	0				urinary_tract(1)|lung(1)|kidney(1)	3						c.(1456-1458)CGT>CTT		DnaJ (Hsp40) homolog, subfamily C, member 16							188.0	195.0	192.0					1																	15890542		2203	4300	6503	SO:0001583	missense	23341				cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding	g.chr1:15890542G>T	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.1457G>T	1.37:g.15890542G>T	ENSP00000365007:p.Arg486Leu		Somatic				DNAJC16_uc001awr.1_Missense_Mutation_p.R486L|DNAJC16_uc001awt.2_Missense_Mutation_p.R174L|DNAJC16_uc001awu.2_RNA	p.R486L	NM_015291	NP_056106	WXS	Illumina HiSeq	Unspecified	Q9Y2G8	DJC16_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)	10	1577	+		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)	486			Cytoplasmic (Potential).		Q68D57|Q86X32|Q8N5P4	Missense_Mutation	SNP	ENST00000375847.3	37	c.1457G>T	CCDS30606.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229331	0.58777	.	.	ENSG00000116138	ENST00000375847;ENST00000375838;ENST00000375849;ENST00000546230	T;T;T	0.15718	2.4;2.4;2.4	6.17	6.17	0.99709	.	0.102446	0.64402	D	0.000002	T	0.21962	0.0529	L	0.57536	1.79	0.29179	N	0.876617	P;P	0.51449	0.945;0.945	B;B	0.44278	0.445;0.445	T	0.34378	-0.9831	10	0.07644	T	0.81	-27.9098	19.4432	0.94831	0.0:0.0:1.0:0.0	.	486;486	Q9Y2G8;Q5TDG9	DJC16_HUMAN;.	L	486	ENSP00000365007:R486L;ENSP00000364998:R486L;ENSP00000365009:R486L	ENSP00000364998:R486L	R	+	2	0	DNAJC16	15763129	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.610000	0.74178	2.941000	0.99782	0.655000	0.94253	CGT		0.542	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291		58	200	1	0	8.81991e-31	0.01441	2.14429e-30	58	200				
TAS1R2	80834	broad.mit.edu	37	1	19168239	19168239	+	Silent	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:19168239G>A	ENST00000375371.3	-	5	1596	c.1575C>T	c.(1573-1575)ttC>ttT	p.F525F		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	525					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.F525F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TGTGGTTGAGGAAGGTGCCGG	0.597																																							uc001bba.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1573-1575)TTC>TTT		taste receptor, type 1, member 2 precursor	Aspartame(DB00168)						128.0	102.0	111.0					1																	19168239		2203	4300	6503	SO:0001819	synonymous_variant	80834				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:19168239G>A		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1575C>T	1.37:g.19168239G>A			Somatic					p.F525F	NM_152232	NP_689418	WXS	Illumina HiSeq	Unspecified	Q8TE23	TS1R2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	5	1576	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	525			Extracellular (Potential).		Q5TZ19	Silent	SNP	ENST00000375371.3	37	c.1575C>T	CCDS187.1																																																																																				0.597	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			13	52	0	0	0	0.013537	0	13	52				
STX12	23673	broad.mit.edu	37	1	28144412	28144412	+	Silent	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:28144412C>T	ENST00000373943.4	+	7	752	c.627C>T	c.(625-627)atC>atT	p.I209I	RP3-426I6.6_ENST00000602843.1_RNA	NM_177424.2	NP_803173.1	Q86Y82	STX12_HUMAN	syntaxin 12	209	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				cholesterol efflux (GO:0033344)|intracellular protein transport (GO:0006886)|protein stabilization (GO:0050821)|synaptic vesicle exocytosis (GO:0016079)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)	p.I209I(1)		breast(1)|central_nervous_system(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)		CCATGATGATCCATGACCAGG	0.358																																					Ovarian(5;5 342 2097 9488 34083)	Ovarian(5;5 342 2097 9488 34083)	uc001bou.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|central_nervous_system(1)	2						c.(625-627)ATC>ATT		syntaxin 12							178.0	165.0	169.0					1																	28144412		2203	4300	6503	SO:0001819	synonymous_variant	23673				cholesterol efflux|intracellular protein transport|protein stabilization|vesicle-mediated transport	Golgi apparatus|integral to membrane|membrane raft|phagocytic vesicle	SNAP receptor activity	g.chr1:28144412C>T	BC046999	CCDS310.1	1p35.3	2008-05-14			ENSG00000117758	ENSG00000117758			11430	protein-coding gene	gene with protein product		606892				9507000	Standard	NM_177424		Approved	STX13, STX14	uc001bou.4	Q86Y82	OTTHUMG00000003730	ENST00000373943.4:c.627C>T	1.37:g.28144412C>T			Somatic					p.I209I	NM_177424	NP_803173	WXS	Illumina HiSeq	Unspecified	Q86Y82	STX12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)	7	752	+		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)	209			t-SNARE coiled-coil homology.|Cytoplasmic (Potential).		B1AJQ7|O95564	Silent	SNP	ENST00000373943.4	37	c.627C>T	CCDS310.1																																																																																				0.358	STX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010519.1	NM_177424		10	45	0	0	0	0.013537	0	10	45				
STX12	23673	broad.mit.edu	37	1	28144414	28144414	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:28144414A>C	ENST00000373943.4	+	7	754	c.629A>C	c.(628-630)cAt>cCt	p.H210P	RP3-426I6.6_ENST00000602843.1_RNA	NM_177424.2	NP_803173.1	Q86Y82	STX12_HUMAN	syntaxin 12	210	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				cholesterol efflux (GO:0033344)|intracellular protein transport (GO:0006886)|protein stabilization (GO:0050821)|synaptic vesicle exocytosis (GO:0016079)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)	p.H210P(1)		breast(1)|central_nervous_system(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)		ATGATGATCCATGACCAGGGT	0.363																																					Ovarian(5;5 342 2097 9488 34083)	Ovarian(5;5 342 2097 9488 34083)	uc001bou.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|central_nervous_system(1)	2						c.(628-630)CAT>CCT		syntaxin 12							174.0	162.0	166.0					1																	28144414		2203	4300	6503	SO:0001583	missense	23673				cholesterol efflux|intracellular protein transport|protein stabilization|vesicle-mediated transport	Golgi apparatus|integral to membrane|membrane raft|phagocytic vesicle	SNAP receptor activity	g.chr1:28144414A>C	BC046999	CCDS310.1	1p35.3	2008-05-14			ENSG00000117758	ENSG00000117758			11430	protein-coding gene	gene with protein product		606892				9507000	Standard	NM_177424		Approved	STX13, STX14	uc001bou.4	Q86Y82	OTTHUMG00000003730	ENST00000373943.4:c.629A>C	1.37:g.28144414A>C	ENSP00000363054:p.His210Pro		Somatic					p.H210P	NM_177424	NP_803173	WXS	Illumina HiSeq	Unspecified	Q86Y82	STX12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)	7	754	+		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)	210			t-SNARE coiled-coil homology.|Cytoplasmic (Potential).		B1AJQ7|O95564	Missense_Mutation	SNP	ENST00000373943.4	37	c.629A>C	CCDS310.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.595574	0.86953	.	.	ENSG00000117758	ENST00000373943;ENST00000440806	T	0.23552	1.9	5.86	5.86	0.93980	t-SNARE (1);Syntaxin/epimorphin, conserved site (1);Target SNARE coiled-coil domain (3);	0.000000	0.85682	D	0.000000	T	0.64692	0.2621	H	0.95079	3.62	0.47153	D	0.999335	D	0.89917	1.0	D	0.97110	1.0	T	0.76282	-0.3016	10	0.72032	D	0.01	-16.0234	16.2644	0.82568	1.0:0.0:0.0:0.0	.	210	Q86Y82	STX12_HUMAN	P	210;233	ENSP00000363054:H210P	ENSP00000363054:H210P	H	+	2	0	STX12	28017001	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.357000	0.90088	2.244000	0.73946	0.528000	0.53228	CAT		0.363	STX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010519.1	NM_177424		9	45	0	0	0	0.008291	0	9	45				
CSMD2	114784	broad.mit.edu	37	1	34092172	34092172	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:34092172A>T	ENST00000373380.1	-	12	2049	c.1829T>A	c.(1828-1830)cTg>cAg	p.L610Q	CSMD2_ENST00000373381.4_Missense_Mutation_p.L1737Q|CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373377.1_5'UTR			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1697	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L1697Q(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGCCAAGGGCAGTGATTCTCC	0.557																																							uc001bxn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(5089-5091)CTG>CAG		CUB and Sushi multiple domains 2							42.0	38.0	40.0					1																	34092172		2203	4299	6502	SO:0001583	missense	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34092172A>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.1829T>A	1.37:g.34092172A>T	ENSP00000362478:p.Leu610Gln		Somatic				CSMD2_uc001bxm.1_Missense_Mutation_p.L1737Q|CSMD2_uc001bxo.1_Missense_Mutation_p.L610Q	p.L1697Q	NM_052896	NP_443128	WXS	Illumina HiSeq	Unspecified	Q7Z408	CSMD2_HUMAN			33	5119	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	1697			Extracellular (Potential).|CUB 10.		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37	c.5090T>A		.	.	.	.	.	.	.	.	.	.	A	26.4	4.734686	0.89482	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.20463	2.07;2.07	5.87	5.87	0.94306	CUB (5);	0.000000	0.64402	D	0.000003	T	0.50922	0.1644	M	0.82716	2.605	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.97110	1.0;0.998;0.998	T	0.56080	-0.8038	10	0.66056	D	0.02	.	15.4617	0.75363	1.0:0.0:0.0:0.0	.	610;1697;1737	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	Q	1737;610	ENSP00000362479:L1737Q;ENSP00000362478:L610Q	ENSP00000241312:L1697Q	L	-	2	0	CSMD2	33864759	1.000000	0.71417	0.972000	0.41901	0.966000	0.64601	9.292000	0.96076	2.248000	0.74166	0.533000	0.62120	CTG		0.557	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896		6	18	0	0	0	0.001984	0	6	18				
GNL2	29889	broad.mit.edu	37	1	38059394	38059394	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:38059394G>A	ENST00000373062.3	-	2	216	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	40					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.R40C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				ATATTCAGGCGCCGGATGGTG	0.512																																							uc001cbk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(118-120)CGC>TGC		guanine nucleotide binding protein-like 2							97.0	97.0	97.0					1																	38059394		2203	4300	6503	SO:0001583	missense	29889				ribosome biogenesis	nucleolus	GTP binding|GTPase activity|protein binding	g.chr1:38059394G>A	L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.118C>T	1.37:g.38059394G>A	ENSP00000362153:p.Arg40Cys		Somatic				GNL2_uc010oif.1_5'UTR|GNL2_uc009vve.2_Missense_Mutation_p.R40C	p.R40C	NM_013285	NP_037417	WXS	Illumina HiSeq	Unspecified	Q13823	NOG2_HUMAN			2	281	-		Myeloproliferative disorder(586;0.0393)	40					Q9BWN7	Missense_Mutation	SNP	ENST00000373062.3	37	c.118C>T	CCDS421.1	.	.	.	.	.	.	.	.	.	.	G	36	5.659001	0.96734	.	.	ENSG00000134697	ENST00000373062	T	0.28895	1.59	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.61689	0.2367	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.63189	-0.6693	10	0.87932	D	0	-11.2291	20.547	0.99278	0.0:0.0:1.0:0.0	.	40;40	Q5T0F3;Q13823	.;NOG2_HUMAN	C	40	ENSP00000362153:R40C	ENSP00000362153:R40C	R	-	1	0	GNL2	37831981	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.720000	0.84759	2.850000	0.98022	0.650000	0.86243	CGC		0.512	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285		6	136	0	0	0	0.00308	0	6	136				
USP33	23032	broad.mit.edu	37	1	78207102	78207102	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:78207102C>A	ENST00000370793.1	-	4	533	c.187G>T	c.(187-189)Gat>Tat	p.D63Y	USP33_ENST00000370794.3_Missense_Mutation_p.D32Y|USP33_ENST00000357428.1_Missense_Mutation_p.D63Y|USP33_ENST00000370792.3_Missense_Mutation_p.D63Y|USP33_ENST00000528150.1_5'UTR	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	63					axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.D63Y(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						ACTTTACAATCCTGACAAGTA	0.303																																					Melanoma(152;72 1870 11110 26780 42647)	Melanoma(152;72 1870 11110 26780 42647)	uc001dht.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(187-189)GAT>TAT		ubiquitin specific protease 33 isoform 1							75.0	83.0	80.0					1																	78207102		2203	4295	6498	SO:0001583	missense	23032				axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr1:78207102C>A	AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.187G>T	1.37:g.78207102C>A	ENSP00000359829:p.Asp63Tyr		Somatic				USP33_uc001dhu.2_Missense_Mutation_p.D32Y|USP33_uc001dhv.2_5'UTR|USP33_uc001dhw.2_Missense_Mutation_p.D63Y	p.D63Y	NM_015017	NP_055832	WXS	Illumina HiSeq	Unspecified	Q8TEY7	UBP33_HUMAN			4	534	-			63			UBP-type.		Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	ENST00000370793.1	37	c.187G>T	CCDS678.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548088	0.65311	.	.	ENSG00000077254	ENST00000370794;ENST00000370793;ENST00000357428;ENST00000370792;ENST00000524536;ENST00000530709;ENST00000524778	T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.08	4.08	0.47627	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, UBP-type (2);	0.044226	0.85682	D	0.000000	T	0.57330	0.2046	M	0.66560	2.04	0.53005	D	0.999965	P;D	0.69078	0.73;0.997	P;D	0.71656	0.492;0.974	T	0.57452	-0.7809	10	0.54805	T	0.06	.	13.4514	0.61174	0.1565:0.8435:0.0:0.0	.	63;63	Q8TEY7-3;Q8TEY7	.;UBP33_HUMAN	Y	32;63;63;63;63;63;32	ENSP00000359830:D32Y;ENSP00000359829:D63Y;ENSP00000350009:D63Y;ENSP00000359828:D63Y;ENSP00000434441:D63Y;ENSP00000433283:D63Y;ENSP00000436441:D32Y	ENSP00000350009:D63Y	D	-	1	0	USP33	77979690	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.839000	0.55835	2.758000	0.94735	0.563000	0.77884	GAT		0.303	USP33-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026923.2	NM_015017		28	155	1	0	1.16021e-09	0.007291	2.19611e-09	28	155				
AGL	178	broad.mit.edu	37	1	100343333	100343333	+	Silent	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:100343333C>T	ENST00000294724.4	+	12	2038	c.1560C>T	c.(1558-1560)ttC>ttT	p.F520F	AGL_ENST00000361302.3_Silent_p.F504F|AGL_ENST00000370163.3_Silent_p.F520F|AGL_ENST00000361522.4_Silent_p.F503F|AGL_ENST00000370165.3_Silent_p.F520F|AGL_ENST00000370161.2_Silent_p.F504F|AGL_ENST00000361915.3_Silent_p.F520F	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	520					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)	p.F520F(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		CAACTTATTTCCAGGGAGTAC	0.393																																							uc001dsi.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1558-1560)TTC>TTT		amylo-1,6-glucosidase,							105.0	102.0	103.0					1																	100343333		2203	4300	6503	SO:0001819	synonymous_variant	178				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding	g.chr1:100343333C>T	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.1560C>T	1.37:g.100343333C>T			Somatic				AGL_uc001dsj.1_Silent_p.F520F|AGL_uc001dsk.1_Silent_p.F520F|AGL_uc001dsl.1_Silent_p.F520F|AGL_uc001dsm.1_Silent_p.F504F|AGL_uc001dsn.1_Silent_p.F503F	p.F520F	NM_000642	NP_000633	WXS	Illumina HiSeq	Unspecified	P35573	GDE_HUMAN		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)	12	1960	+		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)	520			4-alpha-glucanotransferase.		A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Silent	SNP	ENST00000294724.4	37	c.1560C>T	CCDS759.1																																																																																				0.393	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028		16	67	0	0	0	0.006122	0	16	67				
TRMT13	54482	broad.mit.edu	37	1	100614308	100614308	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:100614308G>T	ENST00000370141.2	+	11	1384	c.1378G>T	c.(1378-1380)Gtg>Ttg	p.V460L		NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)	460					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.V460L(1)									AGACCCTCTGGTGTCTTTGGA	0.393																																							uc001dsv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1378-1380)GTG>TTG		coiled-coil domain containing 76							82.0	88.0	86.0					1																	100614308		2203	4300	6503	SO:0001583	missense	54482				tRNA processing		metal ion binding|methyltransferase activity	g.chr1:100614308G>T	BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.1378G>T	1.37:g.100614308G>T	ENSP00000359160:p.Val460Leu		Somatic				CCDC76_uc010ouf.1_RNA|CCDC76_uc009wea.2_3'UTR	p.V460L	NM_019083	NP_061956	WXS	Illumina HiSeq	Unspecified	Q9NUP7	TRM13_HUMAN		Epithelial(280;0.0814)|all cancers(265;0.133)|COAD - Colon adenocarcinoma(174;0.146)|Lung(183;0.194)	11	1397	+		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)	460					Q5VVL0|Q9NW65	Missense_Mutation	SNP	ENST00000370141.2	37	c.1378G>T	CCDS765.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875240	0.91664	.	.	ENSG00000122435	ENST00000370141	T	0.48201	0.82	6.02	5.08	0.68730	Methyltransferase TRM13 (1);	0.052391	0.85682	D	0.000000	T	0.63058	0.2479	M	0.76433	2.335	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61033	-0.7144	10	0.45353	T	0.12	-12.4951	16.7405	0.85458	0.0:0.0:0.8703:0.1297	.	460	Q9NUP7	TRM13_HUMAN	L	460	ENSP00000359160:V460L	ENSP00000359160:V460L	V	+	1	0	CCDC76	100386896	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	3.989000	0.56958	2.859000	0.98148	0.591000	0.81541	GTG		0.393	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029919.1	NM_019083		7	45	1	0	8.12818e-05	0.001984	0.000128212	7	45				
SYT6	148281	broad.mit.edu	37	1	114640500	114640500	+	Splice_Site	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:114640500C>A	ENST00000610222.1	-	6	1511		c.e6-1		SYT6_ENST00000393296.1_Splice_Site|SYT6_ENST00000369547.1_Splice_Site|SYT6_ENST00000607941.1_Splice_Site|SYT6_ENST00000609117.1_Splice_Site			Q5T7P8	SYT6_HUMAN	synaptotagmin VI						acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)	p.?(1)		central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTGGCCCACTCTGAGGGAGAA	0.577																																							uc001eev.2		NA																	1	Unknown(1)		lung(1)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.e6-1		synaptotagmin VI							72.0	67.0	69.0					1																	114640500		2203	4300	6503	SO:0001630	splice_region_variant	148281				acrosomal vesicle exocytosis	cell junction|cytosol|integral to membrane|perinuclear endoplasmic reticulum|peripheral to membrane of membrane fraction|synaptic vesicle membrane	clathrin binding|metal ion binding|protein homodimerization activity|syntaxin binding|transporter activity	g.chr1:114640500C>A		CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.1365-1G>T	1.37:g.114640500C>A			Somatic				SYT6_uc001eeu.2_Splice_Site_p.R15_splice	p.R370_splice	NM_205848	NP_995320	WXS	Illumina HiSeq	Unspecified	Q5T7P8	SYT6_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	6	1360	-	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)						B1AMB8|B3KPK1	Splice_Site	SNP	ENST00000610222.1	37	c.1110_splice		.	.	.	.	.	.	.	.	.	.	C	20.7	4.032156	0.75504	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4355	0.94792	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SYT6	114442023	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	7.780000	0.85658	2.593000	0.87608	0.462000	0.41574	.		0.577	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000314819.2	NM_205848	Intron	8	42	1	0	0.000442599	0.006214	0.000681912	8	42				
VANGL1	81839	broad.mit.edu	37	1	116233804	116233804	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:116233804C>T	ENST00000355485.2	+	8	1650	c.1379C>T	c.(1378-1380)tCt>tTt	p.S460F	VANGL1_ENST00000310260.3_Missense_Mutation_p.S460F|VANGL1_ENST00000369509.1_Missense_Mutation_p.S460F|VANGL1_ENST00000369510.4_Missense_Mutation_p.S458F	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	460					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)		p.S460F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CGCTGGCTCTCTACACAGTGG	0.522																																							uc001efv.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1378-1380)TCT>TTT		vang-like 1							105.0	86.0	93.0					1																	116233804		2203	4300	6503	SO:0001583	missense	81839				multicellular organismal development	integral to membrane	protein binding	g.chr1:116233804C>T	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.1379C>T	1.37:g.116233804C>T	ENSP00000347672:p.Ser460Phe		Somatic				VANGL1_uc009wgy.1_Missense_Mutation_p.S458F	p.S460F	NM_138959	NP_620409	WXS	Illumina HiSeq	Unspecified	Q8TAA9	VANG1_HUMAN		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)	8	1650	+	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)	460			Cytoplasmic (Potential).		Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	ENST00000355485.2	37	c.1379C>T	CCDS883.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.674412	0.88445	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43	5.04	5.04	0.67666	.	0.144833	0.51477	D	0.000094	D	0.83945	0.5364	L	0.58101	1.795	0.58432	D	0.999997	D;D	0.54397	0.958;0.966	P;P	0.58331	0.748;0.837	D	0.84579	0.0660	10	0.56958	D	0.05	-23.5646	18.5856	0.91188	0.0:1.0:0.0:0.0	.	458;460	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	F	460;458;460;460	ENSP00000347672:S460F;ENSP00000358523:S458F;ENSP00000310800:S460F;ENSP00000358522:S460F	ENSP00000310800:S460F	S	+	2	0	VANGL1	116035327	1.000000	0.71417	0.029000	0.17559	0.879000	0.50718	4.702000	0.61817	2.617000	0.88574	0.655000	0.94253	TCT		0.522	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033096.1			15	38	0	0	0	0.00245	0	15	38				
MAN1A2	10905	broad.mit.edu	37	1	118003128	118003128	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:118003128G>T	ENST00000356554.3	+	7	1703	c.968G>T	c.(967-969)tGg>tTg	p.W323L		NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	323					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.W323L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		GGGCGAAACTGGGGCTGGGCA	0.423																																					Ovarian(33;199 881 8228 13687 31538)	Ovarian(33;199 881 8228 13687 31538)	uc001ehd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(967-969)TGG>TTG		mannosidase, alpha, class 1A, member 2							122.0	118.0	120.0					1																	118003128		2203	4300	6503	SO:0001583	missense	10905				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity	g.chr1:118003128G>T	AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.968G>T	1.37:g.118003128G>T	ENSP00000348959:p.Trp323Leu		Somatic				MAN1A2_uc009whg.1_Missense_Mutation_p.W113L	p.W323L	NM_006699	NP_006690	WXS	Illumina HiSeq	Unspecified	O60476	MA1A2_HUMAN		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)	7	1689	+	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)	323			Lumenal (Potential).		Q9H510	Missense_Mutation	SNP	ENST00000356554.3	37	c.968G>T	CCDS895.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.8|25.8	4.674490|4.674490	0.88445|0.88445	.|.	.|.	ENSG00000198162|ENSG00000198162	ENST00000449370|ENST00000356554;ENST00000369450	.|D	.|0.82081	.|-1.57	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81626|0.81626	0.4862|0.4862	L|L	0.42686|0.42686	1.345|1.345	0.80722|0.80722	D|D	1|1	.|D;P	.|0.89917	.|1.0;0.852	.|D;B	.|0.67900	.|0.954;0.393	T|T	0.78125|0.78125	-0.2326|-0.2326	5|10	.|0.12430	.|T	.|0.62	-1.1076|-1.1076	15.9761|15.9761	0.80066|0.80066	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|87;323	.|A6NLR2;O60476	.|.;MA1A2_HUMAN	W|L	56|323;87	.|ENSP00000348959:W323L	.|ENSP00000348959:W323L	G|W	+|+	1|2	0|0	MAN1A2|MAN1A2	117804651|117804651	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	9.682000|9.682000	0.98655|0.98655	2.354000|2.354000	0.79902|0.79902	0.655000|0.655000	0.94253|0.94253	GGG|TGG		0.423	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033593.1	NM_006699		32	94	1	0	9.65963e-10	0.003271	1.85493e-09	32	94				
TXNIP	10628	broad.mit.edu	37	1	145438883	145438883	+	Silent	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:145438883G>T	ENST00000369317.4	+	1	415	c.81G>T	c.(79-81)gtG>gtT	p.V27V	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	27					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)	p.V27V(1)		breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCGAGAAGGTGGCTGGCCGGG	0.507																																							uc001enn.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(79-81)GTG>GTT		thioredoxin interacting protein							137.0	123.0	128.0					1																	145438883		2203	4300	6503	SO:0001819	synonymous_variant	10628				cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding	g.chr1:145438883G>T	S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.81G>T	1.37:g.145438883G>T			Somatic				NBPF10_uc001emp.3_Intron|TXNIP_uc001enm.1_Intron|TXNIP_uc010oys.1_5'Flank	p.V27V	NM_006472	NP_006463	WXS	Illumina HiSeq	Unspecified	Q9H3M7	TXNIP_HUMAN			1	422	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		27					B4E3D3|Q16226|Q6PML0|Q9BXG9	Silent	SNP	ENST00000369317.4	37	c.81G>T	CCDS913.1																																																																																				0.507	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038547.1	NM_006472		60	65	1	0	1.14385e-22	0.01441	2.73082e-22	60	65				
FLG2	388698	broad.mit.edu	37	1	152324797	152324797	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:152324797C>A	ENST00000388718.5	-	3	5537	c.5465G>T	c.(5464-5466)cGa>cTa	p.R1822L	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1822					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGTGTGTCCTCGTGAGTGTGG	0.522																																							uc001ezw.3		NA																	0				ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(5464-5466)CGA>CTA		filaggrin family member 2							307.0	271.0	283.0					1																	152324797		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152324797C>A	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5465G>T	1.37:g.152324797C>A	ENSP00000373370:p.Arg1822Leu		Somatic				uc001ezv.2_Intron	p.R1822L	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	5538	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1822					Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.5465G>T	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.274193	0.23221	.	.	ENSG00000143520	ENST00000388718	T	0.25579	1.79	2.43	0.474	0.16768	.	.	.	.	.	T	0.05686	0.0149	N	0.08118	0	0.09310	N	1	P	0.43352	0.804	P	0.47864	0.559	T	0.22068	-1.0227	9	0.28530	T	0.3	.	5.0815	0.14659	0.0:0.6938:0.0:0.3062	.	1822	Q5D862	FILA2_HUMAN	L	1822	ENSP00000373370:R1822L	ENSP00000373370:R1822L	R	-	2	0	FLG2	150591421	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-0.237000	0.08990	0.156000	0.19299	-0.734000	0.03567	CGA		0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		32	333	1	0	1.36615e-20	0.013726	3.17569e-20	32	333				
LCE3E	353145	broad.mit.edu	37	1	152538635	152538635	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:152538635G>T	ENST00000368789.1	-	2	105	c.50C>A	c.(49-51)cCc>cAc	p.P17H		NM_178435.2	NP_848522.1	Q5T5B0	LCE3E_HUMAN	late cornified envelope 3E	17					keratinization (GO:0031424)			p.P17H(1)		lung(6)|ovary(1)	7	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		Lung(1;0.000294)|LUAD - Lung adenocarcinoma(1;0.00527)|LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)		CTTGGGTGAGGGGCACTTGGG	0.592																																							uc001faa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(49-51)CCC>CAC		late cornified envelope 3E							63.0	68.0	66.0					1																	152538635		2203	4300	6503	SO:0001583	missense	353145				keratinization			g.chr1:152538635G>T		CCDS1013.1	1q21.3	2008-02-05			ENSG00000185966	ENSG00000185966		"""Late cornified envelopes"""	29463	protein-coding gene	gene with protein product		612617				11698679	Standard	NM_178435		Approved	LEP17	uc001faa.4	Q5T5B0	OTTHUMG00000012393	ENST00000368789.1:c.50C>A	1.37:g.152538635G>T	ENSP00000357778:p.Pro17His		Somatic					p.P17H	NM_178435	NP_848522	WXS	Illumina HiSeq	Unspecified	Q5T5B0	LCE3E_HUMAN	Lung(1;0.000294)|LUAD - Lung adenocarcinoma(1;0.00527)|LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)	2	106	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		17					A2RRM6	Missense_Mutation	SNP	ENST00000368789.1	37	c.50C>A	CCDS1013.1	.	.	.	.	.	.	.	.	.	.	G	8.500	0.864009	0.17250	.	.	ENSG00000185966	ENST00000368789	T	0.13196	2.61	3.69	2.67	0.31697	.	.	.	.	.	T	0.09686	0.0238	.	.	.	0.27013	N	0.964631	D	0.55385	0.971	P	0.50490	0.642	T	0.10222	-1.0639	8	0.87932	D	0	.	7.7538	0.28913	0.0:0.0:0.7502:0.2498	.	17	Q5T5B0	LCE3E_HUMAN	H	17	ENSP00000357778:P17H	ENSP00000357778:P17H	P	-	2	0	LCE3E	150805259	1.000000	0.71417	0.998000	0.56505	0.800000	0.45204	2.533000	0.45667	2.033000	0.60031	0.460000	0.39030	CCC		0.592	LCE3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034513.1	NM_178435		12	114	1	0	2.27111e-07	0.013537	3.85798e-07	12	114				
CHRNB2	1141	broad.mit.edu	37	1	154544242	154544242	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:154544242A>T	ENST00000368476.3	+	5	1207	c.943A>T	c.(943-945)Agc>Tgc	p.S315C		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	315					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)	p.S315C(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	CATCGTCACCAGCGTGTGCGT	0.627																																							uc001ffg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(943-945)AGC>TGC		neuronal nicotinic acetylcholine receptor beta 2	Nicotine(DB00184)						126.0	93.0	104.0					1																	154544242		2203	4300	6503	SO:0001583	missense	1141				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr1:154544242A>T	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.943A>T	1.37:g.154544242A>T	ENSP00000357461:p.Ser315Cys		Somatic					p.S315C	NM_000748	NP_000739	WXS	Illumina HiSeq	Unspecified	P17787	ACHB2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		5	1207	+	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		315			Helical; (Potential).		Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	37	c.943A>T	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.287154	0.80803	.	.	ENSG00000160716	ENST00000368476	D	0.85556	-2.0	3.97	3.97	0.46021	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.89283	0.6671	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90107	0.4189	10	0.56958	D	0.05	.	12.6654	0.56840	1.0:0.0:0.0:0.0	.	315	P17787	ACHB2_HUMAN	C	315	ENSP00000357461:S315C	ENSP00000357461:S315C	S	+	1	0	CHRNB2	152810866	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.078000	0.94023	1.645000	0.50612	0.260000	0.18958	AGC		0.627	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748		29	38	0	0	0	0.008361	0	29	38				
CADM3	57863	broad.mit.edu	37	1	159170598	159170598	+	Silent	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:159170598C>A	ENST00000368125.4	+	9	1240	c.1083C>A	c.(1081-1083)acC>acA	p.T361T	CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Silent_p.T395T|DARC_ENST00000537147.1_5'Flank|CTA-134P22.2_ENST00000609696.1_RNA|CADM3_ENST00000497636.1_3'UTR	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	361					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.T395T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					ACACAGGAACCTACCTGACAC	0.582																																							uc001ftl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1081-1083)ACC>ACA		cell adhesion molecule 3 isoform 2							86.0	79.0	82.0					1																	159170598		2203	4300	6503	SO:0001819	synonymous_variant	57863				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity	g.chr1:159170598C>A	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.1083C>A	1.37:g.159170598C>A			Somatic				CADM3_uc001ftk.2_Silent_p.T395T|uc001ftm.1_Intron	p.T361T	NM_001127173	NP_001120645	WXS	Illumina HiSeq	Unspecified	Q8N126	CADM3_HUMAN			9	1225	+	all_hematologic(112;0.0429)		361			Cytoplasmic (Potential).		Q8IZQ9|Q9NVJ5|Q9UJP1	Silent	SNP	ENST00000368125.4	37	c.1083C>A	CCDS44251.1																																																																																				0.582	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189		35	61	1	0	1.26612e-14	0.003271	2.72781e-14	35	61				
SLAMF8	56833	broad.mit.edu	37	1	159799681	159799681	+	Silent	SNP	T	T	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:159799681T>C	ENST00000289707.5	+	2	215	c.66T>C	c.(64-66)ggT>ggC	p.G22G	SLAMF8_ENST00000368104.4_Intron	NM_020125.2	NP_064510.1	Q9P0V8	SLAF8_HUMAN	SLAM family member 8	22					cellular response to drug (GO:0035690)|defense response to bacterium (GO:0042742)|phagosome acidification (GO:0090383)|regulation of kinase activity (GO:0043549)|regulation of NAD(P)H oxidase activity (GO:0033860)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(4)|lung(6)	12	all_hematologic(112;0.0597)					CAGTTACTGGTGCCCAAGTGC	0.587																																							uc001fue.3		NA																	0					0						c.(64-66)GGT>GGC		SLAM family member 8 precursor																																				SO:0001819	synonymous_variant	56833					integral to membrane		g.chr1:159799681T>C	AF146761	CCDS1188.1	1q23.1	2013-01-11			ENSG00000158714	ENSG00000158714		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21391	protein-coding gene	gene with protein product		606620				11313408	Standard	NM_020125		Approved	BLAME, SBBI42, CD353	uc001fue.4	Q9P0V8	OTTHUMG00000035433	ENST00000289707.5:c.66T>C	1.37:g.159799681T>C			Somatic					p.G22G	NM_020125	NP_064510	WXS	Illumina HiSeq	Unspecified	Q9P0V8	SLAF8_HUMAN			2	276	+	all_hematologic(112;0.0597)		22					Q32MC6|Q5VU15	Silent	SNP	ENST00000289707.5	37	c.66T>C	CCDS1188.1																																																																																				0.587	SLAMF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085983.1	NM_020125		36	139	0	0	0	0.003755	0	36	139				
ITLN1	55600	broad.mit.edu	37	1	160850401	160850401	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:160850401G>C	ENST00000326245.3	-	6	777	c.662C>G	c.(661-663)tCt>tGt	p.S221C	ITLN1_ENST00000487531.1_5'UTR	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	221	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)	p.S221C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TGAGTAATAAGATGCTGTTTT	0.448																																							uc001fxc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)	7						c.(661-663)TCT>TGT		intelectin precursor							190.0	191.0	191.0					1																	160850401		2203	4300	6503	SO:0001583	missense	55600				positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding	g.chr1:160850401G>C	AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.662C>G	1.37:g.160850401G>C	ENSP00000323587:p.Ser221Cys		Somatic					p.S221C	NM_017625	NP_060095	WXS	Illumina HiSeq	Unspecified	Q8WWA0	ITLN1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00737)		6	778	-	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		221			Fibrinogen C-terminal.		Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Missense_Mutation	SNP	ENST00000326245.3	37	c.662C>G	CCDS1211.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187216	0.38609	.	.	ENSG00000179914	ENST00000326245	T	0.21191	2.02	4.17	3.17	0.36434	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	0.560906	0.16159	N	0.226837	T	0.31979	0.0814	M	0.85041	2.73	0.29806	N	0.832021	P	0.48350	0.909	P	0.58172	0.834	T	0.03483	-1.1032	10	0.72032	D	0.01	-7.0431	10.8161	0.46575	0.0:0.0:0.799:0.201	.	221	Q8WWA0	ITLN1_HUMAN	C	221	ENSP00000323587:S221C	ENSP00000323587:S221C	S	-	2	0	ITLN1	159117025	0.001000	0.12720	0.968000	0.41197	0.212000	0.24457	0.210000	0.17455	2.129000	0.65627	0.655000	0.94253	TCT		0.448	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071462.1	NM_017625		65	257	0	0	0	0.01441	0	65	257				
FMO4	2329	broad.mit.edu	37	1	171303751	171303751	+	Silent	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:171303751C>T	ENST00000367749.3	+	8	1359	c.1029C>T	c.(1027-1029)agC>agT	p.S343S		NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	343					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.S343S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					CTCTTAAAAGCCTCTGTACAA	0.383																																					Pancreas(24;816 862 7754 7993 32832)	Pancreas(24;816 862 7754 7993 32832)	uc001gho.2		NA																	1	Substitution - coding silent(1)		lung(1)	kidney(2)|skin(1)	3						c.(1027-1029)AGC>AGT		flavin containing monooxygenase 4							85.0	90.0	89.0					1																	171303751		2203	4300	6503	SO:0001819	synonymous_variant	2329				xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding	g.chr1:171303751C>T	BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.1029C>T	1.37:g.171303751C>T			Somatic					p.S343S	NM_002022	NP_002013	WXS	Illumina HiSeq	Unspecified	P31512	FMO4_HUMAN			8	1246	+	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)		343					Q53XR0	Silent	SNP	ENST00000367749.3	37	c.1029C>T	CCDS1295.1																																																																																				0.383	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086223.1	NM_002022		12	121	0	0	0	0.010729	0	12	121				
TNN	63923	broad.mit.edu	37	1	175092548	175092548	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:175092548C>A	ENST00000239462.4	+	12	2776	c.2663C>A	c.(2662-2664)cCc>cAc	p.P888H		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	888	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.P888H(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ATTGACGGCCCCAAAAACCTA	0.473																																							uc001gkl.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2662-2664)CCC>CAC		tenascin N precursor							61.0	64.0	63.0					1																	175092548		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175092548C>A	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2663C>A	1.37:g.175092548C>A	ENSP00000239462:p.Pro888His		Somatic					p.P888H	NM_022093	NP_071376	WXS	Illumina HiSeq	Unspecified	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	12	2776	+		Breast(1374;0.000962)	888			Fibronectin type-III 8.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2663C>A	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.834814	0.50951	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.79940	-1.32	4.98	4.98	0.66077	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93380	0.7889	H	0.97390	3.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95429	0.8514	10	0.66056	D	0.02	.	16.3803	0.83458	0.0:1.0:0.0:0.0	.	888	Q9UQP3	TENN_HUMAN	H	888;711	ENSP00000239462:P888H	ENSP00000239462:P888H	P	+	2	0	TNN	173359171	1.000000	0.71417	0.996000	0.52242	0.062000	0.15995	6.624000	0.74243	2.446000	0.82766	0.462000	0.41574	CCC		0.473	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		29	62	1	0	3.73148e-12	0.007291	7.37941e-12	29	62				
