#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
HCRTR1	3061	broad.mit.edu	37	1	32084987	32084987	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:32084987C>T	ENST00000373706.5	+	1	347	c.194C>T	c.(193-195)aCg>aTg	p.T65M	HCRTR1_ENST00000468521.1_3'UTR|HCRTR1_ENST00000403528.2_Missense_Mutation_p.T65M|HCRTR1_ENST00000373705.1_Missense_Mutation_p.T65M			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	65					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		GTGGGCAACACGCTGGGTAGG	0.602																																							uc009vtx.2		NA																	0				ovary(1)	1						c.(193-195)ACG>ATG		orexin receptor 1							97.0	98.0	98.0					1																	32084987		2203	4300	6503	SO:0001583	missense	3061				feeding behavior|neuropeptide signaling pathway|synaptic transmission	integral to plasma membrane		g.chr1:32084987C>T	AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.194C>T	1.37:g.32084987C>T	ENSP00000362810:p.Thr65Met		Somatic				HCRTR1_uc001btb.2_Intron|HCRTR1_uc001btc.3_Missense_Mutation_p.R39C|HCRTR1_uc001btd.2_Missense_Mutation_p.T65M|HCRTR1_uc010ogl.1_Missense_Mutation_p.T65M	p.T65M	NM_001525	NP_001516	WXS	Illumina HiSeq	Unspecified	O43613	OX1R_HUMAN		STAD - Stomach adenocarcinoma(196;0.053)	3	579	+		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)	65			Helical; Name=1; (Potential).		A8K3A6|Q9HBV6	Missense_Mutation	SNP	ENST00000373706.5	37	c.194C>T	CCDS344.1	.	.	.	.	.	.	.	.	.	.	C	4.406	0.074963	0.08485	.	.	ENSG00000121764	ENST00000403528;ENST00000373706;ENST00000373705	T;T;T	0.04234	3.67;3.67;3.67	4.3	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.803221	0.11558	N	0.552097	T	0.04679	0.0127	L	0.35723	1.085	0.25130	N	0.990571	B;B	0.22746	0.074;0.002	B;B	0.26202	0.067;0.004	T	0.39961	-0.9588	10	0.41790	T	0.15	.	5.8915	0.18915	0.0:0.5842:0.0:0.4158	.	65;65	A6NMV7;O43613	.;OX1R_HUMAN	M	65	ENSP00000384387:T65M;ENSP00000362810:T65M;ENSP00000362809:T65M	ENSP00000362809:T65M	T	+	2	0	HCRTR1	31857574	0.100000	0.21855	0.329000	0.25429	0.069000	0.16628	0.461000	0.21940	0.518000	0.28383	-0.880000	0.02959	ACG		0.602	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011042.1	NM_001525		18	58	0	0	0	0.000566183	0	18	58				
PTPRF	5792	broad.mit.edu	37	1	44071216	44071216	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:44071216G>T	ENST00000359947.4	+	19	3746	c.3406G>T	c.(3406-3408)Gtg>Ttg	p.V1136L	PTPRF_ENST00000438120.1_Missense_Mutation_p.V1127L|PTPRF_ENST00000422171.2_Missense_Mutation_p.V484L|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372413.3_Missense_Mutation_p.V1127L|PTPRF_ENST00000372414.3_Missense_Mutation_p.V1136L	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1136					cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTACATTGTTGTGGTGCCCAT	0.637																																							uc001cjr.2		NA																	0				ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10						c.(3406-3408)GTG>TTG		protein tyrosine phosphatase, receptor type, F							140.0	108.0	119.0					1																	44071216		2203	4300	6503	SO:0001583	missense	5792				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity	g.chr1:44071216G>T	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.3406G>T	1.37:g.44071216G>T	ENSP00000353030:p.Val1136Leu		Somatic				PTPRF_uc001cjs.2_Missense_Mutation_p.V1127L|PTPRF_uc001cju.2_Missense_Mutation_p.V514L|PTPRF_uc009vwt.2_Missense_Mutation_p.V696L|PTPRF_uc001cjv.2_Missense_Mutation_p.V596L|PTPRF_uc001cjw.2_Missense_Mutation_p.V362L	p.V1136L	NM_002840	NP_002831	WXS	Illumina HiSeq	Unspecified	P10586	PTPRF_HUMAN			19	3746	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	1136			Extracellular (Potential).		D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	c.3406G>T	CCDS489.2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	21.9|21.9|21.9	4.219870|4.219870|4.219870	0.79464|0.79464|0.79464	.|.|.	.|.|.	ENSG00000142949|ENSG00000142949|ENSG00000142949	ENST00000412568;ENST00000414879|ENST00000429895|ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407	.|.|T;T;T;T;T;T	.|.|0.59083	.|.|0.29;0.31;0.29;0.31;2.23;3.88	5.18|5.18|5.18	4.25|4.25|4.25	0.50352|0.50352|0.50352	.|.|.	.|.|0.000000	.|.|0.31347	.|.|N	.|.|0.007811	T|T|T	0.73567|0.73567|0.73567	0.3603|0.3603|0.3603	M|M|M	0.73962|0.73962|0.73962	2.25|2.25|2.25	0.58432|0.58432|0.58432	D|D|D	0.999992|0.999992|0.999992	.|.|P;D;P;B;D	.|.|0.71674	.|.|0.756;0.995;0.949;0.135;0.998	.|.|B;D;P;B;D	.|.|0.77557	.|.|0.391;0.916;0.465;0.158;0.99	T|T|T	0.74942|0.74942|0.74942	-0.3492|-0.3492|-0.3492	5|5|10	.|.|0.51188	.|.|T	.|.|0.08	.|.|.	13.4665|13.4665|13.4665	0.61256|0.61256|0.61256	0.0756:0.0:0.9244:0.0|0.0756:0.0:0.9244:0.0|0.0756:0.0:0.9244:0.0	.|.|.	.|.|781;484;702;1127;1136	.|.|Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586	.|.|.;.;.;.;PTPRF_HUMAN	F|F|L	508;549|781|1136;1127;1136;1127;484;197	.|.|ENSP00000353030:V1136L;ENSP00000398822:V1127L;ENSP00000361491:V1136L;ENSP00000361490:V1127L;ENSP00000387885:V484L;ENSP00000361484:V197L	.|.|ENSP00000353030:V1136L	C|L|V	+|+|+	2|3|1	0|2|0	PTPRF|PTPRF|PTPRF	43843803|43843803|43843803	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.921000|0.921000|0.921000	0.55340|0.55340|0.55340	6.855000|6.855000|6.855000	0.75445|0.75445|0.75445	2.600000|2.600000|2.600000	0.87896|0.87896|0.87896	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	TGT|TTG|GTG		0.637	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1			8	42	1	0	2.17888e-05	0.000442599	0.000287145	8	42				
MCOLN2	255231	broad.mit.edu	37	1	85405312	85405312	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:85405312C>A	ENST00000370608.3	-	9	1101	c.1034G>T	c.(1033-1035)gGc>gTc	p.G345V	MCOLN2_ENST00000284027.5_Missense_Mutation_p.G317V|MCOLN2_ENST00000531325.1_5'UTR	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	345					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		GACATACCAGCCGTTGATGAA	0.423																																							uc001dkm.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(1033-1035)GGC>GTC		mucolipin 2							91.0	87.0	88.0					1																	85405312		2203	4300	6503	SO:0001583	missense	255231					integral to membrane	ion channel activity	g.chr1:85405312C>A	AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.1034G>T	1.37:g.85405312C>A	ENSP00000359640:p.Gly345Val		Somatic				MCOLN2_uc001dkn.2_Intron	p.G345V	NM_153259	NP_694991	WXS	Illumina HiSeq	Unspecified	Q8IZK6	MCLN2_HUMAN		all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)	9	1275	-			345			Helical; (Potential).		A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	ENST00000370608.3	37	c.1034G>T	CCDS30762.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.203557	0.38905	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.77489	-1.1;-1.1	5.18	4.27	0.50696	.	0.120643	0.56097	D	0.000029	T	0.74824	0.3767	M	0.80183	2.485	0.80722	D	1	P	0.51933	0.949	P	0.50860	0.652	T	0.75010	-0.3468	10	0.17369	T	0.5	-30.191	13.7179	0.62710	0.0:0.9254:0.0:0.0746	.	345	Q8IZK6	MCLN2_HUMAN	V	345;317	ENSP00000359640:G345V;ENSP00000284027:G317V	ENSP00000284027:G317V	G	-	2	0	MCOLN2	85177900	0.979000	0.34478	0.070000	0.20053	0.734000	0.41952	4.570000	0.60872	1.187000	0.43000	0.563000	0.77884	GGC		0.423	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	NM_153259		23	49	1	0	7.41877e-09	0.000229342	1.05299e-07	23	49				
FLG	2312	broad.mit.edu	37	1	152277995	152277995	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:152277995C>T	ENST00000368799.1	-	3	9402	c.9367G>A	c.(9367-9369)Ggg>Agg	p.G3123R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3123	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGTGGTACCCCTGCCTTCCT	0.607									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(9367-9369)GGG>AGG		filaggrin							88.0	125.0	113.0					1																	152277995		2191	4286	6477	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152277995C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9367G>A	1.37:g.152277995C>T	ENSP00000357789:p.Gly3123Arg		Somatic					p.G3123R	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	9403	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3123			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.9367G>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	11.04	1.520709	0.27211	.	.	ENSG00000143631	ENST00000368799	T	0.01665	4.7	3.66	-3.45	0.04781	.	.	.	.	.	T	0.00815	0.0027	M	0.79805	2.47	0.09310	N	1	B	0.34290	0.447	B	0.29440	0.102	T	0.35798	-0.9774	9	0.29301	T	0.29	.	6.1659	0.20390	0.0:0.3714:0.4383:0.1903	.	3123	P20930	FILA_HUMAN	R	3123	ENSP00000357789:G3123R	ENSP00000357789:G3123R	G	-	1	0	FLG	150544619	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.738000	0.04871	-0.499000	0.06623	0.449000	0.29647	GGG		0.607	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		12	399	0	0	0	0.000958276	0	12	399				
DUSP27	92235	broad.mit.edu	37	1	167097506	167097506	+	Silent	SNP	A	A	G	rs145187556		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:167097506A>G	ENST00000361200.2	+	6	3304	c.3138A>G	c.(3136-3138)ccA>ccG	p.P1046P	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Silent_p.P1046P|DUSP27_ENST00000443333.1_Silent_p.P1046P			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1046					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GCCGGACCCCAGAGTCCTCAG	0.577													A|||	1	0.000199681	0.0008	0.0	5008	,	,		18058	0.0		0.0	False		,,,				2504	0.0						uc001geb.1		NA																	0				ovary(3)	3						c.(3136-3138)CCA>CCG		dual specificity phosphatase 27		A		11,4395	16.8+/-37.8	0,11,2192	31.0	36.0	34.0		3138	-10.5	0.0	1	dbSNP_134	34	0,8600		0,0,4300	no	coding-synonymous	DUSP27	NM_001080426.1		0,11,6492	GG,GA,AA		0.0,0.2497,0.0846		1046/1159	167097506	11,12995	2203	4300	6503	SO:0001819	synonymous_variant	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167097506A>G	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3138A>G	1.37:g.167097506A>G			Somatic					p.P1046P	NM_001080426	NP_001073895	WXS	Illumina HiSeq	Unspecified	Q5VZP5	DUS27_HUMAN			5	3138	+			1046					A0AUM4|Q9C074	Silent	SNP	ENST00000361200.2	37	c.3138A>G	CCDS30932.1																																																																																				0.577	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		5	32	0	0	0	8.12818e-05	0	5	32				
ASPM	259266	broad.mit.edu	37	1	197102670	197102670	+	Silent	SNP	A	A	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:197102670A>T	ENST00000367409.4	-	6	2485	c.2229T>A	c.(2227-2229)ccT>ccA	p.P743P	ASPM_ENST00000294732.7_Silent_p.P743P|ASPM_ENST00000367408.1_5'UTR	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	743					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TAGGTGCTCTAGGAACACTTA	0.373																																							uc001gtu.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(2227-2229)CCT>CCA		asp (abnormal spindle)-like, microcephaly							90.0	83.0	86.0					1																	197102670		2203	4300	6503	SO:0001819	synonymous_variant	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197102670A>T	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.2229T>A	1.37:g.197102670A>T			Somatic				ASPM_uc001gtv.2_Silent_p.P743P|ASPM_uc001gtw.3_Intron	p.P743P	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			6	2486	-			743					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	37	c.2229T>A	CCDS1389.1																																																																																				0.373	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		4	33	0	0	0	0.00024832	0	4	33				
PIK3C2B	5287	broad.mit.edu	37	1	204433733	204433733	+	Splice_Site	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:204433733C>T	ENST00000367187.3	-	5	1591		c.e5-1		PIK3C2B_ENST00000424712.2_Splice_Site	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			AGATCGAAGGCTGTACAGGAA	0.522																																							uc001haw.2		NA																	0				lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7						c.e5-1		phosphoinositide-3-kinase, class 2 beta							85.0	87.0	86.0					1																	204433733		2203	4300	6503	SO:0001630	splice_region_variant	5287				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding	g.chr1:204433733C>T	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.1035-1G>A	1.37:g.204433733C>T			Somatic				PIK3C2B_uc010pqv.1_Splice_Site_p.I345_splice|PIK3C2B_uc001hax.1_Splice_Site_p.I345_splice|PIK3C2B_uc009xbd.1_Splice_Site	p.I345_splice	NM_002646	NP_002637	WXS	Illumina HiSeq	Unspecified	O00750	P3C2B_HUMAN	GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)		5	1514	-	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)							O95666|Q5SW99	Splice_Site	SNP	ENST00000367187.3	37	c.1035_splice	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.817981	0.50633	.	.	ENSG00000133056	ENST00000367187;ENST00000424712;ENST00000438854;ENST00000367184	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7749	0.85548	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PIK3C2B	202700356	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	5.131000	0.64751	2.723000	0.93209	0.655000	0.94253	.		0.522	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	Intron	11	56	0	0	0	0.00010058	0	11	56				
PLXNA2	5362	broad.mit.edu	37	1	208390136	208390136	+	Nonsense_Mutation	SNP	C	C	A	rs144926586		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:208390136C>A	ENST00000367033.3	-	2	1889	c.1132G>T	c.(1132-1134)Gag>Tag	p.E378*		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	378	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		AGGTTGCCCTCGCCCTGGTAG	0.622																																							uc001hgz.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1132-1134)GAG>TAG		plexin A2 precursor							76.0	71.0	73.0					1																	208390136		2203	4300	6503	SO:0001587	stop_gained	5362				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr1:208390136C>A	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.1132G>T	1.37:g.208390136C>A	ENSP00000356000:p.Glu378*		Somatic				PLXNA2_uc001hha.3_Nonsense_Mutation_p.E432*	p.E378*	NM_025179	NP_079455	WXS	Illumina HiSeq	Unspecified	O75051	PLXA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.199)	2	1890	-			378			Extracellular (Potential).|Sema.		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Nonsense_Mutation	SNP	ENST00000367033.3	37	c.1132G>T	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	46	12.634099	0.99684	.	.	ENSG00000076356	ENST00000367033	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	20.1346	0.98019	0.0:1.0:0.0:0.0	.	.	.	.	X	378	.	ENSP00000356000:E378X	E	-	1	0	PLXNA2	206456759	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	5.734000	0.68580	2.765000	0.95021	0.655000	0.94253	GAG		0.622	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179		7	45	1	0	3.09899e-07	0.000274275	4.27486e-06	7	45				
PLXNA2	5362	broad.mit.edu	37	1	208390870	208390870	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:208390870T>A	ENST00000367033.3	-	2	1155	c.398A>T	c.(397-399)tAc>tTc	p.Y133F		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	133	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GACCCCCTGGTAGAGGCTCCC	0.582																																							uc001hgz.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(397-399)TAC>TTC		plexin A2 precursor							98.0	104.0	102.0					1																	208390870		2203	4300	6503	SO:0001583	missense	5362				axon guidance	integral to membrane|intracellular|plasma membrane		g.chr1:208390870T>A	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.398A>T	1.37:g.208390870T>A	ENSP00000356000:p.Tyr133Phe		Somatic				PLXNA2_uc001hha.3_Missense_Mutation_p.Y187F	p.Y133F	NM_025179	NP_079455	WXS	Illumina HiSeq	Unspecified	O75051	PLXA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.199)	2	1156	-			133			Extracellular (Potential).|Sema.		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	c.398A>T	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	T	11.17	1.559000	0.27827	.	.	ENSG00000076356	ENST00000367033	T	0.04049	3.72	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.64402	D	0.000001	T	0.05640	0.0148	L	0.35723	1.085	0.58432	D	0.999998	B;P	0.47604	0.08;0.898	B;P	0.46796	0.114;0.527	T	0.44034	-0.9354	10	0.07482	T	0.82	.	10.2397	0.43305	0.0:0.0739:0.0:0.9261	.	187;133	O75051-2;O75051	.;PLXA2_HUMAN	F	133	ENSP00000356000:Y133F	ENSP00000356000:Y133F	Y	-	2	0	PLXNA2	206457493	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.006000	0.70724	2.150000	0.67090	0.421000	0.28195	TAC		0.582	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179		31	104	0	0	0	0.000279167	0	31	104				
SDCCAG8	10806	broad.mit.edu	37	1	243419506	243419506	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:243419506G>A	ENST00000366541.3	+	1	149	c.31G>A	c.(31-33)Gag>Aag	p.E11K	SDCCAG8_ENST00000355875.4_Missense_Mutation_p.E11K|CEP170_ENST00000366544.1_5'Flank|SDCCAG8_ENST00000391846.1_Missense_Mutation_p.E11K|SDCCAG8_ENST00000343783.6_5'UTR|CEP170_ENST00000366542.1_5'Flank|CEP170_ENST00000366543.1_5'Flank	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	11					establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		CTCTACCCTGGAGGAGATTCT	0.607																																							uc001hzw.2		NA																	0					0						c.(31-33)GAG>AAG		serologically defined colon cancer antigen 8							78.0	78.0	78.0					1																	243419506		2203	4300	6503	SO:0001583	missense	10806				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding	g.chr1:243419506G>A	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.31G>A	1.37:g.243419506G>A	ENSP00000355499:p.Glu11Lys		Somatic				CEP170_uc001hzs.2_5'Flank|CEP170_uc001hzt.2_5'Flank|CEP170_uc001hzu.2_5'Flank|SDCCAG8_uc010pyk.1_5'UTR|SDCCAG8_uc010pyl.1_5'UTR	p.E11K	NM_006642	NP_006633	WXS	Illumina HiSeq	Unspecified	Q86SQ7	SDCG8_HUMAN	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)	1	187	+	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	11					O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	ENST00000366541.3	37	c.31G>A	CCDS31075.1	.	.	.	.	.	.	.	.	.	.	G	35	5.586942	0.96578	.	.	ENSG00000054282	ENST00000355875;ENST00000391846;ENST00000366541	T;T	0.60548	0.18;0.41	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000002	T	0.71508	0.3348	L	0.60455	1.87	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.68864	-0.5296	10	0.40728	T	0.16	-15.9094	14.5925	0.68378	0.0:0.0:1.0:0.0	.	11	Q86SQ7	SDCG8_HUMAN	K	11	ENSP00000348137:E11K;ENSP00000355499:E11K	ENSP00000348137:E11K	E	+	1	0	SDCCAG8	241486129	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.235000	0.58666	2.826000	0.97356	0.563000	0.77884	GAG		0.607	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642		9	58	0	0	0	0.000442599	0	9	58				
OR2L13	284521	broad.mit.edu	37	1	248263055	248263055	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:248263055C>A	ENST00000358120.2	+	2	523	c.378C>A	c.(376-378)tgC>tgA	p.C126*	OR2L13_ENST00000366478.2_Nonsense_Mutation_p.C126*			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TGGCCATCTGCCACTCTCTCT	0.502																																							uc001ids.2		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(376-378)TGC>TGA		olfactory receptor, family 2, subfamily L,							221.0	208.0	212.0					1																	248263055		2203	4300	6503	SO:0001587	stop_gained	284521				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding	g.chr1:248263055C>A	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.378C>A	1.37:g.248263055C>A	ENSP00000350836:p.Cys126*		Somatic					p.C126*	NM_175911	NP_787107	WXS	Illumina HiSeq	Unspecified	Q8N349	OR2LD_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0132)		3	715	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		126			Cytoplasmic (Potential).		Q5VUR5	Nonsense_Mutation	SNP	ENST00000358120.2	37	c.378C>A	CCDS1637.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.848036	0.51164	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	.	.	.	4.31	-3.49	0.04724	.	0.123265	0.37483	N	0.002079	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.2075	0.25915	0.0:0.5299:0.1099:0.3602	.	.	.	.	X	126	.	ENSP00000350836:C126X	C	+	3	2	OR2L13	246329678	0.000000	0.05858	0.211000	0.23655	0.291000	0.27294	-1.623000	0.02040	-0.570000	0.06022	0.650000	0.86243	TGC		0.502	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911		25	243	1	0	3.08376e-08	0.00047179	4.33489e-07	25	243				
OR2T1	26696	broad.mit.edu	37	1	248569566	248569566	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:248569566G>T	ENST00000366474.1	+	1	271	c.271G>T	c.(271-273)Gcc>Tcc	p.A91S		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CGCACTGATGGCCAATGGGGT	0.433																																							uc010pzm.1		NA																	0				pancreas(1)	1						c.(271-273)GCC>TCC		olfactory receptor, family 2, subfamily T,							162.0	146.0	151.0					1																	248569566		2203	4300	6503	SO:0001583	missense	26696				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248569566G>T	U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.271G>T	1.37:g.248569566G>T	ENSP00000355430:p.Ala91Ser		Somatic					p.A91S	NM_030904	NP_112166	WXS	Illumina HiSeq	Unspecified	O43869	OR2T1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	271	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		91			Helical; Name=1; (Potential).		Q6IEZ9	Missense_Mutation	SNP	ENST00000366474.1	37	c.271G>T	CCDS31115.1	.	.	.	.	.	.	.	.	.	.	g	8.711	0.912156	0.17907	.	.	ENSG00000175143	ENST00000366474	T	0.37584	1.19	4.71	2.84	0.33178	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36591	U	0.002507	T	0.20820	0.0501	N	0.13140	0.3	0.09310	N	1	B	0.25719	0.132	B	0.24006	0.05	T	0.16041	-1.0416	10	0.46703	T	0.11	.	9.8644	0.41134	0.1704:0.0:0.8296:0.0	.	91	O43869	OR2T1_HUMAN	S	91	ENSP00000355430:A91S	ENSP00000355430:A91S	A	+	1	0	OR2T1	246636189	0.001000	0.12720	0.233000	0.24025	0.320000	0.28249	1.021000	0.30040	0.592000	0.29728	0.557000	0.71058	GCC		0.433	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097346.2			28	100	1	0	3.65163e-15	0.00106085	6.26721e-14	28	100				
KIAA1462	57608	broad.mit.edu	37	10	30317017	30317017	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr10:30317017C>G	ENST00000375377.1	-	3	2161	c.2060G>C	c.(2059-2061)aGa>aCa	p.R687T		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	687					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						TTGCTGATCTCTGTACCGGTG	0.527																																							uc001iux.2		NA																	0				ovary(4)	4						c.(2059-2061)AGA>ACA		hypothetical protein LOC57608							116.0	111.0	112.0					10																	30317017		1953	4142	6095	SO:0001583	missense	57608							g.chr10:30317017C>G	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.2060G>C	10.37:g.30317017C>G	ENSP00000364526:p.Arg687Thr		Somatic				KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.R549T|KIAA1462_uc009xle.1_Missense_Mutation_p.R687T	p.R687T	NM_020848	NP_065899	WXS	Illumina HiSeq	Unspecified	Q9P266	K1462_HUMAN			2	2119	-			687					Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	37	c.2060G>C	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365338	0.41902	.	.	ENSG00000165757	ENST00000375377	T	0.18338	2.22	5.62	3.78	0.43462	.	0.199323	0.52532	D	0.000077	T	0.34861	0.0912	M	0.70275	2.135	0.37595	D	0.920336	D	0.76494	0.999	D	0.68192	0.956	T	0.25398	-1.0133	10	0.72032	D	0.01	-18.6604	6.9429	0.24502	0.0:0.6204:0.0:0.3796	.	687	Q9P266	K1462_HUMAN	T	687	ENSP00000364526:R687T	ENSP00000364526:R687T	R	-	2	0	KIAA1462	30357023	1.000000	0.71417	0.970000	0.41538	0.032000	0.12392	2.628000	0.46477	0.745000	0.32763	0.561000	0.74099	AGA		0.527	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848		14	51	0	0	0	0.000422831	0	14	51				
