#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PLEKHG5	57449	broad.mit.edu	37	1	6528641	6528641	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:6528641G>C	ENST00000400915.3	-	21	2489	c.2423C>G	c.(2422-2424)tCa>tGa	p.S808*	TNFRSF25_ENST00000351748.3_5'Flank|PLEKHG5_ENST00000544978.1_Nonsense_Mutation_p.S752*|TNFRSF25_ENST00000351959.5_5'Flank|TNFRSF25_ENST00000348333.3_5'Flank|PLEKHG5_ENST00000537245.1_Nonsense_Mutation_p.S831*|PLEKHG5_ENST00000400913.1_Nonsense_Mutation_p.S752*|PLEKHG5_ENST00000340850.5_Nonsense_Mutation_p.S752*|PLEKHG5_ENST00000377740.3_Intron|TNFRSF25_ENST00000377782.3_5'Flank|PLEKHG5_ENST00000377732.1_Nonsense_Mutation_p.S789*|PLEKHG5_ENST00000377725.1_Nonsense_Mutation_p.S752*|TNFRSF25_ENST00000461703.2_5'Flank|PLEKHG5_ENST00000377728.3_Nonsense_Mutation_p.S752*|PLEKHG5_ENST00000377737.2_Nonsense_Mutation_p.S752*|PLEKHG5_ENST00000535355.1_Nonsense_Mutation_p.S821*|TNFRSF25_ENST00000356876.3_5'Flank|PLEKHG5_ENST00000377748.1_Nonsense_Mutation_p.S829*	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	808					apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.S829*(1)		liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		GGAGCCATCTGAGGCACTGTG	0.622																																							uc001ano.1		NA																	1	Substitution - Nonsense(1)		lung(1)	liver(1)	1						c.(2422-2424)TCA>TGA		pleckstrin homology domain containing family G							25.0	27.0	26.0					1																	6528641		2149	4214	6363	SO:0001587	stop_gained	57449				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr1:6528641G>C	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.2423C>G	1.37:g.6528641G>C	ENSP00000383706:p.Ser808*		Somatic				PLEKHG5_uc001ann.1_Nonsense_Mutation_p.S789*|PLEKHG5_uc001anq.1_Intron|PLEKHG5_uc001anp.1_Nonsense_Mutation_p.S829*|TNFRSF25_uc001ana.2_5'Flank|TNFRSF25_uc001anb.2_5'Flank|TNFRSF25_uc001anc.2_5'Flank|TNFRSF25_uc001and.2_5'Flank|TNFRSF25_uc009vlz.2_5'Flank|TNFRSF25_uc001ane.2_5'Flank|TNFRSF25_uc001anf.2_5'Flank|TNFRSF25_uc001ang.2_5'Flank|TNFRSF25_uc001anh.2_5'Flank|TNFRSF25_uc001ani.1_5'Flank|PLEKHG5_uc001anj.1_Nonsense_Mutation_p.S313*|PLEKHG5_uc009vma.1_Nonsense_Mutation_p.S592*|PLEKHG5_uc010nzr.1_Nonsense_Mutation_p.S821*|PLEKHG5_uc001ank.1_Nonsense_Mutation_p.S752*|PLEKHG5_uc009vmb.1_Nonsense_Mutation_p.S752*|PLEKHG5_uc001anl.1_Nonsense_Mutation_p.S752*|PLEKHG5_uc001anm.1_Nonsense_Mutation_p.S752*|PLEKHG5_uc001anr.1_Nonsense_Mutation_p.S15*	p.S808*	NM_001042663	NP_001036128	WXS	Illumina HiSeq	Unspecified	O94827	PKHG5_HUMAN		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)	21	2524	-	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)	808					B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Nonsense_Mutation	SNP	ENST00000400915.3	37	c.2423C>G	CCDS41241.1	.	.	.	.	.	.	.	.	.	.	G	41	8.979696	0.99023	.	.	ENSG00000171680	ENST00000377748;ENST00000340850;ENST00000400913;ENST00000400915;ENST00000377732;ENST00000377728;ENST00000377725;ENST00000535355;ENST00000377737;ENST00000535966;ENST00000537245;ENST00000544978	.	.	.	5.48	5.48	0.80851	.	0.130430	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-10.8267	17.9212	0.88966	0.0:0.0:1.0:0.0	.	.	.	.	X	829;752;752;808;789;752;752;821;752;658;831;752	.	ENSP00000344570:S752X	S	-	2	0	PLEKHG5	6451228	1.000000	0.71417	0.946000	0.38457	0.818000	0.46254	8.114000	0.89570	2.577000	0.86979	0.462000	0.41574	TCA		0.622	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002631.1	NM_020631		3	36	0	0	0	0.004672	0	3	36				
MTOR	2475	broad.mit.edu	37	1	11227550	11227550	+	Silent	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:11227550C>G	ENST00000361445.4	-	29	4354	c.4278G>C	c.(4276-4278)ccG>ccC	p.P1426P	snoU13_ENST00000607349.1_RNA	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1426	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.P1426P(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCGCTGCCTCCGGCTGCTGTA	0.478																																							uc001asd.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						c.(4276-4278)CCG>CCC		FK506 binding protein 12-rapamycin associated							113.0	119.0	117.0					1																	11227550		2203	4300	6503	SO:0001819	synonymous_variant	2475				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity	g.chr1:11227550C>G	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4278G>C	1.37:g.11227550C>G			Somatic					p.P1426P	NM_004958	NP_004949	WXS	Illumina HiSeq	Unspecified	P42345	MTOR_HUMAN			29	4399	-			1426			FAT.		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Silent	SNP	ENST00000361445.4	37	c.4278G>C	CCDS127.1																																																																																				0.478	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958		7	177	0	0	0	0.004482	0	7	177				
MST1L	11223	broad.mit.edu	37	1	17085014	17085014	+	RNA	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:17085014G>A	ENST00000455405.2	-	0	174							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.R456R(1)|p.R487R(1)									CCCCAGCCACGCGCAGCTTGG	0.602																																							uc010ock.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1459-1461)CGC>CGT		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17085014G>A	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085014G>A			Somatic				CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_Silent_p.R61R	p.R487R	NR_002729		WXS	Illumina HiSeq	Unspecified					11	1461	-								B7WPB1|Q13209	Silent	SNP	ENST00000455405.2	37	c.1461C>T																																																																																					0.602	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		6	80	0	0	0	0.001168	0	6	80				
ALDH4A1	8659	broad.mit.edu	37	1	19209814	19209814	+	Missense_Mutation	SNP	C	C	A	rs138334153		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:19209814C>A	ENST00000375341.3	-	6	819	c.562G>T	c.(562-564)Gtg>Ttg	p.V188L	ALDH4A1_ENST00000454547.1_5'UTR|RP13-279N23.2_ENST00000494072.3_3'UTR|ALDH4A1_ENST00000290597.5_Missense_Mutation_p.V188L|ALDH4A1_ENST00000538309.1_Missense_Mutation_p.V128L|MIR4695_ENST00000577305.1_RNA|ALDH4A1_ENST00000538839.1_Missense_Mutation_p.V188L	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1	188					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)	p.V188L(2)		cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CTCGGGGGCACGCTGATGGGC	0.637																																							uc001bbb.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(562-564)GTG>TTG		aldehyde dehydrogenase 4A1 isoform a precursor	NADH(DB00157)						51.0	43.0	46.0					1																	19209814		2203	4300	6503	SO:0001583	missense	8659				proline biosynthetic process|proline catabolic process	mitochondrial matrix	1-pyrroline-5-carboxylate dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|electron carrier activity	g.chr1:19209814C>A	U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.562G>T	1.37:g.19209814C>A	ENSP00000364490:p.Val188Leu		Somatic				ALDH4A1_uc010ocu.1_Missense_Mutation_p.V128L|ALDH4A1_uc001bbc.2_Missense_Mutation_p.V188L	p.V188L	NM_170726	NP_733844	WXS	Illumina HiSeq	Unspecified	P30038	AL4A1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	6	838	-		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	188					A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Missense_Mutation	SNP	ENST00000375341.3	37	c.562G>T	CCDS188.1	.	.	.	.	.	.	.	.	.	.	C	8.077	0.771505	0.16051	.	.	ENSG00000159423	ENST00000290597;ENST00000375341;ENST00000538839;ENST00000538309;ENST00000375335;ENST00000454547;ENST00000375334;ENST00000432718	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	5.31	1.2	0.21068	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.816064	0.11531	N	0.554725	T	0.49712	0.1573	N	0.12502	0.225	0.35348	D	0.787098	B	0.06786	0.001	B	0.13407	0.009	T	0.40608	-0.9554	10	0.27785	T	0.31	-12.5317	1.7674	0.03004	0.1371:0.4752:0.152:0.2357	.	188	P30038	AL4A1_HUMAN	L	188;188;188;128;172;86;128;172	ENSP00000290597:V188L;ENSP00000364490:V188L;ENSP00000446071:V188L;ENSP00000442988:V128L;ENSP00000393209:V172L	ENSP00000290597:V188L	V	-	1	0	ALDH4A1	19082401	0.996000	0.38824	0.690000	0.30148	0.270000	0.26580	0.634000	0.24614	-0.028000	0.13850	-0.333000	0.08304	GTG		0.637	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006954.1			11	33	1	0	3.07112e-06	0.000978	4.74378e-06	11	33				
SDC3	9672	broad.mit.edu	37	1	31351584	31351584	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:31351584G>A	ENST00000339394.6	-	2	316	c.142C>T	c.(142-144)Cag>Tag	p.Q48*	SDC3_ENST00000336798.7_5'UTR|SDC3_ENST00000471567.1_5'UTR	NM_014654.3	NP_055469.3	O75056	SDC3_HUMAN	syndecan 3	48					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.Q48*(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)		CGCCAGCGCTGGGCCTAGGGA	0.627																																							uc001bse.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(142-144)CAG>TAG		syndecan 3							97.0	89.0	91.0					1																	31351584		2203	4300	6503	SO:0001587	stop_gained	9672					integral to membrane	cytoskeletal protein binding	g.chr1:31351584G>A	AF248634	CCDS30661.1	1p35.2	2013-09-19	2007-02-15		ENSG00000162512	ENSG00000162512		"""Proteoglycans / Cell Surface : Syndecans"""	10660	protein-coding gene	gene with protein product	"""syndecan proteoglycan 3"""	186357	"""syndecan 3 (N-syndecan)"""			1556152, 11527150	Standard	NM_014654		Approved	N-syndecan, SYND3	uc001bse.2	O75056	OTTHUMG00000043646	ENST00000339394.6:c.142C>T	1.37:g.31351584G>A	ENSP00000344468:p.Gln48*		Somatic				SDC3_uc001bsd.2_5'UTR	p.Q48*	NM_014654	NP_055469	WXS	Illumina HiSeq	Unspecified	O75056	SDC3_HUMAN		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)	2	189	-		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)	48			Extracellular (Potential).		Q5T1Z6|Q5T1Z7|Q96CT3|Q96PR8	Nonsense_Mutation	SNP	ENST00000339394.6	37	c.142C>T	CCDS30661.1	.	.	.	.	.	.	.	.	.	.	G	38	6.933811	0.97944	.	.	ENSG00000162512	ENST00000339394	.	.	.	5.01	5.01	0.66863	.	0.108055	0.40385	N	0.001118	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-14.5732	14.0038	0.64449	0.0:0.1514:0.8486:0.0	.	.	.	.	X	48	.	ENSP00000344468:Q48X	Q	-	1	0	SDC3	31124171	1.000000	0.71417	0.997000	0.53966	0.948000	0.59901	5.439000	0.66556	2.339000	0.79563	0.561000	0.74099	CAG		0.627	SDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102017.1	NM_014654		4	59	0	0	0	0.000248	0	4	59				
INADL	10207	broad.mit.edu	37	1	62237198	62237198	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:62237198A>G	ENST00000371158.2	+	6	734	c.620A>G	c.(619-621)cAa>cGa	p.Q207R	INADL_ENST00000316485.6_Missense_Mutation_p.Q207R	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	207	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.Q207R(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GCATTATTACAACAAACCACT	0.398																																							uc001dab.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(619-621)CAA>CGA		InaD-like							137.0	125.0	129.0					1																	62237198		2203	4300	6503	SO:0001583	missense	10207				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding	g.chr1:62237198A>G	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.620A>G	1.37:g.62237198A>G	ENSP00000360200:p.Gln207Arg		Somatic				INADL_uc009waf.1_Missense_Mutation_p.Q207R|INADL_uc001daa.2_Missense_Mutation_p.Q207R|INADL_uc001dad.3_5'UTR	p.Q207R	NM_176877	NP_795352	WXS	Illumina HiSeq	Unspecified	Q8NI35	INADL_HUMAN			6	734	+			207			PDZ 1.		O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	c.620A>G	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	16.19	3.054221	0.55218	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.24538	1.85;1.85	4.83	4.83	0.62350	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000010	T	0.37433	0.1003	L	0.28694	0.88	0.80722	D	1	D;D;P	0.64830	0.994;0.966;0.659	D;D;P	0.83275	0.996;0.99;0.8	T	0.07829	-1.0752	10	0.27785	T	0.31	.	14.3892	0.66965	1.0:0.0:0.0:0.0	.	207;207;207	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	R	207	ENSP00000360200:Q207R;ENSP00000326199:Q207R	ENSP00000255202:Q207R	Q	+	2	0	INADL	62009786	1.000000	0.71417	0.748000	0.31131	0.376000	0.30014	8.578000	0.90777	1.808000	0.52836	0.377000	0.23210	CAA		0.398	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605		14	66	0	0	0	0.004007	0	14	66				
PRRX1	5396	broad.mit.edu	37	1	170695400	170695400	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:170695400G>C	ENST00000239461.6	+	3	770	c.457G>C	c.(457-459)Gag>Cag	p.E153Q	PRRX1_ENST00000367760.3_Missense_Mutation_p.E153Q|PRRX1_ENST00000497230.2_Missense_Mutation_p.E153Q|PRRX1_ENST00000476867.2_3'UTR	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1	153					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)	p.E153Q(2)		large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCGCAGGAATGAGAGAGCCAT	0.512																																							uc001ghf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(457-459)GAG>CAG		paired mesoderm homeobox 1 isoform pmx-1b							73.0	67.0	69.0					1																	170695400		2203	4300	6503	SO:0001583	missense	5396					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr1:170695400G>C	M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.457G>C	1.37:g.170695400G>C	ENSP00000239461:p.Glu153Gln		Somatic				PRRX1_uc001ghe.2_Missense_Mutation_p.E153Q	p.E153Q	NM_022716	NP_073207	WXS	Illumina HiSeq	Unspecified	P54821	PRRX1_HUMAN			3	504	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		153			Homeobox.		B5BUM7|O60807	Missense_Mutation	SNP	ENST00000239461.6	37	c.457G>C	CCDS1290.1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.897045	0.72639	.	.	ENSG00000116132	ENST00000367760;ENST00000239461;ENST00000497230	D;D;D	0.95307	-3.67;-3.67;-3.67	5.63	5.63	0.86233	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.151773	0.56097	D	0.000023	D	0.90947	0.7154	M	0.66939	2.045	0.80722	D	1	B;P	0.40476	0.017;0.718	B;B	0.32465	0.007;0.146	D	0.92418	0.5943	10	0.62326	D	0.03	.	18.2616	0.90038	0.0:0.0:1.0:0.0	.	153;153	P54821;P54821-2	PRRX1_HUMAN;.	Q	153	ENSP00000356734:E153Q;ENSP00000239461:E153Q;ENSP00000450762:E153Q	ENSP00000239461:E153Q	E	+	1	0	PRRX1	168962024	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.308000	0.78929	2.649000	0.89929	0.650000	0.86243	GAG		0.512	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085236.3	NM_006902		5	25	0	0	0	0.001168	0	5	25				
FMO3	2328	broad.mit.edu	37	1	171077331	171077331	+	Missense_Mutation	SNP	T	T	C	rs72549327		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:171077331T>C	ENST00000367755.4	+	5	707	c.596T>C	c.(595-597)aTt>aCt	p.I199T	FMO3_ENST00000542847.1_Missense_Mutation_p.I179T|FMO3_ENST00000392085.2_Missense_Mutation_p.I199T|FMO3_ENST00000538429.1_Missense_Mutation_p.I136T	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	199					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)	p.I199T(1)		endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GGCTGTGATATTGCCACAGAA	0.493																																							uc001ghi.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1	GRCh37	CM002018	FMO3	M	rs72549327	c.(595-597)ATT>ACT		flavin containing monooxygenase 3							119.0	117.0	118.0					1																	171077331		2203	4300	6503	SO:0001583	missense	2328				xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity	g.chr1:171077331T>C	BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.596T>C	1.37:g.171077331T>C	ENSP00000356729:p.Ile199Thr		Somatic				FMO3_uc001ghh.2_Missense_Mutation_p.I199T|FMO3_uc010pmb.1_Missense_Mutation_p.I179T|FMO3_uc010pmc.1_Missense_Mutation_p.I136T	p.I199T	NM_001002294	NP_001002294	WXS	Illumina HiSeq	Unspecified	P31513	FMO3_HUMAN			5	707	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		199					B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	ENST00000367755.4	37	c.596T>C	CCDS1292.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.359687	0.82353	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.60040	0.22;0.22;0.22;0.22	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.76644	0.4016	M	0.91406	3.205	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.91635	0.999;0.995;0.995	T	0.83257	-0.0050	10	0.87932	D	0	-18.5277	14.5022	0.67729	0.0:0.0:0.0:1.0	.	136;179;199	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	T	199;199;179;136	ENSP00000356729:I199T;ENSP00000375935:I199T;ENSP00000444073:I179T;ENSP00000439500:I136T	ENSP00000356729:I199T	I	+	2	0	FMO3	169343955	1.000000	0.71417	0.960000	0.40013	0.845000	0.48019	6.287000	0.72671	1.882000	0.54519	0.460000	0.39030	ATT		0.493	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894		6	60	0	0	0	0.001984	0	6	60				
TNFSF4	7292	broad.mit.edu	37	1	173155820	173155820	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:173155820C>T	ENST00000281834.3	-	3	523	c.387G>A	c.(385-387)ctG>ctA	p.L129L	TNFSF4_ENST00000488053.1_5'Flank|TNFSF4_ENST00000367718.1_Silent_p.L79L	NM_003326.3	NP_003317.1	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily, member 4	129					acute inflammatory response (GO:0002526)|CD4-positive, alpha-beta T cell costimulation (GO:0035783)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nitrogen dioxide (GO:0035714)|cellular response to prostaglandin E stimulus (GO:0071380)|chemokine (C-C motif) ligand 11 production (GO:0071954)|cholesterol metabolic process (GO:0008203)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|memory T cell activation (GO:0035709)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell activation (GO:0050871)|positive regulation of CD4-positive, alpha-beta T cell costimulation (GO:1900281)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-4-dependent isotype switching to IgE isotypes (GO:2000572)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of memory T cell activation (GO:2000568)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T-helper 2 cell activation (GO:2000570)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of type 2 immune response (GO:0002830)|regulation of adaptive immune response (GO:0002819)|regulation of inflammatory response (GO:0050727)|response to nitrogen dioxide (GO:0035713)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|T-helper 2 cell activation (GO:0035712)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)	p.L129L(1)		breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	12						TGACCTTCTTCAGTTGGAAGA	0.473																																							uc001giw.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(385-387)CTG>CTA		tumor necrosis factor (ligand) superfamily,							88.0	88.0	88.0					1																	173155820		2203	4300	6503	SO:0001819	synonymous_variant	7292				acute inflammatory response|cellular response to lipopolysaccharide|cellular response to prostaglandin E stimulus|chemokine (C-C motif) ligand 11 production|defense response to nematode|interleukin-4-dependent isotype switching to IgE isotypes|memory T cell activation|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of regulatory T cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T-helper 1 cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of alpha-beta T cell proliferation|positive regulation of B cell activation|positive regulation of immunoglobulin mediated immune response|positive regulation of immunoglobulin secretion|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-6 production|positive regulation of memory T cell differentiation|positive regulation of T cell cytokine production|positive regulation of T-helper 2 cell differentiation|positive regulation of type 2 immune response|response to virus|signal transduction|T-helper 2 cell activation	cell surface|extracellular space|integral to plasma membrane	cytokine activity	g.chr1:173155820C>T	D90224	CCDS1306.1, CCDS72985.1	1q25	2008-07-31	2008-07-31		ENSG00000117586	ENSG00000117586		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11934	protein-coding gene	gene with protein product		603594	"""tax-transcriptionally activated glycoprotein 1, 34kD"""	TXGP1		1996093, 8076595	Standard	XM_005245475		Approved	OX-40L, gp34, CD252	uc001giw.3	P23510	OTTHUMG00000034838	ENST00000281834.3:c.387G>A	1.37:g.173155820C>T			Somatic				TNFSF4_uc001giv.2_Silent_p.L79L	p.L129L	NM_003326	NP_003317	WXS	Illumina HiSeq	Unspecified	P23510	TNFL4_HUMAN			3	543	-			129			Extracellular (Potential).		Q5JZA5|Q8IV74|Q9HCN9	Silent	SNP	ENST00000281834.3	37	c.387G>A	CCDS1306.1																																																																																				0.473	TNFSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084271.1			11	42	0	0	0	0.000978	0	11	42				
TNR	7143	broad.mit.edu	37	1	175355363	175355363	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:175355363G>A	ENST00000367674.2	-	8	2290	c.1582C>T	c.(1582-1584)Cga>Tga	p.R528*	TNR_ENST00000263525.2_Nonsense_Mutation_p.R528*			Q92752	TENR_HUMAN	tenascin R	528	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.R528*(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					ACTTTGGCTCGAGGGGGAATC	0.552																																							uc001gkp.1		NA																	1	Substitution - Nonsense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(1582-1584)CGA>TGA		tenascin R precursor							32.0	36.0	35.0					1																	175355363		2203	4300	6503	SO:0001587	stop_gained	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175355363G>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1582C>T	1.37:g.175355363G>A	ENSP00000356646:p.Arg528*		Somatic				TNR_uc009wwu.1_Nonsense_Mutation_p.R528*	p.R528*	NM_003285	NP_003276	WXS	Illumina HiSeq	Unspecified	Q92752	TENR_HUMAN			6	1663	-	Renal(580;0.146)		528			Fibronectin type-III 3.		C9J563|Q15568|Q5R3G0	Nonsense_Mutation	SNP	ENST00000367674.2	37	c.1582C>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	45	11.798136	0.99604	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	.	.	.	5.68	5.68	0.88126	.	0.073354	0.53938	D	0.000044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2576	0.66062	0.0:0.0:0.851:0.149	.	.	.	.	X	528	.	ENSP00000263525:R528X	R	-	1	2	TNR	173621986	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	5.258000	0.65479	2.660000	0.90430	0.650000	0.86243	CGA		0.552	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		5	20	0	0	0	0.000602	0	5	20				
TEX35	84066	broad.mit.edu	37	1	178489911	178489911	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:178489911G>C	ENST00000319416.2	+	7	557	c.445G>C	c.(445-447)Gtc>Ctc	p.V149L	TEX35_ENST00000367642.3_3'UTR|TEX35_ENST00000367639.1_Missense_Mutation_p.V157L|TEX35_ENST00000367643.3_Missense_Mutation_p.V149L|TEX35_ENST00000367641.3_Missense_Mutation_p.V149L|TEX35_ENST00000258298.2_Missense_Mutation_p.V73L	NM_032126.4	NP_115502.2			testis expressed 35									p.V149L(2)									AGCCAGTGGAGTCAATGGAGC	0.527																																							uc001glt.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(445-447)GTC>CTC		hypothetical protein LOC84066							80.0	77.0	78.0					1																	178489911		2203	4300	6503	SO:0001583	missense	84066					microtubule cytoskeleton		g.chr1:178489911G>C	AL136694	CCDS1323.1, CCDS53433.1, CCDS53434.1	1q25.2	2014-01-28	2012-06-29	2012-06-29	ENSG00000240021	ENSG00000240021			25366	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 24kDa"""		"""chromosome 1 open reading frame 49"""	C1orf49		11230166, 17077512	Standard	NM_032126		Approved	DKFZP564J047, TSC24	uc001glt.2	Q5T0J7	OTTHUMG00000035023	ENST00000319416.2:c.445G>C	1.37:g.178489911G>C	ENSP00000323795:p.Val149Leu		Somatic				C1orf49_uc001glu.1_Missense_Mutation_p.V149L|C1orf49_uc001glv.1_RNA|C1orf49_uc001glw.1_Missense_Mutation_p.V157L	p.V149L	NM_032126	NP_115502	WXS	Illumina HiSeq	Unspecified	Q5T0J7	CA049_HUMAN			7	557	+			149						Missense_Mutation	SNP	ENST00000319416.2	37	c.445G>C	CCDS1323.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.459207	0.26248	.	.	ENSG00000240021	ENST00000319416;ENST00000258298;ENST00000367643;ENST00000367641;ENST00000367639	T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26	3.72	3.72	0.42706	.	.	.	.	.	T	0.08891	0.0220	N	0.08118	0	0.09310	N	1	B;B;B	0.31817	0.004;0.187;0.341	B;B;B	0.25140	0.015;0.058;0.058	T	0.18209	-1.0344	9	0.46703	T	0.11	.	11.1888	0.48673	0.0:0.0:1.0:0.0	.	157;149;149	Q5T0J7-2;Q5T0J7-3;Q5T0J7	.;.;CA049_HUMAN	L	149;73;149;149;157	ENSP00000323795:V149L;ENSP00000258298:V73L;ENSP00000356615:V149L;ENSP00000356613:V149L;ENSP00000356611:V157L	ENSP00000258298:V73L	V	+	1	0	C1orf49	176756534	0.001000	0.12720	0.010000	0.14722	0.018000	0.09664	-0.570000	0.05895	2.084000	0.62774	0.536000	0.68110	GTC		0.527	TEX35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084917.1	NM_032126		3	44	0	0	0	0.000248	0	3	44				
RGS8	85397	broad.mit.edu	37	1	182615944	182615944	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:182615944C>G	ENST00000483095.2	-	7	726	c.469G>C	c.(469-471)Gac>Cac	p.D157H	RGS8_ENST00000258302.4_Missense_Mutation_p.D175H|RGS8_ENST00000367557.4_Missense_Mutation_p.D157H|RGS8_ENST00000367556.1_Missense_Mutation_p.D157H			P57771	RGS8_HUMAN	regulator of G-protein signaling 8	157	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.D175H(1)|p.D157H(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						GGGTAAGAGTCTTTCTCCATG	0.517																																					Ovarian(189;1262 3804 41973)	Ovarian(189;1262 3804 41973)	uc010pnw.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(469-471)GAC>CAC		regulator of G-protein signalling 8 isoform 2							215.0	212.0	213.0					1																	182615944		2203	4300	6503	SO:0001583	missense	85397				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:182615944C>G	AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.469G>C	1.37:g.182615944C>G	ENSP00000426289:p.Asp157His		Somatic				RGS8_uc001gpn.1_Missense_Mutation_p.D157H|RGS8_uc001gpm.1_Missense_Mutation_p.D175H	p.D157H	NM_001102450	NP_001095920	WXS	Illumina HiSeq	Unspecified	P57771	RGS8_HUMAN			7	727	-			157			RGS.		B4DGL9|Q3SYD2	Missense_Mutation	SNP	ENST00000483095.2	37	c.469G>C	CCDS41443.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.535831	0.85812	.	.	ENSG00000135824	ENST00000483095;ENST00000258302;ENST00000367557;ENST00000367556	T;T;T;T	0.38240	1.15;1.15;1.15;1.15	5.27	5.27	0.74061	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.75012	0.3792	H	0.97635	4.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84979	0.0887	10	0.87932	D	0	.	18.5294	0.90986	0.0:1.0:0.0:0.0	.	157;175	P57771;P57771-2	RGS8_HUMAN;.	H	157;175;157;157	ENSP00000426289:D157H;ENSP00000258302:D175H;ENSP00000356528:D157H;ENSP00000356527:D157H	ENSP00000258302:D175H	D	-	1	0	RGS8	180882567	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.450000	0.82876	0.585000	0.79938	GAC		0.517	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358979.1	NM_033345		40	133	0	0	0	0.00623	0	40	133				
SMG7	9887	broad.mit.edu	37	1	183502430	183502430	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:183502430G>T	ENST00000347615.2	+	9	1094	c.975G>T	c.(973-975)caG>caT	p.Q325H	SMG7_ENST00000508461.1_Missense_Mutation_p.Q283H|SMG7_ENST00000515829.2_Missense_Mutation_p.Q325H|SMG7_ENST00000367537.3_Missense_Mutation_p.Q354H|SMG7_ENST00000456731.2_Missense_Mutation_p.Q283H|SMG7_ENST00000507469.1_Missense_Mutation_p.Q325H	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	325					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.Q325H(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						AAGATGAGCAGCTATGTTGGA	0.398																																							uc001gqg.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(973-975)CAG>CAT		SMG-7 homolog isoform 1							219.0	200.0	206.0					1																	183502430		2203	4300	6503	SO:0001583	missense	9887				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding	g.chr1:183502430G>T	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.975G>T	1.37:g.183502430G>T	ENSP00000340766:p.Gln325His		Somatic				SMG7_uc010pob.1_Missense_Mutation_p.Q354H|SMG7_uc001gqf.2_Missense_Mutation_p.Q325H|SMG7_uc001gqh.2_Missense_Mutation_p.Q325H|SMG7_uc001gqi.2_Missense_Mutation_p.Q283H|SMG7_uc010poc.1_Missense_Mutation_p.Q283H	p.Q325H	NM_173156	NP_775179	WXS	Illumina HiSeq	Unspecified	Q92540	SMG7_HUMAN			9	1097	+			325					B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	ENST00000347615.2	37	c.975G>T	CCDS1355.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850296	0.71719	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000419169;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16;2.16	5.81	4.9	0.64082	.	0.117484	0.64402	D	0.000013	T	0.32466	0.0830	L	0.52011	1.625	0.54753	D	0.999982	P;P;P;P;P;D	0.55800	0.954;0.882;0.905;0.856;0.905;0.973	P;P;P;B;P;P	0.52710	0.663;0.579;0.656;0.443;0.677;0.707	T	0.04413	-1.0953	10	0.54805	T	0.06	-9.5676	14.9894	0.71374	0.0683:0.0:0.9317:0.0	.	283;354;283;325;325;325	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	H	283;354;283;283;325;325;325	ENSP00000407629:Q283H;ENSP00000356507:Q354H;ENSP00000426915:Q283H;ENSP00000388390:Q283H;ENSP00000340766:Q325H;ENSP00000425133:Q325H;ENSP00000421358:Q325H	ENSP00000340766:Q325H	Q	+	3	2	SMG7	181769053	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.980000	0.40618	1.450000	0.47717	0.655000	0.94253	CAG		0.398	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837		26	125	1	0	2.65835e-16	0.007291	4.48677e-16	26	125				
CAMSAP2	23271	broad.mit.edu	37	1	200817734	200817734	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:200817734C>G	ENST00000236925.4	+	12	1919	c.1870C>G	c.(1870-1872)Cac>Gac	p.H624D	CAMSAP2_ENST00000358823.2_Missense_Mutation_p.H613D|CAMSAP2_ENST00000413307.2_Missense_Mutation_p.H597D			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	624					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)	p.H613D(1)									CACTGGAATTCACGTTCCTTC	0.368																																							uc001gvl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|pancreas(1)	4						c.(1870-1872)CAC>GAC		calmodulin regulated spectrin-associated protein							107.0	102.0	104.0					1																	200817734		2203	4300	6503	SO:0001583	missense	23271					cytoplasm|microtubule	protein binding	g.chr1:200817734C>G	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.1870C>G	1.37:g.200817734C>G	ENSP00000236925:p.His624Asp		Somatic				CAMSAP1L1_uc001gvk.2_Missense_Mutation_p.H613D|CAMSAP1L1_uc001gvm.2_Missense_Mutation_p.H597D	p.H624D	NM_203459	NP_982284	WXS	Illumina HiSeq	Unspecified	Q08AD1	CAMP2_HUMAN			12	2140	+			624					B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	ENST00000236925.4	37	c.1870C>G		.	.	.	.	.	.	.	.	.	.	C	18.17	3.564091	0.65651	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.40225	1.04;1.04;1.04	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.57562	0.2062	L	0.55481	1.735	0.80722	D	1	D;P;D	0.69078	0.981;0.911;0.997	P;B;P	0.61940	0.667;0.376;0.896	T	0.44877	-0.9299	10	0.18710	T	0.47	-25.5507	19.8968	0.96969	0.0:1.0:0.0:0.0	.	597;624;613	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	D	613;597;624	ENSP00000351684:H613D;ENSP00000416800:H597D;ENSP00000236925:H624D	ENSP00000236925:H624D	H	+	1	0	CAMSAP1L1	199084357	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	5.576000	0.67437	2.691000	0.91804	0.655000	0.94253	CAC		0.368	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459		10	83	0	0	0	0.000978	0	10	83				
NAV1	89796	broad.mit.edu	37	1	201781101	201781101	+	Splice_Site	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:201781101A>G	ENST00000367296.4	+	26	5443	c.5023A>G	c.(5023-5025)Agg>Ggg	p.R1675G	IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367300.3_Splice_Site_p.R1615G|NAV1_ENST00000295624.6_Splice_Site_p.R1672G|NAV1_ENST00000367295.1_Splice_Site_p.R1281G|NAV1_ENST00000367302.1_Splice_Site_p.R1628G|NAV1_ENST00000367297.4_Splice_Site_p.R1667G	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1675					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.R1672G(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CTTGAGCTTCAGGTAAGACCT	0.473																																							uc001gwu.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|ovary(1)	4						c.(5014-5016)AGG>GGG		neuron navigator 1							136.0	137.0	137.0					1																	201781101		2203	4300	6503	SO:0001630	splice_region_variant	89796				cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding	g.chr1:201781101A>G	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.5024+1A>G	1.37:g.201781101A>G			Somatic				NAV1_uc001gwx.2_Missense_Mutation_p.R1281G	p.R1672G	NM_020443	NP_065176	WXS	Illumina HiSeq	Unspecified	Q8NEY1	NAV1_HUMAN			25	5361	+			1675					A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	c.5014A>G	CCDS1414.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	31|31	5.062715|5.062715	0.93898|0.93898	.|.	.|.	ENSG00000134369|ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295|ENST00000367301	T;T;T;T;T;T|.	0.16196|.	2.54;2.36;2.36;2.37;2.55;2.36|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76723|0.76723	0.4027|0.4027	M|M	0.80183|0.80183	2.485|2.485	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.997;0.997|.	T|T	0.78386|0.78386	-0.2224|-0.2224	10|5	0.87932|.	D|.	0|.	-40.1836|-40.1836	15.4286|15.4286	0.75075|0.75075	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1281;1672|.	Q8NEY1-5;Q8NEY1-3|.	.;.|.	G|G	1628;1675;1672;1667;1615;1281|83	ENSP00000356271:R1628G;ENSP00000356265:R1675G;ENSP00000295624:R1672G;ENSP00000356266:R1667G;ENSP00000356269:R1615G;ENSP00000356264:R1281G|.	ENSP00000295624:R1672G|.	R|S	+|+	1|1	2|0	NAV1|NAV1	200047724|200047724	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	7.156000|7.156000	0.77453|0.77453	2.183000|2.183000	0.69458|0.69458	0.528000|0.528000	0.53228|0.53228	AGG|AGC		0.473	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	Missense_Mutation	4	109	0	0	0	0.000602	0	4	109				
USH2A	7399	broad.mit.edu	37	1	216062258	216062258	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:216062258G>A	ENST00000307340.3	-	41	8119	c.7733C>T	c.(7732-7734)aCt>aTt	p.T2578I	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.T2578I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2578	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.T2578I(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATTTCCAGGAGTTCTCAAGTA	0.408										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(7732-7734)ACT>ATT		usherin isoform B							148.0	145.0	146.0					1																	216062258		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216062258G>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7733C>T	1.37:g.216062258G>A	ENSP00000305941:p.Thr2578Ile	HNSCC(13;0.011)	Somatic					p.T2578I	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	41	8120	-			2578			Fibronectin type-III 12.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.7733C>T	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	9.328	1.059730	0.19987	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.55413	0.52;0.52	5.76	1.76	0.24704	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.010830	0.07957	N	0.981828	T	0.34513	0.0900	N	0.17278	0.47	0.09310	N	1	B	0.24317	0.101	B	0.28232	0.087	T	0.30880	-0.9963	10	0.18276	T	0.48	.	6.8606	0.24064	0.5326:0.0:0.4674:0.0	.	2578	O75445	USH2A_HUMAN	I	2578	ENSP00000305941:T2578I;ENSP00000355910:T2578I	ENSP00000305941:T2578I	T	-	2	0	USH2A	214128881	0.020000	0.18652	0.001000	0.08648	0.682000	0.39822	2.473000	0.45145	0.754000	0.32968	0.655000	0.94253	ACT		0.408	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		14	104	0	0	0	0.004007	0	14	104				
USH2A	7399	broad.mit.edu	37	1	216348701	216348701	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:216348701G>T	ENST00000307340.3	-	21	4906	c.4520C>A	c.(4519-4521)tCa>tAa	p.S1507*	USH2A_ENST00000366942.3_Nonsense_Mutation_p.S1507*|USH2A_ENST00000366943.2_Nonsense_Mutation_p.S1507*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1507					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.S1507*(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGGTAGAGATGACTCTCTCCT	0.443										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(4519-4521)TCA>TAA		usherin isoform B							125.0	104.0	111.0					1																	216348701		2203	4300	6503	SO:0001587	stop_gained	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216348701G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4520C>A	1.37:g.216348701G>T	ENSP00000305941:p.Ser1507*	HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Nonsense_Mutation_p.S1507*	p.S1507*	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	21	4907	-			1507			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	ENST00000307340.3	37	c.4520C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	43	10.195399	0.99357	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	.	.	.	5.49	3.6	0.41247	.	0.704870	0.11615	U	0.546336	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	12.3141	0.54946	0.1396:0.0:0.8604:0.0	.	.	.	.	X	1507	.	ENSP00000305941:S1507X	S	-	2	0	USH2A	214415324	0.043000	0.20138	0.022000	0.16811	0.462000	0.32619	2.353000	0.44089	1.310000	0.45006	-0.277000	0.10078	TCA		0.443	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		12	34	1	0	3.07112e-06	0.000978	4.74378e-06	12	34				
NVL	4931	broad.mit.edu	37	1	224495875	224495875	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:224495875C>T	ENST00000281701.6	-	6	692	c.433G>A	c.(433-435)Gaa>Aaa	p.E145K	NVL_ENST00000482491.1_Intron|NVL_ENST00000469075.1_Intron|NVL_ENST00000340871.4_Intron|NVL_ENST00000391875.2_Missense_Mutation_p.E39K|NVL_ENST00000361463.3_Missense_Mutation_p.E39K|RNU6-1008P_ENST00000384160.1_RNA	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	145						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.E145K(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		GAGGTGGTTTCTCTTTGCTCC	0.433																																							uc001hok.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(433-435)GAA>AAA		nuclear VCP-like isoform 1							160.0	147.0	152.0					1																	224495875		2203	4300	6503	SO:0001583	missense	4931					aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity	g.chr1:224495875C>T	U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.433G>A	1.37:g.224495875C>T	ENSP00000281701:p.Glu145Lys		Somatic				NVL_uc001hol.2_Missense_Mutation_p.E39K|NVL_uc010pvd.1_Intron|NVL_uc010pve.1_Intron|NVL_uc010pvf.1_RNA	p.E145K	NM_002533	NP_002524	WXS	Illumina HiSeq	Unspecified	O15381	NVL_HUMAN		GBM - Glioblastoma multiforme(131;0.00501)	6	476	-			145					B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	ENST00000281701.6	37	c.433G>A	CCDS1541.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512199	0.44660	.	.	ENSG00000143748	ENST00000281701;ENST00000391875;ENST00000361463;ENST00000492281;ENST00000436927	D;D;D	0.95205	-3.48;-3.52;-3.64	5.63	4.7	0.59300	.	0.344359	0.31404	N	0.007720	D	0.88415	0.6430	L	0.29908	0.895	0.09310	N	0.999999	B	0.12630	0.006	B	0.08055	0.003	T	0.70037	-0.4982	10	0.08381	T	0.77	-15.2155	12.9221	0.58239	0.0:0.8717:0.0:0.1283	.	145	O15381	NVL_HUMAN	K	145;39;39;50;41	ENSP00000281701:E145K;ENSP00000375747:E39K;ENSP00000354779:E39K	ENSP00000281701:E145K	E	-	1	0	NVL	222562498	0.942000	0.31987	0.985000	0.45067	0.843000	0.47879	1.959000	0.40412	2.814000	0.96858	0.655000	0.94253	GAA		0.433	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533		7	110	0	0	0	0.001984	0	7	110				
TARBP1	6894	broad.mit.edu	37	1	234529176	234529176	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:234529176G>A	ENST00000040877.1	-	28	4491	c.4492C>T	c.(4492-4494)Cag>Tag	p.Q1498*	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1498					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.Q1498*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			CTGATACACTGAAGGCTGCCA	0.473																																							uc001hwd.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(1)	3						c.(4492-4494)CAG>TAG		TAR RNA binding protein 1							135.0	122.0	127.0					1																	234529176		2203	4300	6503	SO:0001587	stop_gained	6894				regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity	g.chr1:234529176G>A		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4492C>T	1.37:g.234529176G>A	ENSP00000040877:p.Gln1498*		Somatic					p.Q1498*	NM_005646	NP_005637	WXS	Illumina HiSeq	Unspecified	Q13395	TARB1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000263)		28	4492	-	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	1498					Q9H581	Nonsense_Mutation	SNP	ENST00000040877.1	37	c.4492C>T	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	G	42	9.301294	0.99130	.	.	ENSG00000059588	ENST00000040877	.	.	.	5.44	5.44	0.79542	.	0.453329	0.25807	N	0.028163	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.9447	19.4445	0.94841	0.0:0.0:1.0:0.0	.	.	.	.	X	1498	.	ENSP00000040877:Q1498X	Q	-	1	0	TARBP1	232595799	1.000000	0.71417	0.294000	0.24946	0.160000	0.22226	7.425000	0.80255	2.828000	0.97474	0.650000	0.86243	CAG		0.473	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646		4	46	0	0	0	0.000602	0	4	46				
RYR2	6262	broad.mit.edu	37	1	237617733	237617733	+	Silent	SNP	C	C	A	rs573201028		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:237617733C>A	ENST00000366574.2	+	15	1652	c.1335C>A	c.(1333-1335)gtC>gtA	p.V445V	RYR2_ENST00000542537.1_Silent_p.V429V|RYR2_ENST00000360064.6_Silent_p.V443V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	445					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.V443V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTCCACAGTCGATTTGCCTA	0.423																																							uc001hyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(1333-1335)GTC>GTA		cardiac muscle ryanodine receptor							91.0	87.0	89.0					1																	237617733		1900	4108	6008	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237617733C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1335C>A	1.37:g.237617733C>A			Somatic					p.V445V	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		15	1455	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	445			Cytoplasmic (By similarity).		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.1335C>A	CCDS55691.1																																																																																				0.423	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		12	50	1	0	7.93312e-07	0.00245	1.25911e-06	12	50				
OR2L3	391192	broad.mit.edu	37	1	248224188	248224188	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:248224188G>C	ENST00000359959.3	+	1	205	c.205G>C	c.(205-207)Gac>Cac	p.D69H	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D69H(1)		cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CTCCCTCATTGACCTAAATTA	0.423																																							uc001idx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(205-207)GAC>CAC		olfactory receptor, family 2, subfamily L,							304.0	287.0	293.0					1																	248224188		2203	4297	6500	SO:0001583	missense	391192				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248224188G>C	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.205G>C	1.37:g.248224188G>C	ENSP00000353044:p.Asp69His		Somatic				OR2L13_uc001ids.2_Intron	p.D69H	NM_001004687	NP_001004687	WXS	Illumina HiSeq	Unspecified	Q8NG85	OR2L3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	205	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		69			Helical; Name=2; (Potential).		B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	c.205G>C	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	.	11.50	1.657336	0.29425	.	.	ENSG00000198128	ENST00000359959	T	0.67698	-0.28	2.05	2.05	0.26809	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33572	U	0.004779	D	0.85779	0.5776	H	0.97540	4.025	0.23126	N	0.998259	D	0.71674	0.998	D	0.67231	0.95	T	0.78425	-0.2209	10	0.87932	D	0	.	11.9647	0.53027	0.0:0.0:1.0:0.0	.	69	Q8NG85	OR2L3_HUMAN	H	69	ENSP00000353044:D69H	ENSP00000353044:D69H	D	+	1	0	OR2L3	246290811	1.000000	0.71417	0.018000	0.16275	0.413000	0.31143	5.136000	0.64783	1.124000	0.41980	0.462000	0.41574	GAC		0.423	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687		43	353	0	0	0	0.003214	0	43	353				
NEBL	10529	broad.mit.edu	37	10	21108395	21108395	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr10:21108395C>T	ENST00000377122.4	-	20	2409	c.2013G>A	c.(2011-2013)ccG>ccA	p.P671P	NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	671					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)	p.P671P(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TCTCTATCTCCGGGGTCATGC	0.413																																							uc001iqi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(2011-2013)CCG>CCA		nebulette sarcomeric isoform							167.0	154.0	158.0					10																	21108395		2203	4300	6503	SO:0001819	synonymous_variant	10529				regulation of actin filament length		actin binding|structural constituent of muscle	g.chr10:21108395C>T	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2013G>A	10.37:g.21108395C>T			Somatic				NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	p.P671P	NM_006393	NP_006384	WXS	Illumina HiSeq	Unspecified	O76041	NEBL_HUMAN			20	2410	-			671			Nebulin 19.		B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	ENST00000377122.4	37	c.2013G>A	CCDS7134.1																																																																																				0.413	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393		43	122	0	0	0	0.003214	0	43	122				
MLLT10	8028	broad.mit.edu	37	10	22015199	22015199	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr10:22015199C>T	ENST00000307729.7	+	15	2083	c.1905C>T	c.(1903-1905)ctC>ctT	p.L635L	MLLT10_ENST00000377059.3_Silent_p.L635L|MLLT10_ENST00000377072.3_Silent_p.L651L|MLLT10_ENST00000446906.2_Silent_p.L635L			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	635	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.L635L(1)|p.L651L(1)		NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						GATCTTCTCTCAGTCAGGCAC	0.313			T	"""MLL, PICALM, CDK6"""	AL																																		uc001iqs.2		NA		Dom	yes		10	10p12	8028	T	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""			L	MLL|PICALM|CDK6		AL		2	Substitution - coding silent(2)		lung(2)	lung(1)|skin(1)	2						c.(1951-1953)CTC>CTT		myeloid/lymphoid or mixed-lineage leukemia							167.0	182.0	177.0					10																	22015199		2203	4300	6503	SO:0001819	synonymous_variant	8028				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:22015199C>T	U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.1905C>T	10.37:g.22015199C>T			Somatic				MLLT10_uc001iqt.2_Silent_p.L635L|MLLT10_uc001iqv.2_RNA|MLLT10_uc001iqy.2_Silent_p.L635L|MLLT10_uc001ira.2_Silent_p.L92L|MLLT10_uc001irb.2_RNA	p.L651L	NM_004641	NP_004632	WXS	Illumina HiSeq	Unspecified	P55197	AF10_HUMAN			16	2301	+			651			DNA-binding.		B1ANA8|Q5JT37|Q5VX90|Q66K63	Silent	SNP	ENST00000307729.7	37	c.1953C>T	CCDS55708.1																																																																																				0.313	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047136.1			24	231	0	0	0	0.005443	0	24	231				
SLC18A3	6572	broad.mit.edu	37	10	50819573	50819573	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr10:50819573G>A	ENST00000374115.3	+	1	1227	c.787G>A	c.(787-789)Gcc>Acc	p.A263T	CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000395559.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	263					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)	p.A263T(1)		endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						GCTGGCAGTGGCCAAACCCTT	0.662																																							uc001jhw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(787-789)GCC>ACC		vesicular acetylcholine transporter							30.0	29.0	29.0					10																	50819573		2203	4299	6502	SO:0001583	missense	6572				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity	g.chr10:50819573G>A	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.787G>A	10.37:g.50819573G>A	ENSP00000363229:p.Ala263Thr		Somatic				CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	p.A263T	NM_003055	NP_003046	WXS	Illumina HiSeq	Unspecified	Q16572	VACHT_HUMAN			1	1227	+			263			Helical; (Potential).		B2R7S1	Missense_Mutation	SNP	ENST00000374115.3	37	c.787G>A	CCDS7231.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.614183	0.28712	.	.	ENSG00000187714	ENST00000374115	T	0.80653	-1.4	5.42	5.42	0.78866	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.265657	0.31884	U	0.006903	T	0.70954	0.3283	L	0.34521	1.04	0.24453	N	0.994476	B	0.21452	0.056	B	0.25405	0.06	T	0.61342	-0.7082	10	0.42905	T	0.14	-13.7172	9.837	0.40975	0.1524:0.0:0.8476:0.0	.	263	Q16572	VACHT_HUMAN	T	263	ENSP00000363229:A263T	ENSP00000363229:A263T	A	+	1	0	SLC18A3	50489579	1.000000	0.71417	0.983000	0.44433	0.113000	0.19764	2.401000	0.44513	2.552000	0.86080	0.561000	0.74099	GCC		0.662	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055		3	16	0	0	0	0.004672	0	3	16				