TNR	7143	broad.mit.edu	37	1	175375611	175375611	+	Silent	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:175375611G>T	ENST00000367674.2	-	3	948	c.240C>A	c.(238-240)tcC>tcA	p.S80S	TNR_ENST00000263525.2_Silent_p.S80S			Q92752	TENR_HUMAN	tenascin R	80					associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.S80S(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CTAGCCCTGAGGAGCAGAGGT	0.562																																							uc001gkp.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(238-240)TCC>TCA		tenascin R precursor							196.0	166.0	176.0					1																	175375611		2203	4300	6503	SO:0001819	synonymous_variant	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175375611G>T	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.240C>A	1.37:g.175375611G>T			Somatic				TNR_uc009wwu.1_Silent_p.S80S|TNR_uc010pmz.1_Silent_p.S80S	p.S80S	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			1	321	-	Renal(580;0.146)		80					C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	c.240C>A	CCDS1318.1																																																																																				0.562	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		39	79	1	0	1.90571e-15	0.004289	4.17366e-15	39	79				
RPS6KC1	26750	broad.mit.edu	37	1	213415205	213415205	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:213415205G>T	ENST00000366960.3	+	11	2536	c.2386G>T	c.(2386-2388)Gat>Tat	p.D796Y	RPS6KC1_ENST00000543354.1_Missense_Mutation_p.D499Y|RPS6KC1_ENST00000490299.1_3'UTR|RPS6KC1_ENST00000543470.1_Missense_Mutation_p.D584Y|RPS6KC1_ENST00000366959.3_Missense_Mutation_p.D784Y	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	796	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)	p.D796Y(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		ACCCAGCTCAGATCCTAAGTT	0.418																																							uc010ptr.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(3)|breast(1)	8						c.(2386-2388)GAT>TAT		ribosomal protein S6 kinase, 52kDa, polypeptide							130.0	130.0	130.0					1																	213415205		2203	4300	6503	SO:0001583	missense	26750				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity	g.chr1:213415205G>T	AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.2386G>T	1.37:g.213415205G>T	ENSP00000355927:p.Asp796Tyr		Somatic				RPS6KC1_uc001hkd.2_Missense_Mutation_p.D784Y|RPS6KC1_uc010pts.1_Missense_Mutation_p.D584Y|RPS6KC1_uc010ptt.1_Missense_Mutation_p.D584Y|RPS6KC1_uc010ptu.1_Missense_Mutation_p.D615Y|RPS6KC1_uc010ptv.1_Missense_Mutation_p.D331Y|RPS6KC1_uc001hke.2_Missense_Mutation_p.D615Y	p.D796Y	NM_012424	NP_036556	WXS	Illumina HiSeq	Unspecified	Q96S38	KS6C1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)	11	2545	+			796			Protein kinase 2.		B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Missense_Mutation	SNP	ENST00000366960.3	37	c.2386G>T	CCDS1513.1	.	.	.	.	.	.	.	.	.	.	G	6.567	0.472943	0.12461	.	.	ENSG00000136643	ENST00000543470;ENST00000366960;ENST00000366959;ENST00000543354	T;T;T;T	0.41400	1.42;1.44;1.44;1.0	5.63	1.58	0.23477	Protein kinase, catalytic domain (1);	1.160410	0.06040	N	0.654719	T	0.35970	0.0950	L	0.44542	1.39	0.09310	N	1	B;B;B	0.16396	0.017;0.002;0.002	B;B;B	0.13407	0.009;0.001;0.001	T	0.34700	-0.9818	10	0.62326	D	0.03	-26.7094	6.6603	0.23011	0.159:0.2909:0.5501:0.0	.	584;796;784	F5H7T0;Q96S38;B1APS8	.;KS6C1_HUMAN;.	Y	584;796;784;499	ENSP00000442306:D584Y;ENSP00000355927:D796Y;ENSP00000355926:D784Y;ENSP00000439282:D499Y	ENSP00000355926:D784Y	D	+	1	0	RPS6KC1	211481828	0.000000	0.05858	0.012000	0.15200	0.882000	0.50991	0.309000	0.19332	0.292000	0.22492	0.655000	0.94253	GAT		0.418	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089690.3	NM_012424		54	79	1	0	4.88482e-21	0.01441	1.15578e-20	54	79				
USH2A	7399	broad.mit.edu	37	1	215956216	215956216	+	Silent	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:215956216C>T	ENST00000307340.3	-	53	10835	c.10449G>A	c.(10447-10449)ggG>ggA	p.G3483G	USH2A_ENST00000366943.2_Silent_p.G3483G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3483	Fibronectin type-III 19. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.G3483G(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGAGTCCTCGCCCATAGCTGT	0.443										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(10447-10449)GGG>GGA		usherin isoform B							78.0	70.0	73.0					1																	215956216		2203	4300	6503	SO:0001819	synonymous_variant	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215956216C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.10449G>A	1.37:g.215956216C>T		HNSCC(13;0.011)	Somatic					p.G3483G	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	53	10836	-			3483			Fibronectin type-III 19.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	c.10449G>A	CCDS31025.1																																																																																				0.443	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		8	68	0	0	0	0.004482	0	8	68				
ESRRG	2104	broad.mit.edu	37	1	216850479	216850479	+	Silent	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:216850479C>A	ENST00000408911.3	-	2	564	c.411G>T	c.(409-411)ggG>ggT	p.G137G	ESRRG_ENST00000487276.1_Silent_p.G114G|ESRRG_ENST00000359162.2_Silent_p.G114G|ESRRG_ENST00000463665.1_Silent_p.G114G|ESRRG_ENST00000493748.1_Silent_p.G114G|ESRRG_ENST00000366937.1_Silent_p.G142G|ESRRG_ENST00000360012.3_Silent_p.G114G|ESRRG_ENST00000366940.2_Silent_p.G114G|ESRRG_ENST00000366938.2_Silent_p.G114G|ESRRG_ENST00000391890.3_Silent_p.G114G|ESRRG_ENST00000361395.2_Silent_p.G114G|ESRRG_ENST00000361525.3_Silent_p.G114G|ESRRG_ENST00000493603.1_Silent_p.G114G	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	137					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.G137G(2)		endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CATAGTGGTACCCAGAAGCGA	0.498																																							uc001hkw.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|kidney(1)	2						c.(409-411)GGG>GGT		estrogen-related receptor gamma isoform 1	Diethylstilbestrol(DB00255)						165.0	144.0	151.0					1																	216850479		2203	4300	6503	SO:0001819	synonymous_variant	2104				positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr1:216850479C>A	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.411G>T	1.37:g.216850479C>A			Somatic				ESRRG_uc001hky.1_Silent_p.G114G|ESRRG_uc009xdp.1_Silent_p.G114G|ESRRG_uc001hkz.1_Silent_p.G114G|ESRRG_uc010puc.1_Silent_p.G114G|ESRRG_uc001hla.1_Silent_p.G114G|ESRRG_uc001hlb.1_Silent_p.G114G|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Silent_p.G114G|ESRRG_uc001hld.1_Silent_p.G114G|ESRRG_uc001hkx.1_Silent_p.G142G|ESRRG_uc009xdo.1_Silent_p.G114G|ESRRG_uc001hle.1_Silent_p.G114G	p.G137G	NM_001438	NP_001429	WXS	Illumina HiSeq	Unspecified	P62508	ERR3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	2	577	-			137			Nuclear receptor.|NR C4-type.		A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Silent	SNP	ENST00000408911.3	37	c.411G>T	CCDS41468.1																																																																																				0.498	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595		21	117	1	0	1.28384e-07	0.012319	2.2092e-07	21	117				
RYR2	6262	broad.mit.edu	37	1	237880622	237880622	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:237880622C>A	ENST00000366574.2	+	72	10765	c.10448C>A	c.(10447-10449)cCt>cAt	p.P3483H	RYR2_ENST00000542537.1_Missense_Mutation_p.P3467H|RYR2_ENST00000360064.6_Missense_Mutation_p.P3481H|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3483					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.P3481H(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATCTGTGCCCCTGGGGACCAG	0.498																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(10447-10449)CCT>CAT		cardiac muscle ryanodine receptor							75.0	80.0	79.0					1																	237880622		1903	4114	6017	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237880622C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10448C>A	1.37:g.237880622C>A	ENSP00000355533:p.Pro3483His		Somatic				RYR2_uc010pxz.1_Missense_Mutation_p.P438H	p.P3483H	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		72	10568	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3483					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.10448C>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283719	0.80803	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	T;D;T	0.96619	-0.23;-4.07;-0.23	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000010	D	0.98074	0.9365	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98342	1.0539	10	0.56958	D	0.05	-10.1269	19.4201	0.94719	0.0:1.0:0.0:0.0	.	3483	Q92736	RYR2_HUMAN	H	3483;3481;3467;438	ENSP00000355533:P3483H;ENSP00000353174:P3481H;ENSP00000443798:P3467H	ENSP00000353174:P3481H	P	+	2	0	RYR2	235947245	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.776000	0.85560	2.667000	0.90743	0.655000	0.94253	CCT		0.498	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		21	25	1	0	1.28384e-07	0.012319	2.2092e-07	21	25				
CASC10	399726	broad.mit.edu	37	10	21784774	21784774	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr10:21784774G>T	ENST00000377113.5	-	2	613	c.166C>A	c.(166-168)Ccg>Acg	p.P56T	MIR1915_ENST00000410139.1_RNA	NM_001010911.2	NP_001010911.1	Q5T4H9	CSC10_HUMAN	cancer susceptibility candidate 10	56								p.P56T(1)									GAGGCGCCCGGCACCTGCAGG	0.786											OREG0020066	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001iqn.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(166-168)CCG>ACG		hypothetical protein LOC399726							4.0	6.0	5.0					10																	21784774		2025	3881	5906	SO:0001583	missense	399726							g.chr10:21784774G>T	BC040880	CCDS31163.1	10p12.31	2013-07-17	2013-07-17	2013-07-17	ENSG00000204682	ENSG00000204682			31448	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 114"""	C10orf114		21804547	Standard	NM_001010911		Approved	bA418C1.3	uc001iqn.4	Q5T4H9	OTTHUMG00000017795	ENST00000377113.5:c.166C>A	10.37:g.21784774G>T	ENSP00000366317:p.Pro56Thr		Somatic	OREG0020066	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	751		p.P56T	NM_001010911	NP_001010911	WXS	Illumina HiSeq	Unspecified	Q5T4H9	CJ114_HUMAN			2	636	-			56					A1L4M3	Missense_Mutation	SNP	ENST00000377113.5	37	c.166C>A	CCDS31163.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.349179	0.24426	.	.	ENSG00000204682	ENST00000377113	T	0.56776	0.44	4.33	2.27	0.28462	.	.	.	.	.	T	0.29491	0.0735	N	0.14661	0.345	0.09310	N	1	P	0.44816	0.844	B	0.41174	0.349	T	0.08351	-1.0726	9	0.31617	T	0.26	-1.7258	1.9378	0.03340	0.1183:0.1828:0.4806:0.2184	.	56	Q5T4H9	CJ114_HUMAN	T	56	ENSP00000366317:P56T	ENSP00000366317:P56T	P	-	1	0	C10orf114	21824780	0.060000	0.20803	0.963000	0.40424	0.043000	0.13939	0.487000	0.22356	1.961000	0.56991	0.455000	0.32223	CCG		0.786	CASC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047130.2	NM_001010911		7	8	1	0	5.18039e-06	0.00308	8.52673e-06	7	8				
ARMC4	55130	broad.mit.edu	37	10	28233185	28233185	+	Missense_Mutation	SNP	C	C	T	rs140569195		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr10:28233185C>T	ENST00000305242.5	-	12	1801	c.1709G>A	c.(1708-1710)cGg>cAg	p.R570Q	ARMC4_ENST00000537576.1_Missense_Mutation_p.R262Q|ARMC4_ENST00000545014.1_Missense_Mutation_p.R95Q|ARMC4_ENST00000480504.1_5'Flank	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	570					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.R570Q(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						CCTCACCACCCGCCGTGCTCT	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		16750	0.0		0.001	False		,,,				2504	0.0						uc009xky.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)	6						c.(1708-1710)CGG>CAG		armadillo repeat containing 4		C	GLN/ARG	15,4391	22.3+/-47.3	0,15,2188	69.0	55.0	60.0		1709	3.4	0.8	10	dbSNP_134	60	2,8598	2.2+/-6.3	0,2,4298	yes	missense	ARMC4	NM_018076.2	43	0,17,6486	TT,TC,CC		0.0233,0.3404,0.1307	benign	570/1045	28233185	17,12989	2203	4300	6503	SO:0001583	missense	55130						binding	g.chr10:28233185C>T	AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1709G>A	10.37:g.28233185C>T	ENSP00000306410:p.Arg570Gln		Somatic				ARMC4_uc010qds.1_Missense_Mutation_p.R95Q|ARMC4_uc010qdt.1_Missense_Mutation_p.R262Q|ARMC4_uc001itz.2_Missense_Mutation_p.R570Q|ARMC4_uc010qdu.1_Missense_Mutation_p.R262Q	p.R570Q	NM_018076	NP_060546	WXS	Illumina HiSeq	Unspecified	Q5T2S8	ARMC4_HUMAN			12	1807	-			570					A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	ENST00000305242.5	37	c.1709G>A	CCDS7157.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	17.84	3.489057	0.64074	0.003404	2.33E-4	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000545014	T;T;T	0.46451	0.87;0.87;0.87	5.34	3.41	0.39046	Armadillo-like helical (1);Armadillo-type fold (1);	0.221207	0.42420	N	0.000713	T	0.41442	0.1159	M	0.67953	2.075	0.80722	D	1	P;B	0.43169	0.8;0.136	B;B	0.41332	0.354;0.014	T	0.26326	-1.0106	10	0.40728	T	0.16	-5.2144	10.7527	0.46219	0.0:0.7766:0.0:0.2234	.	95;570	B7Z7I1;Q5T2S8	.;ARMC4_HUMAN	Q	262;570;95	ENSP00000443208:R262Q;ENSP00000306410:R570Q;ENSP00000441076:R95Q	ENSP00000306410:R570Q	R	-	2	0	ARMC4	28273191	0.638000	0.27225	0.808000	0.32385	0.922000	0.55478	0.371000	0.20450	0.682000	0.31407	0.585000	0.79938	CGG		0.498	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076		12	36	0	0	0	0.013537	0	12	36				
SVIL	6840	broad.mit.edu	37	10	29824951	29824951	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr10:29824951C>A	ENST00000355867.4	-	7	1627	c.875G>T	c.(874-876)gGg>gTg	p.G292V	SVIL_ENST00000375400.3_Intron|SVIL_ENST00000375398.2_Missense_Mutation_p.G292V	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	292					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				AGGTGTGTCCCCTTCGGAATC	0.473											OREG0020098	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001iut.1		NA																	0				ovary(5)|upper_aerodigestive_tract(1)	6						c.(874-876)GGG>GTG		supervillin isoform 2							174.0	167.0	170.0					10																	29824951		2203	4300	6503	SO:0001583	missense	6840				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding	g.chr10:29824951C>A	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.875G>T	10.37:g.29824951C>A	ENSP00000348128:p.Gly292Val		Somatic	OREG0020098	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	812	SVIL_uc001iuu.1_Intron|SVIL_uc009xld.1_Missense_Mutation_p.G292V	p.G292V	NM_021738	NP_068506	WXS	Illumina HiSeq	Unspecified	O95425	SVIL_HUMAN			7	1628	-		Breast(68;0.103)	292					D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	c.875G>T	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.786714	0.90367	.	.	ENSG00000197321	ENST00000375398;ENST00000355867	T;T	0.47177	0.85;0.85	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.69557	0.3124	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67937	-0.5541	9	.	.	.	-27.8878	19.5895	0.95503	0.0:1.0:0.0:0.0	.	292	O95425	SVIL_HUMAN	V	292	ENSP00000364547:G292V;ENSP00000348128:G292V	.	G	-	2	0	SVIL	29864957	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.888000	0.75622	2.645000	0.89757	0.650000	0.86243	GGG		0.473	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1			29	57	1	0	9.65021e-13	0.010818	1.98241e-12	29	57				
AGAP7P	653268	broad.mit.edu	37	10	51465433	51465433	+	Silent	SNP	G	G	T	rs538304931		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr10:51465433G>T	ENST00000374095.5	-	7	1148	c.1023C>A	c.(1021-1023)tcC>tcA	p.S341S		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		341	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						CCATGTCCTTGGATAGGCCAT	0.567																																							uc001jio.2		NA																	0					0						c.(1021-1023)TCC>TCA		ArfGAP with GTPase domain, ankyrin repeat and PH							121.0	143.0	136.0					10																	51465433		2202	4300	6502	SO:0001819	synonymous_variant	653268				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr10:51465433G>T																												ENST00000374095.5:c.1023C>A	10.37:g.51465433G>T			Somatic				PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron	p.S341S	NM_001077685	NP_001071153	WXS	Illumina HiSeq	Unspecified	Q5VUJ5	AGAP7_HUMAN			7	1149	-			341			PH.		A6NGH4	Silent	SNP	ENST00000374095.5	37	c.1023C>A	CCDS41524.1																																																																																				0.567	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048033.1			35	565	1	0	6.97489e-18	0.004878	1.55323e-17	35	565				
USP54	159195	broad.mit.edu	37	10	75289936	75289936	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr10:75289936C>A	ENST00000339859.4	-	13	1893	c.1793G>T	c.(1792-1794)gGc>gTc	p.G598V	USP54_ENST00000394811.2_5'UTR|USP54_ENST00000428547.1_Missense_Mutation_p.G448V|USP54_ENST00000497106.1_5'UTR|USP54_ENST00000408019.1_Missense_Mutation_p.G598V|RNU6-883P_ENST00000384597.1_RNA|USP54_ENST00000319786.7_Missense_Mutation_p.G598V			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	598					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					CTGGGTATAGCCACAGTGCTT	0.398																																					Colon(195;880 2046 8854 25025 38456)	Colon(195;880 2046 8854 25025 38456)	uc001juo.2		NA																	0				breast(3)|lung(2)|kidney(1)	6						c.(1792-1794)GGC>GTC		ubiquitin specific peptidase 54							125.0	120.0	122.0					10																	75289936		1865	4105	5970	SO:0001583	missense	159195				ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity	g.chr10:75289936C>A	AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.1793G>T	10.37:g.75289936C>A	ENSP00000345216:p.Gly598Val		Somatic				USP54_uc001juk.2_5'UTR|USP54_uc001jul.2_5'UTR|USP54_uc001jum.2_RNA|USP54_uc001jun.2_RNA|USP54_uc001jup.2_Missense_Mutation_p.G598V|USP54_uc010qkl.1_Missense_Mutation_p.G598V	p.G598V	NM_152586	NP_689799	WXS	Illumina HiSeq	Unspecified	Q70EL1	UBP54_HUMAN			12	1810	-	Prostate(51;0.0112)		598					A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	ENST00000339859.4	37	c.1793G>T	CCDS7329.2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957089	0.73902	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547;ENST00000319786	T;T;T	0.33438	1.41;1.41;1.43	5.66	5.66	0.87406	.	0.078542	0.49916	U	0.000135	T	0.51652	0.1687	M	0.63843	1.955	0.80722	D	1	D;D;D	0.76494	0.994;0.997;0.999	P;D;D	0.68192	0.826;0.916;0.956	T	0.41124	-0.9526	10	0.44086	T	0.13	-8.8929	15.5909	0.76526	0.0:0.863:0.137:0.0	.	598;598;598	B7Z7X1;Q70EL1-6;Q70EL1	.;.;UBP54_HUMAN	V	598;598;448;598	ENSP00000345216:G598V;ENSP00000386080:G598V;ENSP00000408714:G448V	ENSP00000326547:G598V	G	-	2	0	USP54	74959942	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.391000	0.66266	2.832000	0.97577	0.655000	0.94253	GGC		0.398	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586		70	106	1	0	6.00099e-30	0.01441	1.44569e-29	70	106				
KAT6B	23522	broad.mit.edu	37	10	76790413	76790413	+	Missense_Mutation	SNP	A	A	G	rs143966521		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr10:76790413A>G	ENST00000287239.4	+	18	6320	c.5831A>G	c.(5830-5832)tAt>tGt	p.Y1944C	KAT6B_ENST00000372711.1_Missense_Mutation_p.Y1761C|KAT6B_ENST00000372714.1_Missense_Mutation_p.Y1652C|KAT6B_ENST00000372724.1_Missense_Mutation_p.Y1652C|KAT6B_ENST00000372725.1_Missense_Mutation_p.Y1652C	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1944	Interaction with RUNX1 and RUNX2.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.Y1944C(1)									TCACAAATCTATGGGCGCTCC	0.552																																							uc001jwn.1		NA								T					CREBBP		AML		1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16						c.(5830-5832)TAT>TGT		MYST histone acetyltransferase (monocytic		A	CYS/TYR	0,4406		0,0,2203	86.0	86.0	86.0		5831	5.7	1.0	10	dbSNP_134	86	1,8599	1.2+/-3.3	0,1,4299	no	missense	KAT6B	NM_012330.2	194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	1944/2074	76790413	1,13005	2203	4300	6503	SO:0001583	missense	23522				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding	g.chr10:76790413A>G	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.5831A>G	10.37:g.76790413A>G	ENSP00000287239:p.Tyr1944Cys		Somatic				MYST4_uc001jwo.1_Missense_Mutation_p.Y1652C|MYST4_uc001jwp.1_Missense_Mutation_p.Y1761C	p.Y1944C	NM_012330	NP_036462	WXS	Illumina HiSeq	Unspecified	Q8WYB5	MYST4_HUMAN			18	6324	+	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)		1944			Interaction with RUNX1 and RUNX2.		O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	37	c.5831A>G	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.432460	0.43224	0.0	1.16E-4	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	D;D;D;D;D	0.87650	-2.13;-2.13;-2.28;-2.13;-2.14	5.69	5.69	0.88448	.	0.000000	0.45361	D	0.000363	D	0.89822	0.6826	L	0.29908	0.895	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.998	D	0.91276	0.5048	10	0.87932	D	0	-10.2811	15.9322	0.79672	1.0:0.0:0.0:0.0	.	1761;1652;1944	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	C	1652;1652;1944;1652;1761	ENSP00000361810:Y1652C;ENSP00000361809:Y1652C;ENSP00000287239:Y1944C;ENSP00000361799:Y1652C;ENSP00000361796:Y1761C	ENSP00000287239:Y1944C	Y	+	2	0	KAT6B	76460419	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.962000	0.93254	2.165000	0.68154	0.460000	0.39030	TAT		0.552	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330		21	107	0	0	0	0.012319	0	21	107				
POLR3A	11128	broad.mit.edu	37	10	79745855	79745855	+	Silent	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr10:79745855G>A	ENST00000372371.3	-	22	3101	c.2964C>T	c.(2962-2964)ggC>ggT	p.G988G		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	988					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)	p.G988G(1)		breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TATCATTGATGCCATATTTAT	0.418																																							uc001jzn.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2962-2964)GGC>GGT		polymerase (RNA) III (DNA directed) polypeptide							246.0	231.0	236.0					10																	79745855		2203	4300	6503	SO:0001819	synonymous_variant	11128				innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding	g.chr10:79745855G>A	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.2964C>T	10.37:g.79745855G>A			Somatic					p.G988G	NM_007055	NP_008986	WXS	Illumina HiSeq	Unspecified	O14802	RPC1_HUMAN	Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)		22	3058	-	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		988					Q8IW34|Q8TCW5	Silent	SNP	ENST00000372371.3	37	c.2964C>T	CCDS7354.1																																																																																				0.418	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055		52	112	0	0	0	0.01441	0	52	112				
PKD2L1	9033	broad.mit.edu	37	10	102057200	102057200	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr10:102057200G>A	ENST00000318222.3	-	5	1277	c.895C>T	c.(895-897)Cga>Tga	p.R299*	PKD2L1_ENST00000353274.3_Nonsense_Mutation_p.R299*|PKD2L1_ENST00000338519.3_Intron	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	299					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)	p.R299*(1)		NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		AACACCACTCGAGTGCCCCTG	0.572																																							uc001kqx.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)	4						c.(895-897)CGA>TGA		polycystic kidney disease 2-like 1							73.0	75.0	74.0					10																	102057200		2203	4300	6503	SO:0001587	stop_gained	9033				signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding	g.chr10:102057200G>A	AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.895C>T	10.37:g.102057200G>A	ENSP00000325296:p.Arg299*		Somatic				PKD2L1_uc009xwm.1_Nonsense_Mutation_p.R252*	p.R299*	NM_016112	NP_057196	WXS	Illumina HiSeq	Unspecified	Q9P0L9	PK2L1_HUMAN		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)	5	1278	-		Colorectal(252;0.117)	299			Extracellular (Potential).		O75972|Q5W039|Q9UP35|Q9UPA2	Nonsense_Mutation	SNP	ENST00000318222.3	37	c.895C>T	CCDS7492.1	.	.	.	.	.	.	.	.	.	.	G	40	8.270628	0.98735	.	.	ENSG00000107593	ENST00000353274;ENST00000318222;ENST00000339977	.	.	.	5.65	5.65	0.86999	.	0.053528	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.6907	18.6959	0.91600	0.0:0.0:1.0:0.0	.	.	.	.	X	299	.	ENSP00000325296:R299X	R	-	1	2	PKD2L1	102047190	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.730000	0.47335	2.653000	0.90120	0.561000	0.74099	CGA		0.572	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112		15	74	0	0	0	0.006122	0	15	74				
DCLRE1A	9937	broad.mit.edu	37	10	115609681	115609681	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr10:115609681T>C	ENST00000361384.2	-	2	2100	c.1183A>G	c.(1183-1185)Act>Gct	p.T395A	DCLRE1A_ENST00000369305.1_Missense_Mutation_p.T395A	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	395					mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)		p.T395A(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		TAAGGCAAAGTACTCTCATTA	0.393								Other identified genes with known or suspected DNA repair function																															uc001law.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(1183-1185)ACT>GCT	Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function	DNA cross-link repair 1A							63.0	63.0	63.0					10																	115609681		2203	4300	6503	SO:0001583	missense	9937				cell division|mitosis	nucleus	hydrolase activity	g.chr10:115609681T>C		CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.1183A>G	10.37:g.115609681T>C	ENSP00000355185:p.Thr395Ala		Somatic					p.T395A	NM_014881	NP_055696	WXS	Illumina HiSeq	Unspecified	Q6PJP8	DCR1A_HUMAN		Epithelial(162;0.0157)|all cancers(201;0.0171)	2	2101	-			395					D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Missense_Mutation	SNP	ENST00000361384.2	37	c.1183A>G	CCDS7584.1	.	.	.	.	.	.	.	.	.	.	T	11.83	1.754218	0.31046	.	.	ENSG00000198924	ENST00000361384;ENST00000369305	T;T	0.63096	-0.02;-0.02	5.75	-4.39	0.03611	.	3.323790	0.00520	N	0.000182	T	0.42832	0.1220	N	0.22421	0.69	0.09310	N	1	B	0.22480	0.07	B	0.14023	0.01	T	0.39035	-0.9633	10	0.07482	T	0.82	5.8898	9.2422	0.37504	0.0:0.4168:0.1037:0.4795	.	395	Q6PJP8	DCR1A_HUMAN	A	395	ENSP00000355185:T395A;ENSP00000358311:T395A	ENSP00000355185:T395A	T	-	1	0	DCLRE1A	115599671	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.375000	0.07475	-1.180000	0.02734	-0.274000	0.10170	ACT		0.393	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050444.1	NM_014881		7	75	0	0	0	0.001984	0	7	75				
STK32C	282974	broad.mit.edu	37	10	134038741	134038741	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr10:134038741C>A	ENST00000368622.1	-	7	902	c.521G>T	c.(520-522)gGa>gTa	p.G174V	STK32C_ENST00000368625.4_Missense_Mutation_p.G304V					serine/threonine kinase 32C									p.G291V(1)|p.G304V(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(15)|ovary(2)|skin(1)	23		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		CCATACCCATCCTCGCAGCAG	0.667																																							uc001lle.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)|lung(2)|breast(1)	5						c.(871-873)GGA>GTA		serine/threonine kinase 32C							39.0	40.0	39.0					10																	134038741		2199	4300	6499	SO:0001583	missense	282974						ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr10:134038741C>A	AK057849	CCDS7666.1	10q26.3	2004-07-22			ENSG00000165752	ENSG00000165752			21332	protein-coding gene	gene with protein product							Standard	NM_173575		Approved	PKE, MGC23665, YANK3	uc001lle.1	Q86UX6	OTTHUMG00000019285	ENST00000368622.1:c.521G>T	10.37:g.134038741C>A	ENSP00000357611:p.Gly174Val		Somatic				STK32C_uc001lld.1_Missense_Mutation_p.G174V|STK32C_uc010quu.1_Missense_Mutation_p.G304V|STK32C_uc009ybc.1_Missense_Mutation_p.G174V|STK32C_uc009ybd.1_3'UTR|STK32C_uc001llb.2_Missense_Mutation_p.G62V|STK32C_uc001llc.1_RNA	p.G291V	NM_173575	NP_775846	WXS	Illumina HiSeq	Unspecified	Q86UX6	ST32C_HUMAN		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)	7	1012	-		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)	291			Protein kinase.			Missense_Mutation	SNP	ENST00000368622.1	37	c.872G>T		.	.	.	.	.	.	.	.	.	.	C	23.3	4.403545	0.83230	.	.	ENSG00000165752	ENST00000368622;ENST00000298630;ENST00000368625	T;T;T	0.39592	1.07;1.07;1.07	4.49	4.49	0.54785	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	T	0.77844	0.4191	H	0.97940	4.11	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	0.999;0.987;1.0	D	0.87448	0.2399	10	0.87932	D	0	.	16.8151	0.85732	0.0:1.0:0.0:0.0	.	304;291;174	B7Z7J1;Q86UX6;Q86UX6-2	.;ST32C_HUMAN;.	V	174;291;304	ENSP00000357611:G174V;ENSP00000298630:G291V;ENSP00000357614:G304V	ENSP00000298630:G291V	G	-	2	0	STK32C	133888731	1.000000	0.71417	0.998000	0.56505	0.674000	0.39518	2.882000	0.48546	2.059000	0.61396	0.585000	0.79938	GGA		0.667	STK32C-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051068.2	NM_173575		5	14	1	0	0.000602214	0.000602	0.000922467	5	14				
NLRP6	171389	broad.mit.edu	37	11	280512	280512	+	Missense_Mutation	SNP	C	C	A	rs563626864	byFrequency	TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:280512C>A	ENST00000312165.5	+	4	778	c.778C>A	c.(778-780)Cgc>Agc	p.R260S	NLRP6_ENST00000534750.1_Missense_Mutation_p.R260S	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	260	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)	p.R260S(1)		breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GTGCCCCGACCGCGGCGCGCC	0.751																																							uc010qvs.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|skin(1)	2						c.(778-780)CGC>AGC		NLR family, pyrin domain containing 6							11.0	12.0	11.0					11																	280512		2176	4275	6451	SO:0001583	missense	171389					cytoplasm	ATP binding	g.chr11:280512C>A	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.778C>A	11.37:g.280512C>A	ENSP00000309767:p.Arg260Ser		Somatic				NLRP6_uc010qvt.1_Missense_Mutation_p.R260S	p.R260S	NM_138329	NP_612202	WXS	Illumina HiSeq	Unspecified	P59044	NALP6_HUMAN		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)	4	778	+		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	260			NACHT.		A8K9F3|E9PJZ8	Missense_Mutation	SNP	ENST00000312165.5	37	c.778C>A	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.113241	0.37339	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.77098	-1.07;-1.07	3.66	3.66	0.41972	NACHT nucleoside triphosphatase (1);	0.000000	0.36555	N	0.002527	T	0.71400	0.3335	N	0.13168	0.305	0.20489	N	0.999898	P;D	0.63880	0.479;0.993	P;D	0.64877	0.54;0.93	T	0.61013	-0.7148	10	0.06365	T	0.9	.	11.5744	0.50854	0.0:1.0:0.0:0.0	.	260;260	E9PJZ8;P59044	.;NALP6_HUMAN	S	260	ENSP00000433617:R260S;ENSP00000309767:R260S	ENSP00000309767:R260S	R	+	1	0	NLRP6	270512	0.000000	0.05858	0.070000	0.20053	0.892000	0.51952	0.676000	0.25247	1.984000	0.57885	0.462000	0.41574	CGC		0.751	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329		3	9	1	0	0.004672	0.004672	0.00687822	3	9				
OR51B5	282763	broad.mit.edu	37	11	5363838	5363838	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:5363838G>T	ENST00000300773.2	-	1	971	c.917C>A	c.(916-918)aCt>aAt	p.T306N	AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001005567.2	NP_001005567.2	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B, member 5	306					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T306N(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	28		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTATGGGTAGTAAAAAGGTG	0.368																																							uc001map.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(916-918)ACT>AAT		olfactory receptor, family 51, subfamily B,							93.0	94.0	94.0					11																	5363838		2201	4297	6498	SO:0001583	missense	282763				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5363838G>T	BK004430	CCDS31378.1	11p15.4	2012-08-09			ENSG00000242180	ENSG00000242180		"""GPCR / Class A : Olfactory receptors"""	19599	protein-coding gene	gene with protein product							Standard	NM_001005567		Approved		uc001maq.2	Q9H339	OTTHUMG00000066676	ENST00000300773.2:c.917C>A	11.37:g.5363838G>T	ENSP00000300773:p.Thr306Asn		Somatic				HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	p.T306N	NM_001005567	NP_001005567	WXS	Illumina HiSeq	Unspecified	Q9H339	O51B5_HUMAN		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	917	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	306			Cytoplasmic (Potential).		B2RN59	Missense_Mutation	SNP	ENST00000300773.2	37	c.917C>A	CCDS31378.1	.	.	.	.	.	.	.	.	.	.	G	7.118	0.577411	0.13686	.	.	ENSG00000242180	ENST00000300773	T	0.37584	1.19	4.32	2.42	0.29668	.	1.338760	0.05291	N	0.521119	T	0.21921	0.0528	N	0.10874	0.06	0.09310	N	1	B	0.20164	0.042	B	0.20184	0.028	T	0.26224	-1.0109	10	0.27785	T	0.31	.	7.6369	0.28272	0.0:0.3443:0.4784:0.1773	.	306	Q9H339	O51B5_HUMAN	N	306	ENSP00000300773:T306N	ENSP00000300773:T306N	T	-	2	0	OR51B5	5320414	0.546000	0.26457	0.001000	0.08648	0.002000	0.02628	0.923000	0.28757	0.464000	0.27142	-0.885000	0.02943	ACT		0.368	OR51B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142975.1	NM_001005567		12	44	1	0	9.31168e-06	0.001855	1.49551e-05	12	44				
CCKBR	887	broad.mit.edu	37	11	6292297	6292297	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:6292297A>T	ENST00000334619.2	+	5	1061	c.868A>T	c.(868-870)Agc>Tgc	p.S290C	CCKBR_ENST00000532715.1_Missense_Mutation_p.S206C|CCKBR_ENST00000525462.1_Missense_Mutation_p.S359C|CCKBR_ENST00000532396.1_3'UTR	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	290					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.S359C(1)|p.S290C(1)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	TGGCGAAGACAGCGATGGCTG	0.687																																							uc001mcp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(5)|ovary(2)|breast(1)	8						c.(868-870)AGC>TGC		cholecystokinin B receptor	Pentagastrin(DB00183)						63.0	63.0	63.0					11																	6292297		2201	4296	6497	SO:0001583	missense	887				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding	g.chr11:6292297A>T	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.868A>T	11.37:g.6292297A>T	ENSP00000335544:p.Ser290Cys		Somatic				CCKBR_uc001mcq.2_Missense_Mutation_p.S218C|CCKBR_uc001mcr.2_Missense_Mutation_p.S290C|CCKBR_uc001mcs.2_Missense_Mutation_p.S359C|CCKBR_uc001mct.1_RNA	p.S290C	NM_176875	NP_795344	WXS	Illumina HiSeq	Unspecified	P32239	GASR_HUMAN		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	5	1061	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	290			Cytoplasmic (Potential).		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	c.868A>T	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	A	13.06	2.123249	0.37436	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.77098	0.22;-1.07;0.24	4.99	0.563	0.17296	GPCR, rhodopsin-like superfamily (1);	0.335009	0.35179	N	0.003384	D	0.82332	0.5014	M	0.71036	2.16	0.26338	N	0.97741	D;P;B	0.69078	0.997;0.782;0.011	D;P;B	0.67382	0.951;0.525;0.02	T	0.72308	-0.4332	10	0.59425	D	0.04	.	5.9381	0.19177	0.2169:0.1563:0.6268:0.0	.	359;224;290	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	C	290;206;359	ENSP00000335544:S290C;ENSP00000432079:S206C;ENSP00000435534:S359C	ENSP00000335544:S290C	S	+	1	0	CCKBR	6248873	0.964000	0.33143	0.022000	0.16811	0.218000	0.24690	2.609000	0.46317	-0.068000	0.12953	0.533000	0.62120	AGC		0.687	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875		13	65	0	0	0	0.004007	0	13	65				
OR10A3	26496	broad.mit.edu	37	11	7960402	7960402	+	Silent	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:7960402C>A	ENST00000360759.3	-	1	739	c.666G>T	c.(664-666)ctG>ctT	p.L222L		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	222					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L222L(1)		endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GGATGGCAAACAGAACTCGAA	0.453																																							uc010rbi.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(664-666)CTG>CTT		olfactory receptor, family 10, subfamily A,							118.0	105.0	109.0					11																	7960402		2201	4296	6497	SO:0001819	synonymous_variant	26496				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:7960402C>A	BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.666G>T	11.37:g.7960402C>A			Somatic					p.L222L	NM_001003745	NP_001003745	WXS	Illumina HiSeq	Unspecified	P58181	O10A3_HUMAN		Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	1	666	-			222			Cytoplasmic (Potential).		B9EH39|Q6IF58|Q96R11	Silent	SNP	ENST00000360759.3	37	c.666G>T	CCDS31421.1																																																																																				0.453	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385704.1	NM_001003745		8	40	1	0	0.00307968	0.00308	0.00458492	8	40				
NLRP10	338322	broad.mit.edu	37	11	7981827	7981827	+	Silent	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:7981827G>T	ENST00000328600.2	-	2	1493	c.1332C>A	c.(1330-1332)gcC>gcA	p.A444A		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	444	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)	p.A444A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCAGGAAAGCGGCAAGCCTGG	0.488																																							uc001mfv.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9						c.(1330-1332)GCC>GCA		NLR family, pyrin domain containing 10							97.0	106.0	103.0					11																	7981827		2201	4296	6497	SO:0001819	synonymous_variant	338322						ATP binding	g.chr11:7981827G>T	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1332C>A	11.37:g.7981827G>T			Somatic					p.A444A	NM_176821	NP_789791	WXS	Illumina HiSeq	Unspecified	Q86W26	NAL10_HUMAN		Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	2	1349	-			444			NACHT.		Q2M3C4|Q6JGT0	Silent	SNP	ENST00000328600.2	37	c.1332C>A	CCDS7784.1																																																																																				0.488	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821		19	144	1	0	1.22574e-08	0.014323	2.2248e-08	19	144				
GALNT18	374378	broad.mit.edu	37	11	11362424	11362424	+	Missense_Mutation	SNP	T	T	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:11362424T>G	ENST00000227756.4	-	7	1631	c.1220A>C	c.(1219-1221)gAa>gCa	p.E407A		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	407					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										CATCCAGACTTCAGCCACCCT	0.572																																							uc001mjo.2		NA																	0					0						c.(1219-1221)GAA>GCA		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							209.0	211.0	210.0					11																	11362424		2201	4294	6495	SO:0001583	missense	374378					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr11:11362424T>G	AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.1220A>C	11.37:g.11362424T>G	ENSP00000227756:p.Glu407Ala		Somatic					p.E407A	NM_198516	NP_940918	WXS	Illumina HiSeq	Unspecified	Q6P9A2	GLTL4_HUMAN		all cancers(16;3.67e-05)|Epithelial(150;0.000184)	7	1641	-			407			Lumenal (Potential).		O95903|Q8NDY9	Missense_Mutation	SNP	ENST00000227756.4	37	c.1220A>C	CCDS7807.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.810849	0.90707	.	.	ENSG00000110328	ENST00000227756	T	0.67865	-0.29	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.84433	0.5471	M	0.89840	3.065	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	D	0.87731	0.2579	10	0.87932	D	0	.	14.8587	0.70362	0.0:0.0:0.0:1.0	.	407	Q6P9A2	GLTL4_HUMAN	A	407	ENSP00000227756:E407A	ENSP00000227756:E407A	E	-	2	0	GALNTL4	11319000	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.194000	0.70268	0.459000	0.35465	GAA		0.572	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385848.1	NM_198516		32	192	0	0	0	0.008361	0	32	192				