TET1	80312	broad.mit.edu	37	10	70432756	70432756	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr10:70432756G>A	ENST00000373644.4	+	8	4987	c.4778G>A	c.(4777-4779)aGc>aAc	p.S1593N		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1593	Interaction with DNA. {ECO:0000250}.				chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TTTGGTAGAAGCCCAAGCCCC	0.368																																							uc001jok.3		NA																	0				ovary(5)|lung(2)|prostate(1)|breast(1)	9						c.(4777-4779)AGC>AAC		CXXC finger 6							154.0	144.0	148.0					10																	70432756		2203	4300	6503	SO:0001583	missense	80312				DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding	g.chr10:70432756G>A	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.4778G>A	10.37:g.70432756G>A	ENSP00000362748:p.Ser1593Asn		Somatic				TET1_uc009xpw.1_RNA	p.S1593N	NM_030625	NP_085128	WXS	Illumina HiSeq	Unspecified	Q8NFU7	TET1_HUMAN			8	5283	+			1593					Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	c.4778G>A	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.439421	0.83885	.	.	ENSG00000138336	ENST00000373644;ENST00000545846	T	0.14144	2.53	5.36	5.36	0.76844	TET cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.29061	0.0722	M	0.84219	2.685	0.58432	D	0.99999	B	0.27450	0.179	B	0.34590	0.186	T	0.11916	-1.0568	10	0.87932	D	0	.	19.4366	0.94798	0.0:0.0:1.0:0.0	.	1593	Q8NFU7	TET1_HUMAN	N	1593;65	ENSP00000362748:S1593N	ENSP00000362748:S1593N	S	+	2	0	TET1	70102762	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.767000	0.98960	2.669000	0.90835	0.585000	0.79938	AGC		0.368	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625		10	75	0	0	0	0.000978159	0	10	75				
TNKS2	80351	broad.mit.edu	37	10	93608227	93608227	+	Nonsense_Mutation	SNP	A	A	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr10:93608227A>T	ENST00000371627.4	+	19	2825	c.2446A>T	c.(2446-2448)Aga>Tga	p.R816*		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	816					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				CAATGGTGTGAGAAGCCCAGG	0.537																																							uc001khp.2		NA																	0				kidney(3)|skin(3)|ovary(1)|lung(1)	8						c.(2446-2448)AGA>TGA		tankyrase, TRF1-interacting ankyrin-related							98.0	90.0	93.0					10																	93608227		2203	4300	6503	SO:0001587	stop_gained	80351				positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding	g.chr10:93608227A>T	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.2446A>T	10.37:g.93608227A>T	ENSP00000360689:p.Arg816*		Somatic					p.R816*	NM_025235	NP_079511	WXS	Illumina HiSeq	Unspecified	Q9H2K2	TNKS2_HUMAN			19	2743	+		Colorectal(252;0.162)	816					B2RBD3|Q9H8F2|Q9HAS4	Nonsense_Mutation	SNP	ENST00000371627.4	37	c.2446A>T	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	A	43	10.147454	0.99346	.	.	ENSG00000107854	ENST00000371627	.	.	.	5.98	3.46	0.39613	.	0.136270	0.37577	N	0.002021	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	12.6287	0.56644	0.4913:0.5086:0.0:0.0	.	.	.	.	X	816	.	ENSP00000360689:R816X	R	+	1	2	TNKS2	93598207	0.432000	0.25554	1.000000	0.80357	0.970000	0.65996	1.023000	0.30065	1.041000	0.40125	0.482000	0.46254	AGA		0.537	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235		9	80	0	0	0	0.000442599	0	9	80				
HPSE2	60495	broad.mit.edu	37	10	100380391	100380391	+	Silent	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr10:100380391G>A	ENST00000370552.3	-	8	1232	c.1173C>T	c.(1171-1173)aaC>aaT	p.N391N	HPSE2_ENST00000370546.1_Silent_p.N391N|HPSE2_ENST00000404542.1_Silent_p.N279N|HPSE2_ENST00000370549.1_Silent_p.N333N	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	391					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CGGATAGATTGTTTGTGCCTC	0.483																																							uc001kpn.1		NA																	0				ovary(1)	1						c.(1171-1173)AAC>AAT		heparanase 2							118.0	102.0	107.0					10																	100380391		2203	4300	6503	SO:0001819	synonymous_variant	60495				carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity	g.chr10:100380391G>A	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1173C>T	10.37:g.100380391G>A			Somatic				HPSE2_uc009xwc.1_Silent_p.N381N|HPSE2_uc001kpo.1_Silent_p.N323N|HPSE2_uc009xwd.1_Silent_p.N269N	p.N391N	NM_021828	NP_068600	WXS	Illumina HiSeq	Unspecified	Q8WWQ2	HPSE2_HUMAN		Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)	8	1233	-			391					Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	ENST00000370552.3	37	c.1173C>T	CCDS7477.1																																																																																				0.483	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828		8	38	0	0	0	0.000442599	0	8	38				
ANO3	63982	broad.mit.edu	37	11	26463564	26463564	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr11:26463564G>C	ENST00000256737.3	+	2	998	c.146G>C	c.(145-147)aGc>aCc	p.S49T	ANO3_ENST00000531646.1_Missense_Mutation_p.S49T|ANO3_ENST00000537978.1_Missense_Mutation_p.S33T|ANO3_ENST00000525139.1_Missense_Mutation_p.S33T	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	49					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						TACTCAAAGAGCTTGAGCCAG	0.473																																							uc001mqt.3		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(145-147)AGC>ACC		transmembrane protein 16C							163.0	166.0	165.0					11																	26463564		2203	4300	6503	SO:0001583	missense	63982					chloride channel complex	chloride channel activity	g.chr11:26463564G>C	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.146G>C	11.37:g.26463564G>C	ENSP00000256737:p.Ser49Thr		Somatic				ANO3_uc010rdr.1_Missense_Mutation_p.S33T	p.S49T	NM_031418	NP_113606	WXS	Illumina HiSeq	Unspecified	Q9BYT9	ANO3_HUMAN			2	291	+			49			Cytoplasmic (Potential).		B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	37	c.146G>C	CCDS31447.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.271066	0.40194	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000531646	T;T;T;T	0.62639	0.01;0.01;0.01;0.01	5.24	0.188	0.15114	.	0.159801	0.53938	D	0.000043	T	0.33498	0.0865	N	0.14661	0.345	0.28055	N	0.933212	B	0.20368	0.044	B	0.19148	0.024	T	0.12426	-1.0548	10	0.11794	T	0.64	.	4.2409	0.10647	0.3559:0.1628:0.4813:0.0	.	49	Q9BYT9	ANO3_HUMAN	T	33;33;49;49	ENSP00000440737:S33T;ENSP00000432576:S33T;ENSP00000256737:S49T;ENSP00000435275:S49T	ENSP00000256737:S49T	S	+	2	0	ANO3	26420140	0.958000	0.32768	0.948000	0.38648	0.912000	0.54170	1.053000	0.30442	0.136000	0.18733	0.650000	0.86243	AGC		0.473	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418		54	185	0	0	0	0.000781405	0	54	185				
LRP4	4038	broad.mit.edu	37	11	46924362	46924362	+	Missense_Mutation	SNP	G	G	C	rs142946526		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr11:46924362G>C	ENST00000378623.1	-	2	413	c.171C>G	c.(169-171)tgC>tgG	p.C57W		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	57	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		TGTGGTCCCCGCAGTCATTGT	0.592																																							uc001ndn.3		NA																	0				skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(169-171)TGC>TGG		low density lipoprotein receptor-related protein							89.0	83.0	85.0					11																	46924362		2201	4299	6500	SO:0001583	missense	4038				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity	g.chr11:46924362G>C	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.171C>G	11.37:g.46924362G>C	ENSP00000367888:p.Cys57Trp		Somatic				LRP4_uc009ylh.1_Intron	p.C57W	NM_002334	NP_002325	WXS	Illumina HiSeq	Unspecified	O75096	LRP4_HUMAN		Lung(87;0.159)	2	317	-			57			Extracellular (Potential).|LDL-receptor class A 1.		B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	c.171C>G	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.017592	0.54576	.	.	ENSG00000134569	ENST00000378623	D	0.99919	-8.0	5.59	1.12	0.20585	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99932	0.9969	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97344	0.9959	10	0.87932	D	0	.	9.9251	0.41487	0.6227:0.0:0.3773:0.0	.	57	O75096	LRP4_HUMAN	W	57	ENSP00000367888:C57W	ENSP00000367888:C57W	C	-	3	2	LRP4	46880938	0.070000	0.21116	0.998000	0.56505	0.977000	0.68977	-0.444000	0.06854	-0.086000	0.12550	-1.105000	0.02106	TGC		0.592	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334		5	48	0	0	0	0.000602214	0	5	48				
OR8I2	120586	broad.mit.edu	37	11	55861302	55861302	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr11:55861302C>G	ENST00000302124.2	+	1	550	c.519C>G	c.(517-519)atC>atG	p.I173M		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					ATTCCAGCATCAATCATTTTT	0.448																																							uc010rix.1		NA																	0				breast(1)	1						c.(517-519)ATC>ATG		olfactory receptor, family 8, subfamily I,							159.0	150.0	153.0					11																	55861302		2201	4296	6497	SO:0001583	missense	120586				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55861302C>G	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.519C>G	11.37:g.55861302C>G	ENSP00000303864:p.Ile173Met		Somatic					p.I173M	NM_001003750	NP_001003750	WXS	Illumina HiSeq	Unspecified	Q8N0Y5	OR8I2_HUMAN			1	519	+	Esophageal squamous(21;0.00693)		173			Extracellular (Potential).		B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	ENST00000302124.2	37	c.519C>G	CCDS31517.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.333209	0.24167	.	.	ENSG00000172154	ENST00000302124	T	0.00220	8.52	4.33	0.665	0.17896	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41001	U	0.000972	T	0.00524	0.0017	M	0.93808	3.46	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.50030	-0.8875	10	0.87932	D	0	-18.0194	1.6856	0.02841	0.1385:0.4116:0.1361:0.3138	.	173	Q8N0Y5	OR8I2_HUMAN	M	173	ENSP00000303864:I173M	ENSP00000303864:I173M	I	+	3	3	OR8I2	55617878	0.000000	0.05858	0.993000	0.49108	0.254000	0.26022	-2.223000	0.01214	0.364000	0.24374	0.440000	0.28878	ATC		0.448	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750		17	113	0	0	0	0.00074312	0	17	113				
ATM	472	broad.mit.edu	37	11	108117855	108117855	+	Splice_Site	SNP	G	G	C	rs201089102		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr11:108117855G>C	ENST00000452508.2	+	9	1254		c.e9+1		ATM_ENST00000278616.4_Splice_Site			Q13315	ATM_HUMAN	ATM serine/threonine kinase						brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CTGTCACCAGGTACAGTAAGT	0.338			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		0				haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.e8+1	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							56.0	57.0	57.0					11																	108117855		2201	4296	6497	SO:0001630	splice_region_variant	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108117855G>C	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1065+1G>C	11.37:g.108117855G>C		TSP Lung(14;0.12)	Somatic				ATM_uc009yxr.1_Splice_Site_p.Q355_splice	p.Q355_splice	NM_000051	NP_000042	WXS	Illumina HiSeq	Unspecified	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	8	1450	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)						B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Splice_Site	SNP	ENST00000452508.2	37	c.1065_splice	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681211	0.88542	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8868	0.96915	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATM	107623065	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.141000	0.94612	2.709000	0.92574	0.655000	0.94253	.		0.338	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	Intron	6	31	0	0	0	8.12818e-05	0	6	31				
CACNA1C	775	broad.mit.edu	37	12	2693732	2693732	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr12:2693732C>T	ENST00000347598.4	+	16	2288	c.2288C>T	c.(2287-2289)aCa>aTa	p.T763I	CACNA1C_ENST00000399637.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399655.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399595.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000327702.7_Missense_Mutation_p.T763I|CACNA1C_ENST00000399603.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399606.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399621.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399629.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399641.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399634.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000402845.3_Missense_Mutation_p.T763I|CACNA1C_ENST00000335762.5_Missense_Mutation_p.T788I|CACNA1C_ENST00000399617.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000406454.3_Missense_Mutation_p.T763I|CACNA1C_ENST00000399649.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399644.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399597.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399591.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399601.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000399638.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000480911.1_Missense_Mutation_p.T763I|CACNA1C_ENST00000344100.3_Missense_Mutation_p.T763I	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	763					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGAGCCTCACATCTGCCCaa	0.517																																							uc009zdu.1		NA																	0				ovary(10)|central_nervous_system(1)	11						c.(2287-2289)ACA>ATA		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						68.0	74.0	72.0					12																	2693732		1998	4193	6191	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2693732C>T	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.2288C>T	12.37:g.2693732C>T	ENSP00000266376:p.Thr763Ile		Somatic				CACNA1C_uc009zdv.1_Missense_Mutation_p.T760I|CACNA1C_uc001qkb.2_Missense_Mutation_p.T763I|CACNA1C_uc001qkc.2_Missense_Mutation_p.T763I|CACNA1C_uc001qke.2_Missense_Mutation_p.T763I|CACNA1C_uc001qkf.2_Missense_Mutation_p.T763I|CACNA1C_uc001qjz.2_Missense_Mutation_p.T763I|CACNA1C_uc001qkd.2_Missense_Mutation_p.T763I|CACNA1C_uc001qkg.2_Missense_Mutation_p.T763I|CACNA1C_uc009zdw.1_Missense_Mutation_p.T763I|CACNA1C_uc001qkh.2_Missense_Mutation_p.T763I|CACNA1C_uc001qkl.2_Missense_Mutation_p.T763I|CACNA1C_uc001qkn.2_Missense_Mutation_p.T763I|CACNA1C_uc001qko.2_Missense_Mutation_p.T763I|CACNA1C_uc001qkp.2_Missense_Mutation_p.T763I|CACNA1C_uc001qkr.2_Missense_Mutation_p.T763I|CACNA1C_uc001qku.2_Missense_Mutation_p.T763I|CACNA1C_uc001qkq.2_Missense_Mutation_p.T763I|CACNA1C_uc001qks.2_Missense_Mutation_p.T763I|CACNA1C_uc001qkt.2_Missense_Mutation_p.T763I|CACNA1C_uc001qka.1_Missense_Mutation_p.T298I|CACNA1C_uc001qki.1_Missense_Mutation_p.T499I|CACNA1C_uc001qkj.1_Missense_Mutation_p.T499I|CACNA1C_uc001qkk.1_Missense_Mutation_p.T499I|CACNA1C_uc001qkm.1_Missense_Mutation_p.T499I|CACNA1C_uc001qkw.2_Missense_Mutation_p.T52I	p.T763I	NM_199460	NP_955630	WXS	Illumina HiSeq	Unspecified	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	16	2601	+			763			Cytoplasmic (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	c.2288C>T	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562968	0.86335	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96745	-4.04;-4.04;-4.05;-4.04;-4.03;-4.04;-4.06;-3.96;-4.01;-4.05;-3.97;-3.98;-4.05;-4.08;-3.96;-3.89;-4.11;-4.06;-4.04;-4.08;-3.98;-4.08;-4.11	4.71	4.71	0.59529	.	0.052127	0.85682	D	0.000000	D	0.98220	0.9411	M	0.86028	2.79	0.80722	D	1	D;D;P;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D	0.89917	1.0;0.999;0.936;0.998;0.999;1.0;1.0;1.0;0.962;0.993;1.0;1.0;0.985;0.999;0.999;1.0;0.999;0.982;1.0;0.749;0.999;1.0;1.0;1.0;0.997;1.0	D;D;P;D;D;D;D;D;P;P;D;D;P;D;D;D;D;P;D;B;D;D;D;D;D;D	0.91635	0.997;0.973;0.615;0.986;0.997;0.998;0.996;0.998;0.786;0.905;0.998;0.996;0.863;0.999;0.991;0.996;0.994;0.884;0.998;0.406;0.994;0.998;0.998;0.996;0.991;0.996	D	0.99316	1.0905	10	0.87932	D	0	.	17.8449	0.88727	0.0:1.0:0.0:0.0	.	763;760;763;763;763;763;763;763;763;763;763;763;734;763;763;763;763;763;763;763;763;763;763;763;763;763	Q13936-14;Q13936-35;Q13936;E9PDI6;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	I	788;763;763;763;763;763;763;763;763;763;763;763;763;763;763;763;763;763;763;763;763;763;763;604	ENSP00000336982:T788I;ENSP00000382563:T763I;ENSP00000437936:T763I;ENSP00000382552:T763I;ENSP00000382547:T763I;ENSP00000382506:T763I;ENSP00000382530:T763I;ENSP00000382546:T763I;ENSP00000382500:T763I;ENSP00000382549:T763I;ENSP00000266376:T763I;ENSP00000382515:T763I;ENSP00000382510:T763I;ENSP00000341092:T763I;ENSP00000382537:T763I;ENSP00000329877:T763I;ENSP00000382557:T763I;ENSP00000385724:T763I;ENSP00000382512:T763I;ENSP00000382542:T763I;ENSP00000382526:T763I;ENSP00000385896:T763I;ENSP00000382504:T763I	ENSP00000323129:T604I	T	+	2	0	CACNA1C	2563993	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	4.530000	0.60595	2.452000	0.82932	0.561000	0.74099	ACA		0.517	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		13	69	0	0	0	0.000151284	0	13	69				
SLCO1B1	10599	broad.mit.edu	37	12	21358836	21358836	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr12:21358836C>A	ENST00000256958.2	+	11	1462	c.1366C>A	c.(1366-1368)Ctt>Att	p.L456I		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	456	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	AGATGTACCACTTTCTTATTG	0.383																																							uc001req.3		NA																	0				ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8						c.(1366-1368)CTT>ATT		solute carrier organic anion transporter family,	Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)						116.0	112.0	113.0					12																	21358836		2203	4300	6503	SO:0001583	missense	10599				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity	g.chr12:21358836C>A		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.1366C>A	12.37:g.21358836C>A	ENSP00000256958:p.Leu456Ile		Somatic					p.L456I	NM_006446	NP_006437	WXS	Illumina HiSeq	Unspecified	Q9Y6L6	SO1B1_HUMAN			11	1470	+			456			Extracellular (Potential).|Kazal-like.		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	c.1366C>A	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	C	9.012	0.982654	0.18889	.	.	ENSG00000134538	ENST00000256958	T	0.40476	1.03	4.06	1.72	0.24424	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.34828	N	0.003645	T	0.37461	0.1004	M	0.67953	2.075	0.23758	N	0.996923	B	0.32302	0.363	B	0.35114	0.196	T	0.34976	-0.9807	10	0.62326	D	0.03	.	4.7396	0.13007	0.0:0.592:0.2154:0.1925	.	456	Q9Y6L6	SO1B1_HUMAN	I	456	ENSP00000256958:L456I	ENSP00000256958:L456I	L	+	1	0	SLCO1B1	21250103	0.991000	0.36638	0.999000	0.59377	0.485000	0.33311	0.497000	0.22514	0.664000	0.31047	-0.458000	0.05436	CTT		0.383	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446		7	47	1	0	8.12818e-05	8.12818e-05	0.00104323	7	47				
SYT10	341359	broad.mit.edu	37	12	33592376	33592376	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr12:33592376G>A	ENST00000228567.3	-	1	378	c.82C>T	c.(82-84)Cag>Tag	p.Q28*	SYT10_ENST00000535526.1_5'UTR	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	28					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					CACTCCACCTGGCCGGCGAAG	0.622																																							uc001rll.1		NA																	0				ovary(1)|skin(1)	2						c.(82-84)CAG>TAG		synaptotagmin X							190.0	177.0	181.0					12																	33592376		2203	4300	6503	SO:0001587	stop_gained	341359					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr12:33592376G>A	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.82C>T	12.37:g.33592376G>A	ENSP00000228567:p.Gln28*		Somatic				SYT10_uc009zju.1_5'UTR	p.Q28*	NM_198992	NP_945343	WXS	Illumina HiSeq	Unspecified	Q6XYQ8	SYT10_HUMAN			1	379	-	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)		28			Vesicular (Potential).		Q495U2	Nonsense_Mutation	SNP	ENST00000228567.3	37	c.82C>T	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	G	41	8.995001	0.99029	.	.	ENSG00000110975	ENST00000228567	.	.	.	4.41	4.41	0.53225	.	0.000000	0.37483	U	0.002063	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	16.4521	0.83994	0.0:0.0:1.0:0.0	.	.	.	.	X	28	.	ENSP00000228567:Q28X	Q	-	1	0	SYT10	33483643	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.196000	0.77805	2.376000	0.81061	0.655000	0.94253	CAG		0.622	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992		31	150	0	0	0	0.000279167	0	31	150				
DPY19L2	283417	broad.mit.edu	37	12	64038229	64038229	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr12:64038229T>A	ENST00000324472.4	-	6	940	c.757A>T	c.(757-759)Aat>Tat	p.N253Y	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	253					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		ATTAGTCCATTTAAAATAAAG	0.363																																							uc001srp.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(757-759)AAT>TAT		dpy-19-like 2							25.0	26.0	26.0					12																	64038229		2196	4284	6480	SO:0001583	missense	283417				multicellular organismal development|spermatid development	integral to membrane		g.chr12:64038229T>A		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.757A>T	12.37:g.64038229T>A	ENSP00000315988:p.Asn253Tyr		Somatic				DPY19L2_uc009zqk.1_RNA	p.N253Y	NM_173812	NP_776173	WXS	Illumina HiSeq	Unspecified	Q6NUT2	D19L2_HUMAN	GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)	6	938	-			253			Helical; (Potential).		A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	c.757A>T	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413866	0.42817	.	.	ENSG00000177990	ENST00000324472	T	0.56275	0.47	2.36	2.36	0.29203	.	0.000000	0.85682	U	0.000000	T	0.65821	0.2728	M	0.76328	2.33	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.64850	-0.6310	9	.	.	.	.	6.565	0.22507	0.0:0.0:0.0:1.0	.	253	Q6NUT2	D19L2_HUMAN	Y	253	ENSP00000315988:N253Y	.	N	-	1	0	DPY19L2	62324496	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	4.940000	0.63533	1.084000	0.41184	0.163000	0.16589	AAT		0.363	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812		14	30	0	0	0	0.000958276	0	14	30				
CAND1	55832	broad.mit.edu	37	12	67696217	67696217	+	Missense_Mutation	SNP	A	A	G	rs375779560		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr12:67696217A>G	ENST00000545606.1	+	8	1552	c.1115A>G	c.(1114-1116)tAc>tGc	p.Y372C		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	372					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CCAGAATTCTACAAGACCGTC	0.423																																							uc001stn.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1114-1116)TAC>TGC		TIP120 protein							207.0	193.0	198.0					12																	67696217		2203	4300	6503	SO:0001583	missense	55832				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding	g.chr12:67696217A>G		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.1115A>G	12.37:g.67696217A>G	ENSP00000442318:p.Tyr372Cys		Somatic				CAND1_uc001sto.2_Missense_Mutation_p.Y50C	p.Y372C	NM_018448	NP_060918	WXS	Illumina HiSeq	Unspecified	Q86VP6	CAND1_HUMAN	GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)	8	1552	+			372			HEAT 9.		B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	c.1115A>G	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.597551	0.87055	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047;ENST00000544619	T;T	0.65549	-0.16;-0.16	5.66	5.66	0.87406	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82268	0.5000	M	0.88377	2.95	0.80722	D	1	D;D	0.76494	0.999;0.996	D;P	0.79784	0.993;0.906	D	0.85299	0.1072	9	.	.	.	-6.0479	16.2026	0.82095	1.0:0.0:0.0:0.0	.	372;372	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	C	372;372;214;80	ENSP00000442318:Y372C;ENSP00000444089:Y80C	.	Y	+	2	0	CAND1	65982484	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.451000	0.80668	2.285000	0.76669	0.533000	0.62120	TAC		0.423	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448		3	133	0	0	0	0.00024832	0	3	133				