SLC18A3	6572	broad.mit.edu	37	10	50819935	50819935	+	Silent	SNP	A	A	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr10:50819935A>T	ENST00000374115.3	+	1	1589	c.1149A>T	c.(1147-1149)ctA>ctT	p.L383L	CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000395559.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	383					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)	p.L383L(1)		endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						TCGCGCCGCTAGTGGTCTCAC	0.657																																							uc001jhw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1147-1149)CTA>CTT		vesicular acetylcholine transporter							31.0	31.0	31.0					10																	50819935		2203	4300	6503	SO:0001819	synonymous_variant	6572				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity	g.chr10:50819935A>T	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.1149A>T	10.37:g.50819935A>T			Somatic				CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	p.L383L	NM_003055	NP_003046	WXS	Illumina HiSeq	Unspecified	Q16572	VACHT_HUMAN			1	1589	+			383			Lumenal, vesicle (Potential).		B2R7S1	Silent	SNP	ENST00000374115.3	37	c.1149A>T	CCDS7231.1																																																																																				0.657	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055		8	26	0	0	0	0.000673	0	8	26				
CLRN3	119467	broad.mit.edu	37	10	129676623	129676623	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr10:129676623G>A	ENST00000368671.3	-	3	633	c.471C>T	c.(469-471)tcC>tcT	p.S157S		NM_152311.3	NP_689524.1	Q8NCR9	CLRN3_HUMAN	clarin 3	157						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S157S(1)		endometrium(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6		all_epithelial(44;0.00168)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)|Colorectal(57;0.235)				ACAACTCTTCGGAGAGTTGGT	0.468																																							uc001lka.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(469-471)TCC>TCT		clarin 3							166.0	132.0	143.0					10																	129676623		2203	4300	6503	SO:0001819	synonymous_variant	119467					integral to membrane		g.chr10:129676623G>A	BC029478	CCDS7656.1	10q26.2	2006-11-24	2006-11-23	2006-11-23	ENSG00000180745	ENSG00000180745			20795	protein-coding gene	gene with protein product			"""transmembrane protein 12"""	TMEM12		12145752, 12080385	Standard	NM_152311		Approved	MGC32871, USH3AL1	uc001lka.1	Q8NCR9	OTTHUMG00000019253	ENST00000368671.3:c.471C>T	10.37:g.129676623G>A			Somatic				CLRN3_uc001ljz.1_Silent_p.S89S	p.S157S	NM_152311	NP_689524	WXS	Illumina HiSeq	Unspecified	Q8NCR9	CLRN3_HUMAN			3	634	-		all_epithelial(44;0.00168)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)|Colorectal(57;0.235)	157					Q6MZX8	Silent	SNP	ENST00000368671.3	37	c.471C>T	CCDS7656.1																																																																																				0.468	CLRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050987.1	NM_152311		11	45	0	0	0	0.000673	0	11	45				
ZNF195	7748	broad.mit.edu	37	11	3380601	3380601	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:3380601C>G	ENST00000399602.4	-	6	1763	c.1637G>C	c.(1636-1638)gGa>gCa	p.G546A	ZNF195_ENST00000526601.1_Missense_Mutation_p.G527A|ZNF195_ENST00000354599.6_Missense_Mutation_p.G474A|ZNF195_ENST00000343338.7_Missense_Mutation_p.G478A|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000005082.9_Missense_Mutation_p.G523A|ZNF195_ENST00000429541.2_Missense_Mutation_p.G478A	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	546					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G474A(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		GGGTTTCTCTCCAGTATGAAT	0.403																																							uc001lxt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1636-1638)GGA>GCA		zinc finger protein 195 isoform 1							113.0	117.0	116.0					11																	3380601		2083	4232	6315	SO:0001583	missense	7748				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:3380601C>G		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1637G>C	11.37:g.3380601C>G	ENSP00000382511:p.Gly546Ala		Somatic				uc001lxr.2_5'Flank|ZNF195_uc001lxv.2_Missense_Mutation_p.G523A|ZNF195_uc001lxs.2_Missense_Mutation_p.G474A|ZNF195_uc010qxr.1_Missense_Mutation_p.G527A|ZNF195_uc009ydz.2_Missense_Mutation_p.G501A|ZNF195_uc001lxu.2_Missense_Mutation_p.G478A	p.G546A	NM_001130520	NP_001123992	WXS	Illumina HiSeq	Unspecified	O14628	ZN195_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)	6	1815	-		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)	546					A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Missense_Mutation	SNP	ENST00000399602.4	37	c.1637G>C	CCDS44522.1	.	.	.	.	.	.	.	.	.	.	c	15.51	2.853910	0.51270	.	.	ENSG00000005801	ENST00000354599;ENST00000399602;ENST00000343338;ENST00000429541;ENST00000005082;ENST00000526601	T;T;T;T;T;T	0.01505	4.82;4.82;4.82;4.82;4.82;4.82	1.27	0.193	0.15139	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06188	0.0160	M	0.65975	2.015	0.29557	N	0.850885	D;D;P;D;P;D	0.89917	0.975;0.996;0.537;0.995;0.592;1.0	D;P;B;P;B;P	0.66716	0.946;0.663;0.038;0.532;0.064;0.66	T	0.18398	-1.0338	9	0.87932	D	0	.	5.2894	0.15719	0.0:0.7758:0.0:0.2242	.	527;405;523;478;546;474	O14628-6;Q59EZ7;O14628-5;O14628-7;O14628;O14628-4	.;.;.;.;ZN195_HUMAN;.	A	474;546;478;478;523;527	ENSP00000346613:G474A;ENSP00000382511:G546A;ENSP00000344483:G478A;ENSP00000387998:G478A;ENSP00000005082:G523A;ENSP00000435828:G527A	ENSP00000005082:G523A	G	-	2	0	ZNF195	3337177	0.997000	0.39634	0.001000	0.08648	0.474000	0.32979	5.366000	0.66122	-0.182000	0.10602	0.305000	0.20034	GGA		0.403	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2			14	109	0	0	0	0.006122	0	14	109				
OVCH2	341277	broad.mit.edu	37	11	7722003	7722003	+	RNA	SNP	C	C	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:7722003C>A	ENST00000534193.2	-	0	767				OVCH2_ENST00000454689.1_RNA			Q7RTZ1	OVCH2_HUMAN	ovochymase 2 (gene/pseudogene)							extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.R247R(1)		cervix(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(2)	15				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		CTTTCTTATTCCGGCACATGA	0.512																																							uc010rbf.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(739-741)CGG>CGT		ovochymase 2 precursor							43.0	42.0	42.0					11																	7722003		1953	4139	6092			341277							g.chr11:7722003C>A	BN000120	CCDS73251.1	11p15.4	2012-10-02	2010-06-08		ENSG00000183378	ENSG00000183378			29970	protein-coding gene	gene with protein product			"""ovochymase 2"""			12838346	Standard	XM_006718221		Approved	OVTN	uc031pyw.1	Q7RTZ1	OTTHUMG00000165418		11.37:g.7722003C>A			Somatic					p.R247R	NM_198185	NP_937828	WXS	Illumina HiSeq	Unspecified				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)	7	741	-									Silent	SNP	ENST00000534193.2	37	c.741G>T																																																																																					0.512	OVCH2-001	KNOWN	non_canonical_polymorphism|not_organism_supported|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000383929.7	NM_198185		6	11	1	0	2.0095e-06	0.001984	3.14609e-06	6	11				
LIN7C	55327	broad.mit.edu	37	11	27520959	27520959	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:27520959C>T	ENST00000278193.2	-	4	405	c.385G>A	c.(385-387)Gat>Aat	p.D129N	LIN7C_ENST00000524596.1_Missense_Mutation_p.D105N	NM_018362.3	NP_060832.1	Q9NUP9	LIN7C_HUMAN	lin-7 homolog C (C. elegans)	129	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				exocytosis (GO:0006887)|morphogenesis of an epithelial sheet (GO:0002011)|neurotransmitter secretion (GO:0007269)|protein transport (GO:0015031)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|MPP7-DLG1-LIN7 complex (GO:0097025)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|L27 domain binding (GO:0097016)|protein domain specific binding (GO:0019904)	p.D129N(1)		endometrium(2)|lung(2)|upper_aerodigestive_tract(1)	5						CCATGTCTATCAGCAATTCCA	0.413																																							uc001mrl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(385-387)GAT>AAT		lin-7 homolog C							131.0	128.0	129.0					11																	27520959		2202	4299	6501	SO:0001583	missense	55327				exocytosis|protein transport	basolateral plasma membrane|postsynaptic density|postsynaptic membrane|synaptosome|tight junction		g.chr11:27520959C>T	AK002077	CCDS7864.1	11p14	2008-07-18				ENSG00000148943			17789	protein-coding gene	gene with protein product	"""LIN-7 protein 3"""	612332				10341223	Standard	NM_018362		Approved	MALS-3, Lin7c, LIN-7C, LIN-7-C, VELI3, FLJ11215	uc001mrl.3	Q9NUP9		ENST00000278193.2:c.385G>A	11.37:g.27520959C>T	ENSP00000278193:p.Asp129Asn		Somatic				LIN7C_uc009yii.2_Missense_Mutation_p.D105N	p.D129N	NM_018362	NP_060832	WXS	Illumina HiSeq	Unspecified	Q9NUP9	LIN7C_HUMAN			4	412	-			129			PDZ.			Missense_Mutation	SNP	ENST00000278193.2	37	c.385G>A	CCDS7864.1	.	.	.	.	.	.	.	.	.	.	C	34	5.349724	0.95830	.	.	ENSG00000148943	ENST00000278193;ENST00000524596	T;T	0.27720	1.65;1.65	6.01	6.01	0.97437	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.43144	0.1234	M	0.69358	2.11	0.80722	D	1	B;B	0.22080	0.005;0.064	B;B	0.32724	0.019;0.151	T	0.30563	-0.9974	10	0.72032	D	0.01	.	20.5211	0.99222	0.0:1.0:0.0:0.0	.	105;129	G3V1D4;Q9NUP9	.;LIN7C_HUMAN	N	129;105	ENSP00000278193:D129N;ENSP00000435353:D105N	ENSP00000278193:D129N	D	-	1	0	LIN7C	27477535	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.861000	0.98227	0.650000	0.86243	GAT		0.413	LIN7C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388311.2	NM_018362		20	95	0	0	0	0.001882	0	20	95				
SYT13	57586	broad.mit.edu	37	11	45274044	45274044	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:45274044G>A	ENST00000020926.3	-	4	885	c.774C>T	c.(772-774)ctC>ctT	p.L258L	CTD-2560E9.5_ENST00000534342.1_RNA|CTD-2560E9.5_ENST00000531663.1_RNA	NM_001247987.1|NM_020826.2	NP_001234916.1|NP_065877.1	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	258	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				vesicle-mediated transport (GO:0016192)	integral component of plasma membrane (GO:0005887)|transport vesicle (GO:0030133)		p.L258L(1)		breast(1)|large_intestine(3)|lung(16)|ovary(1)|skin(2)	23						GGCCCAGGCGGAGCTCCCCGG	0.662											OREG0020928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001myq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(772-774)CTC>CTT		synaptotagmin XIII							46.0	47.0	47.0					11																	45274044		2203	4299	6502	SO:0001819	synonymous_variant	57586					transport vesicle		g.chr11:45274044G>A	AB037848	CCDS31470.1	11p12-p11	2013-01-21			ENSG00000019505	ENSG00000019505		"""Synaptotagmins"""	14962	protein-coding gene	gene with protein product		607716				11171101	Standard	NM_020826		Approved	KIAA1427	uc001myq.2	Q7L8C5	OTTHUMG00000166504	ENST00000020926.3:c.774C>T	11.37:g.45274044G>A			Somatic	OREG0020928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	930	SYT13_uc009yku.1_Silent_p.L114L	p.L258L	NM_020826	NP_065877	WXS	Illumina HiSeq	Unspecified	Q7L8C5	SYT13_HUMAN			4	900	-			258			Cytoplasmic (Potential).|C2 1.		A8K4P4|D3DQP1|Q9BQS3|Q9H041|Q9P2C0	Silent	SNP	ENST00000020926.3	37	c.774C>T	CCDS31470.1																																																																																				0.662	SYT13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390110.1	NM_020826		4	57	0	0	0	0.000602	0	4	57				
OR4C15	81309	broad.mit.edu	37	11	55321870	55321870	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:55321870A>C	ENST00000314644.2	+	1	88	c.88A>C	c.(88-90)Aag>Cag	p.K30Q		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K30Q(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						AATTGATCTGAAGCAAATTTT	0.343										HNSCC(20;0.049)																													uc010rig.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(88-90)AAG>CAG		olfactory receptor, family 4, subfamily C,							158.0	156.0	157.0					11																	55321870		2201	4296	6497	SO:0001583	missense	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55321870A>C	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.88A>C	11.37:g.55321870A>C	ENSP00000324958:p.Lys30Gln	HNSCC(20;0.049)	Somatic					p.K30Q	NM_001001920	NP_001001920	WXS	Illumina HiSeq	Unspecified	Q8NGM1	OR4CF_HUMAN			1	88	+			Error:Variant_position_missing_in_Q8NGM1_after_alignment					Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	c.88A>C	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	A	7.611	0.674735	0.14841	.	.	ENSG00000181939	ENST00000314644	T	0.00005	9.78	4.79	4.79	0.61399	.	.	.	.	.	T	0.00109	0.0003	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.41858	-0.9485	6	0.51188	T	0.08	.	10.6247	0.45500	1.0:0.0:0.0:0.0	.	.	.	.	Q	30	ENSP00000324958:K30Q	ENSP00000324958:K30Q	K	+	1	0	OR4C15	55078446	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.385000	0.20685	2.013000	0.59113	0.317000	0.21355	AAG		0.343	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		4	168	0	0	0	0.000248	0	4	168				
MYO7A	4647	broad.mit.edu	37	11	76885842	76885842	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:76885842C>A	ENST00000409709.3	+	17	2248	c.1976C>A	c.(1975-1977)tCa>tAa	p.S659*	MYO7A_ENST00000458637.2_Nonsense_Mutation_p.S659*|MYO7A_ENST00000409893.1_Nonsense_Mutation_p.S659*|MYO7A_ENST00000409619.2_Nonsense_Mutation_p.S648*	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	659	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)	p.S659*(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CTGCGGTACTCAGGAATGATG	0.637																																							uc001oyb.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|breast(1)	4						c.(1975-1977)TCA>TAA		myosin VIIA isoform 1							34.0	38.0	37.0					11																	76885842		2008	4165	6173	SO:0001587	stop_gained	4647				actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr11:76885842C>A	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.1976C>A	11.37:g.76885842C>A	ENSP00000386331:p.Ser659*		Somatic				MYO7A_uc010rsl.1_Nonsense_Mutation_p.S659*|MYO7A_uc010rsm.1_Nonsense_Mutation_p.S648*|MYO7A_uc001oyc.2_Nonsense_Mutation_p.S659*|MYO7A_uc001oyd.2_5'UTR	p.S659*	NM_000260	NP_000251	WXS	Illumina HiSeq	Unspecified	Q13402	MYO7A_HUMAN			17	2248	+			659			Myosin head-like.		B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Nonsense_Mutation	SNP	ENST00000409709.3	37	c.1976C>A	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	C	43	10.148945	0.99346	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.7655	0.91871	0.0:1.0:0.0:0.0	.	.	.	.	X	659;659;659;648;658;658;535;658	.	ENSP00000345075:S535X	S	+	2	0	MYO7A	76563490	1.000000	0.71417	0.985000	0.45067	0.930000	0.56654	5.728000	0.68531	2.435000	0.82474	0.478000	0.44815	TCA		0.637	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260		3	11	1	0	0.004672	0.004672	0.00690817	3	11				
DDIAS	220042	broad.mit.edu	37	11	82645329	82645329	+	Silent	SNP	T	T	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:82645329T>G	ENST00000533655.1	+	6	3161	c.2949T>G	c.(2947-2949)ccT>ccG	p.P983P	C11orf82_ENST00000329143.3_Silent_p.P682P|C11orf82_ENST00000430323.2_Silent_p.P983P|C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000525361.1_Intron	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		983					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P983P(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						AAGGCCCACCTTCAGTGTGTG	0.408																																							uc001ozt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(2947-2949)CCT>CCG		nitric oxide-inducible gene protein							83.0	85.0	84.0					11																	82645329		2203	4300	6503	SO:0001819	synonymous_variant	220042				apoptosis|cell cycle arrest	cytoplasm|nucleus		g.chr11:82645329T>G																												ENST00000533655.1:c.2949T>G	11.37:g.82645329T>G			Somatic				C11orf82_uc010rsr.1_Silent_p.P682P|C11orf82_uc010rss.1_Silent_p.P682P|C11orf82_uc009yvd.2_Intron	p.P983P	NM_145018	NP_659455	WXS	Illumina HiSeq	Unspecified	Q8IXT1	NOXIN_HUMAN			6	3193	+			983					Q96LK6|Q9H856	Silent	SNP	ENST00000533655.1	37	c.2949T>G	CCDS8263.1																																																																																				0.408	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391936.1			14	86	0	0	0	0.00245	0	14	86				
RAB30	27314	broad.mit.edu	37	11	82693228	82693228	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:82693228C>G	ENST00000533486.1	-	6	875	c.591G>C	c.(589-591)ttG>ttC	p.L197F	RP11-659G9.3_ENST00000527550.1_RNA|RAB30_ENST00000527633.1_Missense_Mutation_p.L197F|RAB30_ENST00000260056.2_Missense_Mutation_p.L197F|RAB30_ENST00000534141.1_3'UTR	NM_014488.3	NP_055303.2	Q15771	RAB30_HUMAN	RAB30, member RAS oncogene family	197					Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cis-Golgi network (GO:0005801)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L197F(1)		endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						TACAACAAGTCAAATAGCTGA	0.473																																							uc001ozu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(589-591)TTG>TTC		RAB30, member RAS oncogene family							135.0	120.0	125.0					11																	82693228		2203	4300	6503	SO:0001583	missense	27314				protein transport|small GTPase mediated signal transduction	Golgi stack|plasma membrane	GTP binding|GTPase activity	g.chr11:82693228C>G	U57092	CCDS8264.1	11q12-q14	2008-07-21				ENSG00000137502		"""RAB, member RAS oncogene"""	9770	protein-coding gene	gene with protein product		605693				8863739, 9792283	Standard	NM_014488		Approved		uc001ozu.3	Q15771		ENST00000533486.1:c.591G>C	11.37:g.82693228C>G	ENSP00000435189:p.Leu197Phe		Somatic				RAB30_uc009yve.2_Missense_Mutation_p.L195F|RAB30_uc010rst.1_Missense_Mutation_p.L195F|RAB30_uc001ozv.2_3'UTR	p.L197F	NM_014488	NP_055303	WXS	Illumina HiSeq	Unspecified	Q15771	RAB30_HUMAN			6	852	-			197					Q6FGK1|Q6MZH2|Q96CI8	Missense_Mutation	SNP	ENST00000533486.1	37	c.591G>C	CCDS8264.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.067737	0.36470	.	.	ENSG00000137502	ENST00000533486;ENST00000260056;ENST00000533014;ENST00000527633	T;T;T;T	0.63913	-0.07;-0.07;0.0;-0.07	5.96	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.42471	0.1204	N	0.08118	0	0.80722	D	1	B	0.23128	0.08	B	0.17098	0.017	T	0.27365	-1.0076	9	.	.	.	.	17.253	0.87047	0.0:0.8742:0.1258:0.0	.	197	Q15771	RAB30_HUMAN	F	197;197;161;197	ENSP00000435189:L197F;ENSP00000260056:L197F;ENSP00000433832:L161F;ENSP00000435089:L197F	.	L	-	3	2	RAB30	82370876	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.844000	0.62846	1.515000	0.48885	0.655000	0.94253	TTG		0.473	RAB30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392141.1	NM_014488		3	127	0	0	0	0.004672	0	3	127				
TAF1D	79101	broad.mit.edu	37	11	93469869	93469869	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:93469869G>C	ENST00000448108.2	-	5	1334	c.684C>G	c.(682-684)atC>atG	p.I228M	MIR1304_ENST00000408243.1_RNA|SNORA40_ENST00000388090.1_RNA|TAF1D_ENST00000546088.1_5'Flank	NM_024116.3	NP_077021.1	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa	228					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.I228M(1)		large_intestine(1)|lung(3)|prostate(1)|skin(2)	7						CTGCCAATTTGATATCACATT	0.338																																							uc001ped.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(682-684)ATC>ATG		TATA box binding protein (TBP)-associated							122.0	124.0	123.0					11																	93469869		2200	4298	6498	SO:0001583	missense	79101				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding	g.chr11:93469869G>C		CCDS8293.1	11q21	2012-05-30	2008-09-30	2008-09-30	ENSG00000166012	ENSG00000166012			28759	protein-coding gene	gene with protein product		612823	"""Josephin domain containing 3"""	JOSD3		15520167, 17318177	Standard	NM_024116		Approved	MGC5306, TAF(I)41	uc001pec.3	Q9H5J8	OTTHUMG00000167451	ENST00000448108.2:c.684C>G	11.37:g.93469869G>C	ENSP00000410409:p.Ile228Met		Somatic				SNORA8_uc001pec.2_5'Flank|TAF1D_uc001pdz.2_RNA|TAF1D_uc001pea.1_Intron|MIR1304_hsa-mir-1304|MI0006371_5'Flank|SNORA40_uc009ywh.2_5'Flank	p.I228M	NM_024116	NP_077021	WXS	Illumina HiSeq	Unspecified	Q9H5J8	TAF1D_HUMAN			5	886	-			228					Q6I9Y6	Missense_Mutation	SNP	ENST00000448108.2	37	c.684C>G	CCDS8293.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.035269	0.35893	.	.	ENSG00000166012	ENST00000448108	.	.	.	4.32	2.38	0.29361	.	0.548786	0.17187	N	0.183651	T	0.61502	0.2352	L	0.60455	1.87	0.35834	D	0.825546	D	0.67145	0.996	D	0.66497	0.944	T	0.65821	-0.6075	9	0.54805	T	0.06	-30.7835	6.3048	0.21133	0.2367:0.0:0.7633:0.0	.	228	Q9H5J8	TAF1D_HUMAN	M	228	.	ENSP00000314971:I228M	I	-	3	3	TAF1D	93109517	1.000000	0.71417	0.983000	0.44433	0.404000	0.30871	1.271000	0.33098	0.704000	0.31869	0.585000	0.79938	ATC		0.338	TAF1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394662.2	NM_024116		4	74	0	0	0	0.000248	0	4	74				
GRIA4	2893	broad.mit.edu	37	11	105795124	105795124	+	Splice_Site	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:105795124G>C	ENST00000530497.1	+	11	1476		c.e11-1		GRIA4_ENST00000393127.2_Splice_Site|GRIA4_ENST00000525187.1_Splice_Site|GRIA4_ENST00000282499.5_Splice_Site			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.?(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TTCTCTTATAGAAAGCAGAGA	0.383																																							uc001pix.2		NA																	2	Unknown(2)		lung(2)	ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8						c.e12-1		glutamate receptor, ionotrophic, AMPA 4 isoform	L-Glutamic Acid(DB00142)						81.0	83.0	83.0					11																	105795124		2202	4299	6501	SO:0001630	splice_region_variant	2893				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity	g.chr11:105795124G>C	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1477-1G>C	11.37:g.105795124G>C			Somatic				GRIA4_uc001piw.2_Splice_Site_p.K493_splice	p.K493_splice	NM_000829	NP_000820	WXS	Illumina HiSeq	Unspecified	P48058	GRIA4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	12	1923	+		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)						Q86XE8	Splice_Site	SNP	ENST00000530497.1	37	c.1477_splice	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552611	0.86127	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3242	0.98691	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRIA4	105300334	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.813000	0.99286	2.882000	0.98803	0.655000	0.94253	.		0.383	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		Intron	11	100	0	0	0	0.001368	0	11	100				
SDHD	6392	broad.mit.edu	37	11	111958662	111958662	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:111958662G>A	ENST00000375549.3	+	2	269	c.134G>A	c.(133-135)gGa>gAa	p.G45E	SDHD_ENST00000525291.1_Intron|SDHD_ENST00000528182.1_Missense_Mutation_p.G45E|TIMM8B_ENST00000504148.2_5'Flank|SDHD_ENST00000526592.1_Missense_Mutation_p.G45E|SDHD_ENST00000532699.1_Missense_Mutation_p.G45E|SDHD_ENST00000528021.1_Missense_Mutation_p.G45E|TIMM8B_ENST00000541231.1_5'Flank|SDHD_ENST00000528048.1_Missense_Mutation_p.G45E|TIMM8B_ENST00000507614.1_5'Flank	NM_003002.2	NP_002993.1	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D, integral membrane protein	45					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)|ubiquinone binding (GO:0048039)	p.G45E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	9		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Hexachlorophene(DB00756)|Succinic acid(DB00139)	GAATGGTGTGGAGTGCAGCAC	0.493			"""Mis, N, F, S"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																														uc001pmz.2		NA	yes	Rec		Familial paraganglioma	11	11q23	6392	Mis|N|F|S	"""succinate dehydrogenase complex, subunit D, integral membrane protein"""			O		paraganglioma|pheochromocytoma			1	Substitution - Missense(1)		lung(1)		0						c.(133-135)GGA>GAA		succinate dehydrogenase complex, subunit D	Succinic acid(DB00139)						174.0	151.0	159.0					11																	111958662		2201	4297	6498	SO:0001583	missense	6392	Familial_Paragangliomas|Carney-Stratakis_syndrome|Cowden_syndrome	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II	electron carrier activity|heme binding|succinate dehydrogenase activity|ubiquinone binding	g.chr11:111958662G>A	AB006202	CCDS31678.1, CCDS60958.1, CCDS60959.1, CCDS60960.1	11q23	2014-09-17				ENSG00000204370		"""Mitochondrial respiratory chain complex / Complex II"""	10683	protein-coding gene	gene with protein product		602690		PGL, PGL1		9533030, 1301144	Standard	NM_003002		Approved		uc001pmz.4	O14521		ENST00000375549.3:c.134G>A	11.37:g.111958662G>A	ENSP00000364699:p.Gly45Glu		Somatic				TIMM8B_uc001pmx.2_5'Flank|TIMM8B_uc001pmy.2_5'Flank	p.G45E	NM_003002	NP_002993	WXS	Illumina HiSeq	Unspecified	O14521	DHSD_HUMAN		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	2	195	+		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	45					A6ND90|B3KQQ8|E9PIC0|E9PIG3|E9PQI9|Q53XW5|Q6IRW2	Missense_Mutation	SNP	ENST00000375549.3	37	c.134G>A	CCDS31678.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183385	0.78677	.	.	ENSG00000204370	ENST00000375549;ENST00000528182;ENST00000528048;ENST00000528021;ENST00000526592	D;D;D;D;D	0.95069	-3.6;-3.05;-2.67;-3.02;-3.16	4.9	4.9	0.64082	.	0.492639	0.22280	N	0.062127	D	0.92251	0.7542	M	0.67953	2.075	0.80722	D	1	B	0.29805	0.257	B	0.33846	0.171	D	0.87903	0.2692	10	0.06891	T	0.86	-1.5037	13.4442	0.61131	0.0:0.0:1.0:0.0	.	45	O14521	DHSD_HUMAN	E	45	ENSP00000364699:G45E;ENSP00000435475:G45E;ENSP00000436217:G45E;ENSP00000432465:G45E;ENSP00000432005:G45E	ENSP00000436395:G45E	G	+	2	0	SDHD	111463872	0.998000	0.40836	0.956000	0.39512	0.855000	0.48748	4.166000	0.58203	2.549000	0.85964	0.650000	0.86243	GGA		0.493	SDHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392351.1	NM_003002		12	185	0	0	0	0.001368	0	12	185				
GRIK4	2900	broad.mit.edu	37	11	120833308	120833308	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:120833308G>T	ENST00000527524.2	+	18	2471	c.2184G>T	c.(2182-2184)gaG>gaT	p.E728D	GRIK4_ENST00000438375.2_Missense_Mutation_p.E728D	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	728					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.E728D(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		CCATGAACGAGTACTATCGGC	0.557																																							uc001pxn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2182-2184)GAG>GAT		glutamate receptor KA1 precursor	L-Glutamic Acid(DB00142)						94.0	91.0	92.0					11																	120833308		2203	4299	6502	SO:0001583	missense	2900				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr11:120833308G>T	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.2184G>T	11.37:g.120833308G>T	ENSP00000435648:p.Glu728Asp		Somatic				GRIK4_uc009zav.1_Missense_Mutation_p.E728D|GRIK4_uc009zaw.1_Missense_Mutation_p.E728D|GRIK4_uc009zax.1_Missense_Mutation_p.E728D	p.E728D	NM_014619	NP_055434	WXS	Illumina HiSeq	Unspecified	Q16099	GRIK4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	18	2471	+		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)	728			Extracellular (Potential).		A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	37	c.2184G>T	CCDS8433.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.588722	0.86851	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.11712	2.75;2.75	5.69	4.77	0.60923	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.23451	0.0567	L	0.39147	1.195	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.79108	0.989;0.992	T	0.00245	-1.1882	10	0.38643	T	0.18	.	14.6011	0.68441	0.0717:0.0:0.9283:0.0	.	728;728	A6H8K8;Q16099	.;GRIK4_HUMAN	D	728	ENSP00000435648:E728D;ENSP00000404063:E728D	ENSP00000404063:E728D	E	+	3	2	GRIK4	120338518	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.753000	0.68736	2.676000	0.91093	0.655000	0.94253	GAG		0.557	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619		11	57	1	0	3.07112e-06	0.000978	4.74378e-06	11	57				
OR8D2	283160	broad.mit.edu	37	11	124189796	124189796	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr11:124189796G>C	ENST00000357438.2	-	1	388	c.298C>G	c.(298-300)Caa>Gaa	p.Q100E		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q100E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		AAATAAAGTTGAGTAATGCAT	0.408																																							uc010sah.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|central_nervous_system(1)|pancreas(1)	3						c.(298-300)CAA>GAA		olfactory receptor, family 8, subfamily D,							69.0	67.0	68.0					11																	124189796		2201	4299	6500	SO:0001583	missense	283160				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124189796G>C	AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.298C>G	11.37:g.124189796G>C	ENSP00000350022:p.Gln100Glu		Somatic					p.Q100E	NM_001002918	NP_001002918	WXS	Illumina HiSeq	Unspecified	Q9GZM6	OR8D2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)	1	298	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	100			Helical; Name=3; (Potential).		B9EH49|Q6IFR0	Missense_Mutation	SNP	ENST00000357438.2	37	c.298C>G	CCDS31707.1	.	.	.	.	.	.	.	.	.	.	g	14.30	2.494338	0.44352	.	.	ENSG00000197263	ENST00000357438	T	0.01933	4.55	3.59	3.59	0.41128	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45361	D	0.000370	T	0.17746	0.0426	H	0.94698	3.57	0.39402	D	0.966607	D	0.58268	0.982	D	0.67548	0.952	T	0.21075	-1.0256	10	0.87932	D	0	.	15.3064	0.73995	0.0:0.0:1.0:0.0	.	100	Q9GZM6	OR8D2_HUMAN	E	100	ENSP00000350022:Q100E	ENSP00000350022:Q100E	Q	-	1	0	OR8D2	123695006	1.000000	0.71417	0.990000	0.47175	0.250000	0.25880	8.732000	0.91534	2.318000	0.78349	0.530000	0.56133	CAA		0.408	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387286.1	NM_001002918		3	48	0	0	0	0.004672	0	3	48				
CACNA1C	775	broad.mit.edu	37	12	2566832	2566832	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr12:2566832C>T	ENST00000347598.4	+	5	717	c.717C>T	c.(715-717)ttC>ttT	p.F239F	CACNA1C_ENST00000402845.3_Silent_p.F239F|CACNA1C_ENST00000399629.1_Silent_p.F239F|CACNA1C_ENST00000480911.1_Silent_p.F239F|CACNA1C_ENST00000399621.1_Silent_p.F239F|CACNA1C_ENST00000406454.3_Silent_p.F239F|CACNA1C_ENST00000399603.1_Silent_p.F239F|CACNA1C_ENST00000399637.1_Silent_p.F239F|CACNA1C_ENST00000399617.1_Silent_p.F239F|CACNA1C_ENST00000399591.1_Silent_p.F239F|CACNA1C_ENST00000399601.1_Silent_p.F239F|CACNA1C_ENST00000399595.1_Silent_p.F239F|CACNA1C_ENST00000344100.3_Silent_p.F239F|CACNA1C_ENST00000399655.1_Silent_p.F239F|CACNA1C_ENST00000399644.1_Silent_p.F239F|CACNA1C_ENST00000399641.1_Silent_p.F239F|CACNA1C_ENST00000327702.7_Silent_p.F239F|CACNA1C_ENST00000399649.1_Silent_p.F239F|CACNA1C_ENST00000399634.1_Silent_p.F239F|CACNA1C_ENST00000399638.1_Silent_p.F239F|CACNA1C_ENST00000335762.5_Silent_p.F239F|CACNA1C_ENST00000399597.1_Silent_p.F239F|CACNA1C_ENST00000399606.1_Silent_p.F239F	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	239					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.F239F(3)|p.F269F(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGAGGGCCTTCCGCGTGCTGC	0.557																																							uc009zdu.1		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(10)|central_nervous_system(1)	11						c.(715-717)TTC>TTT		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						158.0	177.0	171.0					12																	2566832		2118	4227	6345	SO:0001819	synonymous_variant	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2566832C>T	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.717C>T	12.37:g.2566832C>T			Somatic				CACNA1C_uc009zdv.1_Silent_p.F239F|CACNA1C_uc001qkb.2_Silent_p.F239F|CACNA1C_uc001qkc.2_Silent_p.F239F|CACNA1C_uc001qke.2_Silent_p.F239F|CACNA1C_uc001qkf.2_Silent_p.F239F|CACNA1C_uc001qjz.2_Silent_p.F239F|CACNA1C_uc001qkd.2_Silent_p.F239F|CACNA1C_uc001qkg.2_Silent_p.F239F|CACNA1C_uc009zdw.1_Silent_p.F239F|CACNA1C_uc001qkh.2_Silent_p.F239F|CACNA1C_uc001qkl.2_Silent_p.F239F|CACNA1C_uc001qkn.2_Silent_p.F239F|CACNA1C_uc001qko.2_Silent_p.F239F|CACNA1C_uc001qkp.2_Silent_p.F239F|CACNA1C_uc001qkr.2_Silent_p.F239F|CACNA1C_uc001qku.2_Silent_p.F239F|CACNA1C_uc001qkq.2_Silent_p.F239F|CACNA1C_uc001qks.2_Silent_p.F239F|CACNA1C_uc001qkt.2_Silent_p.F239F|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_5'UTR|CACNA1C_uc001qkj.1_5'UTR|CACNA1C_uc001qkk.1_5'UTR|CACNA1C_uc001qkm.1_5'UTR	p.F239F	NM_199460	NP_955630	WXS	Illumina HiSeq	Unspecified	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	5	1030	+			239			I.|Helical; Name=S4 of repeat I; (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	c.717C>T	CCDS44788.1																																																																																				0.557	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		18	283	0	0	0	0.001216	0	18	283				
NELL2	4753	broad.mit.edu	37	12	45173775	45173775	+	Silent	SNP	C	C	A	rs535789057		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr12:45173775C>A	ENST00000429094.2	-	4	870	c.366G>T	c.(364-366)cgG>cgT	p.R122R	NELL2_ENST00000437801.2_Silent_p.R172R|NELL2_ENST00000547172.1_5'UTR|NELL2_ENST00000452445.2_Silent_p.R122R|NELL2_ENST00000395487.2_Silent_p.R121R|NELL2_ENST00000551601.1_Silent_p.R121R|NELL2_ENST00000333837.4_Silent_p.R145R|NELL2_ENST00000549027.1_Silent_p.R121R	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	122	Laminin G-like.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R122R(1)|p.R172R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		TGACTTCATTCCGATGGCCAC	0.463																																							uc001rog.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(364-366)CGG>CGT		NEL-like protein 2 isoform b precursor							149.0	136.0	141.0					12																	45173775		2203	4300	6503	SO:0001819	synonymous_variant	4753				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity	g.chr12:45173775C>A	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.366G>T	12.37:g.45173775C>A			Somatic				NELL2_uc001rof.3_Silent_p.R121R|NELL2_uc001roh.2_Silent_p.R122R|NELL2_uc009zkd.2_Silent_p.R121R|NELL2_uc010skz.1_Silent_p.R172R|NELL2_uc010sla.1_Silent_p.R145R|NELL2_uc001roi.1_Silent_p.R122R|NELL2_uc010slb.1_Silent_p.R121R|NELL2_uc001roj.2_Silent_p.R122R	p.R122R	NM_001145108	NP_001138580	WXS	Illumina HiSeq	Unspecified	Q99435	NELL2_HUMAN		GBM - Glioblastoma multiforme(48;0.092)	4	961	-	Lung SC(27;0.192)	Lung NSC(34;0.144)	122			TSP N-terminal.		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	ENST00000429094.2	37	c.366G>T	CCDS8746.1																																																																																				0.463	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159		10	74	1	0	2.17888e-05	0.006214	3.32111e-05	10	74				
ACVRL1	94	broad.mit.edu	37	12	52310003	52310003	+	Missense_Mutation	SNP	G	G	A	rs121909284		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr12:52310003G>A	ENST00000388922.4	+	8	1515	c.1232G>A	c.(1231-1233)cGg>cAg	p.R411Q	ACVRL1_ENST00000419526.2_Missense_Mutation_p.R237Q|ACVRL1_ENST00000550683.1_Missense_Mutation_p.R425Q	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	411	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> P (in HHT2). {ECO:0000269|PubMed:15024723}.|R -> Q (in HHT2; retained in the endoplasmic reticulum; dbSNP:rs28936398). {ECO:0000269|PubMed:14684682, ECO:0000269|PubMed:15024723, ECO:0000269|PubMed:8640225}.|R -> W (in HHT2). {ECO:0000269|PubMed:11484689, ECO:0000269|PubMed:15024723, ECO:0000269|PubMed:15712270}.		activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.R411Q(3)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	ATTGCCCGCCGGACCATCGTG	0.627																																							uc001rzj.2		NA																	3	Substitution - Missense(3)		prostate(2)|lung(1)	lung(2)	2	GRCh37	CM040665|CM960013	ACVRL1	M	rs121909284	c.(1231-1233)CGG>CAG		activin A receptor type II-like 1 precursor	Adenosine triphosphate(DB00171)						62.0	56.0	58.0					12																	52310003		2203	4300	6503	SO:0001583	missense	94	Hereditary_Hemorrhagic_Telangiectasia			blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity	g.chr12:52310003G>A	L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.1232G>A	12.37:g.52310003G>A	ENSP00000373574:p.Arg411Gln		Somatic				ACVRL1_uc001rzk.2_Missense_Mutation_p.R411Q|ACVRL1_uc010snm.1_Missense_Mutation_p.R237Q	p.R411Q	NM_000020	NP_000011	WXS	Illumina HiSeq	Unspecified	P37023	ACVL1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0991)	8	1515	+			411		R -> P (in HHT2).|R -> W (in HHT2).	Cytoplasmic (Potential).|Protein kinase.		A6NGA8	Missense_Mutation	SNP	ENST00000388922.4	37	c.1232G>A	CCDS31804.1	.	.	.	.	.	.	.	.	.	.	G	32	5.165216	0.94768	.	.	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000550683;ENST00000548659;ENST00000419526	D;D;D	0.93763	-3.28;-3.28;-3.28	4.85	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40818	N	0.001013	D	0.97068	0.9042	M	0.86502	2.82	0.80722	A	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.99;0.992	D	0.97606	1.0126	9	0.87932	D	0	.	18.144	0.89649	0.0:0.0:1.0:0.0	rs28936398	237;411	E7EN07;P37023	.;ACVL1_HUMAN	Q	411;411;425;237;237	ENSP00000373574:R411Q;ENSP00000447884:R425Q;ENSP00000392492:R237Q	ENSP00000267008:R411Q	R	+	2	0	ACVRL1	50596270	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	9.648000	0.98483	2.695000	0.91970	0.462000	0.41574	CGG		0.627	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2			4	28	0	0	0	0.000248	0	4	28				
KRT79	338785	broad.mit.edu	37	12	53227843	53227843	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr12:53227843G>T	ENST00000330553.5	-	1	236	c.202C>A	c.(202-204)Cac>Aac	p.H68N		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	68	Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)	p.H68N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ATACTCTTGTGGCCCCCCAAG	0.652																																							uc001sbb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(202-204)CAC>AAC		keratin 6L							25.0	32.0	30.0					12																	53227843		2202	4294	6496	SO:0001583	missense	338785					keratin filament	structural molecule activity	g.chr12:53227843G>T	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.202C>A	12.37:g.53227843G>T	ENSP00000328358:p.His68Asn		Somatic					p.H68N	NM_175834	NP_787028	WXS	Illumina HiSeq	Unspecified	Q5XKE5	K2C79_HUMAN			1	235	-			68			Head.		Q6P465|Q7Z793	Missense_Mutation	SNP	ENST00000330553.5	37	c.202C>A	CCDS8839.1	.	.	.	.	.	.	.	.	.	.	G	0.422	-0.907641	0.02434	.	.	ENSG00000185640	ENST00000330553	T	0.18657	2.2	4.38	0.121	0.14695	.	0.536654	0.16698	N	0.203278	T	0.05868	0.0153	N	0.01152	-0.98	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41945	-0.9480	10	0.15499	T	0.54	.	8.3055	0.32041	0.1255:0.0:0.5181:0.3564	.	68	Q5XKE5	K2C79_HUMAN	N	68	ENSP00000328358:H68N	ENSP00000328358:H68N	H	-	1	0	KRT79	51514110	0.000000	0.05858	0.083000	0.20561	0.666000	0.39218	0.309000	0.19332	0.005000	0.14708	-0.262000	0.10625	CAC		0.652	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834		8	44	1	0	6.5536e-12	0.00308	1.09543e-11	8	44				
TSPAN8	7103	broad.mit.edu	37	12	71531774	71531774	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr12:71531774C>T	ENST00000393330.2	-	9	955	c.403G>A	c.(403-405)Gaa>Aaa	p.E135K	TSPAN8_ENST00000247829.3_Missense_Mutation_p.E135K|TSPAN8_ENST00000552128.1_Missense_Mutation_p.E52K|TSPAN8_ENST00000552786.1_5'Flank|TSPAN8_ENST00000546561.1_Missense_Mutation_p.E135K			P19075	TSN8_HUMAN	tetraspanin 8	135					negative regulation of blood coagulation (GO:0030195)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.E135K(1)		breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(7)|skin(3)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)			AATTGTTTTTCACTTTCCCCT	0.338																																							uc009zrt.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|lung(1)|central_nervous_system(1)	4						c.(403-405)GAA>AAA		transmembrane 4 superfamily member 3							157.0	153.0	155.0					12																	71531774		2203	4300	6503	SO:0001583	missense	7103				protein glycosylation	integral to membrane|lysosome	signal transducer activity	g.chr12:71531774C>T	M35252	CCDS8999.1	12q14.1-q21.1	2013-02-14	2005-03-21	2005-03-21		ENSG00000127324		"""Tetraspanins"""	11855	protein-coding gene	gene with protein product		600769	"""transmembrane 4 superfamily member 3"""	TM4SF3		2395876	Standard	NM_004616		Approved	CO-029	uc001swj.1	P19075		ENST00000393330.2:c.403G>A	12.37:g.71531774C>T	ENSP00000377003:p.Glu135Lys		Somatic				TSPAN8_uc001swk.1_Missense_Mutation_p.E135K|TSPAN8_uc001swj.1_Missense_Mutation_p.E135K	p.E135K	NM_004616	NP_004607	WXS	Illumina HiSeq	Unspecified	P19075	TSN8_HUMAN	LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)		5	565	-			135			Extracellular (Potential).		B2R7T7|Q9BS78	Missense_Mutation	SNP	ENST00000393330.2	37	c.403G>A	CCDS8999.1	.	.	.	.	.	.	.	.	.	.	C	3.973	-0.007905	0.07773	.	.	ENSG00000127324	ENST00000393330;ENST00000247829;ENST00000546561;ENST00000552128	D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18	5.64	2.37	0.29283	Tetraspanin, EC2 domain (1);	.	.	.	.	T	0.71626	0.3362	N	0.11818	0.18	0.09310	N	1	B	0.26147	0.143	B	0.28553	0.091	T	0.58493	-0.7627	9	0.22706	T	0.39	.	3.0882	0.06285	0.2454:0.5125:0.1504:0.0917	.	135	P19075	TSN8_HUMAN	K	135;135;135;52	ENSP00000377003:E135K;ENSP00000247829:E135K;ENSP00000447160:E135K;ENSP00000449820:E52K	ENSP00000247829:E135K	E	-	1	0	TSPAN8	69818041	0.003000	0.15002	0.002000	0.10522	0.001000	0.01503	0.787000	0.26858	1.381000	0.46364	0.655000	0.94253	GAA		0.338	TSPAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404737.1	NM_004616		10	134	0	0	0	0.001368	0	10	134				
RFX4	5992	broad.mit.edu	37	12	107080752	107080752	+	Silent	SNP	G	G	A	rs568955436		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr12:107080752G>A	ENST00000392842.1	+	6	882	c.468G>A	c.(466-468)acG>acA	p.T156T	RP11-482D24.2_ENST00000547531.1_RNA|RFX4_ENST00000357881.4_Silent_p.T165T|RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000229387.5_Silent_p.T62T	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	156					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.T62T(1)|p.T165T(1)|p.T156T(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						TGAGTGAGACGGGCAAGAAAG	0.468																																							uc001tlr.2		NA																	3	Substitution - coding silent(3)		lung(3)	upper_aerodigestive_tract(1)	1						c.(466-468)ACG>ACA		regulatory factor X4 isoform c							190.0	183.0	185.0					12																	107080752		2203	4300	6503	SO:0001819	synonymous_variant	5992				transcription, DNA-dependent	nucleus	DNA binding	g.chr12:107080752G>A	AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.468G>A	12.37:g.107080752G>A			Somatic				RFX4_uc010swv.1_RNA|RFX4_uc001tls.2_Silent_p.T165T|RFX4_uc001tlt.2_Silent_p.T165T|RFX4_uc001tlv.2_Silent_p.T62T|uc001tlu.3_5'Flank	p.T156T	NM_213594	NP_998759	WXS	Illumina HiSeq	Unspecified	Q33E94	RFX4_HUMAN			6	534	+			156					A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Silent	SNP	ENST00000392842.1	37	c.468G>A	CCDS9106.1																																																																																				0.468	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402707.1	NM_032491		14	172	0	0	0	0.00245	0	14	172				
SVOP	55530	broad.mit.edu	37	12	109313526	109313526	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr12:109313526C>A	ENST00000299134.5	-	11	996	c.997G>T	c.(997-999)Ggc>Tgc	p.G333C		NM_018711.2	NP_061181.1	Q8N4V2	SVOP_HUMAN	SV2 related protein homolog (rat)	0						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	ion transmembrane transporter activity (GO:0015075)	p.G333W(2)		breast(2)|lung(4)	6						CTTCTTGCGCCCCAGGCGGTC	0.537																																							uc010sxh.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1192-1194)GGG>GTG		SV2 related protein							68.0	74.0	72.0					12																	109313526		2061	4213	6274	SO:0001583	missense	55530					cell junction|integral to membrane|synaptic vesicle membrane	ion transmembrane transporter activity	g.chr12:109313526C>A	BC033587	CCDS73520.1	12q24.11	2011-07-12				ENSG00000166111			25417	protein-coding gene	gene with protein product		611699					Standard	NM_018711		Approved	DKFZp761H039	uc010sxh.1	Q8N4V2		ENST00000299134.5:c.997G>T	12.37:g.109313526C>A	ENSP00000299134:p.Gly333Cys		Somatic					p.G398V	NM_018711	NP_061181	WXS	Illumina HiSeq	Unspecified	Q8N4V2	SVOP_HUMAN			12	1365	-			398			Cytoplasmic (Potential).		Q9NPW5	Missense_Mutation	SNP	ENST00000299134.5	37	c.1193G>T		.	.	.	.	.	.	.	.	.	.	c	28.1	4.890011	0.91889	.	.	ENSG00000166111	ENST00000299134	T	0.78816	-1.21	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.90981	0.7164	M	0.92268	3.29	.	.	.	.	.	.	.	.	.	D	0.93001	0.6423	7	0.87932	D	0	-21.9574	18.1047	0.89516	0.0:1.0:0.0:0.0	.	.	.	.	C	333	ENSP00000299134:G333C	ENSP00000299134:G333C	G	-	1	0	SVOP	107837655	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.211000	0.77933	2.500000	0.84329	0.655000	0.94253	GGC		0.537	SVOP-001	KNOWN	mRNA_start_NF|cds_start_NF|basic	protein_coding	protein_coding	OTTHUMT00000403982.1	NM_018711		3	11	1	0	6.4e-05	0.004672	9.71228e-05	3	11				
NAA25	80018	broad.mit.edu	37	12	112485592	112485592	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr12:112485592G>A	ENST00000261745.4	-	17	2131	c.1883C>T	c.(1882-1884)tCa>tTa	p.S628L		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	628						cytoplasm (GO:0005737)		p.S628L(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						TAAACTGGTTGATCTGTGATA	0.333																																							uc001ttm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|pancreas(1)	3						c.(1882-1884)TCA>TTA		mitochondrial distribution and morphology 20							176.0	183.0	181.0					12																	112485592		2203	4300	6503	SO:0001583	missense	80018					cytoplasm	protein binding	g.chr12:112485592G>A	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.1883C>T	12.37:g.112485592G>A	ENSP00000261745:p.Ser628Leu		Somatic				NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Missense_Mutation_p.S600L|NAA25_uc009zwa.1_Missense_Mutation_p.S628L	p.S628L	NM_024953	NP_079229	WXS	Illumina HiSeq	Unspecified	Q14CX7	NAA25_HUMAN			17	1903	-			628					A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	ENST00000261745.4	37	c.1883C>T	CCDS9159.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.430984	0.43122	.	.	ENSG00000111300	ENST00000261745	T	0.43688	0.94	5.71	4.81	0.61882	.	0.239142	0.37669	N	0.001997	T	0.37972	0.1023	L	0.59436	1.845	0.46222	D	0.998935	B;B	0.30146	0.27;0.27	B;B	0.28011	0.085;0.085	T	0.25152	-1.0140	10	0.07175	T	0.84	-7.6065	16.7295	0.85431	0.0:0.1294:0.8706:0.0	.	628;628	A8K8X0;Q14CX7	.;NAA25_HUMAN	L	628	ENSP00000261745:S628L	ENSP00000261745:S628L	S	-	2	0	NAA25	110969975	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	6.810000	0.75216	1.391000	0.46566	-0.176000	0.13171	TCA		0.333	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405205.1	NM_024953		57	151	0	0	0	0.00361	0	57	151				
POLE	5426	broad.mit.edu	37	12	133209087	133209087	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr12:133209087G>C	ENST00000320574.5	-	45	6187	c.6144C>G	c.(6142-6144)atC>atG	p.I2048M	POLE_ENST00000535270.1_Missense_Mutation_p.I2021M|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	2048					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.I2048M(2)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GAGAGAAGGTGATCATTCCTG	0.552								DNA polymerases (catalytic subunits)																															uc001uks.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8						c.(6142-6144)ATC>ATG	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	DNA-directed DNA polymerase epsilon							118.0	122.0	121.0					12																	133209087		2203	4300	6503	SO:0001583	missense	5426				base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding	g.chr12:133209087G>C		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.6144C>G	12.37:g.133209087G>C	ENSP00000322570:p.Ile2048Met		Somatic				POLE_uc001ukq.1_Missense_Mutation_p.I258M|POLE_uc001ukr.1_Missense_Mutation_p.I852M|POLE_uc010tbq.1_RNA	p.I2048M	NM_006231	NP_006222	WXS	Illumina HiSeq	Unspecified	Q07864	DPOE1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	45	6188	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)	2048					Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	c.6144C>G	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772602	0.31411	.	.	ENSG00000177084	ENST00000434528;ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.56275	0.47;0.47;0.47	5.24	5.24	0.73138	.	0.051245	0.85682	D	0.000000	T	0.53238	0.1784	M	0.71581	2.175	0.42050	D	0.991111	B;B	0.34399	0.021;0.452	B;B	0.35312	0.017;0.2	T	0.57418	-0.7815	10	0.46703	T	0.11	.	13.2106	0.59822	0.0766:0.0:0.9234:0.0	.	2048;258	Q07864;B3KS74	DPOE1_HUMAN;.	M	258;2048;2059;2021	ENSP00000322570:I2048M;ENSP00000406383:I2059M;ENSP00000445753:I2021M	ENSP00000322570:I2048M	I	-	3	3	POLE	131719160	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.615000	0.46368	2.449000	0.82847	0.478000	0.44815	ATC		0.552	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231		40	134	0	0	0	0.001951	0	40	134				