LOC440040	440040	broad.mit.edu	37	11	49805552	49805552	+	RNA	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:49805552G>A	ENST00000527477.1	+	0	1240																											TTCTGTGAGGGCATGACGGTG	0.517																																							uc010rhy.1		NA																	0					0						c.(748-750)GGC>GAC		SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;																																						440040							g.chr11:49805552G>A																													11.37:g.49805552G>A			Somatic				LOC440040_uc009ymb.2_Missense_Mutation_p.G250D	p.G250D	NR_027044		WXS	Illumina HiSeq	Unspecified					3	1227	+									Missense_Mutation	SNP	ENST00000527477.1	37	c.749G>A																																																																																					0.517	RP11-707M1.1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000391378.2			4	75	0	0	0	0.009096	0	4	75				
OR4C46	119749	broad.mit.edu	37	11	51515432	51515433	+	Missense_Mutation	DNP	CC	CC	AA	rs372979385|rs545486160	byFrequency	TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:51515432_51515433CC>AA	ENST00000328188.1	+	1	151_152	c.151_152CC>AA	c.(151-153)CCa>AAa	p.P51K		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P51Q(2)		endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						CACTGCCAGCCCATCACTGGGG	0.45																																							uc010ric.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(151-153)CCA>AAA		olfactory receptor, family 4, subfamily C,																																				SO:0001583	missense	119749				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51515432_51515433CC>AA		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	Exception_encountered	11.37:g.51515432_51515433delinsAA	ENSP00000329056:p.Pro51Lys		Somatic					p.P51K	NM_001004703	NP_001004703	WXS	Illumina HiSeq	Unspecified	A6NHA9	O4C46_HUMAN			1	151_152	+			51			Helical; Name=2; (Potential).			Missense_Mutation	DNP	ENST00000328188.1	37	c.151_152CC>AA	CCDS31498.1																																																																																				0.450	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703		42	238	0	0	0	0.004672	0	42	238				
MS4A6A	64231	broad.mit.edu	37	11	59949055	59949055	+	Splice_Site	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:59949055C>A	ENST00000530839.1	-	3	638	c.146G>T	c.(145-147)gGg>gTg	p.G49V	MS4A6A_ENST00000529906.1_5'Flank|MS4A6A_ENST00000533023.1_Splice_Site_p.G49V|MS4A6A_ENST00000532169.1_Splice_Site_p.G49V|MS4A6A_ENST00000420732.2_Splice_Site_p.G49V|MS4A6A_ENST00000528851.1_Splice_Site_p.G49V|MS4A6A_ENST00000529054.1_Splice_Site_p.G77V|MS4A6A_ENST00000323961.3_Splice_Site_p.G49V|MS4A6A_ENST00000412309.2_Splice_Site_p.G77V|MS4A6A_ENST00000426738.2_Splice_Site_p.G49V	NM_152852.2	NP_690591.1	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member 6A	49						integral component of membrane (GO:0016021)		p.G49V(1)|p.G77V(1)		endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TAGATTTACCCCAATAACTTT	0.478																																							uc001nor.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(145-147)GGG>GTG		membrane-spanning 4-domains, subfamily A, member							153.0	147.0	149.0					11																	59949055		2201	4295	6496	SO:0001630	splice_region_variant	64231					integral to membrane	receptor activity	g.chr11:59949055C>A	AB013104	CCDS7981.1, CCDS44615.1, CCDS44616.1, CCDS58134.1	11q12.1	2008-03-25			ENSG00000110077	ENSG00000110077			13375	protein-coding gene	gene with protein product		606548		MS4A6		11245982, 11401424	Standard	NM_152852		Approved	CD20L3	uc010rla.2	Q9H2W1	OTTHUMG00000167241	ENST00000530839.1:c.147+1G>T	11.37:g.59949055C>A			Somatic				MS4A6A_uc001noq.2_Missense_Mutation_p.G49V|MS4A6A_uc001nos.3_Missense_Mutation_p.G77V|MS4A6A_uc009ymv.2_Missense_Mutation_p.G49V|MS4A6A_uc001not.2_Missense_Mutation_p.G49V|MS4A6A_uc010rla.1_Missense_Mutation_p.G77V|MS4A6A_uc010rlb.1_Missense_Mutation_p.G49V	p.G49V	NM_152852	NP_690591	WXS	Illumina HiSeq	Unspecified	Q9H2W1	M4A6A_HUMAN			2	384	-			49			Helical; (Potential).		A8K755|F8W9K1|Q7Z4E8|Q8TBV7|Q8TEZ4|Q8TEZ5|Q96PG6|Q9H2L1|Q9H2N3|Q9H3V1|Q9HC76	Missense_Mutation	SNP	ENST00000530839.1	37	c.146G>T	CCDS7981.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.75|14.75	2.628641|2.628641	0.46944|0.46944	.|.	.|.	ENSG00000110077|ENSG00000110077	ENST00000533989|ENST00000323961;ENST00000528851;ENST00000420732;ENST00000530839;ENST00000529054;ENST00000426738;ENST00000412309;ENST00000533023;ENST00000532169;ENST00000534596;ENST00000531531	T|T;T;T;T;T;T;T;T;T;T;T	0.44083|0.51817	0.93|2.95;2.95;2.95;2.95;2.95;3.01;2.95;1.82;2.95;1.81;0.69	4.72|4.72	2.52|2.52	0.30459|0.30459	.|.	0.403026|0.403026	0.24628|0.24628	N|N	0.036909|0.036909	T|T	0.64702|0.64702	0.2622|0.2622	M|M	0.80508|0.80508	2.5|2.5	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|0.996;1.0;1.0;1.0;0.964	.|P;D;D;D;P	.|0.77004	.|0.876;0.98;0.989;0.97;0.728	T|T	0.62191|0.62191	-0.6906|-0.6906	7|9	.|.	.|.	.|.	.|.	7.4793|7.4793	0.27395|0.27395	0.1738:0.5405:0.2858:0.0|0.1738:0.5405:0.2858:0.0	.|.	.|49;77;77;49;49	.|E7EMT7;F8W9K1;E9PSA9;Q9H2W1;Q9H2W1-3	.|.;.;.;M4A6A_HUMAN;.	C|V	29|49;49;49;49;77;49;77;49;49;77;77	ENSP00000436133:G29C|ENSP00000315878:G49V;ENSP00000431901:G49V;ENSP00000392921:G49V;ENSP00000436979:G49V;ENSP00000435844:G77V;ENSP00000392770:G49V;ENSP00000403212:G77V;ENSP00000436172:G49V;ENSP00000431266:G49V;ENSP00000433436:G77V;ENSP00000433012:G77V	.|.	G|G	-|-	1|2	0|0	MS4A6A|MS4A6A	59705631|59705631	0.997000|0.997000	0.39634|0.39634	0.947000|0.947000	0.38551|0.38551	0.501000|0.501000	0.33797|0.33797	1.162000|1.162000	0.31786|0.31786	0.384000|0.384000	0.24942|0.24942	0.655000|0.655000	0.94253|0.94253	GGT|GGG		0.478	MS4A6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393848.1		Missense_Mutation	14	100	1	0	2.61681e-11	0.00245	5.13671e-11	14	100				
LRP5	4041	broad.mit.edu	37	11	68191071	68191071	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:68191071A>G	ENST00000294304.7	+	14	3248	c.3142A>G	c.(3142-3144)Atc>Gtc	p.I1048V		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1048	Beta-propeller 4.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.I1048V(1)		autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CACCAATACCATCAACGTCCA	0.637																																							uc001ont.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						c.(3142-3144)ATC>GTC		low density lipoprotein receptor-related protein							104.0	96.0	99.0					11																	68191071		2200	4294	6494	SO:0001583	missense	4041				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity	g.chr11:68191071A>G	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.3142A>G	11.37:g.68191071A>G	ENSP00000294304:p.Ile1048Val		Somatic				LRP5_uc009ysg.2_Missense_Mutation_p.I458V	p.I1048V	NM_002335	NP_002326	WXS	Illumina HiSeq	Unspecified	O75197	LRP5_HUMAN			14	3217	+			1048			LDL-receptor class B 17.|Beta-propeller 4.|Extracellular (Potential).		Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	c.3142A>G	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	A	14.95	2.686880	0.48097	.	.	ENSG00000162337	ENST00000294304	D	0.91792	-2.91	4.65	4.65	0.58169	Six-bladed beta-propeller, TolB-like (1);	0.135190	0.31566	U	0.007431	D	0.87892	0.6292	L	0.49571	1.57	0.48975	D	0.999737	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.005	D	0.84435	0.0579	10	0.59425	D	0.04	.	7.0217	0.24918	0.8625:0.0:0.1375:0.0	.	1048;1048	Q9UES7;O75197	.;LRP5_HUMAN	V	1048	ENSP00000294304:I1048V	ENSP00000294304:I1048V	I	+	1	0	LRP5	67947647	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	3.702000	0.54800	1.969000	0.57287	0.397000	0.26171	ATC		0.637	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335		12	104	0	0	0	0.013537	0	12	104				
TENM4	26011	broad.mit.edu	37	11	78433921	78433921	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:78433921G>A	ENST00000278550.7	-	24	4054	c.3592C>T	c.(3592-3594)Cag>Tag	p.Q1198*		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1198					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.Q1198*(2)									GGAGGCTGCTGAGACACAAAC	0.562																																							uc001ozl.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|pancreas(2)	4						c.(3592-3594)CAG>TAG		odz, odd Oz/ten-m homolog 4							71.0	75.0	73.0					11																	78433921		2022	4189	6211	SO:0001587	stop_gained	26011				signal transduction	integral to membrane		g.chr11:78433921G>A	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.3592C>T	11.37:g.78433921G>A	ENSP00000278550:p.Gln1198*		Somatic					p.Q1198*	NM_001098816	NP_001092286	WXS	Illumina HiSeq	Unspecified	Q6N022	TEN4_HUMAN			24	4055	-			1198			Extracellular (Potential).		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Nonsense_Mutation	SNP	ENST00000278550.7	37	c.3592C>T	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	G	47	13.095111	0.99719	.	.	ENSG00000149256	ENST00000278550	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8749	0.96865	0.0:0.0:1.0:0.0	.	.	.	.	X	1198	.	.	Q	-	1	0	ODZ4	78111569	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.657000	0.98554	2.932000	0.99384	0.644000	0.83932	CAG		0.562	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			10	37	0	0	0	0.006214	0	10	37				
ATM	472	broad.mit.edu	37	11	108123623	108123623	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:108123623C>T	ENST00000452508.2	+	13	2071	c.1882C>T	c.(1882-1884)Caa>Taa	p.Q628*	ATM_ENST00000278616.4_Nonsense_Mutation_p.Q628*			Q13315	ATM_HUMAN	ATM serine/threonine kinase	628					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.Q628*(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GAATTTTTTCCAAAGCGTGCC	0.318			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		2	Substitution - Nonsense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(1882-1884)CAA>TAA	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							93.0	86.0	88.0					11																	108123623		2201	4294	6495	SO:0001587	stop_gained	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108123623C>T	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1882C>T	11.37:g.108123623C>T	ENSP00000388058:p.Gln628*	TSP Lung(14;0.12)	Somatic				ATM_uc009yxr.1_Nonsense_Mutation_p.Q628*	p.Q628*	NM_000051	NP_000042	WXS	Illumina HiSeq	Unspecified	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	12	2267	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	628					B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Nonsense_Mutation	SNP	ENST00000452508.2	37	c.1882C>T	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	C	42	9.456424	0.99177	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	.	.	.	5.66	5.66	0.87406	.	0.556432	0.19711	N	0.107819	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.564	0.68162	0.1462:0.8538:0.0:0.0	.	.	.	.	X	628	.	ENSP00000278616:Q628X	Q	+	1	0	ATM	107628833	0.993000	0.37304	1.000000	0.80357	0.806000	0.45545	2.106000	0.41835	2.672000	0.90937	0.460000	0.39030	CAA		0.318	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		7	59	0	0	0	0.00308	0	7	59				
ATM	472	broad.mit.edu	37	11	108205768	108205768	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:108205768G>T	ENST00000452508.2	+	56	8272	c.8083G>T	c.(8083-8085)Ggt>Tgt	p.G2695C	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.G2695C			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2695			G -> A (in T-prolymphocytic leukemia and B-cell chronic lymphocytic leukemia). {ECO:0000269|PubMed:10023947, ECO:0000269|PubMed:9288106}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.G2695S(4)|p.G2695C(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CTTAGCAGGAGGTGTAAATTT	0.398			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		6	Substitution - Missense(6)	p.G2695A(2)	lung(4)|prostate(2)	haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(8083-8085)GGT>TGT	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							101.0	100.0	100.0					11																	108205768		2201	4298	6499	SO:0001583	missense	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108205768G>T	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8083G>T	11.37:g.108205768G>T	ENSP00000388058:p.Gly2695Cys	TSP Lung(14;0.12)	Somatic				ATM_uc009yxr.1_Missense_Mutation_p.G2695C|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.G1347C	p.G2695C	NM_000051	NP_000042	WXS	Illumina HiSeq	Unspecified	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	55	8468	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	2695		G -> A (in T-prolymphocytic leukemia and B-cell chronic lymphocytic leukemia).			B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	c.8083G>T	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	33	5.228806	0.95173	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.94376	-3.41;-3.41	5.67	5.67	0.87782	Protein kinase-like domain (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.97857	0.9296	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98512	1.0619	10	0.87932	D	0	.	19.7775	0.96400	0.0:0.0:1.0:0.0	.	2695	Q13315	ATM_HUMAN	C	2695	ENSP00000278616:G2695C;ENSP00000388058:G2695C	ENSP00000278616:G2695C	G	+	1	0	ATM	107710978	1.000000	0.71417	0.991000	0.47740	0.995000	0.86356	9.107000	0.94261	2.680000	0.91292	0.655000	0.94253	GGT		0.398	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		31	58	1	0	3.00307e-07	0.008361	5.06887e-07	31	58				
ZC3H12C	85463	broad.mit.edu	37	11	110035384	110035384	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr11:110035384C>T	ENST00000278590.3	+	6	1625	c.1574C>T	c.(1573-1575)cCa>cTa	p.P525L	ZC3H12C_ENST00000453089.2_Missense_Mutation_p.P494L|ZC3H12C_ENST00000528673.1_Missense_Mutation_p.P526L	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	525							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.P525L(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		GTTAGCATCCCAGCTACTTCT	0.448																																							uc009yxw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1573-1575)CCA>CTA		zinc finger CCCH-type containing 12C							108.0	104.0	105.0					11																	110035384		1905	4126	6031	SO:0001583	missense	85463						endonuclease activity|nucleic acid binding|zinc ion binding	g.chr11:110035384C>T		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1574C>T	11.37:g.110035384C>T	ENSP00000278590:p.Pro525Leu		Somatic				ZC3H12C_uc010rwc.1_Missense_Mutation_p.P526L|ZC3H12C_uc010rwd.1_Missense_Mutation_p.P526L|ZC3H12C_uc001pkr.3_Missense_Mutation_p.P494L	p.P525L	NM_033390	NP_203748	WXS	Illumina HiSeq	Unspecified	Q9C0D7	ZC12C_HUMAN		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)	6	1625	+		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	525					B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	37	c.1574C>T	CCDS44727.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.935875	0.52972	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.30182	1.54;1.54;1.55	5.85	5.85	0.93711	.	0.381484	0.30528	N	0.009430	T	0.46927	0.1418	L	0.61218	1.895	0.58432	D	0.999999	P;D;P	0.63880	0.956;0.993;0.956	B;P;B	0.55923	0.366;0.787;0.366	T	0.13308	-1.0514	10	0.21014	T	0.42	-16.5597	18.3581	0.90365	0.0:1.0:0.0:0.0	.	526;525;525	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	L	525;526;494	ENSP00000278590:P525L;ENSP00000431821:P526L;ENSP00000413094:P494L	ENSP00000278590:P525L	P	+	2	0	ZC3H12C	109540594	1.000000	0.71417	0.999000	0.59377	0.755000	0.42902	3.201000	0.51059	2.771000	0.95319	0.561000	0.74099	CCA		0.448	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390		27	63	0	0	0	0.004656	0	27	63				
LRTM2	654429	broad.mit.edu	37	12	1943635	1943635	+	Silent	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:1943635G>A	ENST00000543818.1	+	5	1703	c.861G>A	c.(859-861)ccG>ccA	p.P287P	CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000587995.1_Intron|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000585708.1_Intron|LRTM2_ENST00000535041.1_Silent_p.P287P|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000588077.1_Intron|CACNA2D4_ENST00000585732.1_Intron|LRTM2_ENST00000299194.1_Silent_p.P287P	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	287						integral component of membrane (GO:0016021)		p.P287P(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			AGCCGGAGCCGGAGCCCAGCA	0.677																																							uc001qjt.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(859-861)CCG>CCA		leucine-rich repeats and transmembrane domains 2							30.0	32.0	31.0					12																	1943635		2202	4298	6500	SO:0001819	synonymous_variant	654429					integral to membrane		g.chr12:1943635G>A	AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.861G>A	12.37:g.1943635G>A			Somatic				CACNA2D4_uc001qjp.2_Intron|CACNA2D4_uc009zds.1_Intron|CACNA2D4_uc009zdt.1_Intron|CACNA2D4_uc009zdr.1_Intron|LRTM2_uc001qju.2_Silent_p.P287P|LRTM2_uc010sdx.1_Silent_p.P287P|LRTM2_uc001qjv.2_Silent_p.P49P	p.P287P	NM_001039029	NP_001034118	WXS	Illumina HiSeq	Unspecified	Q8N967	LRTM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000834)		5	1667	+	Ovarian(42;0.107)		287			Extracellular (Potential).		A7E2U6	Silent	SNP	ENST00000543818.1	37	c.861G>A	CCDS31726.1																																																																																				0.677	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398055.1			11	35	0	0	0	0.013537	0	11	35				
ITFG2	55846	broad.mit.edu	37	12	2932973	2932973	+	Silent	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:2932973C>T	ENST00000228799.2	+	11	1243	c.1104C>T	c.(1102-1104)tgC>tgT	p.C368C	ITFG2_ENST00000419778.2_Silent_p.C191C|ITFG2_ENST00000542548.1_Silent_p.C256C	NM_018463.3	NP_060933.3	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2	368					germinal center B cell differentiation (GO:0002314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.C368C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			ACAGCCCCTGCCTCGTATATG	0.552																																							uc001qlb.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1102-1104)TGC>TGT		integrin alpha FG-GAP repeat containing 2							165.0	170.0	168.0					12																	2932973		2203	4300	6503	SO:0001819	synonymous_variant	55846							g.chr12:2932973C>T	AF220048	CCDS8513.1	12p13.33	2006-11-29		2006-07-25	ENSG00000111203	ENSG00000111203			30879	protein-coding gene	gene with protein product						12477932	Standard	NM_018463		Approved	MDS028	uc001qlb.2	Q969R8	OTTHUMG00000130617	ENST00000228799.2:c.1104C>T	12.37:g.2932973C>T			Somatic				ITFG2_uc010seb.1_Silent_p.C191C|ITFG2_uc010sec.1_RNA	p.C368C	NM_018463	NP_060933	WXS	Illumina HiSeq	Unspecified	Q969R8	ITFG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000818)		11	1168	+			368					A8K4Z5|D3DUQ2|Q6PKU5|Q96SX6	Silent	SNP	ENST00000228799.2	37	c.1104C>T	CCDS8513.1																																																																																				0.552	ITFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253091.1	NM_018463		19	238	0	0	0	0.007413	0	19	238				
CD163L1	283316	broad.mit.edu	37	12	7548699	7548699	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:7548699A>G	ENST00000313599.3	-	8	2099	c.2042T>C	c.(2041-2043)aTc>aCc	p.I681T	CD163L1_ENST00000416109.2_Missense_Mutation_p.I691T|CD163L1_ENST00000396630.1_Missense_Mutation_p.I681T			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	681	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.I681T(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						ACCAGAACAGATCACTCCAAC	0.443																																							uc001qsy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|skin(2)|central_nervous_system(1)	11						c.(2041-2043)ATC>ACC		scavenger receptor cysteine-rich type 1							67.0	55.0	59.0					12																	7548699		2203	4300	6503	SO:0001583	missense	283316					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity	g.chr12:7548699A>G	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2042T>C	12.37:g.7548699A>G	ENSP00000315945:p.Ile681Thr		Somatic				CD163L1_uc010sge.1_Missense_Mutation_p.I691T	p.I681T	NM_174941	NP_777601	WXS	Illumina HiSeq	Unspecified	Q9NR16	C163B_HUMAN			8	2068	-			681			SRCR 6.|Extracellular (Potential).		B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	c.2042T>C	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	A	1.870	-0.460459	0.04508	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.34859	1.34;1.34;1.34	2.23	1.3	0.21679	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.407240	0.05688	N	0.591599	T	0.18087	0.0434	N	0.11154	0.105	0.24798	N	0.992715	B;B	0.06786	0.001;0.001	B;B	0.13407	0.005;0.009	T	0.26815	-1.0092	10	0.15499	T	0.54	.	4.1911	0.10421	0.3803:0.0:0.6197:0.0	.	691;681	E7EVK4;Q9NR16	.;C163B_HUMAN	T	681;691;681	ENSP00000315945:I681T;ENSP00000393474:I691T;ENSP00000379871:I681T	ENSP00000315945:I681T	I	-	2	0	CD163L1	7439966	0.000000	0.05858	0.914000	0.36105	0.781000	0.44180	0.084000	0.14891	0.449000	0.26747	-0.479000	0.04858	ATC		0.443	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941		4	44	0	0	0	0.001168	0	4	44				
RPL13AP20	387841	broad.mit.edu	37	12	13028751	13028751	+	IGR	SNP	G	G	C	rs199863259		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:13028751G>C								DDX47 (45836 upstream) : GPRC5A (14964 downstream)																							GGTGTTTGACGGCATCCCACC	0.612																																							uc010sho.1		NA																	0					0						c.(319-321)GGC>CGC		SubName: Full=Ribosomal protein L13a variant; Flags: Fragment;																																				SO:0001628	intergenic_variant	387841							g.chr12:13028751G>C																													12.37:g.13028751G>C			Somatic					p.G107R	NR_003932		WXS	Illumina HiSeq	Unspecified					1	341	+									Missense_Mutation	SNP		37	c.319G>C																																																																																				0	0.612									4	6	0	0	0	0.009096	0	4	6				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)	Somatic				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	WXS	Illumina HiSeq	Unspecified	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		8	19	1	0	0.00448238	0.004482	0.00663593	8	19				
OVCH1	341350	broad.mit.edu	37	12	29608259	29608259	+	Missense_Mutation	SNP	C	C	A	rs368301924		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:29608259C>A	ENST00000318184.5	-	20	2359	c.2360G>T	c.(2359-2361)gGc>gTc	p.G787V	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	787	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					CTGGACACAGCCAGCTCCCCA	0.448																																							uc001rix.1		NA																	0				ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10						c.(2359-2361)GGC>GTC		ovochymase 1 precursor							74.0	73.0	73.0					12																	29608259		1896	4105	6001	SO:0001583	missense	341350				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	g.chr12:29608259C>A	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.2360G>T	12.37:g.29608259C>A	ENSP00000326708:p.Gly787Val		Somatic					p.G787V	NM_183378	NP_899234	WXS	Illumina HiSeq	Unspecified	Q7RTY7	OVCH1_HUMAN			20	2360	-	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)		787			Peptidase S1 2.			Missense_Mutation	SNP	ENST00000318184.5	37	c.2360G>T		.	.	.	.	.	.	.	.	.	.	C	16.28	3.078016	0.55753	.	.	ENSG00000187950	ENST00000318184	D	0.89810	-2.57	3.19	2.29	0.28610	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.93207	0.7836	M	0.82433	2.59	0.53688	D	0.999973	D	0.76494	0.999	D	0.75020	0.985	D	0.92320	0.5865	9	0.87932	D	0	.	8.4421	0.32820	0.0:0.8799:0.0:0.1201	.	787	Q7RTY7	OVCH1_HUMAN	V	787	ENSP00000326708:G787V	ENSP00000326708:G787V	G	-	2	0	OVCH1	29499526	0.555000	0.26530	0.186000	0.23195	0.998000	0.95712	1.276000	0.33156	0.919000	0.36945	0.655000	0.94253	GGC		0.448	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378		27	78	1	0	2.12542e-12	0.00632	4.26693e-12	27	78				
KIAA1551	55196	broad.mit.edu	37	12	32135902	32135902	+	Silent	SNP	A	A	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:32135902A>G	ENST00000312561.4	+	4	2427	c.2013A>G	c.(2011-2013)gaA>gaG	p.E671E	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	671								p.E671E(1)									GTTCCATGGAAGTGCTAGCAA	0.428																																							uc001rks.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(2011-2013)GAA>GAG		hypothetical protein LOC55196							70.0	66.0	67.0					12																	32135902		2203	4299	6502	SO:0001819	synonymous_variant	55196							g.chr12:32135902A>G	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.2013A>G	12.37:g.32135902A>G			Somatic					p.E671E	NM_018169	NP_060639	WXS	Illumina HiSeq	Unspecified	Q9HCM1	CL035_HUMAN	OV - Ovarian serous cystadenocarcinoma(6;0.0114)		4	2427	+	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		671					B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Silent	SNP	ENST00000312561.4	37	c.2013A>G	CCDS8725.2																																																																																				0.428	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169		10	37	0	0	0	0.013537	0	10	37				
CEP83	51134	broad.mit.edu	37	12	94806266	94806266	+	Start_Codon_SNP	SNP	T	T	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:94806266T>C	ENST00000397809.5	-	3	550	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	CCDC41_ENST00000397807.2_5'UTR|CCDC41_ENST00000339839.5_Start_Codon_SNP_p.M1V|CCDC41_ENST00000547575.1_Start_Codon_SNP_p.M1V	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN		0					cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)		p.M1V(1)		breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						CTGACAACCATGTAAAAATAA	0.393																																							uc001tdd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1-3)ATG>GTG		NY-REN-58 antigen							80.0	76.0	77.0					12																	94806266		1843	4096	5939	SO:0001582	initiator_codon_variant	51134							g.chr12:94806266T>C																												ENST00000397809.5:c.1A>G	12.37:g.94806266T>C	ENSP00000380911:p.Met1Val		Somatic				CCDC41_uc001tde.2_Missense_Mutation_p.M1V|CCDC41_uc009zsw.1_Intron|CCDC41_uc001tdf.2_Missense_Mutation_p.M1V	p.M1V	NM_016122	NP_057206	WXS	Illumina HiSeq	Unspecified	Q9Y592	CCD41_HUMAN			3	587	-			Error:Variant_position_missing_in_Q9Y592_after_alignment					A4FVB1|Q08AP1	Missense_Mutation	SNP	ENST00000397809.5	37	c.1A>G	CCDS41820.1	.	.	.	.	.	.	.	.	.	.	T	6.829	0.522173	0.13066	.	.	ENSG00000173588	ENST00000339839;ENST00000397809;ENST00000547575;ENST00000546527	T;T;T	0.45276	0.94;0.94;0.9	5.67	4.53	0.55603	.	.	.	.	.	T	0.31327	0.0793	.	.	.	0.80722	D	1	B	0.33171	0.4	B	0.30855	0.121	T	0.20538	-1.0272	8	0.87932	D	0	-5.3074	5.116	0.14834	0.2477:0.0788:0.0:0.6736	.	1	F8VYN8	.	V	1	ENSP00000344655:M1V;ENSP00000380911:M1V;ENSP00000448913:M1V	ENSP00000344655:M1V	M	-	1	0	CCDC41	93330397	0.999000	0.42202	0.998000	0.56505	0.003000	0.03518	0.963000	0.29293	1.093000	0.41377	-0.250000	0.11733	ATG		0.393	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408147.3		Missense_Mutation	19	57	0	0	0	0.012319	0	19	57				
CRY1	1407	broad.mit.edu	37	12	107391114	107391114	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:107391114C>T	ENST00000008527.5	-	10	2410	c.1543G>A	c.(1543-1545)Gga>Aga	p.G515R		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	515					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)	p.G515R(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						GCAGAATATCCCATGAAGCCT	0.333																																							uc001tmi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1543-1545)GGA>AGA		cryptochrome 1 (photolyase-like)							147.0	154.0	151.0					12																	107391114		2203	4300	6503	SO:0001583	missense	1407				DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	blue light photoreceptor activity|DNA photolyase activity|double-stranded DNA binding|nucleotide binding|protein binding	g.chr12:107391114C>T	BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.1543G>A	12.37:g.107391114C>T	ENSP00000008527:p.Gly515Arg		Somatic					p.G515R	NM_004075	NP_004066	WXS	Illumina HiSeq	Unspecified	Q16526	CRY1_HUMAN			10	2402	-			515						Missense_Mutation	SNP	ENST00000008527.5	37	c.1543G>A	CCDS9112.1	.	.	.	.	.	.	.	.	.	.	C	12.49	1.954975	0.34471	.	.	ENSG00000008405	ENST00000008527;ENST00000319645;ENST00000549356	.	.	.	5.79	5.79	0.91817	.	0.934650	0.09175	N	0.838212	T	0.51075	0.1653	L	0.43152	1.355	0.35885	D	0.829227	B	0.18166	0.026	B	0.20384	0.029	T	0.46911	-0.9157	9	0.27785	T	0.31	-3.0176	10.4887	0.44737	0.0:0.8551:0.0:0.1449	.	515	Q16526	CRY1_HUMAN	R	515;122;35	.	ENSP00000008527:G515R	G	-	1	0	CRY1	105915244	0.510000	0.26171	0.870000	0.34147	0.763000	0.43281	0.844000	0.27654	2.734000	0.93682	0.655000	0.94253	GGA		0.333	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406827.1	NM_004075		18	276	0	0	0	0.012319	0	18	276				
SELPLG	6404	broad.mit.edu	37	12	109017390	109017390	+	Missense_Mutation	SNP	G	G	T	rs113452057		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:109017390G>T	ENST00000550948.1	-	2	918	c.694C>A	c.(694-696)Cag>Aag	p.Q232K	SELPLG_ENST00000228463.6_Missense_Mutation_p.Q248K|SELPLG_ENST00000388962.3_Missense_Mutation_p.Q222K			Q14242	SELPL_HUMAN	selectin P ligand	232	12 X 10 AA tandem repeats.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.Q232K(1)|p.Q222K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						GCAGTGGTCTGTGCCTCCATG	0.617																																							uc001tni.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(694-696)CAG>AAG		selectin P ligand							216.0	172.0	187.0					12																	109017390		2203	4300	6503	SO:0001583	missense	6404				blood coagulation|cellular response to interleukin-6	integral to plasma membrane|membrane fraction	bacterial cell surface binding|receptor binding	g.chr12:109017390G>T		CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.694C>A	12.37:g.109017390G>T	ENSP00000447752:p.Gln232Lys		Somatic				SELPLG_uc001tnh.2_Missense_Mutation_p.Q222K|SELPLG_uc010sxe.1_Missense_Mutation_p.Q248K	p.Q232K	NM_003006	NP_002997	WXS	Illumina HiSeq	Unspecified	Q14242	SELPL_HUMAN			2	854	-			232			12 X 10 AA tandem repeats.|Extracellular (Potential).|10.		A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Missense_Mutation	SNP	ENST00000550948.1	37	c.694C>A	CCDS31895.2	.	.	.	.	.	.	.	.	.	.	G	4.696	0.129392	0.08981	.	.	ENSG00000110876	ENST00000388962;ENST00000550948;ENST00000228463	T;T;T	0.24723	1.84;1.84;1.84	3.36	0.307	0.15811	.	1.876850	0.03546	N	0.224733	T	0.19805	0.0476	L	0.46157	1.445	0.09310	N	1	B;B;B	0.29671	0.254;0.144;0.144	B;B;B	0.28991	0.097;0.055;0.055	T	0.15723	-1.0427	10	0.06099	T	0.92	0.0908	5.4088	0.16336	0.1235:0.411:0.4655:0.0	.	248;232;192	B7Z5C7;Q14242;B4DHR9	.;SELPL_HUMAN;.	K	222;232;248	ENSP00000373614:Q222K;ENSP00000447752:Q232K;ENSP00000228463:Q248K	ENSP00000228463:Q248K	Q	-	1	0	SELPLG	107541519	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.088000	0.11198	0.063000	0.16370	0.655000	0.94253	CAG		0.617	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403904.1			31	166	1	0	2.68265e-12	0.013726	5.34513e-12	31	166				
FOXN4	121643	broad.mit.edu	37	12	109719546	109719546	+	Silent	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:109719546C>T	ENST00000299162.5	-	9	1064	c.960G>A	c.(958-960)ccG>ccA	p.P320P	FOXN4_ENST00000355216.1_Silent_p.P140P	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	320					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P320P(1)|p.P140P(1)		large_intestine(5)|lung(9)|ovary(2)	16						CTGGTTCCCCCGGTTTGCCGG	0.672																																							uc001toe.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|lung(1)	2						c.(958-960)CCG>CCA		forkhead box N4							13.0	13.0	13.0					12																	109719546		2169	4249	6418	SO:0001819	synonymous_variant	121643				axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr12:109719546C>T	AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.960G>A	12.37:g.109719546C>T			Somatic				FOXN4_uc009zvg.2_Silent_p.P117P|FOXN4_uc001tof.3_Silent_p.P140P	p.P320P	NM_213596	NP_998761	WXS	Illumina HiSeq	Unspecified	Q96NZ1	FOXN4_HUMAN			9	1065	-			320					Q6ZMR4|Q96NZ0	Silent	SNP	ENST00000299162.5	37	c.960G>A	CCDS9126.2																																																																																				0.672	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328306.1	XM_062735		4	25	0	0	0	0.009096	0	4	25				
LCP1	3936	broad.mit.edu	37	13	46716467	46716467	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr13:46716467G>A	ENST00000398576.2	-	16	1850	c.1462C>T	c.(1462-1464)Cgc>Tgc	p.R488C	LCP1_ENST00000323076.2_Missense_Mutation_p.R488C|LCP1_ENST00000435666.2_Missense_Mutation_p.R57C			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	488	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)	p.R488C(1)		breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		GTGAGAGTGCGGTTTCCTTCA	0.413			T	BCL6	NHL																																		uc001vaz.3		NA		Dom	yes		13	13q14.1-q14.3	3936	T	lymphocyte cytosolic protein 1 (L-plastin)			L	BCL6		NHL 		1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(3)	7						c.(1462-1464)CGC>TGC		L-plastin							199.0	171.0	181.0					13																	46716467		2203	4300	6503	SO:0001583	missense	3936				regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding	g.chr13:46716467G>A	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1462C>T	13.37:g.46716467G>A	ENSP00000381581:p.Arg488Cys		Somatic				LCP1_uc010ack.2_Missense_Mutation_p.R57C|LCP1_uc001vay.3_Missense_Mutation_p.R85C|LCP1_uc001vba.3_Missense_Mutation_p.R488C	p.R488C	NM_002298	NP_002289	WXS	Illumina HiSeq	Unspecified	P13796	PLSL_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)	13	1588	-		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	488			Actin-binding 2.|CH 3.		B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	ENST00000398576.2	37	c.1462C>T	CCDS9403.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504255	0.85176	.	.	ENSG00000136167	ENST00000323076;ENST00000398576;ENST00000435666	D;D;D	0.95103	-3.61;-3.61;-3.61	5.5	3.73	0.42828	Actinin-type, actin-binding, conserved site (1);Calponin homology domain (5);	0.101174	0.64402	D	0.000002	D	0.96087	0.8725	M	0.79475	2.455	0.80722	D	1	D;P	0.69078	0.997;0.934	P;P	0.62382	0.901;0.69	D	0.95178	0.8296	10	0.72032	D	0.01	-1.4523	9.7844	0.40666	0.0731:0.0:0.7876:0.1393	.	57;488	B4DUA0;P13796	.;PLSL_HUMAN	C	488;488;57	ENSP00000315757:R488C;ENSP00000381581:R488C;ENSP00000405134:R57C	ENSP00000315757:R488C	R	-	1	0	LCP1	45614468	1.000000	0.71417	0.983000	0.44433	0.979000	0.70002	6.640000	0.74319	0.657000	0.30906	0.561000	0.74099	CGC		0.413	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3	NM_002298		6	118	0	0	0	0.001168	0	6	118				
RAB20	55647	broad.mit.edu	37	13	111176305	111176305	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr13:111176305C>A	ENST00000267328.3	-	2	625	c.412G>T	c.(412-414)Ggg>Tgg	p.G138W		NM_017817.1	NP_060287.1	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family	138					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)	GTP binding (GO:0005525)	p.G138W(2)		endometrium(2)|large_intestine(2)|lung(3)	7	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)			ACACGGTCCCCAGCGTCCATA	0.572																																							uc001vqy.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(412-414)GGG>TGG		RAB20, member RAS oncogene family							62.0	59.0	60.0					13																	111176305		2203	4300	6503	SO:0001583	missense	55647				protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding	g.chr13:111176305C>A	AK000436	CCDS9512.1	13q34	2008-07-18			ENSG00000139832	ENSG00000139832		"""RAB, member RAS oncogene"""	18260	protein-coding gene	gene with protein product						11697911	Standard	NM_017817		Approved	FLJ20429	uc001vqy.3	Q9NX57	OTTHUMG00000017343	ENST00000267328.3:c.412G>T	13.37:g.111176305C>A	ENSP00000267328:p.Gly138Trp		Somatic					p.G138W	NM_017817	NP_060287	WXS	Illumina HiSeq	Unspecified	Q9NX57	RAB20_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)		2	617	-	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		138					Q5T9X5|Q9NX49	Missense_Mutation	SNP	ENST00000267328.3	37	c.412G>T	CCDS9512.1	.	.	.	.	.	.	.	.	.	.	C	8.152	0.787611	0.16258	.	.	ENSG00000139832	ENST00000267328	T	0.69175	-0.38	4.13	-1.14	0.09741	.	0.673677	0.13774	N	0.363661	T	0.57740	0.2074	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	D	0.70487	0.969	T	0.50457	-0.8826	10	0.72032	D	0.01	0.426	5.2256	0.15393	0.0:0.42:0.2799:0.3001	.	138	Q9NX57	RAB20_HUMAN	W	138	ENSP00000267328:G138W	ENSP00000267328:G138W	G	-	1	0	RAB20	109974306	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.810000	0.04505	-0.181000	0.10619	0.561000	0.74099	GGG		0.572	RAB20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045760.2	NM_017817		8	44	1	0	0.000157383	0.00308	0.000243898	8	44				
TEP1	7011	broad.mit.edu	37	14	20854332	20854332	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr14:20854332C>A	ENST00000262715.5	-	20	2924	c.2884G>T	c.(2884-2886)Gag>Tag	p.E962*	TEP1_ENST00000556935.1_Nonsense_Mutation_p.E854*	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	962					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)	p.E962*(1)		NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TTCTCCACCTCCCCAAGGCAC	0.552																																							uc001vxe.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)	5						c.(2884-2886)GAG>TAG		telomerase-associated protein 1							122.0	111.0	115.0					14																	20854332		2203	4300	6503	SO:0001587	stop_gained	7011				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding	g.chr14:20854332C>A		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.2884G>T	14.37:g.20854332C>A	ENSP00000262715:p.Glu962*		Somatic				TEP1_uc010ahk.2_Nonsense_Mutation_p.E312*|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Nonsense_Mutation_p.E854*	p.E962*	NM_007110	NP_009041	WXS	Illumina HiSeq	Unspecified	Q99973	TEP1_HUMAN	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)	20	2924	-	all_cancers(95;0.00123)	all_lung(585;0.235)	962					A0AUV9	Nonsense_Mutation	SNP	ENST00000262715.5	37	c.2884G>T	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	C	42	9.339150	0.99142	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-26.9321	17.8943	0.88881	0.0:1.0:0.0:0.0	.	.	.	.	X	962;962;854	.	ENSP00000262715:E962X	E	-	1	0	TEP1	19924172	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.712000	0.68407	2.505000	0.84491	0.655000	0.94253	GAG		0.552	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110		19	129	1	0	5.3912e-06	0.006122	8.81895e-06	19	129				