GCN1L1	10985	broad.mit.edu	37	12	120595667	120595667	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr12:120595667C>T	ENST00000300648.6	-	26	3085	c.3073G>A	c.(3073-3075)Ggg>Agg	p.G1025R	MIR4498_ENST00000577599.1_RNA	NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1025					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCCACCCGCCCGGGTGGGGTG	0.602																																							uc001txo.2		NA																	0				ovary(4)	4						c.(3073-3075)GGG>AGG		GCN1 general control of amino-acid synthesis							31.0	36.0	34.0					12																	120595667		1923	4121	6044	SO:0001583	missense	10985				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding	g.chr12:120595667C>T	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.3073G>A	12.37:g.120595667C>T	ENSP00000300648:p.Gly1025Arg		Somatic					p.G1025R	NM_006836	NP_006827	WXS	Illumina HiSeq	Unspecified	Q92616	GCN1L_HUMAN			26	3086	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		1025					A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	c.3073G>A	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	C	7.594	0.671293	0.14776	.	.	ENSG00000089154	ENST00000300648	T	0.04809	3.55	6.08	4.2	0.49525	Armadillo-type fold (1);	0.720108	0.14309	N	0.327785	T	0.02807	0.0084	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45991	-0.9223	10	0.16420	T	0.52	.	5.7556	0.18170	0.1678:0.6449:0.1135:0.0739	.	1025	Q92616	GCN1L_HUMAN	R	1025	ENSP00000300648:G1025R	ENSP00000300648:G1025R	G	-	1	0	GCN1L1	119080050	0.000000	0.05858	0.046000	0.18839	0.017000	0.09413	0.723000	0.25939	1.586000	0.49944	0.655000	0.94253	GGG		0.602	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1			10	32	0	0	0	0.000978159	0	10	32				
CLIP1	6249	broad.mit.edu	37	12	122812709	122812709	+	Splice_Site	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr12:122812709C>T	ENST00000540338.1	-	16	3075	c.3034G>A	c.(3034-3036)Gaa>Aaa	p.E1012K	CLIP1_ENST00000302528.7_Splice_Site_p.E1001K|CLIP1_ENST00000361654.4_Splice_Site_p.E890K|CLIP1_ENST00000358808.2_Splice_Site_p.E1001K|CLIP1_ENST00000537178.1_Splice_Site_p.E966K|CLIP1_ENST00000545889.1_Splice_Site_p.E587K			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	1012					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.E1001K(1)		NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		ATTTTCTTTTCCTGCAGAGAC	0.493																																							uc001ucg.1		NA																	1	Substitution - Missense(1)		kidney(1)	ovary(2)|breast(1)	3						c.(3034-3036)GAA>AAA		restin isoform a							158.0	159.0	159.0					12																	122812709		2203	4300	6503	SO:0001630	splice_region_variant	6249				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding	g.chr12:122812709C>T		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.3034-1G>A	12.37:g.122812709C>T			Somatic				CLIP1_uc001uch.1_Missense_Mutation_p.E1001K|CLIP1_uc001uci.1_Missense_Mutation_p.E966K|CLIP1_uc001ucj.1_Missense_Mutation_p.E587K	p.E1012K	NM_002956	NP_002947	WXS	Illumina HiSeq	Unspecified	P30622	CLIP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)	16	3140	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		1012			Potential.		A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	37	c.3034G>A	CCDS58285.1	.	.	.	.	.	.	.	.	.	.	C	12.67	2.008438	0.35415	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000392458;ENST00000537178;ENST00000540338	T;T;T;T;T	0.53640	2.7;0.63;0.63;0.61;0.66	5.35	5.35	0.76521	.	0.167889	0.52532	D	0.000067	T	0.30039	0.0752	N	0.21097	0.63	0.45837	D	0.998705	B;B;B	0.15719	0.014;0.0;0.0	B;B;B	0.19946	0.027;0.004;0.006	T	0.11817	-1.0572	10	0.09843	T	0.71	-11.8769	9.7516	0.40478	0.0:0.8405:0.0:0.1595	.	966;1001;1012	P30622-2;P30622-1;P30622	.;.;CLIP1_HUMAN	K	587;1001;1001;731;43;966;1012	ENSP00000438743:E587K;ENSP00000303585:E1001K;ENSP00000351665:E1001K;ENSP00000445531:E966K;ENSP00000439093:E1012K	ENSP00000303585:E1001K	E	-	1	0	CLIP1	121378662	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.787000	0.47798	2.659000	0.90383	0.655000	0.94253	GAA		0.493	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	Missense_Mutation	13	131	0	0	0	0.000720815	0	13	131				
HS6ST3	266722	broad.mit.edu	37	13	97485353	97485353	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr13:97485353G>C	ENST00000376705.2	+	2	1341	c.1317G>C	c.(1315-1317)agG>agC	p.R439S		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	439					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					AGGAGCGGAGGCTGCAGCGAG	0.597																																							uc001vmw.2		NA																	0				ovary(1)|skin(1)	2						c.(1315-1317)AGG>AGC		heparan sulfate 6-O-sulfotransferase 3							51.0	58.0	55.0					13																	97485353		2203	4300	6503	SO:0001583	missense	266722					integral to membrane	sulfotransferase activity	g.chr13:97485353G>C	AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.1317G>C	13.37:g.97485353G>C	ENSP00000365895:p.Arg439Ser		Somatic					p.R439S	NM_153456	NP_703157	WXS	Illumina HiSeq	Unspecified	Q8IZP7	H6ST3_HUMAN			2	1341	+	all_neural(89;0.0878)|Medulloblastoma(90;0.163)		439			Lumenal (Potential).		Q5W0L0|Q68CW6	Missense_Mutation	SNP	ENST00000376705.2	37	c.1317G>C	CCDS9481.1	.	.	.	.	.	.	.	.	.	.	G	10.97	1.501221	0.26861	.	.	ENSG00000185352	ENST00000376705	D	0.83163	-1.69	5.83	5.83	0.93111	.	0.059361	0.64402	D	0.000003	T	0.80829	0.4698	L	0.54323	1.7	0.39906	D	0.973962	P	0.52463	0.953	P	0.47744	0.556	T	0.77811	-0.2449	10	0.22109	T	0.4	-12.972	9.8096	0.40815	0.1889:0.0:0.8111:0.0	.	439	Q8IZP7	H6ST3_HUMAN	S	439	ENSP00000365895:R439S	ENSP00000365895:R439S	R	+	3	2	HS6ST3	96283354	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	1.314000	0.33597	2.758000	0.94735	0.561000	0.74099	AGG		0.597	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045517.2	NM_153456		3	49	0	0	0	0.00024832	0	3	49				
OR4Q3	441669	broad.mit.edu	37	14	20215836	20215836	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr14:20215836G>T	ENST00000331723.1	+	1	250	c.250G>T	c.(250-252)Ggg>Tgg	p.G84W		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AAAGATGTTAGGGGATTTCCT	0.463																																							uc010tkt.1		NA																	0				breast(3)	3						c.(250-252)GGG>TGG		olfactory receptor, family 4, subfamily Q,							104.0	105.0	104.0					14																	20215836		2203	4300	6503	SO:0001583	missense	441669				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20215836G>T	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.250G>T	14.37:g.20215836G>T	ENSP00000330049:p.Gly84Trp		Somatic					p.G84W	NM_172194	NP_751944	WXS	Illumina HiSeq	Unspecified	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	250	+	all_cancers(95;0.00108)		84			Extracellular (Potential).		Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	c.250G>T	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	13.08	2.130752	0.37630	.	.	ENSG00000182652	ENST00000331723	T	0.00406	7.55	4.32	2.43	0.29744	GPCR, rhodopsin-like superfamily (1);	0.670909	0.11974	U	0.511457	T	0.00300	0.0009	N	0.17474	0.49	0.09310	N	1	P	0.52061	0.95	P	0.48227	0.571	T	0.56420	-0.7982	10	0.62326	D	0.03	.	4.0793	0.09919	0.2052:0.0:0.6099:0.1849	.	84	Q8NH05	OR4Q3_HUMAN	W	84	ENSP00000330049:G84W	ENSP00000330049:G84W	G	+	1	0	OR4Q3	19285676	0.000000	0.05858	0.850000	0.33497	0.963000	0.63663	0.163000	0.16520	1.039000	0.40074	0.509000	0.49947	GGG		0.463	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2			19	63	1	0	6.94344e-10	0.00074312	1.02485e-08	19	63				
ARID4A	5926	broad.mit.edu	37	14	58831552	58831552	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr14:58831552A>G	ENST00000355431.3	+	20	3118	c.2745A>G	c.(2743-2745)atA>atG	p.I915M	ARID4A_ENST00000395168.3_Missense_Mutation_p.I915M|ARID4A_ENST00000348476.3_Missense_Mutation_p.I915M|ARID4A_ENST00000431317.2_Missense_Mutation_p.I915M	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	915					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I915I(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CATCATTGATAGCAGAGTCAA	0.363																																							uc001xdp.2		NA																	2	Substitution - coding silent(2)		kidney(2)	ovary(3)|skin(2)|lung(1)	6						c.(2743-2745)ATA>ATG		retinoblastoma-binding protein 1 isoform I							71.0	69.0	70.0					14																	58831552		2203	4299	6502	SO:0001583	missense	5926				negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr14:58831552A>G	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2745A>G	14.37:g.58831552A>G	ENSP00000347602:p.Ile915Met		Somatic				ARID4A_uc001xdo.2_Missense_Mutation_p.I915M|ARID4A_uc001xdq.2_Missense_Mutation_p.I915M|ARID4A_uc010apg.1_Missense_Mutation_p.I593M	p.I915M	NM_002892	NP_002883	WXS	Illumina HiSeq	Unspecified	P29374	ARI4A_HUMAN			20	2999	+			915					Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	37	c.2745A>G	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	A	8.046	0.764830	0.15914	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317;ENST00000417477	T;T;T;T;T	0.14893	2.52;2.53;2.52;2.53;2.47	5.59	-1.15	0.09709	.	0.703464	0.14865	N	0.293856	T	0.13372	0.0324	L	0.44542	1.39	0.09310	N	0.999999	P;B;P	0.41569	0.755;0.412;0.755	B;B;P	0.45610	0.444;0.201;0.487	T	0.12192	-1.0557	10	0.33940	T	0.23	-1.8122	0.8094	0.01090	0.365:0.2652:0.1105:0.2592	.	915;915;915	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	M	915;915;915;915;593	ENSP00000347602:I915M;ENSP00000344556:I915M;ENSP00000378597:I915M;ENSP00000397368:I915M;ENSP00000416053:I593M	ENSP00000344556:I915M	I	+	3	3	ARID4A	57901305	0.931000	0.31567	0.171000	0.22900	0.599000	0.36880	0.668000	0.25127	-0.196000	0.10366	0.528000	0.53228	ATA		0.363	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001		16	52	0	0	0	0.00074312	0	16	52				
RTL1	388015	broad.mit.edu	37	14	101350989	101350989	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr14:101350989C>A	ENST00000534062.1	-	1	195	c.137G>T	c.(136-138)gGg>gTg	p.G46V	MIR127_ENST00000384876.1_RNA|MIR433_ENST00000384837.1_RNA|MIR432_ENST00000606207.1_RNA|MIR136_ENST00000385207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	46					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GCTGGCTGGCCCTGCCTCTCC	0.597																																							uc010txj.1		NA																	0				pancreas(1)	1						c.(136-138)GGG>GTG		retrotransposon-like 1							25.0	26.0	26.0					14																	101350989		1568	3582	5150	SO:0001583	missense	388015							g.chr14:101350989C>A		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.137G>T	14.37:g.101350989C>A	ENSP00000435342:p.Gly46Val		Somatic				uc010txk.1_5'Flank|MIR136_hsa-mir-136|MI0000475_5'Flank	p.G46V	NM_001134888	NP_001128360	WXS	Illumina HiSeq	Unspecified	A6NKG5	RTL1_HUMAN			1	196	-			46					E9PKS8	Missense_Mutation	SNP	ENST00000534062.1	37	c.137G>T	CCDS53910.1	.	.	.	.	.	.	.	.	.	.	C	5.515	0.280029	0.10458	.	.	ENSG00000254656	ENST00000534062	T	0.34667	1.35	3.41	2.47	0.30058	.	.	.	.	.	T	0.36441	0.0967	N	0.19112	0.55	0.09310	N	0.999999	D	0.76494	0.999	D	0.64042	0.921	T	0.09185	-1.0686	9	0.51188	T	0.08	.	4.9848	0.14183	0.0:0.8155:0.0:0.1845	.	46	E9PKS8	.	V	46	ENSP00000435342:G46V	ENSP00000435342:G46V	G	-	2	0	RTL1	100420742	0.002000	0.14202	0.075000	0.20258	0.166000	0.22503	0.630000	0.24553	0.939000	0.37446	0.511000	0.50034	GGG		0.597	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888		12	22	1	0	6.40141e-05	0.000978159	0.000828814	12	22				
OR4M2	390538	broad.mit.edu	37	15	22368719	22368719	+	Silent	SNP	C	C	G			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr15:22368719C>G	ENST00000332663.2	+	1	242	c.144C>G	c.(142-144)acC>acG	p.T48T	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCATTTGCACCATCAGTCTAG	0.428																																							uc010tzu.1		NA																	0				ovary(1)	1						c.(142-144)ACC>ACG		olfactory receptor, family 4, subfamily M,							492.0	427.0	449.0					15																	22368719		2203	4300	6503	SO:0001819	synonymous_variant	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22368719C>G	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.144C>G	15.37:g.22368719C>G			Somatic				LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.T48T	NM_001004719	NP_001004719	WXS	Illumina HiSeq	Unspecified	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	144	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	48			Helical; Name=1; (Potential).		B9EH16|Q6IEY2	Silent	SNP	ENST00000332663.2	37	c.144C>G	CCDS32172.1																																																																																				0.428	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			34	836	0	0	0	0.000692331	0	34	836				
MEIS2	4212	broad.mit.edu	37	15	37390313	37390313	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr15:37390313G>A	ENST00000561208.1	-	2	518	c.100C>T	c.(100-102)Ccc>Tcc	p.P34S	MEIS2_ENST00000559085.1_Missense_Mutation_p.P21S|MEIS2_ENST00000444725.1_Missense_Mutation_p.P34S|MEIS2_ENST00000382766.2_Missense_Mutation_p.P34S|MEIS2_ENST00000557796.2_Missense_Mutation_p.P21S|MEIS2_ENST00000340545.5_Missense_Mutation_p.P21S|MEIS2_ENST00000397624.3_5'UTR|MEIS2_ENST00000338564.5_Missense_Mutation_p.P34S|MEIS2_ENST00000559561.1_Missense_Mutation_p.P34S|MEIS2_ENST00000424352.2_Missense_Mutation_p.P34S|MEIS2_ENST00000397620.2_5'UTR|RP11-128A17.1_ENST00000559509.1_RNA|MEIS2_ENST00000219869.9_5'UTR			O14770	MEIS2_HUMAN	Meis homeobox 2	34					eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		TGAACCGGGGGGATCGGCCGC	0.677																																							uc001zjr.2		NA																	0				ovary(2)	2						c.(100-102)CCC>TCC		Meis homeobox 2 isoform c							34.0	39.0	38.0					15																	37390313		2201	4295	6496	SO:0001583	missense	4212				negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr15:37390313G>A	AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.100C>T	15.37:g.37390313G>A	ENSP00000453793:p.Pro34Ser		Somatic				MEIS2_uc001zjl.2_Missense_Mutation_p.P21S|MEIS2_uc010ucj.1_Missense_Mutation_p.P21S|MEIS2_uc001zjm.2_5'UTR|MEIS2_uc001zjn.2_5'UTR|MEIS2_uc001zjo.2_Missense_Mutation_p.P34S|MEIS2_uc001zjp.2_Missense_Mutation_p.P34S|MEIS2_uc001zjs.2_Missense_Mutation_p.P34S|MEIS2_uc001zju.2_Missense_Mutation_p.P21S|MEIS2_uc001zjt.2_Missense_Mutation_p.P34S	p.P34S	NM_170675	NP_733775	WXS	Illumina HiSeq	Unspecified	O14770	MEIS2_HUMAN		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)	2	1137	-		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)	34					A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	ENST00000561208.1	37	c.100C>T	CCDS10044.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.620114	0.87460	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766;ENST00000424352;ENST00000444725;ENST00000340545;ENST00000397624	T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.51	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.32164	0.0820	L	0.48642	1.525	0.80722	D	1	B;B;B;B;B;B	0.32467	0.042;0.203;0.073;0.035;0.372;0.077	B;B;B;B;B;B	0.32624	0.071;0.149;0.071;0.039;0.121;0.045	T	0.08186	-1.0734	10	0.46703	T	0.11	-0.9829	18.5803	0.91168	0.0:0.0:1.0:0.0	.	21;34;34;34;34;21	Q96DI2;O14770-4;O14770;O14770-3;O14770-2;B3KP98	.;.;MEIS2_HUMAN;.;.;.	S	34;34;34;34;34;21;21	ENSP00000326296:P34S;ENSP00000341400:P34S;ENSP00000372216:P34S;ENSP00000404185:P34S;ENSP00000391887:P34S;ENSP00000339549:P21S	ENSP00000326296:P34S	P	-	1	0	MEIS2	35177605	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.328000	0.96403	2.457000	0.83068	0.655000	0.94253	CCC		0.677	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677		13	46	0	0	0	0.000151284	0	13	46				
SLC9A3R2	9351	broad.mit.edu	37	16	2089996	2089996	+	IGR	SNP	A	A	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr16:2089996A>C	ENST00000424542.2	+	0	2194				NTHL1_ENST00000562951.1_5'UTR|NTHL1_ENST00000219066.1_Missense_Mutation_p.C290G	NM_001130012.2|NM_004785.5	NP_001123484.1|NP_004776.3	Q15599	NHRF2_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2						negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|protein complex assembly (GO:0006461)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatase binding (GO:0019902)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)	2						ACAGGCAGACAGGTCTGCTGG	0.697																																					Ovarian(69;105 1552 17724 23473)		uc002col.1		NA																	0				lung(1)	1						c.(868-870)TGT>GGT	BER_DNA_glycosylases	nth endonuclease III-like 1							47.0	49.0	48.0					16																	2089996		2197	4299	6496	SO:0001628	intergenic_variant	4913				depyrimidination|nucleotide-excision repair, DNA incision, 5'-to lesion	nucleoplasm	4 iron, 4 sulfur cluster binding|double-stranded DNA binding|endonuclease activity|metal ion binding|oxidized pyrimidine base lesion DNA N-glycosylase activity|protein binding	g.chr16:2089996A>C	AF004900	CCDS45382.1, CCDS45383.1, CCDS58407.1	16p13.3	2014-09-04	2012-03-22		ENSG00000065054	ENSG00000065054			11076	protein-coding gene	gene with protein product		606553	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2"""			9054412, 9671706	Standard	NM_001130012		Approved	SIP-1, TKA-1, NHERF-2, E3KARP	uc002coi.3	Q15599	OTTHUMG00000176956		16.37:g.2089996A>C			Somatic				NTHL1_uc002com.1_Missense_Mutation_p.C291G	p.C290G	NM_002528	NP_002519	WXS	Illumina HiSeq	Unspecified	P78549	NTHL1_HUMAN			6	887	-			290				Iron-sulfur (4Fe-4S) (By similarity).	D3DU84|D3DU85|H3BSV6|O00272|O00556|Q3KQY7	Missense_Mutation	SNP	ENST00000424542.2	37	c.868T>G	CCDS45382.1	.	.	.	.	.	.	.	.	.	.	a	17.72	3.458920	0.63401	.	.	ENSG00000065057	ENST00000219066	D	0.95272	-3.66	3.92	3.92	0.45320	DNA glycosylase (1);Endonuclease III-like, iron-sulphur cluster loop motif (1);Helix-turn-helix, base-excision DNA repair, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98090	0.9370	H	0.98027	4.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98220	1.0477	10	0.87932	D	0	-13.1705	10.6434	0.45606	1.0:0.0:0.0:0.0	.	290;290	E5KTI5;P78549	.;NTHL1_HUMAN	G	290	ENSP00000219066:C290G	ENSP00000219066:C290G	C	-	1	0	NTHL1	2029997	1.000000	0.71417	0.528000	0.27938	0.808000	0.45660	5.990000	0.70595	1.650000	0.50662	0.330000	0.21533	TGT		0.697	SLC9A3R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434448.1			10	37	0	0	0	0.000978159	0	10	37				
HYDIN	54768	broad.mit.edu	37	16	70891750	70891750	+	Silent	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr16:70891750G>A	ENST00000393567.2	-	72	12303	c.12153C>T	c.(12151-12153)ttC>ttT	p.F4051F		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4051					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGCCCAGATGGAAAGGTGTGA	0.468																																							uc002ezr.2		NA																	0				ovary(1)|skin(1)	2						c.(12148-12150)TTC>TTT		hydrocephalus inducing isoform a							62.0	63.0	63.0					16																	70891750		1922	4148	6070	SO:0001819	synonymous_variant	54768							g.chr16:70891750G>A	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12153C>T	16.37:g.70891750G>A			Somatic				HYDIN_uc010cfy.2_RNA	p.F4050F	NM_032821	NP_116210	WXS	Illumina HiSeq	Unspecified	Q4G0P3	HYDIN_HUMAN			72	12278	-		Ovarian(137;0.0654)	4051					A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	c.12150C>T	CCDS59269.1																																																																																				0.468	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			8	28	0	0	0	0.000274275	0	8	28				
NF1	4763	broad.mit.edu	37	17	29664869	29664869	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr17:29664869G>A	ENST00000358273.4	+	44	7058	c.6675G>A	c.(6673-6675)tgG>tgA	p.W2225*	NF1_ENST00000356175.3_Nonsense_Mutation_p.W2204*|NF1_ENST00000417592.2_Missense_Mutation_p.A11T|NF1_ENST00000444181.2_Missense_Mutation_p.A11T	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2225					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CGTGCAAGTGGCTGGACCAGT	0.318			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		11	Whole gene deletion(8)|Unknown(3)		soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(6673-6675)TGG>TGA		neurofibromin isoform 1							71.0	71.0	71.0					17																	29664869		2203	4300	6503	SO:0001587	stop_gained	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29664869G>A		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6675G>A	17.37:g.29664869G>A	ENSP00000351015:p.Trp2225*	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)	Somatic				NF1_uc002hgh.2_Nonsense_Mutation_p.W2204*|NF1_uc010cso.2_Nonsense_Mutation_p.W413*|NF1_uc010wbt.1_5'UTR|NF1_uc010wbu.1_RNA	p.W2225*	NM_001042492	NP_001035957	WXS	Illumina HiSeq	Unspecified	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	44	7008	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	2225					O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	ENST00000358273.4	37	c.6675G>A	CCDS42292.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	50|50	16.314749|16.314749	0.99860|0.99860	.|.	.|.	ENSG00000196712|ENSG00000196712	ENST00000444181;ENST00000417592|ENST00000358273;ENST00000356175;ENST00000456735	T|.	0.47869|.	0.83|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.48390|.	0.1497|.	.|.	.|.	.|.	0.40929|0.40929	D|D	0.984377|0.984377	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.36744|.	-0.9735|.	6|.	0.66056|0.02654	D|T	0.02|1	.|.	20.2982|20.2982	0.98569|0.98569	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	T|X	11|2225;2204;1870	ENSP00000396481:A11T|.	ENSP00000398991:A11T|ENSP00000348498:W2204X	A|W	+|+	1|3	0|0	NF1|NF1	26688995|26688995	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.132000|9.132000	0.94455|0.94455	2.873000|2.873000	0.98535|0.98535	0.563000|0.563000	0.77884|0.77884	GCT|TGG		0.318	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		5	22	0	0	0	8.12818e-05	0	5	22				
EFTUD2	9343	broad.mit.edu	37	17	42929916	42929916	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr17:42929916T>A	ENST00000426333.2	-	26	2873	c.2576A>T	c.(2575-2577)cAg>cTg	p.Q859L	EFTUD2_ENST00000402521.3_Missense_Mutation_p.Q824L|EFTUD2_ENST00000592576.1_Missense_Mutation_p.Q849L|EFTUD2_ENST00000591382.1_Missense_Mutation_p.Q859L	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	859					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				GGGTGCATCCTGAGTCACGTG	0.522																																					Ovarian(10;65 485 10258 29980 30707)	Ovarian(10;65 485 10258 29980 30707)	uc002ihn.2		NA																	0				ovary(1)	1						c.(2575-2577)CAG>CTG		elongation factor Tu GTP binding domain							86.0	74.0	78.0					17																	42929916		2203	4300	6503	SO:0001583	missense	9343					Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding	g.chr17:42929916T>A	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.2576A>T	17.37:g.42929916T>A	ENSP00000392094:p.Gln859Leu		Somatic				EFTUD2_uc010wje.1_Missense_Mutation_p.Q824L|EFTUD2_uc010wjf.1_Missense_Mutation_p.Q849L	p.Q859L	NM_004247	NP_004238	WXS	Illumina HiSeq	Unspecified	Q15029	U5S1_HUMAN			26	2837	-		Prostate(33;0.109)	859					B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	37	c.2576A>T	CCDS11489.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.115193	0.77210	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.63255	-0.03;-0.03	6.06	6.06	0.98353	Elongation factor G/III/V (1);Translation elongation factor EFG/EF2, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.68897	0.3051	M	0.71036	2.16	0.80722	D	1	P;P	0.37276	0.589;0.589	B;B	0.43018	0.405;0.405	T	0.71269	-0.4643	10	0.59425	D	0.04	-22.6567	16.2741	0.82634	0.0:0.0:0.0:1.0	.	849;859	B4DMC0;Q15029	.;U5S1_HUMAN	L	859;849;824	ENSP00000392094:Q859L;ENSP00000385873:Q824L	ENSP00000262414:Q849L	Q	-	2	0	EFTUD2	40285442	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.015000	0.88690	2.322000	0.78497	0.528000	0.53228	CAG		0.522	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247		9	117	0	0	0	0.000673444	0	9	117				