NALCN	259232	broad.mit.edu	37	13	101797225	101797225	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr13:101797225G>A	ENST00000251127.6	-	16	1943	c.1862C>T	c.(1861-1863)gCg>gTg	p.A621V		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	621					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTTGGTGTCCGCATTTGCTTC	0.333																																							uc001vox.1		NA																	0				ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(1861-1863)GCG>GTG		voltage gated channel like 1							150.0	164.0	159.0					13																	101797225		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101797225G>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1862C>T	13.37:g.101797225G>A	ENSP00000251127:p.Ala621Val		Somatic				NALCN_uc001voy.2_Missense_Mutation_p.A336V	p.A621V	NM_052867	NP_443099	WXS	Illumina HiSeq	Unspecified	Q8IZF0	NALCN_HUMAN			16	2051	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		621			Cytoplasmic (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.1862C>T	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083800	0.76642	.	.	ENSG00000102452	ENST00000251127	D	0.97772	-4.53	5.75	5.75	0.90469	.	0.049051	0.85682	D	0.000000	D	0.95114	0.8417	L	0.28400	0.85	0.80722	D	1	P	0.47409	0.895	B	0.38712	0.28	D	0.95227	0.8339	10	0.54805	T	0.06	.	19.9417	0.97165	0.0:0.0:1.0:0.0	.	621	Q8IZF0	NALCN_HUMAN	V	621	ENSP00000251127:A621V	ENSP00000251127:A621V	A	-	2	0	NALCN	100595226	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.357000	0.97099	2.720000	0.93068	0.655000	0.94253	GCG		0.333	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		21	170	0	0	0	0.00278	0	21	170				
CPNE6	9362	broad.mit.edu	37	14	24545604	24545604	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr14:24545604G>C	ENST00000397016.2	+	13	1405	c.1094G>C	c.(1093-1095)cGa>cCa	p.R365P	CPNE6_ENST00000537691.1_Missense_Mutation_p.R420P|CPNE6_ENST00000216775.2_Missense_Mutation_p.R365P	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	365	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.R365P(1)		endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		TTTGGGGCTCGAATCCCCCCC	0.602																																							uc001wll.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1093-1095)CGA>CCA		copine 6							117.0	126.0	123.0					14																	24545604		2203	4300	6503	SO:0001583	missense	9362				lipid metabolic process|nervous system development|synaptic transmission|vesicle-mediated transport		calcium ion binding|transporter activity	g.chr14:24545604G>C	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1094G>C	14.37:g.24545604G>C	ENSP00000380211:p.Arg365Pro		Somatic				CPNE6_uc010tnv.1_Missense_Mutation_p.R420P|CPNE6_uc001wlm.2_Missense_Mutation_p.R190P|CPNE6_uc001wln.2_5'UTR	p.R365P	NM_006032	NP_006023	WXS	Illumina HiSeq	Unspecified	O95741	CPNE6_HUMAN		GBM - Glioblastoma multiforme(265;0.0184)	12	1193	+			365			VWFA.		B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	ENST00000397016.2	37	c.1094G>C	CCDS9607.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.940332	0.52972	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.24350	1.86;1.86;1.86	4.79	4.79	0.61399	von Willebrand factor, type A (2);Copine (1);	0.000000	0.45867	D	0.000338	T	0.55641	0.1933	M	0.87971	2.92	0.38664	D	0.952142	D;D	0.76494	0.999;0.999	D;D	0.70935	0.971;0.968	T	0.66885	-0.5810	10	0.87932	D	0	-33.1198	15.3636	0.74503	0.0:0.0:1.0:0.0	.	420;365	F5GXN1;O95741	.;CPNE6_HUMAN	P	420;365;365	ENSP00000440077:R420P;ENSP00000380211:R365P;ENSP00000216775:R365P	ENSP00000216775:R365P	R	+	2	0	CPNE6	23615444	0.309000	0.24518	1.000000	0.80357	0.461000	0.32589	1.981000	0.40628	2.485000	0.83878	0.467000	0.42956	CGA		0.602	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5			32	106	0	0	0	0.002445	0	32	106				
ZFP36L1	677	broad.mit.edu	37	14	69256498	69256498	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr14:69256498C>A	ENST00000439696.2	-	2	1070	c.769G>T	c.(769-771)Gag>Tag	p.E257*	ZFP36L1_ENST00000336440.3_Nonsense_Mutation_p.E257*|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	257					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E257*(1)		breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CTTGCCAGCTCCTGGCTGGAG	0.632											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001xkh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(769-771)GAG>TAG		butyrate response factor 1							56.0	68.0	64.0					14																	69256498		2199	4296	6495	SO:0001587	stop_gained	677				regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr14:69256498C>A	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.769G>T	14.37:g.69256498C>A	ENSP00000388402:p.Glu257*		Somatic	OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1113	ZFP36L1_uc001xki.1_Nonsense_Mutation_p.E257*	p.E257*	NM_004926	NP_004917	WXS	Illumina HiSeq	Unspecified	Q07352	TISB_HUMAN		all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)	2	899	-			257					Q13851	Nonsense_Mutation	SNP	ENST00000439696.2	37	c.769G>T	CCDS9791.1	.	.	.	.	.	.	.	.	.	.	C	51	17.371687	0.99885	.	.	ENSG00000185650	ENST00000439696;ENST00000336440;ENST00000435246	.	.	.	4.65	3.76	0.43208	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-1.3057	12.481	0.55842	0.0:0.9196:0.0:0.0804	.	.	.	.	X	257;257;240	.	ENSP00000337386:E257X	E	-	1	0	ZFP36L1	68326251	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.312000	0.78968	1.178000	0.42870	0.585000	0.79938	GAG		0.632	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1			11	151	1	0	1.3612e-06	0.003163	2.1408e-06	11	151				
SNRPN	6638	broad.mit.edu	37	15	25221561	25221561	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr15:25221561G>T	ENST00000400100.1	+	9	1155	c.265G>T	c.(265-267)Gat>Tat	p.D89Y	SNRPN_ENST00000346403.6_Missense_Mutation_p.D89Y|SNRPN_ENST00000390687.4_Missense_Mutation_p.D89Y|SNRPN_ENST00000554227.2_Missense_Mutation_p.D93Y|SNRPN_ENST00000400098.1_Missense_Mutation_p.D89Y|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000400097.1_Missense_Mutation_p.D89Y|SNRPN_ENST00000577565.1_Missense_Mutation_p.D89Y|SNRPN_ENST00000444203.2_Missense_Mutation_p.D93Y|SNURF_ENST00000551312.2_Intron	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	89					response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)	p.D89Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		ACCCCCCAAAGATGTAAGGAA	0.493									Prader-Willi syndrome																														uc001ywp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(265-267)GAT>TAT		small nuclear ribonucleoprotein polypeptide N							66.0	71.0	70.0					15																	25221561		1930	4130	6060	SO:0001583	missense	6638	Prader-Willsyndrome	Familial Cancer Database	Prader-Labhart-Willi syndrome	RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding	g.chr15:25221561G>T	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.265G>T	15.37:g.25221561G>T	ENSP00000382972:p.Asp89Tyr		Somatic				SNRPN_uc001ywq.1_Missense_Mutation_p.D89Y|SNRPN_uc001ywr.1_Missense_Mutation_p.D89Y|SNRPN_uc001yws.1_Missense_Mutation_p.D89Y|SNRPN_uc001ywt.1_Missense_Mutation_p.D89Y|SNRPN_uc001ywv.1_Missense_Mutation_p.D92Y|SNRPN_uc001yww.1_Missense_Mutation_p.D89Y|SNRPN_uc001ywx.1_Missense_Mutation_p.D89Y|SNRPN_uc001ywz.1_Intron|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_3'UTR	p.D89Y	NM_022807	NP_073718	WXS	Illumina HiSeq	Unspecified	P63162	RSMN_HUMAN		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)	9	1155	+		all_cancers(20;9.33e-22)|Breast(32;0.000625)	89					B3KVR1|P14648|P17135|Q0D2Q5	Missense_Mutation	SNP	ENST00000400100.1	37	c.265G>T	CCDS10017.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228140	0.58777	.	.	ENSG00000128739	ENST00000400100;ENST00000400098;ENST00000400097;ENST00000554227;ENST00000390687;ENST00000444203	T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88	3.88	3.88	0.44766	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.44008	0.1273	M	0.79123	2.44	0.80722	D	1	P;P	0.40515	0.719;0.559	B;B	0.36335	0.222;0.133	T	0.56902	-0.7902	10	0.62326	D	0.03	-18.3316	14.1313	0.65255	0.0:0.0:1.0:0.0	.	93;89	B3KVR1;P63162	.;RSMN_HUMAN	Y	89;89;89;93;89;93	ENSP00000382972:D89Y;ENSP00000382970:D89Y;ENSP00000382969:D89Y;ENSP00000452342:D93Y;ENSP00000375105:D89Y;ENSP00000408767:D93Y	ENSP00000375105:D89Y	D	+	1	0	SNRPN	22772654	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.786000	0.91826	2.463000	0.83235	0.491000	0.48974	GAT		0.493	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413849.10	NM_003097		9	43	1	0	1.12685e-05	0.004482	1.73285e-05	9	43				
MGA	23269	broad.mit.edu	37	15	42052655	42052655	+	Silent	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr15:42052655C>G	ENST00000570161.1	+	19	7326	c.7326C>G	c.(7324-7326)ctC>ctG	p.L2442L	MGA_ENST00000389936.4_Silent_p.L2403L|MGA_ENST00000545763.1_Silent_p.L2233L|MGA_ENST00000566586.1_Silent_p.L2233L|MGA_ENST00000219905.7_Silent_p.L2442L			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.L2491L(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGAGGGATCTCTTTGAGAAAT	0.433																																							uc010ucy.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(7324-7326)CTC>CTG		MAX-interacting protein isoform 1							119.0	118.0	118.0					15																	42052655		1877	4100	5977	SO:0001819	synonymous_variant	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:42052655C>G	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7326C>G	15.37:g.42052655C>G			Somatic				MGA_uc010ucz.1_Silent_p.L2233L|MGA_uc010uda.1_Silent_p.L1058L	p.L2442L	NM_001164273	NP_001157745	WXS	Illumina HiSeq	Unspecified	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	20	7507	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	2403			Helix-loop-helix motif.		Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	37	c.7326C>G	CCDS55959.1																																																																																				0.433	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		4	91	0	0	0	0.000248	0	4	91				
JMJD7	100137047	broad.mit.edu	37	15	42127270	42127270	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr15:42127270G>A	ENST00000397299.4	+	3	361	c.321G>A	c.(319-321)ctG>ctA	p.L107L	PLA2G4B_ENST00000542534.2_Silent_p.L107L|JMJD7-PLA2G4B_ENST00000382448.4_Silent_p.L107L|PLA2G4B_ENST00000452633.1_5'Flank|JMJD7-PLA2G4B_ENST00000476036.1_3'UTR|JMJD7_ENST00000408047.1_Silent_p.L8L|JMJD7-PLA2G4B_ENST00000342159.4_Silent_p.L107L	NM_001114632.1	NP_001108104.1	P0C870	JMJD7_HUMAN	jumonji domain containing 7	107								p.L107L(3)		NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	8						AGCGCCGCCTGCCCCTGAGCT	0.657																																							uc001zoo.3		NA																	3	Substitution - coding silent(3)		lung(3)	large_intestine(1)	1						c.(319-321)CTG>CTA		JMJD7-PLA2G4B protein							79.0	84.0	82.0					15																	42127270		2203	4300	6503	SO:0001819	synonymous_variant	8681				arachidonic acid metabolic process|calcium-mediated signaling|glycerophospholipid catabolic process|inflammatory response|parturition	cytosol|early endosome membrane|extracellular region|mitochondrial membrane	calcium ion binding|calcium-dependent phospholipase A2 activity|calcium-dependent phospholipid binding|lysophospholipase activity	g.chr15:42127270G>A		CCDS45240.1	15q15.1	2011-02-10			ENSG00000243789	ENSG00000243789			34397	protein-coding gene	gene with protein product							Standard	NM_001114632		Approved			P0C870	OTTHUMG00000156810	ENST00000397299.4:c.321G>A	15.37:g.42127270G>A			Somatic				JMJD7-PLA2G4B_uc001zom.2_Silent_p.L7L|JMJD7-PLA2G4B_uc001zon.2_Silent_p.L107L|JMJD7-PLA2G4B_uc010bcn.2_Silent_p.L107L|JMJD7-PLA2G4B_uc001zop.1_Silent_p.L7L|JMJD7-PLA2G4B_uc001zoq.3_5'Flank	p.L107L	NM_005090	NP_005081	WXS	Illumina HiSeq	Unspecified	P0C869	PA24B_HUMAN			3	361	+			Error:Variant_position_missing_in_P0C869_after_alignment					A5D6V5|O95712|Q59GF9|Q8TB10|Q9UKV7	Silent	SNP	ENST00000397299.4	37	c.321G>A	CCDS45240.1																																																																																				0.657	JMJD7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326082.1	NM_001114632		24	71	0	0	0	0.00333	0	24	71				
PEAK1	79834	broad.mit.edu	37	15	77406519	77406519	+	Silent	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr15:77406519C>G	ENST00000560626.2	-	7	5695	c.5220G>C	c.(5218-5220)gtG>gtC	p.V1740V	PEAK1_ENST00000312493.4_Silent_p.V1740V			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1740					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.V1740V(2)									GCAGAATTTTCACAATACAAC	0.483																																							uc002bcm.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(5218-5220)GTG>GTC		NKF3 kinase family member							118.0	118.0	118.0					15																	77406519		2001	4173	6174	SO:0001819	synonymous_variant	79834				cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr15:77406519C>G		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.5220G>C	15.37:g.77406519C>G			Somatic					p.V1740V	NM_024776	NP_079052	WXS	Illumina HiSeq	Unspecified	Q9H792	PEAK1_HUMAN		STAD - Stomach adenocarcinoma(199;0.124)	6	5528	-			1740					Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Silent	SNP	ENST00000560626.2	37	c.5220G>C	CCDS42062.1																																																																																				0.483	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3			5	113	0	0	0	0.000602	0	5	113				
CEMIP	57214	broad.mit.edu	37	15	81171078	81171078	+	Silent	SNP	T	T	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr15:81171078T>G	ENST00000394685.3	+	4	530	c.111T>G	c.(109-111)ccT>ccG	p.P37P	KIAA1199_ENST00000356249.5_Silent_p.P37P|KIAA1199_ENST00000220244.3_Silent_p.P37P			Q8WUJ3	CEMIP_HUMAN		37					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.P37P(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CTGGGTGCCCTGACCAGAGCC	0.587																																							uc002bfw.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(109-111)CCT>CCG		KIAA1199 precursor							68.0	64.0	65.0					15																	81171078		2203	4300	6503	SO:0001819	synonymous_variant	57214							g.chr15:81171078T>G																												ENST00000394685.3:c.111T>G	15.37:g.81171078T>G			Somatic				KIAA1199_uc010unn.1_Silent_p.P37P	p.P37P	NM_018689	NP_061159	WXS	Illumina HiSeq	Unspecified	Q8WUJ3	K1199_HUMAN			3	371	+			37					Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	ENST00000394685.3	37	c.111T>G	CCDS10315.1																																																																																				0.587	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1			4	42	0	0	0	0.000248	0	4	42				
PRC1	9055	broad.mit.edu	37	15	91512758	91512758	+	Silent	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr15:91512758C>G	ENST00000361188.5	-	13	2879	c.1668G>C	c.(1666-1668)ctG>ctC	p.L556L	PRC1_ENST00000361919.3_Silent_p.L556L|PRC1-AS1_ENST00000556200.1_RNA|PRC1_ENST00000394249.3_Silent_p.L556L|PRC1-AS1_ENST00000554388.1_RNA|PRC1_ENST00000442656.2_Silent_p.L515L					protein regulator of cytokinesis 1									p.L556L(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					ACCCACCACTCAGGATGCTGC	0.547																																							uc002bqm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1666-1668)CTG>CTC		protein regulator of cytokinesis 1 isoform 1							124.0	101.0	109.0					15																	91512758		2198	4298	6496	SO:0001819	synonymous_variant	9055				cytokinesis|mitotic spindle elongation	cytoplasm|nucleus|spindle microtubule|spindle pole	protein binding	g.chr15:91512758C>G	AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.1668G>C	15.37:g.91512758C>G			Somatic				PRC1_uc002bqn.2_Silent_p.L556L|PRC1_uc002bqo.2_Silent_p.L556L|PRC1_uc010uqs.1_Silent_p.L515L	p.L556L	NM_003981	NP_003972	WXS	Illumina HiSeq	Unspecified	O43663	PRC1_HUMAN			13	1825	-	Lung NSC(78;0.0987)|all_lung(78;0.175)		556			Unstructured, Arg/Lys rich.			Silent	SNP	ENST00000361188.5	37	c.1668G>C	CCDS45352.1																																																																																				0.547	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	NM_003981		7	96	0	0	0	0.004482	0	7	96				
SV2B	9899	broad.mit.edu	37	15	91769556	91769556	+	Silent	SNP	C	C	T	rs191343592		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr15:91769556C>T	ENST00000394232.1	+	2	533	c.63C>T	c.(61-63)cgC>cgT	p.R21R	SV2B_ENST00000330276.4_Silent_p.R21R|SV2B_ENST00000557291.1_Intron|SV2B_ENST00000545111.2_Intron	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	21					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.R21R(1)		NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			GCTATTACCGCGGCAATGAGT	0.522													T|||	1	0.000199681	0.0	0.0	5008	,	,		22412	0.001		0.0	False		,,,				2504	0.0						uc002bqv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(61-63)CGC>CGT		synaptic vesicle protein 2B homolog		T	,	0,4396		0,0,2198	111.0	91.0	98.0		,63	-5.0	0.3	15		98	1,8595	819.0+/-406.8	0,1,4297	no	intron,coding-synonymous	SV2B	NM_001167580.1,NM_014848.4	,	0,1,6495	TT,TC,CC		0.0116,0.0,0.0077	,	,21/684	91769556	1,12991	2198	4298	6496	SO:0001819	synonymous_variant	9899				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr15:91769556C>T	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.63C>T	15.37:g.91769556C>T			Somatic				SV2B_uc002bqt.2_Silent_p.R21R|SV2B_uc010uqv.1_Intron|SV2B_uc002bqu.3_RNA	p.R21R	NM_014848	NP_055663	WXS	Illumina HiSeq	Unspecified	Q7L1I2	SV2B_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0895)		1	454	+	Lung NSC(78;0.0987)|all_lung(78;0.172)		21			Cytoplasmic (Potential).		B4DH30|C6G489|O94840|Q6IAR8	Silent	SNP	ENST00000394232.1	37	c.63C>T	CCDS10370.1																																																																																				0.522	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848		7	31	0	0	0	0.00308	0	7	31				
TARSL2	123283	broad.mit.edu	37	15	102241329	102241329	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr15:102241329C>G	ENST00000335968.3	-	10	1496	c.1280G>C	c.(1279-1281)aGa>aCa	p.R427T		NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	427					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)	p.R427T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GAAGGCTCCTCTGGGAAGGAA	0.303																																							uc002bxm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1279-1281)AGA>ACA		threonyl-tRNA synthetase-like 2							47.0	50.0	49.0					15																	102241329		2203	4299	6502	SO:0001583	missense	123283				threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity	g.chr15:102241329C>G	AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.1280G>C	15.37:g.102241329C>G	ENSP00000338093:p.Arg427Thr		Somatic				TARSL2_uc002bxl.2_5'UTR|TARSL2_uc010usi.1_RNA	p.R427T	NM_152334	NP_689547	WXS	Illumina HiSeq	Unspecified	A2RTX5	SYTC2_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		10	1335	-	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		427					B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Missense_Mutation	SNP	ENST00000335968.3	37	c.1280G>C	CCDS10394.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.138556	0.56936	.	.	ENSG00000185418	ENST00000335968;ENST00000333018;ENST00000539112	.	.	.	4.81	3.89	0.44902	.	0.155258	0.56097	D	0.000028	T	0.75554	0.3865	M	0.90977	3.165	0.40275	D	0.97833	P	0.47409	0.895	P	0.50860	0.652	T	0.81234	-0.1025	9	0.87932	D	0	-25.1148	11.1954	0.48709	0.0:0.9089:0.0:0.0911	.	427	A2RTX5	SYTC2_HUMAN	T	427;332;427	.	ENSP00000329291:R332T	R	-	2	0	TARSL2	100058852	0.977000	0.34250	1.000000	0.80357	0.999000	0.98932	1.672000	0.37523	1.147000	0.42369	0.655000	0.94253	AGA		0.303	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313619.3	NM_152334		3	60	0	0	0	0.004672	0	3	60				
ATP6V0C	527	broad.mit.edu	37	16	2569287	2569287	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr16:2569287G>A	ENST00000330398.4	+	2	382	c.148G>A	c.(148-150)Gag>Aag	p.E50K	AMDHD2_ENST00000293971.6_5'Flank|ATP6V0C_ENST00000568562.1_Missense_Mutation_p.G32E|AMDHD2_ENST00000302956.4_5'Flank|ATP6C_ENST00000569317.1_Intron|RP11-20I23.1_ENST00000564543.1_Missense_Mutation_p.G345E|ATP6V0C_ENST00000564973.1_Missense_Mutation_p.E7K|ATP6V0C_ENST00000565223.1_Missense_Mutation_p.E7K|AMDHD2_ENST00000413459.3_5'Flank	NM_001198569.1|NM_001694.3	NP_001185498.1|NP_001685.1	P27449	VATL_HUMAN	ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c	50					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|ubiquitin protein ligase binding (GO:0031625)	p.E50K(1)		endometrium(1)|lung(1)|ovary(1)	3		Ovarian(90;0.17)				CATGCGGCCGGAGCAGATCAT	0.622																																							uc002cqm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1033-1035)GGA>GAA		TBC1 domain family, member 24							98.0	65.0	76.0					16																	2569287		2198	4300	6498	SO:0001583	missense	57465				neuron projection development	cytoplasm	protein binding|Rab GTPase activator activity	g.chr16:2569287G>A	M62762	CCDS10470.1	16p13.3	2010-04-21	2002-08-29	2002-05-10	ENSG00000185883	ENSG00000185883	3.6.3.14	"""ATPases / V-type"""	855	protein-coding gene	gene with protein product		108745	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 16kD"""	ATPL, ATP6C, ATP6L		1709739, 8250920	Standard	NM_001694		Approved	VATL, Vma3	uc021tav.1	P27449	OTTHUMG00000128865	ENST00000330398.4:c.148G>A	16.37:g.2569287G>A	ENSP00000329757:p.Glu50Lys		Somatic				ATP6V0C_uc002cqn.2_Missense_Mutation_p.E50K|ATP6V0C_uc002cqo.2_Missense_Mutation_p.E7K|AMDHD2_uc002cqp.2_5'Flank|AMDHD2_uc002cqq.2_5'Flank|AMDHD2_uc010uwc.1_5'Flank|AMDHD2_uc010uwd.1_5'Flank	p.G345E	NM_020705	NP_065756	WXS	Illumina HiSeq	Unspecified	Q9ULP9	TBC24_HUMAN			2	1149	+			Error:Variant_position_missing_in_Q9ULP9_after_alignment					Q6FH26	Missense_Mutation	SNP	ENST00000330398.4	37	c.1034G>A	CCDS10470.1	.	.	.	.	.	.	.	.	.	.	G	9.599	1.128149	0.20959	.	.	ENSG00000185883	ENST00000330398	T	0.55413	0.52	4.85	3.9	0.45041	ATPase, F0/V0 complex, subunit C (2);	0.000000	0.85682	D	0.000000	T	0.70806	0.3266	M	0.86740	2.835	0.80722	D	1	P	0.35401	0.499	P	0.51516	0.672	T	0.74429	-0.3668	10	0.87932	D	0	-7.5878	11.9352	0.52870	0.0854:0.0:0.9146:0.0	.	50	P27449	VATL_HUMAN	K	50	ENSP00000329757:E50K	ENSP00000329757:E50K	E	+	1	0	ATP6V0C	2509288	1.000000	0.71417	0.879000	0.34478	0.072000	0.16883	7.889000	0.87307	1.055000	0.40461	-0.265000	0.10407	GAG		0.622	ATP6V0C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250810.1	NM_001694		3	30	0	0	0	0.000248	0	3	30				
ZSCAN32	54925	broad.mit.edu	37	16	3433615	3433615	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr16:3433615C>T	ENST00000396852.4	-	7	1638	c.1331G>A	c.(1330-1332)gGa>gAa	p.G444E	NAA60_ENST00000576906.1_Intron|ZSCAN32_ENST00000304926.3_Missense_Mutation_p.G232E|ZSCAN32_ENST00000396846.3_Missense_Mutation_p.G444E|ZSCAN32_ENST00000439568.2_Missense_Mutation_p.G155E	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32	444					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G232E(1)									CCAATAAACTCCTCTGGACTT	0.403																																							uc002cuz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(694-696)GGA>GAA		zinc finger protein 434							84.0	78.0	80.0					16																	3433615		2197	4300	6497	SO:0001583	missense	54925				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:3433615C>T	AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.1331G>A	16.37:g.3433615C>T	ENSP00000380061:p.Gly444Glu		Somatic				ZNF434_uc002cux.3_Missense_Mutation_p.G443E|ZNF434_uc010uwx.1_Missense_Mutation_p.G155E|ZNF434_uc002cuy.3_Missense_Mutation_p.G155E	p.G232E	NM_017810	NP_060280	WXS	Illumina HiSeq	Unspecified	Q9NX65	ZN434_HUMAN			6	1497	-			232					B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	Missense_Mutation	SNP	ENST00000396852.4	37	c.695G>A		.	.	.	.	.	.	.	.	.	.	c	0.404	-0.916758	0.02415	.	.	ENSG00000140987	ENST00000304926;ENST00000396852;ENST00000396846;ENST00000439568	T;T;T;T	0.07800	3.16;3.24;3.24;3.21	3.97	-0.701	0.11269	.	9.632660	0.00772	N	0.001217	T	0.03390	0.0098	N	0.04636	-0.2	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.32719	-0.9896	10	0.02654	T	1	.	4.4477	0.11606	0.1555:0.5977:0.0:0.2468	.	232;444	Q9NX65;Q6WMU8	ZN434_HUMAN;.	E	232;444;444;155	ENSP00000302502:G232E;ENSP00000380061:G444E;ENSP00000380057:G444E;ENSP00000391787:G155E	ENSP00000302502:G232E	G	-	2	0	ZNF434	3373616	.	.	0.000000	0.03702	0.218000	0.24690	.	.	-0.084000	0.12595	0.651000	0.88453	GGA		0.403	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251509.2	NM_017810		6	82	0	0	0	0.001168	0	6	82				
ACSM1	116285	broad.mit.edu	37	16	20648732	20648732	+	Silent	SNP	C	C	T	rs368774746		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr16:20648732C>T	ENST00000307493.4	-	8	1225	c.1158G>A	c.(1156-1158)ccG>ccA	p.P386P	ACSM1_ENST00000520010.1_Silent_p.P386P|ACSM1_ENST00000219151.4_Silent_p.P5P	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	386					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.P5P(1)|p.P386P(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						CCATGAAACCCGGCTTGATCT	0.527																																							uc002dhm.1		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)|skin(1)	2						c.(1156-1158)CCG>CCA		acyl-CoA synthetase medium-chain family member		C		0,4402		0,0,2201	149.0	136.0	140.0		1158	-9.2	0.0	16		140	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ACSM1	NM_052956.2		0,1,6500	TT,TC,CC		0.0116,0.0,0.0077		386/578	20648732	1,13001	2201	4300	6501	SO:0001819	synonymous_variant	116285				benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20648732C>T	AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.1158G>A	16.37:g.20648732C>T			Somatic				ACSM1_uc002dhn.1_RNA|ACSM1_uc010bwg.1_Silent_p.P386P	p.P386P	NM_052956	NP_443188	WXS	Illumina HiSeq	Unspecified	Q08AH1	ACSM1_HUMAN			8	1226	-			386					Q08AH2|Q96A20	Silent	SNP	ENST00000307493.4	37	c.1158G>A	CCDS10587.1	.	.	.	.	.	.	.	.	.	.	C	0.125	-1.120657	0.01785	0.0	1.16E-4	ENSG00000166743	ENST00000524149	.	.	.	5.07	-9.22	0.00675	.	.	.	.	.	T	0.17874	0.0429	.	.	.	0.19300	N	0.999979	.	.	.	.	.	.	T	0.21245	-1.0251	4	.	.	.	.	5.0589	0.14548	0.1001:0.1578:0.0994:0.6427	.	.	.	.	Q	92	.	.	R	-	2	0	ACSM1	20556233	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-7.157000	0.00043	-1.534000	0.01743	-0.192000	0.12808	CGG		0.527	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254412.1	NM_052956		30	124	0	0	0	0.002096	0	30	124				
ITGAD	3681	broad.mit.edu	37	16	31408920	31408920	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr16:31408920G>A	ENST00000389202.2	+	4	294	c.245G>A	c.(244-246)cGc>cAc	p.R82H		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	82					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.R82H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CTTGCAGTCCGCCCTGAGGCC	0.657																																							uc002ebv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(244-246)CGC>CAC		integrin, alpha D precursor							47.0	39.0	42.0					16																	31408920		2197	4300	6497	SO:0001583	missense	3681				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr16:31408920G>A	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.245G>A	16.37:g.31408920G>A	ENSP00000373854:p.Arg82His		Somatic				ITGAD_uc010vfl.1_Missense_Mutation_p.R82H|ITGAD_uc010cap.1_Missense_Mutation_p.R82H|ITGAD_uc002ebw.1_5'UTR	p.R82H	NM_005353	NP_005344	WXS	Illumina HiSeq	Unspecified	Q13349	ITAD_HUMAN			4	294	+			82			FG-GAP 2.|Extracellular (Potential).		Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	c.245G>A	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	G	10.76	1.442436	0.25987	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.71461	-0.57	4.26	2.25	0.28309	.	.	.	.	.	T	0.47691	0.1459	N	0.03608	-0.345	0.09310	N	1	B;D;D	0.56968	0.144;0.978;0.96	B;B;B	0.43194	0.01;0.411;0.411	T	0.40590	-0.9555	9	0.72032	D	0.01	.	9.0258	0.36230	0.1558:0.5434:0.3007:0.0	.	82;98;82	B7Z6V7;Q59H14;Q13349	.;.;ITAD_HUMAN	H	98;82	ENSP00000373854:R82H	ENSP00000373854:R82H	R	+	2	0	ITGAD	31316421	0.002000	0.14202	0.014000	0.15608	0.002000	0.02628	1.197000	0.32211	0.183000	0.20059	-1.966000	0.00469	CGC		0.657	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353		7	33	0	0	0	0.004482	0	7	33				
SALL1	6299	broad.mit.edu	37	16	51174513	51174513	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr16:51174513G>T	ENST00000251020.4	-	2	1653	c.1620C>A	c.(1618-1620)agC>agA	p.S540R	SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.S443R	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	540					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S540R(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TGTCTAGCCAGCTGGTGACTG	0.557																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|ovary(3)	8						c.(1618-1620)AGC>AGA		sal-like 1 isoform a							67.0	65.0	65.0					16																	51174513		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51174513G>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1620C>A	16.37:g.51174513G>T	ENSP00000251020:p.Ser540Arg		Somatic				SALL1_uc010vgr.1_Missense_Mutation_p.S443R|SALL1_uc010cbv.2_Intron	p.S540R	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	1651	-		all_cancers(37;0.0322)	540					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.1620C>A	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.626808	0.46840	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.07114	3.22;3.23	5.33	3.37	0.38596	.	0.037333	0.85682	D	0.000000	T	0.13798	0.0334	M	0.61703	1.905	0.54753	D	0.999981	D	0.53619	0.961	P	0.47206	0.541	T	0.01309	-1.1389	10	0.56958	D	0.05	.	11.5626	0.50785	0.1448:0.0:0.8552:0.0	.	540	Q9NSC2	SALL1_HUMAN	R	540;443;504	ENSP00000251020:S540R;ENSP00000407914:S443R	ENSP00000251020:S540R	S	-	3	2	SALL1	49732014	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.886000	0.63149	0.628000	0.30357	0.563000	0.77884	AGC		0.557	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		16	63	1	0	1.3612e-06	0.003163	2.1408e-06	16	63				
CHD9	80205	broad.mit.edu	37	16	53348933	53348933	+	Missense_Mutation	SNP	G	G	A	rs200047123		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr16:53348933G>A	ENST00000398510.3	+	35	7648	c.7561G>A	c.(7561-7563)Gaa>Aaa	p.E2521K	CHD9_ENST00000447540.1_Missense_Mutation_p.E2506K|CHD9_ENST00000564845.1_Missense_Mutation_p.E2505K|CHD9_ENST00000566029.1_Missense_Mutation_p.E2505K			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2521					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.E2522K(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				GGGTTATGTGGAAGATTTGGG	0.358													G|||	1	0.000199681	0.0	0.0	5008	,	,		16410	0.0		0.001	False		,,,				2504	0.0						uc002ehb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7						c.(7561-7563)GAA>AAA		chromodomain helicase DNA binding protein 9							58.0	56.0	57.0					16																	53348933		1821	4081	5902	SO:0001583	missense	80205				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding	g.chr16:53348933G>A	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.7561G>A	16.37:g.53348933G>A	ENSP00000381522:p.Glu2521Lys		Somatic				CHD9_uc002egy.2_Missense_Mutation_p.E2505K|CHD9_uc002ehc.2_Missense_Mutation_p.E2506K|CHD9_uc002ehf.2_Missense_Mutation_p.E1619K|CHD9_uc010cbw.2_Missense_Mutation_p.E587K	p.E2521K	NM_025134	NP_079410	WXS	Illumina HiSeq	Unspecified	Q3L8U1	CHD9_HUMAN			35	7725	+		all_cancers(37;0.0212)	2521					B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37	c.7561G>A		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	26.0	4.692332	0.88735	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	T	0.43294	0.95	5.96	5.96	0.96718	BRK domain (2);	0.000000	0.64402	D	0.000010	T	0.53834	0.1821	N	0.22421	0.69	0.51482	D	0.99992	D;P;D;D	0.71674	0.998;0.952;0.997;0.996	D;P;D;D	0.72075	0.939;0.6;0.976;0.944	T	0.53961	-0.8364	10	0.54805	T	0.06	-21.7799	20.422	0.99049	0.0:0.0:1.0:0.0	.	587;2506;2521;2505	C9JR69;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	K	2506;2505;587	ENSP00000396345:E2506K	ENSP00000381522:E2505K	E	+	1	0	CHD9	51906434	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.414000	0.97362	2.832000	0.97577	0.655000	0.94253	GAA		0.358	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134		4	56	0	0	0	0.000248	0	4	56				
IRX6	79190	broad.mit.edu	37	16	55361654	55361654	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr16:55361654C>T	ENST00000290552.7	+	4	1902	c.570C>T	c.(568-570)ctC>ctT	p.L190L	RP11-26L20.3_ENST00000558730.2_RNA|IRX6_ENST00000558315.1_3'UTR	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	190					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.L190L(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						AGATGACCCTCACCCAGGTGT	0.572																																							uc002ehy.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(5)|ovary(1)	6						c.(568-570)CTC>CTT		iroquois homeobox protein 6							142.0	112.0	122.0					16																	55361654		2198	4300	6498	SO:0001819	synonymous_variant	79190					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr16:55361654C>T	AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.570C>T	16.37:g.55361654C>T			Somatic				IRX6_uc002ehx.2_Silent_p.L190L|IRX6_uc010ccb.1_RNA	p.L190L	NM_024335	NP_077311	WXS	Illumina HiSeq	Unspecified	P78412	IRX6_HUMAN			4	1103	+			190			Homeobox; TALE-type.		B2RN06|Q7Z2K0	Silent	SNP	ENST00000290552.7	37	c.570C>T	CCDS32449.1																																																																																				0.572	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335		7	76	0	0	0	0.004482	0	7	76				
CIRH1A	84916	broad.mit.edu	37	16	69189791	69189791	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr16:69189791C>G	ENST00000314423.7	+	11	1359	c.1182C>G	c.(1180-1182)atC>atG	p.I394M	CIRH1A_ENST00000563094.1_Missense_Mutation_p.I394M|CIRH1A_ENST00000352319.4_Intron			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	394					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)	p.I394M(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		AGAACATTATCTGTAGCTGTA	0.423																																					Melanoma(69;1156 1278 4951 8715 52012)	Melanoma(69;1156 1278 4951 8715 52012)	uc002ews.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1180-1182)ATC>ATG		cirhin							208.0	193.0	198.0					16																	69189791		2198	4300	6498	SO:0001583	missense	84916					nucleolus	protein binding	g.chr16:69189791C>G	AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.1182C>G	16.37:g.69189791C>G	ENSP00000327179:p.Ile394Met		Somatic				CIRH1A_uc002ewr.2_Missense_Mutation_p.I394M|CIRH1A_uc002ewt.3_Missense_Mutation_p.I311M|CIRH1A_uc010cfi.2_Intron	p.I394M	NM_032830	NP_116219	WXS	Illumina HiSeq	Unspecified	Q969X6	CIR1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.125)	11	1278	+			394					Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	ENST00000314423.7	37	c.1182C>G	CCDS10872.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223178	0.39300	.	.	ENSG00000141076	ENST00000314423	T	0.30448	1.53	5.7	-2.46	0.06461	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.246379	0.48286	D	0.000193	T	0.21590	0.0520	L	0.29908	0.895	0.26283	N	0.978249	P;P	0.51791	0.947;0.948	P;B	0.44561	0.453;0.438	T	0.31998	-0.9923	10	0.33141	T	0.24	.	13.4406	0.61109	0.0:0.6544:0.0:0.3456	.	394;394	Q969X6;Q969X6-3	CIR1A_HUMAN;.	M	394	ENSP00000327179:I394M	ENSP00000327179:I394M	I	+	3	3	CIRH1A	67747292	0.932000	0.31603	0.991000	0.47740	0.888000	0.51559	-0.018000	0.12568	-0.375000	0.07955	-0.302000	0.09304	ATC		0.423	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268950.2	NM_032830		5	107	0	0	0	0.000602	0	5	107				
DNAH2	146754	broad.mit.edu	37	17	7637925	7637925	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr17:7637925A>G	ENST00000572933.1	+	7	2337	c.877A>G	c.(877-879)Aag>Gag	p.K293E	DNAH2_ENST00000570791.1_Missense_Mutation_p.K293E|DNAH2_ENST00000082259.3_Missense_Mutation_p.K293E|DNAH2_ENST00000389173.2_Missense_Mutation_p.K293E			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	293	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K293E(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGGCATCAGTAAGCAGCTGGT	0.532																																							uc002giu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(6)|central_nervous_system(1)	13						c.(877-879)AAG>GAG		dynein heavy chain domain 3							117.0	101.0	106.0					17																	7637925		2203	4300	6503	SO:0001583	missense	146754				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:7637925A>G	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.877A>G	17.37:g.7637925A>G	ENSP00000458355:p.Lys293Glu		Somatic				DNAH2_uc002git.2_Missense_Mutation_p.K293E|DNAH2_uc010vuk.1_Missense_Mutation_p.K293E	p.K293E	NM_020877	NP_065928	WXS	Illumina HiSeq	Unspecified	Q9P225	DYH2_HUMAN			6	891	+		all_cancers(10;4.66e-07)|Prostate(122;0.081)	293			Stem (By similarity).		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	c.877A>G	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	A	10.31	1.315680	0.23908	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.50277	0.75;0.75	5.53	4.44	0.53790	Dynein heavy chain, domain-1 (1);	3.119610	0.00567	N	0.000286	T	0.21022	0.0506	N	0.00729	-1.24	0.32389	N	0.553532	B;B	0.17465	0.001;0.022	B;B	0.20955	0.003;0.032	T	0.44605	-0.9317	10	0.05959	T	0.93	.	10.9812	0.47494	0.8598:0.0:0.0:0.1402	.	293;293	Q9P225;Q9P225-3	DYH2_HUMAN;.	E	293	ENSP00000373825:K293E;ENSP00000082259:K293E	ENSP00000082259:K293E	K	+	1	0	DNAH2	7578650	0.955000	0.32602	0.995000	0.50966	0.982000	0.71751	1.847000	0.39299	0.906000	0.36621	0.374000	0.22700	AAG		0.532	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		7	43	0	0	0	0.000978	0	7	43				
MYH4	4622	broad.mit.edu	37	17	10354166	10354166	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr17:10354166C>T	ENST00000255381.2	-	29	4022	c.3912G>A	c.(3910-3912)caG>caA	p.Q1304Q	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1304					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.Q1304Q(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CTCGGGATAGCTGAGAAACCA	0.383																																							uc002gmn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)|skin(2)|central_nervous_system(1)	13						c.(3910-3912)CAG>CAA		myosin, heavy polypeptide 4, skeletal muscle							166.0	151.0	156.0					17																	10354166		2203	4300	6503	SO:0001819	synonymous_variant	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10354166C>T		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3912G>A	17.37:g.10354166C>T			Somatic				uc002gml.1_Intron	p.Q1304Q	NM_017533	NP_060003	WXS	Illumina HiSeq	Unspecified	Q9Y623	MYH4_HUMAN			29	4023	-			1304			Potential.			Silent	SNP	ENST00000255381.2	37	c.3912G>A	CCDS11154.1																																																																																				0.383	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		17	53	0	0	0	0.006122	0	17	53				
ZNF286A	57335	broad.mit.edu	37	17	15619791	15619791	+	Silent	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr17:15619791C>G	ENST00000464847.2	+	5	1306	c.753C>G	c.(751-753)ctC>ctG	p.L251L	ZNF286A_ENST00000395894.2_3'UTR|ZNF286A_ENST00000472486.1_3'UTR|ZNF286A_ENST00000421016.1_Silent_p.L251L|ZNF286A_ENST00000583566.1_Silent_p.L251L|ZNF286A_ENST00000593105.1_Silent_p.L241L|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000413242.2_Silent_p.L251L			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	251					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L251L(1)		central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		GTGGTGAACTCTTCACCTACC	0.358																																							uc010cot.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(751-753)CTC>CTG		zinc finger protein 286							49.0	48.0	48.0					17																	15619791		2203	4300	6503	SO:0001819	synonymous_variant	57335				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr17:15619791C>G	AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.753C>G	17.37:g.15619791C>G			Somatic				ZNF286A_uc002goz.3_Silent_p.L139L|ZNF286A_uc010vwa.1_Silent_p.L251L|ZNF286A_uc002gpa.2_Silent_p.L251L	p.L251L	NM_001130842	NP_001124314	WXS	Illumina HiSeq	Unspecified	Q9HBT8	Z286A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)	6	1149	+			251			C2H2-type 1.		B4DKF9|Q96JF3	Silent	SNP	ENST00000464847.2	37	c.753C>G	CCDS11172.1																																																																																				0.358	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130696.4	NM_020652		6	52	0	0	0	0.001168	0	6	52				
MPP3	4356	broad.mit.edu	37	17	41905172	41905172	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr17:41905172G>A	ENST00000398389.4	-	8	635	c.470C>T	c.(469-471)tCa>tTa	p.S157L	MPP3_ENST00000398393.1_Missense_Mutation_p.S182L	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	157	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)	p.S157L(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		AACAGCCCCTGAGTGCTCGTC	0.622																																							uc002iei.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|skin(1)	2						c.(469-471)TCA>TTA		palmitoylated membrane protein 3							49.0	60.0	57.0					17																	41905172		2142	4245	6387	SO:0001583	missense	4356				signal transduction	cell surface|integral to plasma membrane	guanylate kinase activity	g.chr17:41905172G>A		CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.470C>T	17.37:g.41905172G>A	ENSP00000381425:p.Ser157Leu		Somatic				MPP3_uc002ieh.2_Missense_Mutation_p.S182L|MPP3_uc002iej.2_RNA|MPP3_uc010czi.1_Missense_Mutation_p.S157L|MPP3_uc010wik.1_Missense_Mutation_p.S182L	p.S157L	NM_001932	NP_001923	WXS	Illumina HiSeq	Unspecified	Q13368	MPP3_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.119)	8	636	-		Breast(137;0.00394)	157			PDZ.		B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Missense_Mutation	SNP	ENST00000398389.4	37	c.470C>T	CCDS42344.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318039	0.81469	.	.	ENSG00000161647	ENST00000398393;ENST00000398389;ENST00000356492	T;T	0.26957	1.7;1.7	5.03	5.03	0.67393	PDZ/DHR/GLGF (4);	0.134187	0.48767	D	0.000166	T	0.33177	0.0854	L	0.36672	1.1	0.58432	D	0.999994	B;P;P	0.38535	0.27;0.494;0.635	B;P;P	0.46389	0.192;0.515;0.515	T	0.10753	-1.0616	10	0.87932	D	0	.	18.5656	0.91115	0.0:0.0:1.0:0.0	.	182;157;182	B4DS20;Q13368;D3DX46	.;MPP3_HUMAN;.	L	182;157;182	ENSP00000381430:S182L;ENSP00000381425:S157L	ENSP00000348885:S182L	S	-	2	0	MPP3	39260698	1.000000	0.71417	0.990000	0.47175	0.252000	0.25951	9.615000	0.98356	2.630000	0.89119	0.563000	0.77884	TCA		0.622	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	NM_001932		15	95	0	0	0	0.007413	0	15	95				
HOXB2	3212	broad.mit.edu	37	17	46620496	46620496	+	Silent	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr17:46620496A>G	ENST00000330070.4	-	2	2172	c.1005T>C	c.(1003-1005)ccT>ccC	p.P335P	HOXB-AS1_ENST00000504972.3_RNA|HOXB-AS1_ENST00000435312.1_RNA|HOXB-AS1_ENST00000508688.1_RNA|HOXB2_ENST00000504772.3_5'UTR	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	335					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P335P(2)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						CCTCGGAAAAAGGGACCGGGC	0.587																																							uc002inm.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1003-1005)CCT>CCC		homeobox B2							80.0	83.0	82.0					17																	46620496		2203	4300	6503	SO:0001819	synonymous_variant	3212				blood circulation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:46620496A>G		CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.1005T>C	17.37:g.46620496A>G			Somatic					p.P335P	NM_002145	NP_002136	WXS	Illumina HiSeq	Unspecified	P14652	HXB2_HUMAN			2	1125	-			335					P10913|P17485	Silent	SNP	ENST00000330070.4	37	c.1005T>C	CCDS11527.1																																																																																				0.587	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358384.2			3	133	0	0	0	0.004672	0	3	133				
HELZ	9931	broad.mit.edu	37	17	65144729	65144729	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr17:65144729C>G	ENST00000358691.5	-	20	2743	c.2577G>C	c.(2575-2577)agG>agC	p.R859S	HELZ_ENST00000580168.1_Missense_Mutation_p.R860S	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	859						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R859S(1)		NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ACAGGAGAATCCTACATGGGA	0.483																																							uc010wqk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(2578-2580)AGG>AGC		helicase with zinc finger domain							220.0	215.0	217.0					17																	65144729		1911	4128	6039	SO:0001583	missense	9931							g.chr17:65144729C>G	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.2577G>C	17.37:g.65144729C>G	ENSP00000351524:p.Arg859Ser		Somatic				HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.R859S	p.R860S	NM_014877	NP_055692	WXS	Illumina HiSeq	Unspecified					20	2767	-	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)							I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	c.2580G>C	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768186	0.31320	.	.	ENSG00000198265	ENST00000358691	D	0.81908	-1.55	5.64	3.3	0.37823	.	0.000000	0.85682	D	0.000000	T	0.81659	0.4869	L	0.28400	0.85	0.58432	D	0.999993	D;P	0.58970	0.984;0.87	D;P	0.63113	0.911;0.723	T	0.81219	-0.1032	10	0.72032	D	0.01	-15.9623	5.7838	0.18322	0.0:0.6059:0.1517:0.2423	.	860;859	B7ZLW2;P42694	.;HELZ_HUMAN	S	859	ENSP00000351524:R859S	ENSP00000351524:R859S	R	-	3	2	HELZ	62575191	0.949000	0.32298	1.000000	0.80357	0.957000	0.61999	0.000000	0.12993	1.523000	0.49018	0.557000	0.71058	AGG		0.483	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877		23	322	0	0	0	0.002299	0	23	322				
ABCA6	23460	broad.mit.edu	37	17	67079099	67079099	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr17:67079099C>G	ENST00000284425.2	-	36	4705	c.4531G>C	c.(4531-4533)Gag>Cag	p.E1511Q	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1511	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.E1511Q(1)		breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					ACTTTTAGCTCTAGAATGTAA	0.433																																							uc002jhw.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7						c.(4531-4533)GAG>CAG		ATP-binding cassette, sub-family A, member 6							206.0	210.0	209.0					17																	67079099		2203	4300	6503	SO:0001583	missense	23460				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67079099C>G	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4531G>C	17.37:g.67079099C>G	ENSP00000284425:p.Glu1511Gln		Somatic					p.E1511Q	NM_080284	NP_525023	WXS	Illumina HiSeq	Unspecified	Q8N139	ABCA6_HUMAN			36	4706	-	Breast(10;5.65e-12)		1511			ABC transporter 2.		Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	c.4531G>C	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673577	0.67928	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.95622	-3.76	5.27	3.21	0.36854	ABC transporter-like (1);	0.114043	0.38326	N	0.001734	D	0.94581	0.8254	L	0.39147	1.195	0.80722	D	1	D	0.56035	0.974	P	0.56278	0.795	D	0.93126	0.6529	10	0.48119	T	0.1	.	10.5074	0.44842	0.0:0.7929:0.1339:0.0731	.	1511	Q8N139	ABCA6_HUMAN	Q	1511;371	ENSP00000284425:E1511Q	ENSP00000284425:E1511Q	E	-	1	0	ABCA6	64590694	0.997000	0.39634	0.968000	0.41197	0.525000	0.34531	2.046000	0.41260	0.862000	0.35528	0.650000	0.86243	GAG		0.433	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284		25	321	0	0	0	0.005443	0	25	321				
BAIAP2	10458	broad.mit.edu	37	17	79060372	79060372	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr17:79060372G>A	ENST00000321300.6	+	6	574	c.481G>A	c.(481-483)Gag>Aag	p.E161K	BAIAP2_ENST00000321280.7_Missense_Mutation_p.E161K|BAIAP2_ENST00000573894.1_3'UTR|BAIAP2_ENST00000428708.2_Missense_Mutation_p.E161K|BAIAP2_ENST00000575245.1_Missense_Mutation_p.E194K|BAIAP2_ENST00000575712.1_Missense_Mutation_p.E161K|BAIAP2_ENST00000435091.3_Missense_Mutation_p.E161K|BAIAP2_ENST00000392411.3_Missense_Mutation_p.E83K	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2	161	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)	p.E161K(2)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CTCGGACAAGGAGCTGCAGGT	0.632																																							uc002jzg.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(481-483)GAG>AAG		BAI1-associated protein 2 isoform 2							72.0	76.0	74.0					17																	79060372		2203	4300	6503	SO:0001583	missense	10458				axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding	g.chr17:79060372G>A	AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.481G>A	17.37:g.79060372G>A	ENSP00000316338:p.Glu161Lys		Somatic				BAIAP2_uc002jyz.3_Missense_Mutation_p.E161K|BAIAP2_uc002jza.2_Missense_Mutation_p.E161K|BAIAP2_uc002jzc.2_Missense_Mutation_p.E161K|BAIAP2_uc002jzb.2_5'UTR|BAIAP2_uc002jzd.2_Missense_Mutation_p.E161K|BAIAP2_uc002jzf.2_Missense_Mutation_p.E161K|BAIAP2_uc002jze.2_Missense_Mutation_p.E194K|BAIAP2_uc010wuh.1_Missense_Mutation_p.E83K|BAIAP2_uc002jzh.2_Missense_Mutation_p.E162K	p.E161K	NM_017451	NP_059345	WXS	Illumina HiSeq	Unspecified	Q9UQB8	BAIP2_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)		6	589	+	all_neural(118;0.101)		161			IMD.		O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Missense_Mutation	SNP	ENST00000321300.6	37	c.481G>A	CCDS11775.1	.	.	.	.	.	.	.	.	.	.	G	32	5.121085	0.94385	.	.	ENSG00000175866	ENST00000321300;ENST00000428708;ENST00000435091;ENST00000321280;ENST00000392411	T;T;T;T;T	0.37915	1.61;1.64;1.17;1.17;1.48	3.91	3.91	0.45181	IRSp53/MIM homology domain (IMD) (3);	0.000000	0.85682	D	0.000000	T	0.63141	0.2486	M	0.85041	2.73	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.998;0.999;1.0;0.999;0.999;0.999;0.999;1.0	T	0.67662	-0.5613	10	0.37606	T	0.19	-16.9389	16.0816	0.81007	0.0:0.0:1.0:0.0	.	83;162;161;161;161;161;161;161	F8W878;B3KPV9;Q9UQB8;Q9UQB8-2;Q9UQB8-3;Q9UQB8-5;Q9UQB8-6;Q9UQB8-4	.;.;BAIP2_HUMAN;.;.;.;.;.	K	161;161;161;161;83	ENSP00000316338:E161K;ENSP00000401022:E161K;ENSP00000413069:E161K;ENSP00000315685:E161K;ENSP00000376211:E83K	ENSP00000315685:E161K	E	+	1	0	BAIAP2	76674967	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.022000	0.93678	1.987000	0.57996	0.561000	0.74099	GAG		0.632	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438553.1			6	90	0	0	0	0.001984	0	6	90				