OR10G2	26534	broad.mit.edu	37	14	22102089	22102089	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr14:22102089G>T	ENST00000542433.1	-	1	1007	c.910C>A	c.(910-912)Ctg>Atg	p.L304M		NM_001005466.1	NP_001005466.1	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G, member 2	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L304M(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(2)	22	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		ATCCTCTTCAGGGCAGACTTC	0.473																																							uc010tmc.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(910-912)CTG>ATG		olfactory receptor, family 10, subfamily G,							107.0	101.0	103.0					14																	22102089		2203	4300	6503	SO:0001583	missense	26534				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22102089G>T		CCDS32047.1	14q11.2	2013-09-24			ENSG00000255582	ENSG00000255582		"""GPCR / Class A : Olfactory receptors"""	8170	protein-coding gene	gene with protein product						8188290	Standard	NM_001005466		Approved		uc010tmc.2	Q8NGC3	OTTHUMG00000168890	ENST00000542433.1:c.910C>A	14.37:g.22102089G>T	ENSP00000445383:p.Leu304Met		Somatic					p.L304M	NM_001005466	NP_001005466	WXS	Illumina HiSeq	Unspecified	Q8NGC3	O10G2_HUMAN		GBM - Glioblastoma multiforme(265;0.0142)	1	910	-	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)	304			Cytoplasmic (Potential).		B2RPD0	Missense_Mutation	SNP	ENST00000542433.1	37	c.910C>A	CCDS32047.1	.	.	.	.	.	.	.	.	.	.	G	7.933	0.741175	0.15642	.	.	ENSG00000255582	ENST00000542433	T	0.46451	0.87	3.82	3.82	0.43975	.	0.000000	0.32134	N	0.006527	T	0.45236	0.1332	L	0.41236	1.265	0.24214	N	0.995467	D	0.89917	1.0	D	0.91635	0.999	T	0.37361	-0.9709	10	0.02654	T	1	-6.692	8.6274	0.33897	0.0:0.0:0.7713:0.2286	.	304	Q8NGC3	O10G2_HUMAN	M	304	ENSP00000445383:L304M	ENSP00000445383:L304M	L	-	1	2	OR10G2	21171929	0.001000	0.12720	1.000000	0.80357	0.896000	0.52359	-0.100000	0.10990	1.970000	0.57323	0.563000	0.77884	CTG		0.473	OR10G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401525.1			21	143	1	0	2.44723e-14	0.004656	5.22997e-14	21	143				
FAM179B	23116	broad.mit.edu	37	14	45433416	45433416	+	Missense_Mutation	SNP	G	G	A	rs373580836		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr14:45433416G>A	ENST00000361577.3	+	1	2006	c.1792G>A	c.(1792-1794)Ggg>Agg	p.G598R	KLHL28_ENST00000396128.4_5'Flank|FAM179B_ENST00000382233.2_Missense_Mutation_p.G598R|FAM179B_ENST00000361462.2_Missense_Mutation_p.G598R|KLHL28_ENST00000553817.1_Intron	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	598								p.G598R(1)		endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						ATCTTCTGCCGGGGGTAGGTC	0.512																																							uc001wvv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|upper_aerodigestive_tract(1)	3						c.(1792-1794)GGG>AGG		hypothetical protein LOC23116		G	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	127.0	119.0	122.0		1792	3.6	1.0	14		122	0,8600		0,0,4300	no	missense	FAM179B	NM_015091.2	125	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	598/1721	45433416	1,13005	2203	4300	6503	SO:0001583	missense	23116						binding	g.chr14:45433416G>A	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.1792G>A	14.37:g.45433416G>A	ENSP00000355045:p.Gly598Arg		Somatic				FAM179B_uc001wvw.2_Missense_Mutation_p.G598R|FAM179B_uc010anc.2_RNA|KLHL28_uc001wvr.2_5'Flank|FAM179B_uc010anb.1_Missense_Mutation_p.G598R|FAM179B_uc001wvu.2_Missense_Mutation_p.G598R	p.G598R	NM_015091	NP_055906	WXS	Illumina HiSeq	Unspecified	Q9Y4F4	F179B_HUMAN			1	2001	+			598					Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	37	c.1792G>A	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	G	6.666	0.491511	0.12702	2.27E-4	0.0	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233	T;T;T	0.04083	3.71;3.71;3.71	4.47	3.57	0.40892	Armadillo-type fold (1);	0.285122	0.28683	N	0.014497	T	0.02193	0.0068	N	0.04959	-0.14	0.28466	N	0.91565	B;B;B;B	0.19331	0.035;0.004;0.001;0.014	B;B;B;B	0.11329	0.006;0.001;0.0;0.006	T	0.43343	-0.9397	10	0.07990	T	0.79	-0.0574	8.9091	0.35541	0.0:0.7602:0.1554:0.0844	.	598;598;598;598	Q9Y4F4-3;G3XAE9;Q9Y4F4;Q9Y4F4-2	.;.;F179B_HUMAN;.	R	598	ENSP00000355045:G598R;ENSP00000354917:G598R;ENSP00000371668:G598R	ENSP00000354917:G598R	G	+	1	0	FAM179B	44503166	1.000000	0.71417	0.998000	0.56505	0.788000	0.44548	2.952000	0.49097	1.093000	0.41377	-0.270000	0.10280	GGG		0.512	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781		42	65	0	0	0	0.010771	0	42	65				
SYT16	83851	broad.mit.edu	37	14	62567300	62567300	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr14:62567300G>T	ENST00000430451.2	+	6	2010	c.1813G>T	c.(1813-1815)Gag>Tag	p.E605*	RP11-355I22.2_ENST00000554252.1_lincRNA	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	605	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)			p.E585*(1)|p.E605*(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GAAGCGTAAAGAGATGATTGG	0.488																																							uc001xfu.1		NA																	2	Substitution - Nonsense(2)		lung(2)	central_nervous_system(1)	1						c.(1813-1815)GAG>TAG		synaptotagmin XIV-like							105.0	106.0	106.0					14																	62567300		2045	4188	6233	SO:0001587	stop_gained	83851							g.chr14:62567300G>T	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1813G>T	14.37:g.62567300G>T	ENSP00000394700:p.Glu605*		Somatic				SYT16_uc010tse.1_Nonsense_Mutation_p.E163*	p.E605*	NM_031914	NP_114120	WXS	Illumina HiSeq	Unspecified	Q17RD7	SYT16_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)	6	2010	+			605			C2 2.		B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Nonsense_Mutation	SNP	ENST00000430451.2	37	c.1813G>T	CCDS45121.1	.	.	.	.	.	.	.	.	.	.	G	39	7.562728	0.98361	.	.	ENSG00000139973	ENST00000430451	.	.	.	5.37	4.42	0.53409	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-4.744	15.5147	0.75815	0.0:0.1384:0.8616:0.0	.	.	.	.	X	605	.	ENSP00000394700:E605X	E	+	1	0	SYT16	61637053	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.530000	0.81962	2.520000	0.84964	0.655000	0.94253	GAG		0.488	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914		7	30	1	0	0.00307968	0.00308	0.00458492	7	30				
PAPLN	89932	broad.mit.edu	37	14	73720461	73720461	+	Splice_Site	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr14:73720461G>T	ENST00000554301.1	+	11	1257		c.e11-1		PAPLN_ENST00000340738.5_Splice_Site|PAPLN_ENST00000381166.3_Splice_Site|PAPLN_ENST00000427855.1_Splice_Site|PAPLN_ENST00000555445.1_Splice_Site			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein							basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)	p.?(2)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		CCTCCTGCCAGCTGGAAGGCA	0.662																																							uc010ttx.1		NA																	2	Unknown(2)		lung(2)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.e11-1		papilin							36.0	39.0	38.0					14																	73720461		2201	4297	6498	SO:0001630	splice_region_variant	89932					proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding	g.chr14:73720461G>T	BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.1095-1G>T	14.37:g.73720461G>T			Somatic				PAPLN_uc001xnw.3_Splice_Site_p.R338_splice|PAPLN_uc010arl.2_Splice_Site|PAPLN_uc010ttw.1_Splice_Site|PAPLN_uc010tty.1_Splice_Site_p.R365_splice	p.R365_splice	NM_173462	NP_775733	WXS	Illumina HiSeq	Unspecified	O95428	PPN_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)	11	1258	+								B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Splice_Site	SNP	ENST00000554301.1	37	c.1095_splice		.	.	.	.	.	.	.	.	.	.	G	14.66	2.603170	0.46423	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000554301;ENST00000555445	.	.	.	5.1	4.14	0.48551	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9853	0.71342	0.0:0.1431:0.8569:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PAPLN	72790214	1.000000	0.71417	0.999000	0.59377	0.533000	0.34776	7.494000	0.81503	2.385000	0.81259	0.462000	0.41574	.		0.662	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1	NM_173462	Intron	13	41	1	0	0.00244969	0.00245	0.00368846	13	41				
SLC24A4	123041	broad.mit.edu	37	14	92915520	92915520	+	Silent	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr14:92915520C>T	ENST00000532405.1	+	10	1066	c.840C>T	c.(838-840)gaC>gaT	p.D280D	SLC24A4_ENST00000298877.1_Silent_p.D263D|SLC24A4_ENST00000531433.1_Intron|SLC24A4_ENST00000351924.5_Intron|SLC24A4_ENST00000393265.2_Silent_p.D216D			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	280					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.D263D(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		ATTTCTATGACGGTAGCTATG	0.493																																					NSCLC(10;315 435 10383 28450 38798)	NSCLC(10;315 435 10383 28450 38798)	uc001yak.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|ovary(1)	3						c.(787-789)GAC>GAT		solute carrier family 24 member 4 isoform 1							131.0	97.0	109.0					14																	92915520		2203	4300	6503	SO:0001819	synonymous_variant	123041					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity	g.chr14:92915520C>T	AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.840C>T	14.37:g.92915520C>T			Somatic				SLC24A4_uc001yai.2_Silent_p.D216D|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron|SLC24A4_uc010auj.2_Intron|SLC24A4_uc010twn.1_Silent_p.D36D|uc001yal.1_RNA	p.D263D	NM_153646	NP_705932	WXS	Illumina HiSeq	Unspecified	Q8NFF2	NCKX4_HUMAN		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)	10	813	+		all_cancers(154;0.0347)|all_epithelial(191;0.163)	280			Extracellular (Potential).		B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Silent	SNP	ENST00000532405.1	37	c.789C>T	CCDS9903.2																																																																																				0.493	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646		6	54	0	0	0	0.001984	0	6	54				
BCL11B	64919	broad.mit.edu	37	14	99640726	99640726	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr14:99640726C>A	ENST00000357195.3	-	4	2456	c.2447G>T	c.(2446-2448)cGg>cTg	p.R816L	BCL11B_ENST00000345514.2_Missense_Mutation_p.R745L|BCL11B_ENST00000443726.2_Missense_Mutation_p.R622L	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	816					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R816L(1)		NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GGTGTGGCTCCGCCGGTGCAC	0.672			T	TLX3	T-ALL																																		uc001yga.2		NA		Dom	yes		14	14q32.1	64919	T	B-cell CLL/lymphoma 11B  (CTIP2)			L	TLX3		T-ALL		1	Substitution - Missense(1)		lung(1)	central_nervous_system(8)|large_intestine(1)|lung(1)	10						c.(2446-2448)CGG>CTG		B-cell CLL/lymphoma 11B isoform 1							39.0	33.0	35.0					14																	99640726		2203	4299	6502	SO:0001583	missense	64919					nucleus	zinc ion binding	g.chr14:99640726C>A	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.2447G>T	14.37:g.99640726C>A	ENSP00000349723:p.Arg816Leu		Somatic				BCL11B_uc001ygb.2_Missense_Mutation_p.R745L	p.R816L	NM_138576	NP_612808	WXS	Illumina HiSeq	Unspecified	Q9C0K0	BC11B_HUMAN		COAD - Colon adenocarcinoma(157;0.103)	4	2714	-		Melanoma(154;0.0866)|all_epithelial(191;0.241)	816			C2H2-type 4.		Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	c.2447G>T	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.053908	0.75960	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.25085	1.82;1.82;1.82	4.5	3.56	0.40772	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000007	T	0.45657	0.1353	L	0.52905	1.665	0.58432	D	0.999997	D;D	0.89917	0.998;1.0	D;D	0.87578	0.976;0.998	T	0.46176	-0.9210	10	0.87932	D	0	-13.694	14.2991	0.66334	0.0:0.8498:0.1502:0.0	.	745;816	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	L	816;745;622	ENSP00000349723:R816L;ENSP00000280435:R745L;ENSP00000387419:R622L	ENSP00000280435:R745L	R	-	2	0	BCL11B	98710479	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.420000	0.80191	0.954000	0.37851	0.462000	0.41574	CGG		0.672	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576		7	22	1	0	0.000157383	0.00308	0.000243898	7	22				
NPAP1	23742	broad.mit.edu	37	15	24924482	24924482	+	Silent	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr15:24924482G>T	ENST00000329468.2	+	1	3942	c.3468G>T	c.(3466-3468)ccG>ccT	p.P1156P		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	1156					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P1156P(1)									TCCAACTTCCGTAAGAGCACC	0.423																																							uc001ywo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(3466-3468)CCG>CCT		hypothetical protein LOC23742							70.0	62.0	64.0					15																	24924482		2202	4298	6500	SO:0001819	synonymous_variant	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24924482G>T	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.3468G>T	15.37:g.24924482G>T			Somatic					p.P1156P	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	3942	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	1156						Silent	SNP	ENST00000329468.2	37	c.3468G>T	CCDS10015.1																																																																																				0.423	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		7	51	1	0	5.18039e-06	0.00308	8.52673e-06	7	51				
GABRA5	2558	broad.mit.edu	37	15	27160003	27160003	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr15:27160003C>A	ENST00000335625.5	+	7	1439	c.551C>A	c.(550-552)gCg>gAg	p.A184E	GABRA5_ENST00000355395.5_Missense_Mutation_p.A184E|GABRA5_ENST00000400081.3_Missense_Mutation_p.A184E|GABRB3_ENST00000541819.2_Intron	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	184					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.A184E(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CCGATGGATGCGCACGCTTGC	0.443																																							uc001zbd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(550-552)GCG>GAG		gamma-aminobutyric acid A receptor, alpha 5	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						72.0	73.0	73.0					15																	27160003		1971	4172	6143	SO:0001583	missense	2558				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27160003C>A		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.551C>A	15.37:g.27160003C>A	ENSP00000335592:p.Ala184Glu		Somatic				GABRB3_uc001zbb.2_Intron	p.A184E	NM_000810	NP_000801	WXS	Illumina HiSeq	Unspecified	P31644	GBRA5_HUMAN		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	8	890	+		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)	184			Extracellular (Potential).		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	c.551C>A	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.271495	0.23221	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000555182;ENST00000400081	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	5.57	5.57	0.84162	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.52693	0.1750	N	0.03294	-0.36	0.80722	D	1	B	0.18461	0.028	B	0.28638	0.092	T	0.53542	-0.8424	10	0.02654	T	1	.	10.4788	0.44680	0.0:0.9119:0.0:0.0881	.	184	P31644	GBRA5_HUMAN	E	184;184;152;184	ENSP00000335592:A184E;ENSP00000347557:A184E;ENSP00000450653:A152E;ENSP00000382953:A184E	ENSP00000335592:A184E	A	+	2	0	GABRA5	24742749	0.999000	0.42202	1.000000	0.80357	0.956000	0.61745	4.136000	0.58004	2.612000	0.88384	0.655000	0.94253	GCG		0.443	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1			12	59	1	0	9.31168e-06	0.001855	1.49551e-05	12	59				
HERC2	8924	broad.mit.edu	37	15	28478865	28478865	+	Silent	SNP	G	G	A	rs377587657		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr15:28478865G>A	ENST00000261609.7	-	28	4404	c.4296C>T	c.(4294-4296)ccC>ccT	p.P1432P		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCTCTTCCACGGGATGCTCGG	0.458																																							uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(4294-4296)CCC>CCT		hect domain and RLD 2		G		0,4406		0,0,2203	55.0	51.0	52.0		4296	-6.4	1.0	15		52	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	HERC2	NM_004667.4		0,1,6499	AA,AG,GG		0.0116,0.0,0.0077		1432/4835	28478865	1,12999	2203	4297	6500	SO:0001819	synonymous_variant	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28478865G>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.4296C>T	15.37:g.28478865G>A			Somatic					p.P1432P	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	28	4402	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	1432						Silent	SNP	ENST00000261609.7	37	c.4296C>T	CCDS10021.1																																																																																				0.458	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		13	71	0	0	0	0.00245	0	13	71				
TJP1	7082	broad.mit.edu	37	15	30092877	30092877	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr15:30092877C>A	ENST00000346128.6	-	2	530	c.56G>T	c.(55-57)tGg>tTg	p.W19L	TJP1_ENST00000400011.2_Missense_Mutation_p.W23L|TJP1_ENST00000495972.2_Missense_Mutation_p.W19L|TJP1_ENST00000356107.6_Missense_Mutation_p.W19L|TJP1_ENST00000545208.2_Missense_Mutation_p.W19L	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	19					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.W19L(1)		breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		ATGTTGTTCCCATATAGCTGT	0.368																																					Melanoma(77;681 1843 6309 6570)	Melanoma(77;681 1843 6309 6570)	uc001zcr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(55-57)TGG>TTG		tight junction protein 1 isoform a							189.0	171.0	177.0					15																	30092877		1920	4131	6051	SO:0001583	missense	7082				cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction		g.chr15:30092877C>A		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.56G>T	15.37:g.30092877C>A	ENSP00000281537:p.Trp19Leu		Somatic				TJP1_uc010azl.2_Missense_Mutation_p.W7L|TJP1_uc001zcq.2_Missense_Mutation_p.W23L|TJP1_uc001zcs.2_Missense_Mutation_p.W19L	p.W19L	NM_003257	NP_003248	WXS	Illumina HiSeq	Unspecified	Q07157	ZO1_HUMAN		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)	2	531	-		all_lung(180;7.48e-11)|Breast(32;0.000153)	19					B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	c.56G>T	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062799	0.76187	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.76	5.76	0.90799	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.68851	0.3046	M	0.68952	2.095	0.80722	D	1	B;B;B;D	0.71674	0.245;0.358;0.245;0.998	B;B;B;D	0.80764	0.21;0.379;0.21;0.994	T	0.64960	-0.6284	9	.	.	.	.	20.3242	0.98691	0.0:1.0:0.0:0.0	.	12;19;19;23	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	L	19;23;19;19;19	ENSP00000281537:W19L;ENSP00000382890:W23L;ENSP00000441202:W19L;ENSP00000348416:W19L	.	W	-	2	0	TJP1	27880169	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.455000	0.73497	2.882000	0.98803	0.655000	0.94253	TGG		0.368	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257		5	95	1	0	1.024e-07	0.000602	1.79709e-07	5	95				
LPCAT4	254531	broad.mit.edu	37	15	34653713	34653713	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr15:34653713T>C	ENST00000314891.6	-	11	1208	c.1031A>G	c.(1030-1032)gAc>gGc	p.D344G		NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	344					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)	p.D344G(1)		NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						TGCCCCAGCGTCCACATAGCC	0.577																																							uc001zig.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1030-1032)GAC>GGC		lysophosphatidylcholine acyltransferase 4							63.0	59.0	60.0					15																	34653713		2201	4298	6499	SO:0001583	missense	254531				phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding	g.chr15:34653713T>C	AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.1031A>G	15.37:g.34653713T>C	ENSP00000317300:p.Asp344Gly		Somatic					p.D344G	NM_153613	NP_705841	WXS	Illumina HiSeq	Unspecified	Q643R3	LPCT4_HUMAN			11	1125	-			344					A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Missense_Mutation	SNP	ENST00000314891.6	37	c.1031A>G	CCDS32191.1	.	.	.	.	.	.	.	.	.	.	T	19.69	3.875127	0.72180	.	.	ENSG00000176454	ENST00000314891	D	0.82344	-1.6	5.62	4.5	0.54988	.	0.167738	0.52532	D	0.000064	T	0.73791	0.3632	L	0.43923	1.385	0.47511	D	0.999449	P	0.44734	0.842	B	0.36922	0.236	T	0.73594	-0.3933	10	0.66056	D	0.02	-20.3082	8.257	0.31763	0.0:0.0898:0.0:0.9102	.	344	Q643R3	LPCT4_HUMAN	G	344	ENSP00000317300:D344G	ENSP00000317300:D344G	D	-	2	0	LPCAT4	32441005	0.996000	0.38824	0.790000	0.31976	0.983000	0.72400	3.831000	0.55776	0.975000	0.38392	0.454000	0.30748	GAC		0.577	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418028.2	NM_153613		7	41	0	0	0	0.004482	0	7	41				
WDR90	197335	broad.mit.edu	37	16	716792	716793	+	Splice_Site	DNP	GG	GG	TT			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr16:716792_716793GG>TT	ENST00000293879.4	+	39	5004	c.5004_5004GG>TT	c.(5002-5004)caGG>caTTg	p.Q1668H	WDR90_ENST00000549091.1_Splice_Site_p.Q1670H|RHOT2_ENST00000315082.4_5'Flank|WDR90_ENST00000547944.1_Splice_Site_p.Q267H|WDR90_ENST00000315764.4_Splice_Site_p.Q219H			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1668								p.?(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GCCAGAAGCAGGTACACGCAGC	0.658																																							uc002cii.1		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e39+1		WD repeat domain 90																																				SO:0001630	splice_region_variant	197335							g.chr16:716792_716793GG>TT	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	Exception_encountered	16.37:g.716792_716793delinsTT			Somatic				WDR90_uc002cij.1_Intron|WDR90_uc002cil.1_Splice_Site|WDR90_uc002cin.1_Splice_Site_p.Q283_splice|WDR90_uc010uul.1_Splice_Site_p.Q219_splice|WDR90_uc002cio.1_Splice_Site_p.Q267_splice|WDR90_uc010bqx.1_Splice_Site_p.Q219_splice|RHOT2_uc010uum.1_5'Flank|RHOT2_uc002cip.2_5'Flank|RHOT2_uc002ciq.2_5'Flank	p.Q1668_splice	NM_145294	NP_660337	WXS	Illumina HiSeq	Unspecified	Q96KV7	WDR90_HUMAN			39	5058	+		Hepatocellular(780;0.0218)						Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Splice_Site	DNP	ENST00000293879.4	37	c.5004_splice	CCDS42092.1																																																																																				0.658	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	Missense_Mutation	24	54	0	0	0	0.004672	0	24	54				
MAPK8IP3	23162	broad.mit.edu	37	16	1818201	1818201	+	Splice_Site	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr16:1818201C>A	ENST00000250894.4	+	30	3718	c.3561C>A	c.(3559-3561)gcC>gcA	p.A1187A	MAPK8IP3_ENST00000356010.5_Splice_Site_p.A1181A	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	1187					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)	p.A1193A(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						TCCCTGCAGCCAATAAGACAT	0.657																																							uc002cmk.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|central_nervous_system(1)	3						c.(3559-3561)GCC>GCA		mitogen-activated protein kinase 8 interacting							42.0	50.0	47.0					16																	1818201		2023	4159	6182	SO:0001630	splice_region_variant	23162				vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding	g.chr16:1818201C>A	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.3560-1C>A	16.37:g.1818201C>A			Somatic				MAPK8IP3_uc002cml.2_Silent_p.A1181A|MAPK8IP3_uc010uvl.1_Silent_p.A1188A	p.A1187A	NM_015133	NP_055948	WXS	Illumina HiSeq	Unspecified	Q9UPT6	JIP3_HUMAN			30	3681	+			1187					A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	ENST00000250894.4	37	c.3561C>A	CCDS10442.2																																																																																				0.657	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439	Silent	5	95	1	0	0.00116845	0.001168	0.00177953	5	95				
ABCC1	4363	broad.mit.edu	37	16	16218667	16218667	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr16:16218667G>T	ENST00000399410.3	+	25	3787	c.3612G>T	c.(3610-3612)gaG>gaT	p.E1204D	ABCC1_ENST00000346370.5_Missense_Mutation_p.E1148D|ABCC1_ENST00000349029.5_Missense_Mutation_p.E1089D|ABCC1_ENST00000345148.5_Missense_Mutation_p.E1204D|ABCC1_ENST00000351154.5_Missense_Mutation_p.E1145D|ABCC1_ENST00000399408.2_Missense_Mutation_p.E1214D	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	1204	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.E1204D(1)		breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	TGCGGCTGGAGTGTGTGGGCA	0.582																																							uc010bvi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(3610-3612)GAG>GAT		ATP-binding cassette, sub-family C, member 1	Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)						89.0	100.0	96.0					16																	16218667		2169	4271	6440	SO:0001583	missense	4363				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:16218667G>T	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.3612G>T	16.37:g.16218667G>T	ENSP00000382342:p.Glu1204Asp		Somatic				ABCC1_uc010bvj.2_Missense_Mutation_p.E1145D|ABCC1_uc010bvk.2_Missense_Mutation_p.E1148D|ABCC1_uc010bvl.2_Missense_Mutation_p.E1204D|ABCC1_uc010bvm.2_Missense_Mutation_p.E1089D|ABCC1_uc002del.3_Missense_Mutation_p.E1098D	p.E1204D	NM_004996	NP_004987	WXS	Illumina HiSeq	Unspecified	P33527	MRP1_HUMAN			25	3787	+			1204			ABC transmembrane type-1 2.|Helical; Name=16.		A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	37	c.3612G>T	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.021049	0.93462	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	T;T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94;-0.94	5.04	5.04	0.67666	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.047222	0.85682	D	0.000000	D	0.82770	0.5109	L	0.45470	1.425	0.58432	D	0.999995	P;D;D;D;D;D	0.89917	0.678;1.0;0.998;0.998;0.999;1.0	P;D;D;D;D;D	0.91635	0.645;0.999;0.997;0.994;0.998;0.999	D	0.84237	0.0470	10	0.62326	D	0.03	-33.9311	17.4597	0.87617	0.0:0.0:1.0:0.0	.	1089;1204;1148;1145;1204;1214	P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;MRP1_HUMAN;.	D	1204;1214;1148;1145;1204;1089;888	ENSP00000382342:E1204D;ENSP00000382340:E1214D;ENSP00000263019:E1148D;ENSP00000263017:E1145D;ENSP00000263014:E1204D;ENSP00000263016:E1089D	ENSP00000263014:E1204D	E	+	3	2	ABCC1	16126168	1.000000	0.71417	0.996000	0.52242	0.793000	0.44817	4.881000	0.63114	2.363000	0.80096	0.650000	0.86243	GAG		0.582	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996		20	52	1	0	4.96729e-08	0.008871	8.83444e-08	20	52				
CD19	930	broad.mit.edu	37	16	28947911	28947911	+	Silent	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr16:28947911C>T	ENST00000324662.3	+	7	1118	c.1074C>T	c.(1072-1074)acC>acT	p.T358T	CD19_ENST00000567541.1_Silent_p.T358T|CD19_ENST00000538922.1_Silent_p.T358T			P15391	CD19_HUMAN	CD19 molecule	358					B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)	p.T358T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						CCACACCCACCTCAGGCCTCG	0.652																																							uc002drs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1072-1074)ACC>ACT		CD19 antigen precursor							41.0	40.0	40.0					16																	28947911		2197	4300	6497	SO:0001819	synonymous_variant	930				cellular defense response	external side of plasma membrane|integral to plasma membrane	protein binding|receptor signaling protein activity	g.chr16:28947911C>T		CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.1074C>T	16.37:g.28947911C>T			Somatic				uc010vct.1_Intron|CD19_uc010byo.1_Silent_p.T358T	p.T358T	NM_001770	NP_001761	WXS	Illumina HiSeq	Unspecified	P15391	CD19_HUMAN			7	1136	+			358			Cytoplasmic (Potential).		A0N0P9|F5H635|Q96S68|Q9BRD6	Silent	SNP	ENST00000324662.3	37	c.1074C>T	CCDS10644.1																																																																																				0.652	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214152.2			7	26	0	0	0	0.00308	0	7	26				
ADAMTS18	170692	broad.mit.edu	37	16	77369710	77369710	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr16:77369710C>A	ENST00000282849.5	-	12	2220	c.1802G>T	c.(1801-1803)tGt>tTt	p.C601F		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	601	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C601F(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TGTCCGGGAACATTCTGACCA	0.562																																							uc002ffc.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						c.(1801-1803)TGT>TTT		ADAM metallopeptidase with thrombospondin type 1							172.0	171.0	171.0					16																	77369710		2198	4300	6498	SO:0001583	missense	170692				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr16:77369710C>A	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.1802G>T	16.37:g.77369710C>A	ENSP00000282849:p.Cys601Phe		Somatic				ADAMTS18_uc010chc.1_Missense_Mutation_p.C189F|ADAMTS18_uc002ffe.1_Missense_Mutation_p.C297F	p.C601F	NM_199355	NP_955387	WXS	Illumina HiSeq	Unspecified	Q8TE60	ATS18_HUMAN			12	2221	-			601			TSP type-1 1.		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	c.1802G>T	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983785	0.93044	.	.	ENSG00000140873	ENST00000282849	D	0.98585	-5.01	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.99569	0.9845	H	0.99783	4.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97533	1.0081	10	0.87932	D	0	.	18.9284	0.92554	0.0:1.0:0.0:0.0	.	601;601	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	F	601	ENSP00000282849:C601F	ENSP00000282849:C601F	C	-	2	0	ADAMTS18	75927211	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.696000	0.84270	2.712000	0.92718	0.650000	0.86243	TGT		0.562	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			88	138	1	0	4.64247e-43	0.01441	1.18294e-42	88	138				
RABEP1	9135	broad.mit.edu	37	17	5235390	5235390	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr17:5235390G>T	ENST00000546142.2	+	3	497	c.310G>T	c.(310-312)Gat>Tat	p.D104Y	RABEP1_ENST00000408982.2_Missense_Mutation_p.D104Y|RABEP1_ENST00000537505.1_Missense_Mutation_p.D61Y|RABEP1_ENST00000341923.6_Missense_Mutation_p.D104Y|RABEP1_ENST00000570487.1_3'UTR|RABEP1_ENST00000262477.6_Missense_Mutation_p.D104Y			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	104					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)	p.D104Y(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						AGAAGCTATAGATGAAGTGAA	0.418																																							uc002gbm.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(310-312)GAT>TAT		rabaptin, RAB GTPase binding effector protein 1							110.0	106.0	107.0					17																	5235390		1915	4117	6032	SO:0001583	missense	9135				apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity	g.chr17:5235390G>T	AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.310G>T	17.37:g.5235390G>T	ENSP00000437701:p.Asp104Tyr		Somatic				RABEP1_uc010clc.1_Missense_Mutation_p.D104Y|RABEP1_uc010cld.1_Missense_Mutation_p.D61Y|RABEP1_uc010vsw.1_Missense_Mutation_p.D61Y|RABEP1_uc002gbl.3_Missense_Mutation_p.D104Y|RABEP1_uc002gbj.2_Missense_Mutation_p.D104Y|RABEP1_uc002gbk.2_Missense_Mutation_p.D104Y	p.D104Y	NM_004703	NP_004694	WXS	Illumina HiSeq	Unspecified	Q15276	RABE1_HUMAN			3	534	+			104			Potential.		B2RAG7|O95369|Q8IVX3	Missense_Mutation	SNP	ENST00000546142.2	37	c.310G>T	CCDS45592.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.734076	0.89482	.	.	ENSG00000029725	ENST00000262477;ENST00000408982;ENST00000539669;ENST00000546142;ENST00000341923;ENST00000537505	T;T;T;T;T	0.49720	0.77;0.78;0.77;0.78;0.78	6.04	6.04	0.98038	Rabaptin coiled-coil domain (1);	0.000000	0.85682	D	0.000000	T	0.67869	0.2939	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.999	T	0.66767	-0.5840	10	0.66056	D	0.02	-20.9569	19.583	0.95478	0.0:0.0:1.0:0.0	.	61;61;104;104;104;104	F5H355;B4DMM4;Q05BX6;Q15276;Q15276-2;F5GZU7	.;.;.;RABE1_HUMAN;.;.	Y	104;104;104;104;104;61	ENSP00000262477:D104Y;ENSP00000386150:D104Y;ENSP00000437701:D104Y;ENSP00000339569:D104Y;ENSP00000445408:D61Y	ENSP00000262477:D104Y	D	+	1	0	RABEP1	5176114	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.358000	0.97109	2.873000	0.98535	0.563000	0.77884	GAT		0.418	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439349.1	NM_004703		15	51	1	0	2.32078e-09	0.003163	4.33104e-09	15	51				
DHRS7C	201140	broad.mit.edu	37	17	9694562	9694562	+	Silent	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr17:9694562G>A	ENST00000330255.5	-	1	52	c.40C>T	c.(40-42)Ctg>Ttg	p.L14L	RP11-477N12.3_ENST00000609065.1_5'UTR|DHRS7C_ENST00000571134.1_Silent_p.L14L	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	14					regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	extracellular region (GO:0005576)|longitudinal sarcoplasmic reticulum (GO:0014801)|sarcoplasmic reticulum membrane (GO:0033017)	retinol dehydrogenase activity (GO:0004745)	p.L14L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	15						CTGATTCCCAGCAGCAGCAGG	0.542																																							uc010vvb.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(40-42)CTG>TTG		dehydrogenase/reductase (SDR family) member 7C							39.0	39.0	39.0					17																	9694562		2020	4182	6202	SO:0001819	synonymous_variant	201140					extracellular region	binding|oxidoreductase activity	g.chr17:9694562G>A		CCDS56020.1, CCDS58517.1	17p13.1	2011-09-20				ENSG00000184544		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	32423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 2"""					19027726	Standard	NM_001105571		Approved	SDR32C2	uc010vvb.2	A6NNS2		ENST00000330255.5:c.40C>T	17.37:g.9694562G>A			Somatic				DHRS7C_uc010cof.2_Silent_p.L14L	p.L14L	NM_001105571	NP_001099041	WXS	Illumina HiSeq	Unspecified	A6NNS2	DRS7C_HUMAN			1	40	-			14					B7ZW74|B9EJH3	Silent	SNP	ENST00000330255.5	37	c.40C>T	CCDS56020.1																																																																																				0.542	DHRS7C-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439863.1	XM_113912		5	9	0	0	0	0.001168	0	5	9				
GLP2R	9340	broad.mit.edu	37	17	9792853	9792853	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr17:9792853A>G	ENST00000262441.5	+	13	2006	c.1493A>G	c.(1492-1494)aAc>aGc	p.N498S	GLP2R_ENST00000574745.1_Missense_Mutation_p.N318S	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	498					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)	p.N498S(1)		endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	CCCTCACTTAACAGTGGGCGG	0.622																																							uc002gmd.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(1492-1494)AAC>AGC		glucagon-like peptide 2 receptor precursor	Glucagon recombinant(DB00040)						50.0	51.0	50.0					17																	9792853		2203	4300	6503	SO:0001583	missense	9340				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane		g.chr17:9792853A>G	AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.1493A>G	17.37:g.9792853A>G	ENSP00000262441:p.Asn498Ser		Somatic					p.N498S	NM_004246	NP_004237	WXS	Illumina HiSeq	Unspecified	O95838	GLP2R_HUMAN			13	1493	+			498			Cytoplasmic (Potential).		Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	37	c.1493A>G	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	A	11.18	1.563600	0.27915	.	.	ENSG00000065325	ENST00000396206;ENST00000262441	T	0.53423	0.62	5.02	-1.23	0.09465	.	1.323100	0.05434	N	0.546489	T	0.24005	0.0581	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17806	-1.0357	10	0.05620	T	0.96	.	5.176	0.15135	0.2907:0.0:0.5518:0.1575	.	498	O95838	GLP2R_HUMAN	S	498	ENSP00000262441:N498S	ENSP00000262441:N498S	N	+	2	0	GLP2R	9733578	0.000000	0.05858	0.000000	0.03702	0.361000	0.29550	0.468000	0.22051	-0.275000	0.09219	0.533000	0.62120	AAC		0.622	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4			8	50	0	0	0	0.006214	0	8	50				
GPR142	350383	broad.mit.edu	37	17	72368582	72368582	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr17:72368582T>A	ENST00000335666.4	+	4	1280	c.1232T>A	c.(1231-1233)tTc>tAc	p.F411Y		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	411						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.F411Y(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						GCAGCCAACTTCGGCCTCTAC	0.607																																							uc010wqy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1231-1233)TTC>TAC		G protein-coupled receptor 142							93.0	78.0	83.0					17																	72368582		2203	4300	6503	SO:0001583	missense	350383					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity	g.chr17:72368582T>A	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.1232T>A	17.37:g.72368582T>A	ENSP00000335158:p.Phe411Tyr		Somatic				GPR142_uc010wqx.1_Missense_Mutation_p.F323Y	p.F411Y	NM_181790	NP_861455	WXS	Illumina HiSeq	Unspecified	Q7Z601	GP142_HUMAN			4	1232	+			411			Helical; Name=7; (Potential).		A4CYJ8|Q86SL3	Missense_Mutation	SNP	ENST00000335666.4	37	c.1232T>A	CCDS11698.1	.	.	.	.	.	.	.	.	.	.	T	12.78	2.040349	0.35989	.	.	ENSG00000257008	ENST00000335666	T	0.38077	1.16	4.55	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.55130	0.1901	M	0.73962	2.25	0.48395	D	0.99964	D;D	0.76494	0.999;0.997	D;D	0.81914	0.995;0.987	T	0.55082	-0.8196	10	0.09338	T	0.73	-13.5607	14.3493	0.66688	0.0:0.0:0.0:1.0	.	411;1373	Q7Z601;Q8NGB0	GP142_HUMAN;.	Y	411	ENSP00000335158:F411Y	ENSP00000335158:F411Y	F	+	2	0	GPR142	69880177	1.000000	0.71417	0.919000	0.36401	0.020000	0.10135	5.895000	0.69814	2.014000	0.59158	0.454000	0.30748	TTC		0.607	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790		23	61	0	0	0	0.003954	0	23	61				