ABCA9	10350	broad.mit.edu	37	17	66985997	66985997	+	Silent	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr17:66985997C>T	ENST00000340001.4	-	30	4123	c.3912G>A	c.(3910-3912)aaG>aaA	p.K1304K	ABCA9_ENST00000370732.2_Silent_p.K1304K|ABCA9_ENST00000482072.1_5'Flank|ABCA9_ENST00000453985.2_Silent_p.K1266K	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1304	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					CAATTTTTTTCTTCCTTTTAG	0.358																																							uc002jhu.2		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6						c.(3910-3912)AAG>AAA		ATP-binding cassette, sub-family A, member 9							71.0	73.0	72.0					17																	66985997		2203	4300	6503	SO:0001819	synonymous_variant	10350				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:66985997C>T	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.3912G>A	17.37:g.66985997C>T			Somatic				ABCA9_uc010dez.2_Silent_p.K1266K	p.K1304K	NM_080283	NP_525022	WXS	Illumina HiSeq	Unspecified	Q8IUA7	ABCA9_HUMAN			30	4055	-	Breast(10;1.47e-12)		1304			ABC transporter 2.		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Silent	SNP	ENST00000340001.4	37	c.3912G>A	CCDS11681.1																																																																																				0.358	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386		8	48	0	0	0	0.000157383	0	8	48				
SLMO1	10650	broad.mit.edu	37	18	12420398	12420398	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr18:12420398T>A	ENST00000440960.1	+	2	187	c.107T>A	c.(106-108)gTg>gAg	p.V36E	SLMO1_ENST00000336990.4_Missense_Mutation_p.V36E|SLMO1_ENST00000587735.1_5'Flank|SLMO1_ENST00000592149.1_Missense_Mutation_p.V15E|SLMO1_ENST00000590956.1_Intron	NM_001142405.1	NP_001135877.1	Q96N28	SLMO1_HUMAN	slowmo homolog 1 (Drosophila)	36	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(1)	1						GTGCTGGGCGTGGATGTGCTA	0.711																																							uc002kra.2		NA																	0					0						c.(106-108)GTG>GAG		slowmo homolog 1 isoform 1							17.0	20.0	19.0					18																	12420398		2196	4293	6489	SO:0001583	missense	10650							g.chr18:12420398T>A	AK056046	CCDS11860.1	18p11.21	2007-02-20	2007-02-06	2007-02-06	ENSG00000141391	ENSG00000141391			24639	protein-coding gene	gene with protein product	"""erythroid differentiation and denucleation factor 1"""		"""chromosome 18 open reading frame 43"""	C18orf43			Standard	NM_006553		Approved	HFL-EDDG1, FLJ31484, PRELID3A	uc010wzu.2	Q96N28	OTTHUMG00000131694	ENST00000440960.1:c.107T>A	18.37:g.12420398T>A	ENSP00000404700:p.Val36Glu		Somatic				SLMO1_uc010wzu.1_Missense_Mutation_p.V36E|SLMO1_uc010wzv.1_Missense_Mutation_p.V15E	p.V36E	NM_001142405	NP_001135877	WXS	Illumina HiSeq	Unspecified	Q96N28	SLMO1_HUMAN			2	187	+			36			PRELI/MSF1.		B0YJ10|B4E0C9|D3DUJ1|Q6AHX2	Missense_Mutation	SNP	ENST00000440960.1	37	c.107T>A	CCDS11860.1	.	.	.	.	.	.	.	.	.	.	t	18.76	3.692803	0.68271	.	.	ENSG00000141391	ENST00000440960;ENST00000336990	T;T	0.19532	2.14;2.14	4.8	4.8	0.61643	PRELI/MSF1 (2);	0.000000	0.85682	D	0.000000	T	0.46814	0.1412	M	0.79693	2.465	0.80722	D	1	D	0.71674	0.998	D	0.75020	0.985	T	0.45716	-0.9242	10	0.33141	T	0.24	-3.3783	14.3896	0.66970	0.0:0.0:0.0:1.0	.	36	Q96N28	SLMO1_HUMAN	E	36	ENSP00000404700:V36E;ENSP00000338988:V36E	ENSP00000338988:V36E	V	+	2	0	SLMO1	12410398	1.000000	0.71417	0.986000	0.45419	0.034000	0.12701	7.446000	0.80609	1.776000	0.52262	0.449000	0.29647	GTG		0.711	SLMO1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254602.2	NM_006553		5	22	0	0	0	3.59834e-05	0	5	22				
STK11	6794	broad.mit.edu	37	19	1221228	1221229	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr19:1221228_1221229GG>TT	ENST00000326873.7	+	6	1924_1925	c.751_752GG>TT	c.(751-753)GGt>TTt	p.G251F		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	251	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(2)|p.G251R(1)|p.Y246fs*3(1)|p.G251V(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CATCACCACGGGTCTGTACCCC	0.589		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		25	Whole gene deletion(20)|Substitution - Missense(2)|Unknown(2)|Deletion - Frameshift(1)	p.0?(19)|p.?(2)|p.Y246fs*3(1)	cervix(14)|lung(7)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CM981868	STK11	M		c.(751-753)GGT>TTT		serine/threonine protein kinase 11																																				SO:0001583	missense	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1221228_1221229GG>TT	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		Exception_encountered	19.37:g.1221228_1221229delinsTT	ENSP00000324856:p.Gly251Phe	TSP Lung(3;<1E-08)	Somatic					p.G251F	NM_000455	NP_000446	WXS	Illumina HiSeq	Unspecified	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	6	1866_1867	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	251			Protein kinase.		B2RBX7|E7EW76	Missense_Mutation	DNP	ENST00000326873.7	37	c.751_752GG>TT	CCDS45896.1																																																																																				0.589	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		3	19	0	0	0	6.4e-05	0	3	19				
TSHZ3	57616	broad.mit.edu	37	19	31767776	31767776	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr19:31767776C>A	ENST00000240587.4	-	2	3250	c.2923G>T	c.(2923-2925)Gtc>Ttc	p.V975F		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	975					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CAAAAGAAGACGGGGTGGCCA	0.512																																							uc002nsy.3		NA																	0				ovary(4)|skin(2)|pancreas(1)|lung(1)	8						c.(2923-2925)GTC>TTC		zinc finger protein 537							71.0	66.0	68.0					19																	31767776		2203	4300	6503	SO:0001583	missense	57616				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:31767776C>A	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2923G>T	19.37:g.31767776C>A	ENSP00000240587:p.Val975Phe		Somatic					p.V975F	NM_020856	NP_065907	WXS	Illumina HiSeq	Unspecified	Q63HK5	TSH3_HUMAN			2	2988	-	Esophageal squamous(110;0.226)		975					Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	c.2923G>T	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606647	0.66558	.	.	ENSG00000121297	ENST00000240587	T	0.14391	2.51	5.84	5.84	0.93424	.	0.059413	0.64402	D	0.000003	T	0.34337	0.0894	L	0.46157	1.445	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.00928	-1.1511	10	0.72032	D	0.01	-28.9143	20.1434	0.98067	0.0:1.0:0.0:0.0	.	975	Q63HK5	TSH3_HUMAN	F	975	ENSP00000240587:V975F	ENSP00000240587:V975F	V	-	1	0	TSHZ3	36459616	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.643000	0.61390	2.760000	0.94817	0.591000	0.81541	GTC		0.512	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		24	62	1	0	7.41945e-09	0.000878237	1.05299e-07	24	62				
MAP3K10	4294	broad.mit.edu	37	19	40710443	40710443	+	Silent	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr19:40710443G>A	ENST00000253055.3	+	3	1203	c.915G>A	c.(913-915)gaG>gaA	p.E305E	MAP3K10_ENST00000593906.1_3'UTR|AC118344.1_ENST00000408124.1_RNA	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	305	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CCTACCGTGAGATCGACGCCT	0.667																																							uc002ona.2		NA																	0				ovary(2)|lung(2)|skin(1)|pancreas(1)	6						c.(913-915)GAG>GAA		mitogen-activated protein kinase kinase kinase							103.0	68.0	80.0					19																	40710443		2203	4300	6503	SO:0001819	synonymous_variant	4294				activation of JUN kinase activity|induction of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of JNK cascade|protein autophosphorylation|smoothened signaling pathway	cytoplasm	ATP binding|bHLH transcription factor binding|JUN kinase kinase kinase activity|protein homodimerization activity|transcription corepressor activity	g.chr19:40710443G>A	X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.915G>A	19.37:g.40710443G>A			Somatic				MAP3K10_uc002onb.2_5'UTR	p.E305E	NM_002446	NP_002437	WXS	Illumina HiSeq	Unspecified	Q02779	M3K10_HUMAN			3	1203	+			305			Protein kinase.		Q12761|Q14871	Silent	SNP	ENST00000253055.3	37	c.915G>A	CCDS12549.1																																																																																				0.667	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446		6	39	0	0	0	8.12818e-05	0	6	39				
ZNF235	9310	broad.mit.edu	37	19	44792062	44792062	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr19:44792062T>A	ENST00000291182.4	-	5	1628	c.1526A>T	c.(1525-1527)cAt>cTt	p.H509L	ZNF235_ENST00000589248.1_Intron|ZNF235_ENST00000589799.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	509					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				CTCTCCTGTATGGACCCTCTG	0.448																																							uc002oza.3		NA																	0				ovary(2)|large_intestine(1)	3						c.(1525-1527)CAT>CTT		zinc finger protein 93 homolog							130.0	126.0	127.0					19																	44792062		2203	4300	6503	SO:0001583	missense	9310				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44792062T>A	X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.1526A>T	19.37:g.44792062T>A	ENSP00000291182:p.His509Leu		Somatic				ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Missense_Mutation_p.H505L|ZNF235_uc010xwx.1_Missense_Mutation_p.H423L	p.H509L	NM_004234	NP_004225	WXS	Illumina HiSeq	Unspecified	Q14590	ZN235_HUMAN			5	1629	-		Prostate(69;0.0352)|all_neural(266;0.116)	509			C2H2-type 8.		B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	ENST00000291182.4	37	c.1526A>T	CCDS33048.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.416267	0.83449	.	.	ENSG00000159917	ENST00000391957;ENST00000291182;ENST00000359844	T	0.67345	-0.26	5.04	5.04	0.67666	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44483	D	0.000449	D	0.87402	0.6168	H	0.97158	3.95	0.49483	D	0.999795	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.91439	0.5172	10	0.87932	D	0	.	14.0388	0.64663	0.0:0.0:0.0:1.0	.	505;509	Q14590-2;Q14590	.;ZN235_HUMAN	L	509;509;401	ENSP00000291182:H509L	ENSP00000291182:H509L	H	-	2	0	ZNF235	49483902	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.583000	0.82559	2.023000	0.59567	0.379000	0.24179	CAT		0.448	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1			8	160	0	0	0	0.000274275	0	8	160				
RTN2	6253	broad.mit.edu	37	19	45989342	45989342	+	Silent	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr19:45989342C>T	ENST00000245923.4	-	10	1762	c.1527G>A	c.(1525-1527)gtG>gtA	p.V509V	PPM1N_ENST00000401705.1_5'Flank|RTN2_ENST00000430715.2_Silent_p.V169V|RTN2_ENST00000344680.4_Silent_p.V436V|RTN2_ENST00000590526.1_Silent_p.V235V	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	509	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		ACTGATTGGTCACCAACCCCA	0.522											OREG0025555	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002pcb.2		NA																	0				ovary(3)	3						c.(1525-1527)GTG>GTA		reticulon 2 isoform A							98.0	82.0	88.0					19																	45989342		2203	4300	6503	SO:0001819	synonymous_variant	6253					integral to endoplasmic reticulum membrane	signal transducer activity	g.chr19:45989342C>T	AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1527G>A	19.37:g.45989342C>T			Somatic	OREG0025555	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	935	RTN2_uc002pcc.2_Silent_p.V436V|RTN2_uc002pcd.2_RNA	p.V509V	NM_005619	NP_005610	WXS	Illumina HiSeq	Unspecified	O75298	RTN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)	10	1755	-		Ovarian(192;0.051)|all_neural(266;0.112)	509			Reticulon.		O60509|Q7RTM6|Q7RTN1|Q7RTN2	Silent	SNP	ENST00000245923.4	37	c.1527G>A	CCDS12665.1																																																																																				0.522	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619		6	74	0	0	0	0.000157383	0	6	74				
KLK11	11012	broad.mit.edu	37	19	51525889	51525889	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr19:51525889T>A	ENST00000594768.1	-	6	946	c.761A>T	c.(760-762)gAt>gTt	p.D254V	KLK11_ENST00000391804.3_Missense_Mutation_p.D247V|KLK11_ENST00000319720.7_Missense_Mutation_p.D222V|KLK11_ENST00000594458.1_5'Flank|KLK10_ENST00000358789.3_5'Flank|KLK11_ENST00000600362.1_Missense_Mutation_p.D81V|KLK10_ENST00000391805.1_5'Flank|KLK10_ENST00000309958.3_5'Flank|KLK11_ENST00000453757.3_Missense_Mutation_p.D222V	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	254	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		CGCACACGGATCCTGGCCCCA	0.552																																							uc002pvd.1		NA																	0					0						c.(760-762)GAT>GTT		kallikrein 11 isoform 2 precursor							128.0	122.0	124.0					19																	51525889		2203	4300	6503	SO:0001583	missense	11012				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr19:51525889T>A	AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.761A>T	19.37:g.51525889T>A	ENSP00000473047:p.Asp254Val		Somatic				KLK10_uc002puy.2_5'Flank|KLK10_uc002puz.2_5'Flank|KLK10_uc002pva.2_5'Flank|KLK11_uc002pvb.1_Missense_Mutation_p.D247V|KLK11_uc002pve.1_Missense_Mutation_p.D111V|KLK11_uc002pvf.1_Missense_Mutation_p.D222V|KLK11_uc002pvc.3_Missense_Mutation_p.D222V	p.D254V	NM_144947	NP_659196	WXS	Illumina HiSeq	Unspecified	Q9UBX7	KLK11_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)	6	873	-		all_neural(266;0.026)	254			Peptidase S1.		O75837|Q0WXX5|Q8IXD7|Q9NS65	Missense_Mutation	SNP	ENST00000594768.1	37	c.761A>T	CCDS12818.1	.	.	.	.	.	.	.	.	.	.	t	3.404	-0.121633	0.06838	.	.	ENSG00000167757	ENST00000391804;ENST00000319720;ENST00000453757;ENST00000319756	D;D;D	0.89123	-2.47;-2.47;-2.47	4.42	2.33	0.28932	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.37809	U	0.001924	T	0.72684	0.3491	N	0.10629	0.01	0.54753	D	0.999987	B;P	0.37370	0.243;0.592	B;B	0.37091	0.112;0.241	T	0.62229	-0.6898	10	0.18710	T	0.47	.	5.6716	0.17725	0.0:0.2208:0.0:0.7792	.	254;247	Q9UBX7;Q8IXD7	KLK11_HUMAN;.	V	247;222;222;254	ENSP00000375680:D247V;ENSP00000324269:D222V;ENSP00000413958:D222V	ENSP00000324269:D222V	D	-	2	0	KLK11	56217701	0.012000	0.17670	0.946000	0.38457	0.615000	0.37417	1.591000	0.36665	0.265000	0.21872	0.254000	0.18369	GAT		0.552	KLK11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464314.2	NM_006853		7	111	0	0	0	0.000274275	0	7	111				
NLRP12	91662	broad.mit.edu	37	19	54313810	54313810	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr19:54313810G>T	ENST00000324134.6	-	3	1271	c.1103C>A	c.(1102-1104)gCa>gAa	p.A368E	NLRP12_ENST00000354278.3_Missense_Mutation_p.A368E|NLRP12_ENST00000391772.1_Missense_Mutation_p.A368E|NLRP12_ENST00000345770.5_Missense_Mutation_p.A368E|NLRP12_ENST00000391775.3_Missense_Mutation_p.A368E|NLRP12_ENST00000391773.1_Missense_Mutation_p.A368E|NLRP12_ENST00000535162.1_Missense_Mutation_p.A368E|NLRP12_ENST00000351894.4_Missense_Mutation_p.A368E	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	368	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CTTCCTTTCTGCCTCAGAGAA	0.542																																							uc002qch.3		NA																	0				ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(1102-1104)GCA>GAA		NLR family, pyrin domain containing 12 isoform							161.0	168.0	166.0					19																	54313810		2203	4300	6503	SO:0001583	missense	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54313810G>T	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1103C>A	19.37:g.54313810G>T	ENSP00000319377:p.Ala368Glu		Somatic				NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.A368E|NLRP12_uc002qcj.3_Missense_Mutation_p.A368E|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.A368E	p.A368E	NM_144687	NP_653288	WXS	Illumina HiSeq	Unspecified	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	3	1323	-	Ovarian(34;0.19)		368			NACHT.		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	c.1103C>A	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	6.280	0.419795	0.11928	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	4.64	1.0	0.19881	NACHT nucleoside triphosphatase (1);	0.558998	0.14842	N	0.295206	T	0.54806	0.1881	N	0.16098	0.37	0.09310	N	1	P;B;B;B	0.34757	0.467;0.235;0.235;0.281	B;B;B;B	0.38020	0.259;0.19;0.19;0.263	T	0.50767	-0.8789	10	0.05525	T	0.97	.	6.4056	0.21662	0.0904:0.0:0.4578:0.4517	.	368;368;368;368	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	E	368	ENSP00000319377:A368E;ENSP00000438030:A368E;ENSP00000340473:A368E;ENSP00000346231:A368E;ENSP00000375655:A368E;ENSP00000375653:A368E;ENSP00000375652:A368E	ENSP00000319377:A368E	A	-	2	0	NLRP12	59005622	0.000000	0.05858	0.007000	0.13788	0.821000	0.46438	-0.142000	0.10311	0.437000	0.26423	0.485000	0.47835	GCA		0.542	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		38	171	1	0	2.52637e-11	0.00111076	3.8843e-10	38	171				
ITSN2	50618	broad.mit.edu	37	2	24498701	24498701	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr2:24498701G>T	ENST00000355123.4	-	18	2405	c.1962C>A	c.(1960-1962)taC>taA	p.Y654*	ITSN2_ENST00000406921.3_Nonsense_Mutation_p.Y654*|SCARNA21_ENST00000515996.1_RNA|ITSN2_ENST00000361999.3_Nonsense_Mutation_p.Y627*	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	654					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTGTGTGTTGTAGGTTTCTC	0.323																																							uc002rfe.2		NA																	0				kidney(2)|ovary(1)|central_nervous_system(1)	4						c.(1960-1962)TAC>TAA		intersectin 2 isoform 1							130.0	124.0	126.0					2																	24498701		2203	4300	6503	SO:0001587	stop_gained	50618				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity	g.chr2:24498701G>T	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.1962C>A	2.37:g.24498701G>T	ENSP00000347244:p.Tyr654*		Somatic				ITSN2_uc002rff.2_Nonsense_Mutation_p.Y627*|ITSN2_uc002rfg.2_Nonsense_Mutation_p.Y654*	p.Y654*	NM_006277	NP_006268	WXS	Illumina HiSeq	Unspecified	Q9NZM3	ITSN2_HUMAN			18	2220	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		654			Potential.		O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Nonsense_Mutation	SNP	ENST00000355123.4	37	c.1962C>A	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	G	39	7.431327	0.98279	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000406921	.	.	.	5.69	-4.43	0.03568	.	0.231155	0.21505	U	0.073471	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4162	0.60970	0.4913:0.0:0.5087:0.0	.	.	.	.	X	627;654;627;654	.	ENSP00000347244:Y654X	Y	-	3	2	ITSN2	24352205	0.952000	0.32445	0.947000	0.38551	0.809000	0.45718	-0.054000	0.11826	-0.631000	0.05560	-0.300000	0.09419	TAC		0.323	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277		10	53	1	0	4.68919e-08	0.000673444	6.52947e-07	10	53				
PSME4	23198	broad.mit.edu	37	2	54148147	54148147	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr2:54148147T>A	ENST00000404125.1	-	18	2196	c.2141A>T	c.(2140-2142)tAc>tTc	p.Y714F	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	714					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AGACAGAGTGTAACCCTGCTT	0.433																																							uc002rxp.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(2140-2142)TAC>TTC		proteasome (prosome, macropain) activator							163.0	163.0	163.0					2																	54148147		2203	4300	6503	SO:0001583	missense	23198				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding	g.chr2:54148147T>A	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2141A>T	2.37:g.54148147T>A	ENSP00000384211:p.Tyr714Phe		Somatic				PSME4_uc010yop.1_Missense_Mutation_p.Y600F|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.Y89F|PSME4_uc010fbv.1_Intron	p.Y714F	NM_014614	NP_055429	WXS	Illumina HiSeq	Unspecified	Q14997	PSME4_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		18	2197	-			714					Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	c.2141A>T	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	T	32	5.150009	0.94645	.	.	ENSG00000068878	ENST00000404125	T	0.64618	-0.11	5.38	5.38	0.77491	.	0.120476	0.64402	D	0.000018	T	0.73946	0.3652	M	0.76002	2.32	0.80722	D	1	B;D	0.71674	0.01;0.998	B;P	0.62184	0.028;0.899	T	0.71590	-0.4547	10	0.10902	T	0.67	-18.568	15.4451	0.75223	0.0:0.0:0.0:1.0	.	89;714	Q14997-2;Q14997	.;PSME4_HUMAN	F	714	ENSP00000384211:Y714F	ENSP00000384211:Y714F	Y	-	2	0	PSME4	54001651	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.059000	0.61396	0.524000	0.50904	TAC		0.433	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158		25	120	0	0	0	0.000586117	0	25	120				
RTKN	6242	broad.mit.edu	37	2	74659594	74659594	+	Splice_Site	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr2:74659594C>T	ENST00000233330.6	-	2	478	c.161G>A	c.(160-162)cGg>cAg	p.R54Q	RTKN_ENST00000484453.1_5'Flank|RTKN_ENST00000272430.5_Splice_Site_p.R104Q|RTKN_ENST00000305557.5_Splice_Site_p.R91Q	NM_001015056.1	NP_001015056.1			rhotekin											endometrium(3)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	16						CCTTGCTCACCGCCGGCTTGT	0.637																																							uc002sle.2		NA																	0				skin(1)	1						c.(310-312)CGG>CAG		rhotekin isoform a							68.0	69.0	69.0					2																	74659594		2203	4299	6502	SO:0001630	splice_region_variant	6242				apoptosis|regulation of anti-apoptosis|Rho protein signal transduction	intracellular	GTP binding|GTP-Rho binding|GTPase inhibitor activity	g.chr2:74659594C>T	AF049227	CCDS1941.1, CCDS33226.1, CCDS42699.1	2p13.1	2013-01-10			ENSG00000114993	ENSG00000114993		"""Pleckstrin homology (PH) domain containing"""	10466	protein-coding gene	gene with protein product		602288				9073523, 10940294	Standard	XM_005264478		Approved	B5	uc002sle.3	Q9BST9	OTTHUMG00000129955	ENST00000233330.6:c.161+1G>A	2.37:g.74659594C>T			Somatic				RTKN_uc002slc.2_Missense_Mutation_p.R91Q|RTKN_uc002sld.2_Missense_Mutation_p.R54Q|RTKN_uc010ffe.1_Intron|RTKN_uc010fff.1_Missense_Mutation_p.R91Q|RTKN_uc010ffg.1_Missense_Mutation_p.R104Q	p.R104Q	NM_001015055	NP_001015055	WXS	Illumina HiSeq	Unspecified	Q9BST9	RTKN_HUMAN			2	428	-			104						Missense_Mutation	SNP	ENST00000233330.6	37	c.311G>A	CCDS42699.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853822	0.91355	.	.	ENSG00000114993	ENST00000305557;ENST00000272430;ENST00000233330	T;T;T	0.34667	1.36;1.35;1.36	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	M	0.72894	2.215	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.74348	0.977;0.983	T	0.50693	-0.8798	10	0.17369	T	0.5	.	15.2231	0.73330	0.0:1.0:0.0:0.0	.	104;91	Q9BST9;Q9BST9-2	RTKN_HUMAN;.	Q	91;104;54	ENSP00000305298:R91Q;ENSP00000272430:R104Q;ENSP00000233330:R54Q	ENSP00000233330:R54Q	R	-	2	0	RTKN	74513102	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	5.259000	0.65485	2.438000	0.82558	0.561000	0.74099	CGG		0.637	RTKN-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328236.3	NM_001015055	Missense_Mutation	6	79	0	0	0	8.12818e-05	0	6	79				
PTPN4	5775	broad.mit.edu	37	2	120677693	120677693	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr2:120677693G>A	ENST00000263708.2	+	12	1648	c.877G>A	c.(877-879)Gca>Aca	p.A293T	snoU13_ENST00000459555.1_RNA	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	293	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	GAATTACAGAGCATGTAAAAA	0.333																																							uc002tmf.1		NA																	0				ovary(2)	2						c.(877-879)GCA>ACA		protein tyrosine phosphatase, non-receptor type	Alendronate(DB00630)						108.0	109.0	109.0					2																	120677693		2203	4300	6503	SO:0001583	missense	5775					cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity	g.chr2:120677693G>A		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.877G>A	2.37:g.120677693G>A	ENSP00000263708:p.Ala293Thr		Somatic				PTPN4_uc010flj.1_Missense_Mutation_p.A6T	p.A293T	NM_002830	NP_002821	WXS	Illumina HiSeq	Unspecified	P29074	PTN4_HUMAN			12	1648	+			293			FERM.		B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	c.877G>A	CCDS2129.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725455	0.68959	.	.	ENSG00000088179	ENST00000263708	D	0.87103	-2.21	5.55	4.65	0.58169	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.046925	0.85682	D	0.000000	D	0.89406	0.6706	L	0.53561	1.675	0.80722	D	1	P	0.45986	0.87	P	0.54174	0.744	D	0.88432	0.3036	10	0.36615	T	0.2	.	15.6949	0.77488	0.0:0.0:0.8621:0.1379	.	293	P29074	PTN4_HUMAN	T	293	ENSP00000263708:A293T	ENSP00000263708:A293T	A	+	1	0	PTPN4	120394163	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.615000	0.83006	1.534000	0.49203	0.655000	0.94253	GCA		0.333	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2			12	78	0	0	0	0.000978159	0	12	78				