CLUL1	27098	broad.mit.edu	37	18	641487	641487	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr18:641487G>A	ENST00000400606.2	+	7	1300	c.1155G>A	c.(1153-1155)gtG>gtA	p.V385V	CLUL1_ENST00000581619.1_Silent_p.V410V|CLUL1_ENST00000579494.1_Silent_p.V385V|CLUL1_ENST00000338387.7_Silent_p.V385V|C18orf56_ENST00000585033.1_Intron|CLUL1_ENST00000540035.1_Silent_p.V437V	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	385					cell death (GO:0008219)	extracellular region (GO:0005576)		p.V385V(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						TTGGCTGGGTGTCTGAACTGG	0.493																																							uc002kkp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1153-1155)GTG>GTA		clusterin-like 1 (retinal) precursor							103.0	101.0	102.0					18																	641487		1934	4127	6061	SO:0001819	synonymous_variant	27098				cell death	extracellular region		g.chr18:641487G>A	D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.1155G>A	18.37:g.641487G>A			Somatic				CLUL1_uc010wys.1_Silent_p.V437V|CLUL1_uc002kkq.2_Silent_p.V385V	p.V385V	NM_014410	NP_055225	WXS	Illumina HiSeq	Unspecified	Q15846	CLUL1_HUMAN			7	1300	+			385					A0FDN7	Silent	SNP	ENST00000400606.2	37	c.1155G>A	CCDS42405.1																																																																																				0.493	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441183.1			10	53	0	0	0	0.000978	0	10	53				
MTCL1	23255	broad.mit.edu	37	18	8813163	8813163	+	Missense_Mutation	SNP	G	G	A	rs567434652	byFrequency	TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr18:8813163G>A	ENST00000306329.11	+	10	3748	c.3748G>A	c.(3748-3750)Gac>Aac	p.D1250N	SOGA2_ENST00000359865.3_Missense_Mutation_p.D931N|SOGA2_ENST00000517570.1_Missense_Mutation_p.D890N|SOGA2_ENST00000518815.1_Missense_Mutation_p.D284N|SOGA2_ENST00000306285.7_Missense_Mutation_p.D284N|SOGA2_ENST00000400050.3_Missense_Mutation_p.D890N														p.D931N(1)									GGAACTTCTCGACCGCCTGGA	0.597													G|||	2	0.000399361	0.0	0.0	5008	,	,		17395	0.002		0.0	False		,,,				2504	0.0						uc002knr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2791-2793)GAC>AAC		hypothetical protein LOC23255							32.0	33.0	33.0					18																	8813163		2203	4300	6503	SO:0001583	missense	23255							g.chr18:8813163G>A																												ENST00000306329.11:c.3748G>A	18.37:g.8813163G>A	ENSP00000305027:p.Asp1250Asn		Somatic				KIAA0802_uc002knq.2_Missense_Mutation_p.D890N|KIAA0802_uc002kns.2_Missense_Mutation_p.D299N	p.D931N	NM_015210	NP_056025	WXS	Illumina HiSeq	Unspecified	Q9Y4B5	CC165_HUMAN			12	2933	+			1241			Potential.			Missense_Mutation	SNP	ENST00000306329.11	37	c.2791G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.985300|3.985300	0.74474|0.74474	.|.	.|.	ENSG00000168502|ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285|ENST00000519823	T;T;T;T|.	0.52295|.	0.67;0.67;0.67;0.67|.	4.96|4.96	3.17|3.17	0.36434|0.36434	.|.	0.433101|.	0.19367|.	N|.	0.115981|.	T|T	0.52757|0.52757	0.1754|0.1754	L|L	0.61387|0.61387	1.9|1.9	0.28296|0.28296	N|N	0.923325|0.923325	P;P|.	0.46020|.	0.871;0.777|.	B;B|.	0.34652|.	0.165;0.187|.	T|T	0.46748|0.46748	-0.9169|-0.9169	10|5	0.62326|.	D|.	0.03|.	-13.583|-13.583	11.327|11.327	0.49454|0.49454	0.1486:0.0:0.8514:0.0|0.1486:0.0:0.8514:0.0	.|.	1241;931|.	Q9Y4B5;Q9Y4B5-3|.	CC165_HUMAN;.|.	N|Q	952;890;931;890;284|64	ENSP00000429556:D890N;ENSP00000352927:D931N;ENSP00000382924:D890N;ENSP00000303670:D284N|.	ENSP00000303670:D284N|.	D|R	+|+	1|2	0|0	CCDC165|CCDC165	8803163|8803163	1.000000|1.000000	0.71417|0.71417	0.426000|0.426000	0.26672|0.26672	0.987000|0.987000	0.75469|0.75469	5.138000|5.138000	0.64795|0.64795	0.688000|0.688000	0.31529|0.31529	0.462000|0.462000	0.41574|0.41574	GAC|CGA		0.597	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			3	10	0	0	0	0.004672	0	3	10				
DSC3	1825	broad.mit.edu	37	18	28588282	28588282	+	Silent	SNP	G	G	A	rs138254140		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr18:28588282G>A	ENST00000360428.4	-	10	1553	c.1473C>T	c.(1471-1473)aaC>aaT	p.N491N	DSC3_ENST00000434452.1_Silent_p.N491N	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	491	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.N491N(2)		endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			CCTTATAGCCGTTGATCTTTG	0.388																																							uc002kwj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)	4						c.(1471-1473)AAC>AAT		desmocollin 3 isoform Dsc3a preproprotein		A	,	1,4405	2.1+/-5.4	0,1,2202	96.0	86.0	89.0		1473,1473	0.4	0.9	18	dbSNP_134	89	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	DSC3	NM_001941.3,NM_024423.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	491/897,491/840	28588282	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1825				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding	g.chr18:28588282G>A	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.1473C>T	18.37:g.28588282G>A			Somatic				DSC3_uc002kwi.3_Silent_p.N491N	p.N491N	NM_001941	NP_001932	WXS	Illumina HiSeq	Unspecified	Q14574	DSC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.125)		10	1628	-			491			Cadherin 4.|Extracellular (Potential).		A6NN35|Q14200|Q9HAZ9	Silent	SNP	ENST00000360428.4	37	c.1473C>T	CCDS32810.1																																																																																				0.388	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423		5	46	0	0	0	0.000602	0	5	46				
ZSCAN30	100101467	broad.mit.edu	37	18	32834195	32834195	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr18:32834195G>C	ENST00000420878.3	-	5	1159	c.704C>G	c.(703-705)tCt>tGt	p.S235C	ZNF397_ENST00000355632.4_Splice_Site|ZNF397_ENST00000592264.1_Intron|ZSCAN30_ENST00000333206.5_Missense_Mutation_p.S235C|ZNF397_ENST00000589420.1_Splice_Site|ZNF397_ENST00000261333.6_Splice_Site	NM_001166012.1	NP_001159484.1	Q86W11	ZSC30_HUMAN	zinc finger and SCAN domain containing 30	235					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S235C(1)|p.?(1)		large_intestine(5)|lung(3)|urinary_tract(1)	9						TTGCTTCTTAGAGTTGTCCAG	0.478																																							uc002kym.2		NA																	2	Substitution - Missense(1)|Unknown(1)		lung(2)		0						c.(703-705)TCT>TGT		zinc finger protein 397 opposite strand							166.0	164.0	164.0					18																	32834195		2203	4300	6503	SO:0001583	missense	100101467				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:32834195G>C	AY234408	CCDS42427.1, CCDS74207.1	18q12.2	2013-01-08	2010-07-23	2010-07-23	ENSG00000186814	ENSG00000186814		"""-"", ""Zinc fingers, C2H2-type"""	33517	protein-coding gene	gene with protein product			"""zinc finger protein 397 opposite strand"", ""ZNF397 opposite strand"""	ZNF397OS		12801647	Standard	NM_001166012		Approved	ZNF917	uc002kym.3	Q86W11		ENST00000420878.3:c.704C>G	18.37:g.32834195G>C	ENSP00000392371:p.Ser235Cys		Somatic				ZNF397_uc010dmq.2_Splice_Site_p.E186_splice|ZNF397_uc010dmr.2_Splice_Site|ZNF397_uc002kyj.2_Splice_Site_p.K216_splice|ZNF397OS_uc002kyl.2_5'Flank|ZNF397OS_uc010xce.1_Missense_Mutation_p.S235C	p.S235C	NM_001112734	NP_001106205	WXS	Illumina HiSeq	Unspecified	Q86W11	ZSC30_HUMAN			4	932	-			235					B4E0N0|Q6ZNB3|Q96PN3	Missense_Mutation	SNP	ENST00000420878.3	37	c.704C>G	CCDS42427.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.752|4.752	0.139926|0.139926	0.09083|0.09083	.|.	.|.	ENSG00000186812|ENSG00000186814	ENST00000261333;ENST00000355632|ENST00000420878;ENST00000333206;ENST00000360932	.|T;T	.|0.07444	.|3.19;3.19	4.01|4.01	-0.189|-0.189	0.13260|0.13260	.|.	.|.	.|.	.|.	.|.	.|T	.|0.03434	.|0.0099	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|P	.|0.42785	.|0.79	.|B	.|0.37731	.|0.257	.|T	.|0.35226	.|-0.9797	.|9	.|0.54805	.|T	.|0.06	.|.	2.4739|2.4739	0.04571|0.04571	0.2925:0.0:0.3078:0.3997|0.2925:0.0:0.3078:0.3997	.|.	.|235	.|Q86W11	.|ZSC30_HUMAN	.|C	-1|235;235;170	.|ENSP00000392371:S235C;ENSP00000329738:S235C	.|ENSP00000329738:S235C	.|S	+|-	.|2	.|0	ZNF397|ZSCAN30	31088193|31088193	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.253000|0.253000	0.25986|0.25986	0.214000|0.214000	0.17541|0.17541	0.135000|0.135000	0.18707|0.18707	0.643000|0.643000	0.83706|0.83706	.|TCT		0.478	ZSCAN30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442510.1	NM_001112734		5	166	0	0	0	0.001984	0	5	166				
SETBP1	26040	broad.mit.edu	37	18	42281614	42281614	+	Silent	SNP	A	A	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr18:42281614A>T	ENST00000282030.5	+	2	599	c.303A>T	c.(301-303)ggA>ggT	p.G101G	SETBP1_ENST00000426838.4_Silent_p.G101G	NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	101						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G101G(2)|p.G47G(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TCACAGAGGGAAGTCTGAAGC	0.458									Schinzel-Giedion syndrome																														uc010dni.2		NA																	3	Substitution - coding silent(3)		lung(3)	upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(301-303)GGA>GGT		SET binding protein 1 isoform a							100.0	100.0	100.0					18																	42281614		2203	4300	6503	SO:0001819	synonymous_variant	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42281614A>T	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.303A>T	18.37:g.42281614A>T			Somatic				SETBP1_uc002lay.2_Silent_p.G101G	p.G101G	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	2	599	+			101					A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	ENST00000282030.5	37	c.303A>T	CCDS11923.2																																																																																				0.458	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		15	75	0	0	0	0.003163	0	15	75				
SLC14A1	6563	broad.mit.edu	37	18	43329823	43329823	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr18:43329823C>G	ENST00000321925.4	+	10	1309	c.1077C>G	c.(1075-1077)atC>atG	p.I359M	SLC14A1_ENST00000402943.2_Missense_Mutation_p.I254M|SLC14A1_ENST00000535474.1_Missense_Mutation_p.I227M|SLC14A1_ENST00000436407.3_Missense_Mutation_p.I415M|SLC14A1_ENST00000586142.1_Missense_Mutation_p.I359M|SLC14A1_ENST00000502059.2_Missense_Mutation_p.I251M|RP11-116O18.3_ENST00000586213.1_RNA|SLC14A1_ENST00000591541.1_Missense_Mutation_p.I63M|SLC14A1_ENST00000415427.3_Missense_Mutation_p.I415M|SLC14A1_ENST00000589700.1_3'UTR	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	359					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)	p.I359M(1)|p.I415M(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						ATTCCAACATCTACAAGATGC	0.458																																							uc010xcn.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)|pancreas(1)	2						c.(1075-1077)ATC>ATG		solute carrier family 14 (urea transporter),							146.0	137.0	140.0					18																	43329823		2203	4300	6503	SO:0001583	missense	6563					integral to plasma membrane	urea transmembrane transporter activity	g.chr18:43329823C>G	BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.1077C>G	18.37:g.43329823C>G	ENSP00000318546:p.Ile359Met		Somatic				SLC14A1_uc010dnk.2_Missense_Mutation_p.I415M|SLC14A1_uc002lbf.3_Missense_Mutation_p.I359M|SLC14A1_uc002lbg.3_RNA|SLC14A1_uc010xco.1_Missense_Mutation_p.I254M|SLC14A1_uc002lbh.3_Missense_Mutation_p.I251M|SLC14A1_uc002lbi.3_Missense_Mutation_p.I227M|SLC14A1_uc002lbj.3_Missense_Mutation_p.I415M|SLC14A1_uc002lbk.3_Missense_Mutation_p.I359M	p.I359M	NM_001146036	NP_001139508	WXS	Illumina HiSeq	Unspecified	Q13336	UT1_HUMAN			11	1396	+			359					A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Missense_Mutation	SNP	ENST00000321925.4	37	c.1077C>G	CCDS11925.1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.096783	0.36952	.	.	ENSG00000141469	ENST00000321925;ENST00000415427;ENST00000502059;ENST00000402943;ENST00000535474;ENST00000436407	T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69	5.19	4.31	0.51392	.	0.218489	0.35378	N	0.003241	T	0.50120	0.1597	M	0.84082	2.675	0.30463	N	0.774137	P;B;P	0.46277	0.875;0.436;0.635	B;B;B	0.42361	0.179;0.213;0.385	T	0.61332	-0.7084	10	0.54805	T	0.06	-23.1873	7.6352	0.28261	0.0:0.7445:0.1677:0.0878	.	415;251;359	Q13336-2;B3KXJ3;Q13336	.;.;UT1_HUMAN	M	359;415;251;254;227;415	ENSP00000318546:I359M;ENSP00000412309:I415M;ENSP00000442180:I251M;ENSP00000385320:I254M;ENSP00000441998:I227M;ENSP00000390637:I415M	ENSP00000318546:I359M	I	+	3	3	SLC14A1	41583821	1.000000	0.71417	1.000000	0.80357	0.155000	0.21991	2.697000	0.47060	1.283000	0.44513	0.591000	0.81541	ATC		0.458	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255860.2	NM_015865		3	113	0	0	0	0.004672	0	3	113				
DOK6	220164	broad.mit.edu	37	18	67365639	67365639	+	Splice_Site	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr18:67365639G>C	ENST00000382713.5	+	5	599		c.e5-1		DOK6_ENST00000584435.1_Splice_Site	NM_152721.5	NP_689934.2	Q6PKX4	DOK6_HUMAN	docking protein 6									p.?(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	20		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				TCTCTTCACAGAGAGATTCAA	0.388																																							uc002lkl.2		NA																	1	Unknown(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.e5-1		docking protein 6							99.0	91.0	94.0					18																	67365639		2203	4300	6503	SO:0001630	splice_region_variant	220164						insulin receptor binding	g.chr18:67365639G>C	AK057795	CCDS32841.1	18q22.2	2013-01-10	2005-01-18	2005-01-18		ENSG00000206052		"""Pleckstrin homology (PH) domain containing"""	28301	protein-coding gene	gene with protein product		611402	"""docking protein 5-like"""	DOK5L		15286081	Standard	NM_152721		Approved	MGC20785, HsT3226	uc002lkl.3	Q6PKX4		ENST00000382713.5:c.410-1G>C	18.37:g.67365639G>C			Somatic					p.E137_splice	NM_152721	NP_689934	WXS	Illumina HiSeq	Unspecified	Q6PKX4	DOK6_HUMAN			5	600	+		Colorectal(73;0.083)|Esophageal squamous(42;0.131)						A6NNG3|Q4V9S3|Q8WUZ8|Q96HI2|Q96LU2	Splice_Site	SNP	ENST00000382713.5	37	c.410_splice	CCDS32841.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.624835	0.46840	.	.	ENSG00000206052	ENST00000382713	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2242	0.93812	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOK6	65516619	1.000000	0.71417	1.000000	0.80357	0.242000	0.25591	9.722000	0.98770	2.791000	0.96007	0.591000	0.81541	.		0.388	DOK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442969.1	NM_152721	Intron	9	46	0	0	0	0.000673	0	9	46				
MFSD12	126321	broad.mit.edu	37	19	3546137	3546137	+	Missense_Mutation	SNP	C	C	G	rs199934761		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:3546137C>G	ENST00000355415.2	-	8	1393	c.1224G>C	c.(1222-1224)atG>atC	p.M408I	AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000591878.1_5'Flank|MFSD12_ENST00000398558.4_Missense_Mutation_p.M408I|MFSD12_ENST00000389395.3_Missense_Mutation_p.M408I	NM_174983.3	NP_778148.2	Q6NUT3	MFS12_HUMAN	major facilitator superfamily domain containing 12	408					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)		p.M408I(2)		cervix(1)|endometrium(2)|lung(4)|urinary_tract(2)	9						CCAAGAAGCTCATGGAGCCGT	0.602																																							uc002lxz.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|pancreas(1)	2						c.(1222-1224)ATG>ATC		hypothetical protein LOC126321 isoform c							65.0	73.0	70.0					19																	3546137		2094	4216	6310	SO:0001583	missense	126321				transmembrane transport	integral to membrane		g.chr19:3546137C>G	AF218008	CCDS42465.1, CCDS74256.1	19p13.3	2012-03-09	2011-11-24	2011-11-24	ENSG00000161091	ENSG00000161091			28299	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 28"""	C19orf28		12477932	Standard	NM_174983		Approved	MGC20700, PP3501	uc002lxw.3	Q6NUT3		ENST00000355415.2:c.1224G>C	19.37:g.3546137C>G	ENSP00000347583:p.Met408Ile		Somatic				C19orf28_uc002lxw.2_Missense_Mutation_p.M408I|C19orf28_uc002lxx.2_Missense_Mutation_p.M408I|C19orf28_uc002lxy.2_Missense_Mutation_p.M399I	p.M408I	NM_174983	NP_778148	WXS	Illumina HiSeq	Unspecified	Q6NUT3	CS028_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00251)|STAD - Stomach adenocarcinoma(1328;0.18)	8	1394	-		Hepatocellular(1079;0.137)	408			Helical; (Potential).		A8MXP7|D6W615|E9PAJ8|Q8N459	Missense_Mutation	SNP	ENST00000355415.2	37	c.1224G>C	CCDS42465.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933017	0.92458	.	.	ENSG00000161091	ENST00000389395;ENST00000398558;ENST00000355415	D;D;D	0.87103	-2.21;-2.21;-2.21	4.63	4.63	0.57726	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.92655	0.7666	M	0.72118	2.19	0.80722	D	1	P;D;D	0.89917	0.94;1.0;1.0	P;D;D	0.81914	0.838;0.992;0.995	D	0.93432	0.6786	10	0.62326	D	0.03	-47.8688	16.4799	0.84155	0.0:1.0:0.0:0.0	.	408;399;408	Q6NUT3;Q6NUT3-2;A8MXP7	CS028_HUMAN;.;.	I	408	ENSP00000374046:M408I;ENSP00000381566:M408I;ENSP00000347583:M408I	ENSP00000347583:M408I	M	-	3	0	C19orf28	3497137	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.458000	0.66679	2.126000	0.65437	0.561000	0.74099	ATG		0.602	MFSD12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452949.2	NM_174983		9	45	0	0	0	0.006214	0	9	45				
MUC16	94025	broad.mit.edu	37	19	9048000	9048000	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:9048000G>C	ENST00000397910.4	-	5	33834	c.33631C>G	c.(33631-33633)Ctg>Gtg	p.L11211V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11213	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L6844V(1)|p.L11211V(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTAGTGACCAGTGAAGTCACC	0.488																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(33631-33633)CTG>GTG		mucin 16							58.0	51.0	53.0					19																	9048000		1920	4138	6058	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9048000G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33631C>G	19.37:g.9048000G>C	ENSP00000381008:p.Leu11211Val		Somatic					p.L11211V	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			5	33835	-			11213			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.33631C>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.083	0.200997	0.09652	.	.	ENSG00000181143	ENST00000397910	T	0.02890	4.12	3.31	-3.34	0.04943	.	.	.	.	.	T	0.02807	0.0084	L	0.55481	1.735	.	.	.	B	0.30851	0.297	B	0.24394	0.053	T	0.35871	-0.9771	8	0.87932	D	0	.	4.1912	0.10421	0.32:0.3137:0.3663:0.0	.	11211	B5ME49	.	V	11211	ENSP00000381008:L11211V	ENSP00000381008:L11211V	L	-	1	2	MUC16	8909000	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-2.167000	0.01271	-0.527000	0.06374	-0.564000	0.04169	CTG		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		6	21	0	0	0	0.001168	0	6	21				
MUC16	94025	broad.mit.edu	37	19	9071029	9071029	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:9071029G>A	ENST00000397910.4	-	3	16620	c.16417C>T	c.(16417-16419)Cag>Tag	p.Q5473*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5475	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.Q5473*(2)|p.Q1106*(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTTAGTCTGAGAGATATTA	0.498																																							uc002mkp.2		NA																	3	Substitution - Nonsense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(16417-16419)CAG>TAG		mucin 16							129.0	127.0	127.0					19																	9071029		2028	4174	6202	SO:0001587	stop_gained	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9071029G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16417C>T	19.37:g.9071029G>A	ENSP00000381008:p.Gln5473*		Somatic					p.Q5473*	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	16621	-			5475			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	c.16417C>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	56	25.913026	0.99967	.	.	ENSG00000181143	ENST00000397910	.	.	.	2.06	-4.12	0.03916	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	2.827	0.05488	0.148:0.4141:0.3151:0.1228	.	.	.	.	X	5473	.	ENSP00000381008:Q5473X	Q	-	1	0	MUC16	8932029	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.145000	0.10265	-1.472000	0.01883	-2.140000	0.00339	CAG		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		9	78	0	0	0	0.006214	0	9	78				
MUC16	94025	broad.mit.edu	37	19	9071370	9071370	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:9071370G>A	ENST00000397910.4	-	3	16279	c.16076C>T	c.(16075-16077)cCc>cTc	p.P5359L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5361	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P5359L(2)|p.P992L(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGAGAGGAGGGGATGCTCTG	0.527																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(16075-16077)CCC>CTC		mucin 16							156.0	154.0	155.0					19																	9071370		2067	4206	6273	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9071370G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16076C>T	19.37:g.9071370G>A	ENSP00000381008:p.Pro5359Leu		Somatic					p.P5359L	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	16280	-			5361			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.16076C>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.359	0.066137	0.08388	.	.	ENSG00000181143	ENST00000397910	T	0.24538	1.85	2.39	0.0419	0.14215	.	.	.	.	.	T	0.14485	0.0350	N	0.12182	0.205	.	.	.	P	0.44659	0.84	P	0.45276	0.475	T	0.16689	-1.0394	8	0.87932	D	0	.	2.9897	0.05979	0.159:0.0:0.5764:0.2647	.	5359	B5ME49	.	L	5359	ENSP00000381008:P5359L	ENSP00000381008:P5359L	P	-	2	0	MUC16	8932370	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.018000	0.12568	0.096000	0.17463	0.313000	0.20887	CCC		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		10	86	0	0	0	0.006214	0	10	86				
NACC1	112939	broad.mit.edu	37	19	13249157	13249158	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:13249157_13249158GC>TT	ENST00000292431.4	+	6	1647_1648	c.1521_1522GC>TT	c.(1519-1524)gaGCat>gaTTat	p.507_508EH>DY	CTC-250I14.3_ENST00000591825.1_RNA	NM_052876.3	NP_443108.1	Q96RE7	NACC1_HUMAN	nucleus accumbens associated 1, BEN and BTB (POZ) domain containing	507					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear body (GO:0016604)|nucleus (GO:0005634)		p.E507_H508>DY(1)		endometrium(3)|large_intestine(2)|lung(3)|skin(1)	9						TGGGTGTGGAGCATGGCTTCGA	0.649																																							uc002mwm.2		NA																	1	Complex - compound substitution(1)		lung(1)		0						c.(1519-1524)GAGCAT>GATTAT		transcriptional repressor NAC1																																				SO:0001583	missense	112939				negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization|transcription, DNA-dependent	cytoplasm|nuclear body		g.chr19:13249157_13249158GC>TT	AF395817	CCDS12294.1	19p13.13	2013-01-09	2008-10-03	2008-10-03		ENSG00000160877		"""BEN domain containing"", ""BTB/POZ domain containing"""	20967	protein-coding gene	gene with protein product	"""nucleus accumbens associated 1"", ""BEN domain containing 8"""	610672	"""BTB (POZ) domain containing 14B"""	BTBD14B		12477932	Standard	NM_052876		Approved	NAC1, NAC-1, BEND8, BTBD30	uc002mwm.4	Q96RE7		Exception_encountered	19.37:g.13249157_13249158delinsTT	ENSP00000292431:p.E507_H508delinsDY		Somatic					p.507_508EH>DY	NM_052876	NP_443108	WXS	Illumina HiSeq	Unspecified	Q96RE7	NACC1_HUMAN			6	1689_1690	+			507_508						Missense_Mutation	DNP	ENST00000292431.4	37	c.1521_1522GC>TT	CCDS12294.1																																																																																				0.649	NACC1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452879.1	NM_052876		12	80	0	0	0	0.004672	0	12	80				
CYP4F2	8529	broad.mit.edu	37	19	15997064	15997064	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:15997064A>G	ENST00000221700.6	-	8	1068	c.973T>C	c.(973-975)Ttt>Ctt	p.F325L	CYP4F2_ENST00000011989.7_Intron	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2									p.F325L(1)		NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TCAAACATAAAGGTGTCAGCT	0.562																																							uc002nbs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(973-975)TTT>CTT		cytochrome P450, family 4, subfamily F,							211.0	216.0	214.0					19																	15997064		2203	4300	6503	SO:0001583	missense	8529				leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding	g.chr19:15997064A>G	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.973T>C	19.37:g.15997064A>G	ENSP00000221700:p.Phe325Leu		Somatic				CYP4F2_uc010xot.1_Missense_Mutation_p.F176L|CYP4F2_uc010xou.1_Intron	p.F325L	NM_001082	NP_001073	WXS	Illumina HiSeq	Unspecified	P78329	CP4F2_HUMAN			8	1023	-			325						Missense_Mutation	SNP	ENST00000221700.6	37	c.973T>C	CCDS12336.1	.	.	.	.	.	.	.	.	.	.	a	17.85	3.489559	0.64074	.	.	ENSG00000186115	ENST00000221700;ENST00000392846	T	0.66280	-0.2	2.73	2.73	0.32206	.	0.000000	0.64402	U	0.000002	T	0.75243	0.3823	M	0.81614	2.55	0.80722	D	1	D	0.67145	0.996	D	0.67900	0.954	T	0.77180	-0.2682	10	0.87932	D	0	.	8.8874	0.35411	1.0:0.0:0.0:0.0	.	325	P78329	CP4F2_HUMAN	L	325;176	ENSP00000221700:F325L	ENSP00000221700:F325L	F	-	1	0	CYP4F2	15858064	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	7.317000	0.79018	1.230000	0.43646	0.260000	0.18958	TTT		0.562	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082		50	236	0	0	0	0.00361	0	50	236				
TSHZ3	57616	broad.mit.edu	37	19	31770030	31770030	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:31770030G>A	ENST00000240587.4	-	2	996	c.669C>T	c.(667-669)taC>taT	p.Y223Y		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	223					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y223Y(1)|p.Y40Y(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CCAGGGTGTCGTAGGCAGCGC	0.592																																							uc002nsy.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(667-669)TAC>TAT		zinc finger protein 537							156.0	141.0	146.0					19																	31770030		2203	4300	6503	SO:0001819	synonymous_variant	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31770030G>A	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.669C>T	19.37:g.31770030G>A			Somatic					p.Y223Y	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	734	-	Esophageal squamous(110;0.226)		223			C2H2-type 1.		Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	c.669C>T	CCDS12421.2																																																																																				0.592	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		33	131	0	0	0	0.003271	0	33	131				
ZNF566	84924	broad.mit.edu	37	19	36940775	36940775	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:36940775C>T	ENST00000434377.2	-	5	442	c.361G>A	c.(361-363)Gat>Aat	p.D121N	ZNF566_ENST00000392170.2_Missense_Mutation_p.D122N|ZNF566_ENST00000424129.2_Missense_Mutation_p.D121N|ZNF566_ENST00000493391.1_Missense_Mutation_p.D17N|ZNF566_ENST00000454319.1_Missense_Mutation_p.D122N	NM_032838.4	NP_116227.1	Q969W8	ZN566_HUMAN	zinc finger protein 566	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D121N(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24	Esophageal squamous(110;0.162)					CATTCCCAATCATCTCTGAAA	0.383																																							uc002oea.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(361-363)GAT>AAT		zinc finger protein 566 isoform 1							159.0	162.0	161.0					19																	36940775		2203	4300	6503	SO:0001583	missense	84924				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:36940775C>T	AK074497	CCDS12494.1, CCDS46061.1, CCDS74346.1	19q13.12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25919	protein-coding gene	gene with protein product						12477932	Standard	NM_001145343		Approved	FLJ14779, MGC12515	uc010xtf.2	Q969W8		ENST00000434377.2:c.361G>A	19.37:g.36940775C>T	ENSP00000415520:p.Asp121Asn		Somatic				ZNF566_uc010xte.1_Missense_Mutation_p.D121N|ZNF566_uc010xtf.1_Missense_Mutation_p.D122N|ZNF566_uc002oeb.3_Missense_Mutation_p.D121N|ZNF566_uc002oec.3_Missense_Mutation_p.D17N|ZNF566_uc010xtg.1_Missense_Mutation_p.D17N	p.D121N	NM_032838	NP_116227	WXS	Illumina HiSeq	Unspecified	Q969W8	ZN566_HUMAN			5	443	-	Esophageal squamous(110;0.162)		121					B7ZL95|Q2M3J1	Missense_Mutation	SNP	ENST00000434377.2	37	c.361G>A	CCDS12494.1	.	.	.	.	.	.	.	.	.	.	C	5.570	0.289980	0.10567	.	.	ENSG00000186017	ENST00000454319;ENST00000434377;ENST00000392170;ENST00000424129;ENST00000452939;ENST00000427002	T;T;T;T;T;T	0.05258	3.58;3.59;3.58;3.59;3.47;6.04	3.96	2.92	0.33932	.	0.839061	0.10211	N	0.702095	T	0.05731	0.0150	L	0.42245	1.32	0.09310	N	1	B;B	0.32717	0.136;0.381	B;B	0.31946	0.039;0.138	T	0.40869	-0.9540	10	0.15952	T	0.53	.	5.6603	0.17664	0.0:0.6892:0.2009:0.1099	.	122;121	B7ZL95;Q969W8	.;ZN566_HUMAN	N	122;121;122;121;121;122	ENSP00000394207:D122N;ENSP00000415520:D121N;ENSP00000376010:D122N;ENSP00000401259:D121N;ENSP00000411526:D121N;ENSP00000400651:D122N	ENSP00000376010:D122N	D	-	1	0	ZNF566	41632615	0.005000	0.15991	0.036000	0.18154	0.225000	0.24961	0.590000	0.23954	1.019000	0.39547	0.555000	0.69702	GAT		0.383	ZNF566-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000341054.1	NM_032838		11	176	0	0	0	0.001368	0	11	176				
SPTBN4	57731	broad.mit.edu	37	19	41078030	41078030	+	Silent	SNP	C	C	G	rs200712024		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:41078030C>G	ENST00000352632.3	+	34	7511	c.7425C>G	c.(7423-7425)ctC>ctG	p.L2475L	SPTBN4_ENST00000392025.1_Silent_p.L1218L|SPTBN4_ENST00000593816.1_3'UTR|SPTBN4_ENST00000598249.1_Silent_p.L2475L			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2475	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.L2475L(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AACCGCTGCTCAGCCTGCACA	0.597																																							uc002ony.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(7423-7425)CTC>CTG		spectrin, beta, non-erythrocytic 4 isoform							97.0	106.0	103.0					19																	41078030		2203	4300	6503	SO:0001819	synonymous_variant	57731				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton	g.chr19:41078030C>G	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.7425C>G	19.37:g.41078030C>G			Somatic				SPTBN4_uc002onz.2_Silent_p.L2475L|SPTBN4_uc010egx.2_Silent_p.L1218L	p.L2475L	NM_020971	NP_066022	WXS	Illumina HiSeq	Unspecified	Q9H254	SPTN4_HUMAN	Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)		34	7511	+			2475			PH.		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	c.7425C>G	CCDS12559.1																																																																																				0.597	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2			11	146	0	0	0	0.000673	0	11	146				
PRKCG	5582	broad.mit.edu	37	19	54403973	54403973	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:54403973C>T	ENST00000263431.3	+	14	1827	c.1545C>T	c.(1543-1545)ttC>ttT	p.F515F	PRKCG_ENST00000542049.1_Silent_p.F402F|PRKCG_ENST00000540413.1_Silent_p.F515F	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	515	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CCCGCACCTTCTGCGGGACCC	0.557																																							uc002qcq.1		NA																	0				lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9						c.(1543-1545)TTC>TTT		protein kinase C, gamma							213.0	216.0	215.0					19																	54403973		2203	4300	6503	SO:0001819	synonymous_variant	5582				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding	g.chr19:54403973C>T	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1545C>T	19.37:g.54403973C>T			Somatic				PRKCG_uc010yeg.1_Silent_p.F515F|PRKCG_uc010yeh.1_Silent_p.F402F	p.F515F	NM_002739	NP_002730	WXS	Illumina HiSeq	Unspecified	P05129	KPCG_HUMAN		GBM - Glioblastoma multiforme(134;0.0521)	14	1827	+	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)		515			Protein kinase.		B7Z8Q0	Silent	SNP	ENST00000263431.3	37	c.1545C>T	CCDS12867.1																																																																																				0.557	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739		6	298	0	0	0	0.001984	0	6	298				
ZSCAN22	342945	broad.mit.edu	37	19	58850179	58850179	+	Silent	SNP	G	G	A	rs139283341	byFrequency	TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr19:58850179G>A	ENST00000329665.4	+	3	1110	c.963G>A	c.(961-963)gcG>gcA	p.A321A		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	321					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A321A(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		ACACAGGGGCGAAGCCCCATG	0.567													G|||	4	0.000798722	0.0	0.0029	5008	,	,		19012	0.0		0.001	False		,,,				2504	0.001						uc002qsc.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(961-963)GCG>GCA		zinc finger and SCAN domain containing 22		G		3,4403	6.2+/-15.9	0,3,2200	73.0	78.0	76.0		963	-2.7	0.7	19	dbSNP_134	76	7,8593	5.7+/-21.5	0,7,4293	no	coding-synonymous	ZSCAN22	NM_181846.2		0,10,6493	AA,AG,GG		0.0814,0.0681,0.0769		321/492	58850179	10,12996	2203	4300	6503	SO:0001819	synonymous_variant	342945				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58850179G>A	M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.963G>A	19.37:g.58850179G>A			Somatic				ZSCAN22_uc010yhz.1_Missense_Mutation_p.R316Q	p.A321A	NM_181846	NP_862829	WXS	Illumina HiSeq	Unspecified	P10073	ZSC22_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)	3	1110	+		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)	321					Q15922|Q7Z3L8	Silent	SNP	ENST00000329665.4	37	c.963G>A	CCDS12975.1																																																																																				0.567	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466765.1	NM_181846		8	89	0	0	0	0.004482	0	8	89				
TPO	7173	broad.mit.edu	37	2	1418189	1418189	+	Silent	SNP	G	G	A	rs61758084		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr2:1418189G>A	ENST00000345913.4	+	2	100	c.9G>A	c.(7-9)gcG>gcA	p.A3A	TPO_ENST00000329066.4_Silent_p.A3A|TPO_ENST00000382201.3_Silent_p.A3A|TPO_ENST00000382198.1_Silent_p.A3A|TPO_ENST00000382269.3_Silent_p.A3A|TPO_ENST00000346956.3_Silent_p.A3A|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Silent_p.A3A|TPO_ENST00000539820.1_Silent_p.A3A|TPO_ENST00000349624.3_Silent_p.A3A	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	3					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.A3A(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GAATGAGAGCGCTCGCTGTGC	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		16634	0.0		0.001	False		,,,				2504	0.0						uc002qww.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20						c.(7-9)GCG>GCA		thyroid peroxidase isoform a	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)						75.0	72.0	73.0					2																	1418189		2203	4300	6503	SO:0001819	synonymous_variant	7173				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity	g.chr2:1418189G>A		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.9G>A	2.37:g.1418189G>A			Somatic				TPO_uc010ewj.2_Intron|TPO_uc010yin.1_Silent_p.A3A|TPO_uc002qwu.2_Silent_p.A3A|TPO_uc002qwr.2_Silent_p.A3A|TPO_uc002qwx.2_Silent_p.A3A|TPO_uc010yio.1_Silent_p.A3A|TPO_uc010yip.1_Silent_p.A3A	p.A3A	NM_000547	NP_000538	WXS	Illumina HiSeq	Unspecified	P07202	PERT_HUMAN		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	2	100	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	3					P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Silent	SNP	ENST00000345913.4	37	c.9G>A	CCDS1643.1																																																																																				0.522	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547		4	18	0	0	0	0.000602	0	4	18				
ADCY3	109	broad.mit.edu	37	2	25044432	25044432	+	Silent	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr2:25044432G>C	ENST00000260600.5	-	19	3932	c.3081C>G	c.(3079-3081)ctC>ctG	p.L1027L	CENPO_ENST00000380834.2_3'UTR|CENPO_ENST00000473706.1_3'UTR|ADCY3_ENST00000405392.1_Silent_p.L614L	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	1027					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.L1027L(1)		NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					TGATGTTGGTGAGCGTATCCT	0.617																																							uc002rfs.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)|ovary(1)	4						c.(3079-3081)CTC>CTG		adenylate cyclase 3							168.0	152.0	158.0					2																	25044432		2203	4300	6503	SO:0001819	synonymous_variant	109				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding	g.chr2:25044432G>C	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.3081C>G	2.37:g.25044432G>C			Somatic				ADCY3_uc002rfr.3_Silent_p.L614L|ADCY3_uc010ykm.1_Silent_p.L1028L	p.L1027L	NM_004036	NP_004027	WXS	Illumina HiSeq	Unspecified	O60266	ADCY3_HUMAN			19	3280	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)		1027			Cytoplasmic (Potential).		B3KT86|Q53T54|Q9UDB1	Silent	SNP	ENST00000260600.5	37	c.3081C>G	CCDS1715.1																																																																																				0.617	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2			3	163	0	0	0	0.004672	0	3	163				
HEATR5B	54497	broad.mit.edu	37	2	37217795	37217795	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr2:37217795G>C	ENST00000233099.5	-	34	5788	c.5693C>G	c.(5692-5694)cCa>cGa	p.P1898R	HEATR5B_ENST00000354531.2_Missense_Mutation_p.P1809R	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1898						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.P1898R(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				ACTTACCCATGGGTCGCATGA	0.343																																							uc002rpp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)|breast(1)	8						c.(5692-5694)CCA>CGA		HEAT repeat containing 5B							108.0	99.0	102.0					2																	37217795		2203	4300	6503	SO:0001583	missense	54497						binding	g.chr2:37217795G>C	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.5693C>G	2.37:g.37217795G>C	ENSP00000233099:p.Pro1898Arg		Somatic				HEATR5B_uc002rpo.1_Missense_Mutation_p.P210R|HEATR5B_uc010ezy.1_Missense_Mutation_p.P393R	p.P1898R	NM_019024	NP_061897	WXS	Illumina HiSeq	Unspecified	Q9P2D3	HTR5B_HUMAN			34	5789	-		all_hematologic(82;0.21)	1898					B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	c.5693C>G	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658843	0.88154	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.67523	-0.27;-0.27	5.52	5.52	0.82312	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77611	0.4156	M	0.72118	2.19	0.49483	D	0.999799	D;D	0.57899	0.981;0.981	P;P	0.55749	0.783;0.706	T	0.75320	-0.3359	10	0.33141	T	0.24	-18.6116	19.445	0.94843	0.0:0.0:1.0:0.0	.	1898;1898	Q9P2D3;B9EK47	HTR5B_HUMAN;.	R	1898;1809	ENSP00000233099:P1898R;ENSP00000346531:P1809R	ENSP00000233099:P1898R	P	-	2	0	HEATR5B	37071299	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.827000	0.99397	2.612000	0.88384	0.655000	0.94253	CCA		0.343	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024		8	51	0	0	0	0.00308	0	8	51				
THADA	63892	broad.mit.edu	37	2	43779386	43779386	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr2:43779386G>A	ENST00000405006.4	-	18	3118	c.2767C>T	c.(2767-2769)Cga>Tga	p.R923*	THADA_ENST00000330266.7_Nonsense_Mutation_p.R633*|THADA_ENST00000402360.2_Nonsense_Mutation_p.R923*|THADA_ENST00000415080.2_Nonsense_Mutation_p.R633*|THADA_ENST00000405975.2_Nonsense_Mutation_p.R923*	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	923								p.R923*(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CAGTGGACTCGCCCATACATT	0.408																																							uc002rsw.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2767-2769)CGA>TGA		thyroid adenoma associated							55.0	56.0	56.0					2																	43779386		1940	4132	6072	SO:0001587	stop_gained	63892						binding	g.chr2:43779386G>A	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.2767C>T	2.37:g.43779386G>A	ENSP00000385995:p.Arg923*		Somatic				THADA_uc010far.2_Nonsense_Mutation_p.R192*|THADA_uc002rsx.3_Nonsense_Mutation_p.R923*|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Nonsense_Mutation_p.R633*|THADA_uc010fat.1_Nonsense_Mutation_p.R71*|THADA_uc002rta.2_Nonsense_Mutation_p.R633*|THADA_uc002rtb.1_Nonsense_Mutation_p.R923*	p.R923*	NM_001083953	NP_001077422	WXS	Illumina HiSeq	Unspecified	Q6YHU6	THADA_HUMAN			18	3119	-		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)	923					A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Nonsense_Mutation	SNP	ENST00000405006.4	37	c.2767C>T	CCDS46268.1	.	.	.	.	.	.	.	.	.	.	G	36	5.951656	0.97139	.	.	ENSG00000115970	ENST00000330266;ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006;ENST00000402360	.	.	.	5.56	3.72	0.42706	.	0.071578	0.56097	D	0.000032	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	8.8461	0.35170	0.0736:0.0:0.5989:0.3275	.	.	.	.	X	633;923;924;633;923;923	.	ENSP00000331105:R633X	R	-	1	2	THADA	43632890	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	2.171000	0.42453	0.780000	0.33566	0.591000	0.81541	CGA		0.408	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065		4	18	0	0	0	0.000248	0	4	18				
SMYD5	10322	broad.mit.edu	37	2	73448960	73448960	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr2:73448960G>C	ENST00000389501.4	+	6	589	c.544G>C	c.(544-546)Gac>Cac	p.D182H	SMYD5_ENST00000474652.1_3'UTR	NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	182	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.D66H(1)|p.D182H(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						GCAGGCGAAGGACAAGGACCG	0.453																																							uc002siw.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(544-546)GAC>CAC		SMYD family member 5							150.0	143.0	146.0					2																	73448960		2203	4300	6503	SO:0001583	missense	10322						metal ion binding	g.chr2:73448960G>C	U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.544G>C	2.37:g.73448960G>C	ENSP00000374152:p.Asp182His		Somatic				SMYD5_uc010yre.1_Missense_Mutation_p.D66H|SMYD5_uc002six.1_5'Flank	p.D182H	NM_006062	NP_006053	WXS	Illumina HiSeq	Unspecified	Q6GMV2	SMYD5_HUMAN			6	573	+			182					D6W5H3|Q13558	Missense_Mutation	SNP	ENST00000389501.4	37	c.544G>C	CCDS33221.2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.916469	0.92249	.	.	ENSG00000135632	ENST00000389501	T	0.49139	0.79	5.55	5.55	0.83447	SET domain (2);	0.534119	0.22008	N	0.065901	T	0.70176	0.3194	M	0.78637	2.42	0.80722	D	1	D	0.76494	0.999	D	0.70487	0.969	T	0.70096	-0.4966	10	0.49607	T	0.09	-19.2793	18.4535	0.90712	0.0:0.0:1.0:0.0	.	182	Q6GMV2	SMYD5_HUMAN	H	182	ENSP00000374152:D182H	ENSP00000374152:D182H	D	+	1	0	SMYD5	73302468	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.117000	0.94347	2.778000	0.95560	0.650000	0.86243	GAC		0.453	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318301.1	NM_006062		9	104	0	0	0	0.006214	0	9	104				
PCGF1	84759	broad.mit.edu	37	2	74733992	74733992	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr2:74733992C>T	ENST00000233630.6	-	3	1130	c.219G>A	c.(217-219)gtG>gtA	p.V73V	LBX2-AS1_ENST00000548978.2_RNA|PCGF1_ENST00000480844.2_5'UTR|LBX2-AS1_ENST00000603175.1_RNA	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	73					histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)	p.V61V(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						GGAGGTACTTCACAATACAAC	0.522																																							uc002slz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(217-219)GTG>GTA		polycomb group ring finger 1							129.0	115.0	120.0					2																	74733992		2203	4300	6503	SO:0001819	synonymous_variant	84759				histone H2A monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PcG protein complex	protein C-terminus binding|zinc ion binding	g.chr2:74733992C>T	AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954	ENST00000233630.6:c.219G>A	2.37:g.74733992C>T			Somatic				PCGF1_uc002sly.2_5'UTR	p.V73V	NM_032673	NP_116062	WXS	Illumina HiSeq	Unspecified	Q9BSM1	PCGF1_HUMAN			3	245	-			73			No repressor activity.|RING-type.		Q7Z506	Silent	SNP	ENST00000233630.6	37	c.219G>A	CCDS1946.2																																																																																				0.522	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252216.1	NM_032673		10	75	0	0	0	0.001855	0	10	75				
KCNJ3	3760	broad.mit.edu	37	2	155555493	155555493	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr2:155555493C>G	ENST00000295101.2	+	1	683	c.206C>G	c.(205-207)tCg>tGg	p.S69W	AC061961.2_ENST00000443901.1_RNA|KCNJ3_ENST00000544049.1_Missense_Mutation_p.S69W	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	69					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.S69W(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	CGCTACCTCTCGGACCTCTTC	0.592																																							uc002tyv.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|pancreas(1)	2						c.(205-207)TCG>TGG		potassium inwardly-rectifying channel J3	Halothane(DB01159)						109.0	106.0	107.0					2																	155555493		2203	4300	6503	SO:0001583	missense	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155555493C>G	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.206C>G	2.37:g.155555493C>G	ENSP00000295101:p.Ser69Trp		Somatic				KCNJ3_uc010zce.1_Missense_Mutation_p.S69W	p.S69W	NM_002239	NP_002230	WXS	Illumina HiSeq	Unspecified	P48549	IRK3_HUMAN			1	401	+			69			Cytoplasmic (By similarity).		B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	c.206C>G	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.451837	0.63290	.	.	ENSG00000162989	ENST00000295101;ENST00000544049	D;T	0.94280	-3.39;1.78	5.16	4.28	0.50868	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.055872	0.64402	D	0.000001	D	0.96682	0.8917	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.96848	0.9623	10	0.87932	D	0	.	12.2064	0.54355	0.0:0.9162:0.0:0.0838	.	69;69	B4DEW7;P48549	.;IRK3_HUMAN	W	69	ENSP00000295101:S69W;ENSP00000438410:S69W	ENSP00000295101:S69W	S	+	2	0	KCNJ3	155263739	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.929000	0.63455	1.173000	0.42796	0.555000	0.69702	TCG		0.592	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		13	39	0	0	0	0.00245	0	13	39				
TTN	7273	broad.mit.edu	37	2	179468736	179468736	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr2:179468736C>T	ENST00000591111.1	-	232	49979	c.49755G>A	c.(49753-49755)ttG>ttA	p.L16585L	TTN_ENST00000359218.5_Silent_p.L9286L|TTN_ENST00000342992.6_Silent_p.L15658L|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000589042.1_Silent_p.L18226L|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Silent_p.L9161L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Silent_p.L9353L			Q8WZ42	TITIN_HUMAN	titin	16585	Fibronectin type-III 20. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L15658L(2)|p.L9353L(1)|p.L9286L(1)|p.L9161L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCACGCCTTTCAATCCCACTT	0.468																																							uc010zfg.1		NA																	5	Substitution - coding silent(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(46972-46974)TTG>TTA		titin isoform N2-A							258.0	252.0	254.0					2																	179468736		1899	4122	6021	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179468736C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.49755G>A	2.37:g.179468736C>T			Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L9353L|TTN_uc010zfi.1_Silent_p.L9286L|TTN_uc010zfj.1_Silent_p.L9161L	p.L15658L	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		231	47198	-			16585					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.46974G>A																																																																																					0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		26	358	0	0	0	0.007291	0	26	358				
FAM126B	285172	broad.mit.edu	37	2	201873785	201873785	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr2:201873785C>G	ENST00000418596.3	-	7	628	c.441G>C	c.(439-441)ttG>ttC	p.L147F	AC005037.3_ENST00000413848.1_RNA	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	147						intracellular (GO:0005622)		p.L147F(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						CCCCTTCTGTCAAAGCCATGG	0.378																																							uc002uws.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(439-441)TTG>TTC		hypothetical protein LOC285172							125.0	111.0	116.0					2																	201873785		2203	4300	6503	SO:0001583	missense	285172					intracellular		g.chr2:201873785C>G	BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.441G>C	2.37:g.201873785C>G	ENSP00000393667:p.Leu147Phe		Somatic				FAM126B_uc002uwu.2_Missense_Mutation_p.L65F|FAM126B_uc002uwv.2_Missense_Mutation_p.L147F|FAM126B_uc002uww.1_Missense_Mutation_p.L147F	p.L147F	NM_173822	NP_776183	WXS	Illumina HiSeq	Unspecified	Q8IXS8	F126B_HUMAN			7	629	-			147					B2RCG7|Q4ZG87|Q53TX6	Missense_Mutation	SNP	ENST00000418596.3	37	c.441G>C	CCDS2335.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844490	0.71488	.	.	ENSG00000155744	ENST00000418596;ENST00000452799	T;T	0.78481	-1.18;-1.18	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000003	D	0.87116	0.6097	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.88237	0.2907	10	0.72032	D	0.01	-3.9831	12.8	0.57580	0.0:0.9144:0.0:0.0856	.	147	Q8IXS8	F126B_HUMAN	F	147	ENSP00000393667:L147F;ENSP00000401905:L147F	ENSP00000393667:L147F	L	-	3	2	FAM126B	201582030	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.594000	0.36697	2.499000	0.84300	0.491000	0.48974	TTG		0.378	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256285.3	NM_173822		8	83	0	0	0	0.004482	0	8	83				