TMC6	11322	broad.mit.edu	37	17	76117707	76117707	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr17:76117707C>G	ENST00000590602.1	-	11	1472	c.1313G>C	c.(1312-1314)tGg>tCg	p.W438S	TMC6_ENST00000392467.3_Missense_Mutation_p.W438S|TMC6_ENST00000589553.1_Missense_Mutation_p.W211S|TMC6_ENST00000306591.7_Intron|TMC6_ENST00000322914.3_Missense_Mutation_p.W438S|TMC6_ENST00000322933.4_Missense_Mutation_p.W77S|TMC6_ENST00000592076.1_Intron|TMC6_ENST00000591436.1_Missense_Mutation_p.W77S			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	438					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)		p.W438S(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			ACACAGCAGCCACACAAGCCC	0.721																																							uc002juj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1312-1314)TGG>TCG		transmembrane channel-like 6							17.0	22.0	21.0					17																	76117707		2173	4263	6436	SO:0001583	missense	11322	Epidermodysplasia_Verruciformis_Familial_Clustering_of				endoplasmic reticulum membrane|integral to membrane		g.chr17:76117707C>G	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.1313G>C	17.37:g.76117707C>G	ENSP00000465261:p.Trp438Ser		Somatic				TMC6_uc002jui.1_Missense_Mutation_p.W77S|TMC6_uc010dhf.1_Missense_Mutation_p.W271S|TMC6_uc002juk.2_Missense_Mutation_p.W438S|TMC6_uc010dhg.1_Intron|TMC6_uc002jul.1_Missense_Mutation_p.W438S|TMC6_uc002jum.3_Missense_Mutation_p.W229S|TMC6_uc002jun.3_Missense_Mutation_p.W438S|TMC6_uc002juo.2_Missense_Mutation_p.W211S	p.W438S	NM_007267	NP_009198	WXS	Illumina HiSeq	Unspecified	Q7Z403	TMC6_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)		10	1439	-			438			Helical; (Potential).		O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	ENST00000590602.1	37	c.1313G>C	CCDS32748.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093375	0.56075	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000322933	T;T;T	0.72942	0.79;0.79;-0.7	4.36	4.36	0.52297	.	0.000000	0.85682	D	0.000000	D	0.83936	0.5362	M	0.79693	2.465	0.80722	D	1	D;D;P;D	0.89917	1.0;0.999;0.877;1.0	D;D;P;D	0.91635	0.998;0.933;0.622;0.999	D	0.85866	0.1413	10	0.52906	T	0.07	-11.2292	15.0309	0.71705	0.0:1.0:0.0:0.0	.	211;438;438;77	Q7Z403-4;B3KTU5;Q7Z403;Q7Z403-3	.;.;TMC6_HUMAN;.	S	438;438;77	ENSP00000313408:W438S;ENSP00000376260:W438S;ENSP00000313479:W77S	ENSP00000313408:W438S	W	-	2	0	TMC6	73629302	1.000000	0.71417	0.982000	0.44146	0.100000	0.18952	3.688000	0.54699	1.955000	0.56771	0.313000	0.20887	TGG		0.721	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1			3	16	0	0	0	0.001168	0	3	16				
LAMA1	284217	broad.mit.edu	37	18	6959354	6959354	+	Missense_Mutation	SNP	C	C	A	rs577056597		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr18:6959354C>A	ENST00000389658.3	-	54	7857	c.7764G>T	c.(7762-7764)ttG>ttT	p.L2588F	RP11-781P6.1_ENST00000584722.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2588	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.L2588F(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GATTCCTGACCAAGGAGATGG	0.582																																							uc002knm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(7762-7764)TTG>TTT		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						151.0	127.0	135.0					18																	6959354		2203	4300	6503	SO:0001583	missense	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:6959354C>A	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7764G>T	18.37:g.6959354C>A	ENSP00000374309:p.Leu2588Phe		Somatic				LAMA1_uc002knk.2_5'Flank|LAMA1_uc002knl.2_Missense_Mutation_p.L41F|LAMA1_uc010wzj.1_Missense_Mutation_p.L2064F	p.L2588F	NM_005559	NP_005550	WXS	Illumina HiSeq	Unspecified	P25391	LAMA1_HUMAN			54	7858	-		Colorectal(10;0.172)	2588			Laminin G-like 3.			Missense_Mutation	SNP	ENST00000389658.3	37	c.7764G>T	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.811324	0.50527	.	.	ENSG00000101680	ENST00000389658;ENST00000344342	T	0.81078	-1.45	5.85	4.97	0.65823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.574458	0.15595	N	0.254225	D	0.87704	0.6244	M	0.82716	2.605	0.40637	D	0.981917	D	0.63880	0.993	D	0.63033	0.91	D	0.87906	0.2694	10	0.72032	D	0.01	.	7.4876	0.27443	0.1402:0.7259:0.0:0.1339	.	2588	P25391	LAMA1_HUMAN	F	2588;41	ENSP00000374309:L2588F	ENSP00000341000:L41F	L	-	3	2	LAMA1	6949354	0.727000	0.28069	0.773000	0.31616	0.485000	0.33311	0.609000	0.24238	2.753000	0.94483	0.655000	0.94253	TTG		0.582	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		20	90	1	0	8.10497e-08	0.010504	1.43188e-07	20	90				
SERPINB12	89777	broad.mit.edu	37	18	61233938	61233938	+	Silent	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr18:61233938G>T	ENST00000269491.1	+	7	912	c.912G>T	c.(910-912)ctG>ctT	p.L304L	SERPINB12_ENST00000382768.1_Silent_p.L324L	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	304					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						GGTTCACCCTGGAAGACAGCT	0.458																																							uc010xen.1		NA																	0					0						c.(910-912)CTG>CTT		serine (or cysteine) proteinase inhibitor, clade							186.0	182.0	183.0					18																	61233938		2203	4300	6503	SO:0001819	synonymous_variant	89777				negative regulation of protein catabolic process|regulation of proteolysis	cytoplasm	enzyme binding|serine-type endopeptidase inhibitor activity	g.chr18:61233938G>T	AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.912G>T	18.37:g.61233938G>T			Somatic				SERPINB12_uc010xeo.1_Silent_p.L324L	p.L304L	NM_080474	NP_536722	WXS	Illumina HiSeq	Unspecified	Q96P63	SPB12_HUMAN			7	912	+			304					Q3SYB4	Silent	SNP	ENST00000269491.1	37	c.912G>T	CCDS11984.1																																																																																				0.458	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256197.1	NM_080474		77	179	1	0	4.03997e-35	0.01441	9.91289e-35	77	179				
ZNF560	147741	broad.mit.edu	37	19	9577542	9577542	+	Missense_Mutation	SNP	C	C	T	rs148650284		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:9577542C>T	ENST00000301480.4	-	10	2294	c.2081G>A	c.(2080-2082)cGa>cAa	p.R694Q		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	694					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R694Q(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						CATGGAATTTCGAAAGGAATT	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		22168	0.0		0.001	False		,,,				2504	0.0						uc002mlp.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						c.(2080-2082)CGA>CAA		zinc finger protein 560		C	GLN/ARG	0,4406		0,0,2203	131.0	132.0	132.0		2081	-1.1	0.0	19	dbSNP_134	132	2,8598	2.2+/-6.3	0,2,4298	yes	missense	ZNF560	NM_152476.2	43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	694/791	9577542	2,13004	2203	4300	6503	SO:0001583	missense	147741				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9577542C>T	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.2081G>A	19.37:g.9577542C>T	ENSP00000301480:p.Arg694Gln		Somatic				ZNF560_uc010dwr.1_Missense_Mutation_p.R588Q	p.R694Q	NM_152476	NP_689689	WXS	Illumina HiSeq	Unspecified	Q96MR9	ZN560_HUMAN			10	2291	-			694					Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	c.2081G>A	CCDS12214.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	9.467	1.094536	0.20471	0.0	2.33E-4	ENSG00000198028	ENST00000301480	T	0.15718	2.4	1.5	-1.13	0.09775	.	.	.	.	.	T	0.16085	0.0387	L	0.52364	1.645	0.09310	N	1	D	0.64830	0.994	P	0.47102	0.537	T	0.15122	-1.0448	9	0.38643	T	0.18	.	4.0441	0.09764	0.0:0.3478:0.4721:0.1801	.	694	Q96MR9	ZN560_HUMAN	Q	694	ENSP00000301480:R694Q	ENSP00000301480:R694Q	R	-	2	0	ZNF560	9438542	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	-6.412000	0.00067	-0.217000	0.10033	0.462000	0.41574	CGA		0.378	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476		39	153	0	0	0	0.00623	0	39	153				
CACNA1A	773	broad.mit.edu	37	19	13339571	13339571	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:13339571C>T	ENST00000573710.2	-	37	5848	c.5570G>A	c.(5569-5571)cGa>cAa	p.R1857Q	CACNA1A_ENST00000574822.1_5'Flank|CACNA1A_ENST00000360228.5_Intron	NM_001127221.1	NP_001120693.1	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1857					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.R1857Q(2)|p.R1857L(2)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	AGATATTACTCGTAATAAACT	0.478																																							uc010dze.2		NA																	4	Substitution - Missense(4)		lung(4)	large_intestine(2)	2						c.(5569-5571)CGA>CAA		calcium channel, alpha 1A subunit isoform 3	Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)						69.0	62.0	64.0					19																	13339571		1568	3582	5150	SO:0001583	missense	773				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding	g.chr19:13339571C>T	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000573710.2:c.5570G>A	19.37:g.13339571C>T	ENSP00000460092:p.Arg1857Gln		Somatic				CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Missense_Mutation_p.R1382Q|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc002mwv.3_Missense_Mutation_p.R373Q	p.R1857Q	NM_001127221	NP_001120693	WXS	Illumina HiSeq	Unspecified	O00555	CAC1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		37	5806	-			1857			Cytoplasmic (Potential).		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000573710.2	37	c.5570G>A	CCDS45999.1	.	.	.	.	.	.	.	.	.	.	c	14.54	2.565066	0.45694	.	.	ENSG00000141837	ENST00000325084	.	.	.	4.04	2.98	0.34508	.	.	.	.	.	T	0.70902	0.3277	M	0.89414	3.03	0.44711	D	0.997701	D;D;P	0.57899	0.981;0.978;0.937	P;P;B	0.47626	0.552;0.497;0.331	T	0.76296	-0.3011	8	0.66056	D	0.02	.	11.8878	0.52613	0.1763:0.8237:0.0:0.0	.	1857;1862;1857	O00555;E9PD31;E7EVF2	CAC1A_HUMAN;.;.	Q	1857	.	ENSP00000317661:R1857Q	R	-	2	0	CACNA1A	13200571	1.000000	0.71417	0.992000	0.48379	0.961000	0.63080	7.717000	0.84732	0.661000	0.30985	0.298000	0.19748	CGA		0.478	CACNA1A-002	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439639.2	NM_000068		18	30	0	0	0	0.00333	0	18	30				
HCST	10870	broad.mit.edu	37	19	36393396	36393397	+	5'UTR	DNP	GG	GG	CA			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:36393396_36393397GG>CA	ENST00000246551.4	+	0	15_16				NFKBID_ENST00000606253.1_5'Flank|NFKBID_ENST00000396901.1_5'Flank|HCST_ENST00000437550.2_5'Flank|NFKBID_ENST00000585544.1_5'Flank|NFKBID_ENST00000352614.2_5'Flank			Q9UBK5	HCST_HUMAN	hematopoietic cell signal transducer						positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of immune response (GO:0050776)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase binding (GO:0043548)|receptor binding (GO:0005102)			lung(4)	4	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACACCAGCAGGGTGACATCCGC	0.584																																							uc002ocl.1		NA																	0					0						c.(-101--96)AGGGTG>AGCATG		hematopoietic cell signal transducer isoform 1																																				SO:0001623	5_prime_UTR_variant	10870				regulation of immune response	integral to membrane|plasma membrane		g.chr19:36393396_36393397GG>CA	AF072844	CCDS32998.1, CCDS46057.1	19q13.1	2009-05-07	2003-10-14	2003-10-15	ENSG00000126264	ENSG00000126264			16977	protein-coding gene	gene with protein product	"""DNAX-activation protein 10"", ""kinase assoc pro of ~10kDa"""	604089	"""phosphoinositide-3-kinase adaptor protein"""	PIK3AP		10426994	Standard	NM_014266		Approved	DAP10, DKFZP586C1522, KAP10	uc002ocl.1	Q9UBK5	OTTHUMG00000048132	Exception_encountered	19.37:g.36393396_36393397delinsCA			Somatic				NFKBID_uc002oci.1_5'Flank|NFKBID_uc002ocj.1_5'Flank|HCST_uc002ock.1_Translation_Start_Site		NM_014266	NP_055081	WXS	Illumina HiSeq	Unspecified	Q9UBK5	HCST_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		1	15_16	+	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)							Q9UBS1|Q9Y3Y0	Translation_Start_Site	DNP	ENST00000246551.4	37	c.-99_-98GG>CA	CCDS32998.1																																																																																				0.584	HCST-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109520.3	NM_014266		19	99	0	0	0	0.004672	0	19	99				
GGN	199720	broad.mit.edu	37	19	38876275	38876275	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:38876275A>C	ENST00000334928.6	-	3	1759	c.1627T>G	c.(1627-1629)Ttg>Gtg	p.L543V	GGN_ENST00000591809.1_Intron|AC005789.9_ENST00000585411.1_RNA|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	543	Interactions with ZNF403/GGNBP2 and OAZ3. {ECO:0000250}.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)		p.L543V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TCTCCATGCAAGCCATCCTTA	0.687																																							uc002oij.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1627-1629)TTG>GTG		gametogenetin							50.0	46.0	47.0					19																	38876275		2203	4300	6503	SO:0001583	missense	199720				cell differentiation|multicellular organismal development|spermatogenesis			g.chr19:38876275A>C	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1627T>G	19.37:g.38876275A>C	ENSP00000334940:p.Leu543Val		Somatic				GGN_uc002oik.1_Intron|GGN_uc010efy.1_Intron	p.L543V	NM_152657	NP_689870	WXS	Illumina HiSeq	Unspecified	Q86UU5	GGN_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		3	1762	-	all_cancers(60;3.4e-06)		543			Interactions with ZNF403/GGNBP2 and OAZ3 (By similarity).		Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	37	c.1627T>G	CCDS12516.1	.	.	.	.	.	.	.	.	.	.	A	11.57	1.677302	0.29783	.	.	ENSG00000179168	ENST00000334928	.	.	.	3.57	-1.81	0.07882	.	0.853486	0.09698	N	0.767482	T	0.16685	0.0401	N	0.14661	0.345	0.09310	N	1	B	0.20780	0.048	B	0.17098	0.017	T	0.21177	-1.0253	9	0.28530	T	0.3	2.7397	3.107	0.06345	0.2031:0.3741:0.0:0.4228	.	543	Q86UU5	GGN_HUMAN	V	543	.	ENSP00000334940:L543V	L	-	1	2	GGN	43568115	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.998000	0.03701	-0.605000	0.05753	-0.714000	0.03626	TTG		0.687	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657		6	52	0	0	0	0.001984	0	6	52				
RYR1	6261	broad.mit.edu	37	19	38976748	38976748	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:38976748C>G	ENST00000359596.3	+	34	5453	c.5453C>G	c.(5452-5454)gCg>gGg	p.A1818G	RYR1_ENST00000360985.3_Missense_Mutation_p.A1818G|RYR1_ENST00000355481.4_Missense_Mutation_p.A1818G			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1818	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.A1818G(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTGGGGGAGGCGGTGCGCGAC	0.706																																							uc002oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(5452-5454)GCG>GGG		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						52.0	52.0	52.0					19																	38976748		2201	4292	6493	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38976748C>G	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5453C>G	19.37:g.38976748C>G	ENSP00000352608:p.Ala1818Gly		Somatic				RYR1_uc002oiu.2_Missense_Mutation_p.A1818G	p.A1818G	NM_000540	NP_000531	WXS	Illumina HiSeq	Unspecified	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		34	5583	+	all_cancers(60;7.91e-06)		1818			Cytoplasmic.|6 X approximate repeats.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.5453C>G	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646336	0.67358	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.75260	-0.92;-0.92;-0.92	3.7	3.7	0.42460	.	0.000000	0.64402	U	0.000005	D	0.85318	0.5669	M	0.81341	2.54	0.52099	D	0.99994	D;P	0.76494	0.999;0.661	D;B	0.68039	0.955;0.318	D	0.88162	0.2858	10	0.72032	D	0.01	.	15.2171	0.73277	0.0:1.0:0.0:0.0	.	1818;1818	P21817-2;P21817	.;RYR1_HUMAN	G	1818	ENSP00000352608:A1818G;ENSP00000347667:A1818G;ENSP00000354254:A1818G	ENSP00000347667:A1818G	A	+	2	0	RYR1	43668588	1.000000	0.71417	0.992000	0.48379	0.898000	0.52572	5.840000	0.69402	1.886000	0.54624	0.585000	0.79938	GCG		0.706	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			35	74	0	0	0	0.003755	0	35	74				
CYP2S1	29785	broad.mit.edu	37	19	41703808	41703808	+	Silent	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:41703808G>T	ENST00000310054.4	+	3	684	c.468G>T	c.(466-468)ctG>ctT	p.L156L	CYP2S1_ENST00000542619.1_Intron	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1	156					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.L156L(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						CCCGGTGTCTGGTGGAGACAT	0.632																																							uc002opw.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(466-468)CTG>CTT		cytochrome P450, family 2, subfamily S,							49.0	49.0	49.0					19																	41703808		2203	4300	6503	SO:0001819	synonymous_variant	29785				xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity	g.chr19:41703808G>T	AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.468G>T	19.37:g.41703808G>T			Somatic				CYP2F1_uc010xvw.1_Intron|CYP2S1_uc010xvx.1_Intron	p.L156L	NM_030622	NP_085125	WXS	Illumina HiSeq	Unspecified	Q96SQ9	CP2S1_HUMAN			3	523	+			156					Q9BZ66	Silent	SNP	ENST00000310054.4	37	c.468G>T	CCDS12573.1																																																																																				0.632	CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463287.1			6	33	1	0	4.096e-09	0.001168	7.59049e-09	6	33				
SHANK1	50944	broad.mit.edu	37	19	51215303	51215303	+	Silent	SNP	C	C	T	rs201562791		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:51215303C>T	ENST00000293441.1	-	6	879	c.861G>A	c.(859-861)acG>acA	p.T287T	SHANK1_ENST00000359082.3_Silent_p.T287T|SHANK1_ENST00000391814.1_Silent_p.T287T	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	287					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.T287T(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CCACCATGGCCGTGTGGAACA	0.617																																							uc002psx.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)	2						c.(859-861)ACG>ACA		SH3 and multiple ankyrin repeat domains 1							62.0	64.0	63.0					19																	51215303		2203	4300	6503	SO:0001819	synonymous_variant	50944				cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding	g.chr19:51215303C>T	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.861G>A	19.37:g.51215303C>T			Somatic					p.T287T	NM_016148	NP_057232	WXS	Illumina HiSeq	Unspecified	Q9Y566	SHAN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)	6	880	-		all_neural(266;0.057)	287			ANK 3.		A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	ENST00000293441.1	37	c.861G>A	CCDS12799.1																																																																																				0.617	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148		5	56	0	0	0	0.000602	0	5	56				
ZNF160	90338	broad.mit.edu	37	19	53572754	53572754	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:53572754C>G	ENST00000429604.1	-	7	1448	c.1033G>C	c.(1033-1035)Gag>Cag	p.E345Q	ZNF160_ENST00000418871.1_Missense_Mutation_p.E345Q|ZNF160_ENST00000599056.1_Missense_Mutation_p.E345Q|ZNF160_ENST00000601421.1_Missense_Mutation_p.E309Q	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	345					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E345Q(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		TTTCCACACTCATTACACTTG	0.403																																							uc010eqk.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1033-1035)GAG>CAG		zinc finger protein 160							85.0	86.0	86.0					19																	53572754		2203	4300	6503	SO:0001583	missense	90338				hemopoiesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53572754C>G	X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.1033G>C	19.37:g.53572754C>G	ENSP00000406201:p.Glu345Gln		Somatic				ZNF160_uc002qaq.3_Missense_Mutation_p.E345Q|ZNF160_uc002qar.3_Missense_Mutation_p.E345Q	p.E345Q	NM_001102603	NP_001096073	WXS	Illumina HiSeq	Unspecified	Q9HCG1	ZN160_HUMAN		GBM - Glioblastoma multiforme(134;0.02)	7	1449	-			345			C2H2-type 4.		Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	ENST00000429604.1	37	c.1033G>C	CCDS12859.1	.	.	.	.	.	.	.	.	.	.	C	9.307	1.054520	0.19907	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.07444	3.19;3.19	2.47	0.831	0.18860	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12008	0.0292	N	0.12502	0.225	0.09310	N	1	D	0.76494	0.999	D	0.73708	0.981	T	0.35276	-0.9795	9	0.44086	T	0.13	.	10.7655	0.46291	0.0:0.6777:0.3222:0.0	.	345	Q9HCG1	ZN160_HUMAN	Q	345	ENSP00000406201:E345Q;ENSP00000409597:E345Q	ENSP00000409597:E345Q	E	-	1	0	ZNF160	58264566	0.000000	0.05858	0.015000	0.15790	0.157000	0.22087	-1.674000	0.01949	0.322000	0.23283	0.561000	0.74099	GAG		0.403	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2	NM_033288		9	75	0	0	0	0.004482	0	9	75				
ZIM3	114026	broad.mit.edu	37	19	57647012	57647012	+	Silent	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:57647012G>T	ENST00000269834.1	-	5	1078	c.693C>A	c.(691-693)gcC>gcA	p.A231A	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	231					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A231A(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCTGCTTGTAGGCATTTCCAC	0.408																																							uc002qnz.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)|skin(1)	2						c.(691-693)GCC>GCA		zinc finger, imprinted 3							141.0	137.0	138.0					19																	57647012		2203	4300	6503	SO:0001819	synonymous_variant	114026				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57647012G>T	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.693C>A	19.37:g.57647012G>T			Somatic					p.A231A	NM_052882	NP_443114	WXS	Illumina HiSeq	Unspecified	Q96PE6	ZIM3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	5	1079	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)	231			C2H2-type 3.		Q14CA6	Silent	SNP	ENST00000269834.1	37	c.693C>A	CCDS33125.1																																																																																				0.408	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1			28	136	1	0	1.75199e-13	0.007291	3.71421e-13	28	136				
ZNF547	284306	broad.mit.edu	37	19	57883173	57883174	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:57883173_57883174GG>TT	ENST00000282282.3	+	3	198_199	c.48_49GG>TT	c.(46-51)gtGGcc>gtTTcc	p.A17S	AC003002.4_ENST00000597658.1_Missense_Mutation_p.A17S	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A17S(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTGAAGACGTGGCCATATATTT	0.431																																							uc002qol.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(46-51)GTGGCC>GTTTCC		zinc finger protein 547																																				SO:0001583	missense	284306				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57883173_57883174GG>TT	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		Exception_encountered	19.37:g.57883173_57883174delinsTT	ENSP00000282282:p.Ala17Ser		Somatic				ZNF547_uc010ygx.1_Missense_Mutation_p.A17S	p.A17S	NM_173631	NP_775902	WXS	Illumina HiSeq	Unspecified	Q8IVP9	ZN547_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	3	241_242	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)	17			KRAB.		A8K5Z9|Q96NC4	Missense_Mutation	DNP	ENST00000282282.3	37	c.48_49GG>TT	CCDS33131.1																																																																																				0.431	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465787.1	NM_173631		35	226	0	0	0	0.004672	0	35	226				
KIF3C	3797	broad.mit.edu	37	2	26151869	26151869	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr2:26151869G>T	ENST00000264712.3	-	8	2939	c.2360C>A	c.(2359-2361)gCa>gAa	p.A787E	KIF3C_ENST00000405914.1_Missense_Mutation_p.A787E|KIF3C_ENST00000496378.1_5'Flank	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	787	Globular. {ECO:0000255}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.A787E(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGCCACTGTTGCAGGGCGCAG	0.622																																							uc002rgu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2359-2361)GCA>GAA		kinesin family member 3C							104.0	91.0	95.0					2																	26151869		2203	4300	6503	SO:0001583	missense	3797				blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity	g.chr2:26151869G>T		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.2360C>A	2.37:g.26151869G>T	ENSP00000264712:p.Ala787Glu		Somatic				KIF3C_uc010eyj.1_RNA|KIF3C_uc010ykr.1_Missense_Mutation_p.A785E	p.A787E	NM_002254	NP_002245	WXS	Illumina HiSeq	Unspecified	O14782	KIF3C_HUMAN			8	3017	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		787			Globular (Potential).		O43544|Q4ZG18|Q53SX5|Q562F7	Missense_Mutation	SNP	ENST00000264712.3	37	c.2360C>A	CCDS1719.1	.	.	.	.	.	.	.	.	.	.	G	5.658	0.305961	0.10733	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	T;T	0.73363	-0.74;-0.74	5.58	4.71	0.59529	.	0.828503	0.10914	N	0.620205	T	0.52517	0.1739	N	0.03608	-0.345	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.09377	0.004;0.004	T	0.33523	-0.9865	10	0.19590	T	0.45	.	12.4848	0.55866	0.0813:0.0:0.9186:0.0	.	785;787	B7ZM25;O14782	.;KIF3C_HUMAN	E	787;593;787	ENSP00000264712:A787E;ENSP00000385030:A787E	ENSP00000264712:A787E	A	-	2	0	KIF3C	26005373	0.642000	0.27260	0.002000	0.10522	0.001000	0.01503	4.880000	0.63107	1.359000	0.45940	-0.448000	0.05591	GCA		0.622	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1			12	95	1	0	1.99824e-07	0.00499	3.41634e-07	12	95				
THUMPD2	80745	broad.mit.edu	37	2	39988520	39988520	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr2:39988520C>A	ENST00000505747.1	-	6	869	c.842G>T	c.(841-843)gGa>gTa	p.G281V	THUMPD2_ENST00000260619.6_Missense_Mutation_p.G251V|THUMPD2_ENST00000454352.2_3'UTR	NM_025264.4	NP_079540.2	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2	281							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.G251V(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	17		all_hematologic(82;0.248)				AGATCGCAGTCCAGCTGTCTT	0.363																																							uc002rru.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(841-843)GGA>GTA		THUMP domain containing 2							177.0	176.0	177.0					2																	39988520		2203	4300	6503	SO:0001583	missense	80745						methyltransferase activity	g.chr2:39988520C>A	AF380576	CCDS1805.1, CCDS1805.2	2p22.2	2004-06-04	2004-06-04	2004-06-04	ENSG00000138050	ENSG00000138050			14890	protein-coding gene	gene with protein product		611751	"""chromosome 2 open reading frame 8"""	C2orf8		12063391	Standard	NM_025264		Approved	MGC2454	uc002rru.2	Q9BTF0	OTTHUMG00000102149	ENST00000505747.1:c.842G>T	2.37:g.39988520C>A	ENSP00000423933:p.Gly281Val		Somatic				THUMPD2_uc002rrv.2_RNA|THUMPD2_uc010ynt.1_Missense_Mutation_p.G172V|THUMPD2_uc010ynu.1_3'UTR	p.G281V	NM_025264	NP_079540	WXS	Illumina HiSeq	Unspecified	Q9BTF0	THUM2_HUMAN			6	879	-		all_hematologic(82;0.248)	281					A8K7I7|Q53TT8|Q53TV0	Missense_Mutation	SNP	ENST00000505747.1	37	c.842G>T	CCDS1805.2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154589	0.78114	.	.	ENSG00000138050	ENST00000505747;ENST00000260619	T;T	0.29397	1.57;1.57	5.64	5.64	0.86602	Putative RNA methylase (1);	0.000000	0.85682	D	0.000000	T	0.55924	0.1951	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.55023	-0.8205	9	.	.	.	.	15.2013	0.73139	0.0:1.0:0.0:0.0	.	172;281	B4DP37;Q9BTF0	.;THUM2_HUMAN	V	281;251	ENSP00000423933:G281V;ENSP00000260619:G251V	.	G	-	2	0	THUMPD2	39842024	0.999000	0.42202	0.779000	0.31741	0.937000	0.57800	5.745000	0.68672	2.637000	0.89404	0.563000	0.77884	GGA		0.363	THUMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219991.2	NM_025264		25	233	1	0	1.12875e-08	0.00632	2.06289e-08	25	233				
CNGA3	1261	broad.mit.edu	37	2	99012411	99012411	+	Missense_Mutation	SNP	G	G	C	rs374258471		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr2:99012411G>C	ENST00000272602.2	+	7	817	c.778G>C	c.(778-780)Gac>Cac	p.D260H	CNGA3_ENST00000436404.2_Missense_Mutation_p.D242H|CNGA3_ENST00000393504.1_Missense_Mutation_p.D260H|CNGA3_ENST00000409937.1_Missense_Mutation_p.D264H			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	260			D -> N (in ACHM2; also found in patients with cone-rod dystrophy). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:24903488}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.D260H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GGTCCCCACCGACCTGGCTTA	0.517																																							uc002syt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(1)	6	GRCh37	CM014536	CNGA3	M		c.(778-780)GAC>CAC		cyclic nucleotide gated channel alpha 3 isoform							101.0	96.0	98.0					2																	99012411		2203	4300	6503	SO:0001583	missense	1261				signal transduction|visual perception	integral to membrane	cGMP binding	g.chr2:99012411G>C	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.778G>C	2.37:g.99012411G>C	ENSP00000272602:p.Asp260His		Somatic				CNGA3_uc002syu.2_Missense_Mutation_p.D242H|CNGA3_uc010fij.2_Missense_Mutation_p.D264H	p.D260H	NM_001298	NP_001289	WXS	Illumina HiSeq	Unspecified	Q16281	CNGA3_HUMAN			8	1195	+			260		D -> N (in ACHM2).			E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	c.778G>C	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.809981	0.70797	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98	5.29	5.29	0.74685	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99387	0.9784	H	0.97240	3.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.98490	1.0609	10	0.87932	D	0	.	17.8538	0.88756	0.0:0.0:1.0:0.0	.	264;242;260	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	H	260;242;260;264	ENSP00000377140:D260H;ENSP00000410070:D242H;ENSP00000272602:D260H;ENSP00000386761:D264H	ENSP00000272602:D260H	D	+	1	0	CNGA3	98378843	1.000000	0.71417	0.969000	0.41365	0.757000	0.42996	9.263000	0.95617	2.757000	0.94681	0.462000	0.41574	GAC		0.517	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298		12	76	0	0	0	0.00245	0	12	76				
TMEM177	80775	broad.mit.edu	37	2	120438630	120438630	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr2:120438630G>T	ENST00000424086.1	+	2	674	c.201G>T	c.(199-201)gaG>gaT	p.E67D	TMEM177_ENST00000409951.1_Missense_Mutation_p.E67D|TMEM177_ENST00000401466.1_Missense_Mutation_p.E67D|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000272521.6_Missense_Mutation_p.E67D	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	67						integral component of membrane (GO:0016021)		p.E67D(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					TCTTCCAAGAGGTGCTACAGG	0.592																																							uc010flg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(199-201)GAG>GAT		transmembrane protein 177							152.0	150.0	150.0					2																	120438630		2203	4300	6503	SO:0001583	missense	80775					integral to membrane		g.chr2:120438630G>T	BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.201G>T	2.37:g.120438630G>T	ENSP00000402661:p.Glu67Asp		Somatic				TMEM177_uc002tme.2_Intron|TMEM177_uc002tmc.1_Missense_Mutation_p.E67D|TMEM177_uc002tmd.2_Missense_Mutation_p.E67D|TMEM177_uc010flh.2_Missense_Mutation_p.E67D	p.E67D	NM_001105198	NP_001098668	WXS	Illumina HiSeq	Unspecified	Q53S58	TM177_HUMAN			2	674	+	Colorectal(110;0.196)		67					Q9BT20	Missense_Mutation	SNP	ENST00000424086.1	37	c.201G>T	CCDS2128.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.781439	0.31502	.	.	ENSG00000144120	ENST00000401466;ENST00000424086;ENST00000272521;ENST00000445518;ENST00000409951;ENST00000415646	T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2	4.48	2.58	0.30949	.	0.165185	0.51477	D	0.000096	T	0.34483	0.0899	M	0.62723	1.935	0.46774	D	0.999192	D;D	0.71674	0.998;0.994	D;P	0.66716	0.946;0.888	T	0.04128	-1.0975	10	0.36615	T	0.2	-19.7224	6.1031	0.20059	0.3422:0.0:0.6578:0.0	.	67;67	B8ZZT5;Q53S58	.;TM177_HUMAN	D	67	ENSP00000385966:E67D;ENSP00000402661:E67D;ENSP00000272521:E67D;ENSP00000405898:E67D;ENSP00000386430:E67D	ENSP00000272521:E67D	E	+	3	2	TMEM177	120155100	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	0.539000	0.23175	0.574000	0.29417	0.549000	0.68633	GAG		0.592	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577		65	150	1	0	1.34159e-35	0.01441	3.32264e-35	65	150				
WDR33	55339	broad.mit.edu	37	2	128481960	128481960	+	Silent	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr2:128481960C>A	ENST00000322313.4	-	11	1301	c.1143G>T	c.(1141-1143)ctG>ctT	p.L381L		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	381					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L381L(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		GATGCCAAGCCAGACTCCAGA	0.448																																							uc002tpg.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1141-1143)CTG>CTT		WD repeat domain 33 isoform 1							132.0	119.0	123.0					2																	128481960		2203	4300	6503	SO:0001819	synonymous_variant	55339				postreplication repair|spermatogenesis	collagen|nucleus	protein binding	g.chr2:128481960C>A		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.1143G>T	2.37:g.128481960C>A			Somatic					p.L381L	NM_018383	NP_060853	WXS	Illumina HiSeq	Unspecified	Q9C0J8	WDR33_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0695)	11	1326	-	Colorectal(110;0.1)		381			WD 7.		Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Silent	SNP	ENST00000322313.4	37	c.1143G>T	CCDS2150.1																																																																																				0.448	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383		13	87	1	0	1.5842e-08	0.001855	2.85587e-08	13	87				
SLC4A10	57282	broad.mit.edu	37	2	162807357	162807357	+	Splice_Site	SNP	A	A	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr2:162807357A>T	ENST00000446997.1	+	19	2633	c.2540A>T	c.(2539-2541)aAg>aTg	p.K847M	SLC4A10_ENST00000272716.5_Splice_Site_p.K817M|SLC4A10_ENST00000375514.5_Splice_Site_p.K828M|SLC4A10_ENST00000421911.1_Splice_Site_p.K847M|SLC4A10_ENST00000415876.2_Splice_Site_p.K817M	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	847					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)	p.K847M(1)|p.K817M(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	CATAAGCTAAAGGTATATTTT	0.308																																							uc002ubx.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(2)|pancreas(1)	5						c.(2539-2541)AAG>ATG		solute carrier family 4, sodium bicarbonate							45.0	42.0	43.0					2																	162807357		1823	4081	5904	SO:0001630	splice_region_variant	57282				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity	g.chr2:162807357A>T		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.2541+1A>T	2.37:g.162807357A>T			Somatic				SLC4A10_uc002uby.3_Missense_Mutation_p.K817M|SLC4A10_uc010zcs.1_Missense_Mutation_p.K828M	p.K847M	NM_022058	NP_071341	WXS	Illumina HiSeq	Unspecified	Q6U841	S4A10_HUMAN			19	2724	+			847			Cytoplasmic (Potential).		B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	c.2540A>T	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.742165	0.89573	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43	5.98	5.98	0.97165	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91727	0.7384	M	0.91717	3.235	0.80722	D	1	D;D;D	0.89917	0.997;0.997;1.0	D;D;D	0.74023	0.962;0.962;0.982	D	0.93281	0.6660	10	0.72032	D	0.01	.	16.4696	0.84102	1.0:0.0:0.0:0.0	.	828;817;847	F8W675;Q6U841-2;Q6U841	.;.;S4A10_HUMAN	M	828;817;817;816;847;847;846	ENSP00000364664:K828M;ENSP00000395797:K817M;ENSP00000272716:K817M;ENSP00000393066:K847M;ENSP00000404486:K847M	ENSP00000272716:K817M	K	+	2	0	SLC4A10	162515603	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.339000	0.96797	2.289000	0.77006	0.482000	0.46254	AAG		0.308	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	Missense_Mutation	6	13	0	0	0	0.001984	0	6	13				
XIRP2	129446	broad.mit.edu	37	2	167992572	167992573	+	Splice_Site	DNP	GG	GG	TT			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr2:167992572_167992573GG>TT	ENST00000409728.1	+	3	651	c.562_562GG>TT	c.(562-564)GGgc>TTggc	p.G188L	XIRP2_ENST00000420519.1_Splice_Site_p.G188L|XIRP2_ENST00000409756.2_Splice_Site_p.G188L|XIRP2_ENST00000295237.9_Splice_Site_p.G188L|XIRP2-AS1_ENST00000525330.1_RNA|XIRP2_ENST00000409043.1_Splice_Site_p.G188L|XIRP2_ENST00000409195.1_Splice_Site_p.G188L	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	13					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.?(2)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CATCTTTGAAGGTTAGCATAAC	0.366																																							uc002udx.2		NA																	2	Unknown(2)		lung(2)	skin(7)|ovary(6)|pancreas(1)	14						c.e2+1		xin actin-binding repeat containing 2 isoform 1																																				SO:0001630	splice_region_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:167992572_167992573GG>TT	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	Exception_encountered	2.37:g.167992572_167992573delinsTT			Somatic				XIRP2_uc010fpn.2_Splice_Site_p.A188_splice|XIRP2_uc010fpo.2_Splice_Site_p.A188_splice|XIRP2_uc010fpp.2_Splice_Site_p.A188_splice|XIRP2_uc002udy.2_Splice_Site_p.A13_splice	p.A188_splice	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			2	580	+								A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Splice_Site	DNP	ENST00000409728.1	37	c.562_splice	CCDS56143.1																																																																																				0.366	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	Missense_Mutation	5	54	0	0	0	0.004672	0	5	54				
DNAH7	56171	broad.mit.edu	37	2	196636407	196636407	+	Missense_Mutation	SNP	C	C	A	rs113133988		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr2:196636407C>A	ENST00000312428.6	-	61	11510	c.11410G>T	c.(11410-11412)Gta>Tta	p.V3804L	DNAH7_ENST00000409063.1_Missense_Mutation_p.V287L	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3804					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.V3804L(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TGAATATTTACGCACGAATCT	0.353																																							uc002utj.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(10)|ovary(2)	12						c.(11410-11412)GTA>TTA		dynein, axonemal, heavy chain 7							192.0	171.0	177.0					2																	196636407		1855	4108	5963	SO:0001583	missense	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196636407C>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.11410G>T	2.37:g.196636407C>A	ENSP00000311273:p.Val3804Leu		Somatic				DNAH7_uc002uti.3_Missense_Mutation_p.V287L	p.V3804L	NM_018897	NP_061720	WXS	Illumina HiSeq	Unspecified	Q8WXX0	DYH7_HUMAN			61	11511	-			3804					B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	c.11410G>T	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	2.918	-0.223798	0.06061	.	.	ENSG00000118997	ENST00000312428;ENST00000409063	T;T	0.08282	3.11;3.11	5.08	1.31	0.21738	Dynein heavy chain (1);	0.376328	0.26812	N	0.022363	T	0.08268	0.0206	L	0.55213	1.73	0.80722	D	1	B	0.18968	0.032	B	0.28465	0.09	T	0.22173	-1.0224	10	0.27785	T	0.31	.	5.1725	0.15118	0.1239:0.2148:0.0:0.6613	.	3804	Q8WXX0	DYH7_HUMAN	L	3804;287	ENSP00000311273:V3804L;ENSP00000386912:V287L	ENSP00000311273:V3804L	V	-	1	0	DNAH7	196344652	0.002000	0.14202	0.528000	0.27938	0.073000	0.16967	-0.822000	0.04448	0.063000	0.16370	-0.294000	0.09567	GTA		0.353	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		21	138	1	0	1.10513e-12	0.014323	2.25277e-12	21	138				