DARS	1615	broad.mit.edu	37	2	136673803	136673803	+	Missense_Mutation	SNP	C	C	T	rs370064817		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr2:136673803C>T	ENST00000264161.4	-	11	1314	c.1099G>A	c.(1099-1101)Gat>Aat	p.D367N	DARS_ENST00000537273.1_Missense_Mutation_p.D267N	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	367			D -> Y (in HBSL). {ECO:0000269|PubMed:23643384}.		aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	AACCTCAGATCGTCTTCATCT	0.418																																							uc002tux.1		NA																	0				ovary(1)	1						c.(1099-1101)GAT>AAT		aspartyl-tRNA synthetase	L-Aspartic Acid(DB00128)						112.0	106.0	108.0					2																	136673803		2203	4300	6503	SO:0001583	missense	1615				aspartyl-tRNA aminoacylation|protein complex assembly	cytosol|nuclear membrane|plasma membrane|soluble fraction	aminoacylase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding	g.chr2:136673803C>T	J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.1099G>A	2.37:g.136673803C>T	ENSP00000264161:p.Asp367Asn		Somatic				DARS_uc010fnj.1_Missense_Mutation_p.D267N	p.D367N	NM_001349	NP_001340	WXS	Illumina HiSeq	Unspecified	P14868	SYDC_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.168)	11	1283	-			367					A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Missense_Mutation	SNP	ENST00000264161.4	37	c.1099G>A	CCDS2180.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468552	0.84533	.	.	ENSG00000115866	ENST00000264161;ENST00000422708;ENST00000537273	T;D;T	0.84873	0.8;-1.91;0.8	5.43	4.55	0.56014	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.94640	0.8272	H	0.96048	3.76	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	D	0.96361	0.9266	10	0.87932	D	0	-11.0612	15.8356	0.78796	0.1371:0.8629:0.0:0.0	.	367	P14868	SYDC_HUMAN	N	367;81;267	ENSP00000264161:D367N;ENSP00000387508:D81N;ENSP00000444192:D267N	ENSP00000264161:D367N	D	-	1	0	DARS	136390273	1.000000	0.71417	0.880000	0.34516	0.679000	0.39708	7.537000	0.82033	1.400000	0.46741	-0.188000	0.12872	GAT		0.418	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349		9	57	0	0	0	0.000673444	0	9	57				
MYO3B	140469	broad.mit.edu	37	2	171239692	171239692	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr2:171239692C>A	ENST00000408978.4	+	11	1321	c.1178C>A	c.(1177-1179)tCt>tAt	p.S393Y	MYO3B_ENST00000409044.3_Missense_Mutation_p.S393Y|MYO3B_ENST00000334231.6_Missense_Mutation_p.S402Y|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	393	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						AGCATATACTCTCCACAGGTA	0.348																																							uc002ufy.2		NA																	0				lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						c.(1177-1179)TCT>TAT		myosin IIIB isoform 2							129.0	120.0	123.0					2																	171239692		1816	4087	5903	SO:0001583	missense	140469				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity	g.chr2:171239692C>A		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.1178C>A	2.37:g.171239692C>A	ENSP00000386213:p.Ser393Tyr		Somatic				MYO3B_uc002ufv.2_Missense_Mutation_p.S380Y|MYO3B_uc010fqb.1_Missense_Mutation_p.S380Y|MYO3B_uc002ufz.2_Missense_Mutation_p.S393Y|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA	p.S393Y	NM_138995	NP_620482	WXS	Illumina HiSeq	Unspecified	Q8WXR4	MYO3B_HUMAN			11	1321	+			393			Myosin head-like.		B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	c.1178C>A	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918953	0.92249	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78	5.87	5.87	0.94306	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.89787	0.6816	M	0.91612	3.225	0.80722	D	1	D;D;D	0.76494	0.997;0.998;0.999	D;D;D	0.77557	0.976;0.973;0.99	D	0.90954	0.4807	10	0.72032	D	0.01	.	20.2192	0.98319	0.0:1.0:0.0:0.0	.	393;393;393	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	Y	393;393;392;402;402	ENSP00000386497:S393Y;ENSP00000386213:S393Y;ENSP00000446237:S402Y;ENSP00000335100:S402Y	ENSP00000314213:S392Y	S	+	2	0	MYO3B	170947938	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.596000	0.82721	2.780000	0.95670	0.655000	0.94253	TCT		0.348	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1			20	110	1	0	6.44725e-10	0.000295444	9.61227e-09	20	110				
MAP2	4133	broad.mit.edu	37	2	210560942	210560942	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr2:210560942G>T	ENST00000360351.4	+	7	4554	c.4048G>T	c.(4048-4050)Gct>Tct	p.A1350S	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.A1346S	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1350					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TTCCCCAGAGGCTCCAGCTTC	0.483																																					Pancreas(27;423 979 28787 29963)	Pancreas(27;423 979 28787 29963)	uc002vde.1		NA																	0				ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17						c.(4048-4050)GCT>TCT		microtubule-associated protein 2 isoform 1	Estramustine(DB01196)						73.0	84.0	80.0					2																	210560942		2203	4300	6503	SO:0001583	missense	4133				central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity	g.chr2:210560942G>T		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4048G>T	2.37:g.210560942G>T	ENSP00000353508:p.Ala1350Ser		Somatic				MAP2_uc002vdc.1_Missense_Mutation_p.A1350S|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.A1346S	p.A1350S	NM_002374	NP_002365	WXS	Illumina HiSeq	Unspecified	P11137	MAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	7	4296	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	1350					Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	c.4048G>T	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355785	0.61293	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.25085	1.82;1.82	5.62	5.62	0.85841	MAP2/Tau projection (1);	0.000000	0.64402	D	0.000016	T	0.50292	0.1607	L	0.59436	1.845	0.44643	D	0.997629	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.989	T	0.40496	-0.9560	10	0.51188	T	0.08	-15.5005	19.6568	0.95845	0.0:0.0:1.0:0.0	.	1346;1350	P11137-3;P11137	.;MAP2_HUMAN	S	1350;1346	ENSP00000353508:A1350S;ENSP00000392164:A1346S	ENSP00000353508:A1350S	A	+	1	0	MAP2	210269187	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.698000	0.61789	2.656000	0.90262	0.650000	0.86243	GCT		0.483	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		22	88	1	0	6.21321e-17	0.000375601	1.09175e-15	22	88				
DAW1	164781	broad.mit.edu	37	2	228767798	228767798	+	Silent	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr2:228767798G>A	ENST00000309931.2	+	7	704	c.621G>A	c.(619-621)caG>caA	p.Q207Q	DAW1_ENST00000545118.1_Silent_p.Q192Q|DAW1_ENST00000373666.2_Silent_p.Q207Q	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1	207						cilium (GO:0005929)											GGGACATTCAGAATGGCGAGG	0.358																																							uc002vpn.1		NA																	0				breast(1)	1						c.(619-621)CAG>CAA		WD repeat domain 69							136.0	126.0	130.0					2																	228767798		2203	4300	6503	SO:0001819	synonymous_variant	164781							g.chr2:228767798G>A		CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.621G>A	2.37:g.228767798G>A			Somatic				WDR69_uc010zlw.1_Silent_p.Q192Q|WDR69_uc002vpo.1_RNA	p.Q207Q	NM_178821	NP_849143	WXS	Illumina HiSeq	Unspecified	Q8N136	WDR69_HUMAN		Epithelial(121;1.22e-10)|all cancers(144;8.11e-08)|Lung(261;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0148)	7	700	+		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	207			WD 3.		Q6ZRY1|Q8N776	Silent	SNP	ENST00000309931.2	37	c.621G>A	CCDS2470.1																																																																																				0.358	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331745.1	NM_178821		9	42	0	0	0	0.000673444	0	9	42				
SLC2A10	81031	broad.mit.edu	37	20	45354495	45354495	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr20:45354495G>T	ENST00000359271.2	+	2	1070	c.820G>T	c.(820-822)Gtg>Ttg	p.V274L		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	274					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				GCTGGCCTCTGTGGGGCTTGG	0.632																																							uc002xsl.2		NA																	0				ovary(1)	1						c.(820-822)GTG>TTG		solute carrier family 2 member 10							107.0	100.0	102.0					20																	45354495		2203	4300	6503	SO:0001583	missense	81031					endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity	g.chr20:45354495G>T	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.820G>T	20.37:g.45354495G>T	ENSP00000352216:p.Val274Leu		Somatic					p.V274L	NM_030777	NP_110404	WXS	Illumina HiSeq	Unspecified	O95528	GTR10_HUMAN			2	917	+		Myeloproliferative disorder(115;0.0122)	274			Helical; Name=8; (Potential).		A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	c.820G>T	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.367952	0.24771	.	.	ENSG00000197496	ENST00000359271	T	0.74842	-0.88	5.86	4.9	0.64082	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.058124	0.64402	D	0.000002	T	0.65428	0.2690	L	0.41710	1.295	0.45502	D	0.998467	B	0.33807	0.426	B	0.31614	0.133	T	0.62553	-0.6830	10	0.26408	T	0.33	0.3527	15.2743	0.73728	0.0678:0.0:0.9322:0.0	.	274	O95528	GTR10_HUMAN	L	274	ENSP00000352216:V274L	ENSP00000352216:V274L	V	+	1	0	SLC2A10	44787902	1.000000	0.71417	0.806000	0.32338	0.054000	0.15201	4.355000	0.59424	1.460000	0.47911	0.655000	0.94253	GTG		0.632	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2			31	75	1	0	6.90743e-12	0.000692331	1.08461e-10	31	75				
TPTE	7179	broad.mit.edu	37	21	10959797	10959797	+	Silent	SNP	C	C	G			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr21:10959797C>G	ENST00000361285.4	-	8	506	c.177G>C	c.(175-177)gtG>gtC	p.V59V	TPTE_ENST00000298232.7_Silent_p.V41V|TPTE_ENST00000342420.5_Intron|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	59					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.V41V(1)|p.V59V(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTCGTGCTAACACACTTTAGC	0.328																																							uc002yip.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(175-177)GTG>GTC		transmembrane phosphatase with tensin homology							98.0	93.0	94.0					21																	10959797		2203	4300	6503	SO:0001819	synonymous_variant	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10959797C>G	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.177G>C	21.37:g.10959797C>G			Somatic				TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Silent_p.V41V|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	p.V59V	NM_199261	NP_954870	WXS	Illumina HiSeq	Unspecified	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	8	545	-			59					B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	ENST00000361285.4	37	c.177G>C	CCDS13560.2																																																																																				0.328	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			4	111	0	0	0	0.00024832	0	4	111				
IGLL1	3543	broad.mit.edu	37	22	23915549	23915549	+	Silent	SNP	C	C	G	rs146592375		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr22:23915549C>G	ENST00000330377.2	-	3	663	c.546G>C	c.(544-546)acG>acC	p.T182T	IGLL1_ENST00000249053.3_3'UTR|AP000345.2_ENST00000454863.1_RNA|AP000345.2_ENST00000458318.1_RNA	NM_020070.3	NP_064455.1	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1	182	C region (By similarity to lambda light- chain).|Ig-like C1-type.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				kidney(1)|large_intestine(1)|lung(5)|skin(4)|stomach(1)	12						ACTGCTCGGGCGTCAGGCTCA	0.612																																							uc002zxd.2		NA																	0					0						c.(544-546)ACG>ACC		immunoglobulin lambda-like polypeptide 1 isoform		C	,	6,4400		0,6,2197	79.0	75.0	76.0		546,	-4.9	0.0	22	dbSNP_134	76	0,8598		0,0,4299	no	coding-synonymous,utr-3	IGLL1	NM_020070.2,NM_152855.1	,	0,6,6496	GG,GC,CC		0.0,0.1362,0.0461	,	182/214,	23915549	6,12998	2203	4299	6502	SO:0001819	synonymous_variant	3543				immune response	extracellular region|membrane		g.chr22:23915549C>G	X52204	CCDS13809.1, CCDS13810.1	22q11.23	2014-09-17			ENSG00000128322	ENSG00000128322		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	5870	protein-coding gene	gene with protein product		146770		IGLL		3139558, 2511029	Standard	NM_020070		Approved	IGVPB, IGL5, 14.1, CD179B	uc002zxd.3	P15814	OTTHUMG00000150673	ENST00000330377.2:c.546G>C	22.37:g.23915549C>G			Somatic				IGLL1_uc002zxe.2_3'UTR	p.T182T	NM_020070	NP_064455	WXS	Illumina HiSeq	Unspecified	P15814	IGLL1_HUMAN			3	664	-			182			C region (By similarity to lambda light- chain).|Ig-like C1-type.		Q0P681	Silent	SNP	ENST00000330377.2	37	c.546G>C	CCDS13809.1																																																																																				0.612	IGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319569.1	NM_020070		20	54	0	0	0	0.000175454	0	20	54				
MYH9	4627	broad.mit.edu	37	22	36710225	36710225	+	Missense_Mutation	SNP	C	C	G	rs377410439		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr22:36710225C>G	ENST00000216181.5	-	13	1749	c.1519G>C	c.(1519-1521)Gac>Cac	p.D507H	RN7SL349P_ENST00000582364.1_RNA	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	507	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GGCTGCAGGTCGAGGCCAAAG	0.582			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														uc003apg.2		NA		Dom	yes		22	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome	L	ALK		ALCL		0				breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						c.(1519-1521)GAC>CAC		myosin, heavy polypeptide 9, non-muscle							174.0	130.0	145.0					22																	36710225		2203	4300	6503	SO:0001583	missense	4627	Hereditary_Macrothrombocytopenia_MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	g.chr22:36710225C>G		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1519G>C	22.37:g.36710225C>G	ENSP00000216181:p.Asp507His		Somatic				MYH9_uc003aph.1_Missense_Mutation_p.D371H	p.D507H	NM_002473	NP_002464	WXS	Illumina HiSeq	Unspecified	P35579	MYH9_HUMAN			13	1750	-			507			Myosin head-like.		A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	c.1519G>C	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.738592	0.89573	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	T	0.78246	-1.16	5.05	5.05	0.67936	Myosin head, motor domain (3);	0.110497	0.64402	D	0.000007	D	0.91563	0.7335	H	0.97635	4.045	0.80722	D	1	P	0.48834	0.916	P	0.58172	0.834	D	0.94423	0.7642	10	0.87932	D	0	.	18.4598	0.90735	0.0:1.0:0.0:0.0	.	507	P35579	MYH9_HUMAN	H	371;507	ENSP00000216181:D507H	ENSP00000216181:D507H	D	-	1	0	MYH9	35040171	1.000000	0.71417	0.975000	0.42487	0.921000	0.55340	7.818000	0.86416	2.524000	0.85096	0.558000	0.71614	GAC		0.582	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		7	34	0	0	0	0.000157383	0	7	34				
MITF	4286	broad.mit.edu	37	3	69990419	69990419	+	Silent	SNP	A	A	G			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr3:69990419A>G	ENST00000448226.2	+	5	826	c.699A>G	c.(697-699)ctA>ctG	p.L233L	MITF_ENST00000314589.5_Silent_p.L217L|MITF_ENST00000394351.3_Silent_p.L126L|MITF_ENST00000314557.6_Silent_p.L126L|MITF_ENST00000531774.1_Silent_p.L70L|MITF_ENST00000394355.2_Silent_p.L208L|MITF_ENST00000472437.1_Silent_p.L181L|MITF_ENST00000352241.4_Silent_p.L233L|MITF_ENST00000328528.6_Silent_p.L232L			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	233	Transactivation.				bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		TCATTAGCCTAGAATCAAGTT	0.343			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														Melanoma(29;269 969 31479 41502 42961)	Melanoma(29;269 969 31479 41502 42961)	uc003dnz.2		NA		Dom	yes		3	3p14.1	4286	A	microphthalmia-associated transcription factor	yes	Waardenburg syndrome type 2|Tietz syndrome	E			melanoma 		0				ovary(2)	2						c.(697-699)CTA>CTG		microphthalmia-associated transcription factor							129.0	124.0	125.0					3																	69990419		2203	4300	6503	SO:0001819	synonymous_variant	4286				melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription	g.chr3:69990419A>G		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.699A>G	3.37:g.69990419A>G			Somatic				MITF_uc011bgb.1_Silent_p.L181L|MITF_uc003doa.2_Silent_p.L232L|MITF_uc003dob.2_Silent_p.L217L|MITF_uc003dod.2_Silent_p.L208L|MITF_uc003doe.2_Silent_p.L126L|MITF_uc003dof.2_Silent_p.L126L	p.L233L	NM_198159	NP_937802	WXS	Illumina HiSeq	Unspecified	O75030	MITF_HUMAN		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)	5	815	+		Lung NSC(201;0.0384)|Prostate(884;0.0526)	233			Transactivation.		B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	37	c.699A>G																																																																																					0.343	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159		5	29	0	0	0	8.12818e-05	0	5	29				
CNTN3	5067	broad.mit.edu	37	3	74411061	74411061	+	Silent	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr3:74411061C>T	ENST00000263665.6	-	10	1371	c.1344G>A	c.(1342-1344)gtG>gtA	p.V448V		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	448	Ig-like C2-type 5.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CCTGCACGCTCACATCCCCCT	0.468																																							uc003dpm.1		NA																	0				breast(3)|ovary(1)|skin(1)	5						c.(1342-1344)GTG>GTA		contactin 3 precursor							76.0	74.0	75.0					3																	74411061		2203	4300	6503	SO:0001819	synonymous_variant	5067				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr3:74411061C>T	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1344G>A	3.37:g.74411061C>T			Somatic					p.V448V	NM_020872	NP_065923	WXS	Illumina HiSeq	Unspecified	Q9P232	CNTN3_HUMAN		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)	10	1424	-		Lung NSC(201;0.138)|Lung SC(41;0.21)	448			Ig-like C2-type 5.		B9EK50|Q9H039	Silent	SNP	ENST00000263665.6	37	c.1344G>A	CCDS33790.1																																																																																				0.468	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872		7	71	0	0	0	8.12818e-05	0	7	71				
MROH2B	133558	broad.mit.edu	37	5	41038924	41038924	+	Missense_Mutation	SNP	G	G	T	rs376700959		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr5:41038924G>T	ENST00000399564.4	-	21	2578	c.2128C>A	c.(2128-2130)Ctc>Atc	p.L710I	MROH2B_ENST00000506092.2_Missense_Mutation_p.L265I	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	710																	GGAGCATGGAGGGCCACTGCT	0.478																																							uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(2128-2130)CTC>ATC		HEAT repeat family member 7B2							78.0	75.0	76.0					5																	41038924		1900	4123	6023	SO:0001583	missense	133558						binding	g.chr5:41038924G>T		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2128C>A	5.37:g.41038924G>T	ENSP00000382476:p.Leu710Ile		Somatic				HEATR7B2_uc003jmi.3_Missense_Mutation_p.L265I	p.L710I	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			21	2618	-			710					Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	c.2128C>A	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.534877	0.45073	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.68181	4.71;-0.31	5.93	5.04	0.67666	Armadillo-type fold (1);	0.303544	0.23896	N	0.043498	T	0.70701	0.3254	L	0.51422	1.61	0.28636	N	0.907398	D	0.59767	0.986	P	0.55713	0.782	T	0.65861	-0.6065	10	0.35671	T	0.21	.	12.3474	0.55128	0.0:0.0:0.8314:0.1686	.	710	Q7Z745	HTRB2_HUMAN	I	265;415;710	ENSP00000441504:L265I;ENSP00000382476:L710I	ENSP00000296803:L415I	L	-	1	0	HEATR7B2	41074681	1.000000	0.71417	1.000000	0.80357	0.573000	0.36030	1.609000	0.36858	1.458000	0.47871	0.655000	0.94253	CTC		0.478	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		9	37	1	0	3.86212e-05	0.000673444	0.000504468	9	37				
GPR98	84059	broad.mit.edu	37	5	90072275	90072275	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr5:90072275G>T	ENST00000405460.2	+	61	12505	c.12409G>T	c.(12409-12411)Gca>Tca	p.A4137S		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4137					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTTAGGTAGTGCATCAATAAT	0.418																																							uc003kju.2		NA																	0				ovary(11)|central_nervous_system(3)|pancreas(2)	16						c.(12409-12411)GCA>TCA		G protein-coupled receptor 98 precursor							93.0	93.0	93.0					5																	90072275		1925	4126	6051	SO:0001583	missense	84059				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr5:90072275G>T	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.12409G>T	5.37:g.90072275G>T	ENSP00000384582:p.Ala4137Ser		Somatic				GPR98_uc003kjt.2_Missense_Mutation_p.A1843S	p.A4137S	NM_032119	NP_115495	WXS	Illumina HiSeq	Unspecified	Q8WXG9	GPR98_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)	61	12505	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	4137			Extracellular (Potential).		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	c.12409G>T	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.912691	0.52439	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.35789	1.29	5.27	5.27	0.74061	.	0.096869	0.64402	D	0.000001	T	0.42108	0.1188	M	0.66939	2.045	0.80722	D	1	P	0.42692	0.787	B	0.40199	0.322	T	0.40478	-0.9561	10	0.44086	T	0.13	.	18.8671	0.92296	0.0:0.0:1.0:0.0	.	4137	Q8WXG9	GPR98_HUMAN	S	4137	ENSP00000384582:A4137S	ENSP00000296619:A4137S	A	+	1	0	GPR98	90108031	1.000000	0.71417	0.986000	0.45419	0.362000	0.29581	8.188000	0.89710	2.629000	0.89072	0.637000	0.83480	GCA		0.418	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		5	17	1	0	0.000602214	0.000602214	0.00766266	5	17				
YTHDC2	64848	broad.mit.edu	37	5	112860861	112860861	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr5:112860861T>A	ENST00000161863.4	+	3	675	c.462T>A	c.(460-462)ttT>ttA	p.F154L	YTHDC2_ENST00000515883.1_Missense_Mutation_p.F154L	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	154					ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GAAATGTGTTTGCAGTTGAAG	0.353																																							uc003kqn.2		NA																	0				skin(2)|central_nervous_system(1)	3						c.(460-462)TTT>TTA		YTH domain containing 2							111.0	115.0	114.0					5																	112860861		2202	4300	6502	SO:0001583	missense	64848						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr5:112860861T>A	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.462T>A	5.37:g.112860861T>A	ENSP00000161863:p.Phe154Leu		Somatic				YTHDC2_uc010jce.1_Missense_Mutation_p.F154L|YTHDC2_uc010jcf.1_Intron	p.F154L	NM_022828	NP_073739	WXS	Illumina HiSeq	Unspecified	Q9H6S0	YTDC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)	3	645	+		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)	154					B2RP66	Missense_Mutation	SNP	ENST00000161863.4	37	c.462T>A	CCDS4113.1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.617439	0.46736	.	.	ENSG00000047188	ENST00000161863;ENST00000515883;ENST00000514720;ENST00000511372	T;T	0.06218	4.31;3.33	5.93	4.78	0.61160	.	0.299635	0.37955	N	0.001872	T	0.05823	0.0152	L	0.40543	1.245	0.51012	D	0.999902	B	0.02656	0.0	B	0.01281	0.0	T	0.28490	-1.0042	10	0.11182	T	0.66	.	11.4609	0.50211	0.0:0.0697:0.0:0.9303	.	154	Q9H6S0	YTDC2_HUMAN	L	154;154;94;64	ENSP00000161863:F154L;ENSP00000423101:F154L	ENSP00000161863:F154L	F	+	3	2	YTHDC2	112888760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.319000	0.51983	2.263000	0.75096	0.533000	0.62120	TTT		0.353	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828		6	34	0	0	0	8.12818e-05	0	6	34				