ABI2	10152	broad.mit.edu	37	2	204267336	204267336	+	Silent	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr2:204267336C>G	ENST00000422511.2	+	9	1003	c.972C>G	c.(970-972)gcC>gcG	p.A324A	ABI2_ENST00000295851.5_Silent_p.A357A|ABI2_ENST00000261017.5_Silent_p.A290A|ABI2_ENST00000430418.1_Silent_p.A302A|ABI2_ENST00000261016.6_Silent_p.A245A|ABI2_ENST00000261018.7_Silent_p.A143A|ABI2_ENST00000430574.1_3'UTR|RAPH1_ENST00000457812.1_Intron|ABI2_ENST00000424558.1_Silent_p.A351A			Q9NYB9	ABI2_HUMAN	abl-interactor 2	357	Pro-rich.			PN -> QT (in Ref. 5; BAG61693). {ECO:0000305}.	actin polymerization or depolymerization (GO:0008154)|cell migration (GO:0016477)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|Rac protein signal transduction (GO:0016601)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	cytoskeletal adaptor activity (GO:0008093)|DNA binding (GO:0003677)|kinase binding (GO:0019900)|proline-rich region binding (GO:0070064)|protein complex binding (GO:0032403)|SH3 domain binding (GO:0017124)|ubiquitin protein ligase binding (GO:0031625)	p.A290A(1)		breast(1)|kidney(3)|large_intestine(1)|liver(2)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	15						ATAGGCCTGCCTCTCGCCATA	0.423																																							uc002vaa.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1069-1071)GCC>GCG		abl interactor 2							84.0	79.0	80.0					2																	204267336		2203	4300	6503	SO:0001819	synonymous_variant	10152				actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding	g.chr2:204267336C>G	AF260261	CCDS2358.1, CCDS63093.1, CCDS63094.1, CCDS74634.1	2q33	2010-09-20	2009-07-23		ENSG00000138443	ENSG00000138443			24011	protein-coding gene	gene with protein product		606442				7590236, 10964520	Standard	XM_005246217		Approved	ABI-2, AIP-1, ABI2B, AblBP3, argBPIA, SSH3BP2	uc002uzz.3	Q9NYB9	OTTHUMG00000132879	ENST00000422511.2:c.972C>G	2.37:g.204267336C>G			Somatic				ABI2_uc002uzz.2_Silent_p.A290A|ABI2_uc010zih.1_Silent_p.A5A|ABI2_uc010zii.1_Silent_p.A351A|ABI2_uc010zij.1_Silent_p.A234A|ABI2_uc002vab.2_Silent_p.A245A|ABI2_uc010zik.1_Silent_p.A82A|ABI2_uc010zil.1_Silent_p.A192A|ABI2_uc010zim.1_Silent_p.A143A|ABI2_uc002vac.2_Silent_p.A143A|ABI2_uc010zin.1_Silent_p.A5A	p.A357A	NM_005759	NP_005750	WXS	Illumina HiSeq	Unspecified	Q9NYB9	ABI2_HUMAN			9	1306	+			357			Pro-rich.		B4DSN1|Q13147|Q13249|Q13801|Q9BV70	Silent	SNP	ENST00000422511.2	37	c.1071C>G		.	.	.	.	.	.	.	.	.	.	C	10.72	1.430685	0.25726	.	.	ENSG00000138443	ENST00000451591;ENST00000454023	.	.	.	5.6	1.21	0.21127	.	.	.	.	.	T	0.40448	0.1117	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30736	-0.9968	4	.	.	.	-5.9187	0.3839	0.00399	0.358:0.208:0.2203:0.2136	.	.	.	.	R	161;137	.	.	P	+	2	0	ABI2	203975581	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-0.964000	0.03833	0.699000	0.31761	0.655000	0.94253	CCT		0.423	ABI2-007	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000336179.2	NM_005759		10	39	0	0	0	0.000673	0	10	39				
NOP56	10528	broad.mit.edu	37	20	2636241	2636241	+	Splice_Site	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr20:2636241G>T	ENST00000329276.5	+	7	1274	c.758G>T	c.(757-759)gGc>gTc	p.G253V	SNORD110_ENST00000408189.1_RNA|MIR1292_ENST00000408135.1_RNA|IDH3B_ENST00000488299.1_5'Flank|SNORD57_ENST00000448188.1_RNA|SNORA51_ENST00000606420.1_RNA|SNORD86_ENST00000391196.1_RNA|SNORD56_ENST00000413522.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	253					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)	p.G253V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						TTTTTCCTAGGCATGGACATA	0.507																																							uc002wgh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(757-759)GGC>GTC		nucleolar protein 5A							143.0	138.0	140.0					20																	2636241		2203	4300	6503	SO:0001630	splice_region_variant	10528				rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding	g.chr20:2636241G>T	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.758-1G>T	20.37:g.2636241G>T			Somatic				NOP56_uc010zpy.1_RNA|NOP56_uc002wgi.2_Missense_Mutation_p.G87V|NOP56_uc002wgm.1_5'UTR|SNORD86_uc010gaq.1_5'Flank|SNORD56_uc010gar.2_5'Flank|SNORD57_uc002wgo.1_5'Flank	p.G253V	NM_006392	NP_006383	WXS	Illumina HiSeq	Unspecified	O00567	NOP56_HUMAN			7	811	+			253					Q2M3T6|Q9NQ05	Missense_Mutation	SNP	ENST00000329276.5	37	c.758G>T	CCDS13030.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.782253	0.70222	.	.	ENSG00000101361	ENST00000329276	D	0.81499	-1.5	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.93275	0.7857	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95369	0.8462	9	.	.	.	.	15.6132	0.76744	0.0:0.0:1.0:0.0	.	253	O00567	NOP56_HUMAN	V	253	ENSP00000370589:G253V	.	G	+	2	0	NOP56	2584241	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.231000	0.95317	2.522000	0.85027	0.561000	0.74099	GGC		0.507	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392	Missense_Mutation	11	86	1	0	2.27111e-07	0.001368	3.6549e-07	11	86				
POFUT1	23509	broad.mit.edu	37	20	30804435	30804435	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr20:30804435C>T	ENST00000375749.3	+	4	515	c.453C>T	c.(451-453)ttC>ttT	p.F151F	POFUT1_ENST00000539210.1_Intron|POFUT1_ENST00000375730.3_Silent_p.F151F|POFUT1_ENST00000486717.1_3'UTR	NM_015352.1	NP_056167.1	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1	151					angiogenesis (GO:0001525)|embryo development (GO:0009790)|fucose metabolic process (GO:0006004)|heart development (GO:0007507)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|O-glycan processing (GO:0016266)|protein O-linked fucosylation (GO:0036066)|protein O-linked glycosylation (GO:0006493)|regulation of transcription, DNA-templated (GO:0006355)|somitogenesis (GO:0001756)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|peptide-O-fucosyltransferase activity (GO:0046922)	p.F151F(2)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	6			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TTGGCCCATTCTGGGATCAGT	0.507																																							uc002wxp.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(1)	1						c.(451-453)TTC>TTT		protein O-fucosyltransferase 1 isoform 1							117.0	113.0	114.0					20																	30804435		2203	4300	6503	SO:0001819	synonymous_variant	23509				fucose metabolic process|Notch signaling pathway|O-glycan processing|regulation of transcription, DNA-dependent	endoplasmic reticulum|membrane	peptide-O-fucosyltransferase activity	g.chr20:30804435C>T	AF375884	CCDS13198.1, CCDS13199.1	20q11	2013-03-06			ENSG00000101346	ENSG00000101346	2.4.1.221	"""Fucosyltransferases"""	14988	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 1"""	607491				9023546, 9525914	Standard	NM_015352		Approved	O-FUT, O-Fuc-T, KIAA0180, FUT12	uc002wxp.3	Q9H488	OTTHUMG00000133268	ENST00000375749.3:c.453C>T	20.37:g.30804435C>T			Somatic				POFUT1_uc002wxo.2_Silent_p.F151F|POFUT1_uc010ztt.1_Silent_p.F43F|POFUT1_uc010ztu.1_Intron	p.F151F	NM_015352	NP_056167	WXS	Illumina HiSeq	Unspecified	Q9H488	OFUT1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		4	502	+			151					A8K4R8|E1P5M4|Q14685|Q5W185|Q9BW76	Silent	SNP	ENST00000375749.3	37	c.453C>T	CCDS13198.1																																																																																				0.507	POFUT1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078613.1	NM_015352		11	100	0	0	0	0.001368	0	11	100				
KCNB1	3745	broad.mit.edu	37	20	47990222	47990222	+	Silent	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr20:47990222G>T	ENST00000371741.4	-	2	2041	c.1875C>A	c.(1873-1875)ggC>ggA	p.G625G		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	625					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)	p.G625G(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	CTCCCCGCCAGCCCACTTCTG	0.607																																							uc002xur.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)|skin(1)	2						c.(1873-1875)GGC>GGA		potassium voltage-gated channel, Shab-related							30.0	32.0	32.0					20																	47990222		2203	4300	6503	SO:0001819	synonymous_variant	3745				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	g.chr20:47990222G>T	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1875C>A	20.37:g.47990222G>T			Somatic				KCNB1_uc002xus.1_Silent_p.G625G	p.G625G	NM_004975	NP_004966	WXS	Illumina HiSeq	Unspecified	Q14721	KCNB1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		2	2039	-			625			Cytoplasmic (Potential).		Q14193	Silent	SNP	ENST00000371741.4	37	c.1875C>A	CCDS13418.1																																																																																				0.607	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975		8	52	1	0	1.06961e-07	0.00308	1.73749e-07	8	52				
ZFP64	55734	broad.mit.edu	37	20	50701362	50701362	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr20:50701362G>A	ENST00000361387.2	-	9	1732	c.1672C>T	c.(1672-1674)Ctg>Ttg	p.L558L	ZFP64_ENST00000371523.4_Silent_p.L339L|ZFP64_ENST00000371518.2_Intron	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	403					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L558L(1)		breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						TCCTTGCCCAGAGGGGCCCGG	0.657																																							uc002xwk.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1672-1674)CTG>TTG		zinc finger protein 64 isoform d							50.0	43.0	45.0					20																	50701362		2203	4300	6503	SO:0001819	synonymous_variant	55734				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:50701362G>A	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1672C>T	20.37:g.50701362G>A			Somatic				ZFP64_uc002xwj.2_Silent_p.L339L	p.L558L	NM_199427	NP_955459	WXS	Illumina HiSeq	Unspecified	Q9NPA5	ZF64A_HUMAN			9	2021	-			403					Q9NTS7|Q9NVH4	Silent	SNP	ENST00000361387.2	37	c.1672C>T	CCDS13439.1																																																																																				0.657	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079743.2	NM_018197		4	38	0	0	0	0.000248	0	4	38				
KRTAP20-2	337976	broad.mit.edu	37	21	32007755	32007755	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr21:32007755G>C	ENST00000330798.2	+	1	201	c.173G>C	c.(172-174)aGa>aCa	p.R58T		NM_181616.1	NP_853647.1	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	58						intermediate filament (GO:0005882)		p.R58T(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|ovary(1)	8						TGCTATGGAAGATACTGGTCC	0.507																																							uc011adg.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(172-174)AGA>ACA		keratin associated protein 20-2							162.0	140.0	148.0					21																	32007755		2203	4300	6503	SO:0001583	missense	337976					intermediate filament		g.chr21:32007755G>C	AP001708	CCDS13604.1	21q22.1	2006-03-13			ENSG00000184032	ENSG00000184032		"""Keratin associated proteins"""	18944	protein-coding gene	gene with protein product						12359730	Standard	NM_181616		Approved	KAP20.2	uc011adg.2	Q3LI61	OTTHUMG00000057786	ENST00000330798.2:c.173G>C	21.37:g.32007755G>C	ENSP00000330746:p.Arg58Thr		Somatic					p.R58T	NM_181616	NP_853647	WXS	Illumina HiSeq	Unspecified	Q3LI61	KR202_HUMAN			1	173	+			58						Missense_Mutation	SNP	ENST00000330798.2	37	c.173G>C	CCDS13604.1	.	.	.	.	.	.	.	.	.	.	G	8.000	0.755192	0.15846	.	.	ENSG00000184032	ENST00000330798	T	0.10860	2.83	4.62	3.73	0.42828	.	0.000000	0.43919	U	0.000520	T	0.09686	0.0238	.	.	.	0.09310	N	1	B	0.29085	0.232	B	0.27076	0.076	T	0.20739	-1.0266	9	0.87932	D	0	.	10.908	0.47092	0.0:0.1897:0.8103:0.0	.	58	Q3LI61	KR202_HUMAN	T	58	ENSP00000330746:R58T	ENSP00000330746:R58T	R	+	2	0	KRTAP20-2	30929626	0.004000	0.15560	0.008000	0.14137	0.003000	0.03518	0.926000	0.28804	1.295000	0.44724	0.650000	0.86243	AGA		0.507	KRTAP20-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128238.3			12	163	0	0	0	0.000978	0	12	163				
DOPEY2	9980	broad.mit.edu	37	21	37617525	37617525	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr21:37617525G>A	ENST00000399151.3	+	19	3332	c.3247G>A	c.(3247-3249)Gag>Aag	p.E1083K		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1083					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.E1083K(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCTGCGAGGCGAGCTGAGCGA	0.627																																							uc002yvg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(3247-3249)GAG>AAG		pad-1-like							74.0	63.0	67.0					21																	37617525		2203	4300	6503	SO:0001583	missense	9980				endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane		g.chr21:37617525G>A	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3247G>A	21.37:g.37617525G>A	ENSP00000382104:p.Glu1083Lys		Somatic				DOPEY2_uc011aeb.1_Missense_Mutation_p.E1032K|DOPEY2_uc002yvh.2_5'UTR	p.E1083K	NM_005128	NP_005119	WXS	Illumina HiSeq	Unspecified	Q9Y3R5	DOP2_HUMAN			19	3326	+			1083					D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	37	c.3247G>A	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	G	7.310	0.614730	0.14129	.	.	ENSG00000142197	ENST00000399151	T	0.29397	1.57	5.36	3.49	0.39957	.	0.292413	0.28977	N	0.013533	T	0.25005	0.0607	L	0.46157	1.445	0.09310	N	1	P;B	0.37122	0.583;0.448	B;B	0.27380	0.079;0.036	T	0.05084	-1.0907	10	0.41790	T	0.15	.	15.1077	0.72334	0.0:0.2688:0.7312:0.0	.	1083;1083	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	K	1083	ENSP00000382104:E1083K	ENSP00000382104:E1083K	E	+	1	0	DOPEY2	36539395	0.607000	0.26958	0.003000	0.11579	0.035000	0.12851	2.789000	0.47813	0.695000	0.31675	0.650000	0.86243	GAG		0.627	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128		6	42	0	0	0	0.001984	0	6	42				
KRTAP10-10	353333	broad.mit.edu	37	21	46057941	46057941	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr21:46057941T>A	ENST00000380095.1	+	1	669	c.607T>A	c.(607-609)Tgc>Agc	p.C203S	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	203	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.C203S(1)		NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						GTCCACCTGCTGCGTGCCCGT	0.692																																							uc002zfq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(607-609)TGC>AGC		keratin associated protein 10-10							98.0	101.0	100.0					21																	46057941		2203	4300	6503	SO:0001583	missense	353333					keratin filament		g.chr21:46057941T>A	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.607T>A	21.37:g.46057941T>A	ENSP00000369438:p.Cys203Ser		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.C203S	NM_181688	NP_859016	WXS	Illumina HiSeq	Unspecified	P60014	KR10A_HUMAN			1	669	+			203			14.|15 X 5 AA repeats of C-C-X(3).			Missense_Mutation	SNP	ENST00000380095.1	37	c.607T>A	CCDS33585.1	.	.	.	.	.	.	.	.	.	.	t	12.87	2.068176	0.36470	.	.	ENSG00000221859	ENST00000380095	T	0.01516	4.81	3.52	3.52	0.40303	.	.	.	.	.	T	0.03871	0.0109	M	0.78456	2.415	0.26925	N	0.966581	P	0.41910	0.764	B	0.43155	0.41	T	0.27673	-1.0067	9	0.48119	T	0.1	.	5.6781	0.17759	0.0:0.1303:0.0:0.8697	.	203	P60014	KR10A_HUMAN	S	203	ENSP00000369438:C203S	ENSP00000369438:C203S	C	+	1	0	KRTAP10-10	44882369	0.964000	0.33143	0.888000	0.34837	0.092000	0.18411	0.892000	0.28322	1.358000	0.45922	0.383000	0.25322	TGC		0.692	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688		35	75	0	0	0	0.00623	0	35	75				
YBEY	54059	broad.mit.edu	37	21	47706941	47706941	+	Silent	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr21:47706941G>C	ENST00000329319.3	+	2	512	c.114G>C	c.(112-114)ggG>ggC	p.G38G	MCM3AP_ENST00000291688.1_5'Flank|YBEY_ENST00000397692.1_Intron|YBEY_ENST00000339195.6_Silent_p.G38G|YBEY_ENST00000397691.1_Silent_p.G38G|YBEY_ENST00000397694.1_Intron|YBEY_ENST00000397701.4_Silent_p.G38G|MCM3AP_ENST00000397708.1_5'Flank	NM_058181.1	NP_478061.1	P58557	YBEY_HUMAN	ybeY metallopeptidase (putative)	38					rRNA processing (GO:0006364)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.G38G(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(2)	9						TTGACCTGGGGATCATCTGTG	0.418																																							uc002ziv.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(112-114)GGG>GGC		hypothetical protein LOC54059 isoform 1							96.0	93.0	94.0					21																	47706941		2203	4300	6503	SO:0001819	synonymous_variant	54059						metal ion binding|metalloendopeptidase activity	g.chr21:47706941G>C	AK294975	CCDS33591.1	21q22.3	2010-12-08	2010-12-08	2010-12-08	ENSG00000182362	ENSG00000182362			1299	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 57"""	C21orf57			Standard	XM_005261155		Approved		uc002ziv.3	P58557	OTTHUMG00000090632	ENST00000329319.3:c.114G>C	21.37:g.47706941G>C			Somatic				C21orf57_uc002zit.1_Silent_p.G38G|C21orf57_uc002ziu.1_Silent_p.G38G|C21orf57_uc002ziw.2_Intron|C21orf57_uc002zix.2_Silent_p.G38G|C21orf57_uc010gqh.2_Intron|C21orf57_uc002ziy.2_Silent_p.G38G|MCM3AP_uc002zir.1_5'Flank	p.G38G	NM_058181	NP_478061	WXS	Illumina HiSeq	Unspecified	P58557	YBEY_HUMAN		Colorectal(79;0.236)	2	543	+	Breast(49;0.112)		38					B7WPA9|B7WPF7|D3DSN2	Silent	SNP	ENST00000329319.3	37	c.114G>C	CCDS33591.1																																																																																				0.418	YBEY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207265.1	NM_058181		4	48	0	0	0	0.000248	0	4	48				
TXNRD2	10587	broad.mit.edu	37	22	19865699	19865699	+	Silent	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr22:19865699C>G	ENST00000400521.1	-	16	1365	c.1359G>C	c.(1357-1359)ctG>ctC	p.L453L	TXNRD2_ENST00000400518.1_Silent_p.L423L|TXNRD2_ENST00000535882.1_Silent_p.L452L|TXNRD2_ENST00000400519.1_Silent_p.L452L|TXNRD2_ENST00000542719.1_Silent_p.L423L	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	453					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)	p.L453L(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					GGGGCTCCCTCAGGCACACCA	0.627																																							uc011ahc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1357-1359)CTG>CTC		thioredoxin reductase 2 precursor							35.0	40.0	38.0					22																	19865699		2066	4203	6269	SO:0001819	synonymous_variant	10587				cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity	g.chr22:19865699C>G	AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.1359G>C	22.37:g.19865699C>G			Somatic				TXNRD2_uc002zql.1_Silent_p.L207L|TXNRD2_uc002zqm.1_RNA|TXNRD2_uc002zqn.1_RNA|TXNRD2_uc002zqo.1_RNA|TXNRD2_uc002zqp.1_RNA|TXNRD2_uc002zqr.1_Silent_p.L452L|TXNRD2_uc002zqj.1_RNA|TXNRD2_uc002zqq.1_Silent_p.L103L	p.L453L	NM_006440	NP_006431	WXS	Illumina HiSeq	Unspecified	Q9NNW7	TRXR2_HUMAN			16	1392	-	Colorectal(54;0.0993)		453					O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Silent	SNP	ENST00000400521.1	37	c.1359G>C	CCDS42981.1																																																																																				0.627	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000314903.3	NM_006440		3	28	0	0	0	0.004672	0	3	28				
IL5RA	3568	broad.mit.edu	37	3	3139822	3139822	+	Splice_Site	SNP	T	T	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr3:3139822T>C	ENST00000446632.2	-	6	1094	c.520A>G	c.(520-522)Agg>Ggg	p.R174G	IL5RA_ENST00000383846.1_Splice_Site_p.R174G|IL5RA_ENST00000456302.1_Splice_Site_p.R174G|IL5RA_ENST00000438560.1_Splice_Site_p.R174G|IL5RA_ENST00000256452.3_Splice_Site_p.R174G|IL5RA_ENST00000418488.2_Splice_Site_p.R174G|IL5RA_ENST00000445864.2_Intron|IL5RA_ENST00000430514.2_Splice_Site_p.R174G|IL5RA_ENST00000311981.8_Splice_Site_p.R174G	NM_175726.3	NP_783853.1	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha	174					cell proliferation (GO:0008283)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-5-mediated signaling pathway (GO:0038043)|regulation of interleukin-5 production (GO:0032674)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-5 receptor activity (GO:0004914)	p.R174G(1)		cervix(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	24				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		AGTACTAACCTATAGTAGAGA	0.418																																					GBM(169;430 2801 24955 28528)	GBM(169;430 2801 24955 28528)	uc011ask.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(520-522)AGG>GGG		interleukin 5 receptor, alpha isoform 1							149.0	155.0	153.0					3																	3139822		2203	4300	6503	SO:0001630	splice_region_variant	3568				cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity	g.chr3:3139822T>C	M96652	CCDS2559.1, CCDS2560.1, CCDS46739.1, CCDS58813.1	3p26-p24	2008-01-11			ENSG00000091181	ENSG00000091181		"""Interleukins and interleukin receptors"", ""CD molecules"""	6017	protein-coding gene	gene with protein product		147851		IL5R		1732409	Standard	NM_175727		Approved	CDw125, CD125	uc010hbs.3	Q01344	OTTHUMG00000090245	ENST00000446632.2:c.521+1A>G	3.37:g.3139822T>C			Somatic				IL5RA_uc010hbq.2_Missense_Mutation_p.R174G|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Missense_Mutation_p.R174G|IL5RA_uc011asl.1_Missense_Mutation_p.R174G|IL5RA_uc011asm.1_Missense_Mutation_p.R174G|IL5RA_uc010hbt.2_Missense_Mutation_p.R174G|IL5RA_uc011asn.1_Missense_Mutation_p.R174G|IL5RA_uc010hbu.2_Missense_Mutation_p.R174G	p.R174G	NM_000564	NP_000555	WXS	Illumina HiSeq	Unspecified	Q01344	IL5RA_HUMAN		Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)	7	1164	-			174			Extracellular (Potential).		B3IU77|B4E2G0|Q14633|Q15469|Q6ISX9	Missense_Mutation	SNP	ENST00000446632.2	37	c.520A>G	CCDS2559.1	.	.	.	.	.	.	.	.	.	.	T	19.17	3.775908	0.70107	.	.	ENSG00000091181	ENST00000446632;ENST00000438560;ENST00000256452;ENST00000418488;ENST00000383846;ENST00000311981;ENST00000430514;ENST00000456302;ENST00000445701	D;D;D;D;D;D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97	5.91	5.91	0.95273	Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (1);Short hematopoietin receptor, family 2, conserved site (1);Immunoglobulin-like fold (1);	0.278888	0.36854	N	0.002365	D	0.92479	0.7612	M	0.84433	2.695	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;0.998;1.0;0.999	D;D;D;D;D	0.77557	0.983;0.976;0.972;0.99;0.974	D	0.92624	0.6110	10	0.46703	T	0.11	-30.3775	13.7215	0.62730	0.0:0.0:0.0:1.0	.	174;174;174;174;174	B4E2G0;Q01344-3;Q01344-2;Q01344;E7ERY4	.;.;.;IL5RA_HUMAN;.	G	174	ENSP00000412209:R174G;ENSP00000390753:R174G;ENSP00000256452:R174G;ENSP00000388858:R174G;ENSP00000373358:R174G;ENSP00000309196:R174G;ENSP00000400400:R174G;ENSP00000392059:R174G;ENSP00000398117:R174G	ENSP00000256452:R174G	R	-	1	2	IL5RA	3114822	1.000000	0.71417	0.910000	0.35882	0.717000	0.41224	4.960000	0.63673	2.254000	0.74563	0.533000	0.62120	AGG		0.418	IL5RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337537.2		Missense_Mutation	15	58	0	0	0	0.004007	0	15	58				
SLC6A6	6533	broad.mit.edu	37	3	14508105	14508105	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr3:14508105G>T	ENST00000454876.2	+	7	1143	c.814G>T	c.(814-816)Gca>Tca	p.A272S	SLC6A6_ENST00000360861.3_Missense_Mutation_p.A272S			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	272				A -> R (in Ref. 1; CAA79481). {ECO:0000305}.	amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)	p.A272S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						GGGCGCGGGCGCAGGCATCAA	0.622																																							uc010heg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(814-816)GCA>TCA		solute carrier family 6 (neurotransmitter							79.0	69.0	72.0					3																	14508105		2203	4300	6503	SO:0001583	missense	6533				cellular amino acid metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity|taurine:sodium symporter activity	g.chr3:14508105G>T		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.814G>T	3.37:g.14508105G>T	ENSP00000398063:p.Ala272Ser		Somatic				SLC6A6_uc003byq.2_Missense_Mutation_p.A272S|SLC6A6_uc003byr.2_RNA	p.A272S	NM_001134367	NP_001127839	WXS	Illumina HiSeq	Unspecified	P31641	SC6A6_HUMAN			14	1105	+			272	A -> R (in Ref. 1; CAA79481).				B2RNU7|Q9BRI2|Q9BXB0	Missense_Mutation	SNP	ENST00000454876.2	37	c.814G>T	CCDS33705.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517636	0.44763	.	.	ENSG00000131389	ENST00000454876;ENST00000360861	T;T	0.74106	-0.81;-0.81	4.55	2.6	0.31112	.	0.428844	0.25256	N	0.031998	T	0.53546	0.1803	N	0.10809	0.05	0.09310	N	1	B	0.06786	0.001	B	0.14023	0.01	T	0.50311	-0.8843	10	0.51188	T	0.08	.	9.6954	0.40154	0.0776:0.0:0.7834:0.1389	.	272	P31641	SC6A6_HUMAN	S	272	ENSP00000398063:A272S;ENSP00000354107:A272S	ENSP00000354107:A272S	A	+	1	0	SLC6A6	14483109	0.998000	0.40836	0.186000	0.23195	0.739000	0.42172	6.574000	0.74014	1.036000	0.39998	0.491000	0.48974	GCA		0.622	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340507.1	NM_003043		17	50	1	0	2.5808e-16	0.006122	4.37723e-16	17	50				
KCNH8	131096	broad.mit.edu	37	3	19479731	19479731	+	Missense_Mutation	SNP	G	G	A	rs138531032	byFrequency	TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr3:19479731G>A	ENST00000328405.2	+	8	1519	c.1253G>A	c.(1252-1254)cGa>cAa	p.R418Q	KCNH8_ENST00000537696.1_Missense_Mutation_p.R59Q	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	418					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.R418Q(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CCGTCGATCCGAAGTGCCTAT	0.493													G|||	3	0.000599042	0.0	0.0	5008	,	,		17929	0.0		0.003	False		,,,				2504	0.0				NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(1)	5						c.(1252-1254)CGA>CAA		potassium voltage-gated channel, subfamily H,		G	GLN/ARG	0,4406		0,0,2203	149.0	147.0	147.0		1253	5.6	1.0	3	dbSNP_134	147	15,8585	11.2+/-40.8	0,15,4285	yes	missense	KCNH8	NM_144633.2	43	0,15,6488	AA,AG,GG		0.1744,0.0,0.1153	possibly-damaging	418/1108	19479731	15,12991	2203	4300	6503	SO:0001583	missense	131096					integral to membrane	two-component sensor activity	g.chr3:19479731G>A	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.1253G>A	3.37:g.19479731G>A	ENSP00000328813:p.Arg418Gln		Somatic				KCNH8_uc011awe.1_Missense_Mutation_p.R418Q|KCNH8_uc010hex.1_5'UTR|KCNH8_uc011awf.1_Missense_Mutation_p.R49Q	p.R418Q	NM_144633	NP_653234	WXS	Illumina HiSeq	Unspecified	Q96L42	KCNH8_HUMAN			8	1448	+			418			Extracellular (Potential).		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	c.1253G>A	CCDS2632.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	34	5.409621	0.96072	0.0	0.001744	ENSG00000183960	ENST00000328405;ENST00000537696	D;T	0.98437	-4.93;1.89	5.6	5.6	0.85130	Ion transport (1);	0.000000	0.28225	U	0.016127	D	0.97269	0.9107	L	0.41415	1.275	0.58432	D	0.999999	B;P	0.43287	0.377;0.802	B;P	0.47376	0.06;0.545	D	0.96732	0.9540	9	.	.	.	.	19.6153	0.95632	0.0:0.0:1.0:0.0	.	59;418	B7Z2I7;Q96L42	.;KCNH8_HUMAN	Q	418;59	ENSP00000328813:R418Q;ENSP00000446294:R59Q	.	R	+	2	0	KCNH8	19454735	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	7.902000	0.87389	2.630000	0.89119	0.555000	0.69702	CGA		0.493	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		5	163	0	0	0	0.000602	0	5	163				
ADAMTS9	56999	broad.mit.edu	37	3	64507906	64507906	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr3:64507906C>T	ENST00000498707.1	-	39	6091	c.5749G>A	c.(5749-5751)Ggt>Agt	p.G1917S	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.G1889S|ADAMTS9_ENST00000467257.1_5'UTR	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1917	GON. {ECO:0000255|PROSITE- ProRule:PRU00383}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G1917S(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CCACAGTAACCACCGCATTTC	0.493																																							uc003dmg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|urinary_tract(1)|skin(1)	4						c.(5749-5751)GGT>AGT		ADAM metallopeptidase with thrombospondin type 1							165.0	127.0	140.0					3																	64507906		2203	4300	6503	SO:0001583	missense	56999				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr3:64507906C>T	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.5749G>A	3.37:g.64507906C>T	ENSP00000418735:p.Gly1917Ser		Somatic				ADAMTS9_uc011bfo.1_Missense_Mutation_p.G1889S|ADAMTS9_uc011bfp.1_Missense_Mutation_p.G828S	p.G1917S	NM_182920	NP_891550	WXS	Illumina HiSeq	Unspecified	Q9P2N4	ATS9_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)	39	5781	-		Lung NSC(201;0.00682)	1917			GON.		A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	c.5749G>A	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.310362	0.81358	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.47177	0.85;0.85	5.69	5.69	0.88448	Peptidase M12B, GON-ADAMTSs (2);	0.000000	0.85682	D	0.000000	T	0.75620	0.3874	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80495	-0.1357	10	0.87932	D	0	.	17.9857	0.89155	0.0:1.0:0.0:0.0	.	1889;1917	B7ZVX9;Q9P2N4	.;ATS9_HUMAN	S	1889;1917	ENSP00000295903:G1889S;ENSP00000418735:G1917S	ENSP00000295903:G1889S	G	-	1	0	ADAMTS9	64482946	1.000000	0.71417	0.997000	0.53966	0.509000	0.34042	5.630000	0.67805	2.692000	0.91855	0.650000	0.86243	GGT		0.493	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1			8	33	0	0	0	0.004482	0	8	33				
CMSS1	84319	broad.mit.edu	37	3	99890704	99890704	+	Silent	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr3:99890704A>G	ENST00000421999.2	+	7	686	c.540A>G	c.(538-540)ggA>ggG	p.G180G	CMSS1_ENST00000489081.1_Silent_p.G162G	NM_032359.3	NP_115735.2	Q9BQ75	CMS1_HUMAN	cms1 ribosomal small subunit homolog (yeast)	180							poly(A) RNA binding (GO:0044822)	p.G180G(1)									CATTCAGAGGAGACGGCAAAG	0.413																																							uc003dtl.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(538-540)GGA>GGG		hypothetical protein LOC84319							99.0	98.0	98.0					3																	99890704		2203	4300	6503	SO:0001819	synonymous_variant	84319						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr3:99890704A>G		CCDS2935.1, CCDS54618.1	3q12.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000184220	ENSG00000184220			28666	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 26"""	C3orf26		12477932	Standard	NM_032359		Approved	MGC4308	uc003dtl.3	Q9BQ75	OTTHUMG00000159054	ENST00000421999.2:c.540A>G	3.37:g.99890704A>G			Somatic					p.G180G	NM_032359	NP_115735	WXS	Illumina HiSeq	Unspecified	Q9BQ75	CC026_HUMAN			7	683	+			180					A8K5S7|B4DUM1|E9PHS3	Silent	SNP	ENST00000421999.2	37	c.540A>G	CCDS2935.1																																																																																				0.413	CMSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353060.1	NM_032359		11	45	0	0	0	0.000978	0	11	45				
ATP13A5	344905	broad.mit.edu	37	3	193081170	193081170	+	Splice_Site	SNP	T	T	A	rs150024258		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr3:193081170T>A	ENST00000342358.4	-	3	356	c.239A>T	c.(238-240)gAc>gTc	p.D80V		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	80						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.D80V(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TTGAAATTCGTCCTGGAAAAG	0.403																																							uc011bsq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(4)|large_intestine(2)	11						c.(238-240)GAC>GTC		ATPase type 13A5							68.0	68.0	68.0					3																	193081170		2203	4300	6503	SO:0001630	splice_region_variant	344905				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:193081170T>A	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.238-1A>T	3.37:g.193081170T>A			Somatic					p.D80V	NM_198505	NP_940907	WXS	Illumina HiSeq	Unspecified	Q4VNC0	AT135_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)	3	239	-	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		80					Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	c.239A>T	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	T	16.69	3.193654	0.58017	.	.	ENSG00000187527	ENST00000342358;ENST00000446087	T;T	0.56776	0.44;0.44	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000002	T	0.72803	0.3506	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76919	-0.2781	10	0.72032	D	0.01	-18.0262	13.4129	0.60952	0.0:0.0:0.0:1.0	.	80	Q4VNC0	AT135_HUMAN	V	80;102	ENSP00000341942:D80V;ENSP00000389416:D102V	ENSP00000341942:D80V	D	-	2	0	ATP13A5	194563864	1.000000	0.71417	1.000000	0.80357	0.433000	0.31745	5.122000	0.64697	2.218000	0.71995	0.533000	0.62120	GAC		0.403	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	Missense_Mutation	9	39	0	0	0	0.000673	0	9	39				
LINC00969	440993	broad.mit.edu	37	3	195404612	195404612	+	lincRNA	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr3:195404612C>T	ENST00000445430.1	+	0	1469									long intergenic non-protein coding RNA 969																		TAAAGTCCCTCCAATTAAACC	0.348																																							uc003fuw.2		NA																	0					0						c.(169-171)CCA>TCA		SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);																																						727956							g.chr3:195404612C>T	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195404612C>T			Somatic				SDHAP2_uc011btc.1_RNA|SDHAP2_uc003fuv.2_RNA	p.P57S			WXS	Illumina HiSeq	Unspecified					10	1363	+									Missense_Mutation	SNP	ENST00000445430.1	37	c.169C>T																																																																																					0.348	LINC00969-038	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000341951.1			8	22	0	0	0	0.006214	0	8	22				
TXK	7294	broad.mit.edu	37	4	48081936	48081936	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr4:48081936C>G	ENST00000264316.4	-	11	1251	c.1166G>C	c.(1165-1167)aGg>aCg	p.R389T	TXK_ENST00000507351.1_Missense_Mutation_p.R44T	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	389	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)	p.R389T(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						TACCAAATCCCTATGAATATA	0.343																																							uc003gxx.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1165-1167)AGG>ACG		TXK tyrosine kinase							156.0	152.0	154.0					4																	48081936		2203	4300	6503	SO:0001583	missense	7294					cytoplasm	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr4:48081936C>G	L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.1166G>C	4.37:g.48081936C>G	ENSP00000264316:p.Arg389Thr		Somatic				TXK_uc010igj.2_RNA|TXK_uc011bzj.1_Missense_Mutation_p.R76T	p.R389T	NM_003328	NP_003319	WXS	Illumina HiSeq	Unspecified	P42681	TXK_HUMAN			11	1252	-			389			Protein kinase.		Q14220	Missense_Mutation	SNP	ENST00000264316.4	37	c.1166G>C	CCDS3480.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621207	0.87460	.	.	ENSG00000074966	ENST00000264316;ENST00000507351	T;T	0.74842	-0.88;-0.88	5.15	5.15	0.70609	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.91389	0.7283	H	0.97440	4.005	0.49915	D	0.999837	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.94148	0.7403	10	0.87932	D	0	.	17.7966	0.88574	0.0:1.0:0.0:0.0	.	76;389	B4DTB5;P42681	.;TXK_HUMAN	T	389;44	ENSP00000264316:R389T;ENSP00000423481:R44T	ENSP00000264316:R389T	R	-	2	0	TXK	47776693	1.000000	0.71417	0.623000	0.29173	0.976000	0.68499	7.625000	0.83145	2.683000	0.91414	0.561000	0.74099	AGG		0.343	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219869.7	NM_003328		4	120	0	0	0	0.000248	0	4	120				
PDGFRA	5156	broad.mit.edu	37	4	55146502	55146502	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr4:55146502G>C	ENST00000257290.5	+	16	2507	c.2176G>C	c.(2176-2178)Gaa>Caa	p.E726Q	FIP1L1_ENST00000507166.1_Missense_Mutation_p.E486Q	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	726	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.E726Q(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	TTTATCTTTTGAAAACAATGG	0.393			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)	Pancreas(151;208 1913 7310 23853 37092)	uc003han.3		NA		Dom	yes		4	4q11-q13	5156	Mis|O|T	"""platelet-derived growth factor, alpha-receptor"""			"""L, M, O"""	FIP1L1		GIST|idiopathic hypereosinophilic syndrome		1	Substitution - Missense(1)		lung(1)	soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674						c.(2176-2178)GAA>CAA		platelet-derived growth factor receptor alpha	Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)						117.0	113.0	114.0					4																	55146502		2203	4300	6503	SO:0001583	missense	5156	Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	g.chr4:55146502G>C	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.2176G>C	4.37:g.55146502G>C	ENSP00000257290:p.Glu726Gln	TSP Lung(21;0.16)	Somatic				PDGFRA_uc003haa.2_Missense_Mutation_p.E486Q|PDGFRA_uc010igq.1_Missense_Mutation_p.E620Q|PDGFRA_uc003ham.2_RNA|PDGFRA_uc003hao.1_Missense_Mutation_p.E105Q	p.E726Q	NM_006206	NP_006197	WXS	Illumina HiSeq	Unspecified	P16234	PGFRA_HUMAN	GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		16	2507	+	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		726			Protein kinase.|Cytoplasmic (Potential).		B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	c.2176G>C	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	G	32	5.191109	0.94923	.	.	ENSG00000145216;ENSG00000134853	ENST00000507166;ENST00000257290	T;T	0.81078	-1.45;-1.45	5.79	5.79	0.91817	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.33005	U	0.005396	T	0.81735	0.4885	N	0.11673	0.155	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82481	-0.0436	10	0.35671	T	0.21	.	20.0212	0.97504	0.0:0.0:1.0:0.0	.	726	P16234	PGFRA_HUMAN	Q	486;726	ENSP00000423325:E486Q;ENSP00000257290:E726Q	ENSP00000423325:E486Q	E	+	1	0	FIP1L1;PDGFRA	54841259	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.476000	0.97823	2.735000	0.93741	0.561000	0.74099	GAA		0.393	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206		4	45	0	0	0	0.000602	0	4	45				
ODAM	54959	broad.mit.edu	37	4	71066318	71066318	+	Splice_Site	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr4:71066318G>T	ENST00000396094.2	+	6	576	c.528G>T	c.(526-528)caG>caT	p.Q176H		NM_017855.3	NP_060325.3	A1E959	ODAM_HUMAN	odontogenic, ameloblast asssociated	176	Gln-rich.				biomineral tissue development (GO:0031214)|odontogenesis of dentin-containing tooth (GO:0042475)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|fibril (GO:0043205)|nucleus (GO:0005634)		p.Q176H(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(3)|skin(2)	20						ATGAGGAGCAGGTACTGCAAA	0.358																																							uc003hfc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(526-528)CAG>CAT		odontogenic ameloblast-associated protein							93.0	81.0	85.0					4																	71066318		2203	4300	6503	SO:0001630	splice_region_variant	54959				biomineral tissue development|odontogenesis of dentine-containing tooth	fibril		g.chr4:71066318G>T	AK000520	CCDS3536.2	4q13.3	2010-11-23			ENSG00000109205	ENSG00000109205			26043	protein-coding gene	gene with protein product		614843				14647039	Standard	NM_017855		Approved	APin, FLJ20513	uc003hfc.3	A1E959	OTTHUMG00000129406	ENST00000396094.2:c.528+1G>T	4.37:g.71066318G>T			Somatic					p.Q176H	NM_017855	NP_060325	WXS	Illumina HiSeq	Unspecified	A1E959	ODAM_HUMAN			6	545	+			176			Gln-rich.		Q8WWE5|Q9NWZ9	Missense_Mutation	SNP	ENST00000396094.2	37	c.528G>T	CCDS3536.2	.	.	.	.	.	.	.	.	.	.	G	14.73	2.621470	0.46736	.	.	ENSG00000109205	ENST00000396094;ENST00000510709;ENST00000514097	T;T	0.54071	0.59;0.59	5.36	5.36	0.76844	.	0.162076	0.29638	N	0.011587	T	0.67373	0.2886	L	0.59436	1.845	0.35927	D	0.832272	D	0.89917	1.0	D	0.66979	0.948	T	0.74691	-0.3580	10	0.72032	D	0.01	-2.6803	14.4679	0.67497	0.0:0.0:1.0:0.0	.	176	A1E959	ODAM_HUMAN	H	176;162;129	ENSP00000379401:Q176H;ENSP00000426106:Q129H	ENSP00000379401:Q176H	Q	+	3	2	ODAM	71100907	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	4.188000	0.58351	2.794000	0.96219	0.655000	0.94253	CAG		0.358	ODAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251562.1	NM_017855	Missense_Mutation	10	38	1	0	0.000978159	0.000978	0.00145881	10	38				
WDFY3	23001	broad.mit.edu	37	4	85687162	85687162	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr4:85687162C>T	ENST00000295888.4	-	32	5396	c.4989G>A	c.(4987-4989)gtG>gtA	p.V1663V	WDFY3_ENST00000322366.6_Silent_p.V1663V	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1663					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.V1663V(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCAGTGTCTTCACCAGTTCTT	0.343																																							uc003hpd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(4987-4989)GTG>GTA		WD repeat and FYVE domain containing 3 isoform							128.0	124.0	125.0					4																	85687162		2203	4300	6503	SO:0001819	synonymous_variant	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85687162C>T	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.4989G>A	4.37:g.85687162C>T			Somatic					p.V1663V	NM_014991	NP_055806	WXS	Illumina HiSeq	Unspecified	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	32	5397	-		Hepatocellular(203;0.114)	1663					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	c.4989G>A	CCDS3609.1																																																																																				0.343	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		5	72	0	0	0	0.001168	0	5	72				
ARHGAP24	83478	broad.mit.edu	37	4	86893267	86893267	+	Silent	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr4:86893267G>C	ENST00000395184.1	+	6	1144	c.678G>C	c.(676-678)gcG>gcC	p.A226A	ARHGAP24_ENST00000264343.4_Silent_p.A133A|ARHGAP24_ENST00000503995.1_Silent_p.A226A|ARHGAP24_ENST00000395183.2_Silent_p.A131A	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	226	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)	p.A133A(2)|p.A226A(1)		breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		TTCCTTATGCGAAGTATGAAG	0.408																																							uc003hpk.2		NA																	3	Substitution - coding silent(3)		lung(2)|large_intestine(1)		0						c.(676-678)GCG>GCC		Rho GTPase activating protein 24 isoform 1							117.0	109.0	112.0					4																	86893267		2203	4300	6503	SO:0001819	synonymous_variant	83478				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding	g.chr4:86893267G>C	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.678G>C	4.37:g.86893267G>C			Somatic				ARHGAP24_uc003hpj.2_Silent_p.A226A|ARHGAP24_uc003hpl.2_Silent_p.A131A|ARHGAP24_uc010ikf.2_Silent_p.A141A|ARHGAP24_uc003hpm.2_Silent_p.A133A	p.A226A	NM_001025616	NP_001020787	WXS	Illumina HiSeq	Unspecified	Q8N264	RHG24_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000571)	6	1127	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	226			Rho-GAP.		Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Silent	SNP	ENST00000395184.1	37	c.678G>C	CCDS34025.1																																																																																				0.408	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305		7	85	0	0	0	0.004482	0	7	85				
DAPP1	27071	broad.mit.edu	37	4	100774382	100774382	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr4:100774382G>A	ENST00000512369.1	+	4	434	c.366G>A	c.(364-366)ctG>ctA	p.L122L	DAPP1_ENST00000296414.7_Silent_p.L122L	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides	122	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)	p.L122L(2)		endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		CAGGCACTCTGATGGTTCTAA	0.423																																							uc003hvf.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(364-366)CTG>CTA		dual adaptor of phosphotyrosine and							98.0	90.0	92.0					4																	100774382		1880	4100	5980	SO:0001819	synonymous_variant	27071				signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity	g.chr4:100774382G>A	AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.366G>A	4.37:g.100774382G>A			Somatic				DAPP1_uc011cek.1_Intron|DAPP1_uc010ilh.2_Silent_p.L122L	p.L122L	NM_014395	NP_055210	WXS	Illumina HiSeq	Unspecified	Q9UN19	DAPP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)	4	456	+			122			SH2.		Q8TCK5|Q9UHF2	Silent	SNP	ENST00000512369.1	37	c.366G>A	CCDS47112.1																																																																																				0.423	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363215.1			4	38	0	0	0	0.000248	0	4	38				
CENPE	1062	broad.mit.edu	37	4	104064548	104064548	+	Missense_Mutation	SNP	C	C	G	rs146277781	byFrequency	TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr4:104064548C>G	ENST00000265148.3	-	34	5250	c.5161G>C	c.(5161-5163)Gag>Cag	p.E1721Q	CENPE_ENST00000380026.3_Missense_Mutation_p.E1696Q	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1721					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.E1721Q(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTTAGCTCCTCTTGTTTTTCT	0.318																																							uc003hxb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(4)	9						c.(5161-5163)GAG>CAG		centromere protein E		C	GLN/GLU	2,4404	2.1+/-5.4	0,2,2201	131.0	136.0	134.0		5161	5.0	1.0	4	dbSNP_134	134	0,8596		0,0,4298	no	missense	CENPE	NM_001813.2	29	0,2,6499	GG,GC,CC		0.0,0.0454,0.0154	probably-damaging	1721/2702	104064548	2,13000	2203	4298	6501	SO:0001583	missense	1062				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity	g.chr4:104064548C>G	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.5161G>C	4.37:g.104064548C>G	ENSP00000265148:p.Glu1721Gln		Somatic				CENPE_uc003hxc.1_Missense_Mutation_p.E1696Q|CENPE_uc003hxd.1_5'Flank	p.E1721Q	NM_001813	NP_001804	WXS	Illumina HiSeq	Unspecified	Q02224	CENPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)	34	5251	-			1721			Potential.		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	c.5161G>C	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.408658	0.62399	4.54E-4	0.0	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.71934	-0.61;-0.61	5.03	5.03	0.67393	.	.	.	.	.	T	0.80899	0.4712	L	0.59436	1.845	0.37268	D	0.907297	D;D	0.89917	1.0;0.995	D;P	0.76071	0.987;0.827	D	0.84479	0.0604	9	0.66056	D	0.02	.	14.2555	0.66048	0.0:1.0:0.0:0.0	.	1696;1721	Q02224-3;Q02224	.;CENPE_HUMAN	Q	1721;1721;1696	ENSP00000265148:E1721Q;ENSP00000369365:E1696Q	ENSP00000265148:E1721Q	E	-	1	0	CENPE	104283997	0.998000	0.40836	1.000000	0.80357	0.834000	0.47266	0.723000	0.25939	2.494000	0.84150	0.551000	0.68910	GAG		0.318	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				5	173	0	0	0	0.001168	0	5	173				
FAT4	79633	broad.mit.edu	37	4	126372722	126372722	+	Silent	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr4:126372722C>G	ENST00000394329.3	+	9	10564	c.10551C>G	c.(10549-10551)gtC>gtG	p.V3517V	FAT4_ENST00000335110.5_Silent_p.V1815V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3517	Cadherin 34. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V3517V(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AAGGAGAAGTCATGGAAAACA	0.483																																							uc003ifj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(10549-10551)GTC>GTG		FAT tumor suppressor homolog 4 precursor							116.0	114.0	115.0					4																	126372722		2203	4300	6503	SO:0001819	synonymous_variant	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126372722C>G	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10551C>G	4.37:g.126372722C>G			Somatic				FAT4_uc011cgp.1_Silent_p.V1815V|FAT4_uc003ifi.1_Silent_p.V995V	p.V3517V	NM_024582	NP_078858	WXS	Illumina HiSeq	Unspecified	Q6V0I7	FAT4_HUMAN			9	10551	+			3517			Cadherin 34.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	c.10551C>G	CCDS3732.3																																																																																				0.483	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		9	178	0	0	0	0.006214	0	9	178				
NPY2R	4887	broad.mit.edu	37	4	156135229	156135229	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr4:156135229G>A	ENST00000329476.3	+	2	627	c.138G>A	c.(136-138)ctG>ctA	p.L46L	NPY2R_ENST00000506608.1_Silent_p.L46L	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	46					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)	p.L46L(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	GTACCAAGCTGATTGAGGTAC	0.463																																							uc003ioq.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|skin(1)	3						c.(136-138)CTG>CTA		neuropeptide Y receptor Y2							204.0	188.0	194.0					4																	156135229		2203	4300	6503	SO:0001819	synonymous_variant	4887				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity	g.chr4:156135229G>A	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.138G>A	4.37:g.156135229G>A			Somatic				NPY2R_uc003ior.2_Silent_p.L46L	p.L46L	NM_000910	NP_000901	WXS	Illumina HiSeq	Unspecified	P49146	NPY2R_HUMAN			2	633	+	all_hematologic(180;0.24)	Renal(120;0.0854)	46			Extracellular (Potential).		Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Silent	SNP	ENST00000329476.3	37	c.138G>A	CCDS3791.1																																																																																				0.463	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910		10	59	0	0	0	0.000978	0	10	59				