BOLL	66037	broad.mit.edu	37	2	198646540	198646541	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr2:198646540_198646541GG>TT	ENST00000392296.4	-	2	343_344	c.34_35CC>AA	c.(34-36)CCt>AAt	p.P12N	BOLL_ENST00000433157.1_Missense_Mutation_p.P12N|BOLL_ENST00000282278.8_De_novo_Start_InFrame|BOLL_ENST00000321801.7_Missense_Mutation_p.P24N|BOLL_ENST00000430004.1_Missense_Mutation_p.P12N	NM_033030.5	NP_149019.1	Q8N9W6	BOLL_HUMAN	boule-like RNA-binding protein	12					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)	p.P24N(1)|p.P12N(1)		central_nervous_system(1)|endometrium(2)|lung(6)|ovary(3)|prostate(1)	13						AGGTGACACAGGATTAGGGGAT	0.396																																							uc002uus.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(34-36)CCT>AAT		boule isoform 2																																				SO:0001583	missense	66037				cell differentiation|meiosis|multicellular organismal development|positive regulation of translational initiation|spermatogenesis	cytoplasm	nucleotide binding|protein binding|RNA binding|translation activator activity	g.chr2:198646540_198646541GG>TT		CCDS2324.1, CCDS2325.1, CCDS63081.1	2q33	2013-10-17	2013-10-17		ENSG00000152430	ENSG00000152430		"""RNA binding motif (RRM) containing"""	14273	protein-coding gene	gene with protein product		606165	"""bol (Drosophila boule homolog)-like"", ""bol, boule-like (Drosophila)"""			11390979, 16001084	Standard	NM_197970		Approved	BOULE	uc002uut.2	Q8N9W6	OTTHUMG00000132747	ENST00000392296.4:c.34_35delinsTT	2.37:g.198646540_198646541delinsTT	ENSP00000376116:p.Pro12Asn		Somatic				BOLL_uc002uur.2_Missense_Mutation_p.P18N|BOLL_uc002uut.2_Missense_Mutation_p.P24N|BOLL_uc010zha.1_Translation_Start_Site|BOLL_uc002uuu.1_Missense_Mutation_p.P18N	p.P12N	NM_033030	NP_149019	WXS	Illumina HiSeq	Unspecified	Q8N9W6	BOLL_HUMAN			2	344_345	-			12					B4DZA4|Q0JW32|Q53T62|Q969U3	Missense_Mutation	DNP	ENST00000392296.4	37	c.34_35CC>AA	CCDS2325.1																																																																																				0.396	BOLL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256107.3	NM_033030		17	104	0	0	0	0.004672	0	17	104				
SP100	6672	broad.mit.edu	37	2	231327148	231327148	+	Splice_Site	SNP	A	A	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr2:231327148A>T	ENST00000264052.5	+	10	1328		c.e10-1		SP100_ENST00000409824.1_Splice_Site|SP100_ENST00000427101.2_Splice_Site|SP100_ENST00000341950.4_Splice_Site|SP100_ENST00000409112.1_Splice_Site|SP100_ENST00000409341.1_Splice_Site|SP100_ENST00000340126.4_Splice_Site|SP100_ENST00000409897.1_Splice_Site	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen						cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.?(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TCCTTTGTGCAGTCATCAGCA	0.498																																							uc002vqt.2		NA																	2	Unknown(2)		lung(2)	ovary(4)|central_nervous_system(1)	5						c.e10-2		nuclear antigen Sp100 isoform 2							114.0	100.0	104.0					2																	231327148		2203	4300	6503	SO:0001630	splice_region_variant	6672				DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding	g.chr2:231327148A>T	AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.974-1A>T	2.37:g.231327148A>T			Somatic				SP100_uc002vqs.2_Splice_Site_p.V325_splice|SP100_uc002vqu.1_Splice_Site_p.V325_splice|SP100_uc010zmb.1_Splice_Site_p.V325_splice|SP100_uc002vqq.1_Splice_Site_p.V325_splice|SP100_uc002vqr.1_Splice_Site_p.V300_splice|SP100_uc010zmc.1_Splice_Site_p.V300_splice|SP100_uc002vqv.1_Splice_Site_p.V289_splice	p.V325_splice	NM_003113	NP_003104	WXS	Illumina HiSeq	Unspecified	P23497	SP100_HUMAN		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)	10	1115	+		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)						B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Splice_Site	SNP	ENST00000264052.5	37	c.974_splice	CCDS2477.1	.	.	.	.	.	.	.	.	.	.	A	1.406	-0.576819	0.03854	.	.	ENSG00000067066	ENST00000264052;ENST00000427101;ENST00000409824;ENST00000409341;ENST00000409112;ENST00000340126;ENST00000341950;ENST00000409897	.	.	.	3.94	2.78	0.32641	.	.	.	.	.	.	.	.	.	.	.	0.49915	D	0.999838	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1142	0.20117	0.8851:0.0:0.1149:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SP100	231035392	0.505000	0.26131	0.513000	0.27749	0.015000	0.08874	2.239000	0.43079	0.862000	0.35528	0.528000	0.53228	.		0.498	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113	Intron	16	51	0	0	0	0.00499	0	16	51				
FRG1B	284802	broad.mit.edu	37	20	29614328	29614328	+	Splice_Site	SNP	G	G	A	rs200267032		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr20:29614328G>A	ENST00000278882.3	+	2	320		c.e2+1		FRG1B_ENST00000358464.4_Splice_Site|FRG1B_ENST00000439954.2_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGATACGTTGGTGAGTCAGTT	0.289																																							uc010ztk.1		NA																	0					0						c.e1+1		RecName: Full=Protein FRG1B;																																				SO:0001630	splice_region_variant	284802							g.chr20:29614328G>A			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-61+1G>A	20.37:g.29614328G>A			Somatic				FRG1B_uc002wvm.1_Splice_Site|FRG1B_uc010ztj.1_Splice_Site|FRG1B_uc010gdr.1_Splice_Site				WXS	Illumina HiSeq	Unspecified					1	67	+								C4AME5	Splice_Site	SNP	ENST00000278882.3	37	c.-6_splice																																																																																					0.289	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	Intron	5	59	0	0	0	0.000602	0	5	59				
SLC32A1	140679	broad.mit.edu	37	20	37356236	37356236	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr20:37356236G>T	ENST00000217420.1	+	2	795	c.532G>T	c.(532-534)Gag>Tag	p.E178*		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	178					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.E178*(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	TGAAGACGGCGAGGTGGTGCG	0.637																																							uc002xjc.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(532-534)GAG>TAG		solute carrier family 32, member 1	Glycine(DB00145)						79.0	63.0	68.0					20																	37356236		2203	4300	6503	SO:0001587	stop_gained	140679				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity	g.chr20:37356236G>T	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.532G>T	20.37:g.37356236G>T	ENSP00000217420:p.Glu178*		Somatic					p.E178*	NM_080552	NP_542119	WXS	Illumina HiSeq	Unspecified	Q9H598	VIAAT_HUMAN			2	795	+		Myeloproliferative disorder(115;0.00878)	178			Lumenal, vesicle (Potential).		Q8N489	Nonsense_Mutation	SNP	ENST00000217420.1	37	c.532G>T	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	G	37	6.235027	0.97399	.	.	ENSG00000101438	ENST00000217420	.	.	.	4.13	3.16	0.36331	.	0.058315	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-13.9018	11.7879	0.52053	0.0:0.1796:0.8204:0.0	.	.	.	.	X	178	.	ENSP00000217420:E178X	E	+	1	0	SLC32A1	36789650	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.814000	0.62627	1.081000	0.41110	-0.302000	0.09304	GAG		0.637	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552		7	37	1	0	1.06961e-07	0.00308	1.86479e-07	7	37				
PLCG1	5335	broad.mit.edu	37	20	39788290	39788290	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr20:39788290C>T	ENST00000373271.1	+	2	667	c.262C>T	c.(262-264)Cgg>Tgg	p.R88W	PLCG1_ENST00000244007.3_Missense_Mutation_p.R88W|PLCG1_ENST00000373272.2_Missense_Mutation_p.R88W	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	88	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				GAAGACCTCACGGGACTTTGA	0.512																																							uc002xjp.1		NA																	0				lung(3)|breast(3)|skin(2)	8						c.(262-264)CGG>TGG		phospholipase C, gamma 1 isoform b							80.0	82.0	82.0					20																	39788290		2203	4300	6503	SO:0001583	missense	5335				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity	g.chr20:39788290C>T	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.262C>T	20.37:g.39788290C>T	ENSP00000362368:p.Arg88Trp		Somatic				PLCG1_uc002xjo.1_Missense_Mutation_p.R88W	p.R88W	NM_182811	NP_877963	WXS	Illumina HiSeq	Unspecified	P19174	PLCG1_HUMAN			2	383	+		Myeloproliferative disorder(115;0.00878)	88			PH 1.		B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	ENST00000373271.1	37	c.262C>T	CCDS13314.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284733	0.80803	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.65732	-0.17;-0.17;-0.17	5.07	4.1	0.47936	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.76666	0.4019	M	0.76574	2.34	0.58432	D	0.999999	D;D	0.69078	0.997;0.997	D;D	0.70487	0.961;0.969	T	0.79215	-0.1895	10	0.87932	D	0	.	12.4738	0.55801	0.3045:0.6955:0.0:0.0	.	88;88	P19174;A2A284	PLCG1_HUMAN;.	W	88	ENSP00000244007:R88W;ENSP00000362368:R88W;ENSP00000362369:R88W	ENSP00000244007:R88W	R	+	1	2	PLCG1	39221704	0.967000	0.33354	0.997000	0.53966	0.978000	0.69477	2.304000	0.43655	1.090000	0.41315	0.650000	0.86243	CGG		0.512	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3	NM_182811		12	49	0	0	0	0.010729	0	12	49				
PREX1	57580	broad.mit.edu	37	20	47296209	47296209	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr20:47296209G>C	ENST00000371941.3	-	12	1541	c.1519C>G	c.(1519-1521)Ctg>Gtg	p.L507V	PREX1_ENST00000396220.1_Missense_Mutation_p.L507V	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	507					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L507V(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			ATGTCCTCCAGCTCACTTCGG	0.592																																							uc002xtw.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(2)|pancreas(1)	6						c.(1519-1521)CTG>GTG		phosphatidylinositol-3,4,							165.0	126.0	140.0					20																	47296209		2203	4300	6503	SO:0001583	missense	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47296209G>C	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1519C>G	20.37:g.47296209G>C	ENSP00000361009:p.Leu507Val		Somatic					p.L507V	NM_020820	NP_065871	WXS	Illumina HiSeq	Unspecified	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		12	1542	-			507					E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	c.1519C>G	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772335	0.49680	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.16324	2.35;2.35	4.52	3.56	0.40772	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.42548	U	0.000699	T	0.10294	0.0252	N	0.14661	0.345	0.41450	D	0.987976	P	0.36753	0.568	B	0.38106	0.265	T	0.16541	-1.0399	10	0.37606	T	0.19	.	9.4385	0.38655	0.1704:0.0:0.8296:0.0	.	507	Q8TCU6	PREX1_HUMAN	V	507	ENSP00000361009:L507V;ENSP00000379522:L507V	ENSP00000361009:L507V	L	-	1	2	PREX1	46729616	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	2.305000	0.43664	2.073000	0.62155	0.442000	0.29010	CTG		0.592	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		25	70	0	0	0	0.007291	0	25	70				
CYP24A1	1591	broad.mit.edu	37	20	52782307	52782307	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr20:52782307C>A	ENST00000216862.3	-	5	1099	c.706G>T	c.(706-708)Gtg>Ttg	p.V236L	CYP24A1_ENST00000395954.3_Missense_Mutation_p.V94L|CYP24A1_ENST00000395955.3_Missense_Mutation_p.V236L	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	236					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)	p.V236L(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	ATGAAGTTCACAGCTTCATCC	0.383																																							uc002xwv.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3						c.(706-708)GTG>TTG		cytochrome P450 family 24 subfamily A	Calcidiol(DB00146)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)						130.0	117.0	121.0					20																	52782307		2203	4300	6503	SO:0001583	missense	1591				hormone biosynthetic process|osteoblast differentiation|vitamin D catabolic process|vitamin D receptor signaling pathway|xenobiotic metabolic process	mitochondrial inner membrane	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity|electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen	g.chr20:52782307C>A	U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.706G>T	20.37:g.52782307C>A	ENSP00000216862:p.Val236Leu		Somatic				CYP24A1_uc002xwu.1_Missense_Mutation_p.V94L|CYP24A1_uc002xww.2_Missense_Mutation_p.V236L	p.V236L	NM_000782	NP_000773	WXS	Illumina HiSeq	Unspecified	Q07973	CP24A_HUMAN	STAD - Stomach adenocarcinoma(23;0.206)		5	1104	-	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		236					Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	ENST00000216862.3	37	c.706G>T	CCDS33491.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.318970	0.00232	.	.	ENSG00000019186	ENST00000216862;ENST00000395955;ENST00000395954	T;T;T	0.68331	-0.32;-0.32;-0.32	5.37	-5.39	0.02664	.	0.399325	0.26680	N	0.023049	T	0.23054	0.0557	N	0.01128	-1	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.35724	-0.9777	10	0.11794	T	0.64	-10.7587	4.2268	0.10584	0.2906:0.1969:0.416:0.0965	.	236;236;94	Q32ML3;Q07973;Q5I2W7	.;CP24A_HUMAN;.	L	236;236;94	ENSP00000216862:V236L;ENSP00000379285:V236L;ENSP00000379284:V94L	ENSP00000216862:V236L	V	-	1	0	CYP24A1	52215714	0.045000	0.20229	0.025000	0.17156	0.177000	0.22998	0.219000	0.17641	-1.680000	0.01450	-3.423000	0.00037	GTG		0.383	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079769.2			25	63	1	0	5.61819e-17	0.005443	1.24068e-16	25	63				
GATA5	140628	broad.mit.edu	37	20	61039900	61039900	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr20:61039900A>T	ENST00000252997.2	-	7	1247	c.1186T>A	c.(1186-1188)Ttg>Atg	p.L396M		NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	396					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L396M(1)		kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			ACCTAGGCCAAGGCCAGCGCA	0.662																																							uc002ycx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1186-1188)TTG>ATG		GATA binding protein 5							36.0	41.0	39.0					20																	61039900		2202	4300	6502	SO:0001583	missense	140628				blood coagulation|intestinal epithelial cell differentiation|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding	g.chr20:61039900A>T	BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.1186T>A	20.37:g.61039900A>T	ENSP00000252997:p.Leu396Met		Somatic					p.L396M	NM_080473	NP_536721	WXS	Illumina HiSeq	Unspecified	Q9BWX5	GATA5_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.08e-06)		7	1248	-	Breast(26;2.05e-08)		396					D9ZGF7|Q17RE2|Q86VU4	Missense_Mutation	SNP	ENST00000252997.2	37	c.1186T>A	CCDS13499.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.030218	0.54790	.	.	ENSG00000130700	ENST00000370545;ENST00000540404;ENST00000252997	D	0.99176	-5.52	4.88	3.73	0.42828	.	0.070924	0.56097	D	0.000038	D	0.98516	0.9505	M	0.67397	2.05	0.31668	N	0.644754	D	0.67145	0.996	P	0.59171	0.853	D	0.97755	1.0217	10	0.72032	D	0.01	10.5334	6.1979	0.20559	0.779:0.0:0.221:0.0	.	396	Q9BWX5	GATA5_HUMAN	M	396;416;396	ENSP00000252997:L396M	ENSP00000252997:L396M	L	-	1	2	GATA5	60473295	0.511000	0.26179	1.000000	0.80357	0.777000	0.43975	0.888000	0.28268	0.681000	0.31386	-0.375000	0.07067	TTG		0.662	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080038.2	NM_080473		8	50	0	0	0	0.006214	0	8	50				
KCNQ2	3785	broad.mit.edu	37	20	62046267	62046267	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr20:62046267T>A	ENST00000359125.2	-	13	1688	c.1514A>T	c.(1513-1515)cAg>cTg	p.Q505L	KCNQ2_ENST00000360480.3_Missense_Mutation_p.Q477L|KCNQ2_ENST00000357249.2_Missense_Mutation_p.Q487L|KCNQ2_ENST00000354587.3_Missense_Mutation_p.Q477L|KCNQ2_ENST00000344462.4_Missense_Mutation_p.Q475L|KCNQ2_ENST00000359689.1_Missense_Mutation_p.Q505L|KCNQ2_ENST00000370224.1_Missense_Mutation_p.Q477L	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	505					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.Q505L(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TTCTGAGTTCTGCCGTGACGC	0.672																																							uc002yey.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1513-1515)CAG>CTG		potassium voltage-gated channel KQT-like protein	Amitriptyline(DB00321)						69.0	79.0	76.0					20																	62046267		2203	4300	6503	SO:0001583	missense	3785				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr20:62046267T>A	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1514A>T	20.37:g.62046267T>A	ENSP00000352035:p.Gln505Leu		Somatic				KCNQ2_uc002yez.1_Missense_Mutation_p.Q475L|KCNQ2_uc002yfa.1_Missense_Mutation_p.Q487L|KCNQ2_uc002yfb.1_Missense_Mutation_p.Q477L	p.Q505L	NM_172107	NP_742105	WXS	Illumina HiSeq	Unspecified	O43526	KCNQ2_HUMAN	BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		13	1691	-	all_cancers(38;1.24e-11)		505			Cytoplasmic (Potential).		O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	c.1514A>T	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.803158	0.50315	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222	D;D;D;D;D;D;D;D;D;D	0.99214	-5.41;-5.56;-5.56;-5.29;-5.57;-5.37;-5.38;-5.47;-5.29;-5.36	5.15	5.15	0.70609	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.207774	0.41194	D	0.000921	D	0.98532	0.9510	M	0.68952	2.095	0.58432	D	0.999999	B;P;B;P	0.48998	0.452;0.649;0.452;0.918	B;B;B;P	0.45913	0.228;0.228;0.164;0.497	D	0.98669	1.0687	10	0.46703	T	0.11	1.158	14.9428	0.71006	0.0:0.0:0.0:1.0	.	477;487;475;505	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	L	487;505;475;477;505;475;477;465;477;477	ENSP00000349789:Q487L;ENSP00000352035:Q505L;ENSP00000359246:Q475L;ENSP00000346601:Q477L;ENSP00000352718:Q505L;ENSP00000399612:Q475L;ENSP00000353668:Q477L;ENSP00000339611:Q465L;ENSP00000359244:Q477L;ENSP00000359242:Q477L	ENSP00000339611:Q465L	Q	-	2	0	KCNQ2	61516711	1.000000	0.71417	0.998000	0.56505	0.205000	0.24178	7.743000	0.85020	1.934000	0.56057	0.391000	0.25812	CAG		0.672	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109		35	64	0	0	0	0.00623	0	35	64				
OR11H1	81061	broad.mit.edu	37	22	16449670	16449670	+	Silent	SNP	G	G	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr22:16449670G>C	ENST00000252835.4	-	1	135	c.135C>G	c.(133-135)ctC>ctG	p.L45L		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		TTGTAGTAAAGAGTGAGAAGA	0.428																																							uc011agd.1		NA																	0					0						c.(133-135)CTC>CTG		olfactory receptor, family 11, subfamily H,							44.0	48.0	47.0					22																	16449670		2065	4073	6138	SO:0001819	synonymous_variant	81061				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr22:16449670G>C	AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.135C>G	22.37:g.16449670G>C			Somatic					p.L45L	NM_001005239	NP_001005239	WXS	Illumina HiSeq	Unspecified	Q8NG94	O11H1_HUMAN		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)	1	135	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)	45			Helical; Name=1; (Potential).		Q6IEX0|Q96R32	Silent	SNP	ENST00000252835.4	37	c.135C>G	CCDS33594.1																																																																																				0.428	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074923.2	NM_001005239		10	170	0	0	0	0.00499	0	10	170				
SYNGR1	9145	broad.mit.edu	37	22	39770447	39770447	+	Missense_Mutation	SNP	G	G	T	rs200512399		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr22:39770447G>T	ENST00000328933.5	+	2	241	c.226G>T	c.(226-228)Gtg>Ttg	p.V76L	SYNGR1_ENST00000406293.3_Missense_Mutation_p.V76L|SYNGR1_ENST00000216155.7_Missense_Mutation_p.V76L|SYNGR1_ENST00000318801.4_Missense_Mutation_p.V76L|SYNGR1_ENST00000381535.4_Missense_Mutation_p.V77L	NM_004711.4	NP_004702.2	O43759	SNG1_HUMAN	synaptogyrin 1	76	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				protein targeting (GO:0006605)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle membrane (GO:0030672)		p.V76L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	7	Melanoma(58;0.04)					GGCCGTGGGCGTGCTCGCCTT	0.627																																							uc003axq.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(226-228)GTG>TTG		synaptogyrin 1 isoform 1a							158.0	106.0	124.0					22																	39770447		2203	4300	6503	SO:0001583	missense	9145				regulation of long-term neuronal synaptic plasticity|regulation of short-term neuronal synaptic plasticity	cell junction|integral to plasma membrane|melanosome		g.chr22:39770447G>T	AJ002303	CCDS13989.1, CCDS13990.1, CCDS13991.1	22q13	2008-06-10			ENSG00000100321	ENSG00000100321			11498	protein-coding gene	gene with protein product		603925				9760194, 10595519	Standard	NM_004711		Approved			O43759	OTTHUMG00000030978	ENST00000328933.5:c.226G>T	22.37:g.39770447G>T	ENSP00000332287:p.Val76Leu		Somatic				SYNGR1_uc003axo.3_Missense_Mutation_p.V76L|SYNGR1_uc003axp.3_Silent_p.A6A|TAB1_uc003axr.2_5'UTR|SYNGR1_uc003axs.3_Missense_Mutation_p.V77L	p.V76L	NM_004711	NP_004702	WXS	Illumina HiSeq	Unspecified	O43759	SNG1_HUMAN			2	288	+	Melanoma(58;0.04)		76			Helical; (Potential).|MARVEL.		A6NP69|A8K0E2|O43757|O43758|Q53Y02|Q96J56|Q9UGZ4	Missense_Mutation	SNP	ENST00000328933.5	37	c.226G>T	CCDS13989.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.750995	0.69533	.	.	ENSG00000100321	ENST00000318801;ENST00000216155;ENST00000406293;ENST00000328933;ENST00000381535	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	5.02	5.02	0.67125	Marvel (1);MARVEL-like domain (1);	0.266187	0.36268	N	0.002686	T	0.41994	0.1183	L	0.48218	1.51	0.48571	D	0.999672	D;P;P	0.53462	0.96;0.774;0.923	P;P;P	0.53102	0.718;0.518;0.577	T	0.14559	-1.0468	10	0.36615	T	0.2	.	18.3277	0.90260	0.0:0.0:1.0:0.0	.	77;76;76	O43759-3;O43759;O43759-2	.;SNG1_HUMAN;.	L	76;76;76;76;77	ENSP00000318845:V76L;ENSP00000216155:V76L;ENSP00000385447:V76L;ENSP00000332287:V76L;ENSP00000370946:V77L	ENSP00000216155:V76L	V	+	1	0	SYNGR1	38100393	1.000000	0.71417	0.995000	0.50966	0.900000	0.52787	6.196000	0.72094	2.300000	0.77407	0.561000	0.74099	GTG		0.627	SYNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075866.2	NM_004711		8	56	1	0	0.000157383	0.00308	0.000243898	8	56				
SETD5	55209	broad.mit.edu	37	3	9488802	9488802	+	Silent	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr3:9488802G>A	ENST00000406341.1	+	13	1783	c.1593G>A	c.(1591-1593)cgG>cgA	p.R531R	SETD5_ENST00000402466.1_Silent_p.R433R|SETD5_ENST00000402198.1_Silent_p.R531R|SETD5_ENST00000302463.6_Silent_p.R433R|SETD5_ENST00000407969.1_Silent_p.R550R			Q9C0A6	SETD5_HUMAN	SET domain containing 5	531								p.R531R(1)|p.R433R(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		GAAAGAAGCGGCGGGATCAGC	0.443																																							uc003brt.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(1591-1593)CGG>CGA		SET domain containing 5							69.0	71.0	70.0					3																	9488802		1827	4094	5921	SO:0001819	synonymous_variant	55209							g.chr3:9488802G>A	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.1593G>A	3.37:g.9488802G>A			Somatic				SETD5_uc003brs.1_Silent_p.R512R|SETD5_uc003bru.2_Silent_p.R433R|SETD5_uc003brv.2_Silent_p.R420R|SETD5_uc010hck.2_Silent_p.R13R|SETD5_uc003brx.2_Silent_p.R200R	p.R531R	NM_001080517	NP_001073986	WXS	Illumina HiSeq	Unspecified	Q9C0A6	SETD5_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.112)	14	2028	+	Medulloblastoma(99;0.227)		531					Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	ENST00000406341.1	37	c.1593G>A	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	G	4.185	0.032919	0.08101	.	.	ENSG00000168137	ENST00000399686	.	.	.	5.56	-0.932	0.10435	.	.	.	.	.	T	0.39989	0.1099	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31641	-0.9936	4	.	.	.	-11.6671	1.2234	0.01929	0.4399:0.1514:0.2541:0.1546	.	.	.	.	T	199	.	.	A	+	1	0	SETD5	9463802	0.144000	0.22641	0.989000	0.46669	0.433000	0.31745	-0.743000	0.04845	0.303000	0.22785	0.561000	0.74099	GCG		0.443	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614		37	37	0	0	0	0.003755	0	37	37				
C3orf14	57415	broad.mit.edu	37	3	62317051	62317051	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr3:62317051C>T	ENST00000494481.1	+	5	543	c.229C>T	c.(229-231)Cgg>Tgg	p.R77W	C3orf14_ENST00000542214.1_Missense_Mutation_p.R77W|PTPRG-AS1_ENST00000495542.1_RNA|C3orf14_ENST00000232519.5_Missense_Mutation_p.R77W|C3orf14_ENST00000462069.1_Missense_Mutation_p.R77W|PTPRG-AS1_ENST00000490916.1_RNA			Q9HBI5	CC014_HUMAN	chromosome 3 open reading frame 14	77								p.R77W(1)		central_nervous_system(1)|large_intestine(1)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(55;0.00023)|KIRC - Kidney renal clear cell carcinoma(15;0.00877)|Kidney(15;0.0101)		CCCACTTCCACGGCCTGAGGT	0.388																																							uc003dlf.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(229-231)CGG>TGG		hypothetical protein LOC57415							113.0	111.0	112.0					3																	62317051		2203	4300	6503	SO:0001583	missense	57415							g.chr3:62317051C>T	AF236158	CCDS2896.1	3p14.2	2011-11-29			ENSG00000114405	ENSG00000114405			25024	protein-coding gene	gene with protein product						12477932	Standard	XM_005265338		Approved	HT021	uc003dlg.3	Q9HBI5	OTTHUMG00000158704	ENST00000494481.1:c.229C>T	3.37:g.62317051C>T	ENSP00000418086:p.Arg77Trp		Somatic				C3orf14_uc010hnq.2_Missense_Mutation_p.R77W|C3orf14_uc003dlg.2_Missense_Mutation_p.R77W	p.R77W	NM_020685	NP_065736	WXS	Illumina HiSeq	Unspecified	Q9HBI5	CC014_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00023)|KIRC - Kidney renal clear cell carcinoma(15;0.00877)|Kidney(15;0.0101)	5	373	+			77					B2R9U0	Missense_Mutation	SNP	ENST00000494481.1	37	c.229C>T	CCDS2896.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399513	0.42512	.	.	ENSG00000114405	ENST00000462069;ENST00000232519;ENST00000494481;ENST00000542214	.	.	.	6.12	3.33	0.38152	.	1.224480	0.05667	N	0.587906	T	0.24812	0.0602	N	0.19112	0.55	0.09310	N	1	D	0.62365	0.991	B	0.43123	0.409	T	0.25222	-1.0138	9	0.62326	D	0.03	-8.7862	9.3099	0.37898	0.0:0.771:0.0:0.229	.	77	Q9HBI5	CC014_HUMAN	W	77	.	ENSP00000232519:R77W	R	+	1	2	C3orf14	62292091	0.005000	0.15991	0.000000	0.03702	0.874000	0.50279	0.593000	0.23999	0.445000	0.26639	0.644000	0.83932	CGG		0.388	C3orf14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351807.1	NM_020685		30	142	0	0	0	0.003755	0	30	142				
OR5K1	26339	broad.mit.edu	37	3	98188897	98188897	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr3:98188897T>A	ENST00000332650.5	+	1	574	c.477T>A	c.(475-477)caT>caA	p.H159Q		NM_001004736.2	NP_001004736.2	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K, member 1	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H159Q(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(21)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCATGATTCATGTAGGGCTTG	0.423																																							uc003dsm.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(475-477)CAT>CAA		olfactory receptor, family 5, subfamily K,							207.0	210.0	209.0					3																	98188897		2203	4300	6503	SO:0001583	missense	26339				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:98188897T>A	X64984	CCDS43115.1	3q11.2	2013-09-23			ENSG00000232382	ENSG00000232382		"""GPCR / Class A : Olfactory receptors"""	8349	protein-coding gene	gene with protein product						1370859	Standard	NM_001004736		Approved	HTPCRX10, HSHTPCRX10	uc003dsm.3	Q8NHB7	OTTHUMG00000160048	ENST00000332650.5:c.477T>A	3.37:g.98188897T>A	ENSP00000373193:p.His159Gln		Somatic					p.H159Q	NM_001004736	NP_001004736	WXS	Illumina HiSeq	Unspecified	Q8NHB7	OR5K1_HUMAN			1	477	+			159			Helical; Name=4; (Potential).		B9EGY5|Q6IF46	Missense_Mutation	SNP	ENST00000332650.5	37	c.477T>A	CCDS43115.1	.	.	.	.	.	.	.	.	.	.	T	5.678	0.309673	0.10733	.	.	ENSG00000232382	ENST00000332650	T	0.00249	8.44	5.33	-2.92	0.05615	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	D	0.000456	T	0.00144	0.0004	L	0.39633	1.23	0.09310	N	1	B	0.24920	0.114	B	0.30251	0.113	T	0.39781	-0.9597	10	0.52906	T	0.07	-2.1372	11.0194	0.47709	0.0:0.4637:0.0:0.5363	.	159	Q8NHB7	OR5K1_HUMAN	Q	159	ENSP00000373193:H159Q	ENSP00000373193:H159Q	H	+	3	2	OR5K1	99671587	0.000000	0.05858	0.010000	0.14722	0.070000	0.16714	-2.591000	0.00899	-0.542000	0.06249	-1.098000	0.02139	CAT		0.423	OR5K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359019.1			32	252	0	0	0	0.012213	0	32	252				
GABRA2	2555	broad.mit.edu	37	4	46252550	46252550	+	Missense_Mutation	SNP	A	A	T	rs200515415		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr4:46252550A>T	ENST00000510861.1	-	10	1304	c.1131T>A	c.(1129-1131)aaT>aaA	p.N377K	GABRA2_ENST00000507069.1_Missense_Mutation_p.N437K|GABRA2_ENST00000356504.1_Missense_Mutation_p.N377K|GABRA2_ENST00000514090.1_Missense_Mutation_p.N377K|GABRA2_ENST00000381620.4_Missense_Mutation_p.N377K|GABRA2_ENST00000540012.1_Missense_Mutation_p.N382K			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	377					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.N377K(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTTTTGAAAGATTCGGGGCAT	0.408																																							uc003gxc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1129-1131)AAT>AAA		gamma-aminobutyric acid A receptor, alpha 2	Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	A	LYS/ASN,LYS/ASN	2,4404	4.2+/-10.8	0,2,2201	133.0	133.0	133.0		1131,1131	-3.6	1.0	4		133	0,8598		0,0,4299	no	missense,missense	GABRA2	NM_000807.2,NM_001114175.1	94,94	0,2,6500	TT,TA,AA		0.0,0.0454,0.0154	benign,benign	377/452,377/452	46252550	2,13002	2203	4299	6502	SO:0001583	missense	2555				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:46252550A>T		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.1131T>A	4.37:g.46252550A>T	ENSP00000421828:p.Asn377Lys		Somatic				GABRA2_uc010igc.2_Missense_Mutation_p.N377K|GABRA2_uc011bzc.1_Missense_Mutation_p.N382K	p.N377K	NM_001114175	NP_001107647	WXS	Illumina HiSeq	Unspecified	P47869	GBRA2_HUMAN			9	1804	-			377			Cytoplasmic (Probable).		A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	ENST00000510861.1	37	c.1131T>A	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	A	16.78	3.216610	0.58452	4.54E-4	0.0	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069	D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91;-1.91	5.96	-3.58	0.04597	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.83285	0.5221	L	0.60067	1.865	0.21822	N	0.999527	D;P	0.53462	0.96;0.784	P;P	0.54815	0.761;0.527	T	0.76553	-0.2917	10	0.07175	T	0.84	.	13.4762	0.61310	0.4702:0.0:0.5298:0.0	.	382;377	B7Z1H8;P47869	.;GBRA2_HUMAN	K	377;377;377;377;382;437	ENSP00000421828:N377K;ENSP00000421300:N377K;ENSP00000371033:N377K;ENSP00000348897:N377K;ENSP00000444409:N382K;ENSP00000427603:N437K	ENSP00000348897:N377K	N	-	3	2	GABRA2	45947307	0.984000	0.35163	0.957000	0.39632	0.996000	0.88848	0.582000	0.23834	-0.605000	0.05753	0.533000	0.62120	AAT		0.408	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2			45	176	0	0	0	0.010771	0	45	176				
SOWAHB	345079	broad.mit.edu	37	4	77817780	77817780	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr4:77817780C>A	ENST00000334306.2	-	1	1222	c.1223G>T	c.(1222-1224)aGc>aTc	p.S408I		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	408								p.S408I(1)									CCCACTGCTGCTCTCCTCACT	0.582																																							uc003hki.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1222-1224)AGC>ATC		ankyrin repeat domain 56							64.0	71.0	69.0					4																	77817780		2203	4300	6503	SO:0001583	missense	345079							g.chr4:77817780C>A		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.1223G>T	4.37:g.77817780C>A	ENSP00000334879:p.Ser408Ile		Somatic					p.S408I	NM_001029870	NP_001025041	WXS	Illumina HiSeq	Unspecified	A6NEL2	ANR56_HUMAN			1	1223	-			408					B2RP29	Missense_Mutation	SNP	ENST00000334306.2	37	c.1223G>T	CCDS34017.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851371	0.51270	.	.	ENSG00000186212	ENST00000334306	T	0.10288	2.89	5.05	5.05	0.67936	.	0.000000	0.45126	U	0.000392	T	0.11580	0.0282	L	0.32530	0.975	0.33415	D	0.579066	P	0.42692	0.787	B	0.40199	0.322	T	0.06162	-1.0842	10	0.56958	D	0.05	-13.5561	17.3494	0.87318	0.0:1.0:0.0:0.0	.	408	A6NEL2	ANR56_HUMAN	I	408	ENSP00000334879:S408I	ENSP00000334879:S408I	S	-	2	0	ANKRD56	78036804	1.000000	0.71417	1.000000	0.80357	0.108000	0.19459	1.584000	0.36589	2.611000	0.88343	0.655000	0.94253	AGC		0.582	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870		18	75	1	0	4.96729e-08	0.008871	8.83444e-08	18	75				
FRAS1	80144	broad.mit.edu	37	4	79360172	79360172	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr4:79360172C>T	ENST00000325942.6	+	40	5923	c.5483C>T	c.(5482-5484)cCt>cTt	p.P1828L	FRAS1_ENST00000264895.6_Missense_Mutation_p.P1828L	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1828					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ATGATCACTCCTGCTGAAAAT	0.408																																							uc003hlb.2		NA																	0				large_intestine(5)	5						c.(5482-5484)CCT>CTT		Fraser syndrome 1							240.0	236.0	237.0					4																	79360172		1899	4116	6015	SO:0001583	missense	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79360172C>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.5483C>T	4.37:g.79360172C>T	ENSP00000326330:p.Pro1828Leu		Somatic				FRAS1_uc003hkw.2_Missense_Mutation_p.P1828L|FRAS1_uc010ijj.1_Missense_Mutation_p.P248L	p.P1828L	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			40	5923	+			1827			CSPG 7.|Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	c.5483C>T	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076666	0.36662	.	.	ENSG00000138759	ENST00000325942;ENST00000264895;ENST00000545316	T;T	0.38401	1.14;1.14	5.92	5.06	0.68205	.	0.191786	0.48767	D	0.000172	T	0.43122	0.1233	M	0.81802	2.56	0.80722	D	1	B;B	0.32350	0.366;0.346	B;B	0.27887	0.077;0.084	T	0.49273	-0.8957	10	0.87932	D	0	.	16.2641	0.82565	0.1337:0.8663:0.0:0.0	.	1828;1828	E9PHH6;A2RRR8	.;.	L	1828;1828;248	ENSP00000326330:P1828L;ENSP00000264895:P1828L	ENSP00000264895:P1828L	P	+	2	0	FRAS1	79579196	0.769000	0.28531	0.777000	0.31699	0.248000	0.25809	5.036000	0.64164	1.471000	0.48121	0.585000	0.79938	CCT		0.408	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2			49	241	0	0	0	0.01441	0	49	241				
STPG2	285555	broad.mit.edu	37	4	99055589	99055589	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr4:99055589G>A	ENST00000295268.3	-	2	220	c.131C>T	c.(130-132)tCt>tTt	p.S44F		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	44								p.S44F(1)									GGCAGTCAAAGAAAGAAATGG	0.353																																							uc003htt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(130-132)TCT>TTT		hypothetical protein LOC285555							80.0	82.0	82.0					4																	99055589		2203	4300	6503	SO:0001583	missense	285555							g.chr4:99055589G>A	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.131C>T	4.37:g.99055589G>A	ENSP00000295268:p.Ser44Phe		Somatic					p.S44F	NM_174952	NP_777612	WXS	Illumina HiSeq	Unspecified	Q8N412	CD037_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)	2	221	-			44						Missense_Mutation	SNP	ENST00000295268.3	37	c.131C>T	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.088913	0.76756	.	.	ENSG00000163116	ENST00000295268	T	0.36520	1.25	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.62405	0.2425	M	0.78049	2.395	0.42476	D	0.992846	D	0.89917	1.0	D	0.91635	0.999	T	0.66532	-0.5900	10	0.87932	D	0	-31.0477	16.4059	0.83670	0.0:0.0:1.0:0.0	.	44	Q8N412	CD037_HUMAN	F	44	ENSP00000295268:S44F	ENSP00000295268:S44F	S	-	2	0	C4orf37	99274612	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.683000	0.61679	2.666000	0.90696	0.650000	0.86243	TCT		0.353	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952		9	99	0	0	0	0.006214	0	9	99				
CEP170P1	645455	broad.mit.edu	37	4	119434968	119434968	+	RNA	SNP	G	G	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr4:119434968G>C	ENST00000412784.2	+	0	0					NR_003135.2		Q96L14	C170L_HUMAN	centrosomal protein 170kDa pseudogene 1								identical protein binding (GO:0042802)										GCAGTAAATGGAGAGACTCTC	0.413																																							uc010imy.1		NA																	0					NA						c.(253-255)GGA>GCA		Homo sapiens cDNA, FLJ98257.																																						0							g.chr4:119434968G>C	BC014590		4q26	2010-10-11	2010-10-11	2010-10-11	ENSG00000154608	ENSG00000154608			28364	pseudogene	pseudogene			"""KIAA0470-like"", ""centrosomal protein 170kDa-like"""	KIAA0470L, CEP170L			Standard	NR_003135		Approved	MGC26143, FAM68B	uc003icb.3	Q96L14	OTTHUMG00000132958		4.37:g.119434968G>C			Somatic				CEP170L_uc003icb.2_5'Flank	p.G85A			WXS	Illumina HiSeq	Unspecified					2	323	+									Missense_Mutation	SNP	ENST00000412784.2	37	c.254G>C																																																																																					0.413	CEP170P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000364033.2	NR_003135.2		11	40	0	0	0	0.003163	0	11	40				
C4orf27	54969	broad.mit.edu	37	4	170652978	170652978	+	Missense_Mutation	SNP	C	C	A	rs1047673		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr4:170652978C>A	ENST00000393381.2	-	7	861	c.786G>T	c.(784-786)gaG>gaT	p.E262D		NM_017867.2	NP_060337.2	Q9NWY4	CD027_HUMAN	chromosome 4 open reading frame 27	262						nucleus (GO:0005634)		p.E262D(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	12		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		TTAGTCTCTCCTCATCACTTG	0.363																																							uc003isl.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(784-786)GAG>GAT		hypothetical protein LOC54969							87.0	76.0	79.0					4																	170652978		2203	4300	6503	SO:0001583	missense	54969					nucleus		g.chr4:170652978C>A	BC010367	CCDS3813.1	4q33	2011-01-25			ENSG00000056050	ENSG00000056050			26051	protein-coding gene	gene with protein product						11230166	Standard	NM_017867		Approved	FLJ20534	uc003isl.4	Q9NWY4	OTTHUMG00000160960	ENST00000393381.2:c.786G>T	4.37:g.170652978C>A	ENSP00000406598:p.Glu262Asp		Somatic					p.E262D	NM_017867	NP_060337	WXS	Illumina HiSeq	Unspecified	Q9NWY4	CD027_HUMAN		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)	7	851	-		Prostate(90;0.00601)|Renal(120;0.0183)	262						Missense_Mutation	SNP	ENST00000393381.2	37	c.786G>T	CCDS3813.1	.	.	.	.	.	.	.	.	.	.	C	9.569	1.120608	0.20877	.	.	ENSG00000056050	ENST00000393381	T	0.47869	0.83	4.79	-1.72	0.08107	.	0.145456	0.64402	D	0.000009	T	0.19446	0.0467	N	0.16098	0.37	0.44309	D	0.997185	B	0.10296	0.003	B	0.18871	0.023	T	0.07597	-1.0764	10	0.12430	T	0.62	-21.7014	1.6352	0.02740	0.1927:0.3336:0.2762:0.1975	rs1047673	262	Q9NWY4	CD027_HUMAN	D	262	ENSP00000406598:E262D	ENSP00000406598:E262D	E	-	3	2	C4orf27	170889553	0.002000	0.14202	0.918000	0.36340	0.905000	0.53344	-1.382000	0.02546	-0.284000	0.09102	0.462000	0.41574	GAG		0.363	C4orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363140.1	NM_017867		5	61	1	0	0.00136819	0.013537	0.00207184	5	61				