NMUR2	56923	broad.mit.edu	37	5	151784021	151784021	+	Missense_Mutation	SNP	C	C	A	rs200602427		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr5:151784021C>A	ENST00000255262.3	-	1	819	c.654G>T	c.(652-654)caG>caT	p.Q218H	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	218					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AGGAGGTGACCTGGATGATGA	0.532																																							uc003luv.2		NA																	0				ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8						c.(652-654)CAG>CAT		neuromedin U receptor 2							166.0	155.0	159.0					5																	151784021		2203	4300	6503	SO:0001583	missense	56923				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity	g.chr5:151784021C>A	AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.654G>T	5.37:g.151784021C>A	ENSP00000255262:p.Gln218His		Somatic					p.Q218H	NM_020167	NP_064552	WXS	Illumina HiSeq	Unspecified	Q9GZQ4	NMUR2_HUMAN	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)		1	820	-		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	218			Helical; Name=5; (Potential).		Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	37	c.654G>T	CCDS4321.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333771	0.60853	.	.	ENSG00000132911	ENST00000255262	T	0.71934	-0.61	5.44	2.2	0.27929	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.76118	0.3943	M	0.61703	1.905	0.44000	D	0.9967	D	0.89917	1.0	D	0.72982	0.979	T	0.71497	-0.4575	10	0.14252	T	0.57	-20.1303	8.8601	0.35251	0.0:0.6473:0.0:0.3527	.	218	Q9GZQ4	NMUR2_HUMAN	H	218	ENSP00000255262:Q218H	ENSP00000255262:Q218H	Q	-	3	2	NMUR2	151764214	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.918000	0.40006	0.656000	0.30886	0.585000	0.79938	CAG		0.532	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167		16	110	1	0	2.23348e-06	0.000422831	3.02442e-05	16	110				
LCP2	3937	broad.mit.edu	37	5	169697723	169697723	+	Splice_Site	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr5:169697723C>A	ENST00000046794.5	-	7	1138	c.523G>T	c.(523-525)Gac>Tac	p.D175Y		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	175					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		GGGCCCTTACCGATGTACATG	0.582																																							uc003man.1		NA																	0				ovary(1)	1						c.(523-525)GAC>TAC		lymphocyte cytosolic protein 2							92.0	104.0	100.0					5																	169697723		2078	4197	6275	SO:0001630	splice_region_variant	3937				immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding	g.chr5:169697723C>A		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.523+1G>T	5.37:g.169697723C>A			Somatic				LCP2_uc011det.1_Missense_Mutation_p.D4Y|LCP2_uc010jjo.1_5'Flank	p.D175Y	NM_005565	NP_005556	WXS	Illumina HiSeq	Unspecified	Q13094	LCP2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)	7	730	-	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	175					A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	37	c.523G>T	CCDS47339.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692707	0.68271	.	.	ENSG00000043462	ENST00000046794	T	0.57595	0.39	5.4	4.54	0.55810	.	0.326162	0.27725	N	0.018109	T	0.69070	0.3070	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.70193	-0.4939	9	.	.	.	-26.6066	10.3699	0.44046	0.0:0.9092:0.0:0.0908	.	175	Q13094	LCP2_HUMAN	Y	175	ENSP00000046794:D175Y	.	D	-	1	0	LCP2	169630301	0.997000	0.39634	0.976000	0.42696	0.790000	0.44656	4.175000	0.58263	1.410000	0.46936	0.655000	0.94253	GAC		0.582	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	Missense_Mutation	16	60	1	0	2.48551e-13	0.000566183	4.03143e-12	16	60				
PHIP	55023	broad.mit.edu	37	6	79655879	79655879	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr6:79655879T>C	ENST00000275034.4	-	38	4636	c.4469A>G	c.(4468-4470)aAt>aGt	p.N1490S	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1490					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CTGAGCAGCATTGTGTCTTGG	0.438																																							uc003pir.2		NA																	0				large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6						c.(4468-4470)AAT>AGT		pleckstrin homology domain interacting protein							207.0	182.0	191.0					6																	79655879		2203	4300	6503	SO:0001583	missense	55023				insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding	g.chr6:79655879T>C	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.4469A>G	6.37:g.79655879T>C	ENSP00000275034:p.Asn1490Ser		Somatic				PHIP_uc003piq.2_Missense_Mutation_p.N514S|PHIP_uc011dyp.1_Missense_Mutation_p.N1489S|IRAK1BP1_uc010kbg.1_RNA|PHIP_uc003pio.3_Missense_Mutation_p.N376S	p.N1490S	NM_017934	NP_060404	WXS	Illumina HiSeq	Unspecified	Q8WWQ0	PHIP_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.231)	38	4695	-		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)	1490					A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	37	c.4469A>G	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	T	2.748	-0.260702	0.05791	.	.	ENSG00000146247	ENST00000275034;ENST00000355098	T	0.38240	1.15	5.96	1.96	0.26148	.	0.294034	0.32218	N	0.006403	T	0.03651	0.0104	N	0.02539	-0.55	0.09310	N	0.999996	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45026	-0.9289	9	.	.	.	-22.1289	6.7724	0.23601	0.0:0.1457:0.185:0.6694	.	1490;1490	A7J992;Q8WWQ0	.;PHIP_HUMAN	S	1490;216	ENSP00000275034:N1490S	.	N	-	2	0	PHIP	79712598	0.123000	0.22298	0.991000	0.47740	0.936000	0.57629	0.241000	0.18065	0.468000	0.27243	0.533000	0.62120	AAT		0.438	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2			11	83	0	0	0	0.000978159	0	11	83				
HS3ST5	222537	broad.mit.edu	37	6	114383989	114383989	+	Silent	SNP	C	C	T	rs369720690		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr6:114383989C>T	ENST00000312719.5	-	4	1209	c.21G>A	c.(19-21)gcG>gcA	p.A7A	RP3-399L15.3_ENST00000519104.1_RNA|HS3ST5_ENST00000411826.1_Silent_p.A7A|RP3-399L15.3_ENST00000523087.1_RNA			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	7					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		GTCTCAGCCACGCCTGCTGTT	0.547																																							uc003pwg.3		NA																	0				ovary(1)|pancreas(1)	2						c.(19-21)GCG>GCA		heparan sulfate (glucosamine)		C		0,4406		0,0,2203	106.0	102.0	103.0		21	5.1	1.0	6		103	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	HS3ST5	NM_153612.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		7/347	114383989	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	222537				heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding	g.chr6:114383989C>T	AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.21G>A	6.37:g.114383989C>T			Somatic				uc003pwf.2_Intron|HS3ST5_uc003pwh.3_Silent_p.A7A	p.A7A	NM_153612	NP_705840	WXS	Illumina HiSeq	Unspecified	Q8IZT8	HS3S5_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)	1	53	-		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)	7			Cytoplasmic (Potential).		A8K1J2|Q52LI2|Q8N285	Silent	SNP	ENST00000312719.5	37	c.21G>A	CCDS34517.1																																																																																				0.547	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041911.2	NM_153612		10	62	0	0	0	0.000673444	0	10	62				
TMEM200A	114801	broad.mit.edu	37	6	130762987	130762987	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr6:130762987C>T	ENST00000296978.3	+	3	2291	c.1420C>T	c.(1420-1422)Cat>Tat	p.H474Y	TMEM200A_ENST00000392429.1_Missense_Mutation_p.H474Y|TMEM200A_ENST00000545622.1_Missense_Mutation_p.H474Y	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	474						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GAGTTTTGAACATGATGAGTT	0.323																																							uc003qca.2		NA																	0				ovary(1)	1						c.(1420-1422)CAT>TAT		transmembrane protein 200A							54.0	55.0	55.0					6																	130762987		2203	4300	6503	SO:0001583	missense	114801					integral to membrane		g.chr6:130762987C>T	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.1420C>T	6.37:g.130762987C>T	ENSP00000296978:p.His474Tyr		Somatic				TMEM200A_uc010kfh.2_Missense_Mutation_p.H474Y|TMEM200A_uc010kfi.2_Missense_Mutation_p.H474Y|TMEM200A_uc003qcb.2_Missense_Mutation_p.H474Y	p.H474Y	NM_052913	NP_443145	WXS	Illumina HiSeq	Unspecified	Q86VY9	T200A_HUMAN		GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)	3	2291	+			474			Cytoplasmic (Potential).		Q96PX5	Missense_Mutation	SNP	ENST00000296978.3	37	c.1420C>T	CCDS5140.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762064	0.69763	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.76	5.76	0.90799	.	0.101955	0.64402	D	0.000003	T	0.38983	0.1061	N	0.14661	0.345	0.80722	D	1	D	0.59357	0.985	P	0.49799	0.622	T	0.44590	-0.9318	9	0.62326	D	0.03	-19.9447	19.9601	0.97247	0.0:1.0:0.0:0.0	.	474	Q86VY9	T200A_HUMAN	Y	474	.	ENSP00000296978:H474Y	H	+	1	0	TMEM200A	130804680	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.817000	0.69229	2.720000	0.93068	0.655000	0.94253	CAT		0.323	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042201.1	NM_052913		10	29	0	0	0	0.000442599	0	10	29				
UTRN	7402	broad.mit.edu	37	6	144803496	144803496	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr6:144803496G>A	ENST00000367545.3	+	26	3659	c.3659G>A	c.(3658-3660)aGa>aAa	p.R1220K		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1220					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CTTTGTAATAGAATTCGAGGA	0.353																																							uc003qkt.2		NA																	0				ovary(4)|pancreas(1)	5						c.(3658-3660)AGA>AAA		utrophin							91.0	88.0	89.0					6																	144803496		2203	4300	6503	SO:0001583	missense	7402				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding	g.chr6:144803496G>A	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.3659G>A	6.37:g.144803496G>A	ENSP00000356515:p.Arg1220Lys		Somatic					p.R1220K	NM_007124	NP_009055	WXS	Illumina HiSeq	Unspecified	P46939	UTRO_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)	26	3751	+		Ovarian(120;0.218)	1220			Spectrin 8.		Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	c.3659G>A	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768516	0.90020	.	.	ENSG00000152818	ENST00000367545	T	0.50277	0.75	5.51	4.65	0.58169	.	0.000000	0.50627	D	0.000113	T	0.46034	0.1372	L	0.36672	1.1	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.40757	-0.9546	10	0.30854	T	0.27	.	14.2824	0.66221	0.0714:0.0:0.9286:0.0	.	1220	P46939	UTRO_HUMAN	K	1220	ENSP00000356515:R1220K	ENSP00000356515:R1220K	R	+	2	0	UTRN	144845189	1.000000	0.71417	0.844000	0.33320	0.941000	0.58515	9.624000	0.98398	1.330000	0.45394	0.563000	0.77884	AGA		0.353	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1			11	32	0	0	0	0.000151284	0	11	32				
CPVL	54504	broad.mit.edu	37	7	29070208	29070208	+	Silent	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr7:29070208C>A	ENST00000409850.1	-	16	1951	c.1305G>T	c.(1303-1305)gcG>gcT	p.A435A	CPVL_ENST00000396276.3_Silent_p.A435A|CPVL_ENST00000265394.5_Silent_p.A435A			Q9H3G5	CPVL_HUMAN	carboxypeptidase, vitellogenic-like	435			A -> V (in dbSNP:rs7313). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16303743}.			extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)	28						GGAAGTCACCCGCTTGCCGGA	0.478																																							uc003szv.2		NA																	0				ovary(2)	2						c.(1303-1305)GCG>GCT		serine carboxypeptidase vitellogenic-like							142.0	140.0	141.0					7																	29070208		2203	4300	6503	SO:0001819	synonymous_variant	54504				proteolysis		protein binding|serine-type carboxypeptidase activity	g.chr7:29070208C>A	AF106704	CCDS5419.1	7p15.1	2012-02-10			ENSG00000106066	ENSG00000106066			14399	protein-coding gene	gene with protein product	"""carboxypeptidase WUG"", ""vitellogenic carboxypeptidase-like protein"", ""CP-Mac carboxypeptidase"""	609780				11401439	Standard	XM_005249786		Approved		uc003szw.3	Q9H3G5	OTTHUMG00000023669	ENST00000409850.1:c.1305G>T	7.37:g.29070208C>A			Somatic				CPVL_uc003szw.2_Silent_p.A435A|CPVL_uc003szx.2_Silent_p.A435A	p.A435A	NM_031311	NP_112601	WXS	Illumina HiSeq	Unspecified	Q9H3G5	CPVL_HUMAN			12	1424	-			435					A4D1A4|Q6UX20|Q8NBL7|Q96AR7|Q9HB41	Silent	SNP	ENST00000409850.1	37	c.1305G>T	CCDS5419.1	.	.	.	.	.	.	.	.	.	.	C	7.135	0.580746	0.13686	.	.	ENSG00000106066	ENST00000432534	.	.	.	5.5	2.41	0.29592	.	.	.	.	.	T	0.36358	0.0964	.	.	.	0.35192	D	0.773491	.	.	.	.	.	.	T	0.40270	-0.9572	4	.	.	.	-15.4544	1.1866	0.01856	0.4041:0.2916:0.1105:0.1939	.	.	.	.	W	139	.	.	G	-	1	0	CPVL	29036733	0.897000	0.30589	0.852000	0.33557	0.846000	0.48090	0.426000	0.21363	0.627000	0.30340	0.585000	0.79938	GGG		0.478	CPVL-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328305.1	NM_019029		35	190	1	0	5.71845e-15	0.00111076	9.70165e-14	35	190				
GSAP	54103	broad.mit.edu	37	7	76982913	76982913	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr7:76982913C>A	ENST00000257626.7	-	17	1462	c.1384G>T	c.(1384-1386)Gac>Tac	p.D462Y		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	462					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										TGAATGAGGTCAAATGAATGG	0.378																																							uc003ugf.2		NA																	0				central_nervous_system(1)	1						c.(1384-1386)GAC>TAC		pigeon homolog							96.0	91.0	93.0					7																	76982913		2203	4300	6503	SO:0001583	missense	54103				beta-amyloid formation|regulation of proteolysis	trans-Golgi network	beta-amyloid binding	g.chr7:76982913C>A		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.1384G>T	7.37:g.76982913C>A	ENSP00000257626:p.Asp462Tyr		Somatic				PION_uc003ugg.1_Missense_Mutation_p.D247Y	p.D462Y	NM_017439	NP_059135	WXS	Illumina HiSeq	Unspecified	A4D1B5	GSAP_HUMAN			17	1463	-			462					A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	ENST00000257626.7	37	c.1384G>T	CCDS34672.2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127152	0.77549	.	.	ENSG00000186088	ENST00000257626	T	0.23754	1.89	5.95	5.95	0.96441	.	0.000000	0.64402	U	0.000001	T	0.52484	0.1737	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.51148	-0.8742	10	0.87932	D	0	.	17.3192	0.87232	0.0:1.0:0.0:0.0	.	462;462	A4D1B5-3;A4D1B5	.;GSAP_HUMAN	Y	462	ENSP00000257626:D462Y	ENSP00000257626:D462Y	D	-	1	0	PION	76820849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.591000	0.46163	2.827000	0.97445	0.650000	0.86243	GAC		0.378	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439		9	52	1	0	0.000673444	0.000673444	0.00849576	9	52				
SAMD9L	219285	broad.mit.edu	37	7	92762430	92762430	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr7:92762430C>G	ENST00000318238.4	-	5	4071	c.2855G>C	c.(2854-2856)aGt>aCt	p.S952T	SAMD9L_ENST00000411955.1_Missense_Mutation_p.S952T|SAMD9L_ENST00000437805.1_Missense_Mutation_p.S952T	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	952					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CCAGGGTGTACTAGTGTATAT	0.383																																							uc003umh.1		NA																	0				ovary(4)	4						c.(2854-2856)AGT>ACT		sterile alpha motif domain containing 9-like							87.0	84.0	85.0					7																	92762430		2203	4299	6502	SO:0001583	missense	219285							g.chr7:92762430C>G	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.2855G>C	7.37:g.92762430C>G	ENSP00000326247:p.Ser952Thr		Somatic				SAMD9L_uc003umj.1_Missense_Mutation_p.S952T|SAMD9L_uc003umi.1_Missense_Mutation_p.S952T|SAMD9L_uc010lfb.1_Missense_Mutation_p.S952T|SAMD9L_uc003umk.1_Missense_Mutation_p.S952T|SAMD9L_uc010lfc.1_Missense_Mutation_p.S952T|SAMD9L_uc010lfd.1_Missense_Mutation_p.S952T|SAMD9L_uc011khx.1_Intron	p.S952T	NM_152703	NP_689916	WXS	Illumina HiSeq	Unspecified	Q8IVG5	SAM9L_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		5	4071	-	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		952					A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	c.2855G>C	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	C	8.338	0.828137	0.16749	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.23147	1.92;1.92;1.92	5.02	-5.03	0.02973	.	2.042130	0.02511	N	0.091577	T	0.17662	0.0424	L	0.40543	1.245	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.11203	-1.0597	10	0.31617	T	0.26	6.0179	3.0873	0.06281	0.1043:0.1397:0.3061:0.4499	.	952	Q8IVG5	SAM9L_HUMAN	T	952	ENSP00000326247:S952T;ENSP00000405760:S952T;ENSP00000408796:S952T	ENSP00000326247:S952T	S	-	2	0	SAMD9L	92600366	0.000000	0.05858	0.000000	0.03702	0.884000	0.51177	-2.750000	0.00793	-1.424000	0.01999	0.467000	0.42956	AGT		0.383	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703		3	28	0	0	0	6.4e-05	0	3	28				
FLNC	2318	broad.mit.edu	37	7	128481258	128481258	+	Silent	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr7:128481258C>A	ENST00000325888.8	+	12	2109	c.1848C>A	c.(1846-1848)atC>atA	p.I616I	FLNC_ENST00000346177.6_Silent_p.I616I	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	616					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AAGCCAAGATCGAATGTGACG	0.637																																							uc003vnz.3		NA																	0				breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(1846-1848)ATC>ATA		gamma filamin isoform a							108.0	115.0	113.0					7																	128481258		2114	4223	6337	SO:0001819	synonymous_variant	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128481258C>A	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.1848C>A	7.37:g.128481258C>A			Somatic				FLNC_uc003voa.3_Silent_p.I616I	p.I616I	NM_001458	NP_001449	WXS	Illumina HiSeq	Unspecified	Q14315	FLNC_HUMAN			12	2057	+			616			Filamin 4.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	37	c.1848C>A	CCDS43644.1																																																																																				0.637	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			20	77	1	0	5.26018e-13	0.000229342	8.43916e-12	20	77				
SLC35B4	84912	broad.mit.edu	37	7	133986513	133986513	+	Splice_Site	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr7:133986513C>A	ENST00000378509.4	-	6	786	c.487G>T	c.(487-489)Ggt>Tgt	p.G163C		NM_032826.4	NP_116215.1	Q969S0	S35B4_HUMAN	solute carrier family 35 (UDP-xylose/UDP-N-acetylglucosamine transporter), member B4	163					carbohydrate transport (GO:0008643)|regulation of gluconeogenesis (GO:0006111)|transmembrane transport (GO:0055085)|UDP-N-acetylglucosamine transport (GO:0015788)|UDP-xylose transport (GO:0015790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-N-acetylglucosamine transmembrane transporter activity (GO:0005462)|UDP-xylose transmembrane transporter activity (GO:0005464)			large_intestine(1)|lung(2)|skin(1)|stomach(1)	5						TTGTACTTGCCTAGTAACCAC	0.393																																							uc003vrn.2		NA																	0				skin(1)	1						c.(487-489)GGT>TGT		solute carrier family 35, member B4							128.0	136.0	134.0					7																	133986513		2203	4300	6503	SO:0001630	splice_region_variant	84912					Golgi membrane|integral to membrane	UDP-N-acetylglucosamine transmembrane transporter activity|UDP-xylose transmembrane transporter activity	g.chr7:133986513C>A	AB052892	CCDS34756.1	7q33	2013-07-17	2013-07-17		ENSG00000205060	ENSG00000205060		"""Solute carriers"""	20584	protein-coding gene	gene with protein product		610923	"""solute carrier family 35, member B4"""				Standard	NM_032826		Approved	FLJ14697, YEA4	uc003vrn.3	Q969S0	OTTHUMG00000155321	ENST00000378509.4:c.487+1G>T	7.37:g.133986513C>A			Somatic				SLC35B4_uc010lmk.2_Missense_Mutation_p.G27C|SLC35B4_uc010lml.1_Missense_Mutation_p.G95C|SLC35B4_uc003vro.3_Missense_Mutation_p.G163C	p.G163C	NM_032826	NP_116215	WXS	Illumina HiSeq	Unspecified	Q969S0	S35B4_HUMAN			6	811	-			163			Helical; (Potential).		A4D1P3|A6NNS4|Q53GQ7|Q8TCU7|Q96K33	Missense_Mutation	SNP	ENST00000378509.4	37	c.487G>T	CCDS34756.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656568	0.88154	.	.	ENSG00000205060	ENST00000378509	D	0.85013	-1.93	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.94551	0.8245	M	0.92604	3.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94870	0.8029	9	.	.	.	-5.5962	19.2163	0.93780	0.0:1.0:0.0:0.0	.	163;163;163	Q969S0-3;Q969S0-2;Q969S0	.;.;S35B4_HUMAN	C	163	ENSP00000367770:G163C	.	G	-	1	0	SLC35B4	133637053	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.846000	0.62860	2.890000	0.99128	0.585000	0.79938	GGT		0.393	SLC35B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339444.2	NM_032826	Missense_Mutation	30	170	1	0	4.31634e-10	0.000409698	6.50093e-09	30	170				
PRSS3P2	154754	broad.mit.edu	37	7	142482242	142482242	+	RNA	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr7:142482242G>A	ENST00000603901.1	+	0	622					NR_001296.3		Q8NHM4	TRY6_HUMAN	protease, serine, 3 pseudogene 2						endothelial cell migration (GO:0043542)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)										GGTCTGCAATGGACAGCTTCA	0.493																																							uc011ksq.1		NA																	0					0						c.(622-624)GGA>AGA		SubName: Full=Protease, serine, 3; Flags: Fragment;																																						154754							g.chr7:142482242G>A			7q34	2012-03-06			ENSG00000250606	ENSG00000275896			43788	pseudogene	pseudogene	"""trypsinogen C"""						Standard	NR_001296		Approved	TRY6	uc011ksq.2	Q8NHM4	OTTHUMG00000158904		7.37:g.142482242G>A			Somatic				uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc003wan.1_Intron	p.G208R	NR_001296		WXS	Illumina HiSeq	Unspecified					5	705	+									Missense_Mutation	SNP	ENST00000603901.1	37	c.622G>A																																																																																					0.493	PRSS3P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000470000.1	NR_001296		5	50	0	0	0	3.59834e-05	0	5	50				
OR6B1	135946	broad.mit.edu	37	7	143701548	143701548	+	Silent	SNP	T	T	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr7:143701548T>C	ENST00000408922.2	+	1	527	c.459T>C	c.(457-459)ttT>ttC	p.F153F		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					CCATTGGCTTTGGCATCTCCC	0.532																																							uc003wdt.1		NA																	0				ovary(1)	1						c.(457-459)TTT>TTC		olfactory receptor, family 6, subfamily B,							85.0	85.0	85.0					7																	143701548		2129	4261	6390	SO:0001819	synonymous_variant	135946				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143701548T>C		CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.459T>C	7.37:g.143701548T>C			Somatic					p.F153F	NM_001005281	NP_001005281	WXS	Illumina HiSeq	Unspecified	O95007	OR6B1_HUMAN			1	459	+	Melanoma(164;0.0783)		153			Helical; Name=4; (Potential).		A4D2G2|B9EH47|Q6IFP6|Q96R38	Silent	SNP	ENST00000408922.2	37	c.459T>C	CCDS43667.1																																																																																				0.532	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349566.1			4	31	0	0	0	0.00024832	0	4	31				