CYP4V2	285440	broad.mit.edu	37	4	187122497	187122497	+	Splice_Site	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr4:187122497G>T	ENST00000378802.4	+	7	1291		c.e7+1			NM_207352.3	NP_997235.3	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily V, polypeptide 2						fatty acid omega-oxidation (GO:0010430)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)	p.?(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)|stomach(2)	20		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		CATGTTTGAGGTATTGTATAT	0.313																																							uc003iyw.3		NA																	1	Unknown(1)		lung(1)		0						c.e7+1		cytochrome P450, family 4, subfamily v,							111.0	111.0	111.0					4																	187122497		2203	4300	6503	SO:0001630	splice_region_variant	285440				response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen	g.chr4:187122497G>T	AK022114	CCDS34119.1	4q35.2	2004-07-05			ENSG00000145476	ENSG00000145476		"""Cytochrome P450s"""	23198	protein-coding gene	gene with protein product		608614				15042513	Standard	NM_207352		Approved	CYP4AH1	uc003iyw.4	Q6ZWL3	OTTHUMG00000160379	ENST00000378802.4:c.987+1G>T	4.37:g.187122497G>T			Somatic				CYP4V2_uc010ism.2_5'Flank	p.E329_splice	NM_207352	NP_997235	WXS	Illumina HiSeq	Unspecified	Q6ZWL3	CP4V2_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)	7	1291	+		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)						B7U6W2|Q6ZTM4	Splice_Site	SNP	ENST00000378802.4	37	c.987_splice	CCDS34119.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.596263	0.86953	.	.	ENSG00000145476	ENST00000378802;ENST00000274118	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4355	0.94792	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CYP4V2	187359491	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.568000	0.98166	2.668000	0.90789	0.655000	0.94253	.		0.313	CYP4V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360398.1	XM_209612	Intron	9	72	1	0	9.70103e-10	0.000673	1.58328e-09	9	72				
C6	729	broad.mit.edu	37	5	41160464	41160464	+	Silent	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:41160464G>T	ENST00000263413.3	-	11	1728	c.1464C>A	c.(1462-1464)gcC>gcA	p.A488A	C6_ENST00000475349.1_5'UTR|C6_ENST00000337836.5_Silent_p.A488A	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	488	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.A488A(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CCACGATGGGGGCAAGCTAGG	0.502																																							uc003jmk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)	7						c.(1462-1464)GCC>GCA		complement component 6 precursor							111.0	95.0	101.0					5																	41160464		2203	4300	6503	SO:0001819	synonymous_variant	729				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding	g.chr5:41160464G>T	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1464C>A	5.37:g.41160464G>T			Somatic				C6_uc003jml.1_Silent_p.A488A	p.A488A	NM_000065	NP_000056	WXS	Illumina HiSeq	Unspecified	P13671	CO6_HUMAN			11	1674	-		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)	488			MACPF.			Silent	SNP	ENST00000263413.3	37	c.1464C>A	CCDS3936.1																																																																																				0.502	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1			14	59	1	0	2.61681e-11	0.00245	4.35297e-11	14	59				
DEPDC1B	55789	broad.mit.edu	37	5	59901643	59901643	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:59901643C>G	ENST00000265036.5	-	8	1006	c.939G>C	c.(937-939)caG>caC	p.Q313H	DEPDC1B_ENST00000509006.1_5'UTR|DEPDC1B_ENST00000545085.1_Missense_Mutation_p.Q286H|DEPDC1B_ENST00000453022.2_Missense_Mutation_p.Q313H	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	313	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.Q313H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				GGCAGCAAATCTGAAATGCTT	0.378																																							uc003jsh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(937-939)CAG>CAC		DEP domain containing 1B isoform 1							143.0	136.0	138.0					5																	59901643		2203	4300	6503	SO:0001583	missense	55789				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr5:59901643C>G	AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.939G>C	5.37:g.59901643C>G	ENSP00000265036:p.Gln313His		Somatic				DEPDC1B_uc011cqm.1_Missense_Mutation_p.Q313H|DEPDC1B_uc011cqn.1_Missense_Mutation_p.Q286H	p.Q313H	NM_018369	NP_060839	WXS	Illumina HiSeq	Unspecified	Q8WUY9	DEP1B_HUMAN			8	1012	-		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)	313			Rho-GAP.		A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Missense_Mutation	SNP	ENST00000265036.5	37	c.939G>C	CCDS3977.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.322204	0.60634	.	.	ENSG00000035499	ENST00000265036;ENST00000453022;ENST00000545085	D;D;D	0.90133	-2.62;-2.62;-2.62	4.47	2.56	0.30785	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.259271	0.41823	D	0.000809	D	0.95249	0.8459	M	0.90198	3.095	0.48452	D	0.999659	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.94148	0.7403	9	.	.	.	-16.3073	9.7801	0.40643	0.0:0.7526:0.0:0.2474	.	313;313	B4DUT4;Q8WUY9	.;DEP1B_HUMAN	H	313;313;286	ENSP00000265036:Q313H;ENSP00000389101:Q313H;ENSP00000438320:Q286H	.	Q	-	3	2	DEPDC1B	59937400	0.956000	0.32656	1.000000	0.80357	0.989000	0.77384	1.979000	0.40608	0.433000	0.26313	-0.157000	0.13467	CAG		0.378	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1	NM_018369		9	141	0	0	0	0.004482	0	9	141				
CMYA5	202333	broad.mit.edu	37	5	79026143	79026143	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:79026143C>A	ENST00000446378.2	+	2	1586	c.1555C>A	c.(1555-1557)Cct>Act	p.P519T		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	519	Glu-rich.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.P519T(2)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGCTATTACCCCTGAACCTGA	0.413																																							uc003kgc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|pancreas(2)|lung(1)	9						c.(1555-1557)CCT>ACT		cardiomyopathy associated 5							106.0	101.0	103.0					5																	79026143		1842	4097	5939	SO:0001583	missense	202333					perinuclear region of cytoplasm		g.chr5:79026143C>A	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.1555C>A	5.37:g.79026143C>A	ENSP00000394770:p.Pro519Thr		Somatic					p.P519T	NM_153610	NP_705838	WXS	Illumina HiSeq	Unspecified	Q8N3K9	CMYA5_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)	2	1627	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	519			Glu-rich.		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	c.1555C>A	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536443	0.27475	.	.	ENSG00000164309	ENST00000446378	T	0.37915	1.17	5.8	0.365	0.16131	.	0.563567	0.16152	N	0.227212	T	0.18130	0.0435	N	0.19112	0.55	0.09310	N	1	B	0.17852	0.024	B	0.18561	0.022	T	0.18053	-1.0349	10	0.72032	D	0.01	.	0.9314	0.01336	0.2109:0.3948:0.1381:0.2562	.	519	Q8N3K9	CMYA5_HUMAN	T	519	ENSP00000394770:P519T	ENSP00000394770:P519T	P	+	1	0	CMYA5	79061899	0.000000	0.05858	0.016000	0.15963	0.059000	0.15707	-0.967000	0.03821	0.227000	0.20999	0.563000	0.77884	CCT		0.413	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610		35	121	1	0	4.4194e-11	0.002836	7.31633e-11	35	121				
DCP2	167227	broad.mit.edu	37	5	112337369	112337369	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:112337369G>A	ENST00000389063.2	+	7	1002	c.804G>A	c.(802-804)ttG>ttA	p.L268L	DCP2_ENST00000515408.1_Silent_p.L268L|DCP2_ENST00000543319.1_Silent_p.L57L	NM_152624.5	NP_689837	Q8IU60	DCP2_HUMAN	decapping mRNA 2	268					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)|RISC complex (GO:0016442)	exoribonuclease activity, producing 5'-phosphomonoesters (GO:0016896)|m7G(5')pppN diphosphatase activity (GO:0050072)|manganese ion binding (GO:0030145)|RNA binding (GO:0003723)	p.L268L(1)		endometrium(3)|large_intestine(6)|lung(1)	10		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		TGGAAAAATTGAGGTAAAGAA	0.373																																							uc003kqh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(802-804)TTG>TTA		DCP2 decapping enzyme							93.0	102.0	99.0					5																	112337369		2202	4300	6502	SO:0001819	synonymous_variant	167227				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus|RNA-induced silencing complex	exoribonuclease activity, producing 5'-phosphomonoesters|manganese ion binding|protein binding|protein binding|RNA binding	g.chr5:112337369G>A	AY135173	CCDS34210.1, CCDS56377.1	5q22	2013-05-02	2013-05-02		ENSG00000172795	ENSG00000172795	3.6.1.62	"""Nudix motif containing"""	24452	protein-coding gene	gene with protein product	"""nudix (nucleoside diphosphate linked moiety X)-type motif 20"", ""M(7)GpppN-mRNA hydrolase"""	609844	"""DCP2 decapping enzyme homolog (S. cerevisiae)"""			12218187, 12417715	Standard	NM_152624		Approved	NUDT20	uc003kqh.3	Q8IU60	OTTHUMG00000162853	ENST00000389063.2:c.804G>A	5.37:g.112337369G>A			Somatic				DCP2_uc011cwa.1_Silent_p.L57L|DCP2_uc010jcc.2_Silent_p.L174L	p.L268L	NM_152624	NP_689837	WXS	Illumina HiSeq	Unspecified	Q8IU60	DCP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)	7	1002	+		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)	268					C9J778|Q6P2D4|Q7Z5W5|Q8NBG5	Silent	SNP	ENST00000389063.2	37	c.804G>A	CCDS34210.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017083	0.35606	.	.	ENSG00000172795	ENST00000513585	.	.	.	5.79	4.89	0.63831	.	.	.	.	.	T	0.55369	0.1916	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54289	-0.8316	4	.	.	.	-16.5921	5.6417	0.17567	0.1733:0.0:0.6596:0.1672	.	.	.	.	K	250	.	.	E	+	1	0	DCP2	112365268	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	0.981000	0.29526	1.355000	0.45865	0.643000	0.83706	GAG		0.373	DCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370765.3	NM_152624		9	97	0	0	0	0.004482	0	9	97				
IRF1	3659	broad.mit.edu	37	5	131822793	131822793	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:131822793C>G	ENST00000245414.4	-	4	475	c.217G>C	c.(217-219)Gat>Cat	p.D73H	IRF1_ENST00000405885.2_Missense_Mutation_p.D73H|IRF1_ENST00000463784.1_5'UTR	NM_002198.2	NP_002189.1	P10914	IRF1_HUMAN	interferon regulatory factor 1	73					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell cycle arrest (GO:0007050)|cellular response to interferon-beta (GO:0035458)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000564)|regulation of cell cycle (GO:0051726)|regulation of innate immune response (GO:0045088)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D73H(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		GTCTTGGGATCTGGCTCCTTT	0.567																																							uc003kxa.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(217-219)GAT>CAT		interferon regulatory factor 1							398.0	369.0	379.0					5																	131822793		2203	4300	6503	SO:0001583	missense	3659				blood coagulation|cellular response to mechanical stimulus|interferon-gamma-mediated signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleoplasm		g.chr5:131822793C>G		CCDS4155.1	5q23-q31	2008-07-18			ENSG00000125347	ENSG00000125347			6116	protein-coding gene	gene with protein product	"""interferon regulatory factor-1"""	147575				2726461, 1680796	Standard	NM_002198		Approved	MAR	uc003kxa.2	P10914	OTTHUMG00000059497	ENST00000245414.4:c.217G>C	5.37:g.131822793C>G	ENSP00000245414:p.Asp73His		Somatic				IRF1_uc003kxd.2_RNA|IRF1_uc003kxb.2_Missense_Mutation_p.D73H|IRF1_uc010jdt.1_Missense_Mutation_p.D73H	p.D73H	NM_002198	NP_002189	WXS	Illumina HiSeq	Unspecified	P10914	IRF1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)	4	451	-		all_cancers(142;0.026)|Breast(839;0.198)	73			IRF tryptophan pentad repeat.		Q96GG7	Missense_Mutation	SNP	ENST00000245414.4	37	c.217G>C	CCDS4155.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353807	0.82243	.	.	ENSG00000125347	ENST00000245414;ENST00000405885;ENST00000437654;ENST00000458069	D;D;D;D	0.98234	-4.81;-4.81;-4.81;-4.81	5.7	5.7	0.88788	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.99190	0.9719	M	0.90198	3.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99429	1.0935	10	0.87932	D	0	-17.209	19.8314	0.96638	0.0:1.0:0.0:0.0	.	73;73	Q5FBX3;P10914	.;IRF1_HUMAN	H	73	ENSP00000245414:D73H;ENSP00000384406:D73H;ENSP00000405655:D73H;ENSP00000396318:D73H	ENSP00000245414:D73H	D	-	1	0	IRF1	131850692	1.000000	0.71417	0.992000	0.48379	0.968000	0.65278	7.814000	0.86154	2.675000	0.91044	0.655000	0.94253	GAT		0.567	IRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132340.1	NM_002198		5	324	0	0	0	0.000602	0	5	324				
MATR3	9782	broad.mit.edu	37	5	138661298	138661298	+	Missense_Mutation	SNP	A	A	G	rs368217486	byFrequency	TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:138661298A>G	ENST00000394805.3	+	13	2653	c.2318A>G	c.(2317-2319)tAt>tGt	p.Y773C	MATR3_ENST00000509990.1_Missense_Mutation_p.Y773C|MATR3_ENST00000503811.1_Missense_Mutation_p.Y485C|MATR3_ENST00000361059.2_Missense_Mutation_p.Y773C|MATR3_ENST00000510056.1_Missense_Mutation_p.Y773C|MATR3_ENST00000502929.1_Missense_Mutation_p.Y821C|MATR3_ENST00000504203.1_Missense_Mutation_p.Y435C|MATR3_ENST00000502499.1_Missense_Mutation_p.Y435C|MATR3_ENST00000394800.2_Missense_Mutation_p.Y821C	NM_001194955.1|NM_018834.5	NP_001181884.1|NP_061322.2	P43243	MATR3_HUMAN	matrin 3	773					cell death (GO:0008219)	membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)	p.Y773C(1)|p.Y209C(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AAGGACGACTATACAATCCCA	0.423																																							uc003ldu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2317-2319)TAT>TGT		matrin 3		A	CYS/TYR,CYS/TYR,CYS/TYR,CYS/TYR,CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	145.0	129.0	134.0		2318,2318,1454,2318,2318	2.5	1.0	5		134	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	MATR3	NM_199189.2,NM_018834.5,NM_001194956.1,NM_001194955.1,NM_001194954.1	194,194,194,194,194	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign,benign,benign,benign,benign	773/848,773/848,485/560,773/848,773/848	138661298	1,13005	2203	4300	6503	SO:0001583	missense	9782					nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding	g.chr5:138661298A>G	M63483	CCDS4210.1, CCDS54908.1, CCDS75316.1	5q31.3	2010-08-12			ENSG00000015479	ENSG00000015479			6912	protein-coding gene	gene with protein product		164015	"""myopathy, distal 2"""	MPD2		2033075, 19344878	Standard	NM_018834		Approved	KIAA0723, MGC9105, VCPDM	uc003ldx.3	P43243	OTTHUMG00000129229	ENST00000394805.3:c.2318A>G	5.37:g.138661298A>G	ENSP00000378284:p.Tyr773Cys		Somatic				MATR3_uc003ldt.2_Missense_Mutation_p.Y435C|MATR3_uc003ldw.2_Missense_Mutation_p.Y821C|MATR3_uc003ldx.2_Missense_Mutation_p.Y773C|MATR3_uc010jfc.2_Missense_Mutation_p.Y773C|MATR3_uc011czb.1_Missense_Mutation_p.Y485C|MATR3_uc003ldz.2_Missense_Mutation_p.Y773C|MATR3_uc003lea.2_Missense_Mutation_p.Y773C|MATR3_uc003leb.2_Missense_Mutation_p.Y435C|MATR3_uc003lec.2_Missense_Mutation_p.Y450C	p.Y773C	NM_199189	NP_954659	WXS	Illumina HiSeq	Unspecified	P43243	MATR3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		16	2745	+			773					B7ZAV5|D3DQC3|Q9UHW0|Q9UQ27	Missense_Mutation	SNP	ENST00000394805.3	37	c.2318A>G	CCDS4210.1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.535373	0.27475	2.27E-4	0.0	ENSG00000015479	ENST00000509990;ENST00000361059;ENST00000504203;ENST00000502929;ENST00000394800;ENST00000394805;ENST00000502499;ENST00000510056;ENST00000503811;ENST00000337359	T;T;T;T;T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.66;-0.66;-0.99;-0.99;-0.66;-0.08	3.74	2.53	0.30540	.	0.528179	0.19647	N	0.109315	T	0.51466	0.1676	N	0.14661	0.345	0.32709	N	0.511795	P;B;P;P;B	0.47762	0.9;0.191;0.9;0.833;0.191	B;B;B;B;B	0.40602	0.334;0.032;0.334;0.293;0.032	T	0.58781	-0.7576	10	0.39692	T	0.17	-5.9821	4.5036	0.11876	0.5885:0.2258:0.0:0.1857	.	485;773;485;821;773	B7ZAV5;D6REM6;B4DRS1;A8MXP9;P43243	.;.;.;.;MATR3_HUMAN	C	773;773;435;821;821;773;435;773;485;209	ENSP00000423533:Y773C;ENSP00000354346:Y773C;ENSP00000421218:Y435C;ENSP00000422319:Y821C;ENSP00000378279:Y821C;ENSP00000378284:Y773C;ENSP00000426030:Y435C;ENSP00000426743:Y773C;ENSP00000423587:Y485C	ENSP00000338208:Y209C	Y	+	2	0	MATR3	138689197	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.210000	0.32370	0.748000	0.32831	0.477000	0.44152	TAT		0.423	MATR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251324.2	NM_018834		6	73	0	0	0	0.001168	0	6	73				
PCDHB2	56133	broad.mit.edu	37	5	140476411	140476411	+	Silent	SNP	A	A	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:140476411A>C	ENST00000194155.4	+	1	2185	c.2037A>C	c.(2035-2037)gcA>gcC	p.A679A		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	679					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A679A(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGAGGCGGCACCGGCCCAGG	0.687																																							uc003lil.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(2035-2037)GCA>GCC		protocadherin beta 2 precursor							65.0	67.0	66.0					5																	140476411		2178	4247	6425	SO:0001819	synonymous_variant	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140476411A>C	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2037A>C	5.37:g.140476411A>C			Somatic				PCDHB2_uc003lim.1_Silent_p.A340A	p.A679A	NM_018936	NP_061759	WXS	Illumina HiSeq	Unspecified	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2175	+			679			Extracellular (Potential).		Q4KMU1	Silent	SNP	ENST00000194155.4	37	c.2037A>C	CCDS4244.1																																																																																				0.687	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		11	144	0	0	0	0.001368	0	11	144				
PCDHB4	56131	broad.mit.edu	37	5	140501869	140501869	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:140501869C>G	ENST00000194152.1	+	1	289	c.289C>G	c.(289-291)Cct>Gct	p.P97A	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P97A(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCTGTGGTCCTATTGAACC	0.483																																							uc003lip.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(289-291)CCT>GCT		protocadherin beta 4 precursor							58.0	63.0	62.0					5																	140501869		2203	4300	6503	SO:0001583	missense	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140501869C>G	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.289C>G	5.37:g.140501869C>G	ENSP00000194152:p.Pro97Ala		Somatic					p.P97A	NM_018938	NP_061761	WXS	Illumina HiSeq	Unspecified	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	289	+			97			Cadherin 1.|Extracellular (Potential).		Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	c.289C>G	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.915421	0.00503	.	.	ENSG00000081818	ENST00000194152	T	0.26067	1.76	4.66	-2.87	0.05700	Cadherin, N-terminal (1);	.	.	.	.	T	0.12135	0.0295	L	0.31476	0.935	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36720	-0.9736	9	0.12766	T	0.61	.	1.7864	0.03042	0.1098:0.3185:0.2157:0.356	.	97	Q9Y5E5	PCDB4_HUMAN	A	97	ENSP00000194152:P97A	ENSP00000194152:P97A	P	+	1	0	PCDHB4	140482053	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.101000	0.03336	-0.497000	0.06641	-0.175000	0.13238	CCT		0.483	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		20	58	0	0	0	0.00278	0	20	58				
PCDHGA4	56111	broad.mit.edu	37	5	140736874	140736874	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:140736874G>A	ENST00000571252.1	+	1	2107	c.2107G>A	c.(2107-2109)Gtc>Atc	p.V703I	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	703					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCTCCTGCGTCTTCCTGGC	0.607																																							uc003ljq.1		NA																	0					0						c.(2107-2109)GTC>ATC		protocadherin gamma subfamily A, 4 isoform 1							40.0	44.0	43.0					5																	140736874		2203	4300	6503	SO:0001583	missense	56111				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140736874G>A	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.2107G>A	5.37:g.140736874G>A	ENSP00000458570:p.Val703Ile		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGB2_uc003ljs.1_5'Flank|PCDHGA4_uc003ljp.1_Missense_Mutation_p.V703I|PCDHGB2_uc011dar.1_5'Flank	p.V703I	NM_018917	NP_061740	WXS	Illumina HiSeq	Unspecified	Q9Y5G9	PCDG4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2107	+			703			Helical; (Potential).		Q9Y5D3	Missense_Mutation	SNP	ENST00000571252.1	37	c.2107G>A	CCDS58979.1																																																																																				0.607	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917		12	20	0	0	0	0.003163	0	12	20				
PCDHGB2	56103	broad.mit.edu	37	5	140740398	140740398	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:140740398C>T	ENST00000522605.1	+	1	696	c.696C>T	c.(694-696)gtC>gtT	p.V232V	PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	232	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V232V(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAATCAAAGTCACGGATGCCA	0.552																																							uc003ljs.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(694-696)GTC>GTT		protocadherin gamma subfamily B, 2 isoform 1							89.0	89.0	89.0					5																	140740398		2047	4196	6243	SO:0001819	synonymous_variant	56103				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140740398C>T	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.696C>T	5.37:g.140740398C>T			Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc011dar.1_Silent_p.V232V	p.V232V	NM_018923	NP_061746	WXS	Illumina HiSeq	Unspecified	Q9Y5G2	PCDGE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	696	+			232			Extracellular (Potential).|Cadherin 2.		Q3MIJ3|Q9UN65	Silent	SNP	ENST00000522605.1	37	c.696C>T	CCDS54924.1																																																																																				0.552	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923		4	26	0	0	0	0.000248	0	4	26				
CCDC69	26112	broad.mit.edu	37	5	150584997	150584997	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:150584997C>G	ENST00000355417.2	-	2	262	c.88G>C	c.(88-90)Gag>Cag	p.E30Q	CCDC69_ENST00000521308.1_Intron	NM_015621.2	NP_056436.2	A6NI79	CCD69_HUMAN	coiled-coil domain containing 69	30								p.E30Q(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|stomach(1)	9		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCATGGGGCTCTGGTCTGGGT	0.552																																							uc003ltq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(88-90)GAG>CAG		coiled-coil domain containing 69							174.0	162.0	166.0					5																	150584997		2203	4300	6503	SO:0001583	missense	26112							g.chr5:150584997C>G		CCDS4312.1	5q33.1	2008-02-05			ENSG00000198624	ENSG00000198624			24487	protein-coding gene	gene with protein product						12477932	Standard	NM_015621		Approved	FLJ13705, DKFZP434C171	uc011dcq.3	A6NI79	OTTHUMG00000130127	ENST00000355417.2:c.88G>C	5.37:g.150584997C>G	ENSP00000347586:p.Glu30Gln		Somatic				CCDC69_uc010jhu.2_Intron|CCDC69_uc011dcq.1_RNA	p.E30Q	NM_015621	NP_056436	WXS	Illumina HiSeq	Unspecified	A6NI79	CCD69_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		2	211	-		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	30					A8K9X6	Missense_Mutation	SNP	ENST00000355417.2	37	c.88G>C	CCDS4312.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.880231	0.51801	.	.	ENSG00000198624	ENST00000355417	T	0.35048	1.33	4.32	3.44	0.39384	.	1.247230	0.05898	N	0.629557	T	0.27866	0.0686	L	0.27053	0.805	0.23720	N	0.997021	B	0.14805	0.011	B	0.14578	0.011	T	0.23226	-1.0194	10	0.19590	T	0.45	-4.1984	10.0813	0.42391	0.0:0.796:0.204:0.0	.	30	A6NI79	CCD69_HUMAN	Q	30	ENSP00000347586:E30Q	ENSP00000347586:E30Q	E	-	1	0	CCDC69	150565190	0.443000	0.25641	0.996000	0.52242	0.982000	0.71751	1.377000	0.34317	1.006000	0.39211	0.555000	0.69702	GAG		0.552	CCDC69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252435.1	NM_015621		5	139	0	0	0	0.000602	0	5	139				
TENM2	57451	broad.mit.edu	37	5	167673884	167673884	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr5:167673884C>T	ENST00000518659.1	+	27	5979	c.5940C>T	c.(5938-5940)atC>atT	p.I1980I	TENM2_ENST00000403607.2_Silent_p.I1804I|TENM2_ENST00000520394.1_Silent_p.I1741I|TENM2_ENST00000519204.1_Silent_p.I1859I|TENM2_ENST00000545108.1_Silent_p.I1979I	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1980					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.I1813I(1)|p.I1980I(1)|p.I1859I(1)									ACACCTCCATCGGCTACATCC	0.532																																							uc010jjd.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(6)|central_nervous_system(4)	10						c.(5911-5913)ATC>ATT		odz, odd Oz/ten-m homolog 2							117.0	125.0	122.0					5																	167673884		2103	4231	6334	SO:0001819	synonymous_variant	57451							g.chr5:167673884C>T	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5940C>T	5.37:g.167673884C>T			Somatic				ODZ2_uc003lzr.3_Silent_p.I1741I|ODZ2_uc003lzt.3_Silent_p.I1344I|ODZ2_uc010jje.2_Silent_p.I1235I	p.I1971I	NM_001122679	NP_001116151	WXS	Illumina HiSeq	Unspecified			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	27	5913	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Silent	SNP	ENST00000518659.1	37	c.5913C>T																																																																																					0.532	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		32	110	0	0	0	0.001786	0	32	110				
OR2H2	7932	broad.mit.edu	37	6	29556336	29556336	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:29556336G>C	ENST00000383640.2	+	1	654	c.615G>C	c.(613-615)ttG>ttC	p.L205F	GABBR1_ENST00000355973.3_Intron	NM_007160.3	NP_009091.3	O95918	OR2H2_HUMAN	olfactory receptor, family 2, subfamily H, member 2	205					defense response (GO:0006952)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|mating (GO:0007618)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L205F(1)		central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	14						TCTTCATCTTGGTTGTGCCTC	0.507																																							uc003nmr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(613-615)TTG>TTC		olfactory receptor, family 2, subfamily H,							159.0	138.0	146.0					6																	29556336		1511	2708	4219	SO:0001583	missense	7932				defense response|mating|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29556336G>C		CCDS34365.1	6p22.2-p21.31	2012-08-09				ENSG00000204657		"""GPCR / Class A : Olfactory receptors"""	8253	protein-coding gene	gene with protein product		600578					Standard	XM_005249407		Approved	hs6M1-12	uc003nmr.1	O95918		ENST00000383640.2:c.615G>C	6.37:g.29556336G>C	ENSP00000373136:p.Leu205Phe		Somatic				GABBR1_uc003nmp.3_Intron	p.L205F	NM_007160	NP_009091	WXS	Illumina HiSeq	Unspecified	O95918	OR2H2_HUMAN			1	654	+			205			Helical; Name=5; (Potential).		Q15062|Q2M1Y3|Q5STL8|Q5SUK1|Q6IFN7|Q6NTB7|Q96R14	Missense_Mutation	SNP	ENST00000383640.2	37	c.615G>C	CCDS34365.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.802387	0.31869	.	.	ENSG00000204657	ENST00000383640	T	0.30714	1.52	4.24	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.249234	0.21168	N	0.079036	T	0.13628	0.0330	L	0.53780	1.695	0.30571	N	0.763539	B	0.29590	0.25	B	0.31614	0.133	T	0.09707	-1.0662	10	0.87932	D	0	.	7.0824	0.25239	0.0968:0.1745:0.7287:0.0	.	205	O95918	OR2H2_HUMAN	F	205	ENSP00000373136:L205F	ENSP00000373136:L205F	L	+	3	2	OR2H2	29664315	0.000000	0.05858	0.411000	0.26484	0.982000	0.71751	-0.299000	0.08254	0.995000	0.38917	0.585000	0.79938	TTG		0.507	OR2H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076057.2			13	121	0	0	0	0.001855	0	13	121				
EYS	346007	broad.mit.edu	37	6	66204732	66204732	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:66204732C>A	ENST00000370621.3	-	4	1098	c.572G>T	c.(571-573)aGt>aTt	p.S191I	EYS_ENST00000370616.2_Missense_Mutation_p.S191I|EYS_ENST00000393380.2_Missense_Mutation_p.S191I|EYS_ENST00000342421.5_Missense_Mutation_p.S191I|EYS_ENST00000370618.3_Missense_Mutation_p.S191I|EYS_ENST00000503581.1_Missense_Mutation_p.S191I			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	191	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.S191I(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CCAAGCTTCACTAAGACATTT	0.423																																							uc011dxu.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(4)|ovary(1)|skin(1)	6						c.(571-573)AGT>ATT		eyes shut homolog isoform 1							57.0	53.0	54.0					6																	66204732		2203	4300	6503	SO:0001583	missense	346007				response to stimulus|visual perception	extracellular region	calcium ion binding	g.chr6:66204732C>A		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.572G>T	6.37:g.66204732C>A	ENSP00000359655:p.Ser191Ile		Somatic				EYS_uc003peq.2_Missense_Mutation_p.S191I|EYS_uc003per.1_Missense_Mutation_p.S191I|EYS_uc010kaj.1_RNA	p.S191I	NM_001142800	NP_001136272	WXS	Illumina HiSeq	Unspecified	Q5T1H1	EYS_HUMAN			4	1110	-			191			EGF-like 1.		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37	c.572G>T		.	.	.	.	.	.	.	.	.	.	C	9.596	1.127451	0.20959	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26;-2.26;-2.26	4.81	-0.338	0.12651	.	.	.	.	.	T	0.55146	0.1902	N	0.14661	0.345	0.09310	N	1	B;B;P	0.39216	0.102;0.356;0.664	B;B;B	0.37550	0.08;0.164;0.253	T	0.55082	-0.8196	9	0.72032	D	0.01	.	2.378	0.04346	0.1299:0.3831:0.3137:0.1733	.	191;191;191	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	I	191	ENSP00000424243:S191I;ENSP00000359655:S191I;ENSP00000359650:S191I;ENSP00000377042:S191I;ENSP00000341818:S191I;ENSP00000359652:S191I	ENSP00000341818:S191I	S	-	2	0	EYS	66261453	0.007000	0.16637	0.001000	0.08648	0.627000	0.37826	0.723000	0.25939	-0.345000	0.08325	0.591000	0.81541	AGT		0.423	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050		7	28	1	0	0.00198382	0.001984	0.00294593	7	28				
COL9A1	1297	broad.mit.edu	37	6	70944631	70944631	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:70944631C>G	ENST00000357250.6	-	34	2283	c.2125G>C	c.(2125-2127)Ggg>Cgg	p.G709R	COL9A1_ENST00000489611.1_5'UTR|RP1-149L1.1_ENST00000522264.1_RNA|COL9A1_ENST00000370499.4_Missense_Mutation_p.G466R|COL9A1_ENST00000320755.7_Missense_Mutation_p.G466R	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	709	Collagen-like 7.|Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.G466R(1)|p.G709R(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CCAGGTTCCCCAGGATTACCT	0.522																																							uc003pfg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(2125-2127)GGG>CGG		alpha 1 type IX collagen isoform 1 precursor							40.0	42.0	41.0					6																	70944631		2203	4300	6503	SO:0001583	missense	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:70944631C>G		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.2125G>C	6.37:g.70944631C>G	ENSP00000349790:p.Gly709Arg		Somatic				COL9A1_uc003pfe.3_Missense_Mutation_p.G258R|COL9A1_uc003pff.3_Missense_Mutation_p.G466R	p.G709R	NM_001851	NP_001842	WXS	Illumina HiSeq	Unspecified	P20849	CO9A1_HUMAN			34	2284	-			709			Triple-helical region (COL2).		Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	c.2125G>C	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409769	0.62399	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.99353	-5.77;-5.77;-5.77	5.74	5.74	0.90152	.	0.050671	0.85682	D	0.000000	D	0.99654	0.9872	H	0.94345	3.525	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.957	D;D;P	0.81914	0.995;0.957;0.862	D	0.97985	1.0351	10	0.87932	D	0	.	19.9077	0.97014	0.0:1.0:0.0:0.0	.	709;466;258	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	R	709;466;466	ENSP00000349790:G709R;ENSP00000315252:G466R;ENSP00000359530:G466R	ENSP00000315252:G466R	G	-	1	0	COL9A1	71001352	1.000000	0.71417	0.998000	0.56505	0.546000	0.35178	7.563000	0.82314	2.714000	0.92807	0.585000	0.79938	GGG		0.522	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			8	29	0	0	0	0.006214	0	8	29				
ELOVL4	6785	broad.mit.edu	37	6	80636031	80636031	+	Nonsense_Mutation	SNP	A	A	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:80636031A>C	ENST00000369816.4	-	2	468	c.168T>G	c.(166-168)taT>taG	p.Y56*		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	56					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)	p.Y56*(1)		central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	CAAACAGGAGATAAAGAGTGC	0.398																																							uc003pja.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(166-168)TAT>TAG		elongation of very long chain fatty acids-like	Alpha-Linolenic Acid(DB00132)						83.0	72.0	76.0					6																	80636031		2203	4300	6503	SO:0001587	stop_gained	6785				fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	G-protein coupled photoreceptor activity|protein binding|transferase activity, transferring acyl groups other than amino-acyl groups	g.chr6:80636031A>C	AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.168T>G	6.37:g.80636031A>C	ENSP00000358831:p.Tyr56*		Somatic				ELOVL4_uc011dyt.1_Intron	p.Y56*	NM_022726	NP_073563	WXS	Illumina HiSeq	Unspecified	Q9GZR5	ELOV4_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0168)	2	487	-		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)	56			Helical; (Potential).		B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Nonsense_Mutation	SNP	ENST00000369816.4	37	c.168T>G	CCDS4992.1	.	.	.	.	.	.	.	.	.	.	A	37	6.316789	0.97467	.	.	ENSG00000118402	ENST00000369816	.	.	.	5.7	-0.781	0.10965	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.0638	9.6873	0.40107	0.6337:0.0:0.3663:0.0	.	.	.	.	X	56	.	ENSP00000358831:Y56X	Y	-	3	2	ELOVL4	80692750	0.999000	0.42202	0.949000	0.38748	0.908000	0.53690	0.642000	0.24735	-0.360000	0.08138	0.454000	0.30748	TAT		0.398	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041315.1			4	40	0	0	0	0.000248	0	4	40				
CASP8AP2	9994	broad.mit.edu	37	6	90578701	90578701	+	RNA	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:90578701C>G	ENST00000551025.1	+	0	7129									caspase 8 associated protein 2									p.P1898A(1)		NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		AAAGGCAACCCCAGGGATTAA	0.398																																					Colon(187;1656 2025 17045 31481 39901)	Colon(187;1656 2025 17045 31481 39901)	uc003pnr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(5692-5694)CCA>GCA		caspase 8 associated protein 2							38.0	36.0	36.0					6																	90578701		1843	4091	5934			9994				cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity	g.chr6:90578701C>G	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90578701C>G			Somatic				CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.P1898A|CASP8AP2_uc011dzz.1_Missense_Mutation_p.P1898A	p.P1898A	NM_001137667	NP_001131139	WXS	Illumina HiSeq	Unspecified	Q9UKL3	C8AP2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0953)	8	5888	+		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)	1898			NCOA2-binding.			Missense_Mutation	SNP	ENST00000551025.1	37	c.5692C>G																																																																																					0.398	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667		4	18	0	0	0	0.000248	0	4	18				
FHL5	9457	broad.mit.edu	37	6	97053872	97053872	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:97053872C>T	ENST00000326771.2	+	5	809	c.429C>T	c.(427-429)atC>atT	p.I143I	FHL5_ENST00000541107.1_Silent_p.I143I	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	143	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.I143I(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		AGCCTTTGATCTCCAAAGAGA	0.413																																							uc003pos.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(427-429)ATC>ATT		activator of cAMP-responsive element modulator							111.0	100.0	103.0					6																	97053872		2203	4300	6503	SO:0001819	synonymous_variant	9457					nucleus	zinc ion binding	g.chr6:97053872C>T	AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.429C>T	6.37:g.97053872C>T			Somatic				FHL5_uc003pot.1_Silent_p.I143I	p.I143I	NM_020482	NP_065228	WXS	Illumina HiSeq	Unspecified	Q5TD97	FHL5_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0948)	5	834	+		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)	143			LIM zinc-binding 2.		B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Silent	SNP	ENST00000326771.2	37	c.429C>T	CCDS5035.1																																																																																				0.413	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482		5	68	0	0	0	0.000602	0	5	68				
ROS1	6098	broad.mit.edu	37	6	117647511	117647511	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:117647511G>A	ENST00000368508.3	-	33	5631	c.5433C>T	c.(5431-5433)tgC>tgT	p.C1811C	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Silent_p.C1805C	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1811	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.C1811C(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AAACACTACTGCAGGATCCAT	0.333			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		uc003pxp.1		NA		Dom	yes		6	6q22	6098	T	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)			"""O, E"""	GOPC|ROS1		glioblastoma|NSCLC		2	Substitution - coding silent(2)		lung(2)	lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25						c.(5431-5433)TGC>TGT		proto-oncogene c-ros-1 protein precursor							109.0	105.0	106.0					6																	117647511		2202	4299	6501	SO:0001819	synonymous_variant	6098				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr6:117647511G>A	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.5433C>T	6.37:g.117647511G>A			Somatic				ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	p.C1811C	NM_002944	NP_002935	WXS	Illumina HiSeq	Unspecified	P08922	ROS_HUMAN		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)	33	5632	-		all_cancers(87;0.00846)|all_epithelial(87;0.0242)	1811			Fibronectin type-III 9.|Extracellular (Potential).		Q15368|Q5TDB5	Silent	SNP	ENST00000368508.3	37	c.5433C>T	CCDS5116.1																																																																																				0.333	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1			7	47	0	0	0	0.00308	0	7	47				
NKAIN2	154215	broad.mit.edu	37	6	125139557	125139557	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:125139557C>G	ENST00000368417.1	+	6	620	c.560C>G	c.(559-561)tCt>tGt	p.S187C	NKAIN2_ENST00000546092.1_Missense_Mutation_p.S120C|NKAIN2_ENST00000545433.1_Missense_Mutation_p.S172C	NM_001040214.1	NP_001035304.1	Q5VXU1	NKAI2_HUMAN	Na+/K+ transporting ATPase interacting 2	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S187C(1)		cervix(1)|endometrium(1)|large_intestine(3)|lung(12)|skin(2)	19				GBM - Glioblastoma multiforme(226;0.104)		GGCTTTGACTCTTATGGCTAT	0.378																																							uc003pzo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(559-561)TCT>TGT		T-cell lymphoma breakpoint-associated target 1							136.0	129.0	131.0					6																	125139557		2203	4300	6503	SO:0001583	missense	154215					integral to membrane|plasma membrane		g.chr6:125139557C>G	AB070452	CCDS34526.1	6q21	2008-02-05	2007-10-04	2007-10-04	ENSG00000188580	ENSG00000188580		"""Na+/K+ transporting ATPase interacting"""	16443	protein-coding gene	gene with protein product		609758	"""T-cell lymphoma breakpoint associated target 1"""	TCBA1		17606467	Standard	XM_005266833		Approved	FAM77B	uc003pzo.3	Q5VXU1	OTTHUMG00000015500	ENST00000368417.1:c.560C>G	6.37:g.125139557C>G	ENSP00000357402:p.Ser187Cys		Somatic				NKAIN2_uc003pzp.2_Missense_Mutation_p.S186C|NKAIN2_uc010keq.2_Missense_Mutation_p.S120C|NKAIN2_uc010ker.2_Missense_Mutation_p.S97C	p.S187C	NM_001040214	NP_001035304	WXS	Illumina HiSeq	Unspecified	Q5VXU1	NKAI2_HUMAN		GBM - Glioblastoma multiforme(226;0.104)	6	837	+			187					Q8IYR4|Q8TF67	Missense_Mutation	SNP	ENST00000368417.1	37	c.560C>G	CCDS34526.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966616	0.92855	.	.	ENSG00000188580	ENST00000368417;ENST00000546092;ENST00000539866;ENST00000545433	T;T;T	0.36157	2.31;1.27;2.32	6.17	6.17	0.99709	.	0.151558	0.43919	D	0.000501	T	0.59418	0.2192	M	0.78637	2.42	0.58432	D	0.999998	D;D;D;D	0.76494	0.997;0.999;0.999;0.999	D;D;D;D	0.81914	0.993;0.992;0.992;0.995	T	0.58657	-0.7598	10	0.62326	D	0.03	-11.9828	20.8794	0.99867	0.0:1.0:0.0:0.0	.	172;120;186;187	B3KNZ0;F5GY48;Q5VXU1-3;Q5VXU1	.;.;.;NKAI2_HUMAN	C	187;120;186;172	ENSP00000357402:S187C;ENSP00000440287:S120C;ENSP00000437798:S172C	ENSP00000357402:S187C	S	+	2	0	NKAIN2	125181256	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.433000	0.80362	2.941000	0.99782	0.655000	0.94253	TCT		0.378	NKAIN2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042057.1	NM_001040214		11	65	0	0	0	0.00245	0	11	65				
ENPP3	5169	broad.mit.edu	37	6	131973770	131973770	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:131973770G>A	ENST00000414305.1	+	5	694	c.366G>A	c.(364-366)agG>agA	p.R122R	ENPP3_ENST00000358229.5_Silent_p.R122R|ENPP3_ENST00000427148.2_Silent_p.R88R|ENPP3_ENST00000543135.1_Silent_p.R88R|ENPP3_ENST00000470930.1_3'UTR|ENPP3_ENST00000357639.3_Silent_p.R122R			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	122	SMB 2. {ECO:0000255|PROSITE- ProRule:PRU00350}.			R -> K (in Ref. 1; AAC51813). {ECO:0000305}.	immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.R122R(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		GTTTGCAGAGGAAAGATTGCT	0.448																																							uc003qcu.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(364-366)AGG>AGA		ectonucleotide pyrophosphatase/phosphodiesterase							174.0	157.0	162.0					6																	131973770		2203	4300	6503	SO:0001819	synonymous_variant	5169				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity	g.chr6:131973770G>A	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.366G>A	6.37:g.131973770G>A			Somatic				ENPP3_uc010kfn.1_RNA|ENPP3_uc011ecc.1_Silent_p.R88R|ENPP3_uc010kfo.1_RNA|ENPP3_uc010kfp.1_RNA|ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Silent_p.R122R	p.R122R	NM_005021	NP_005012	WXS	Illumina HiSeq	Unspecified	O14638	ENPP3_HUMAN		GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)	5	713	+	Breast(56;0.0753)		122	R -> K (in Ref. 1; AAC51813).		Extracellular (Potential).|SMB 2.		Q5JTL3	Silent	SNP	ENST00000414305.1	37	c.366G>A	CCDS5148.1																																																																																				0.448	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2			10	82	0	0	0	0.001368	0	10	82				
ENPP3	5169	broad.mit.edu	37	6	131973774	131973774	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:131973774G>A	ENST00000414305.1	+	5	698	c.370G>A	c.(370-372)Gat>Aat	p.D124N	ENPP3_ENST00000358229.5_Missense_Mutation_p.D124N|ENPP3_ENST00000427148.2_Missense_Mutation_p.D90N|ENPP3_ENST00000543135.1_Missense_Mutation_p.D90N|ENPP3_ENST00000470930.1_3'UTR|ENPP3_ENST00000357639.3_Missense_Mutation_p.D124N			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	124	SMB 2. {ECO:0000255|PROSITE- ProRule:PRU00350}.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.D124N(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		GCAGAGGAAAGATTGCTGTGC	0.453																																							uc003qcu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(370-372)GAT>AAT		ectonucleotide pyrophosphatase/phosphodiesterase							175.0	157.0	163.0					6																	131973774		2203	4300	6503	SO:0001583	missense	5169				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity	g.chr6:131973774G>A	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.370G>A	6.37:g.131973774G>A	ENSP00000406261:p.Asp124Asn		Somatic				ENPP3_uc010kfn.1_RNA|ENPP3_uc011ecc.1_Missense_Mutation_p.D90N|ENPP3_uc010kfo.1_RNA|ENPP3_uc010kfp.1_RNA|ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Missense_Mutation_p.D124N	p.D124N	NM_005021	NP_005012	WXS	Illumina HiSeq	Unspecified	O14638	ENPP3_HUMAN		GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)	5	717	+	Breast(56;0.0753)		124			Extracellular (Potential).|SMB 2.		Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	37	c.370G>A	CCDS5148.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.761707	0.89932	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000543135;ENST00000427148;ENST00000358229	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	5.42	5.42	0.78866	Somatomedin B domain (4);	0.000000	0.64402	D	0.000002	T	0.58722	0.2142	M	0.70903	2.155	0.46149	D	0.998891	D	0.63880	0.993	D	0.63381	0.914	T	0.60224	-0.7305	10	0.51188	T	0.08	-21.4773	16.1301	0.81422	0.0:0.0:1.0:0.0	.	124	O14638	ENPP3_HUMAN	N	124;124;90;90;124	ENSP00000406261:D124N;ENSP00000350265:D124N;ENSP00000440810:D90N;ENSP00000399269:D90N;ENSP00000350964:D124N	ENSP00000350265:D124N	D	+	1	0	ENPP3	132015467	1.000000	0.71417	0.958000	0.39756	0.966000	0.64601	4.968000	0.63728	2.545000	0.85829	0.655000	0.94253	GAT		0.453	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2			10	82	0	0	0	0.000978	0	10	82				
UTRN	7402	broad.mit.edu	37	6	145156988	145156988	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:145156988G>C	ENST00000367545.3	+	69	9738	c.9738G>C	c.(9736-9738)caG>caC	p.Q3246H	UTRN_ENST00000367526.4_Missense_Mutation_p.Q801H	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	3246					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.Q3246H(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GCCAGCCGCAGAGCCCAGCTC	0.552																																							uc003qkt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(9736-9738)CAG>CAC		utrophin							118.0	120.0	119.0					6																	145156988		2203	4300	6503	SO:0001583	missense	7402				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding	g.chr6:145156988G>C	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.9738G>C	6.37:g.145156988G>C	ENSP00000356515:p.Gln3246His		Somatic					p.Q3246H	NM_007124	NP_009055	WXS	Illumina HiSeq	Unspecified	P46939	UTRO_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)	69	9830	+		Ovarian(120;0.218)	3246					Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	c.9738G>C	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658602	0.67586	.	.	ENSG00000152818	ENST00000367545;ENST00000367526;ENST00000455022	D;D;D	0.82984	-1.67;-1.67;-1.67	5.9	2.14	0.27477	.	0.000000	0.49916	D	0.000139	T	0.80144	0.4569	L	0.55103	1.725	0.36087	D	0.843203	P	0.52692	0.955	P	0.55011	0.766	T	0.80576	-0.1321	10	0.56958	D	0.05	.	13.5308	0.61621	0.2316:0.0:0.7684:0.0	.	3246	P46939	UTRO_HUMAN	H	3246;801;158	ENSP00000356515:Q3246H;ENSP00000356496:Q801H;ENSP00000387927:Q158H	ENSP00000356496:Q801H	Q	+	3	2	UTRN	145198681	1.000000	0.71417	0.996000	0.52242	0.916000	0.54674	3.499000	0.53310	0.138000	0.18790	-0.813000	0.03139	CAG		0.552	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1			9	117	0	0	0	0.004482	0	9	117				
C6orf211	79624	broad.mit.edu	37	6	151789867	151789867	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr6:151789867G>A	ENST00000367294.3	+	5	1207	c.948G>A	c.(946-948)ggG>ggA	p.G316G	C6orf211_ENST00000545879.1_Silent_p.G197G	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	316								p.G316G(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		CCAAGTGTGGGGCTGACTGGG	0.373																																							uc003qok.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(946-948)GGG>GGA		hypothetical protein LOC79624							85.0	88.0	87.0					6																	151789867		2203	4300	6503	SO:0001819	synonymous_variant	79624						protein binding	g.chr6:151789867G>A	AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.948G>A	6.37:g.151789867G>A			Somatic				C6orf211_uc011ees.1_Silent_p.G197G	p.G316G	NM_024573	NP_078849	WXS	Illumina HiSeq	Unspecified	Q9H993	CF211_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)	5	1207	+			316					Q96FC6|Q9UFY5	Silent	SNP	ENST00000367294.3	37	c.948G>A	CCDS5233.1																																																																																				0.373	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042724.1	NM_024573		9	76	0	0	0	0.006214	0	9	76				
TTYH3	80727	broad.mit.edu	37	7	2697955	2697955	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:2697955C>T	ENST00000258796.7	+	12	1491	c.1286C>T	c.(1285-1287)cCa>cTa	p.P429L	TTYH3_ENST00000407643.1_Missense_Mutation_p.P397L|TTYH3_ENST00000403167.1_Missense_Mutation_p.P258L	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	429					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)	p.P429L(1)		kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		GAGGCCGCTCCAGGGCCGCGG	0.697																																							uc003smp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1285-1287)CCA>CTA		tweety 3							14.0	13.0	13.0					7																	2697955		2169	4263	6432	SO:0001583	missense	80727					chloride channel complex|plasma membrane	chloride channel activity	g.chr7:2697955C>T		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.1286C>T	7.37:g.2697955C>T	ENSP00000258796:p.Pro429Leu		Somatic				TTYH3_uc010ksn.2_Missense_Mutation_p.P149L|TTYH3_uc003smq.2_Missense_Mutation_p.P258L	p.P429L	NM_025250	NP_079526	WXS	Illumina HiSeq	Unspecified	Q9C0H2	TTYH3_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)	12	1473	+		Ovarian(82;0.0112)	429			Cytoplasmic (Potential).		A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Missense_Mutation	SNP	ENST00000258796.7	37	c.1286C>T	CCDS34588.1	.	.	.	.	.	.	.	.	.	.	C	8.905	0.957336	0.18507	.	.	ENSG00000136295	ENST00000258796;ENST00000407643;ENST00000403167;ENST00000429448	T;T;T;T	0.24538	2.87;2.84;2.42;1.85	3.94	2.96	0.34315	.	0.193593	0.44688	U	0.000430	T	0.12263	0.0298	N	0.08118	0	0.54753	D	0.999986	B;B	0.15930	0.004;0.015	B;B	0.18561	0.004;0.022	T	0.10683	-1.0619	10	0.20519	T	0.43	.	11.2618	0.49087	0.2831:0.7169:0.0:0.0	.	258;429	Q9C0H2-3;Q9C0H2	.;TTYH3_HUMAN	L	429;397;258;89	ENSP00000258796:P429L;ENSP00000385316:P397L;ENSP00000385015:P258L;ENSP00000413757:P89L	ENSP00000258796:P429L	P	+	2	0	TTYH3	2664481	0.109000	0.22037	0.418000	0.26571	0.407000	0.30961	0.942000	0.29017	1.909000	0.55274	0.448000	0.29417	CCA		0.697	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325082.2	XM_166523		3	26	0	0	0	0.004672	0	3	26				