DNAH5	1767	broad.mit.edu	37	5	13721350	13721350	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:13721350C>G	ENST00000265104.4	-	71	12142	c.12038G>C	c.(12037-12039)cGc>cCc	p.R4013P		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4013	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R4013P(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GATGTACTTGCGGGCCTGCCA	0.413									Kartagener syndrome																														uc003jfd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(12037-12039)CGC>CCC		dynein, axonemal, heavy chain 5							65.0	66.0	66.0					5																	13721350		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13721350C>G	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12038G>C	5.37:g.13721350C>G	ENSP00000265104:p.Arg4013Pro		Somatic				DNAH5_uc003jfc.2_Missense_Mutation_p.R181P	p.R4013P	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			71	12080	-	Lung NSC(4;0.00476)		4013			AAA 6 (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.12038G>C	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.902174	0.52227	.	.	ENSG00000039139	ENST00000265104	T	0.09350	2.99	5.31	4.44	0.53790	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.25082	0.0609	M	0.90483	3.12	0.80722	D	1	P	0.34892	0.474	B	0.39068	0.289	T	0.11372	-1.0590	10	0.72032	D	0.01	.	14.2197	0.65818	0.0:0.9278:0.0:0.0722	.	4013	Q8TE73	DYH5_HUMAN	P	4013	ENSP00000265104:R4013P	ENSP00000265104:R4013P	R	-	2	0	DNAH5	13774350	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	5.951000	0.70273	1.375000	0.46248	-0.142000	0.14014	CGC		0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		6	64	0	0	0	0.001168	0	6	64				
SPEF2	79925	broad.mit.edu	37	5	35740120	35740120	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:35740120A>G	ENST00000356031.3	+	22	3317	c.3163A>G	c.(3163-3165)Act>Gct	p.T1055A	SPEF2_ENST00000440995.2_Missense_Mutation_p.T1050A|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1055					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.T1055A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGACCAGCATACTGTGCTTGC	0.333																																							uc003jjo.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(3163-3165)ACT>GCT		KPL2 protein isoform 1							117.0	107.0	110.0					5																	35740120		1829	4087	5916	SO:0001583	missense	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35740120A>G	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3163A>G	5.37:g.35740120A>G	ENSP00000348314:p.Thr1055Ala		Somatic				SPEF2_uc003jjp.1_Missense_Mutation_p.T541A	p.T1055A	NM_024867	NP_079143	WXS	Illumina HiSeq	Unspecified	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		22	3274	+	all_lung(31;7.56e-05)		1055					Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	c.3163A>G	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	A	3.918	-0.018662	0.07681	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	T;T	0.05319	3.47;3.46	5.83	-8.47	0.00939	.	1.510590	0.03408	N	0.204331	T	0.04452	0.0122	L	0.35414	1.06	0.09310	N	1	B;B	0.11235	0.004;0.001	B;B	0.08055	0.003;0.001	T	0.36480	-0.9746	10	0.24483	T	0.36	.	6.4307	0.21794	0.2333:0.0:0.3166:0.4502	.	1050;1055	Q9C093-2;Q9C093	.;SPEF2_HUMAN	A	1055;1050	ENSP00000348314:T1055A;ENSP00000412125:T1050A	ENSP00000348314:T1055A	T	+	1	0	SPEF2	35775877	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-2.377000	0.01069	-1.307000	0.02321	-0.333000	0.08304	ACT		0.333	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		16	83	0	0	0	0.00499	0	16	83				
C7	730	broad.mit.edu	37	5	40964946	40964946	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:40964946G>C	ENST00000313164.9	+	14	2212	c.1853G>C	c.(1852-1854)cGg>cCg	p.R618P		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	618	CCP 2.|Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.R618L(1)|p.R618P(1)					Ovarian(839;0.0112)				GAAGATTTACGGTGGCTTGTT	0.393																																							uc003jmh.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1852-1854)CGG>CCG		complement component 7 precursor							163.0	162.0	162.0					5																	40964946		1988	4160	6148	SO:0001583	missense	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40964946G>C	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1853G>C	5.37:g.40964946G>C	ENSP00000322061:p.Arg618Pro		Somatic				C7_uc011cpn.1_RNA	p.R618P	NM_000587	NP_000578	WXS	Illumina HiSeq	Unspecified	P10643	CO7_HUMAN			14	1967	+		Ovarian(839;0.0112)	618			Sushi 1.		Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	c.1853G>C	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594269	0.28445	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	T	0.65732	-0.17	6.04	-1.24	0.09435	Complement control module (2);Sushi/SCR/CCP (3);	1.180520	0.06173	N	0.678110	T	0.50086	0.1595	L	0.36672	1.1	0.09310	N	0.999994	P	0.38148	0.62	B	0.40565	0.333	T	0.42258	-0.9462	10	0.34782	T	0.22	-0.8018	4.51	0.11906	0.6247:0.101:0.1844:0.0899	.	618	P10643	CO7_HUMAN	P	618;458	ENSP00000322061:R618P	ENSP00000322061:R618P	R	+	2	0	C7	41000703	0.012000	0.17670	0.995000	0.50966	0.908000	0.53690	0.271000	0.18626	-0.060000	0.13132	-1.340000	0.01251	CGG		0.393	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			54	126	0	0	0	0.01441	0	54	126				
GPX8	493869	broad.mit.edu	37	5	54456928	54456928	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:54456928T>A	ENST00000503787.1	+	2	386	c.311T>A	c.(310-312)tTg>tAg	p.L104*	CDC20B_ENST00000322374.6_Intron|CDC20B_ENST00000331730.3_Intron|CDC20B_ENST00000334206.5_Intron|GPX8_ENST00000506123.1_3'UTR|GPX8_ENST00000515370.1_Nonsense_Mutation_p.L53*|CDC20B_ENST00000296733.1_Intron|CDC20B_ENST00000381375.2_Intron|GPX8_ENST00000296734.6_Intron	NM_001008397.2	NP_001008398.2	Q8TED1	GPX8_HUMAN	glutathione peroxidase 8 (putative)	104					response to oxidative stress (GO:0006979)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	glutathione peroxidase activity (GO:0004602)|peroxidase activity (GO:0004601)	p.L104*(1)|p.L104W(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)	11					Glutathione(DB00143)	TTCAGCGTGTTGGCTTTTCCC	0.473																																							uc003jpq.2		NA																	2	Substitution - Nonsense(1)|Substitution - Missense(1)		lung(1)|kidney(1)		0						c.(310-312)TTG>TAG		glutathione peroxidase 8	Glutathione(DB00143)						89.0	85.0	86.0					5																	54456928		2203	4300	6503	SO:0001587	stop_gained	493869				response to oxidative stress	integral to membrane	glutathione peroxidase activity	g.chr5:54456928T>A	BC029424	CCDS34156.1	5q11.2	2008-09-29				ENSG00000164294			33100	protein-coding gene	gene with protein product							Standard	NM_001008397		Approved	UNQ847, EPLA847	uc003jpq.2	Q8TED1		ENST00000503787.1:c.311T>A	5.37:g.54456928T>A	ENSP00000423822:p.Leu104*		Somatic				CDC20B_uc003jpn.1_Intron|CDC20B_uc010ivu.1_Intron|CDC20B_uc003jpo.1_Intron|CDC20B_uc010ivv.1_Intron|CDC20B_uc003jpp.2_Intron|GPX8_uc003jpr.2_Intron|GPX8_uc003jps.2_RNA|GPX8_uc003jpt.2_Nonsense_Mutation_p.L53*	p.L104*	NM_001008397	NP_001008398	WXS	Illumina HiSeq	Unspecified	Q8TED1	GPX8_HUMAN			2	348	+			104						Nonsense_Mutation	SNP	ENST00000503787.1	37	c.311T>A	CCDS34156.1	.	.	.	.	.	.	.	.	.	.	T	33	5.255457	0.95336	.	.	ENSG00000164294	ENST00000503787;ENST00000515370	.	.	.	5.47	5.47	0.80525	.	0.142967	0.48286	D	0.000183	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5604	0.76240	0.0:0.0:0.0:1.0	.	.	.	.	X	104;53	.	ENSP00000423822:L104X	L	+	2	0	GPX8	54492685	1.000000	0.71417	0.986000	0.45419	0.998000	0.95712	7.691000	0.84191	2.081000	0.62600	0.533000	0.62120	TTG		0.473	GPX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369717.1	NM_001008397		13	77	0	0	0	0.001855	0	13	77				
SSBP2	23635	broad.mit.edu	37	5	80724479	80724479	+	Silent	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:80724479C>A	ENST00000320672.4	-	16	1191	c.981G>T	c.(979-981)ctG>ctT	p.L327L	SSBP2_ENST00000510060.1_5'UTR|SSBP2_ENST00000505980.1_Silent_p.L307L|SSBP2_ENST00000509053.1_Intron|SSBP2_ENST00000514493.1_Silent_p.L297L|SSBP2_ENST00000515395.1_Silent_p.L305L	NM_001256732.1|NM_001256733.1|NM_012446.3	NP_001243661.1|NP_001243662.1|NP_036578.2	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2	327					regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)	p.L327L(1)	SSBP2/JAK2(4)	central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		GTTGATTACTCAGGCTCATAT	0.368																																							uc003kho.2		NA																SSBP2/JAK2(4)	1	Substitution - coding silent(1)		lung(1)	haematopoietic_and_lymphoid_tissue(4)|skin(1)	5						c.(979-981)CTG>CTT		single-stranded DNA binding protein 2							78.0	79.0	78.0					5																	80724479		2203	4299	6502	SO:0001819	synonymous_variant	23635				regulation of transcription, DNA-dependent	cytoplasm|nucleus	single-stranded DNA binding	g.chr5:80724479C>A	AF077048	CCDS4056.1, CCDS58960.1, CCDS58961.1, CCDS58962.1, CCDS58963.1, CCDS75268.1	5q14.1	2012-05-25	2001-11-28		ENSG00000145687	ENSG00000145687			15831	protein-coding gene	gene with protein product		607389	"""single-stranded DNA-binding protein 2"""			11230166, 11042152	Standard	NM_001256732		Approved	HSPC116	uc003khp.4	P81877	OTTHUMG00000119039	ENST00000320672.4:c.981G>T	5.37:g.80724479C>A			Somatic				RNU5E_uc011cto.1_Intron|SSBP2_uc010jar.2_Silent_p.L212L|SSBP2_uc003khn.2_Silent_p.L201L|SSBP2_uc003khp.2_Silent_p.L335L|SSBP2_uc011ctp.1_Silent_p.L307L|SSBP2_uc011ctq.1_Silent_p.L305L|SSBP2_uc011ctr.1_Intron	p.L327L	NM_012446	NP_036578	WXS	Illumina HiSeq	Unspecified	P81877	SSBP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)	16	1192	-		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)	327					B2R5W1|B7Z1J2|B7Z2L9|B7Z665|D6RH18|E9PB74|E9PDA8|Q8N2Q2|Q9BWW6|Q9Y4T7	Silent	SNP	ENST00000320672.4	37	c.981G>T	CCDS4056.1																																																																																				0.368	SSBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239249.1	NM_012446		22	49	1	0	1.5548e-18	0.005443	3.49171e-18	22	49				
TTC37	9652	broad.mit.edu	37	5	94865853	94865853	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:94865853A>C	ENST00000358746.2	-	11	1130	c.832T>G	c.(832-834)Tta>Gta	p.L278V		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	278						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)		p.L278V(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						TTAATGCCTAAGCCAATGAGG	0.378																																							uc003klb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(832-834)TTA>GTA		tetratricopeptide repeat domain 37							145.0	123.0	131.0					5																	94865853		2203	4300	6503	SO:0001583	missense	9652						binding	g.chr5:94865853A>C	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.832T>G	5.37:g.94865853A>C	ENSP00000351596:p.Leu278Val		Somatic				TTC37_uc010jbf.1_Missense_Mutation_p.L230V	p.L278V	NM_014639	NP_055454	WXS	Illumina HiSeq	Unspecified	Q6PGP7	TTC37_HUMAN			11	1102	-			278			TPR 3.		O15077|Q6PJI3	Missense_Mutation	SNP	ENST00000358746.2	37	c.832T>G	CCDS4072.1	.	.	.	.	.	.	.	.	.	.	A	14.99	2.701548	0.48307	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	T;T	0.64618	-0.11;-0.11	5.82	3.24	0.37175	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.254165	0.33364	N	0.004984	T	0.55481	0.1923	L	0.59436	1.845	0.35566	D	0.805103	B;B	0.27700	0.183;0.186	B;B	0.33295	0.161;0.078	T	0.56177	-0.8022	10	0.15952	T	0.53	.	9.9796	0.41806	0.6135:0.0:0.0:0.3865	.	230;278	D6RCE2;Q6PGP7	.;TTC37_HUMAN	V	278;230	ENSP00000351596:L278V;ENSP00000423742:L230V	ENSP00000351596:L278V	L	-	1	2	TTC37	94891609	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.437000	0.44828	0.992000	0.38840	0.482000	0.46254	TTA		0.378	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639		20	47	0	0	0	0.010504	0	20	47				
PCDHB2	56133	broad.mit.edu	37	5	140476407	140476407	+	Missense_Mutation	SNP	C	C	A	rs201070541		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:140476407C>A	ENST00000194155.4	+	1	2181	c.2033C>A	c.(2032-2034)gCg>gAg	p.A678E		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	678					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A678E(1)|p.A678V(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCCCGGAGGCGGCACCGGCC	0.682																																							uc003lil.2		NA																	2	Substitution - Missense(2)	p.A678V(1)	ovary(1)|lung(1)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(2032-2034)GCG>GAG		protocadherin beta 2 precursor							64.0	66.0	66.0					5																	140476407		2182	4247	6429	SO:0001583	missense	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140476407C>A	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2033C>A	5.37:g.140476407C>A	ENSP00000194155:p.Ala678Glu		Somatic				PCDHB2_uc003lim.1_Missense_Mutation_p.A339E	p.A678E	NM_018936	NP_061759	WXS	Illumina HiSeq	Unspecified	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2171	+			678			Extracellular (Potential).		Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	c.2033C>A	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194576	0.38806	.	.	ENSG00000112852	ENST00000194155	T	0.50277	0.75	3.99	-1.85	0.07784	.	.	.	.	.	T	0.47451	0.1446	M	0.90198	3.095	0.09310	N	1	B	0.10296	0.003	B	0.16722	0.016	T	0.52147	-0.8614	9	0.46703	T	0.11	.	1.5061	0.02486	0.1377:0.3305:0.1357:0.3961	.	678	Q9Y5E7	PCDB2_HUMAN	E	678	ENSP00000194155:A678E	ENSP00000194155:A678E	A	+	2	0	PCDHB2	140456591	0.000000	0.05858	0.007000	0.13788	0.495000	0.33615	-1.445000	0.02401	-0.399000	0.07668	0.456000	0.33151	GCG		0.682	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		47	137	1	0	6.08268e-21	0.01441	1.42647e-20	47	137				
PCDHB16	57717	broad.mit.edu	37	5	140568427	140568428	+	IGR	DNP	CC	CC	AA			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:140568427_140568428CC>AA	ENST00000361016.2	+	0	4814					NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAATGGCCACCTGTTTGCCCT	0.678																																							uc003liw.1		NA																	0					0						c.(1534-1539)CACCTG>CAAATG		protocadherin beta 9 precursor																																				SO:0001628	intergenic_variant	56127				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140568427_140568428CC>AA	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	Exception_encountered	5.37:g.140568427_140568428delinsAA			Somatic					p.512_513HL>QM	NM_019119	NP_061992	WXS	Illumina HiSeq	Unspecified	Q9Y5E1	PCDB9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		3	1536_1537	+			512_513			Extracellular (Potential).|Cadherin 5.		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	DNP	ENST00000361016.2	37	c.1536_1537CC>AA	CCDS4251.1																																																																																				0.678	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		24	188	0	0	0	0.004672	0	24	188				
PCDHGA3	56112	broad.mit.edu	37	5	140725310	140725310	+	Silent	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:140725310C>T	ENST00000253812.6	+	1	1710	c.1710C>T	c.(1708-1710)gaC>gaT	p.D570D	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	570	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D570D(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCCACAGACGGTTCCACTG	0.672																																							uc003ljm.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1708-1710)GAC>GAT		protocadherin gamma subfamily A, 3 isoform 1							108.0	119.0	115.0					5																	140725310		2203	4300	6503	SO:0001819	synonymous_variant	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140725310C>T	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1710C>T	5.37:g.140725310C>T			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Silent_p.D330D|PCDHGA3_uc011dap.1_Silent_p.D570D	p.D570D	NM_018916	NP_061739	WXS	Illumina HiSeq	Unspecified	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1710	+			570			Extracellular (Potential).|Cadherin 6.		Q9Y5D4	Silent	SNP	ENST00000253812.6	37	c.1710C>T	CCDS47290.1																																																																																				0.672	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		28	176	0	0	0	0.008361	0	28	176				
PDE6A	5145	broad.mit.edu	37	5	149286941	149286942	+	Splice_Site	DNP	CC	CC	AG			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:149286941_149286942CC>AG	ENST00000255266.5	-	7	1118	c.999_999GG>CT	c.(997-999)ccGG>ccCTg	p.P333P		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	333	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.?(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	GAGGTGGATTCCTGTGAAGGCC	0.5																																							uc003lrg.3		NA																	1	Unknown(1)		lung(1)	ovary(1)|pancreas(1)	2						c.e7-1		phosphodiesterase 6A																																				SO:0001630	splice_region_variant	5145				cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr5:149286941_149286942CC>AG		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.999_999delinsAG	5.37:g.149286941_149286942delinsAG			Somatic					p.P333_splice	NM_000440	NP_000431	WXS	Illumina HiSeq	Unspecified	P16499	PDE6A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		7	1119	-								Q0P638	Splice_Site	DNP	ENST00000255266.5	37	c.999_splice	CCDS4299.1																																																																																				0.500	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2		Silent	10	72	0	0	0	0.004672	0	10	72				
ADAMTS2	9509	broad.mit.edu	37	5	178552041	178552041	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr5:178552041G>T	ENST00000251582.7	-	19	2992	c.2891C>A	c.(2890-2892)cCc>cAc	p.P964H		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	964	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P964H(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GCGGCTCTCGGGCCGGGCGTC	0.706																																							uc003mjw.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(2890-2892)CCC>CAC		ADAM metallopeptidase with thrombospondin type 1							52.0	58.0	55.0					5																	178552041		2203	4298	6501	SO:0001583	missense	9509				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:178552041G>T	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2891C>A	5.37:g.178552041G>T	ENSP00000251582:p.Pro964His		Somatic					p.P964H	NM_014244	NP_055059	WXS	Illumina HiSeq	Unspecified	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)	19	2891	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	964			TSP type-1 3.			Missense_Mutation	SNP	ENST00000251582.7	37	c.2891C>A	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694940	0.88830	.	.	ENSG00000087116	ENST00000251582	T	0.64085	-0.08	5.31	4.44	0.53790	.	0.000000	0.56097	D	0.000030	D	0.87188	0.6115	H	0.99169	4.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91213	0.5000	10	0.87932	D	0	.	12.5947	0.56463	0.0795:0.0:0.9205:0.0	.	964	O95450	ATS2_HUMAN	H	964	ENSP00000251582:P964H	ENSP00000251582:P964H	P	-	2	0	ADAMTS2	178484647	1.000000	0.71417	0.856000	0.33681	0.972000	0.66771	9.475000	0.97721	1.235000	0.43724	0.655000	0.94253	CCC		0.706	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244		28	72	1	0	8.88839e-20	0.010818	2.04819e-19	28	72				
ATXN1	6310	broad.mit.edu	37	6	16327605	16327605	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr6:16327605G>A	ENST00000244769.4	-	8	1873	c.937C>T	c.(937-939)Cgg>Tgg	p.R313W	ATXN1_ENST00000436367.1_Missense_Mutation_p.R313W	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	313					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.R313W(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				TGCTGCAGCCGGCTGCTCTCA	0.677																																							uc003nbt.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|central_nervous_system(1)	4						c.(937-939)CGG>TGG		ataxin 1							34.0	40.0	38.0					6																	16327605		2203	4299	6502	SO:0001583	missense	6310				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association	g.chr6:16327605G>A	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.937C>T	6.37:g.16327605G>A	ENSP00000244769:p.Arg313Trp		Somatic				ATXN1_uc010jpi.2_Missense_Mutation_p.R313W|ATXN1_uc010jpj.1_Intron	p.R313W	NM_000332	NP_000323	WXS	Illumina HiSeq	Unspecified	P54253	ATX1_HUMAN			8	1908	-	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)	313					Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	c.937C>T	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.975463	0.53720	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.36699	1.24;1.24	4.73	-5.63	0.02474	.	0.132730	0.53938	D	0.000048	T	0.41442	0.1159	M	0.61703	1.905	0.36683	D	0.879173	D	0.89917	1.0	D	0.79784	0.993	T	0.60469	-0.7257	10	0.66056	D	0.02	-26.1096	17.1068	0.86665	0.0:0.0:0.2958:0.7042	.	313	P54253	ATX1_HUMAN	W	313	ENSP00000244769:R313W;ENSP00000416360:R313W	ENSP00000244769:R313W	R	-	1	2	ATXN1	16435584	0.998000	0.40836	0.810000	0.32431	0.609000	0.37215	0.259000	0.18405	-0.751000	0.04734	-0.521000	0.04368	CGG		0.677	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332		16	77	0	0	0	0.006122	0	16	77				
HIST1H3G	8355	broad.mit.edu	37	6	26271476	26271476	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr6:26271476G>T	ENST00000305910.3	-	1	136	c.137C>A	c.(136-138)aCc>aAc	p.T46N	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	46					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.T46N(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						CAGAGCCACGGTGCCGGGACG	0.637																																							uc003nhi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(136-138)ACC>AAC		H3 histone family, member H							54.0	58.0	57.0					6																	26271476		2203	4300	6503	SO:0001583	missense	8355				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26271476G>T	Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.137C>A	6.37:g.26271476G>T	ENSP00000439660:p.Thr46Asn		Somatic				uc003nhj.2_5'Flank|HIST1H2BI_uc003nhk.2_5'Flank	p.T46N	NM_003534	NP_003525	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	137	-			46					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000305910.3	37	c.137C>A	CCDS4602.1	.	.	.	.	.	.	.	.	.	.	.	14.47	2.545297	0.45280	.	.	ENSG00000256018	ENST00000305910	T	0.49139	0.79	4.42	4.42	0.53409	.	.	.	.	.	T	0.57888	0.2084	.	.	.	0.42777	D	0.993854	.	.	.	.	.	.	T	0.65340	-0.6192	6	0.87932	D	0	.	16.4001	0.83637	0.0:0.0:1.0:0.0	.	.	.	.	N	46	ENSP00000439660:T46N	ENSP00000439660:T46N	T	-	2	0	HIST1H3G	26379455	1.000000	0.71417	0.987000	0.45799	0.104000	0.19210	9.530000	0.98051	2.183000	0.69458	0.563000	0.77884	ACC		0.637	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040099.2	NM_003534		14	69	1	0	2.23348e-06	0.004007	3.74603e-06	14	69				
HTR1E	3354	broad.mit.edu	37	6	87725649	87725649	+	Silent	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr6:87725649G>T	ENST00000305344.5	+	2	1300	c.597G>T	c.(595-597)ctG>ctT	p.L199L		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	199					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.P194fs*20(1)|p.L199L(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	CTTTGATACTGATTCTCTATT	0.478																																							uc003pli.2		NA																	2	Deletion - Frameshift(1)|Substitution - coding silent(1)		lung(1)|breast(1)	ovary(2)|skin(1)	3						c.(595-597)CTG>CTT		5-hydroxytryptamine (serotonin) receptor 1E	Eletriptan(DB00216)						102.0	99.0	100.0					6																	87725649		2203	4300	6503	SO:0001819	synonymous_variant	3354				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity	g.chr6:87725649G>T		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.597G>T	6.37:g.87725649G>T			Somatic					p.L199L	NM_000865	NP_000856	WXS	Illumina HiSeq	Unspecified	P28566	5HT1E_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.055)	2	1300	+		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)	199			Helical; Name=5; (By similarity).		E1P503|Q9P1Y1	Silent	SNP	ENST00000305344.5	37	c.597G>T	CCDS5006.1																																																																																				0.478	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865		6	38	1	0	3.59834e-05	0.001168	5.74433e-05	6	38				
EPHA7	2045	broad.mit.edu	37	6	93956606	93956606	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr6:93956606C>A	ENST00000369303.4	-	15	2814	c.2630G>T	c.(2629-2631)cGt>cTt	p.R877L		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	877	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.R877L(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CCTTTCAGCACGCTCCTTTTG	0.423																																							uc003poe.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28						c.(2629-2631)CGT>CTT		ephrin receptor EphA7 precursor							114.0	110.0	111.0					6																	93956606		2203	4300	6503	SO:0001583	missense	2045					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr6:93956606C>A	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2630G>T	6.37:g.93956606C>A	ENSP00000358309:p.Arg877Leu		Somatic				EPHA7_uc003pof.2_Missense_Mutation_p.R872L|EPHA7_uc011eac.1_Missense_Mutation_p.R873L	p.R877L	NM_004440	NP_004431	WXS	Illumina HiSeq	Unspecified	Q15375	EPHA7_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0847)	15	2871	-		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)	877			Cytoplasmic (Potential).|Protein kinase.		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	c.2630G>T	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	35	5.454366	0.96223	.	.	ENSG00000135333	ENST00000369303	T	0.61510	0.1	5.74	5.74	0.90152	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.57651	0.2068	N	0.20445	0.575	0.80722	D	1	D;D;D	0.64830	0.993;0.993;0.994	D;P;D	0.66196	0.942;0.853;0.909	T	0.64419	-0.6412	10	0.87932	D	0	.	19.9265	0.97104	0.0:1.0:0.0:0.0	.	873;872;877	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	L	877	ENSP00000358309:R877L	ENSP00000358309:R877L	R	-	2	0	EPHA7	94013327	1.000000	0.71417	0.870000	0.34147	0.995000	0.86356	7.726000	0.84824	2.723000	0.93209	0.591000	0.81541	CGT		0.423	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			12	60	1	0	1.05317e-09	0.00245	2.00784e-09	12	60				
PTPRK	5796	broad.mit.edu	37	6	128306976	128306976	+	Silent	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr6:128306976C>A	ENST00000368215.3	-	22	3137	c.3138G>T	c.(3136-3138)acG>acT	p.T1046T	PTPRK_ENST00000532331.1_Silent_p.T1069T|PTPRK_ENST00000368210.3_Silent_p.T1065T|PTPRK_ENST00000368227.3_Silent_p.T1064T|PTPRK_ENST00000368213.5_Silent_p.T1053T|PTPRK_ENST00000368207.3_Silent_p.T1079T|PTPRK_ENST00000368226.4_Silent_p.T1047T			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1046	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T1047T(1)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CAGGCCAGCCCGTGAAATGGA	0.473																																							uc003qbk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8						c.(3136-3138)ACG>ACT		protein tyrosine phosphatase, receptor type, K							139.0	135.0	136.0					6																	128306976		2203	4300	6503	SO:0001819	synonymous_variant	5796				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr6:128306976C>A	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.3138G>T	6.37:g.128306976C>A			Somatic				PTPRK_uc003qbj.2_Silent_p.T1047T|PTPRK_uc010kfc.2_Silent_p.T1053T|PTPRK_uc011ebu.1_Silent_p.T1069T	p.T1046T	NM_002844	NP_002835	WXS	Illumina HiSeq	Unspecified	Q15262	PTPRK_HUMAN		all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)	22	3505	-			1046			Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).		B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Silent	SNP	ENST00000368215.3	37	c.3138G>T		.	.	.	.	.	.	.	.	.	.	C	7.202	0.593659	0.13875	.	.	ENSG00000152894	ENST00000415046	.	.	.	5.97	-10.1	0.00402	.	.	.	.	.	T	0.34629	0.0904	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59364	-0.7468	4	.	.	.	.	11.7802	0.52010	0.6084:0.0917:0.2999:0.0	.	.	.	.	L	340	.	.	R	-	2	0	PTPRK	128348669	0.005000	0.15991	0.725000	0.30721	0.991000	0.79684	-0.957000	0.03861	-1.929000	0.01057	-0.172000	0.13284	CGG		0.473	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1			13	53	1	0	4.93089e-13	0.00245	1.02889e-12	13	53				
C6orf118	168090	broad.mit.edu	37	6	165715464	165715464	+	Missense_Mutation	SNP	G	G	T	rs150870882	byFrequency	TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr6:165715464G>T	ENST00000230301.8	-	2	367	c.347C>A	c.(346-348)aCg>aAg	p.T116K	C6orf118_ENST00000543069.1_Missense_Mutation_p.T12K	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	116								p.T116K(1)		breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		GACCAGGGCCGTGTGGATGGT	0.667																																							uc003qum.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(346-348)ACG>AAG		hypothetical protein LOC168090							65.0	69.0	68.0					6																	165715464		2203	4300	6503	SO:0001583	missense	168090							g.chr6:165715464G>T		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.347C>A	6.37:g.165715464G>T	ENSP00000230301:p.Thr116Lys		Somatic				C6orf118_uc011egi.1_RNA	p.T116K	NM_144980	NP_659417	WXS	Illumina HiSeq	Unspecified	Q5T5N4	CF118_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)	2	383	-		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)	116					Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	37	c.347C>A	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.008247	0.35415	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.35605	1.3;1.68	5.31	4.45	0.53987	.	0.000000	0.64402	D	0.000001	T	0.41050	0.1142	M	0.61703	1.905	0.09310	N	0.99999	D	0.76494	0.999	D	0.69479	0.964	T	0.33240	-0.9876	10	0.72032	D	0.01	.	11.42	0.49976	0.0849:0.0:0.9151:0.0	.	116	Q5T5N4	CF118_HUMAN	K	116;12	ENSP00000230301:T116K;ENSP00000439288:T12K	ENSP00000230301:T116K	T	-	2	0	C6orf118	165635454	0.484000	0.25964	0.167000	0.22817	0.007000	0.05969	2.781000	0.47750	1.246000	0.43901	-0.137000	0.14449	ACG		0.667	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980		12	72	1	0	9.31168e-06	0.001855	1.49551e-05	12	72				
ZNF679	168417	broad.mit.edu	37	7	63720641	63720641	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr7:63720641G>T	ENST00000421025.1	+	3	351	c.82G>T	c.(82-84)Gag>Tag	p.E28*	ZNF679_ENST00000255746.4_Nonsense_Mutation_p.E28*	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	28	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E28*(1)		endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						ATTCTCTCTGGAGGAGTGGCA	0.398																																							uc003tsx.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(82-84)GAG>TAG		zinc finger protein 679							61.0	53.0	56.0					7																	63720641		692	1591	2283	SO:0001587	stop_gained	168417				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:63720641G>T	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.82G>T	7.37:g.63720641G>T	ENSP00000416809:p.Glu28*		Somatic					p.E28*	NM_153363	NP_699194	WXS	Illumina HiSeq	Unspecified	Q8IYX0	ZN679_HUMAN			3	351	+			28			KRAB.			Nonsense_Mutation	SNP	ENST00000421025.1	37	c.82G>T	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	a	8.650	0.898019	0.17686	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	.	.	.	0.195	-0.39	0.12450	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	4.6027	0.12361	0.3023:0.0:0.6977:0.0	.	.	.	.	X	28	.	ENSP00000255746:E28X	E	+	1	0	ZNF679	63358076	0.137000	0.22531	0.034000	0.17996	0.034000	0.12701	-0.146000	0.10250	-0.705000	0.05035	-0.699000	0.03677	GAG		0.398	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363		13	89	1	0	7.03913e-09	0.013537	1.29539e-08	13	89				
GAL3ST4	79690	broad.mit.edu	37	7	99758491	99758491	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr7:99758491G>A	ENST00000360039.4	-	4	913	c.521C>T	c.(520-522)tCc>tTc	p.S174F	C7orf43_ENST00000316937.3_5'Flank|C7orf43_ENST00000457641.1_5'Flank|GAL3ST4_ENST00000423751.1_Missense_Mutation_p.P73S|GAL3ST4_ENST00000413800.1_Missense_Mutation_p.S174F|GAL3ST4_ENST00000411994.1_Missense_Mutation_p.P73S|GAL3ST4_ENST00000426974.2_Missense_Mutation_p.S112F	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	174					cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)	p.S174F(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGATGAGGTGGATTTATAGTA	0.572																																							uc003utt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(520-522)TCC>TTC		galactose-3-O-sulfotransferase 4							56.0	56.0	56.0					7																	99758491		2203	4294	6497	SO:0001583	missense	79690				cell-cell signaling|oligosaccharide metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane|membrane fraction	3'-phosphoadenosine 5'-phosphosulfate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity	g.chr7:99758491G>A	AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.521C>T	7.37:g.99758491G>A	ENSP00000353142:p.Ser174Phe		Somatic				C7orf43_uc003utr.2_5'Flank|C7orf43_uc003uts.2_5'Flank|GAL3ST4_uc003utu.2_Missense_Mutation_p.S174F|GAL3ST4_uc010lgq.2_Missense_Mutation_p.S112F	p.S174F	NM_024637	NP_078913	WXS	Illumina HiSeq	Unspecified	Q96RP7	G3ST4_HUMAN			3	1538	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		174			Lumenal (Potential).		A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Missense_Mutation	SNP	ENST00000360039.4	37	c.521C>T	CCDS5688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.42|16.42	3.119521|3.119521	0.56505|0.56505	.|.	.|.	ENSG00000197093|ENSG00000197093	ENST00000423751;ENST00000411994|ENST00000413800;ENST00000360039;ENST00000426974	.|T;T;T	.|0.14516	.|2.5;2.5;2.5	5.35|5.35	4.41|4.41	0.53225|0.53225	.|.	.|0.981590	.|0.08326	.|U	.|0.963104	T|T	0.24044|0.24044	0.0582|0.0582	L|L	0.31664|0.31664	0.95|0.95	0.31784|0.31784	N|N	0.630468|0.630468	.|D;P	.|0.76494	.|0.999;0.953	.|D;P	.|0.87578	.|0.998;0.69	T|T	0.00770|0.00770	-1.1573|-1.1573	6|10	0.87932|0.10111	D|T	0|0.7	-16.0429|-16.0429	12.5012|12.5012	0.55955|0.55955	0.0:0.0:0.8322:0.1678|0.0:0.0:0.8322:0.1678	.|.	.|112;174	.|B4DWL8;Q96RP7	.|.;G3ST4_HUMAN	S|F	73|174;174;112	.|ENSP00000400451:S174F;ENSP00000353142:S174F;ENSP00000398304:S112F	ENSP00000414733:P73S|ENSP00000353142:S174F	P|S	-|-	1|2	0|0	GAL3ST4|GAL3ST4	99596427|99596427	0.002000|0.002000	0.14202|0.14202	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	1.068000|1.068000	0.30629|0.30629	2.518000|2.518000	0.84900|0.84900	0.511000|0.511000	0.50034|0.50034	CCA|TCC		0.572	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337495.2	NM_024637		9	65	0	0	0	0.006214	0	9	65				
LRRN3	54674	broad.mit.edu	37	7	110764827	110764827	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr7:110764827C>G	ENST00000422987.3	+	2	2830	c.1999C>G	c.(1999-2001)Cag>Gag	p.Q667E	LRRN3_ENST00000451085.1_Missense_Mutation_p.Q667E|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000452895.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.Q667E	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	667					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q667E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		GAATTACTTACAGAAACCAAC	0.418																																							uc003vft.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8						c.(1999-2001)CAG>GAG		leucine rich repeat neuronal 3 precursor							109.0	115.0	113.0					7																	110764827		2203	4300	6503	SO:0001583	missense	54674					integral to membrane		g.chr7:110764827C>G	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1999C>G	7.37:g.110764827C>G	ENSP00000412417:p.Gln667Glu		Somatic				IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_Missense_Mutation_p.Q667E|LRRN3_uc003vfs.3_Missense_Mutation_p.Q667E	p.Q667E	NM_001099660	NP_001093130	WXS	Illumina HiSeq	Unspecified	Q9H3W5	LRRN3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)	4	3045	+			667			Cytoplasmic (Potential).		O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	c.1999C>G	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.758746	0.49468	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	T;T;T	0.48522	0.81;0.81;0.81	5.66	4.76	0.60689	.	0.322800	0.26820	N	0.022322	T	0.48095	0.1481	M	0.66939	2.045	0.24909	N	0.992052	B	0.12630	0.006	B	0.14023	0.01	T	0.47289	-0.9129	10	0.54805	T	0.06	.	14.1361	0.65289	0.3254:0.6746:0.0:0.0	.	667	Q9H3W5	LRRN3_HUMAN	E	667	ENSP00000312001:Q667E;ENSP00000397312:Q667E;ENSP00000412417:Q667E	ENSP00000312001:Q667E	Q	+	1	0	LRRN3	110552063	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.630000	0.54273	1.481000	0.48307	0.655000	0.94253	CAG		0.418	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334		25	94	0	0	0	0.007291	0	25	94				
PLXNA4	91584	broad.mit.edu	37	7	131859563	131859563	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr7:131859563C>A	ENST00000359827.3	-	21	4953	c.3991G>T	c.(3991-3993)Gac>Tac	p.D1331Y	PLXNA4_ENST00000321063.4_Missense_Mutation_p.D1331Y			Q9HCM2	PLXA4_HUMAN	plexin A4	1331					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.D1331Y(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						ACAGGGTGGTCTTCAATTCCT	0.557																																							uc003vra.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(3991-3993)GAC>TAC		plexin A4 isoform 1							112.0	119.0	117.0					7																	131859563		2133	4272	6405	SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131859563C>A	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.3991G>T	7.37:g.131859563C>A	ENSP00000352882:p.Asp1331Tyr		Somatic					p.D1331Y	NM_020911	NP_065962	WXS	Illumina HiSeq	Unspecified	Q9HCM2	PLXA4_HUMAN			21	4220	-			1331			Cytoplasmic (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	c.3991G>T	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511352	0.85389	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.12569	2.67;2.67	5.59	5.59	0.84812	Plexin, cytoplasmic RasGAP domain (1);	0.087086	0.85682	D	0.000000	T	0.46112	0.1376	M	0.86420	2.815	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	T	0.51276	-0.8726	10	0.72032	D	0.01	.	19.5911	0.95511	0.0:1.0:0.0:0.0	.	1331	Q9HCM2	PLXA4_HUMAN	Y	1331	ENSP00000323194:D1331Y;ENSP00000352882:D1331Y	ENSP00000323194:D1331Y	D	-	1	0	PLXNA4	131510103	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.792000	0.85828	2.643000	0.89663	0.655000	0.94253	GAC		0.557	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		34	64	1	0	1.04352e-10	0.003755	2.03332e-10	34	64				
SSPO	23145	broad.mit.edu	37	7	149503133	149503133	+	RNA	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr7:149503133G>T	ENST00000378016.2	+	0	8637							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ACTGCAACACGCAGCCCTGCA	0.637																																							uc010lpk.2		NA																	0					0						c.(8635-8637)ACG>ACT		SCO-spondin precursor							56.0	66.0	63.0					7																	149503133		2102	4223	6325			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149503133G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149503133G>T			Somatic					p.T2879T	NM_198455	NP_940857	WXS	Illumina HiSeq	Unspecified	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		59	8637	+	Melanoma(164;0.165)|Ovarian(565;0.177)		2879			TSP type-1 8.		Q76B61	Silent	SNP	ENST00000378016.2	37	c.8637G>T																																																																																					0.637	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				7	42	1	0	8.12818e-05	0.001984	0.000128212	7	42				