PLAG1	5324	broad.mit.edu	37	8	57080807	57080807	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr8:57080807C>T	ENST00000316981.3	-	4	501	c.22G>A	c.(22-24)Gat>Aat	p.D8N	PLAG1_ENST00000423799.2_Intron|PLAG1_ENST00000429357.2_Missense_Mutation_p.D8N	NM_001114634.1|NM_002655.2	NP_001108106.1|NP_002646.2	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1	8	Interacts with KPNA2.				gland morphogenesis (GO:0022612)|multicellular organism growth (GO:0035264)|negative regulation of gene expression (GO:0010629)|organ growth (GO:0035265)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		CTNNB1/PLAG1(60)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|FGFR1_ENST00000447712/PLAG1(28)|COL1A2/PLAG1(3)|CHCHD7/PLAG1(12)|TCEA1_ENST00000521604/PLAG1(3)	breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			TCTGACAAATCACCAGGAATG	0.463			T	"""TCEA1, LIFR, CTNNB1, CHCHD7"""	salivary adenoma																																		uc003xsq.3		NA		Dom	yes		8	8q12	5324	T	pleiomorphic adenoma gene 1			E	TCEA1|LIFR|CTNNB1|CHCHD7		salivary adenoma	CTNNB1/PLAG1(60)|FGFR1_ENST00000447712/PLAG1(28)|CHCHD7/PLAG1(12)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|COL1A2/PLAG1(3)|TCEA1_ENST00000521604/PLAG1(3)	0				salivary_gland(113)|soft_tissue(13)|lung(1)|central_nervous_system(1)|breast(1)	129						c.(22-24)GAT>AAT		pleiomorphic adenoma gene 1 isoform b							96.0	88.0	91.0					8																	57080807		2203	4300	6503	SO:0001583	missense	5324					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:57080807C>T	U65002	CCDS6165.1, CCDS47860.1	8q12	2010-07-30				ENSG00000181690		"""Zinc fingers, C2H2-type"""	9045	protein-coding gene	gene with protein product		603026				9268638	Standard	NM_002655		Approved	ZNF912	uc010lyi.3	Q6DJT9		ENST00000316981.3:c.22G>A	8.37:g.57080807C>T	ENSP00000325546:p.Asp8Asn		Somatic				PLAG1_uc003xsr.3_Missense_Mutation_p.D8N|PLAG1_uc010lyi.2_Missense_Mutation_p.D8N|PLAG1_uc010lyj.2_Intron	p.D8N	NM_001114635	NP_001108107	WXS	Illumina HiSeq	Unspecified	Q6DJT9	PLAG1_HUMAN	Epithelial(17;0.00179)|all cancers(17;0.0125)		2	473	-		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	8			Interacts with KPNA2.		B4DLC2|Q59GH8|Q9Y4L2	Missense_Mutation	SNP	ENST00000316981.3	37	c.22G>A	CCDS6165.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.080559	0.76528	.	.	ENSG00000181690	ENST00000316981;ENST00000429357	T;T	0.11385	2.78;2.78	5.36	5.36	0.76844	.	0.159057	0.53938	D	0.000058	T	0.15262	0.0368	N	0.14661	0.345	0.80722	D	1	D	0.57571	0.98	P	0.57009	0.811	T	0.18272	-1.0342	10	0.26408	T	0.33	-10.631	19.4461	0.94847	0.0:1.0:0.0:0.0	.	8	Q6DJT9	PLAG1_HUMAN	N	8	ENSP00000325546:D8N;ENSP00000416537:D8N	ENSP00000325546:D8N	D	-	1	0	PLAG1	57243361	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.204000	0.58460	2.638000	0.89438	0.563000	0.77884	GAT		0.463	PLAG1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378212.1	NM_002655		7	67	0	0	0	0.000274275	0	7	67				
CHD7	55636	broad.mit.edu	37	8	61774808	61774808	+	Silent	SNP	T	T	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr8:61774808T>C	ENST00000423902.2	+	36	8363	c.7884T>C	c.(7882-7884)caT>caC	p.H2628H	CHD7_ENST00000524602.1_Silent_p.H579H	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2628					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AGAAACGACATAGATGTCGAA	0.353																																							uc003xue.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9	GRCh37	CD061381	CHD7	D		c.(7882-7884)CAT>CAC		chromodomain helicase DNA binding protein 7							54.0	50.0	51.0					8																	61774808		1843	4090	5933	SO:0001819	synonymous_variant	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61774808T>C	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.7884T>C	8.37:g.61774808T>C			Somatic					p.H2628H	NM_017780	NP_060250	WXS	Illumina HiSeq	Unspecified	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		36	8361	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	2628					D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	37	c.7884T>C	CCDS47865.1																																																																																				0.353	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		4	16	0	0	0	0.00024832	0	4	16				
DPY19L4	286148	broad.mit.edu	37	8	95792635	95792635	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr8:95792635T>C	ENST00000414645.2	+	15	1723	c.1624T>C	c.(1624-1626)Tgg>Cgg	p.W542R		NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	542						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					TCTCAGCTTATGGAAAGAGGt	0.303																																							uc003ygx.2		NA																	0				ovary(2)	2						c.(1624-1626)TGG>CGG		dpy-19-like 4							51.0	50.0	50.0					8																	95792635		2200	4293	6493	SO:0001583	missense	286148					integral to membrane		g.chr8:95792635T>C		CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.1624T>C	8.37:g.95792635T>C	ENSP00000389630:p.Trp542Arg		Somatic					p.W542R	NM_181787	NP_861452	WXS	Illumina HiSeq	Unspecified	Q7Z388	D19L4_HUMAN			15	1748	+	Breast(36;3.85e-06)		542			Helical; (Potential).		Q6ZW32|Q6ZW42|Q7Z329	Missense_Mutation	SNP	ENST00000414645.2	37	c.1624T>C	CCDS34924.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.083148	0.76642	.	.	ENSG00000156162	ENST00000414645	T	0.54279	0.58	5.25	5.25	0.73442	.	0.122876	0.64402	D	0.000011	T	0.61627	0.2362	L	0.54323	1.7	0.58432	D	0.999999	D	0.55172	0.97	P	0.57846	0.828	T	0.57963	-0.7720	10	0.25751	T	0.34	-0.7334	14.0342	0.64636	0.0:0.0:0.0:1.0	.	542	Q7Z388	D19L4_HUMAN	R	542	ENSP00000389630:W542R	ENSP00000389630:W542R	W	+	1	0	DPY19L4	95861811	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.244000	0.72391	2.102000	0.63906	0.528000	0.53228	TGG		0.303	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379339.1	NM_181787		11	38	0	0	0	0.000978159	0	11	38				
ZFAT	57623	broad.mit.edu	37	8	135622829	135622829	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr8:135622829G>A	ENST00000377838.3	-	4	692	c.518C>T	c.(517-519)cCa>cTa	p.P173L	ZFAT_ENST00000523399.1_Intron|ZFAT_ENST00000429442.2_Missense_Mutation_p.P161L|ZFAT_ENST00000520356.1_Missense_Mutation_p.P161L|ZFAT_ENST00000520727.1_Missense_Mutation_p.P161L|ZFAT_ENST00000520214.1_Missense_Mutation_p.P161L	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	173					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CTGTGACCGTGGTCTTTTCGA	0.443																																							uc003yup.2		NA																	0				central_nervous_system(1)	1						c.(517-519)CCA>CTA		zinc finger protein 406 isoform ZFAT-1							168.0	158.0	161.0					8																	135622829		1915	4121	6036	SO:0001583	missense	57623				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding	g.chr8:135622829G>A	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.518C>T	8.37:g.135622829G>A	ENSP00000367069:p.Pro173Leu		Somatic				ZFAT_uc003yun.2_Missense_Mutation_p.P161L|ZFAT_uc003yuo.2_Missense_Mutation_p.P161L|ZFAT_uc010meh.2_Missense_Mutation_p.P161L|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Missense_Mutation_p.P161L|ZFAT_uc010mej.2_Intron|ZFAT_uc003yur.2_Missense_Mutation_p.P161L	p.P173L	NM_020863	NP_065914	WXS	Illumina HiSeq	Unspecified	Q9P243	ZFAT_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0432)		4	693	-	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		173					B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	c.518C>T	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.443734	0.43429	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000398946;ENST00000522257	T;T;T;T;T;T	0.44881	3.02;2.96;2.97;2.95;2.96;0.91	5.36	4.49	0.54785	.	0.396543	0.25050	N	0.033521	T	0.28134	0.0694	L	0.27053	0.805	0.80722	D	1	B;B;B	0.12630	0.006;0.002;0.001	B;B;B	0.12156	0.003;0.007;0.001	T	0.05886	-1.0858	10	0.08599	T	0.76	-6.6309	13.4059	0.60913	0.0761:0.0:0.9239:0.0	.	161;161;173	E9PBN4;Q9P243-3;Q9P243	.;.;ZFAT_HUMAN	L	161;161;161;173;161;161;161;111	ENSP00000427879:P161L;ENSP00000427831:P161L;ENSP00000394501:P161L;ENSP00000367069:P173L;ENSP00000428483:P161L;ENSP00000429983:P111L	ENSP00000326997:P161L	P	-	2	0	ZFAT	135692011	1.000000	0.71417	0.087000	0.20705	0.899000	0.52679	3.969000	0.56816	1.253000	0.44018	0.655000	0.94253	CCA		0.443	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939		17	66	0	0	0	0.000229342	0	17	66				
FBXO10	26267	broad.mit.edu	37	9	37541466	37541466	+	Silent	SNP	T	T	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr9:37541466T>C	ENST00000432825.2	-	2	348	c.300A>G	c.(298-300)ctA>ctG	p.L100L	RP11-613M10.8_ENST00000544475.1_5'UTR|FBXO10_ENST00000541829.1_Intron|RP11-613M10.8_ENST00000537239.2_3'UTR	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	100					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		TCCGGCGGAATAGAGAAAAGC	0.552																																							uc004aab.2		NA																	0				lung(5)	5						c.(298-300)CTA>CTG		F-box protein 10							75.0	75.0	75.0					9																	37541466		2030	4195	6225	SO:0001819	synonymous_variant	26267					ubiquitin ligase complex	ubiquitin-protein ligase activity	g.chr9:37541466T>C	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.300A>G	9.37:g.37541466T>C			Somatic				FBXO10_uc004aac.2_Silent_p.L116L|FBXO10_uc004aad.2_Intron	p.L100L	NM_012166	NP_036298	WXS	Illumina HiSeq	Unspecified	Q9UK96	FBX10_HUMAN		GBM - Glioblastoma multiforme(29;0.0107)	2	349	-			100					Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Silent	SNP	ENST00000432825.2	37	c.300A>G	CCDS47966.1																																																																																				0.552	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3			8	33	0	0	0	0.000157383	0	8	33				
COL15A1	1306	broad.mit.edu	37	9	101824569	101824569	+	Missense_Mutation	SNP	C	C	T	rs142838918	byFrequency	TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr9:101824569C>T	ENST00000375001.3	+	38	3997	c.3574C>T	c.(3574-3576)Cct>Tct	p.P1192S		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	1192	Nonhelical region 10 (NC10).			Missing (in Ref. 2; AAC78500). {ECO:0000305}.	angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				CCCTCCACCCCCTGCGCTTTC	0.458													C|||	2	0.000399361	0.0	0.0	5008	,	,		19518	0.0		0.0	False		,,,				2504	0.002						uc004azb.1		NA																	0				ovary(6)	6						c.(3574-3576)CCT>TCT		alpha 1 type XV collagen precursor							90.0	84.0	86.0					9																	101824569		2203	4300	6503	SO:0001583	missense	1306				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding	g.chr9:101824569C>T	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.3574C>T	9.37:g.101824569C>T	ENSP00000364140:p.Pro1192Ser		Somatic					p.P1192S	NM_001855	NP_001846	WXS	Illumina HiSeq	Unspecified	P39059	COFA1_HUMAN			38	3780	+		Acute lymphoblastic leukemia(62;0.0562)	1192	Missing (in Ref. 2; AAC78500).		Nonhelical region 10 (NC10).		Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	c.3574C>T	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.859211	0.51376	.	.	ENSG00000204291	ENST00000375001	D	0.90955	-2.76	5.88	5.88	0.94601	.	0.235738	0.43260	D	0.000582	D	0.92482	0.7613	L	0.60455	1.87	0.47276	D	0.999371	D	0.56968	0.978	P	0.57324	0.818	D	0.89459	0.3735	10	0.17369	T	0.5	-11.4118	17.1377	0.86744	0.0:1.0:0.0:0.0	.	1192	P39059	COFA1_HUMAN	S	1192	ENSP00000364140:P1192S	ENSP00000364140:P1192S	P	+	1	0	COL15A1	100864390	1.000000	0.71417	0.997000	0.53966	0.817000	0.46193	3.948000	0.56660	2.792000	0.96026	0.555000	0.69702	CCT		0.458	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855		7	39	0	0	0	0.000274275	0	7	39				
ASS1	445	broad.mit.edu	37	9	133333866	133333866	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr9:133333866G>T	ENST00000372394.1	+	5	734	c.253G>T	c.(253-255)Gac>Tac	p.D85Y	ASS1_ENST00000372393.3_Missense_Mutation_p.D85Y|ASS1_ENST00000352480.5_Missense_Mutation_p.D85Y			P00966	ASSY_HUMAN	argininosuccinate synthase 1	85					acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	ACTGTATGAGGACCGCTACCT	0.612																																							uc004bzm.2		NA																	0				ovary(1)	1						c.(253-255)GAC>TAC		argininosuccinate synthetase 1	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)						63.0	61.0	61.0					9																	133333866		2203	4300	6503	SO:0001583	missense	445				arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding	g.chr9:133333866G>T	X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.253G>T	9.37:g.133333866G>T	ENSP00000361471:p.Asp85Tyr		Somatic				ASS1_uc004bzn.2_Missense_Mutation_p.D85Y|ASS1_uc010mza.2_Missense_Mutation_p.D161Y|ASS1_uc004bzo.2_Missense_Mutation_p.D85Y|ASS1_uc010mzb.2_Missense_Mutation_p.D123Y|ASS1_uc004bzp.2_Missense_Mutation_p.D85Y|ASS1_uc010mzc.2_Missense_Mutation_p.D85Y	p.D85Y	NM_000050	NP_000041	WXS	Illumina HiSeq	Unspecified	P00966	ASSY_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000514)	5	609	+			85					Q6LDL2|Q86UZ0|Q96GT4	Missense_Mutation	SNP	ENST00000372394.1	37	c.253G>T	CCDS6933.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.381647	0.82792	.	.	ENSG00000130707	ENST00000334909;ENST00000352480;ENST00000372394;ENST00000372393;ENST00000422569;ENST00000443588	D;D;D;D;D	0.95307	-3.67;-3.67;-3.67;-3.67;-3.67	4.88	4.88	0.63580	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.133430	0.48286	U	0.000192	D	0.97679	0.9239	M	0.89968	3.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.987;0.987;0.987	D	0.98779	1.0731	10	0.87932	D	0	.	17.0225	0.86437	0.0:0.0:1.0:0.0	.	85;85;85	A8KAP9;Q5T6L4;P00966	.;.;ASSY_HUMAN	Y	85	ENSP00000253004:D85Y;ENSP00000361471:D85Y;ENSP00000361469:D85Y;ENSP00000394212:D85Y;ENSP00000397785:D85Y	ENSP00000361470:D85Y	D	+	1	0	ASS1	132323687	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.492000	0.90471	2.243000	0.73865	0.650000	0.86243	GAC		0.612	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054652.1	NM_000050		8	41	1	0	5.18039e-06	0.000157383	6.95114e-05	8	41				
SARDH	1757	broad.mit.edu	37	9	136529011	136529011	+	Nonstop_Mutation	SNP	T	T	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr9:136529011T>C	ENST00000371872.4	-	21	3014	c.2757A>G	c.(2755-2757)tgA>tgG	p.*919W	SARDH_ENST00000469828.1_5'Flank|SARDH_ENST00000439388.1_Nonstop_Mutation_p.*919W|SARDH_ENST00000371868.1_Nonstop_Mutation_p.*369W|SARDH_ENST00000422262.2_Nonstop_Mutation_p.*751W	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	0					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GTCTGAGCCCTCAGTAGATTC	0.597																																							uc004cep.3		NA																	0					0						c.(2755-2757)TGA>TGG		sarcosine dehydrogenase precursor							224.0	178.0	194.0					9																	136529011		2203	4300	6503	SO:0001578	stop_lost	1757				glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity	g.chr9:136529011T>C		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.2757A>G	9.37:g.136529011T>C	ENSP00000360938:p.*919Cysext*38		Somatic				SARDH_uc004ceo.2_Nonstop_Mutation_p.*919W|SARDH_uc011mdn.1_Nonstop_Mutation_p.*919W|SARDH_uc011mdo.1_Nonstop_Mutation_p.*751W|SARDH_uc004cen.2_Nonstop_Mutation_p.*369W	p.*919W	NM_001134707	NP_001128179	WXS	Illumina HiSeq	Unspecified	Q9UL12	SARDH_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)	21	2891	-			919					B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Nonstop_Mutation	SNP	ENST00000371872.4	37	c.2757A>G	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	T	5.743	0.321570	0.10845	.	.	ENSG00000123453	ENST00000371872;ENST00000371868;ENST00000439388;ENST00000422262	.	.	.	2.03	-2.02	0.07388	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.8691	0.18793	0.0:0.3292:0.0:0.6708	.	.	.	.	W	919;369;919;751	.	.	X	-	3	0	SARDH	135518832	1.000000	0.71417	0.002000	0.10522	0.057000	0.15508	5.937000	0.70162	-0.527000	0.06374	0.459000	0.35465	TGA		0.597	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1			4	170	0	0	0	0.000602214	0	4	170				
VCX	26609	broad.mit.edu	37	X	7811292	7811292	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:7811292G>T	ENST00000381059.3	+	2	267	c.48G>T	c.(46-48)gaG>gaT	p.E16D	VCX_ENST00000341408.4_Missense_Mutation_p.E16D	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	16				TEA -> KET (in Ref. 3; AAH98123). {ECO:0000305}.	chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.E16D(1)		NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				AGGCCACGGAGGCAGGAAAGA	0.632																																							uc004crz.2		NA																	1	Substitution - Missense(1)		endometrium(1)		0						c.(46-48)GAG>GAT		variable charge, X chromosome							17.0	15.0	15.0					X																	7811292		1719	3107	4826	SO:0001583	missense	26609				chromatin organization|ribosome assembly|spermatogenesis	nucleolus	chromatin binding	g.chrX:7811292G>T	AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.48G>T	X.37:g.7811292G>T	ENSP00000370447:p.Glu16Asp		Somatic					p.E16D	NM_013452	NP_038480	WXS	Illumina HiSeq	Unspecified	Q9H320	VCX1_HUMAN			2	267	+		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)	16					A0JNS5|Q4V774|Q9P0H3	Missense_Mutation	SNP	ENST00000381059.3	37	c.48G>T	CCDS14128.1	.	.	.	.	.	.	.	.	.	.	-	7.733	0.699686	0.15106	.	.	ENSG00000182583	ENST00000381059;ENST00000341408	T;T	0.22336	1.96;1.96	0.167	0.167	0.15006	.	.	.	.	.	T	0.26011	0.0634	L	0.48642	1.525	0.09310	N	1	P	0.49696	0.927	P	0.56563	0.801	T	0.22417	-1.0217	8	0.15066	T	0.55	.	.	.	.	.	16	Q9H320	VCX1_HUMAN	D	16	ENSP00000370447:E16D;ENSP00000344144:E16D	ENSP00000344144:E16D	E	+	3	2	VCX	7771292	0.002000	0.14202	0.002000	0.10522	0.002000	0.02628	0.745000	0.26259	0.270000	0.21984	0.274000	0.19336	GAG		0.632	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071474.1	NM_013452		18	154	1	0	4.65686e-17	0.000692331	8.28136e-16	18	154				
FAM47A	158724	broad.mit.edu	37	X	34149183	34149183	+	Missense_Mutation	SNP	T	T	C	rs374415122		TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:34149183T>C	ENST00000346193.3	-	1	1264	c.1213A>G	c.(1213-1215)Aag>Gag	p.K405E		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	405										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ACTCCAGTCTTGGGAGGCACT	0.577																																							uc004ddg.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1213-1215)AAG>GAG		hypothetical protein LOC158724							46.0	45.0	46.0					X																	34149183		2200	4299	6499	SO:0001583	missense	158724							g.chrX:34149183T>C	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1213A>G	X.37:g.34149183T>C	ENSP00000345029:p.Lys405Glu		Somatic					p.K405E	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	1246	-			405					A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	c.1213A>G	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	t	0.007	-2.001583	0.00431	.	.	ENSG00000185448	ENST00000346193	T	0.08807	3.05	0.226	-0.452	0.12205	.	.	.	.	.	T	0.02494	0.0076	N	0.04203	-0.255	0.09310	N	1	B	0.23854	0.092	B	0.22880	0.042	T	0.42137	-0.9469	8	0.02654	T	1	.	.	.	.	.	405	Q5JRC9	FA47A_HUMAN	E	405	ENSP00000345029:K405E	ENSP00000345029:K405E	K	-	1	0	FAM47A	34059104	0.187000	0.23238	0.003000	0.11579	0.003000	0.03518	0.078000	0.14761	-0.894000	0.03925	-0.921000	0.02739	AAG		0.577	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		12	46	0	0	0	0.00010058	0	12	46				
PIM2	11040	broad.mit.edu	37	X	48772360	48772360	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:48772360C>A	ENST00000376509.4	-	4	721	c.532G>T	c.(532-534)Gcc>Tcc	p.A178S	PIM2_ENST00000485431.1_5'Flank	NM_006875.3	NP_006866.2	Q9P1W9	PIM2_HUMAN	Pim-2 proto-oncogene, serine/threonine kinase	178	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic mitochondrial changes (GO:0008637)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|response to virus (GO:0009615)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			lung(3)|stomach(1)	4						ATGAGTTTGGCACAGCCACGG	0.498																																							uc004dls.2		NA																	0				lung(3)|stomach(1)	4						c.(532-534)GCC>TCC		serine/threonine protein kinase pim-2							76.0	59.0	65.0					X																	48772360		2203	4300	6503	SO:0001583	missense	11040				anti-apoptosis|cell proliferation|male meiosis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|response to virus		ATP binding|protein serine/threonine kinase activity	g.chrX:48772360C>A	U77735	CCDS14312.1	Xp11.23	2014-06-25	2014-06-25		ENSG00000102096	ENSG00000102096			8987	protein-coding gene	gene with protein product		300295	"""pim-2 oncogene"""			9804974	Standard	NM_006875		Approved		uc004dls.3	Q9P1W9	OTTHUMG00000024132	ENST00000376509.4:c.532G>T	X.37:g.48772360C>A	ENSP00000365692:p.Ala178Ser		Somatic					p.A178S	NM_006875	NP_006866	WXS	Illumina HiSeq	Unspecified	Q9P1W9	PIM2_HUMAN			4	834	-			178			Protein kinase.		A8K4G6|Q99739	Missense_Mutation	SNP	ENST00000376509.4	37	c.532G>T	CCDS14312.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.458136	0.26161	.	.	ENSG00000102096	ENST00000376509;ENST00000442430	T;T	0.14640	2.49;2.49	5.72	-0.998	0.10212	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.497030	0.03924	N	0.284048	T	0.15652	0.0377	M	0.69248	2.105	0.09310	N	1	B	0.06786	0.001	B	0.16722	0.016	T	0.39461	-0.9613	10	0.87932	D	0	.	1.8004	0.03070	0.1364:0.2936:0.1311:0.4388	.	178	Q9P1W9	PIM2_HUMAN	S	178;66	ENSP00000365692:A178S;ENSP00000410960:A66S	ENSP00000365692:A178S	A	-	1	0	PIM2	48657304	0.003000	0.15002	0.000000	0.03702	0.760000	0.43138	-0.059000	0.11731	-0.359000	0.08150	0.600000	0.82982	GCC		0.498	PIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060805.1			11	43	1	0	9.05144e-12	0.000151284	1.40631e-10	11	43				
WNK3	65267	broad.mit.edu	37	X	54359891	54359891	+	Silent	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:54359891G>T	ENST00000375159.2	-	1	215	c.216C>A	c.(214-216)gcC>gcA	p.A72A	WNK3_ENST00000354646.2_Silent_p.A72A|WNK3_ENST00000375169.3_Silent_p.A72A			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	72					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GGGATGATTCGGCAACTTTGT	0.393																																							uc004dtd.1		NA																	0				lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						c.(214-216)GCC>GCA		WNK lysine deficient protein kinase 3 isoform 2							119.0	109.0	113.0					X																	54359891		2203	4300	6503	SO:0001819	synonymous_variant	65267				intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity	g.chrX:54359891G>T	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.216C>A	X.37:g.54359891G>T			Somatic				WNK3_uc004dtc.1_Silent_p.A72A	p.A72A	NM_001002838	NP_001002838	WXS	Illumina HiSeq	Unspecified	Q9BYP7	WNK3_HUMAN			2	655	-			72					B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Silent	SNP	ENST00000375159.2	37	c.216C>A	CCDS14357.1																																																																																				0.393	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922		31	105	1	0	1.30897e-18	0.000279167	2.35615e-17	31	105				
ERCC6L	54821	broad.mit.edu	37	X	71426847	71426847	+	Silent	SNP	T	T	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:71426847T>C	ENST00000334463.3	-	2	1905	c.1770A>G	c.(1768-1770)gtA>gtG	p.V590V	ERCC6L_ENST00000373657.1_Silent_p.V467V|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	590	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					TTTTTTCCTCTACAGTCCCAC	0.368																																							uc004eaq.1		NA																	0				ovary(3)	3						c.(1768-1770)GTA>GTG		excision repair protein ERCC6-like							98.0	96.0	97.0					X																	71426847		2203	4300	6503	SO:0001819	synonymous_variant	54821				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding	g.chrX:71426847T>C	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.1770A>G	X.37:g.71426847T>C			Somatic				PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Silent_p.V467V	p.V590V	NM_017669	NP_060139	WXS	Illumina HiSeq	Unspecified	Q2NKX8	ERC6L_HUMAN			2	1867	-	Renal(35;0.156)		590			Helicase C-terminal.		Q8NCI1|Q96H93|Q9NXQ8	Silent	SNP	ENST00000334463.3	37	c.1770A>G	CCDS35329.1																																																																																				0.368	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669		15	90	0	0	0	0.000308642	0	15	90				
COL4A6	1288	broad.mit.edu	37	X	107418883	107418883	+	Splice_Site	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:107418883C>A	ENST00000372216.4	-	29	2934		c.e29+1		COL4A6_ENST00000538570.1_Splice_Site|COL4A6_ENST00000334504.7_Splice_Site|COL4A6_ENST00000545689.1_Splice_Site|COL4A6_ENST00000394872.2_Splice_Site	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6						cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CCCCAGCTCACCCTTTTCACC	0.428									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)	Melanoma(87;1895 1945 2589 7165)	uc004enw.3		NA																	0				ovary(6)|urinary_tract(1)|large_intestine(1)	8						c.e29+1		type IV alpha 6 collagen isoform A precursor							125.0	104.0	111.0					X																	107418883		2203	4300	6503	SO:0001630	splice_region_variant	1288	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107418883C>A	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.2833+1G>T	X.37:g.107418883C>A			Somatic				COL4A6_uc004env.3_Splice_Site_p.G944_splice|COL4A6_uc011msn.1_Splice_Site_p.G944_splice|COL4A6_uc010npk.2_Splice_Site_p.G944_splice	p.G945_splice	NM_001847	NP_001838	WXS	Illumina HiSeq	Unspecified	Q14031	CO4A6_HUMAN			29	2936	-								Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Splice_Site	SNP	ENST00000372216.4	37	c.2833_splice	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.734026	0.69189	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.918	0.86156	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL4A6	107305539	1.000000	0.71417	0.998000	0.56505	0.790000	0.44656	5.417000	0.66423	2.458000	0.83093	0.436000	0.28706	.		0.428	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		Intron	15	68	1	0	1.56452e-12	0.000958276	2.48305e-11	15	68				