SDK1	221935	broad.mit.edu	37	7	4273011	4273011	+	Silent	SNP	G	G	A	rs202174587		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:4273011G>A	ENST00000404826.2	+	41	6091	c.5952G>A	c.(5950-5952)gcG>gcA	p.A1984A	SDK1_ENST00000466611.1_3'UTR|SDK1_ENST00000389531.3_Silent_p.A1964A	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1984	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A1984A(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TGAATGAGGCGGGCTACGGGG	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		16632	0.0		0.0	False		,,,				2504	0.001						uc003smx.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(3)|ovary(2)|skin(1)	6						c.(5950-5952)GCG>GCA		sidekick 1 precursor																																				SO:0001819	synonymous_variant	221935				cell adhesion	integral to membrane		g.chr7:4273011G>A	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5952G>A	7.37:g.4273011G>A			Somatic				SDK1_uc010kso.2_Silent_p.A1240A|SDK1_uc003smy.2_Silent_p.A471A|SDK1_uc003smz.2_Silent_p.A44A	p.A1984A	NM_152744	NP_689957	WXS	Illumina HiSeq	Unspecified	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	41	6091	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	1984			Fibronectin type-III 13.		Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	c.5952G>A	CCDS34590.1																																																																																				0.617	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		8	108	0	0	0	0.004482	0	8	108				
GLCCI1	113263	broad.mit.edu	37	7	8062112	8062112	+	Splice_Site	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:8062112G>A	ENST00000223145.5	+	3	1166		c.e3-1		GLCCI1_ENST00000474269.1_Splice_Site	NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1							cytoplasm (GO:0005737)		p.?(1)		endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		attttttaaaGACACCTAGCT	0.348																																							uc003srk.2		NA																	1	Unknown(1)		lung(1)		0						c.e3-1		glucocorticoid induced transcript 1							54.0	52.0	53.0					7																	8062112		2203	4300	6503	SO:0001630	splice_region_variant	113263							g.chr7:8062112G>A	BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.610-1G>A	7.37:g.8062112G>A			Somatic					p.T204_splice	NM_138426	NP_612435	WXS	Illumina HiSeq	Unspecified	Q86VQ1	GLCI1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)	3	1169	+		Ovarian(82;0.0608)						A4D103|Q96FD0	Splice_Site	SNP	ENST00000223145.5	37	c.610_splice	CCDS34601.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.181429	0.57800	.	.	ENSG00000106415	ENST00000223145;ENST00000430798	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5927	0.76550	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GLCCI1	8028637	1.000000	0.71417	0.999000	0.59377	0.772000	0.43724	6.024000	0.70857	2.734000	0.93682	0.650000	0.86243	.		0.348	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324672.1	NM_138426	Intron	4	43	0	0	0	0.000602	0	4	43				
BZW2	28969	broad.mit.edu	37	7	16736596	16736596	+	Silent	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:16736596G>A	ENST00000433922.2	+	9	1057	c.879G>A	c.(877-879)gtG>gtA	p.V293V	BZW2_ENST00000258761.3_Silent_p.V293V|BZW2_ENST00000452975.2_3'UTR|BZW2_ENST00000405202.1_Silent_p.V217V|BZW2_ENST00000432311.1_3'UTR|AC073333.8_ENST00000418907.1_RNA|BZW2_ENST00000407633.1_Silent_p.V99V	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	293	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)		p.V293V(1)		cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		AAACAGCAGTGATTGGTCTTC	0.443																																							uc003stl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(877-879)GTG>GTA		basic leucine zipper and W2 domains 2							157.0	146.0	150.0					7																	16736596		2203	4300	6503	SO:0001819	synonymous_variant	28969				cell differentiation|nervous system development|RNA metabolic process		protein binding	g.chr7:16736596G>A	AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.879G>A	7.37:g.16736596G>A			Somatic				BZW2_uc011jxx.1_Silent_p.V99V|BZW2_uc003stm.2_Silent_p.V99V|BZW2_uc003stj.2_Silent_p.V293V|BZW2_uc003stk.2_Silent_p.V217V|BZW2_uc003sto.1_Silent_p.V141V|BZW2_uc003stp.2_Silent_p.V141V|BZW2_uc010kua.2_Silent_p.V293V	p.V293V	NM_001159767	NP_001153239	WXS	Illumina HiSeq	Unspecified	Q9Y6E2	BZW2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.199)	9	1057	+	Lung NSC(10;0.0367)|all_lung(11;0.0837)		293			W2.		A4D123|Q3B779|Q96JW5|Q9H3F7	Silent	SNP	ENST00000433922.2	37	c.879G>A	CCDS5362.1																																																																																				0.443	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253256.2	NM_014038		4	84	0	0	0	0.000248	0	4	84				
AGR2	10551	broad.mit.edu	37	7	16841359	16841359	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:16841359C>G	ENST00000419304.2	-	2	214	c.62G>C	c.(61-63)aGa>aCa	p.R21T	AGR2_ENST00000419572.2_Missense_Mutation_p.R41T|AGR2_ENST00000486219.1_5'Flank|AGR2_ENST00000401412.1_Missense_Mutation_p.R21T	NM_006408.3	NP_006399.1	O95994	AGR2_HUMAN	anterior gradient 2	21					lung goblet cell differentiation (GO:0060480)|mucus secretion (GO:0070254)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	dystroglycan binding (GO:0002162)	p.R21T(1)		endometrium(2)|lung(1)|prostate(1)|skin(2)	6	Lung NSC(10;0.0376)|all_lung(11;0.0855)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		TGTGGTATCTCTGGCCAGAGT	0.498																																							uc003str.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(61-63)AGA>ACA		anterior gradient 2 homolog precursor							191.0	180.0	184.0					7																	16841359		2203	4300	6503	SO:0001583	missense	10551				mucus secretion	endoplasmic reticulum|extracellular region	protein binding	g.chr7:16841359C>G	AF038451	CCDS5364.1	7p21.3	2013-07-31	2013-07-31		ENSG00000106541	ENSG00000106541		"""Protein disulfide isomerases"""	328	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 17"""	606358	"""anterior gradient 2 homolog (Xenopus laevis)"""			9790916	Standard	NM_006408		Approved	XAG-2, HAG-2, AG2, PDIA17	uc003str.3	O95994	OTTHUMG00000023446	ENST00000419304.2:c.62G>C	7.37:g.16841359C>G	ENSP00000391490:p.Arg21Thr		Somatic				AGR2_uc011jxy.1_Missense_Mutation_p.R21T	p.R21T	NM_006408	NP_006399	WXS	Illumina HiSeq	Unspecified	O95994	AGR2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.184)	2	249	-	Lung NSC(10;0.0376)|all_lung(11;0.0855)		21						Missense_Mutation	SNP	ENST00000419304.2	37	c.62G>C	CCDS5364.1	.	.	.	.	.	.	.	.	.	.	C	15.43	2.830712	0.50845	.	.	ENSG00000106541	ENST00000419304;ENST00000419572;ENST00000401412;ENST00000412973	.	.	.	5.67	4.45	0.53987	.	0.046502	0.85682	D	0.000000	T	0.17280	0.0415	N	0.03608	-0.345	0.23468	N	0.99762	B;B	0.26708	0.157;0.0	B;B	0.24155	0.051;0.0	T	0.16364	-1.0405	9	0.66056	D	0.02	-17.8157	9.9079	0.41388	0.0:0.0788:0.0:0.9212	.	21;21	B4DKU8;O95994	.;AGR2_HUMAN	T	21;41;21;21	.	ENSP00000386025:R21T	R	-	2	0	AGR2	16807884	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.662000	0.54510	0.975000	0.38392	-0.290000	0.09829	AGA		0.498	AGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207594.2	NM_006408		17	68	0	0	0	0.006122	0	17	68				
CREB5	9586	broad.mit.edu	37	7	28858876	28858876	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:28858876G>T	ENST00000357727.2	+	11	1897	c.1507G>T	c.(1507-1509)Gac>Tac	p.D503Y	CREB5_ENST00000396300.2_Missense_Mutation_p.D496Y|CREB5_ENST00000409603.1_Missense_Mutation_p.D470Y|CREB5_ENST00000396298.2_Missense_Mutation_p.D364Y|CREB5_ENST00000396299.2_Missense_Mutation_p.D470Y	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	503					adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D503Y(1)|p.D364Y(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						TCACAGAACAGACCTGAATCC	0.478																																							uc003szq.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)	2						c.(1507-1509)GAC>TAC		cAMP responsive element binding protein 5							157.0	157.0	157.0					7																	28858876		2203	4300	6503	SO:0001583	missense	9586				positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:28858876G>T	L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.1507G>T	7.37:g.28858876G>T	ENSP00000350359:p.Asp503Tyr		Somatic				CREB5_uc003szo.2_Missense_Mutation_p.D470Y|CREB5_uc003szr.2_Missense_Mutation_p.D496Y|CREB5_uc003szs.2_Missense_Mutation_p.D364Y	p.D503Y	NM_182898	NP_878901	WXS	Illumina HiSeq	Unspecified	Q02930	CREB5_HUMAN			11	1897	+			503					A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Missense_Mutation	SNP	ENST00000357727.2	37	c.1507G>T	CCDS5417.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427649	0.62733	.	.	ENSG00000146592	ENST00000396299;ENST00000357727;ENST00000396300;ENST00000409603;ENST00000396298	T;T;T;T;T	0.69926	-0.39;-0.39;-0.38;-0.39;-0.44	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.69043	0.3067	L	0.36672	1.1	0.53005	D	0.999966	D;P	0.54397	0.966;0.886	P;B	0.50708	0.648;0.259	T	0.72513	-0.4270	10	0.87932	D	0	-19.732	19.5909	0.95509	0.0:0.0:1.0:0.0	.	364;503	B4DU13;Q02930	.;CREB5_HUMAN	Y	470;503;496;470;364	ENSP00000379593:D470Y;ENSP00000350359:D503Y;ENSP00000379594:D496Y;ENSP00000387197:D470Y;ENSP00000379592:D364Y	ENSP00000350359:D503Y	D	+	1	0	CREB5	28825401	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.169000	0.94788	2.633000	0.89246	0.650000	0.86243	GAC		0.478	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214204.4	NM_004904		13	135	1	0	0.000151284	0.001855	0.000228578	13	135				
PKD1L1	168507	broad.mit.edu	37	7	47870862	47870862	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:47870862C>T	ENST00000289672.2	-	42	6476	c.6426G>A	c.(6424-6426)ggG>ggA	p.G2142G		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2142					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.G2142G(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AAGAAGCGGTCCCACAAATGG	0.552																																							uc003tny.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(6424-6426)GGG>GGA		polycystin-1L1							101.0	87.0	92.0					7																	47870862		2203	4300	6503	SO:0001819	synonymous_variant	168507				cell-cell adhesion	integral to membrane		g.chr7:47870862C>T	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6426G>A	7.37:g.47870862C>T			Somatic				C7orf69_uc003toa.1_RNA	p.G2142G	NM_138295	NP_612152	WXS	Illumina HiSeq	Unspecified	Q8TDX9	PK1L1_HUMAN			42	6426	-			2142			Helical; (Potential).		Q6UWK1	Silent	SNP	ENST00000289672.2	37	c.6426G>A	CCDS34633.1																																																																																				0.552	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		32	66	0	0	0	0.001512	0	32	66				
ZNF479	90827	broad.mit.edu	37	7	57188673	57188673	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:57188673G>C	ENST00000331162.4	-	5	719	c.449C>G	c.(448-450)tCa>tGa	p.S150*		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	150					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S150*(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TTGGGTAGTTGACAAACATTG	0.299																																							uc010kzo.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|skin(1)	4						c.(448-450)TCA>TGA		zinc finger protein 479							74.0	70.0	71.0					7																	57188673		1845	4098	5943	SO:0001587	stop_gained	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57188673G>C	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.449C>G	7.37:g.57188673G>C	ENSP00000333776:p.Ser150*		Somatic					p.S150*	NM_033273	NP_150376	WXS	Illumina HiSeq	Unspecified	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	720	-			150						Nonsense_Mutation	SNP	ENST00000331162.4	37	c.449C>G	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	g	15.49	2.848651	0.51164	.	.	ENSG00000185177	ENST00000331162	.	.	.	1.6	-1.89	0.07689	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	4.8075	0.13328	0.0:0.0:0.4032:0.5968	.	.	.	.	X	150	.	ENSP00000333776:S150X	S	-	2	0	ZNF479	57192615	0.472000	0.25870	0.004000	0.12327	0.048000	0.14542	-0.110000	0.10824	-0.080000	0.12685	0.400000	0.26472	TCA		0.299	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		9	118	0	0	0	0.000673	0	9	118				
CYP51A1	1595	broad.mit.edu	37	7	91752461	91752461	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:91752461C>G	ENST00000003100.8	-	7	1224	c.1059G>C	c.(1057-1059)gaG>gaC	p.E353D	LRRD1_ENST00000422722.1_5'UTR|CYP51A1_ENST00000450723.1_Missense_Mutation_p.E248D	NM_000786.3	NP_000777.1	Q16850	CP51A_HUMAN	cytochrome P450, family 51, subfamily A, polypeptide 1	347					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via 24,25-dihydrolanosterol (GO:0033488)|demethylation (GO:0070988)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|sterol 14-demethylase activity (GO:0008398)	p.E353D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	10	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Itraconazole(DB01167)|Ketoconazole(DB01026)|Sertaconazole(DB01153)|Tioconazole(DB01007)	GAGGCAGATTCTCTCCACAGA	0.373																																					GBM(70;1100 1190 11592 25836 51397)	GBM(70;1100 1190 11592 25836 51397)	uc003ulm.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1057-1059)GAG>GAC		cytochrome P450, family 51, subfamily A,	Fluconazole(DB00196)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Miconazole(DB01110)|Terconazole(DB00251)						87.0	91.0	89.0					7																	91752461		2203	4300	6503	SO:0001583	missense	1595				cholesterol biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|sterol 14-demethylase activity	g.chr7:91752461C>G	U51685	CCDS5623.1, CCDS55123.1	7q21.2	2012-10-10	2003-02-14	2003-02-28	ENSG00000001630	ENSG00000001630		"""Cytochrome P450s"""	2649	protein-coding gene	gene with protein product		601637	"""cytochrome P450, 51 (lanosterol 14-alpha-demethylase)"""	CYP51		8975714	Standard	NM_000786		Approved	CP51, CYPL1, P450L1, LDM, P450-14DM	uc003ulm.4	Q16850	OTTHUMG00000131131	ENST00000003100.8:c.1059G>C	7.37:g.91752461C>G	ENSP00000003100:p.Glu353Asp		Somatic				CYP51A1_uc011khn.1_Missense_Mutation_p.E248D|CYP51A1_uc003uln.3_Missense_Mutation_p.E290D	p.E353D	NM_000786	NP_000777	WXS	Illumina HiSeq	Unspecified	Q16850	CP51A_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		7	1221	-	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		347					A4D1F8|B2RAI4|B4DJ55|O00770|O00772|Q16784|Q8N1A8|Q99868	Missense_Mutation	SNP	ENST00000003100.8	37	c.1059G>C	CCDS5623.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.27|12.27	1.888400|1.888400	0.33348|0.33348	.|.	.|.	ENSG00000001630|ENSG00000001630	ENST00000003100;ENST00000496998;ENST00000450723|ENST00000422867	T;T|T	0.66099|0.68025	-0.19;-0.19|-0.3	5.59|5.59	-2.86|-2.86	0.05717|0.05717	.|.	0.279434|0.279434	0.44902|0.44902	N|D	0.000417|0.000417	T|T	0.31263|0.31263	0.0791|0.0791	N|N	0.02202|0.02202	-0.64|-0.64	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.02721|0.02721	-1.1119|-1.1119	10|8	0.15066|0.44086	T|T	0.55|0.13	.|.	0.7506|0.7506	0.00989|0.00989	0.1967:0.3109:0.1821:0.3102|0.1967:0.3109:0.1821:0.3102	.|.	293;347|.	B3KRC6;Q16850|.	.;CP51A_HUMAN|.	D|Q	353;293;248|94	ENSP00000003100:E353D;ENSP00000406757:E248D|ENSP00000394268:E94Q	ENSP00000003100:E353D|ENSP00000394268:E94Q	E|E	-|-	3|1	2|0	CYP51A1|CYP51A1	91590397|91590397	0.065000|0.065000	0.20965|0.20965	0.655000|0.655000	0.29622|0.29622	0.997000|0.997000	0.91878|0.91878	-0.541000|-0.541000	0.06099|0.06099	-0.184000|-0.184000	0.10567|0.10567	0.650000|0.650000	0.86243|0.86243	GAG|GAA		0.373	CYP51A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253812.4			4	102	0	0	0	0.000248	0	4	102				
COL1A2	1278	broad.mit.edu	37	7	94038733	94038733	+	Splice_Site	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:94038733G>T	ENST00000297268.6	+	17	1362		c.e17+1			NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2						blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.?(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGACCTCCTGTAAGTAGCCA	0.507										HNSCC(75;0.22)																													uc003ung.1		NA																COL1A2/PLAG1(3)	1	Unknown(1)		lung(1)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9						c.e17+1		alpha 2 type I collagen precursor	Collagenase(DB00048)						56.0	64.0	61.0					7																	94038733		2203	4300	6503	SO:0001630	splice_region_variant	1278				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging	g.chr7:94038733G>T	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.891+1G>T	7.37:g.94038733G>T		HNSCC(75;0.22)	Somatic				COL1A2_uc011kib.1_Intron	p.P297_splice	NM_000089	NP_000080	WXS	Illumina HiSeq	Unspecified	P08123	CO1A2_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		17	1362	+	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)							P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Splice_Site	SNP	ENST00000297268.6	37	c.891_splice	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.212631	0.79240	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2886	0.98538	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL1A2	93876669	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	9.869000	0.99810	2.882000	0.98803	0.655000	0.94253	.		0.507	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	Intron	27	74	1	0	4.87955e-14	0.005443	8.19576e-14	27	74				
PON3	5446	broad.mit.edu	37	7	94989416	94989416	+	Missense_Mutation	SNP	C	C	T	rs200038070		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:94989416C>T	ENST00000265627.5	-	9	944	c.934G>A	c.(934-936)Gag>Aag	p.E312K	PON3_ENST00000451904.1_3'UTR|PON3_ENST00000427422.1_Silent_p.L241L|PON1_ENST00000542556.1_Intron	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	312					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)	p.E312K(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	CTGGGCTTCTCAGACAAAACA	0.453																																							uc003unt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(934-936)GAG>AAG		paraoxonase 3							109.0	106.0	107.0					7																	94989416		2203	4300	6503	SO:0001583	missense	5446				aromatic compound catabolic process|carboxylic acid catabolic process|response to external stimulus	extracellular space	aryldialkylphosphatase activity|arylesterase activity|metal ion binding|protein homodimerization activity	g.chr7:94989416C>T	L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.934G>A	7.37:g.94989416C>T	ENSP00000265627:p.Glu312Lys		Somatic				PON1_uc011kih.1_Intron	p.E312K	NM_000940	NP_000931	WXS	Illumina HiSeq	Unspecified	Q15166	PON3_HUMAN	STAD - Stomach adenocarcinoma(171;0.0151)		9	959	-	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		312					A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	ENST00000265627.5	37	c.934G>A	CCDS5639.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.689030	0.29962	.	.	ENSG00000105852	ENST00000265627	T	0.42131	0.98	4.7	2.64	0.31445	Six-bladed beta-propeller, TolB-like (1);	0.580111	0.19727	N	0.107460	T	0.37625	0.1010	M	0.64404	1.975	0.80722	D	1	B	0.13145	0.007	B	0.11329	0.006	T	0.17440	-1.0369	10	0.42905	T	0.14	-4.7639	8.4798	0.33036	0.0:0.7549:0.1494:0.0957	.	312	Q15166	PON3_HUMAN	K	312	ENSP00000265627:E312K	ENSP00000265627:E312K	E	-	1	0	PON3	94827352	0.843000	0.29541	0.039000	0.18376	0.139000	0.21198	2.571000	0.45990	0.549000	0.28973	0.655000	0.94253	GAG		0.453	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333007.1	NM_000940		11	121	0	0	0	0.001368	0	11	121				
PILRB	29990	broad.mit.edu	37	7	99956586	99956586	+	Nonsense_Mutation	SNP	C	C	G	rs373581534		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:99956586C>G	ENST00000452089.1	+	7	1397	c.338C>G	c.(337-339)tCa>tGa	p.S113*	PILRB_ENST00000448382.1_Silent_p.L165L|PILRB_ENST00000609309.1_Nonsense_Mutation_p.S113*|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|PILRB_ENST00000444073.1_Nonsense_Mutation_p.S113*|PILRB_ENST00000610247.1_Nonsense_Mutation_p.S113*			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta	113	Ig-like V-type.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)		p.S113*(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTCAGGATCTCAAACCTGCGG	0.552																																							uc003uuk.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(337-339)TCA>TGA		paired immunoglobulin-like type 2 receptor beta							100.0	107.0	105.0					7																	99956586		2203	4300	6503	SO:0001587	stop_gained	29990				activation of transmembrane receptor protein tyrosine kinase activity	integral to plasma membrane	protein binding|receptor activity	g.chr7:99956586C>G	AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000452089.1:c.338C>G	7.37:g.99956586C>G	ENSP00000391748:p.Ser113*		Somatic				PILRB_uc003uul.2_Silent_p.L43L|PILRB_uc003uum.1_RNA|PILRB_uc003uun.2_Nonsense_Mutation_p.S113*	p.S113*	NM_013440	NP_038468	WXS	Illumina HiSeq	Unspecified	Q9UKJ0	PILRB_HUMAN			16	2834	+	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		113			Extracellular (Potential).|Ig-like V-type.		Q69YF9|Q9HBS0	Nonsense_Mutation	SNP	ENST00000452089.1	37	c.338C>G	CCDS43622.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.101655	0.37048	.	.	ENSG00000121716	ENST00000310771;ENST00000420688;ENST00000452089;ENST00000457519;ENST00000443526;ENST00000419749;ENST00000422808;ENST00000438028;ENST00000444073;ENST00000413850;ENST00000438231	.	.	.	2.63	-2.92	0.05615	.	2.264110	0.01821	N	0.034078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.499	0.07666	0.1448:0.4804:0.262:0.1127	.	.	.	.	X	113;113;113;113;113;113;113;32;113;218;113	.	.	S	+	2	0	PILRB	99794522	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.028000	0.01431	-1.624000	0.01556	-1.636000	0.00776	TCA		0.552	PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339923.2	NM_178238		11	131	0	0	0	0.000978	0	11	131				
GNB2	2783	broad.mit.edu	37	7	100275742	100275742	+	Silent	SNP	A	A	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:100275742A>T	ENST00000303210.4	+	8	1001	c.519A>T	c.(517-519)acA>acT	p.T173T	GNB2_ENST00000427895.1_Silent_p.T73T|GNB2_ENST00000393924.1_Silent_p.T173T|GNB2_ENST00000424361.1_Silent_p.T129T|GNB2_ENST00000436220.1_Silent_p.T129T|GNB2_ENST00000393926.1_Silent_p.T173T|GNB2_ENST00000419828.1_Silent_p.T73T	NM_005273.3	NP_005264.2	P62879	GBB2_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2	173					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)	p.T173T(1)		endometrium(1)|lung(3)|ovary(2)|prostate(1)	7	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				ACATTGAGACAGGCCAGCAGA	0.587																																							uc003uwb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(517-519)ACA>ACT		guanine nucleotide-binding protein, beta-2							106.0	98.0	101.0					7																	100275742		2203	4300	6503	SO:0001819	synonymous_variant	2783				cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	perinuclear region of cytoplasm|plasma membrane	GTPase activity|GTPase binding|signal transducer activity	g.chr7:100275742A>T	M16514	CCDS5703.1	7q21.3-q22.1	2013-01-10			ENSG00000172354	ENSG00000172354		"""WD repeat domain containing"""	4398	protein-coding gene	gene with protein product	"""G protein, beta-2 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2"", ""signal-transducing guanine nucleotide-binding regulatory protein beta subunit"", ""transducin beta chain 2"""	139390				9799793	Standard	NM_005273		Approved		uc003uwb.3	P62879	OTTHUMG00000137419	ENST00000303210.4:c.519A>T	7.37:g.100275742A>T			Somatic				GNB2_uc003uwc.2_Silent_p.T129T|GNB2_uc010lhd.2_Silent_p.T129T|GNB2_uc010lhe.2_Silent_p.T129T|GNB2_uc003uwd.2_Silent_p.T73T|GNB2_uc010lhf.2_Silent_p.T73T|GNB2_uc003uwe.2_Silent_p.T173T|GNB2_uc003uwf.2_Silent_p.T73T	p.T173T	NM_005273	NP_005264	WXS	Illumina HiSeq	Unspecified	P62879	GBB2_HUMAN			8	792	+	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)	173					B3KPU1|P11016|P54312	Silent	SNP	ENST00000303210.4	37	c.519A>T	CCDS5703.1																																																																																				0.587	GNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268391.2	NM_005273		15	48	0	0	0	0.003163	0	15	48				
ZAN	7455	broad.mit.edu	37	7	100345986	100345986	+	RNA	SNP	C	C	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:100345986C>A	ENST00000348028.3	+	0	1307				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546292.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P381H(2)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AACGCCCATCCCTTCTGTGAC	0.567																																							uc003uwj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11						c.(1141-1143)CCC>CAC		zonadhesin isoform 3							80.0	80.0	80.0					7																	100345986		1898	4119	6017			7455				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane		g.chr7:100345986C>A	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100345986C>A			Somatic				ZAN_uc003uwk.2_Missense_Mutation_p.P381H|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	p.P381H	NM_003386	NP_003377	WXS	Illumina HiSeq	Unspecified	Q9Y493	ZAN_HUMAN	STAD - Stomach adenocarcinoma(171;0.19)		11	1307	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		381			MAM 3.|Extracellular (Potential).		A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37	c.1142C>A		.	.	.	.	.	.	.	.	.	.	c	14.20	2.463017	0.43736	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.02032	4.49;4.49;4.49	4.82	3.94	0.45596	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.192376	0.25872	N	0.027741	T	0.13072	0.0317	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00204	-1.1923	10	0.87932	D	0	.	9.9581	0.41680	0.0:0.9033:0.0:0.0966	.	381;381	F5H0T8;Q9Y493	.;ZAN_HUMAN	H	381	ENSP00000445943:P381H;ENSP00000445091:P381H;ENSP00000444427:P381H	ENSP00000423579:P381H	P	+	2	0	ZAN	100183922	0.982000	0.34865	0.862000	0.33874	0.377000	0.30045	3.477000	0.53151	1.338000	0.45544	-0.226000	0.12346	CCC		0.567	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		18	63	1	0	1.15919e-05	0.001216	1.77468e-05	18	63				
MET	4233	broad.mit.edu	37	7	116435946	116435946	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:116435946A>G	ENST00000318493.6	+	21	4182	c.3995A>G	c.(3994-3996)gAa>gGa	p.E1332G	MET_ENST00000539704.1_Missense_Mutation_p.E184G|MET_ENST00000397752.3_Missense_Mutation_p.E1314G			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E1332G(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			AACAGATATGAAGTAATGCTA	0.428			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.(3940-3942)GAA>GGA		met proto-oncogene isoform b precursor							110.0	102.0	105.0					7																	116435946		1886	4104	5990	SO:0001583	missense	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116435946A>G	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3995A>G	7.37:g.116435946A>G	ENSP00000317272:p.Glu1332Gly		Somatic				MET_uc010lkh.2_Missense_Mutation_p.E1332G|MET_uc011knj.1_Missense_Mutation_p.E884G	p.E1314G	NM_000245	NP_000236	WXS	Illumina HiSeq	Unspecified	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		21	4128	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	1314			Protein kinase.|Interaction with RANBP9.|Cytoplasmic (Potential).		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	c.3941A>G	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	A	19.69	3.874581	0.72180	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.35605	1.3;1.3;1.3	5.72	5.72	0.89469	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.134442	0.64402	D	0.000002	T	0.49508	0.1561	L	0.31120	0.905	0.48395	D	0.999643	D;D	0.89917	0.987;1.0	P;D	0.91635	0.68;0.999	T	0.49542	-0.8929	10	0.54805	T	0.06	.	16.2988	0.82793	1.0:0.0:0.0:0.0	.	1332;1314	P08581-2;P08581	.;MET_HUMAN	G	1314;1332;184	ENSP00000380860:E1314G;ENSP00000317272:E1332G;ENSP00000445020:E184G	ENSP00000317272:E1332G	E	+	2	0	MET	116223182	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	6.675000	0.74493	2.311000	0.77944	0.533000	0.62120	GAA		0.428	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			20	89	0	0	0	0.001523	0	20	89				
CFTR	1080	broad.mit.edu	37	7	117282538	117282538	+	Nonsense_Mutation	SNP	C	C	G	rs76649725		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:117282538C>G	ENST00000003084.6	+	23	3896	c.3764C>G	c.(3763-3765)tCa>tGa	p.S1255*	CFTR_ENST00000454343.1_Nonsense_Mutation_p.S1194*|AC000111.6_ENST00000456270.1_RNA	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	1255	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.		S -> P (in CF). {ECO:0000269|PubMed:1284530}.		cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)	p.S1255*(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	ACTTTGTTATCAGCTTTTTTG	0.433									Cystic Fibrosis																														uc003vjd.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(2)|skin(2)|ovary(1)	5	GRCh37	CM920186|CM980356	CFTR	M	rs76649725	c.(3763-3765)TCA>TGA		cystic fibrosis transmembrane conductance	Bumetanide(DB00887)|Glibenclamide(DB01016)						142.0	142.0	142.0					7																	117282538		2203	4300	6503	SO:0001587	stop_gained	1080	Cystic_Fibrosis	Familial Cancer Database	CF	respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding	g.chr7:117282538C>G	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.3764C>G	7.37:g.117282538C>G	ENSP00000003084:p.Ser1255*		Somatic				CFTR_uc011knq.1_Nonsense_Mutation_p.S661*	p.S1255*	NM_000492	NP_000483	WXS	Illumina HiSeq	Unspecified	P13569	CFTR_HUMAN	STAD - Stomach adenocarcinoma(10;0.000534)		23	3896	+	Lung NSC(10;0.00148)|all_lung(10;0.00171)		1255		S -> P (in CF).	Cytoplasmic (Potential).|ABC transporter 2.		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Nonsense_Mutation	SNP	ENST00000003084.6	37	c.3764C>G	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	C	40	8.181580	0.98693	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	.	.	.	5.2	2.31	0.28768	.	0.449653	0.26072	N	0.026510	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.9264	7.3448	0.26658	0.0:0.581:0.0:0.419	.	.	.	.	X	1255;1194;1225	.	ENSP00000003084:S1255X	S	+	2	0	CFTR	117069774	0.242000	0.23868	0.707000	0.30419	0.857000	0.48899	1.341000	0.33907	0.647000	0.30713	0.585000	0.79938	TCA		0.433	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492		6	67	0	0	0	0.001984	0	6	67				
FSCN3	29999	broad.mit.edu	37	7	127240303	127240303	+	Silent	SNP	C	C	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:127240303C>A	ENST00000265825.5	+	6	1566	c.1347C>A	c.(1345-1347)ggC>ggA	p.G449G	FSCN3_ENST00000420086.2_Missense_Mutation_p.Q314K	NM_020369.2	NP_065102.1	Q9NQT6	FSCN3_HUMAN	fascin actin-bundling protein 3, testicular	449						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G449G(1)		endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30						GCCCTTGGGGCAAGTTTGCCC	0.557																																							uc003vmd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1345-1347)GGC>GGA		fascin 3							83.0	73.0	76.0					7																	127240303		2203	4300	6503	SO:0001819	synonymous_variant	29999					actin cytoskeleton|cytoplasm	actin filament binding|protein binding, bridging	g.chr7:127240303C>A		CCDS34746.1	7q31.3	2014-02-03	2014-02-03		ENSG00000106328	ENSG00000106328		"""Fascins"""	3961	protein-coding gene	gene with protein product		615800	"""fascin (Strongylocentrotus purpuratus) homolog 3 (actin-bundling protein, testicular)"", ""fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)"""			11925108	Standard	NM_020369		Approved		uc003vmd.2	Q9NQT6	OTTHUMG00000022935	ENST00000265825.5:c.1347C>A	7.37:g.127240303C>A			Somatic				FSCN3_uc011koh.1_Missense_Mutation_p.Q314K|FSCN3_uc010llc.1_Missense_Mutation_p.Q448K	p.G449G	NM_020369	NP_065102	WXS	Illumina HiSeq	Unspecified	Q9NQT6	FSCN3_HUMAN			6	1566	+			449					A4D0Z2|A6NLL7|B2RA62|B4DU68	Silent	SNP	ENST00000265825.5	37	c.1347C>A	CCDS34746.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.438956	0.43326	.	.	ENSG00000106328	ENST00000420086	T	0.39787	1.06	5.74	-0.765	0.11023	.	.	.	.	.	T	0.14874	0.0359	.	.	.	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.30238	-0.9985	8	0.02654	T	1	-39.1146	4.7129	0.12880	0.4234:0.323:0.2536:0.0	.	314	B4DU68	.	K	314	ENSP00000412243:Q314K	ENSP00000412243:Q314K	Q	+	1	0	FSCN3	127027539	0.974000	0.33945	0.997000	0.53966	0.965000	0.64279	-0.041000	0.12084	-0.129000	0.11620	-1.193000	0.01689	CAA		0.557	FSCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059256.2	NM_020369		9	43	1	0	7.48243e-07	0.006214	1.19305e-06	9	43				
DENND2A	27147	broad.mit.edu	37	7	140301553	140301553	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:140301553C>G	ENST00000275884.6	-	2	1062	c.645G>C	c.(643-645)caG>caC	p.Q215H	DENND2A_ENST00000492720.1_Missense_Mutation_p.Q215H|DENND2A_ENST00000496613.1_Missense_Mutation_p.Q215H|DENND2A_ENST00000537639.1_Missense_Mutation_p.Q215H			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	215					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.Q215H(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					GGTGGACCCTCTGGCTGACTT	0.632																																							uc010lnj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(643-645)CAG>CAC		DENN/MADD domain containing 2A							70.0	72.0	71.0					7																	140301553		1923	4140	6063	SO:0001583	missense	27147							g.chr7:140301553C>G	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.645G>C	7.37:g.140301553C>G	ENSP00000275884:p.Gln215His		Somatic				DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.Q215H|DENND2A_uc003vvw.2_Missense_Mutation_p.Q215H|DENND2A_uc003vvx.2_Missense_Mutation_p.Q215H	p.Q215H	NM_015689	NP_056504	WXS	Illumina HiSeq	Unspecified	Q9ULE3	DEN2A_HUMAN			1	790	-	Melanoma(164;0.00956)		215					C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	ENST00000275884.6	37	c.645G>C	CCDS43659.1	.	.	.	.	.	.	.	.	.	.	C	2.881	-0.231771	0.05983	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720	T;T;T;T	0.09817	3.64;3.64;3.64;2.94	3.55	-0.905	0.10527	.	2.084280	0.02130	N	0.056292	T	0.06645	0.0170	N	0.08118	0	0.09310	N	1	B;P	0.38148	0.003;0.62	B;B	0.37508	0.002;0.252	T	0.22277	-1.0221	10	0.46703	T	0.11	-0.3405	6.5235	0.22289	0.0:0.3407:0.4601:0.1991	.	215;215	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	H	215	ENSP00000275884:Q215H;ENSP00000442245:Q215H;ENSP00000419654:Q215H;ENSP00000419464:Q215H	ENSP00000275884:Q215H	Q	-	3	2	DENND2A	139948022	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.017000	0.13399	-0.516000	0.06470	-0.258000	0.10820	CAG		0.632	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689		5	128	0	0	0	0.000602	0	5	128				
PAXIP1	22976	broad.mit.edu	37	7	154738478	154738478	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:154738478T>C	ENST00000404141.1	-	18	3122	c.2968A>G	c.(2968-2970)Act>Gct	p.T990A	PAXIP1_ENST00000397192.1_Missense_Mutation_p.T990A|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	990	BRCT 6. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)		p.T956A(1)|p.T990A(1)		NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GCCTTCATAGTGGAAAGACTT	0.383																																							uc003wlp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|ovary(1)|breast(1)|pancreas(1)	5						c.(2968-2970)ACT>GCT		PAX interacting protein 1							63.0	58.0	60.0					7																	154738478		1895	4132	6027	SO:0001583	missense	22976				DNA damage response, signal transduction by p53 class mediator|DNA recombination|DNA repair|histone H3-K4 methylation|positive regulation of histone acetylation|positive regulation of histone H3-K36 methylation|positive regulation of histone H3-K4 methylation|positive regulation of isotype switching|positive regulation of protein ubiquitination|positive regulation of transcription initiation from RNA polymerase II promoter|response to ionizing radiation|transcription, DNA-dependent	histone methyltransferase complex|nuclear matrix		g.chr7:154738478T>C	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.2968A>G	7.37:g.154738478T>C	ENSP00000384048:p.Thr990Ala		Somatic				LOC100132707_uc011kvr.1_RNA|LOC100132707_uc003wlo.2_RNA|PAXIP1_uc003wlq.1_Missense_Mutation_p.T956A|PAXIP1_uc011kvs.1_Missense_Mutation_p.T954A	p.T990A	NM_007349	NP_031375	WXS	Illumina HiSeq	Unspecified	Q6ZW49	PAXI1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)	18	3011	-	all_neural(206;0.119)	all_hematologic(28;0.0592)	990			Interaction with TP53BP1.|BRCT 6.		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	ENST00000404141.1	37	c.2968A>G	CCDS47753.1	.	.	.	.	.	.	.	.	.	.	T	9.620	1.133492	0.21041	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	T;T	0.31510	1.49;1.49	5.34	5.34	0.76211	BRCT (1);	0.000000	0.56097	U	0.000024	T	0.39172	0.1068	L	0.27053	0.805	0.54753	D	0.999982	P;D;D	0.65815	0.951;0.995;0.992	P;D;D	0.78314	0.693;0.991;0.98	T	0.10590	-1.0623	10	0.09843	T	0.71	-28.5587	15.3512	0.74389	0.0:0.0:0.0:1.0	.	943;956;990	B4DEQ6;Q6ZW49-1;Q6ZW49	.;.;PAXI1_HUMAN	A	990;990;814;943	ENSP00000384048:T990A;ENSP00000380376:T990A	ENSP00000319149:T943A	T	-	1	0	PAXIP1	154369411	1.000000	0.71417	0.063000	0.19743	0.142000	0.21351	7.397000	0.79903	2.017000	0.59298	0.454000	0.30748	ACT		0.383	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349		4	17	0	0	0	0.000602	0	4	17				
RP1L1	94137	broad.mit.edu	37	8	10464923	10464923	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:10464923C>T	ENST00000382483.3	-	4	6908	c.6685G>A	c.(6685-6687)Gag>Aag	p.E2229K		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2309	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.E2229K(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCCGGGGTCTCTACGCCTTCT	0.602																																							uc003wtc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(6685-6687)GAG>AAG		retinitis pigmentosa 1-like 1							103.0	110.0	108.0					8																	10464923		1916	4113	6029	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10464923C>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.6685G>A	8.37:g.10464923C>T	ENSP00000371923:p.Glu2229Lys		Somatic					p.E2229K	NM_178857	NP_849188	WXS	Illumina HiSeq	Unspecified	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	6914	-			2229					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.6685G>A	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.267580	0.23136	.	.	ENSG00000183638	ENST00000382483	T	0.07688	3.17	2.86	1.92	0.25849	.	.	.	.	.	T	0.04588	0.0125	N	0.14661	0.345	0.09310	N	1	P	0.45531	0.86	B	0.43783	0.431	T	0.24835	-1.0149	9	0.10377	T	0.69	.	4.5418	0.12061	0.0:0.6237:0.2352:0.1411	.	2229	A6NKC6	.	K	2229	ENSP00000371923:E2229K	ENSP00000371923:E2229K	E	-	1	0	RP1L1	10502333	0.000000	0.05858	0.002000	0.10522	0.000000	0.00434	0.405000	0.21015	0.455000	0.26910	-0.494000	0.04653	GAG		0.602	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			15	147	0	0	0	0.004007	0	15	147				
TEX15	56154	broad.mit.edu	37	8	30704595	30704595	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:30704595C>T	ENST00000256246.2	-	1	2013	c.1939G>A	c.(1939-1941)Gaa>Aaa	p.E647K	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	647					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.E647K(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTATCAATTTCACAATCAGAA	0.299																																							uc003xil.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(1939-1941)GAA>AAA		testis expressed 15							46.0	47.0	46.0					8																	30704595		2203	4298	6501	SO:0001583	missense	56154							g.chr8:30704595C>T	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1939G>A	8.37:g.30704595C>T	ENSP00000256246:p.Glu647Lys		Somatic					p.E647K	NM_031271	NP_112561	WXS	Illumina HiSeq	Unspecified	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	1939	-			647						Missense_Mutation	SNP	ENST00000256246.2	37	c.1939G>A	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064110	0.55432	.	.	ENSG00000133863	ENST00000256246	T	0.11604	2.76	5.48	2.55	0.30701	.	0.197655	0.35805	N	0.002970	T	0.07007	0.0178	N	0.24115	0.695	0.20196	N	0.999922	P	0.40107	0.703	B	0.40101	0.319	T	0.20538	-1.0272	10	0.87932	D	0	.	4.6477	0.12580	0.0:0.6254:0.1822:0.1924	.	647	Q9BXT5	TEX15_HUMAN	K	647	ENSP00000256246:E647K	ENSP00000256246:E647K	E	-	1	0	TEX15	30824137	0.538000	0.26394	0.527000	0.27925	0.025000	0.11179	0.983000	0.29552	1.440000	0.47531	0.655000	0.94253	GAA		0.299	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			15	28	0	0	0	0.00245	0	15	28				
DDHD2	23259	broad.mit.edu	37	8	38105235	38105235	+	Missense_Mutation	SNP	C	C	T	rs145943165	byFrequency	TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:38105235C>T	ENST00000397166.2	+	10	1655	c.1130C>T	c.(1129-1131)tCg>tTg	p.S377L	DDHD2_ENST00000528888.1_3'UTR|DDHD2_ENST00000517385.1_5'UTR|DDHD2_ENST00000529845.1_5'Flank|DDHD2_ENST00000520272.2_Missense_Mutation_p.S377L	NM_015214.2	NP_056029.2	O94830	DDHD2_HUMAN	DDHD domain containing 2	377					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.S377L(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)|urinary_tract(2)	28	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			TTTTAGGATTCGCTAAATATT	0.294													C|||	2	0.000399361	0.0	0.0	5008	,	,		15419	0.001		0.0	False		,,,				2504	0.001						uc003xlb.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1129-1131)TCG>TTG		DDHD domain containing 2 isoform 1		C	LEU/SER,LEU/SER	0,4404		0,0,2202	48.0	53.0	51.0		1130,1130	0.2	0.0	8	dbSNP_134	51	3,8581	3.0+/-9.4	0,3,4289	yes	missense,missense	DDHD2	NM_001164232.1,NM_015214.2	145,145	0,3,6491	TT,TC,CC		0.0349,0.0,0.0231	benign,benign	377/712,377/712	38105235	3,12985	2202	4292	6494	SO:0001583	missense	23259				lipid catabolic process	centrosome	hydrolase activity|metal ion binding	g.chr8:38105235C>T	AK056525	CCDS34883.1	8p11.23	2014-03-03	2004-04-05	2004-04-07				"""Sterile alpha motif (SAM) domain containing"""	29106	protein-coding gene	gene with protein product		615003	"""SAM, WWE and DDHD domain containing 1"""	SAMWD1		9872452, 11788596, 19632984, 20932832	Standard	NM_015214		Approved	KIAA0725, SPG54	uc003xlc.3	O94830		ENST00000397166.2:c.1130C>T	8.37:g.38105235C>T	ENSP00000380352:p.Ser377Leu		Somatic				DDHD2_uc003xlc.2_Missense_Mutation_p.S377L|DDHD2_uc011lbl.1_Missense_Mutation_p.S189L|DDHD2_uc003xld.2_5'UTR	p.S377L	NM_015214	NP_056029	WXS	Illumina HiSeq	Unspecified	O94830	DDHD2_HUMAN	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)		10	1507	+	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	377					B3KWV2|B3KXB5|Q9H8X7	Missense_Mutation	SNP	ENST00000397166.2	37	c.1130C>T	CCDS34883.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041126	0.55003	0.0	3.49E-4	ENSG00000085788	ENST00000397166;ENST00000520272;ENST00000440212	T;T	0.33216	1.42;1.42	5.51	0.164	0.14990	.	1.736100	0.02775	N	0.120126	T	0.25791	0.0628	L	0.38175	1.15	0.09310	N	1	B;B	0.15719	0.014;0.001	B;B	0.04013	0.001;0.001	T	0.18587	-1.0332	10	0.26408	T	0.33	0.5463	8.4143	0.32662	0.0:0.5423:0.0:0.4577	.	189;377	B4DSR3;O94830	.;DDHD2_HUMAN	L	377;377;189	ENSP00000380352:S377L;ENSP00000429932:S377L	ENSP00000380352:S377L	S	+	2	0	DDHD2	38224392	0.000000	0.05858	0.000000	0.03702	0.979000	0.70002	-0.431000	0.06965	-0.188000	0.10499	-0.157000	0.13467	TCG		0.294	DDHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377251.2	XM_291291		6	76	0	0	0	0.001168	0	6	76				
CHRNA6	8973	broad.mit.edu	37	8	42611669	42611669	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:42611669C>G	ENST00000276410.2	-	5	1028	c.673G>C	c.(673-675)Gag>Cag	p.E225Q	CHRNA6_ENST00000530869.1_5'Flank|CHRNA6_ENST00000534622.1_Missense_Mutation_p.E210Q	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	225					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)	p.E225Q(1)		endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	GTGTATATCTCTTCACAACAG	0.338																																							uc003xpj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(673-675)GAG>CAG		cholinergic receptor, nicotinic, alpha 6							96.0	98.0	97.0					8																	42611669		2203	4300	6503	SO:0001583	missense	8973					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr8:42611669C>G	U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.673G>C	8.37:g.42611669C>G	ENSP00000276410:p.Glu225Gln		Somatic				CHRNA6_uc011lcw.1_Missense_Mutation_p.E210Q	p.E225Q	NM_004198	NP_004189	WXS	Illumina HiSeq	Unspecified	Q15825	ACHA6_HUMAN	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		5	719	-	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	225			Extracellular.		B2R8V4|B4DQH1	Missense_Mutation	SNP	ENST00000276410.2	37	c.673G>C	CCDS6135.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.190189	0.78789	.	.	ENSG00000147434	ENST00000276410;ENST00000534622	T;T	0.79033	-1.23;-1.23	5.97	5.97	0.96955	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.88066	0.6337	M	0.69463	2.115	0.50039	D	0.999848	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.996	D	0.87752	0.2592	10	0.72032	D	0.01	.	20.4239	0.99064	0.0:1.0:0.0:0.0	.	210;225	B4DQH1;Q15825	.;ACHA6_HUMAN	Q	225;210	ENSP00000276410:E225Q;ENSP00000433871:E210Q	ENSP00000276410:E225Q	E	-	1	0	CHRNA6	42730826	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.398000	0.66308	2.828000	0.97474	0.655000	0.94253	GAG		0.338	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383156.1			7	87	0	0	0	0.001984	0	7	87				
RB1CC1	9821	broad.mit.edu	37	8	53569134	53569134	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:53569134C>T	ENST00000025008.5	-	15	3778	c.3255G>A	c.(3253-3255)caG>caA	p.Q1085Q	RB1CC1_ENST00000435644.2_Silent_p.Q1085Q|RB1CC1_ENST00000539297.1_Silent_p.Q1085Q|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1085					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.Q1085Q(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				AGGTCTCCTTCTGCTGGGCTC	0.358																																					GBM(180;1701 2102 13475 42023 52570)	GBM(180;1701 2102 13475 42023 52570)	uc003xre.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11						c.(3253-3255)CAG>CAA		Rb1-inducible coiled coil protein 1 isoform 1							70.0	72.0	71.0					8																	53569134		2201	4299	6500	SO:0001819	synonymous_variant	9821				autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding	g.chr8:53569134C>T	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.3255G>A	8.37:g.53569134C>T			Somatic				RB1CC1_uc003xrf.3_Silent_p.Q1085Q	p.Q1085Q	NM_014781	NP_055596	WXS	Illumina HiSeq	Unspecified	Q8TDY2	RBCC1_HUMAN			15	3813	-		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)	1085			Potential.		Q86YR4|Q8WVU9|Q92601	Silent	SNP	ENST00000025008.5	37	c.3255G>A	CCDS34892.1																																																																																				0.358	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781		15	69	0	0	0	0.003163	0	15	69				
JPH1	56704	broad.mit.edu	37	8	75227253	75227253	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:75227253C>T	ENST00000342232.4	-	2	1022	c.982G>A	c.(982-984)Gag>Aag	p.E328K		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	328					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.E328K(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			TATTTTCCCTCTTCTTTGGAG	0.448																																							uc003yae.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(982-984)GAG>AAG		junctophilin 1							118.0	119.0	119.0					8																	75227253		2203	4300	6503	SO:0001583	missense	56704				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane		g.chr8:75227253C>T	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.982G>A	8.37:g.75227253C>T	ENSP00000344488:p.Glu328Lys		Somatic				JPH1_uc003yaf.2_Missense_Mutation_p.E328K|JPH1_uc003yag.1_Missense_Mutation_p.E192K	p.E328K	NM_020647	NP_065698	WXS	Illumina HiSeq	Unspecified	Q9HDC5	JPH1_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)		2	1022	-	Breast(64;0.00576)		328			Cytoplasmic (Potential).		B2RTZ0	Missense_Mutation	SNP	ENST00000342232.4	37	c.982G>A	CCDS6217.1	.	.	.	.	.	.	.	.	.	.	C	32	5.106749	0.94292	.	.	ENSG00000104369	ENST00000342232	T	0.48836	0.8	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.73713	0.3622	M	0.87269	2.87	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.76777	-0.2834	10	0.54805	T	0.06	.	19.1608	0.93531	0.0:1.0:0.0:0.0	.	328	Q9HDC5	JPH1_HUMAN	K	328	ENSP00000344488:E328K	ENSP00000344488:E328K	E	-	1	0	JPH1	75389808	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.749000	0.94314	0.655000	0.94253	GAG		0.448	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1			10	151	0	0	0	0.006214	0	10	151				
CRISPLD1	83690	broad.mit.edu	37	8	75924672	75924672	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:75924672G>A	ENST00000262207.4	+	3	731	c.263G>A	c.(262-264)tGg>tAg	p.W88*	CRISPLD1_ENST00000517786.1_5'UTR|CRISPLD1_ENST00000519798.1_3'UTR|CRISPLD1_ENST00000523524.1_5'UTR	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	88	SCP.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.W88*(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CTGTAGACATGGGATGTAGAG	0.418																																							uc003yan.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(262-264)TGG>TAG		cysteine-rich secretory protein LCCL domain							155.0	144.0	147.0					8																	75924672		2203	4300	6503	SO:0001587	stop_gained	83690					extracellular region		g.chr8:75924672G>A	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.263G>A	8.37:g.75924672G>A	ENSP00000262207:p.Trp88*		Somatic				CRISPLD1_uc011lfk.1_5'UTR|CRISPLD1_uc011lfl.1_5'UTR	p.W88*	NM_031461	NP_113649	WXS	Illumina HiSeq	Unspecified	Q9H336	CRLD1_HUMAN	Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)		3	638	+	Breast(64;0.0799)		88					B2RA60|B7Z929	Nonsense_Mutation	SNP	ENST00000262207.4	37	c.263G>A	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	G	39	7.610944	0.98387	.	.	ENSG00000121005	ENST00000262207;ENST00000520277	.	.	.	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.636	0.91379	0.0:0.0:1.0:0.0	.	.	.	.	X	88	.	ENSP00000262207:W88X	W	+	2	0	CRISPLD1	76087227	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.193000	0.94954	2.625000	0.88918	0.557000	0.71058	TGG		0.418	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461		7	66	0	0	0	0.00308	0	7	66				