POLR3D	661	broad.mit.edu	37	8	22105494	22105494	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr8:22105494G>T	ENST00000397802.4	+	3	549	c.334G>T	c.(334-336)Ggc>Tgc	p.G112C	POLR3D_ENST00000306433.4_Missense_Mutation_p.G112C|MIR320A_ENST00000385302.1_RNA			P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide D, 44kDa	112					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.G112C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	13				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		CTTTGAGCAGGGCCCAGCTGA	0.522																																							uc003xbl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(334-336)GGC>TGC		polymerase (RNA) III (DNA directed) polypeptide							115.0	105.0	109.0					8																	22105494		2203	4300	6503	SO:0001583	missense	661				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity	g.chr8:22105494G>T	M17754	CCDS34858.1	8q21	2013-01-21	2003-04-01	2003-04-04	ENSG00000168495	ENSG00000168495		"""RNA polymerase subunits"""	1080	protein-coding gene	gene with protein product		187280	"""BN51 (BHK21) temperature sensitivity complementing"""	BN51T		12391170, 11279001	Standard	NM_001722		Approved	TSBN51, RPC4	uc003xbl.3	P05423	OTTHUMG00000163778	ENST00000397802.4:c.334G>T	8.37:g.22105494G>T	ENSP00000380904:p.Gly112Cys		Somatic				uc011kzd.1_5'Flank|MIR320A_hsa-mir-320a|MI0000542_5'Flank|POLR3D_uc003xbm.2_Missense_Mutation_p.G112C|POLR3D_uc011kze.1_RNA	p.G112C	NM_001722	NP_001713	WXS	Illumina HiSeq	Unspecified	P05423	RPC4_HUMAN		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)	4	417	+			112					Q6FI28|Q9BPV7|Q9BPZ1|Q9BXB3	Missense_Mutation	SNP	ENST00000397802.4	37	c.334G>T	CCDS34858.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807120	0.90623	.	.	ENSG00000168495	ENST00000306433;ENST00000519237;ENST00000397802	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.83464	0.5260	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85064	0.0936	9	0.87932	D	0	-15.4321	18.7009	0.91620	0.0:0.0:1.0:0.0	.	112	P05423	RPC4_HUMAN	C	112	.	ENSP00000303088:G112C	G	+	1	0	POLR3D	22161439	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.413000	0.97351	2.695000	0.91970	0.655000	0.94253	GGC		0.522	POLR3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375434.2	NM_001722		24	38	1	0	1.85244e-09	0.00333	3.48154e-09	24	38				
POTEA	340441	broad.mit.edu	37	8	43171053	43171053	+	RNA	SNP	A	A	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr8:43171053A>T	ENST00000522175.2	+	0	788							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A									p.T308T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TAAAGCTGACATCAGAGGAAG	0.279																																							uc003xpz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(922-924)ACA>ACT		POTE ankyrin domain family, member A isoform 2							43.0	45.0	45.0					8																	43171053		2071	4243	6314			340441							g.chr8:43171053A>T	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43171053A>T			Somatic				POTEA_uc003xqa.1_Silent_p.T262T	p.T308T	NM_001005365	NP_001005365	WXS	Illumina HiSeq	Unspecified	Q6S8J7	POTEA_HUMAN			7	967	+			308					A6ND17|A6ND71|Q6S8J6	Silent	SNP	ENST00000522175.2	37	c.924A>T																																																																																					0.279	POTEA-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000383492.1	NM_001002920		30	62	0	0	0	0.003271	0	30	62				
ANXA2P2	304	broad.mit.edu	37	9	33624919	33624919	+	IGR	SNP	C	C	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr9:33624919C>G								TRBV20OR9-2 (6415 upstream) : TRBV21OR9-2 (4199 downstream)														p.I216M(1)									GGATCAGCATCATGACCGAGC	0.468																																							uc010mjx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(646-648)ATC>ATG		annexin A2 isoform 2																																				SO:0001628	intergenic_variant	304							g.chr9:33624919C>G																													9.37:g.33624919C>G			Somatic					p.I216M	NM_004039	NP_004030	WXS	Illumina HiSeq	Unspecified					1	697	+									Missense_Mutation	SNP		37	c.648C>G																																																																																				0	0.468									8	44	0	0	0	0.004482	0	8	44				
SPATA31A3	727830	broad.mit.edu	37	9	40702806	40702806	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr9:40702806C>A	ENST00000356699.5	+	4	492	c.463C>A	c.(463-465)Ccg>Acg	p.P155T	RP11-395E19.5_ENST00000432614.1_lincRNA|SPATA31A3_ENST00000463536.1_3'UTR	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	155	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GTTAGCTTCCCCGGATCCTCA	0.602																																							uc010mmj.2		NA																	0				ovary(2)|skin(1)	3						c.(463-465)CCG>ACG		hypothetical protein LOC727830							71.0	85.0	80.0					9																	40702806		1950	4122	6072	SO:0001583	missense	727830					integral to membrane		g.chr9:40702806C>A			9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.463C>A	9.37:g.40702806C>A	ENSP00000349132:p.Pro155Thr		Somatic					p.P155T	NM_001083124	NP_001076593	WXS	Illumina HiSeq	Unspecified	Q5VYP0	F75A3_HUMAN		GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)	4	492	+			155			Pro-rich.			Missense_Mutation	SNP	ENST00000356699.5	37	c.463C>A	CCDS47969.1	.	.	.	.	.	.	.	.	.	.	C	10.28	1.307330	0.23821	.	.	ENSG00000147926	ENST00000356699	T	0.04809	3.55	2.0	-2.86	0.05717	.	0.575965	0.13226	N	0.404032	T	0.05044	0.0135	L	0.41906	1.305	0.09310	N	1	P	0.50528	0.936	P	0.50192	0.634	T	0.24012	-1.0172	10	0.29301	T	0.29	-0.8816	2.2726	0.04095	0.4555:0.2885:0.0:0.256	.	155	Q5VYP0	F75A3_HUMAN	T	155	ENSP00000349132:P155T	ENSP00000349132:P155T	P	+	1	0	FAM75A3	40692806	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.084000	0.11268	-0.733000	0.04850	0.404000	0.27445	CCG		0.602	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036919.1	NM_001083124		53	373	1	0	2.41709e-19	0.01441	5.4746e-19	53	373				
ZNF462	58499	broad.mit.edu	37	9	109701363	109701363	+	Silent	SNP	G	G	T	rs374074936		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr9:109701363G>T	ENST00000277225.5	+	7	6691	c.6402G>T	c.(6400-6402)ccG>ccT	p.P2134P	ZNF462_ENST00000457913.1_Silent_p.P2194P|ZNF462_ENST00000441147.2_Silent_p.P1040P|ZNF462_ENST00000542028.1_Silent_p.P91P			Q96JM2	ZN462_HUMAN	zinc finger protein 462	2134					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P2134P(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						AAGCTACCCCGGCTGAAGAAG	0.532																																							uc004bcz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)	5						c.(6400-6402)CCG>CCT		zinc finger protein 462							129.0	129.0	129.0					9																	109701363		2203	4300	6503	SO:0001819	synonymous_variant	58499				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:109701363G>T	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.6402G>T	9.37:g.109701363G>T			Somatic				ZNF462_uc010mto.2_Silent_p.P2043P|ZNF462_uc004bda.2_Silent_p.P2042P|ZNF462_uc011lvz.1_Silent_p.P91P|ZNF462_uc004bdb.1_Silent_p.P42P	p.P2134P	NM_021224	NP_067047	WXS	Illumina HiSeq	Unspecified	Q96JM2	ZN462_HUMAN			7	6691	+			2134					Q5T0T4|Q8N408	Silent	SNP	ENST00000277225.5	37	c.6402G>T	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	G	0.311	-0.967642	0.02232	.	.	ENSG00000148143	ENST00000427098	.	.	.	5.71	-11.4	0.00090	.	.	.	.	.	T	0.44159	0.1280	.	.	.	0.43662	D	0.996086	.	.	.	.	.	.	T	0.56571	-0.7957	4	.	.	.	.	7.2409	0.26096	0.1518:0.1973:0.5601:0.0909	.	.	.	.	C	36	.	.	G	+	1	0	ZNF462	108741184	.	.	0.000000	0.03702	0.097000	0.18754	.	.	-3.147000	0.00231	-1.004000	0.02495	GGC		0.532	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224		20	116	1	0	2.37509e-13	0.010504	4.99523e-13	20	116				
ODF2	4957	broad.mit.edu	37	9	131231471	131231471	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr9:131231471C>T	ENST00000434106.3	+	5	622	c.259C>T	c.(259-261)Cat>Tat	p.H87Y	ODF2_ENST00000535026.1_Intron|ODF2_ENST00000351030.3_Missense_Mutation_p.H82Y|RP11-339B21.9_ENST00000420801.1_RNA|ODF2_ENST00000393527.3_Missense_Mutation_p.H63Y|ODF2_ENST00000604420.1_Missense_Mutation_p.H87Y|ODF2_ENST00000372807.5_Missense_Mutation_p.H82Y|ODF2_ENST00000372791.3_Missense_Mutation_p.H68Y|ODF2_ENST00000448249.3_Intron|ODF2_ENST00000393533.2_Missense_Mutation_p.H87Y|ODF2_ENST00000372814.3_Missense_Mutation_p.H131Y|ODF2_ENST00000546203.1_Missense_Mutation_p.H68Y|ODF2_ENST00000444119.2_Missense_Mutation_p.H63Y	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	87					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)	p.H87Y(1)|p.H63Y(1)|p.H131Y(1)		autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						GAATCCACCTCATTGCCTGGA	0.473																																							uc011mbd.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(259-261)CAT>TAT		outer dense fiber of sperm tails 2 isoform 1							155.0	132.0	140.0					9																	131231471		2203	4300	6503	SO:0001583	missense	4957				cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity	g.chr9:131231471C>T	AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.259C>T	9.37:g.131231471C>T	ENSP00000403453:p.His87Tyr		Somatic				ODF2_uc011maz.1_Missense_Mutation_p.H87Y|ODF2_uc011mba.1_Intron|ODF2_uc010myb.2_Missense_Mutation_p.H63Y|ODF2_uc011mbb.1_Missense_Mutation_p.H21Y|ODF2_uc011mbc.1_Intron|ODF2_uc004bva.2_Missense_Mutation_p.H40Y|ODF2_uc004bvb.2_Missense_Mutation_p.H63Y|ODF2_uc011mbe.1_Missense_Mutation_p.H82Y|ODF2_uc004bvc.2_Missense_Mutation_p.H63Y|ODF2_uc010myc.2_Intron|ODF2_uc011mbf.1_Missense_Mutation_p.H68Y|ODF2_uc004bvd.3_Missense_Mutation_p.H87Y|ODF2_uc004bve.2_Missense_Mutation_p.H68Y	p.H87Y	NM_002540	NP_002531	WXS	Illumina HiSeq	Unspecified	Q5BJF6	ODFP2_HUMAN			5	570	+			87					B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	ENST00000434106.3	37	c.259C>T	CCDS56588.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576539	0.65878	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000444119;ENST00000434106;ENST00000546203;ENST00000446274;ENST00000372791	T;T;T;T;T;T;T;T;T	0.38722	1.25;1.29;1.69;1.7;1.68;1.68;1.7;1.12;1.14	5.97	5.97	0.96955	.	0.094174	0.64402	D	0.000001	T	0.61350	0.2340	L	0.53249	1.67	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.999;0.998;0.994;0.999;0.999;0.994;0.999;0.998	D;D;P;D;D;P;D;P	0.67725	0.943;0.917;0.857;0.953;0.938;0.899;0.948;0.876	T	0.60439	-0.7263	10	0.72032	D	0.01	-8.9684	18.9809	0.92755	0.0:1.0:0.0:0.0	.	68;82;21;87;82;68;87;63	Q5BJF6-8;Q5BJF6-4;Q5BJF6-2;B4DX73;B1AND4;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;.;ODFP2_HUMAN;.	Y	87;131;82;87;63;63;87;68;68;68	ENSP00000377166:H87Y;ENSP00000361901:H131Y;ENSP00000342581:H82Y;ENSP00000361882:H87Y;ENSP00000307781:H63Y;ENSP00000394506:H63Y;ENSP00000403453:H87Y;ENSP00000437579:H68Y;ENSP00000361877:H68Y	ENSP00000307781:H63Y	H	+	1	0	ODF2	130271292	1.000000	0.71417	1.000000	0.80357	0.330000	0.28571	3.944000	0.56629	2.832000	0.97577	0.585000	0.79938	CAT		0.473	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3			21	96	0	0	0	0.014323	0	21	96				
CAMSAP1	157922	broad.mit.edu	37	9	138713008	138713008	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr9:138713008C>A	ENST00000389532.4	-	11	3563	c.3499G>T	c.(3499-3501)Gac>Tac	p.D1167Y	CAMSAP1_ENST00000312405.6_Missense_Mutation_p.D889Y|CAMSAP1_ENST00000409386.3_Missense_Mutation_p.D1178Y|CAMSAP1_ENST00000483991.1_5'UTR	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	1167					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)	p.D1167Y(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CTGTAACTGTCGAAGAGACAC	0.567																																							uc004cgr.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(3499-3501)GAC>TAC		calmodulin regulated spectrin-associated protein							96.0	100.0	99.0					9																	138713008		2203	4300	6503	SO:0001583	missense	157922					cytoplasm|microtubule		g.chr9:138713008C>A	AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.3499G>T	9.37:g.138713008C>A	ENSP00000374183:p.Asp1167Tyr		Somatic				CAMSAP1_uc004cgq.3_Missense_Mutation_p.D1057Y|CAMSAP1_uc010nbg.2_Missense_Mutation_p.D889Y	p.D1167Y	NM_015447	NP_056262	WXS	Illumina HiSeq	Unspecified	Q5T5Y3	CAMP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)	11	3499	-			1167					A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	c.3499G>T	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237375	0.58886	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.15017	2.46;2.46;2.46	5.29	5.29	0.74685	.	0.313320	0.32884	N	0.005528	T	0.38558	0.1045	M	0.68317	2.08	0.24790	N	0.992767	D;D	0.63046	0.992;0.992	P;P	0.58391	0.818;0.838	T	0.15321	-1.0441	10	0.87932	D	0	-2.7182	19.271	0.94010	0.0:1.0:0.0:0.0	.	1167;1178	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	Y	1167;889;1178	ENSP00000374183:D1167Y;ENSP00000312463:D889Y;ENSP00000386420:D1178Y	ENSP00000312463:D889Y	D	-	1	0	CAMSAP1	137852829	0.999000	0.42202	0.024000	0.17045	0.463000	0.32649	5.204000	0.65180	2.620000	0.88729	0.561000	0.74099	GAC		0.567	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857		17	118	1	0	1.56452e-12	0.007413	3.16488e-12	17	118				
ZNF630	57232	broad.mit.edu	37	X	47918714	47918714	+	Missense_Mutation	SNP	T	T	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chrX:47918714T>G	ENST00000409324.3	-	5	1343	c.1117A>C	c.(1117-1119)Aag>Cag	p.K373Q	ZNF630_ENST00000442455.3_Missense_Mutation_p.K359Q|ZNF630_ENST00000276054.4_Missense_Mutation_p.K249Q|ZNF630-AS1_ENST00000436124.1_RNA	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K373Q(1)		endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						TCAAAGGGCTTCTCTCTGGTA	0.418																																							uc004div.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(1117-1119)AAG>CAG		zinc finger protein 630							80.0	73.0	75.0					X																	47918714		2194	4288	6482	SO:0001583	missense	57232				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:47918714T>G	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.1117A>C	X.37:g.47918714T>G	ENSP00000386393:p.Lys373Gln		Somatic				ZNF630_uc010nhz.1_Intron|ZNF630_uc004diw.2_Missense_Mutation_p.K249Q	p.K373Q	NM_001037735	NP_001032824	WXS	Illumina HiSeq	Unspecified	Q2M218	ZN630_HUMAN			5	1369	-			373					F8WAG4|Q5H8Z5	Missense_Mutation	SNP	ENST00000409324.3	37	c.1117A>C	CCDS35237.2	.	.	.	.	.	.	.	.	.	.	.	9.184	1.024339	0.19433	.	.	ENSG00000221994	ENST00000442455;ENST00000276054;ENST00000409324	T;T;T	0.27104	1.69;1.69;1.69	2.31	2.31	0.28768	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25419	0.0618	M	0.68728	2.09	0.22666	N	0.99887	B	0.31026	0.304	B	0.26202	0.067	T	0.21827	-1.0234	9	0.87932	D	0	.	7.6956	0.28592	0.0:0.0:0.0:1.0	.	373	Q2M218	ZN630_HUMAN	Q	359;249;373	ENSP00000393163:K359Q;ENSP00000354683:K249Q;ENSP00000386393:K373Q	ENSP00000354683:K249Q	K	-	1	0	ZNF630	47803658	0.996000	0.38824	0.023000	0.16930	0.041000	0.13682	3.165000	0.50778	0.961000	0.38030	0.441000	0.28932	AAG		0.418	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1	NM_001037735		28	19	0	0	0	0.009535	0	28	19				
TEX13A	56157	broad.mit.edu	37	X	104463895	104463895	+	Silent	SNP	T	T	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chrX:104463895T>A	ENST00000413579.1	-	5	1092	c.981A>T	c.(979-981)ccA>ccT	p.P327P	IL1RAPL2_ENST00000372582.1_Intron|TEX13A_ENST00000372575.1_Missense_Mutation_p.Q328L|IL1RAPL2_ENST00000344799.4_Intron|TEX13A_ENST00000372578.3_Missense_Mutation_p.Q328L			Q9BXU3	TX13A_HUMAN	testis expressed 13A	327							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						GAGGCGGAACTGGTGCTGTGA	0.542																																							uc004ema.2		NA																	0				ovary(2)	2						c.(979-981)CCA>CCT		testis expressed sequence 13A							108.0	102.0	104.0					X																	104463895		2160	4269	6429	SO:0001819	synonymous_variant	56157					intracellular	zinc ion binding	g.chrX:104463895T>A	AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.981A>T	X.37:g.104463895T>A			Somatic				IL1RAPL2_uc004elz.1_Intron|TEX13A_uc004emb.2_Missense_Mutation_p.Q328L	p.P327P	NM_031274	NP_112564	WXS	Illumina HiSeq	Unspecified	Q9BXU3	TX13A_HUMAN			5	1093	-			327					B1B1G8|Q32NB6	Silent	SNP	ENST00000413579.1	37	c.981A>T		.	.	.	.	.	.	.	.	.	.	T	4.703	0.130764	0.08981	.	.	ENSG00000133149	ENST00000372578;ENST00000372575	.	.	.	3.05	-3.56	0.04626	.	.	.	.	.	T	0.34513	0.0900	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.42666	-0.9438	5	0.87932	D	0	.	4.5439	0.12071	0.6403:0.1353:0.0:0.2243	.	.	.	.	L	328	.	ENSP00000361656:Q328L	Q	-	2	0	TEX13A	104350551	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.224000	0.09164	-0.915000	0.03823	-0.799000	0.03217	CAG		0.542	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_031274		21	22	0	0	0	0.014323	0	21	22				
ENOX2	10495	broad.mit.edu	37	X	129759305	129759305	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chrX:129759305C>A	ENST00000370927.1	-	13	1837	c.1816G>T	c.(1816-1818)Ggc>Tgc	p.G606C	ENOX2_ENST00000370935.1_Missense_Mutation_p.G577C|ENOX2_ENST00000394363.1_Missense_Mutation_p.G577C|ENOX2_ENST00000338144.3_Missense_Mutation_p.G606C			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	606					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						AGCTTCAAGCCCTCGAAGCCA	0.423																																					Ovarian(101;828 1506 2951 9500 35258)	Ovarian(101;828 1506 2951 9500 35258)	uc004evw.2		NA																	0				ovary(1)	1						c.(1816-1818)GGC>TGC		ecto-NOX disulfide-thiol exchanger 2 isoform b							118.0	96.0	103.0					X																	129759305		2203	4300	6503	SO:0001583	missense	10495				cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity	g.chrX:129759305C>A	AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.1816G>T	X.37:g.129759305C>A	ENSP00000359965:p.Gly606Cys		Somatic				ENOX2_uc004evx.2_Missense_Mutation_p.G577C|ENOX2_uc004evy.2_Missense_Mutation_p.G577C|ENOX2_uc004evv.2_Missense_Mutation_p.G431C	p.G606C	NM_182314	NP_872114	WXS	Illumina HiSeq	Unspecified	Q16206	ENOX2_HUMAN			16	2234	-			606					A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	ENST00000370927.1	37	c.1816G>T	CCDS14626.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826423	0.71143	.	.	ENSG00000165675	ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.68430	0.3000	L	0.45581	1.43	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	T	0.70846	-0.4761	9	0.87932	D	0	-10.6331	12.5197	0.56052	0.0:1.0:0.0:0.0	.	606;634	Q16206;A4QPE1	ENOX2_HUMAN;.	C	577;606;577;634;606	.	ENSP00000337146:G606C	G	-	1	0	ENOX2	129586986	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.120000	0.64685	2.447000	0.82792	0.538000	0.68166	GGC		0.423	ENOX2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058277.1	NM_182314		44	60	1	0	3.73646e-36	0.01441	9.34114e-36	44	60				
SLITRK2	84631	broad.mit.edu	37	X	144905997	144905997	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chrX:144905997A>T	ENST00000370490.1	+	1	6309	c.2054A>T	c.(2053-2055)tAc>tTc	p.Y685F	SLITRK2_ENST00000413937.2_Missense_Mutation_p.Y685F|TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000447897.2_Missense_Mutation_p.Y685F|SLITRK2_ENST00000428560.2_Missense_Mutation_p.Y685F|SLITRK2_ENST00000434188.2_Missense_Mutation_p.Y685F			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	685					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.Y685F(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GGCCATGTCTACAACTATATC	0.473																																							uc004fcd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(2053-2055)TAC>TTC		SLIT and NTRK-like family, member 2 precursor							75.0	68.0	70.0					X																	144905997		2203	4300	6503	SO:0001583	missense	84631					integral to membrane		g.chrX:144905997A>T	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2054A>T	X.37:g.144905997A>T	ENSP00000359521:p.Tyr685Phe		Somatic				SLITRK2_uc010nsp.2_Missense_Mutation_p.Y685F|SLITRK2_uc010nso.2_Missense_Mutation_p.Y685F|SLITRK2_uc011mwq.1_Missense_Mutation_p.Y685F|SLITRK2_uc011mwr.1_Missense_Mutation_p.Y685F|SLITRK2_uc011mws.1_Missense_Mutation_p.Y685F|SLITRK2_uc004fcg.2_Missense_Mutation_p.Y685F|SLITRK2_uc011mwt.1_Missense_Mutation_p.Y685F|CXorf1_uc004fch.2_5'Flank	p.Y685F	NM_032539	NP_115928	WXS	Illumina HiSeq	Unspecified	Q9H156	SLIK2_HUMAN			5	3044	+	Acute lymphoblastic leukemia(192;6.56e-05)		685			Cytoplasmic (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.2054A>T	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	A	19.03	3.747732	0.69533	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.58210	0.54;0.35;0.35;0.35;0.35;0.35	5.67	5.67	0.87782	.	0.064498	0.64402	D	0.000005	T	0.60856	0.2301	M	0.69823	2.125	0.49687	D	0.999817	P	0.45348	0.856	P	0.49361	0.608	T	0.61969	-0.6953	10	0.39692	T	0.17	-7.701	12.6934	0.56988	1.0:0.0:0.0:0.0	.	685	Q9H156	SLIK2_HUMAN	F	685	ENSP00000334374:Y685F;ENSP00000411681:Y685F;ENSP00000359521:Y685F;ENSP00000397015:Y685F;ENSP00000407347:Y685F;ENSP00000412010:Y685F	ENSP00000334374:Y685F	Y	+	2	0	SLITRK2	144713689	1.000000	0.71417	0.996000	0.52242	0.954000	0.61252	7.517000	0.81783	1.904000	0.55121	0.486000	0.48141	TAC		0.473	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		38	41	0	0	0	0.006999	0	38	41				
SSR4	6748	broad.mit.edu	37	X	153060161	153060161	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chrX:153060161C>G	ENST00000320857.3	+	2	1103	c.19C>G	c.(19-21)Ctc>Gtc	p.L7V	SSR4_ENST00000370086.3_Missense_Mutation_p.L7V|SSR4_ENST00000460616.1_3'UTR|IDH3G_ENST00000427365.2_5'Flank|SSR4_ENST00000370087.1_Missense_Mutation_p.L7V|SSR4_ENST00000370085.3_Missense_Mutation_p.L7V|IDH3G_ENST00000370092.3_5'Flank|IDH3G_ENST00000497043.1_5'Flank|IDH3G_ENST00000217901.5_5'Flank|IDH3G_ENST00000370093.1_5'Flank	NM_001204526.1	NP_001191455.1	P51571	SSRD_HUMAN	signal sequence receptor, delta	7					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|Sec61 translocon complex (GO:0005784)		p.L7V(1)		central_nervous_system(1)|endometrium(1)|lung(2)	4	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GATGGCATCTCTCGGCGCCCT	0.637																																							uc004fiw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(19-21)CTC>GTC		signal sequence receptor, delta precursor							46.0	37.0	40.0					X																	153060161		2200	4299	6499	SO:0001583	missense	6748				intracellular protein transport	integral to membrane|Sec61 translocon complex	calcium ion binding|protein binding	g.chrX:153060161C>G	BC032351	CCDS14731.1	Xq28	2011-08-31	2011-08-31		ENSG00000180879	ENSG00000180879			11326	protein-coding gene	gene with protein product	"""translocon-associated protein delta"""	300090				9286695	Standard	NM_001204526		Approved	TRAPD	uc022chw.1	P51571	OTTHUMG00000024212	ENST00000320857.3:c.19C>G	X.37:g.153060161C>G	ENSP00000317331:p.Leu7Val		Somatic				IDH3G_uc004fio.2_5'Flank|IDH3G_uc004fip.2_5'Flank|IDH3G_uc004fiq.2_5'Flank|IDH3G_uc010num.2_5'Flank|IDH3G_uc004fir.2_5'Flank|IDH3G_uc004fit.1_5'Flank|IDH3G_uc004fis.2_5'Flank|SSR4_uc004fiv.2_Missense_Mutation_p.L18V	p.L7V	NM_006280	NP_006271	WXS	Illumina HiSeq	Unspecified	P51571	SSRD_HUMAN			1	68	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		7					A8K378|Q53XY1	Missense_Mutation	SNP	ENST00000320857.3	37	c.19C>G	CCDS14731.1	.	.	.	.	.	.	.	.	.	.	C	0.124	-1.121587	0.01785	.	.	ENSG00000180879	ENST00000320857;ENST00000370087;ENST00000370086;ENST00000370085	T;T;T;T	0.45668	0.93;0.93;0.93;0.89	4.67	2.86	0.33363	.	0.340919	0.30036	N	0.010572	T	0.20901	0.0503	N	0.08118	0	0.19775	N	0.999951	P;B	0.51351	0.944;0.004	P;B	0.44696	0.458;0.038	T	0.11203	-1.0597	10	0.14252	T	0.57	-19.6892	6.8584	0.24054	0.0:0.7635:0.0:0.2365	.	7;7	P51571;A6NLM8	SSRD_HUMAN;.	V	7	ENSP00000317331:L7V;ENSP00000359104:L7V;ENSP00000359103:L7V;ENSP00000359102:L7V	ENSP00000317331:L7V	L	+	1	0	SSR4	152713355	0.127000	0.22367	0.391000	0.26233	0.014000	0.08584	-0.151000	0.10175	0.462000	0.27095	-0.295000	0.09555	CTC		0.637	SSR4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061029.1	NM_006280		18	14	0	0	0	0.007413	0	18	14				
MST1L	11223	broad.mit.edu	37	1	17086085	17086086	+	RNA	INS	-	-	C	rs200532237		TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr1:17086085_17086086insC	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										GGCAAGGTACGCCGCGGTGGTG	0.649																																							uc010ock.1		NA																	0					0						c.(811-813)GCGfs		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17086085_17086086insC	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17086087_17086087dupC			Somatic				CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	p.A271fs	NR_002729		WXS	Illumina HiSeq	Unspecified					7	811_812	-								B7WPB1|Q13209	Frame_Shift_Ins	INS	ENST00000455405.2	37	c.811_812insG																																																																																					0.649	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		3	5	NA	NA	NA	NA	NA	3	5	---	---	---	---
ASIC1	41	broad.mit.edu	37	12	50479213	50479213	+	IGR	DEL	G	G	-			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr12:50479213delG	ENST00000447966.2	+	0	3778				SMARCD1_ENST00000548573.1_5'Flank|SMARCD1_ENST00000381513.4_Frame_Shift_Del_p.G21fs|SMARCD1_ENST00000394963.4_Frame_Shift_Del_p.G21fs	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1						associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	AGCCTCAGGAGGGGCGGGCGC	0.736																																							uc001rvx.3		NA																	0				ovary(1)	1						c.(61-63)GGGfs		SWI/SNF-related matrix-associated							2.0	3.0	3.0					12																	50479213		1165	2892	4057	SO:0001628	intergenic_variant	6602				chromatin-mediated maintenance of transcription|nervous system development|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	protein complex scaffold|transcription coactivator activity	g.chr12:50479213delG	U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812		12.37:g.50479213delG			Somatic				SMARCD1_uc010smo.1_Frame_Shift_Del_p.G21fs|SMARCD1_uc001rvy.3_Frame_Shift_Del_p.G21fs|SMARCD1_uc009zlp.2_Frame_Shift_Del_p.G21fs	p.G21fs	NM_003076	NP_003067	WXS	Illumina HiSeq	Unspecified	Q96GM5	SMRD1_HUMAN			1	231	+			21					A3KN86|E5KBL7|P78349|Q96CV2	Frame_Shift_Del	DEL	ENST00000447966.2	37	c.61delG	CCDS44876.1																																																																																				0.736	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406004.2	NM_020039		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
FBN1	2200	broad.mit.edu	37	15	48757810	48757811	+	In_Frame_Ins	INS	-	-	GCG			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr15:48757810_48757811insGCG	ENST00000316623.5	-	40	5351_5352	c.4896_4897insCGC	c.(4894-4899)cgctgt>cgcCGCtgt	p.1632_1633insR		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1632	EGF-like 27; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CCGGTTGGACAGCGGCACTGGA	0.46																																							uc001zwx.1		NA																	0				ovary(2)|large_intestine(1)	3						c.(4894-4899)insCGC		fibrillin 1 precursor																																				SO:0001652	inframe_insertion	2200				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding	g.chr15:48757810_48757811insGCG	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.4894_4896dupCGC	15.37:g.48757811_48757813dupGCG	ENSP00000325527:p.Arg1632_Arg1632dup		Somatic				FBN1_uc010beo.1_RNA	p.1632_1633insR	NM_000138	NP_000129	WXS	Illumina HiSeq	Unspecified	P35555	FBN1_HUMAN		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)	40	5224_5225	-		all_lung(180;0.00279)	1632_1633			EGF-like 27; calcium-binding.		B2RUU0|D2JYH6|Q15972|Q75N87	In_Frame_Ins	INS	ENST00000316623.5	37	c.4896_4897insCGC	CCDS32232.1																																																																																				0.460	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1			7	120	NA	NA	NA	NA	NA	7	120	---	---	---	---
ABCC11	85320	broad.mit.edu	37	16	48244967	48244967	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr16:48244967delG	ENST00000394747.1	-	10	1849	c.1500delC	c.(1498-1500)aacfs	p.N500fs	ABCC11_ENST00000353782.5_Frame_Shift_Del_p.N500fs|ABCC11_ENST00000356608.2_Frame_Shift_Del_p.N500fs|ABCC11_ENST00000394748.1_Frame_Shift_Del_p.N500fs|ABCC11_ENST00000537808.1_Frame_Shift_Del_p.N500fs	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	500					organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	AAGCATGCCCGTTCCTCTCCA	0.592																																							uc002eff.1		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1498-1500)AACfs		ATP-binding cassette, sub-family C, member 11							111.0	96.0	101.0					16																	48244967		2201	4300	6501	SO:0001589	frameshift_variant	85320	Cerumen_Type				integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:48244967delG	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1500delC	16.37:g.48244967delG	ENSP00000378230:p.Asn500fs		Somatic				ABCC11_uc002efg.1_Frame_Shift_Del_p.N500fs|ABCC11_uc002efh.1_Frame_Shift_Del_p.N500fs|ABCC11_uc010vgk.1_RNA	p.N500fs	NM_033151	NP_149163	WXS	Illumina HiSeq	Unspecified	Q96J66	ABCCB_HUMAN			10	1850	-		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)	500			Cytoplasmic (Potential).		Q8TDJ0|Q96JA6|Q9BX80	Frame_Shift_Del	DEL	ENST00000394747.1	37	c.1500delC	CCDS10732.1																																																																																				0.592	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583		16	60	NA	NA	NA	NA	NA	16	60	---	---	---	---
IGFLR1	79713	broad.mit.edu	37	19	36231408	36231408	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:36231408delG	ENST00000592537.1	-	3	315	c.215delC	c.(214-216)ccgfs	p.P72fs	AD000671.6_ENST00000589807.1_3'UTR|IGFLR1_ENST00000344990.3_Intron|IGFLR1_ENST00000592889.1_Intron|KMT2B_ENST00000607650.1_RNA|IGFLR1_ENST00000588992.1_Intron|IGFLR1_ENST00000587101.1_5'UTR|IGFLR1_ENST00000246532.1_Frame_Shift_Del_p.P72fs			Q9H665	IGFR1_HUMAN	IGF-like family receptor 1	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(3)|large_intestine(1)|lung(8)|prostate(1)	15						CTTTCGGAACGGGGGCGTTAC	0.672																																							uc002obc.2		NA																	0					0						c.(214-216)CCGfs		transmembrane protein 149 precursor							39.0	35.0	36.0					19																	36231408		2202	4298	6500	SO:0001589	frameshift_variant	79713					integral to membrane|plasma membrane	protein binding|receptor activity	g.chr19:36231408delG	AK026226	CCDS12472.1	19q13.12	2012-10-02	2011-04-04	2011-04-04	ENSG00000126246	ENSG00000126246			23620	protein-coding gene	gene with protein product		614143	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 4"", ""transmembrane protein 149"""	U2AF1L4, TMEM149		21454693	Standard	NM_024660		Approved	FLJ22573	uc002obd.4	Q9H665		ENST00000592537.1:c.215delC	19.37:g.36231408delG	ENSP00000466181:p.Pro72fs		Somatic				TMEM149_uc002obb.2_Intron|TMEM149_uc002obd.3_Frame_Shift_Del_p.P72fs|TMEM149_uc010xsy.1_RNA|TMEM149_uc010eej.2_Frame_Shift_Del_p.P152fs	p.P72fs	NM_024660	NP_078936	WXS	Illumina HiSeq	Unspecified	Q9H665	IGFR1_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)		3	316	-	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		72			Extracellular (Potential).		Q8N5X0	Frame_Shift_Del	DEL	ENST00000592537.1	37	c.215delC	CCDS12472.1																																																																																				0.672	IGFLR1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459077.1	NM_024660		7	53	NA	NA	NA	NA	NA	7	53	---	---	---	---
PEG3	5178	broad.mit.edu	37	19	57327542	57327542	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr19:57327542delG	ENST00000326441.9	-	10	2631	c.2268delC	c.(2266-2268)cccfs	p.P756fs	ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Frame_Shift_Del_p.P756fs|PEG3_ENST00000593695.1_Frame_Shift_Del_p.P630fs|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000598410.1_Frame_Shift_Del_p.P632fs	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	756					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GGTTTTCATAGGGGTTAGAGC	0.408																																							uc002qnu.2		NA																	0				ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(2266-2268)CCCfs		paternally expressed 3 isoform 1							163.0	160.0	161.0					19																	57327542		2203	4300	6503	SO:0001589	frameshift_variant	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57327542delG	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2268delC	19.37:g.57327542delG	ENSP00000326581:p.Pro756fs		Somatic				ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Frame_Shift_Del_p.P727fs|PEG3_uc002qnv.2_Frame_Shift_Del_p.P756fs|PEG3_uc002qnw.2_Frame_Shift_Del_p.P632fs|PEG3_uc002qnx.2_Frame_Shift_Del_p.P630fs|PEG3_uc010etr.2_Frame_Shift_Del_p.P756fs	p.P756fs	NM_001146186	NP_001139658	WXS	Illumina HiSeq	Unspecified	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	2619	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	756					A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Frame_Shift_Del	DEL	ENST00000326441.9	37	c.2268delC	CCDS12948.1																																																																																				0.408	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			37	203	NA	NA	NA	NA	NA	37	203	---	---	---	---
HOXA5	3202	broad.mit.edu	37	7	27182704	27182704	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chr7:27182704delG	ENST00000222726.3	-	1	583	c.523delC	c.(523-525)cagfs	p.Q175fs	HOXA5_ENST00000520854.1_5'Flank|HOXA3_ENST00000521401.1_5'Flank|RP1-170O19.22_ENST00000467897.2_RNA|HOXA6_ENST00000521478.1_5'Flank|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000521197.1_RNA	NM_019102.3	NP_061975.2	P20719	HXA5_HUMAN	homeobox A5	175					anterior/posterior pattern specification (GO:0009952)|bronchiole development (GO:0060435)|cell migration (GO:0016477)|cell-cell signaling involved in mammary gland development (GO:0060764)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|intestinal epithelial cell maturation (GO:0060574)|lung alveolus development (GO:0048286)|lung goblet cell differentiation (GO:0060480)|lung-associated mesenchyme development (GO:0060484)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal-epithelial cell signaling (GO:0060638)|multicellular organism growth (GO:0035264)|negative regulation of angiogenesis (GO:0016525)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of apoptotic process (GO:0043065)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|respiratory system process (GO:0003016)|thyroid gland development (GO:0030878)|trachea cartilage morphogenesis (GO:0060535)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(12)|skin(1)	16						GGGTAGATCTGGGGTTGGGCG	0.692																																					Colon(119;75 2200 7557 42868)	Colon(119;75 2200 7557 42868)	uc003syn.1		NA																	0					0						c.(523-525)CAGfs		homeobox A5							85.0	106.0	98.0					7																	27182704		2203	4300	6503	SO:0001589	frameshift_variant	3202				negative regulation of angiogenesis|negative regulation of erythrocyte differentiation|positive regulation of apoptosis|positive regulation of myeloid cell differentiation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27182704delG		CCDS5406.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106004	ENSG00000106004		"""Homeoboxes / ANTP class : HOXL subclass"""	5106	protein-coding gene	gene with protein product		142952	"""homeo box A5"""	HOX1C, HOX1		1973146, 1358459	Standard	NM_019102		Approved		uc003syn.2	P20719	OTTHUMG00000023214	ENST00000222726.3:c.523delC	7.37:g.27182704delG	ENSP00000222726:p.Gln175fs		Somatic					p.Q175fs	NM_019102	NP_061975	WXS	Illumina HiSeq	Unspecified	P20719	HXA5_HUMAN			1	584	-			175					A4D179|O43367|Q96CY6	Frame_Shift_Del	DEL	ENST00000222726.3	37	c.523delC	CCDS5406.1																																																																																				0.692	HOXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358705.1			36	278	NA	NA	NA	NA	NA	36	278	---	---	---	---
MID1IP1	58526	broad.mit.edu	37	X	38664680	38664681	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-55-6642-01A-11D-1855-08	TCGA-55-6642-11A-01D-1855-08	CT	CT	-	-	CT	CT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	3c756f7c-d1f0-4ab1-9c9f-41d2282af3bf	27666212-a211-4433-9589-528f3108ef48	g.chrX:38664680_38664681delCT	ENST00000336949.6	+	2	1426_1427	c.481_482delCT	c.(481-483)ctcfs	p.L161fs	MID1IP1_ENST00000457894.1_Frame_Shift_Del_p.L161fs|MID1IP1_ENST00000378474.3_Frame_Shift_Del_p.L161fs|MID1IP1-AS1_ENST00000436893.1_RNA	NM_021242.4	NP_067065.1	Q9NPA3	M1IP1_HUMAN	MID1 interacting protein 1	161					lipid metabolic process (GO:0006629)|negative regulation of microtubule depolymerization (GO:0007026)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of ligase activity (GO:0051351)|protein polymerization (GO:0051258)|regulation of lipid biosynthetic process (GO:0046890)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7						GCTCTCGAAACTCACGCGCAAA	0.624																																							uc004dei.3		NA																	0					0						c.(481-483)CTCfs		MID1 interacting G12-like protein																																				SO:0001589	frameshift_variant	58526				lipid biosynthetic process|negative regulation of microtubule depolymerization|positive regulation of fatty acid biosynthetic process|positive regulation of ligase activity|protein polymerization	cytosol|microtubule|nucleus		g.chrX:38664680_38664681delCT		CCDS14249.1	Xp11.4	2012-02-23	2012-02-23		ENSG00000165175	ENSG00000165175			20715	protein-coding gene	gene with protein product	"""gastrulation specific G12 homolog (zebrafish)"""		"""MID1 interacting protein 1 (gastrulation specific G12-like (zebrafish))"""				Standard	NM_001098790		Approved	STRAIT11499, FLJ10386, MIG12, THRSPL, G12-like	uc010ngz.3	Q9NPA3	OTTHUMG00000024092	ENST00000336949.6:c.481_482delCT	X.37:g.38664680_38664681delCT	ENSP00000338706:p.Leu161fs		Somatic				MID1IP1_uc010ngz.2_Frame_Shift_Del_p.L161fs|MID1IP1_uc004dej.3_Frame_Shift_Del_p.L161fs	p.L161fs	NM_001098790	NP_001092260	WXS	Illumina HiSeq	Unspecified	Q9NPA3	M1IP1_HUMAN			3	905_906	+			161					D3DWB2	Frame_Shift_Del	DEL	ENST00000336949.6	37	c.481_482delCT	CCDS14249.1																																																																																				0.624	MID1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060655.1			7	10	NA	NA	NA	NA	NA	7	10	---	---	---	---