ACSL4	2182	broad.mit.edu	37	X	108926642	108926642	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:108926642A>G	ENST00000469796.2	-	3	470	c.74T>C	c.(73-75)cTt>cCt	p.L25P	ACSL4_ENST00000348502.6_Intron|ACSL4_ENST00000340800.2_Missense_Mutation_p.L25P			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	25					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	AATAAATATAAGGGCACTGTA	0.373																																					Pancreas(188;358 2127 38547 41466 45492)	Pancreas(188;358 2127 38547 41466 45492)	uc004eoi.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)	3						c.(73-75)CTT>CCT		acyl-CoA synthetase long-chain family member 4	Icosapent(DB00159)|Troglitazone(DB00197)						111.0	109.0	110.0					X																	108926642		2203	4297	6500	SO:0001583	missense	2182				fatty acid metabolic process|learning or memory|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chrX:108926642A>G	BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.74T>C	X.37:g.108926642A>G	ENSP00000419171:p.Leu25Pro		Somatic				ACSL4_uc004eoj.2_Intron|ACSL4_uc004eok.2_Intron|ACSL4_uc010npp.1_Missense_Mutation_p.L25P	p.L25P	NM_022977	NP_075266	WXS	Illumina HiSeq	Unspecified	O60488	ACSL4_HUMAN			4	579	-			25			Helical; Signal-anchor for type III membrane protein; (Potential).		D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	ENST00000469796.2	37	c.74T>C	CCDS14548.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.956782	0.73902	.	.	ENSG00000068366	ENST00000469796;ENST00000340800;ENST00000502391;ENST00000508092;ENST00000504980;ENST00000469857	T;T	0.39229	1.09;1.09	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.55065	0.1897	M	0.65975	2.015	0.80722	D	1	D	0.55605	0.972	P	0.53593	0.73	T	0.60464	-0.7258	10	0.72032	D	0.01	-14.1412	14.3459	0.66662	1.0:0.0:0.0:0.0	.	25	O60488	ACSL4_HUMAN	P	25	ENSP00000419171:L25P;ENSP00000339787:L25P	ENSP00000339787:L25P	L	-	2	0	ACSL4	108813298	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.421000	0.80204	1.766000	0.52107	0.412000	0.27726	CTT		0.373	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2	NM_004458		28	102	0	0	0	0.000184323	0	28	102				
ARHGAP36	158763	broad.mit.edu	37	X	130222678	130222678	+	Silent	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:130222678C>T	ENST00000276211.5	+	12	1908	c.1563C>T	c.(1561-1563)ccC>ccT	p.P521P	ARHGAP36_ENST00000370922.1_Silent_p.P509P|ARHGAP36_ENST00000370921.1_Silent_p.P385P	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	521					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GTAACCCTCCCATTCCGGAGC	0.532																																							uc004evz.2		NA																	0				ovary(3)	3						c.(1561-1563)CCC>CCT		hypothetical protein LOC158763 precursor							72.0	63.0	66.0					X																	130222678		2203	4300	6503	SO:0001819	synonymous_variant	158763				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chrX:130222678C>T		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1563C>T	X.37:g.130222678C>T			Somatic				ARHGAP36_uc004ewa.2_Silent_p.P509P|ARHGAP36_uc004ewb.2_Silent_p.P490P|ARHGAP36_uc004ewc.2_Silent_p.P385P	p.P521P	NM_144967	NP_659404	WXS	Illumina HiSeq	Unspecified	Q6ZRI8	RHG36_HUMAN			12	1908	+			521					B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Silent	SNP	ENST00000276211.5	37	c.1563C>T	CCDS14628.1																																																																																				0.532	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967		11	35	0	0	0	0.00010058	0	11	35				
DDX26B	203522	broad.mit.edu	37	X	134681100	134681100	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:134681100C>A	ENST00000370752.4	+	6	986	c.652C>A	c.(652-654)Caa>Aaa	p.Q218K	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	218	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.									large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					AATGTTGAATCAATGTTTAGA	0.328																																							uc004eyw.3		NA																	0					0						c.(652-654)CAA>AAA		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide							143.0	143.0	143.0					X																	134681100		2203	4297	6500	SO:0001583	missense	203522							g.chrX:134681100C>A	AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.652C>A	X.37:g.134681100C>A	ENSP00000359788:p.Gln218Lys		Somatic					p.Q218K	NM_182540	NP_872346	WXS	Illumina HiSeq	Unspecified	Q5JSJ4	DX26B_HUMAN			6	1015	+	Acute lymphoblastic leukemia(192;6.56e-05)		218			VWFA.		Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	ENST00000370752.4	37	c.652C>A	CCDS35401.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054167	0.75960	.	.	ENSG00000165359	ENST00000370752	T	0.13307	2.6	5.28	5.28	0.74379	von Willebrand factor, type A (2);	0.000000	0.85682	D	0.000000	T	0.41073	0.1143	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.35176	-0.9799	10	0.54805	T	0.06	-2.1351	16.9536	0.86252	0.0:1.0:0.0:0.0	.	218	Q5JSJ4	DX26B_HUMAN	K	218	ENSP00000359788:Q218K	ENSP00000359788:Q218K	Q	+	1	0	DDX26B	134508766	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.763000	0.85283	2.210000	0.71456	0.529000	0.55759	CAA		0.328	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058420.1	NM_182540		21	182	1	0	8.24728e-16	0.000720815	1.43212e-14	21	182				
CT45A1	541466	broad.mit.edu	37	X	134856769	134856769	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:134856769A>C	ENST00000497301.2	+	5	634	c.544A>C	c.(544-546)Aag>Cag	p.K182Q	CT45A1_ENST00000482795.1_Missense_Mutation_p.K182Q|CT45A1_ENST00000370741.3_Missense_Mutation_p.K182Q			Q5HYN5	CT451_HUMAN	cancer/testis antigen family 45, member A1	182																	TAAGCACCTTAAGAAGAAACT	0.383																																							uc004eyy.2		NA																	0					0						c.(544-546)AAG>CAG		cancer/testis antigen family 45, member A1							313.0	255.0	276.0					X																	134856769		2040	3569	5609	SO:0001583	missense	541466							g.chrX:134856769A>C	AY743709	CCDS48174.1	Xq26.3	2009-03-12				ENSG00000268940			33267	protein-coding gene	gene with protein product	"""cancer/testis antigen CT45-1"""	300648				15905330	Standard	XM_005278141		Approved	CT45-1, CT45.1	uc004eyy.3	Q5HYN5		ENST00000497301.2:c.544A>C	X.37:g.134856769A>C	ENSP00000434170:p.Lys182Gln		Somatic					p.K182Q	NM_001017417	NP_001017417	WXS	Illumina HiSeq	Unspecified	Q5HYN5	CT451_HUMAN			5	789	+			182					B9EIR8	Missense_Mutation	SNP	ENST00000497301.2	37	c.544A>C	CCDS48174.1	.	.	.	.	.	.	.	.	.	.	-	4.117	0.019804	0.08006	.	.	ENSG00000232478	ENST00000370741	T	0.46063	0.88	2.05	-0.117	0.13551	.	0.271361	0.33691	N	0.004652	T	0.14570	0.0352	N	0.03608	-0.345	0.09310	N	1	B	0.28291	0.206	B	0.25140	0.058	T	0.10200	-1.0640	10	0.40728	T	0.16	-6.2199	2.9794	0.05948	0.1949:0.2876:0.5175:0.0	.	182	Q5HYN5	CT451_HUMAN	Q	182	ENSP00000359777:K182Q	ENSP00000359777:K182Q	K	+	1	0	CT45A1	134684435	0.955000	0.32602	0.054000	0.19295	0.009000	0.06853	0.524000	0.22940	-0.064000	0.13043	-1.261000	0.01458	AAG		0.383	CT45A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058430.3	NM_001017417		6	596	0	0	0	0.000442599	0	6	596				
MMGT1	93380	broad.mit.edu	37	X	135047290	135047290	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:135047290C>A	ENST00000305963.2	-	4	676	c.289G>T	c.(289-291)Ggt>Tgt	p.G97C	MMGT1_ENST00000433339.2_Missense_Mutation_p.G162C	NM_173470.1	NP_775741.1	Q8N4V1	MMGT1_HUMAN	membrane magnesium transporter 1	97					magnesium ion transport (GO:0015693)	early endosome (GO:0005769)|ER membrane protein complex (GO:0072546)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(1)|endometrium(1)|kidney(1)	3						AGTACTCGACCACGATGATTA	0.363																																							uc004ezi.1		NA																	0					0						c.(289-291)GGT>TGT		membrane magnesium transporter 1 precursor							185.0	170.0	175.0					X																	135047290		2203	4300	6503	SO:0001583	missense	93380					early endosome membrane|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	magnesium ion transmembrane transporter activity	g.chrX:135047290C>A	AL157477	CCDS14653.1	Xq26.3	2012-05-23	2008-11-21	2008-11-21	ENSG00000169446	ENSG00000169446			28100	protein-coding gene	gene with protein product	"""ER membrane protein complex subunit 5"""		"""transmembrane protein 32"""	TMEM32		18057121, 22119785	Standard	NM_173470		Approved	EMC5	uc004ezi.1	Q8N4V1	OTTHUMG00000022499	ENST00000305963.2:c.289G>T	X.37:g.135047290C>A	ENSP00000306220:p.Gly97Cys		Somatic				MMGT1_uc011mvw.1_Missense_Mutation_p.G162C	p.G97C	NM_173470	NP_775741	WXS	Illumina HiSeq	Unspecified	Q8N4V1	MMGT1_HUMAN			4	589	-			97			Cytoplasmic (Potential).		B2R625|B4DIY3|D3DWG7|Q5JPP7	Missense_Mutation	SNP	ENST00000305963.2	37	c.289G>T	CCDS14653.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402941	0.83230	.	.	ENSG00000169446	ENST00000305963;ENST00000433339	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.83238	0.5211	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85416	0.1140	9	0.87932	D	0	.	17.7637	0.88470	0.0:1.0:0.0:0.0	.	162;97	Q8N4V1-2;Q8N4V1	.;MMGT1_HUMAN	C	97;162	.	ENSP00000306220:G97C	G	-	1	0	MMGT1	134874956	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.398000	0.79919	2.413000	0.81919	0.600000	0.82982	GGT		0.363	MMGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058453.3	NM_173470		27	180	1	0	7.26314e-15	0.000184323	1.21823e-13	27	180				
MCF2	4168	broad.mit.edu	37	X	138708452	138708452	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:138708452A>T	ENST00000370576.4	-	6	796	c.587T>A	c.(586-588)gTa>gAa	p.V196E	MCF2_ENST00000520602.1_Missense_Mutation_p.V256E|MCF2_ENST00000519895.1_Missense_Mutation_p.V256E|MCF2_ENST00000536274.1_Missense_Mutation_p.V157E|MCF2_ENST00000414978.1_Missense_Mutation_p.V256E|MCF2_ENST00000370578.4_Missense_Mutation_p.V341E|MCF2_ENST00000338585.6_Missense_Mutation_p.V196E|MCF2_ENST00000370573.4_Missense_Mutation_p.V196E	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	196					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					CATATCATGTACTTGAGTCAG	0.338																																							uc004fau.2		NA																	0				lung(1)|pleura(1)	2						c.(586-588)GTA>GAA		MCF.2 cell line derived transforming sequence							76.0	73.0	74.0					X																	138708452		2202	4297	6499	SO:0001583	missense	4168				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chrX:138708452A>T		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.587T>A	X.37:g.138708452A>T	ENSP00000359608:p.Val196Glu		Somatic				MCF2_uc004fav.2_Missense_Mutation_p.V196E|MCF2_uc011mwl.1_Missense_Mutation_p.V157E|MCF2_uc010nsh.1_Missense_Mutation_p.V196E|MCF2_uc011mwm.1_Missense_Mutation_p.V157E|MCF2_uc011mwn.1_Missense_Mutation_p.V341E|MCF2_uc004faw.2_Missense_Mutation_p.V256E|MCF2_uc011mwo.1_Missense_Mutation_p.V256E	p.V196E	NM_005369	NP_005360	WXS	Illumina HiSeq	Unspecified	P10911	MCF2_HUMAN			6	881	-	Acute lymphoblastic leukemia(192;0.000127)		196					B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000370576.4	37	c.587T>A	CCDS14667.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.675561	0.88445	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.92	5.92	0.95590	.	0.061171	0.64402	D	0.000005	T	0.59555	0.2202	L	0.44542	1.39	0.40208	D	0.977595	D;D;D;D;D;D;D;D	0.65815	0.975;0.995;0.96;0.975;0.96;0.975;0.994;0.975	P;P;P;P;P;P;D;P	0.63703	0.733;0.869;0.782;0.733;0.782;0.733;0.917;0.733	T	0.63906	-0.6531	10	0.87932	D	0	.	14.3534	0.66719	1.0:0.0:0.0:0.0	.	256;341;157;196;196;341;196;196	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	E	256;196;157;341;256;256;196;196	ENSP00000427745:V256E;ENSP00000359608:V196E;ENSP00000438155:V157E;ENSP00000359610:V341E;ENSP00000397055:V256E;ENSP00000430276:V256E;ENSP00000359605:V196E;ENSP00000342204:V196E	ENSP00000342204:V196E	V	-	2	0	MCF2	138536118	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	8.675000	0.91195	1.988000	0.58038	0.481000	0.45027	GTA		0.338	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369		19	69	0	0	0	0.000175454	0	19	69				
FMR1NB	158521	broad.mit.edu	37	X	147106420	147106420	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:147106420G>T	ENST00000370467.3	+	5	742	c.668G>T	c.(667-669)aGa>aTa	p.R223I		NM_152578.2	NP_689791.1	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	223						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)				breast(2)|cervix(1)|endometrium(3)|large_intestine(7)|lung(10)|ovary(1)|skin(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					CAGGACAACAGAGTTGTAACG	0.418																																							uc004fcm.2		NA																	0				ovary(1)	1						c.(667-669)AGA>ATA		fragile X mental retardation 1 neighbor							134.0	120.0	125.0					X																	147106420		2203	4300	6503	SO:0001583	missense	158521					integral to membrane		g.chrX:147106420G>T		CCDS14683.1	Xq28	2009-03-25			ENSG00000176988	ENSG00000176988			26372	protein-coding gene	gene with protein product	"""cancer/testis antigen 37"""					12601173	Standard	NM_152578		Approved	FLJ25736, NY-SAR-35, CT37	uc004fcm.3	Q8N0W7	OTTHUMG00000022608	ENST00000370467.3:c.668G>T	X.37:g.147106420G>T	ENSP00000359498:p.Arg223Ile		Somatic					p.R223I	NM_152578	NP_689791	WXS	Illumina HiSeq	Unspecified	Q8N0W7	FMR1N_HUMAN			5	742	+	Acute lymphoblastic leukemia(192;6.56e-05)		223			Cytoplasmic (Potential).		D3DWT3	Missense_Mutation	SNP	ENST00000370467.3	37	c.668G>T	CCDS14683.1	.	.	.	.	.	.	.	.	.	.	g	8.508	0.865881	0.17250	.	.	ENSG00000176988	ENST00000370467	T	0.41400	1.0	3.56	-1.68	0.08212	.	0.558397	0.14859	N	0.294218	T	0.19886	0.0478	N	0.24115	0.695	0.09310	N	1	P	0.40332	0.713	B	0.36418	0.224	T	0.15636	-1.0430	10	0.87932	D	0	-5.6387	0.3891	0.00407	0.2171:0.1633:0.2833:0.3364	.	223	Q8N0W7	FMR1N_HUMAN	I	223	ENSP00000359498:R223I	ENSP00000359498:R223I	R	+	2	0	FMR1NB	146914112	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.395000	0.07287	-0.579000	0.05952	-0.912000	0.02778	AGA		0.418	FMR1NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058667.1	NM_152578		17	91	1	0	3.32936e-07	0.00074312	4.55012e-06	17	91				
MAGEA6	4105	broad.mit.edu	37	X	151870199	151870199	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:151870199C>T	ENST00000329342.5	+	3	1114	c.889C>T	c.(889-891)Cct>Tct	p.P297S		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	297	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					CAGTGGAGGACCTCGCATTTC	0.552																																							uc004ffq.1		NA																	0					0						c.(889-891)CCT>TCT		melanoma antigen family A, 6							142.0	136.0	138.0					X																	151870199		2202	4298	6500	SO:0001583	missense	4105						protein binding	g.chrX:151870199C>T		CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.889C>T	X.37:g.151870199C>T	ENSP00000329199:p.Pro297Ser		Somatic				MAGEA6_uc004ffr.1_Missense_Mutation_p.P297S|MAGEA2_uc010nto.2_Intron	p.P297S	NM_005363	NP_005354	WXS	Illumina HiSeq	Unspecified	P43360	MAGA6_HUMAN			3	1083	+	Acute lymphoblastic leukemia(192;6.56e-05)		297			MAGE.		A8IF93|Q6NW44	Missense_Mutation	SNP	ENST00000329342.5	37	c.889C>T	CCDS14708.1	.	.	.	.	.	.	.	.	.	.	c	0.006	-2.051338	0.00394	.	.	ENSG00000197172	ENST00000329342	T	0.01527	4.8	0.605	-0.952	0.10366	.	.	.	.	.	T	0.01454	0.0047	L	0.35723	1.085	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.49062	-0.8978	8	0.15952	T	0.53	.	.	.	.	.	297	P43360	MAGA6_HUMAN	S	297	ENSP00000329199:P297S	ENSP00000329199:P297S	P	+	1	0	MAGEA6	151620855	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.603000	0.02077	-0.374000	0.07967	0.181000	0.17075	CCT		0.552	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058747.2	NM_005363		8	226	0	0	0	0.000157383	0	8	226				
F8	2157	broad.mit.edu	37	X	154158121	154158121	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chrX:154158121C>T	ENST00000360256.4	-	14	4144	c.3944G>A	c.(3943-3945)aGg>aAg	p.R1315K		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1315	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	AGGAGATATCCTTGTGGTGCA	0.388																																							uc004fmt.2		NA																	0				ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(3943-3945)AGG>AAG		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						198.0	168.0	178.0					X																	154158121		2203	4300	6503	SO:0001583	missense	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154158121C>T	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3944G>A	X.37:g.154158121C>T	ENSP00000353393:p.Arg1315Lys		Somatic					p.R1315K	NM_000132	NP_000123	WXS	Illumina HiSeq	Unspecified	P00451	FA8_HUMAN			14	4115	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		1315			B.		Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	c.3944G>A	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	c	0.112	-1.136793	0.01742	.	.	ENSG00000185010	ENST00000360256	D	0.99032	-5.35	4.31	-2.89	0.05665	.	1.101050	0.06980	N	0.819737	D	0.94719	0.8296	N	0.25890	0.77	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	D	0.90833	0.4718	10	0.02654	T	1	-3.0E-4	4.3342	0.11078	0.549:0.2379:0.0:0.2131	.	1315	P00451	FA8_HUMAN	K	1315	ENSP00000353393:R1315K	ENSP00000353393:R1315K	R	-	2	0	F8	153811315	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.467000	0.02352	-0.492000	0.06687	-0.195000	0.12781	AGG		0.388	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			13	130	0	0	0	0.000151284	0	13	130				
LRRN2	10446	broad.mit.edu	37	1	204587091	204587091	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr1:204587091delG	ENST00000367175.1	-	1	4242	c.2030delC	c.(2029-2031)cctfs	p.P677fs	LRRN2_ENST00000367177.3_Frame_Shift_Del_p.P677fs|RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367176.3_Frame_Shift_Del_p.P677fs			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	677					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			CCGGACAGAAGGGGCACTCCA	0.652																																							uc001hbe.1		NA																	0				central_nervous_system(2)	2						c.(2029-2031)CCTfs		leucine rich repeat neuronal 2 precursor							67.0	73.0	71.0					1																	204587091		2203	4300	6503	SO:0001589	frameshift_variant	10446				cell adhesion	integral to membrane	receptor activity	g.chr1:204587091delG	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.2030delC	1.37:g.204587091delG	ENSP00000356143:p.Pro677fs		Somatic				MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Frame_Shift_Del_p.P677fs|LRRN2_uc009xbf.1_Frame_Shift_Del_p.P677fs|MDM4_uc001hbc.2_Intron	p.P677fs	NM_006338	NP_006329	WXS	Illumina HiSeq	Unspecified	O75325	LRRN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)		3	2418	-	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		677			Cytoplasmic (Potential).		B2R624|Q5T0Y0|Q6UXM0|Q8N182	Frame_Shift_Del	DEL	ENST00000367175.1	37	c.2030delC	CCDS1448.1																																																																																				0.652	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338		11	108	NA	NA	NA	NA	NA	11	108	---	---	---	---
TUBA3C	7278	broad.mit.edu	37	13	19751481	19751481	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr13:19751481delC	ENST00000400113.3	-	4	746	c.642delG	c.(640-642)cggfs	p.R215fs		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	215					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CCAGGTTGCGCCGACATATGT	0.572																																							uc009zzj.2		NA																	0				ovary(3)|skin(2)	5						c.(640-642)CGGfs		tubulin, alpha 3c							203.0	173.0	183.0					13																	19751481		2203	4300	6503	SO:0001589	frameshift_variant	7278				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr13:19751481delC	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.642delG	13.37:g.19751481delC	ENSP00000382982:p.Arg215fs		Somatic					p.R214fs	NM_006001	NP_005992	WXS	Illumina HiSeq	Unspecified	Q13748	TBA3C_HUMAN		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)	4	691	-		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)	214					A6NJQ0|Q5W099|Q6PEY3|Q96F18	Frame_Shift_Del	DEL	ENST00000400113.3	37	c.642delG	CCDS9284.1																																																																																				0.572	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001		12	151	NA	NA	NA	NA	NA	12	151	---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11656200	11656200	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr17:11656200delC	ENST00000262442.4	+	33	6729	c.6661delC	c.(6661-6663)cccfs	p.P2221fs	DNAH9_ENST00000454412.2_Frame_Shift_Del_p.P2221fs	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2221	AAA 2. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CCATGATGGGCCCAAGTGGAT	0.428																																							uc002gne.2		NA																	0				skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(6661-6663)CCCfs		dynein, axonemal, heavy chain 9 isoform 2							132.0	115.0	121.0					17																	11656200		2203	4300	6503	SO:0001589	frameshift_variant	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11656200delC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6661delC	17.37:g.11656200delC	ENSP00000262442:p.Pro2221fs		Somatic				DNAH9_uc010coo.2_Frame_Shift_Del_p.P1515fs	p.P2221fs	NM_001372	NP_001363	WXS	Illumina HiSeq	Unspecified	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	33	6729	+		Breast(5;0.0122)|all_epithelial(5;0.131)	2221			AAA 2 (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Frame_Shift_Del	DEL	ENST00000262442.4	37	c.6661delC	CCDS11160.1																																																																																				0.428	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		9	41	NA	NA	NA	NA	NA	9	41	---	---	---	---
TBC1D9	23158	broad.mit.edu	37	4	141578684	141578684	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6971-01A-11D-1945-08	TCGA-55-6971-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	972572de-a48b-4e1e-8482-05bf5e3e9299	9b08f4ea-7ef6-465c-8480-7430dfb204b0	g.chr4:141578684delC	ENST00000442267.2	-	12	2278	c.2204delG	c.(2203-2205)ggafs	p.G735fs		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	735							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.G735V(2)		endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				ACAATACCTTCCCAAAACGGT	0.423																																							uc010ioj.2		NA																	2	Substitution - Missense(2)		kidney(2)	ovary(1)	1						c.(2203-2205)GGAfs		TBC1 domain family, member 9 (with GRAM domain)							196.0	184.0	188.0					4																	141578684		1962	4147	6109	SO:0001589	frameshift_variant	23158					intracellular	calcium ion binding|Rab GTPase activator activity	g.chr4:141578684delC	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.2204delG	4.37:g.141578684delC	ENSP00000411197:p.Gly735fs		Somatic					p.G735fs	NM_015130	NP_055945	WXS	Illumina HiSeq	Unspecified	Q6ZT07	TBCD9_HUMAN			12	2476	-	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)	735					A6H8U8|D3DNZ1|O94958	Frame_Shift_Del	DEL	ENST00000442267.2	37	c.2204delG	CCDS47136.1																																																																																				0.423	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130		42	208	NA	NA	NA	NA	NA	42	208	---	---	---	---