PSKH2	85481	broad.mit.edu	37	8	87076709	87076709	+	Missense_Mutation	SNP	G	G	A	rs375694521		TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:87076709G>A	ENST00000276616.2	-	2	411	c.337C>T	c.(337-339)Cgg>Tgg	p.R113W	PSKH2_ENST00000517981.1_5'UTR	NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	113	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R113W(1)		NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			CTAACCCGCCGCAGGACGCTC	0.507																																							uc011lfy.1		NA																	1	Substitution - Missense(1)		lung(1)	stomach(2)|lung(2)|ovary(1)	5						c.(337-339)CGG>TGG		protein serine kinase H2		G	TRP/ARG	0,4406		0,0,2203	99.0	86.0	90.0		337	1.6	0.2	8		90	1,8599	1.2+/-3.3	0,1,4299	no	missense	PSKH2	NM_033126.1	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	113/386	87076709	1,13005	2203	4300	6503	SO:0001583	missense	85481						ATP binding|protein serine/threonine kinase activity	g.chr8:87076709G>A	AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.337C>T	8.37:g.87076709G>A	ENSP00000276616:p.Arg113Trp		Somatic					p.R113W	NM_033126	NP_149117	WXS	Illumina HiSeq	Unspecified	Q96QS6	KPSH2_HUMAN	STAD - Stomach adenocarcinoma(118;0.129)		2	337	-			113			Protein kinase.		A0AV22	Missense_Mutation	SNP	ENST00000276616.2	37	c.337C>T	CCDS6240.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134489	0.56828	0.0	1.16E-4	ENSG00000147613	ENST00000276616	T	0.67698	-0.28	5.59	1.6	0.23607	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.75162	0.3812	M	0.63169	1.94	0.31378	N	0.679392	D	0.89917	1.0	D	0.72625	0.978	T	0.72593	-0.4246	9	0.87932	D	0	.	7.1126	0.25399	0.1243:0.0:0.3739:0.5018	.	113	Q96QS6	KPSH2_HUMAN	W	113	ENSP00000276616:R113W	ENSP00000276616:R113W	R	-	1	2	PSKH2	87145825	1.000000	0.71417	0.234000	0.24042	0.680000	0.39746	2.758000	0.47565	0.390000	0.25115	-0.262000	0.10625	CGG		0.507	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374628.1	NM_033126		13	90	0	0	0	0.001216	0	13	90				
CPNE3	8895	broad.mit.edu	37	8	87544779	87544779	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:87544779G>C	ENST00000521271.1	+	6	592	c.430G>C	c.(430-432)Gaa>Caa	p.E144Q	CPNE3_ENST00000198765.4_Missense_Mutation_p.E144Q	NM_003909.3	NP_003900.1	O75131	CPNE3_HUMAN	copine III	144	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|protein phosphorylation (GO:0006468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|transporter activity (GO:0005215)	p.E144Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	23						GGTCTTGTTTGAAATGGAAGC	0.318																																							uc003ydv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(430-432)GAA>CAA		copine III							117.0	130.0	125.0					8																	87544779		2203	4298	6501	SO:0001583	missense	8895				lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity	g.chr8:87544779G>C	AB014536	CCDS6243.1	8q21	2008-07-03				ENSG00000085719			2316	protein-coding gene	gene with protein product		604207				9430674	Standard	NM_003909		Approved		uc003ydv.2	O75131		ENST00000521271.1:c.430G>C	8.37:g.87544779G>C	ENSP00000430934:p.Glu144Gln		Somatic					p.E144Q	NM_003909	NP_003900	WXS	Illumina HiSeq	Unspecified	O75131	CPNE3_HUMAN			6	592	+			144			C2 2.		A8KA47|Q8IYA1	Missense_Mutation	SNP	ENST00000521271.1	37	c.430G>C	CCDS6243.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.26|14.26	2.481137|2.481137	0.44147|0.44147	.|.	.|.	ENSG00000085719|ENSG00000085719	ENST00000198765;ENST00000521271;ENST00000523072;ENST00000523469|ENST00000517391	T;T;T;T|.	0.38887|.	1.11;1.11;1.11;2.34|.	5.6|5.6	5.6|5.6	0.85130|0.85130	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56093|0.56093	0.1962|0.1962	N|N	0.21097|0.21097	0.63|0.63	0.80722|0.80722	D|D	1|1	P|.	0.36837|.	0.571|.	B|.	0.42163|.	0.378|.	T|T	0.49670|0.49670	-0.8915|-0.8915	10|5	0.02654|.	T|.	1|.	-8.5003|-8.5003	19.604|19.604	0.95574|0.95574	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	144|.	O75131|.	CPNE3_HUMAN|.	Q|F	144|60	ENSP00000198765:E144Q;ENSP00000430934:E144Q;ENSP00000427791:E144Q;ENSP00000429561:E144Q|.	ENSP00000198765:E144Q|.	E|L	+|+	1|3	0|2	CPNE3|CPNE3	87613895|87613895	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.835000|7.835000	0.86780|0.86780	2.642000|2.642000	0.89623|0.89623	0.591000|0.591000	0.81541|0.81541	GAA|TTG		0.318	CPNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374994.1			4	273	0	0	0	0.000248	0	4	273				
RGS22	26166	broad.mit.edu	37	8	100994288	100994288	+	Silent	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:100994288A>G	ENST00000360863.6	-	22	3431	c.3237T>C	c.(3235-3237)atT>atC	p.I1079I	RGS22_ENST00000523287.1_Silent_p.I898I|RGS22_ENST00000523437.1_Silent_p.I1067I	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1079	RGS 2. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.I1079I(2)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			AGCAGTTGATAATAGTTGTAA	0.373																																							uc003yjb.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(3235-3237)ATT>ATC		regulator of G-protein signaling 22							127.0	122.0	124.0					8																	100994288		1858	4098	5956	SO:0001819	synonymous_variant	26166				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr8:100994288A>G	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.3237T>C	8.37:g.100994288A>G			Somatic				RGS22_uc003yja.1_Silent_p.I898I|RGS22_uc003yjc.1_Silent_p.I1067I	p.I1079I	NM_015668	NP_056483	WXS	Illumina HiSeq	Unspecified	Q8NE09	RGS22_HUMAN	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)		22	3432	-			1079			RGS 2.		A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Silent	SNP	ENST00000360863.6	37	c.3237T>C	CCDS43758.1																																																																																				0.373	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668		30	87	0	0	0	0.007291	0	30	87				
UBR5	51366	broad.mit.edu	37	8	103289239	103289239	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:103289239C>T	ENST00000520539.1	-	45	7076	c.6470G>A	c.(6469-6471)gGa>gAa	p.G2157E	UBR5_ENST00000220959.4_Missense_Mutation_p.G2157E|UBR5_ENST00000521922.1_Missense_Mutation_p.G2151E	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2157					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.G2157K(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TTCAGTAAGTCCTATTTCTGC	0.408																																					Ovarian(131;96 1741 5634 7352 27489)	Ovarian(131;96 1741 5634 7352 27489)	uc003ykr.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28						c.(6469-6471)GGA>GAA		ubiquitin protein ligase E3 component n-recognin							149.0	137.0	141.0					8																	103289239		2203	4300	6503	SO:0001583	missense	51366				cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding	g.chr8:103289239C>T	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.6470G>A	8.37:g.103289239C>T	ENSP00000429084:p.Gly2157Glu		Somatic				UBR5_uc003yks.1_Missense_Mutation_p.G2157E	p.G2157E	NM_015902	NP_056986	WXS	Illumina HiSeq	Unspecified	O95071	UBR5_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.000442)		45	6503	-	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		2157					B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	c.6470G>A	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.935445	0.73442	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.46819	0.86;0.86;0.86	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.50326	0.1609	N	0.14661	0.345	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.75484	0.986;0.986	T	0.38802	-0.9644	10	0.09590	T	0.72	.	19.0745	0.93154	0.0:1.0:0.0:0.0	.	2151;2157	E7EMW7;O95071	.;UBR5_HUMAN	E	2157;2157;2151	ENSP00000429084:G2157E;ENSP00000220959:G2157E;ENSP00000427819:G2151E	ENSP00000220959:G2157E	G	-	2	0	UBR5	103358415	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.345000	0.79337	2.568000	0.86640	0.643000	0.83706	GGA		0.408	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902		11	96	0	0	0	0.000673	0	11	96				
RSPO2	340419	broad.mit.edu	37	8	108970419	108970419	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:108970419G>C	ENST00000276659.5	-	5	1125	c.505C>G	c.(505-507)Ctg>Gtg	p.L169V	RSPO2_ENST00000517781.1_Missense_Mutation_p.L105V|RSPO2_ENST00000517939.1_Missense_Mutation_p.L102V|RSPO2_ENST00000378439.2_Missense_Mutation_p.L105V	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	169	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.L169V(1)	EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			CTGGTTTCCAGACCCCATTTA	0.408																																							uc003yms.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)|pancreas(1)|lung(1)	7						c.(505-507)CTG>GTG		R-spondin family, member 2 precursor							206.0	192.0	197.0					8																	108970419		2203	4300	6503	SO:0001583	missense	340419				Wnt receptor signaling pathway	extracellular region	heparin binding	g.chr8:108970419G>C	AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.505C>G	8.37:g.108970419G>C	ENSP00000276659:p.Leu169Val		Somatic				RSPO2_uc003ymq.2_Missense_Mutation_p.L102V|RSPO2_uc003ymr.2_Missense_Mutation_p.L105V	p.L169V	NM_178565	NP_848660	WXS	Illumina HiSeq	Unspecified	Q6UXX9	RSPO2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)		5	1163	-			169			TSP type-1.		B3KVP0|Q4G0U4|Q8N6X6	Missense_Mutation	SNP	ENST00000276659.5	37	c.505C>G	CCDS6307.1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896310	0.72639	.	.	ENSG00000147655	ENST00000517939;ENST00000517781;ENST00000378439;ENST00000276659;ENST00000521502	D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51	5.6	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.88142	0.6357	N	0.20574	0.59	0.51012	D	0.9999	D;D	0.67145	0.996;0.99	D;P	0.75484	0.986;0.79	D	0.84481	0.0605	10	0.15499	T	0.54	-8.6401	12.1085	0.53825	0.139:0.0:0.861:0.0	.	169;105	Q6UXX9;Q6UXX9-3	RSPO2_HUMAN;.	V	102;105;105;169;102	ENSP00000428940:L102V;ENSP00000427937:L105V;ENSP00000367698:L105V;ENSP00000276659:L169V;ENSP00000428614:L102V	ENSP00000276659:L169V	L	-	1	2	RSPO2	109039595	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.335000	0.65929	1.504000	0.48704	0.563000	0.77884	CTG		0.408	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565		4	159	0	0	0	0.000248	0	4	159				
EFR3A	23167	broad.mit.edu	37	8	132958769	132958769	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:132958769C>T	ENST00000254624.5	+	4	480	c.255C>T	c.(253-255)ctC>ctT	p.L85L	EFR3A_ENST00000519656.1_Silent_p.L49L|EFR3A_ENST00000334503.4_Silent_p.L85L	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	85						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)		p.L85L(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			ACCAACTTCTCATGGCTTGCC	0.418																																							uc003yte.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|breast(1)|central_nervous_system(1)	5						c.(253-255)CTC>CTT		EFR3 homolog A							90.0	77.0	82.0					8																	132958769		2203	4299	6502	SO:0001819	synonymous_variant	23167					plasma membrane	binding	g.chr8:132958769C>T	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.255C>T	8.37:g.132958769C>T			Somatic					p.L85L	NM_015137	NP_055952	WXS	Illumina HiSeq	Unspecified	Q14156	EFR3A_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)		4	456	+	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		85					A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Silent	SNP	ENST00000254624.5	37	c.255C>T	CCDS34942.2																																																																																				0.418	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137		5	36	0	0	0	0.000602	0	5	36				
FAM135B	51059	broad.mit.edu	37	8	139144882	139144882	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:139144882A>G	ENST00000395297.1	-	20	4345	c.4175T>C	c.(4174-4176)tTc>tCc	p.F1392S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1392								p.F1392S(4)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CTTCTCCAGGAAGAGTTCTGA	0.522										HNSCC(54;0.14)																													uc003yuy.2		NA																	4	Substitution - Missense(4)	p.F1392S(2)	ovary(2)|lung(2)	ovary(7)|skin(2)	9						c.(4174-4176)TTC>TCC		hypothetical protein LOC51059							179.0	187.0	184.0					8																	139144882		1954	4149	6103	SO:0001583	missense	51059							g.chr8:139144882A>G	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.4175T>C	8.37:g.139144882A>G	ENSP00000378710:p.Phe1392Ser	HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Missense_Mutation_p.F1293S|FAM135B_uc003yuz.2_RNA	p.F1392S	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		20	4346	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		1392					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.4175T>C	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	A	23.6	4.434611	0.83885	.	.	ENSG00000147724	ENST00000395297	T	0.26957	1.7	5.74	5.74	0.90152	.	0.059495	0.64402	D	0.000002	T	0.54983	0.1892	M	0.82517	2.595	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.61456	-0.7059	10	0.87932	D	0	-24.7186	15.226	0.73352	1.0:0.0:0.0:0.0	.	1392	Q49AJ0	F135B_HUMAN	S	1392	ENSP00000378710:F1392S	ENSP00000378710:F1392S	F	-	2	0	FAM135B	139214064	1.000000	0.71417	1.000000	0.80357	0.590000	0.36582	9.339000	0.96797	2.206000	0.71126	0.482000	0.46254	TTC		0.522	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		5	265	0	0	0	0.001168	0	5	265				
ZNF623	9831	broad.mit.edu	37	8	144733502	144733502	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:144733502A>G	ENST00000501748.2	+	1	1549	c.1460A>G	c.(1459-1461)tAt>tGt	p.Y487C	ZNF623_ENST00000458270.2_Missense_Mutation_p.Y447C|ZNF623_ENST00000526926.1_Missense_Mutation_p.Y447C	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	487					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y487C(2)		endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GAGAAGCTCTATGAATGTAGT	0.403																																							uc003yzd.2		NA																	2	Substitution - Missense(2)		urinary_tract(1)|lung(1)		0						c.(1459-1461)TAT>TGT		zinc finger protein 623 isoform 1							89.0	87.0	88.0					8																	144733502		2203	4300	6503	SO:0001583	missense	9831				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:144733502A>G	AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.1460A>G	8.37:g.144733502A>G	ENSP00000445979:p.Tyr487Cys		Somatic				ZNF623_uc011lkp.1_Missense_Mutation_p.Y447C|ZNF623_uc003yzc.2_Missense_Mutation_p.Y447C	p.Y487C	NM_014789	NP_055604	WXS	Illumina HiSeq	Unspecified	O75123	ZN623_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		1	1549	+	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		487					A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	ENST00000501748.2	37	c.1460A>G	CCDS34957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.28|10.28	1.306060|1.306060	0.23736|0.23736	.|.	.|.	ENSG00000183309|ENSG00000183309	ENST00000328466|ENST00000526926;ENST00000458270;ENST00000532796;ENST00000501748	.|T;T;T	.|0.63913	.|-0.07;-0.07;-0.07	4.93|4.93	4.93|4.93	0.64822|0.64822	.|Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	T|T	0.75708|0.75708	0.3886|0.3886	M|M	0.70108|0.70108	2.13|2.13	0.09310|0.09310	N|N	0.999999|0.999999	.|D	.|0.67145	.|0.996	.|P	.|0.62649	.|0.905	T|T	0.67795|0.67795	-0.5578|-0.5578	6|9	0.87932|0.87932	D|D	0|0	-15.1947|-15.1947	12.7996|12.7996	0.57578|0.57578	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|487	.|O75123	.|ZN623_HUMAN	V|C	447|447;447;487;487	.|ENSP00000435232:Y447C;ENSP00000411139:Y447C;ENSP00000445979:Y487C	ENSP00000330358:M447V|ENSP00000411139:Y447C	M|Y	+|+	1|2	0|0	ZNF623|ZNF623	144804645|144804645	0.000000|0.000000	0.05858|0.05858	0.813000|0.813000	0.32504|0.32504	0.864000|0.864000	0.49448|0.49448	0.567000|0.567000	0.23608|0.23608	1.967000|1.967000	0.57214|0.57214	0.402000|0.402000	0.26972|0.26972	ATG|TAT		0.403	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382522.3	NM_014789		27	65	0	0	0	0.004656	0	27	65				
PPP1R16A	84988	broad.mit.edu	37	8	145724389	145724389	+	Silent	SNP	C	C	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr8:145724389C>T	ENST00000292539.4	+	4	1338	c.421C>T	c.(421-423)Ctg>Ttg	p.L141L	CTD-2517M22.14_ENST00000532766.1_RNA|PPP1R16A_ENST00000435887.1_Silent_p.L141L|CTD-2517M14.5_ENST00000569326.1_RNA			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	141						plasma membrane (GO:0005886)		p.L141L(1)		NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CTGGACGCCTCTGCATGCTGC	0.622																																							uc003zdd.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(421-423)CTG>TTG		protein phosphatase 1, regulatory (inhibitor)							62.0	48.0	53.0					8																	145724389		2203	4300	6503	SO:0001819	synonymous_variant	84988					plasma membrane	protein binding	g.chr8:145724389C>T		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.421C>T	8.37:g.145724389C>T			Somatic				uc003zde.1_5'Flank|PPP1R16A_uc003zdf.2_Silent_p.L141L	p.L141L	NM_032902	NP_116291	WXS	Illumina HiSeq	Unspecified	Q96I34	PP16A_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		4	1334	+	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		141			ANK 3.		D3DWM5	Silent	SNP	ENST00000292539.4	37	c.421C>T	CCDS6429.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839138	0.51057	.	.	ENSG00000255182	ENST00000527086	.	.	.	5.0	1.91	0.25777	.	.	.	.	.	T	0.61022	0.2314	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60141	-0.7321	5	0.87932	D	0	.	6.5266	0.22305	0.0:0.675:0.1441:0.1809	.	.	.	.	K	17	.	ENSP00000437304:R17K	R	-	2	0	CTD-2517M22.14	145695197	0.680000	0.27605	0.987000	0.45799	0.951000	0.60555	1.251000	0.32862	0.440000	0.26502	0.462000	0.41574	AGA		0.622	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382459.1	NM_032902		6	51	0	0	0	0.001168	0	6	51				
SLC28A3	64078	broad.mit.edu	37	9	86903009	86903009	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr9:86903009C>G	ENST00000376238.4	-	12	1283	c.1234G>C	c.(1234-1236)Gaa>Caa	p.E412Q	RP11-380F14.2_ENST00000419815.1_RNA|SLC28A3_ENST00000537648.1_Missense_Mutation_p.E343Q	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	412					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)	p.E412Q(1)		endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	TTAGGTTTTTCTGTCTCAGGC	0.463																																					Ovarian(106;425 1539 34835 42413 43572)	Ovarian(106;425 1539 34835 42413 43572)	uc010mpz.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						c.(1234-1236)GAA>CAA		concentrative Na+-nucleoside cotransporter							162.0	165.0	164.0					9																	86903009		2203	4300	6503	SO:0001583	missense	64078				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding	g.chr9:86903009C>G	AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1234G>C	9.37:g.86903009C>G	ENSP00000365413:p.Glu412Gln		Somatic				SLC28A3_uc011lsy.1_Missense_Mutation_p.E343Q|SLC28A3_uc004anu.1_Missense_Mutation_p.E412Q	p.E412Q	NM_022127	NP_071410	WXS	Illumina HiSeq	Unspecified	Q9HAS3	S28A3_HUMAN			12	1359	-			412			Extracellular (Potential).		A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	ENST00000376238.4	37	c.1234G>C	CCDS6670.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695849	0.88830	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	T;T	0.08282	3.11;3.11	5.6	4.69	0.59074	Na dependent nucleoside transporter, C-terminal (1);	0.150760	0.64402	D	0.000017	T	0.32285	0.0824	M	0.89715	3.055	0.48288	D	0.999626	D	0.56287	0.975	P	0.62014	0.897	T	0.10613	-1.0622	10	0.56958	D	0.05	-26.1998	14.2567	0.66058	0.0:0.9284:0.0:0.0716	.	412	Q9HAS3	S28A3_HUMAN	Q	412;343	ENSP00000365413:E412Q;ENSP00000446438:E343Q	ENSP00000365413:E412Q	E	-	1	0	SLC28A3	86092829	0.997000	0.39634	1.000000	0.80357	0.992000	0.81027	2.576000	0.46033	2.786000	0.95864	0.561000	0.74099	GAA		0.463	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052874.1	NM_022127		5	130	0	0	0	0.000602	0	5	130				
SH3KBP1	30011	broad.mit.edu	37	X	19560190	19560190	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chrX:19560190C>G	ENST00000397821.3	-	16	2035	c.1745G>C	c.(1744-1746)gGa>gCa	p.G582A	SH3KBP1_ENST00000379698.4_Missense_Mutation_p.G545A|SH3KBP1_ENST00000541422.1_Missense_Mutation_p.G321A|SH3KBP1_ENST00000379716.1_Missense_Mutation_p.G344A	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	582					apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.G582A(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						GGCTCTGTGTCCAGCTGTTCC	0.667																																							uc004czm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1744-1746)GGA>GCA		SH3-domain kinase binding protein 1 isoform a							69.0	66.0	67.0					X																	19560190		2203	4300	6503	SO:0001583	missense	30011				apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding	g.chrX:19560190C>G	AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.1745G>C	X.37:g.19560190C>G	ENSP00000380921:p.Gly582Ala		Somatic				SH3KBP1_uc011mje.1_Missense_Mutation_p.G321A|SH3KBP1_uc011mjf.1_Missense_Mutation_p.G344A|SH3KBP1_uc004czl.2_Missense_Mutation_p.G545A|SH3KBP1_uc010nfm.2_Missense_Mutation_p.G27A	p.G582A	NM_031892	NP_114098	WXS	Illumina HiSeq	Unspecified	Q96B97	SH3K1_HUMAN			16	2061	-			582					B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Missense_Mutation	SNP	ENST00000397821.3	37	c.1745G>C	CCDS14193.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.976905	0.53720	.	.	ENSG00000147010	ENST00000379702;ENST00000397821;ENST00000379716;ENST00000379698;ENST00000541422;ENST00000379726	T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78	5.54	5.54	0.83059	.	0.601453	0.18193	N	0.148774	T	0.27629	0.0679	L	0.54323	1.7	0.48696	D	0.99969	B;B;B	0.24483	0.104;0.104;0.104	B;B;B	0.21546	0.035;0.014;0.035	T	0.03008	-1.1083	10	0.29301	T	0.29	-15.9982	15.5969	0.76590	0.0:1.0:0.0:0.0	.	344;582;545	Q5JPT4;Q96B97;Q5JPT5	.;SH3K1_HUMAN;.	A	567;582;344;545;321;562	ENSP00000380921:G582A;ENSP00000369039:G344A;ENSP00000369020:G545A;ENSP00000442499:G321A;ENSP00000369049:G562A	ENSP00000369020:G545A	G	-	2	0	SH3KBP1	19470111	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.154000	0.64894	2.333000	0.79357	0.529000	0.55759	GGA		0.667	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892		14	32	0	0	0	0.00245	0	14	32				
FAM104B	90736	broad.mit.edu	37	X	55170248	55170248	+	Silent	SNP	G	G	C			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chrX:55170248G>C	ENST00000358460.4	-	4	465	c.312C>G	c.(310-312)ctC>ctG	p.L104L	FAM104B_ENST00000478918.1_5'Flank|FAM104B_ENST00000332132.4_Silent_p.L105L			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	104								p.L105L(1)		endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						GTGAAGTATTGAGTTTTATTT	0.353																																							uc004duh.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(310-312)CTC>CTG		hypothetical protein LOC90736							145.0	125.0	132.0					X																	55170248		2203	4300	6503	SO:0001819	synonymous_variant	90736							g.chrX:55170248G>C	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.312C>G	X.37:g.55170248G>C			Somatic				FAM104B_uc004dug.1_Silent_p.L105L	p.L104L	NM_138362	NP_612371	WXS	Illumina HiSeq	Unspecified	Q5XKR9	F104B_HUMAN			4	332	-			104					A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Silent	SNP	ENST00000358460.4	37	c.312C>G	CCDS35305.2																																																																																				0.353	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056851.1	NM_138362		24	75	0	0	0	0.004656	0	24	75				
MAGEE1	57692	broad.mit.edu	37	X	75648398	75648398	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chrX:75648398G>T	ENST00000361470.2	+	1	353	c.75G>T	c.(73-75)tgG>tgT	p.W25C		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	25						dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.W25C(2)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						ACAGCAGCTGGGGCGAAATGC	0.667																																							uc004ecm.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(3)|ovary(1)|pancreas(1)|skin(1)	6						c.(73-75)TGG>TGT		melanoma antigen family E, 1							18.0	17.0	18.0					X																	75648398		2197	4289	6486	SO:0001583	missense	57692					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane		g.chrX:75648398G>T	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.75G>T	X.37:g.75648398G>T	ENSP00000354912:p.Trp25Cys		Somatic					p.W25C	NM_020932	NP_065983	WXS	Illumina HiSeq	Unspecified	Q9HCI5	MAGE1_HUMAN			1	282	+			25					Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	ENST00000361470.2	37	c.75G>T	CCDS14433.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.352319	0.24512	.	.	ENSG00000198934	ENST00000361470	T	0.03124	4.04	2.27	2.27	0.28462	.	.	.	.	.	T	0.02119	0.0066	N	0.08118	0	0.37333	D	0.910048	D	0.63046	0.992	B	0.41332	0.354	T	0.59658	-0.7413	9	0.72032	D	0.01	.	7.1767	0.25749	0.0:0.0:1.0:0.0	.	25	Q9HCI5	MAGE1_HUMAN	C	25	ENSP00000354912:W25C	ENSP00000354912:W25C	W	+	3	0	MAGEE1	75564802	0.001000	0.12720	0.774000	0.31636	0.248000	0.25809	0.301000	0.19174	1.385000	0.46445	0.556000	0.70494	TGG		0.667	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932		7	2	1	0	1.6384e-10	0.001984	2.68667e-10	7	2				
KLHL4	56062	broad.mit.edu	37	X	86921487	86921487	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chrX:86921487A>G	ENST00000373119.4	+	11	2255	c.2110A>G	c.(2110-2112)Aac>Gac	p.N704D	KLHL4_ENST00000373114.4_Intron	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	704						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.N704D(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						AGTTCCTGTTAACATTGGAAG	0.318																																							uc004efb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(2110-2112)AAC>GAC		kelch-like 4 isoform 1							154.0	137.0	142.0					X																	86921487		2203	4300	6503	SO:0001583	missense	56062					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding	g.chrX:86921487A>G	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.2110A>G	X.37:g.86921487A>G	ENSP00000362211:p.Asn704Asp		Somatic				KLHL4_uc004efa.2_Intron	p.N704D	NM_019117	NP_061990	WXS	Illumina HiSeq	Unspecified	Q9C0H6	KLHL4_HUMAN			11	2292	+			704			Kelch 6.		B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	c.2110A>G	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.594559	0.46214	.	.	ENSG00000102271	ENST00000373119	T	0.66815	-0.23	4.11	4.11	0.48088	Galactose oxidase, beta-propeller (1);	.	.	.	.	T	0.67590	0.2909	M	0.72479	2.2	0.80722	D	1	P	0.43314	0.803	P	0.45071	0.468	T	0.68428	-0.5411	9	0.41790	T	0.15	.	10.2812	0.43541	1.0:0.0:0.0:0.0	.	704	Q9C0H6	KLHL4_HUMAN	D	704	ENSP00000362211:N704D	ENSP00000362211:N704D	N	+	1	0	KLHL4	86808143	1.000000	0.71417	0.998000	0.56505	0.838000	0.47535	5.492000	0.66893	1.622000	0.50330	0.339000	0.21740	AAC		0.318	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1			3	39	0	0	0	0.004672	0	3	39				
KLHL13	90293	broad.mit.edu	37	X	117079539	117079539	+	Splice_Site	SNP	C	C	G			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chrX:117079539C>G	ENST00000262820.3	-	2	1008		c.e2-1		KLHL13_ENST00000540167.1_Splice_Site|KLHL13_ENST00000539496.1_Splice_Site|KLHL13_ENST00000469946.1_Splice_Site|KLHL13_ENST00000371882.1_Splice_Site|KLHL13_ENST00000545703.1_Splice_Site|KLHL13_ENST00000371876.1_5'UTR|KLHL13_ENST00000371878.1_Splice_Site|KLHL13_ENST00000541812.1_Splice_Site	NM_033495.3	NP_277030.2	Q9P2N7	KLH13_HUMAN	kelch-like family member 13						cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)		p.?(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						CACGAGAGATCTGAAAGTTTT	0.378																																							uc004eql.2		NA																	1	Unknown(1)		lung(1)	kidney(1)|skin(1)	2						c.e2-1		kelch-like 13							57.0	50.0	52.0					X																	117079539		2203	4300	6503	SO:0001630	splice_region_variant	90293				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex		g.chrX:117079539C>G	AB037730	CCDS14571.1, CCDS55479.1, CCDS55480.1, CCDS55481.1	Xq23-q24	2013-01-30	2013-01-30	2004-02-18	ENSG00000003096	ENSG00000003096		"""Kelch-like"", ""BTB/POZ domain containing"""	22931	protein-coding gene	gene with protein product		300655	"""BTB and kelch domain containing 2, KIAA1309"", ""kelch-like 13 (Drosophila)"""	BKLHD2, KIAA1309		10718198	Standard	NM_033495		Approved	FLJ10262	uc011mtp.2	Q9P2N7	OTTHUMG00000022252	ENST00000262820.3:c.99-1G>C	X.37:g.117079539C>G			Somatic				KLHL13_uc004eqk.2_5'UTR|KLHL13_uc011mtn.1_Splice_Site|KLHL13_uc011mto.1_Splice_Site_p.R27_splice|KLHL13_uc011mtp.1_Splice_Site_p.G35_splice|KLHL13_uc004eqm.2_Splice_Site|KLHL13_uc011mtq.1_Splice_Site_p.R17_splice	p.I33_splice	NM_033495	NP_277030	WXS	Illumina HiSeq	Unspecified	Q9P2N7	KLH13_HUMAN			2	161	-								B3KV78|B3KWM7|B7Z3S9|B7Z5P2|B7Z802|D3DWH6|Q6P2E3|Q96QI7|Q9UDN9	Splice_Site	SNP	ENST00000262820.3	37	c.99_splice	CCDS14571.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.486315	0.63962	.	.	ENSG00000003096	ENST00000541812;ENST00000540167;ENST00000539496;ENST00000262820	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4339	0.83864	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KLHL13	116963567	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	6.919000	0.75793	2.490000	0.84030	0.594000	0.82650	.		0.378	KLHL13-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_033495	Intron	5	13	0	0	0	0.001168	0	5	13				
IGSF1	3547	broad.mit.edu	37	X	130420592	130420592	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chrX:130420592C>A	ENST00000361420.3	-	2	136	c.57G>T	c.(55-57)ttG>ttT	p.L19F	IGSF1_ENST00000370900.1_Missense_Mutation_p.L19F|IGSF1_ENST00000370910.1_Missense_Mutation_p.L19F|IGSF1_ENST00000370903.3_Missense_Mutation_p.L19F|IGSF1_ENST00000370904.1_Missense_Mutation_p.L19F|IGSF1_ENST00000370901.4_Missense_Mutation_p.L19F			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	19					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.L19F(2)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TGCAAAAGAGCAAAACAGTGA	0.527																																							uc004ewd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(1)|central_nervous_system(1)	5						c.(55-57)TTG>TTT		immunoglobulin superfamily, member 1 isoform 1							142.0	106.0	118.0					X																	130420592		2203	4300	6503	SO:0001583	missense	3547				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding	g.chrX:130420592C>A	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.57G>T	X.37:g.130420592C>A	ENSP00000355010:p.Leu19Phe		Somatic				IGSF1_uc004ewe.3_Missense_Mutation_p.L8F|IGSF1_uc004ewf.2_Missense_Mutation_p.L8F|IGSF1_uc004ewg.2_Missense_Mutation_p.L19F	p.L19F	NM_001555	NP_001546	WXS	Illumina HiSeq	Unspecified	Q8N6C5	IGSF1_HUMAN			2	295	-			19					B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	c.57G>T	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	C	10.28	1.306839	0.23821	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903;ENST00000370901;ENST00000370900	T;T;T;T;T;T	0.00816	5.68;5.69;5.68;5.66;6.3;6.3	4.24	3.38	0.38709	.	3.535590	0.00691	N	0.000732	T	0.01189	0.0039	N	0.24115	0.695	0.31086	N	0.711312	B;B;B	0.10296	0.003;0.003;0.001	B;B;B	0.11329	0.006;0.004;0.003	T	0.36040	-0.9764	10	0.59425	D	0.04	.	7.1616	0.25667	0.0:0.8783:0.0:0.1217	.	19;19;19	Q8N6C5-3;Q8N6C5-2;Q8N6C5	.;.;IGSF1_HUMAN	F	19	ENSP00000359947:L19F;ENSP00000355010:L19F;ENSP00000359941:L19F;ENSP00000359940:L19F;ENSP00000359938:L19F;ENSP00000359937:L19F	ENSP00000355010:L19F	L	-	3	2	IGSF1	130248273	1.000000	0.71417	0.992000	0.48379	0.498000	0.33706	0.916000	0.28651	1.146000	0.42352	0.589000	0.80489	TTG		0.527	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			5	41	1	0	0.000602214	0.000602	0.000902018	5	41				
PCDH11Y	83259	broad.mit.edu	37	Y	4968620	4968620	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chrY:4968620G>A	ENST00000333703.4	+	5	3481	c.2968G>A	c.(2968-2970)Gat>Aat	p.D990N	PCDH11Y_ENST00000215473.6_Missense_Mutation_p.D1001N|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.D1001N	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	1001					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D1001N(2)|p.D990N(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						ACTGCCTCTCGATAACACCTT	0.498																																							uc004fqo.2		NA																	3	Substitution - Missense(3)		lung(3)		0						c.(3001-3003)GAT>AAT		protocadherin 11 Y-linked isoform c																																				SO:0001583	missense	83259				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chrY:4968620G>A	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.2968G>A	Y.37:g.4968620G>A	ENSP00000330552:p.Asp990Asn		Somatic				PCDH11Y_uc010nwg.1_Missense_Mutation_p.D990N|PCDH11Y_uc004fql.1_Missense_Mutation_p.D990N|PCDH11Y_uc004fqm.1_Missense_Mutation_p.D990N|PCDH11Y_uc004fqn.1_Missense_Mutation_p.D1001N|PCDH11Y_uc004fqp.1_Missense_Mutation_p.D772N	p.D1001N	NM_032973	NP_116755	WXS	Illumina HiSeq	Unspecified	Q9BZA8	PC11Y_HUMAN			2	3735	+			1001			Cytoplasmic (Potential).		Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	c.3001G>A	CCDS14776.1																																																																																				0.498	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973		6	128	0	0	0	0.001984	0	6	128				
OR10Z1	128368	broad.mit.edu	37	1	158577073	158577073	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr1:158577073delC	ENST00000361284.1	+	1	845	c.845delC	c.(844-846)accfs	p.T282fs		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					ACTGTAGTGACCCCCCTCCTT	0.458																																							uc010pio.1		NA																	0				pancreas(1)|skin(1)	2						c.(844-846)ACCfs		olfactory receptor, family 10, subfamily Z,							229.0	231.0	230.0					1																	158577073		2203	4300	6503	SO:0001589	frameshift_variant	128368				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158577073delC	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.845delC	1.37:g.158577073delC	ENSP00000354707:p.Thr282fs		Somatic					p.T282fs	NM_001004478	NP_001004478	WXS	Illumina HiSeq	Unspecified	Q8NGY1	O10Z1_HUMAN			1	845	+	all_hematologic(112;0.0378)		282			Helical; Name=7; (Potential).		Q5VYL0|Q6IFR7	Frame_Shift_Del	DEL	ENST00000361284.1	37	c.845delC	CCDS30901.1																																																																																				0.458	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478		21	284	NA	NA	NA	NA	NA	21	284	---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88213425	88213442	+	In_Frame_Del	DEL	TTAAATTAAGCAACACCC	TTAAATTAAGCAACACCC	-			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	TTAAATTAAGCAACACCC	TTAAATTAAGCAACACCC	-	-	TTAAATTAAGCAACACCC	TTAAATTAAGCAACACCC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr10:88213425_88213442delTTAAATTAAGCAACACCC	ENST00000298767.5	-	13	3276_3293	c.2804_2821delGGGTGTTGCTTAATTTAA	c.(2803-2823)ggggtgttgcttaatttaact>gct	p.935_941GVLLNLT>A	WAPAL_ENST00000263070.7_In_Frame_Del_p.202_208GVLLNLT>A|WAPAL_ENST00000372075.1_In_Frame_Del_p.202_208GVLLNLT>A	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	935	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						TTATCATTAGTTAAATTAAGCAACACCCCGATGATGGC	0.394																																							uc001kdo.2		NA																	0				ovary(1)	1						c.(2803-2823)GGGGTGTTGCTTAATTTAACT>GCT		wings apart-like homolog																																				SO:0001651	inframe_deletion	23063				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding	g.chr10:88213425_88213442delTTAAATTAAGCAACACCC	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.2804_2821delGGGTGTTGCTTAATTTAA	10.37:g.88213425_88213442delTTAAATTAAGCAACACCC	ENSP00000298767:p.Gly935_Thr941delinsAla		Somatic				WAPAL_uc009xsv.2_In_Frame_Del_p.249_255GVLLNLT>A|WAPAL_uc001kdn.2_In_Frame_Del_p.972_978GVLLNLT>A|WAPAL_uc009xsw.2_In_Frame_Del_p.929_935GVLLNLT>A	p.935_941GVLLNLT>A	NM_015045	NP_055860	WXS	Illumina HiSeq	Unspecified	Q7Z5K2	WAPL_HUMAN			13	3246_3263	-			935_941			WAPL.		A7E2B5|Q5VSK5|Q8IX10|Q92549	In_Frame_Del	DEL	ENST00000298767.5	37	c.2804_2821delGGGTGTTGCTTAATTTAA	CCDS7375.1																																																																																				0.394	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045		9	96	NA	NA	NA	NA	NA	9	96	---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124957515	124957516	+	Frame_Shift_Ins	INS	-	-	A			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr12:124957515_124957516insA	ENST00000405201.1	-	4	573_574	c.573_574insT	c.(571-576)tctaagfs	p.K192fs	NCOR2_ENST00000397355.1_Frame_Shift_Ins_p.K192fs|NCOR2_ENST00000404121.2_5'UTR|NCOR2_ENST00000404621.1_Frame_Shift_Ins_p.K192fs|NCOR2_ENST00000429285.2_Frame_Shift_Ins_p.K192fs|NCOR2_ENST00000356219.3_Frame_Shift_Ins_p.K192fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	192					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TTCTTCAGCTTAGAGATCTGCT	0.574																																							uc010tba.1		NA																	0				skin(3)|ovary(1)	4						c.(571-576)TCTAAGfs		nuclear receptor co-repressor 2 isoform 2																																				SO:0001589	frameshift_variant	9612				cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity	g.chr12:124957515_124957516insA	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.574dupT	12.37:g.124957516_124957516dupA	ENSP00000384018:p.Lys192fs		Somatic				NCOR2_uc010tay.1_Frame_Shift_Ins_p.S191fs|NCOR2_uc010taz.1_Frame_Shift_Ins_p.S191fs|NCOR2_uc010tbb.1_Frame_Shift_Ins_p.S191fs|NCOR2_uc010tbc.1_Frame_Shift_Ins_p.S191fs|NCOR2_uc001ugj.1_Frame_Shift_Ins_p.S191fs|NCOR2_uc001ugk.1_Frame_Shift_Ins_p.S191fs	p.S191fs	NM_001077261	NP_001070729	WXS	Illumina HiSeq	Unspecified	Q9Y618	NCOR2_HUMAN		Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)	4	690_691	-	all_neural(191;0.0804)|Medulloblastoma(191;0.163)		191_192			Potential.		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Ins	INS	ENST00000405201.1	37	c.573_574insT	CCDS41858.2																																																																																				0.574	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312		22	186	NA	NA	NA	NA	NA	22	186	---	---	---	---
MGA	23269	broad.mit.edu	37	15	42042623	42042629	+	Frame_Shift_Del	DEL	ACTTACT	ACTTACT	-			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	ACTTACT	ACTTACT	-	-	ACTTACT	ACTTACT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr15:42042623_42042629delACTTACT	ENST00000570161.1	+	16	6818_6824	c.6818_6824delACTTACT	c.(6817-6825)cacttactgfs	p.HLL2273fs	MGA_ENST00000389936.4_Frame_Shift_Del_p.HLL2234fs|MGA_ENST00000545763.1_Frame_Shift_Del_p.HLL2064fs|MGA_ENST00000566586.1_Frame_Shift_Del_p.HLL2064fs|MGA_ENST00000219905.7_Frame_Shift_Del_p.HLL2273fs			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTTCAGGGTCACTTACTGCTACCTGGA	0.44																																							uc010ucy.1		NA																	0				ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(6817-6825)CACTTACTGfs		MAX-interacting protein isoform 1																																				SO:0001589	frameshift_variant	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:42042623_42042629delACTTACT	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.6818_6824delACTTACT	15.37:g.42042623_42042629delACTTACT	ENSP00000457035:p.His2273fs		Somatic				MGA_uc010ucz.1_Frame_Shift_Del_p.H2064fs|MGA_uc010uda.1_Frame_Shift_Del_p.H889fs|MGA_uc001zoi.2_Frame_Shift_Del_p.H487fs	p.H2273fs	NM_001164273	NP_001157745	WXS	Illumina HiSeq	Unspecified	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	17	6999_7005	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	2234_2236			Basic motif.		Q0VAX6|Q75ME7|Q86UM5	Frame_Shift_Del	DEL	ENST00000570161.1	37	c.6818_6824delACTTACT	CCDS55959.1																																																																																				0.440	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		12	42	NA	NA	NA	NA	NA	12	42	---	---	---	---
TP53	7157	broad.mit.edu	37	17	7574012	7574012	+	Frame_Shift_Del	DEL	C	C	-	rs17882252	byFrequency	TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr17:7574012delC	ENST00000269305.4	-	10	1204	c.1015delG	c.(1015-1017)gagfs	p.E339fs	TP53_ENST00000359597.4_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.E339fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000420246.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	339	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		E -> K (in a sporadic cancer; somatic mutation; dbSNP:rs17882252). {ECO:0000269|Ref.12}.|E -> Q (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E339*(14)|p.0?(8)|p.E339fs*8(2)|p.E339Q(1)|p.?(1)|p.F338fs*6(1)|p.F338_E339>L(1)|p.E339fs*13(1)|p.I332fs*5(1)|p.E339K(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGAACATCTCGAAGCGCTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		31	Substitution - Nonsense(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Unknown(2)|Deletion - Frameshift(2)|Substitution - Missense(2)	p.E339*(10)|p.0?(7)|p.E339fs*8(2)|p.E339Q(1)|p.?(1)|p.F338fs*6(1)|p.F338_E339>L(1)|p.E339fs*13(1)|p.I332fs*5(1)|p.E339K(1)	upper_aerodigestive_tract(5)|breast(5)|liver(4)|bone(4)|large_intestine(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|pancreas(2)|stomach(1)|oesophagus(1)|ovary(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM984588	TP53	M	rs17882252	c.(1015-1017)GAGfs	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							59.0	46.0	51.0					17																	7574012		2203	4300	6503	SO:0001589	frameshift_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7574012delC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1015delG	17.37:g.7574012delC	ENSP00000269305:p.Glu339fs	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Intron|TP53_uc010cne.1_Intron|TP53_uc010cnf.1_3'UTR|TP53_uc010cng.1_3'UTR|TP53_uc002gii.1_Frame_Shift_Del_p.E207fs|TP53_uc010cnh.1_3'UTR|TP53_uc010cni.1_3'UTR|TP53_uc002gij.2_Frame_Shift_Del_p.E339fs	p.E339fs	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	10	1209	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	339		E -> Q (in a sporadic cancer; somatic mutation).	Oligomerization.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.|Nuclear export signal.|Interaction with HIPK2.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	c.1015delG	CCDS11118.1																																																																																				0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		12	33	NA	NA	NA	NA	NA	12	33	---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10944697	10944697	+	Frame_Shift_Del	DEL	A	A	-			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr21:10944697delA	ENST00000361285.4	-	11	866	c.537delT	c.(535-537)tttfs	p.F179fs	TPTE_ENST00000298232.7_Frame_Shift_Del_p.F161fs|TPTE_ENST00000342420.5_Frame_Shift_Del_p.F141fs|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	179					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ACTTAATGTCAAAAAAAATGT	0.299																																							uc002yip.1		NA																	0				ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(535-537)TTTfs		transmembrane phosphatase with tensin homology							157.0	168.0	164.0					21																	10944697		2203	4300	6503	SO:0001589	frameshift_variant	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10944697delA	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.537delT	21.37:g.10944697delA	ENSP00000355208:p.Phe179fs		Somatic				TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Frame_Shift_Del_p.F161fs|TPTE_uc002yir.1_Frame_Shift_Del_p.F141fs|TPTE_uc010gkv.1_Frame_Shift_Del_p.F41fs	p.F179fs	NM_199261	NP_954870	WXS	Illumina HiSeq	Unspecified	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	11	905	-			179			Helical; (Potential).		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Frame_Shift_Del	DEL	ENST00000361285.4	37	c.537delT	CCDS13560.2																																																																																				0.299	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			8	310	NA	NA	NA	NA	NA	8	310	---	---	---	---
WBSCR28	135886	broad.mit.edu	37	7	73280192	73280193	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:73280192_73280193delCC	ENST00000320531.2	+	3	823_824	c.787_788delCC	c.(787-789)cccfs	p.P263fs		NM_182504.3	NP_872310.2	Q6UE05	WBS28_HUMAN	Williams-Beuren syndrome chromosome region 28	263						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|lung(6)|skin(1)	11		Lung NSC(55;0.159)				GCAAGAAACTCCCAGAGAATAA	0.54																																							uc003tzk.2		NA																	0				breast(1)	1						c.(787-789)CCCfs		hypothetical protein LOC135886																																				SO:0001589	frameshift_variant	135886					integral to membrane		g.chr7:73280192_73280193delCC	BC030643	CCDS43597.1	7q11.23	2006-07-04			ENSG00000175877	ENSG00000175877			23018	protein-coding gene	gene with protein product		612547				8812460	Standard	NM_182504		Approved	MGC26719	uc003tzk.2	Q6UE05	OTTHUMG00000157243	ENST00000320531.2:c.787_788delCC	7.37:g.73280192_73280193delCC	ENSP00000316775:p.Pro263fs		Somatic				RFC2_uc011kfa.1_Intron|WBSCR28_uc003tzl.2_Frame_Shift_Del_p.P162fs	p.P263fs	NM_182504	NP_872310	WXS	Illumina HiSeq	Unspecified	Q6UE05	WBS28_HUMAN			3	823_824	+		Lung NSC(55;0.159)	263					Q6UE04|Q8NHP4	Frame_Shift_Del	DEL	ENST00000320531.2	37	c.787_788delCC	CCDS43597.1																																																																																				0.540	WBSCR28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348130.1	NM_182504		21	147	NA	NA	NA	NA	NA	21	147	---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82544361	82544361	+	Frame_Shift_Del	DEL	A	A	-			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr7:82544361delA	ENST00000333891.9	-	7	13278	c.12941delT	c.(12940-12942)ctafs	p.L4314fs	PCLO_ENST00000437081.1_Frame_Shift_Del_p.L1034fs|PCLO_ENST00000423517.2_Frame_Shift_Del_p.L4314fs	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTCAGTCTTAGGGAAGAGCT	0.453																																							uc003uhx.2		NA																	0				ovary(7)	7						c.(12940-12942)CTAfs		piccolo isoform 1							47.0	45.0	46.0					7																	82544361		1878	4098	5976	SO:0001589	frameshift_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82544361delA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12941delT	7.37:g.82544361delA	ENSP00000334319:p.Leu4314fs		Somatic				PCLO_uc003uhv.2_Frame_Shift_Del_p.L4314fs|PCLO_uc010lec.2_Frame_Shift_Del_p.L1279fs	p.L4314fs	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			7	13230	-			4245			Ser-rich.			Frame_Shift_Del	DEL	ENST00000333891.9	37	c.12941delT	CCDS47630.1																																																																																				0.453	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		7	38	NA	NA	NA	NA	NA	7	38	---	---	---	---
DAPK1	1612	broad.mit.edu	37	9	90315030	90315037	+	Splice_Site	DEL	AGGTTTGG	AGGTTTGG	-			TCGA-55-6712-01A-11D-1855-08	TCGA-55-6712-10A-01D-1855-08	AGGTTTGG	AGGTTTGG	-	-	AGGTTTGG	AGGTTTGG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	bc6eaf2b-9ccc-4ac7-9b19-204b0ff420a3	46dd81ba-62e9-42bb-8a84-461d79531d24	g.chr9:90315030_90315037delAGGTTTGG	ENST00000408954.3	+	24	3085_3091	c.2750_2756delAGGTTTGG	c.(2749-2757)aaggtttgg>ag	p.KVW917fs	DAPK1_ENST00000491893.1_Splice_Site_p.KVW851fs|DAPK1_ENST00000472284.1_Splice_Site_p.KVW917fs|DAPK1_ENST00000358077.5_Splice_Site_p.KVW917fs|DAPK1_ENST00000469640.2_Splice_Site_p.KVW917fs	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	917					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						CTCTTCCCTTAGGTTTGGAAATGATCTT	0.49									Chronic Lymphocytic Leukemia, Familial Clustering of																														uc004apc.2		NA																	0				ovary(1)|breast(1)	2						c.e24-1		death-associated protein kinase 1																																				SO:0001630	splice_region_variant	1612	Chronic_Lymphocytic_Leukemia_Familial_Clustering_of	Familial Cancer Database	Familial CLL	apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity	g.chr9:90315030_90315037delAGGTTTGG	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.2751-1AGGTTTGG>-	9.37:g.90315030_90315037delAGGTTTGG			Somatic				DAPK1_uc004apd.2_Splice_Site_p.R917_splice|DAPK1_uc011ltg.1_Splice_Site_p.R851_splice|DAPK1_uc011lth.1_Splice_Site_p.R654_splice	p.R917_splice	NM_004938	NP_004929	WXS	Illumina HiSeq	Unspecified	P53355	DAPK1_HUMAN			24	2889	+								B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Splice_Site	DEL	ENST00000408954.3	37	c.2751_splice	CCDS43842.1																																																																																				0.490	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	Frame_Shift_Del	11	82	NA	NA	NA	NA	NA	11	82	---	---	---	---
