#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
GNB1	2782	broad.mit.edu	37	1	1720625	1720625	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:1720625G>A	ENST00000378609.4	-	10	1114	c.783C>T	c.(781-783)ctC>ctT	p.L261L		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	261					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		AGTAAGTCATGAGCTCCTGGT	0.537											OREG0012998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001aif.2		NA																	0					0						c.(781-783)CTC>CTT		guanine nucleotide-binding protein, beta-1							105.0	97.0	99.0					1																	1720625		2203	4300	6503	SO:0001819	synonymous_variant	2782				cellular response to glucagon stimulus|energy reserve metabolic process|muscarinic acetylcholine receptor signaling pathway|platelet activation|Ras protein signal transduction|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|GTPase binding|signal transducer activity	g.chr1:1720625G>A	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.783C>T	1.37:g.1720625G>A			Somatic	OREG0012998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	598	GNB1_uc009vky.2_Silent_p.L161L	p.L261L	NM_002074	NP_002065	WXS	Illumina HiSeq	Unspecified	P62873	GBB1_HUMAN		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)	10	1115	-	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)	261					B1AJZ7|P04697|P04901|Q1RMY8	Silent	SNP	ENST00000378609.4	37	c.783C>T	CCDS34.1	.	.	.	.	.	.	.	.	.	.	G	9.072	0.997151	0.19043	.	.	ENSG00000078369	ENST00000424622	.	.	.	5.36	2.27	0.28462	.	.	.	.	.	T	0.53594	0.1806	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48603	-0.9021	4	.	.	.	0.0914	6.4117	0.21694	0.0763:0.3933:0.4201:0.1103	.	.	.	.	L	119	.	.	S	-	2	0	GNB1	1710485	0.993000	0.37304	1.000000	0.80357	0.870000	0.49936	0.407000	0.21049	1.238000	0.43771	0.655000	0.94253	TCA		0.537	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3	NM_002074		31	35	0	0	0	0.002445	0	31	35				
KLHDC7A	127707	broad.mit.edu	37	1	18809739	18809739	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:18809739C>A	ENST00000400664.1	+	1	2316	c.2264C>A	c.(2263-2265)gCc>gAc	p.A755D		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	755						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGTTTCCCGGCCCCGCAGGGC	0.627																																							uc001bax.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(2263-2265)GCC>GAC		kelch domain containing 7A							69.0	74.0	72.0					1																	18809739		2203	4300	6503	SO:0001583	missense	127707					integral to membrane		g.chr1:18809739C>A	AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.2264C>A	1.37:g.18809739C>A	ENSP00000383505:p.Ala755Asp		Somatic				KLHDC7A_uc009vpg.2_Intron	p.A755D	NM_152375	NP_689588	WXS	Illumina HiSeq	Unspecified	Q5VTJ3	KLD7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	1	2316	+		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)	755					Q8N8W6	Missense_Mutation	SNP	ENST00000400664.1	37	c.2264C>A	CCDS185.2	.	.	.	.	.	.	.	.	.	.	C	6.185	0.402318	0.11696	.	.	ENSG00000179023	ENST00000400664	T	0.15487	2.42	5.32	4.4	0.53042	.	0.315451	0.30177	N	0.010229	T	0.07503	0.0189	N	0.03050	-0.425	0.20703	N	0.999866	B	0.06786	0.001	B	0.04013	0.001	T	0.25572	-1.0128	10	0.44086	T	0.13	.	10.0179	0.42024	0.155:0.6955:0.1496:0.0	.	755	Q5VTJ3	KLD7A_HUMAN	D	755	ENSP00000383505:A755D	ENSP00000383505:A755D	A	+	2	0	KLHDC7A	18682326	0.000000	0.05858	0.007000	0.13788	0.095000	0.18619	0.857000	0.27831	1.188000	0.43014	0.655000	0.94253	GCC		0.627	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006923.3	NM_152375		33	77	1	0	1.71298e-08	0.003755	2.6624e-08	33	77				
MTFR1L	56181	broad.mit.edu	37	1	26153313	26153313	+	Silent	SNP	T	T	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:26153313T>C	ENST00000374301.3	+	5	755	c.447T>C	c.(445-447)gaT>gaC	p.D149D	MTFR1L_ENST00000524618.1_Silent_p.D52D|MTFR1L_ENST00000474295.1_Silent_p.D149D|MTFR1L_ENST00000374303.2_Silent_p.D149D|MTFR1L_ENST00000526894.1_Silent_p.D149D|MTFR1L_ENST00000469815.1_Intron|MTFR1L_ENST00000374307.5_Silent_p.D149D|MTFR1L_ENST00000466284.1_Silent_p.D149D|MTFR1L_ENST00000374300.3_Silent_p.D149D	NM_019557.5	NP_062457.3	Q9H019	MFR1L_HUMAN	mitochondrial fission regulator 1-like	149																	TGGCAGCTGATGCAGGTAGGA	0.572																																							uc001bkq.3		NA																	0				pancreas(1)	1						c.(445-447)GAT>GAC		hypothetical protein LOC56181 isoform a							22.0	23.0	23.0					1																	26153313		2011	4182	6193	SO:0001819	synonymous_variant	56181							g.chr1:26153313T>C		CCDS41284.1, CCDS44089.1	1p36.11	2012-11-30	2012-11-29	2012-11-29	ENSG00000117640	ENSG00000117640			28836	protein-coding gene	gene with protein product			"""family with sequence similarity 54, member B"""	FAM54B		8619474, 9110174	Standard	NM_019557		Approved		uc001bkq.4	Q9H019	OTTHUMG00000007377	ENST00000374301.3:c.447T>C	1.37:g.26153313T>C			Somatic				FAM54B_uc001bkr.3_Silent_p.D149D|FAM54B_uc010oet.1_Silent_p.D182D|FAM54B_uc009vrz.2_Silent_p.D146D|FAM54B_uc001bks.3_Silent_p.D149D|FAM54B_uc001bkt.3_Silent_p.D149D|FAM54B_uc001bku.3_Silent_p.D146D|FAM54B_uc001bkv.3_Silent_p.D52D	p.D149D	NM_001099625	NP_001093095	WXS	Illumina HiSeq	Unspecified	Q9H019	FA54B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;1.96e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.00095)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0649)	5	657	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)	149					A6NCB4|B7WNV5|D3DPJ4|Q63HP1|Q7Z2S7|Q9NUI7	Silent	SNP	ENST00000374301.3	37	c.447T>C	CCDS41284.1																																																																																				0.572	MTFR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019319.1	NM_019557		8	16	0	0	0	0.00308	0	8	16				
SFN	2810	broad.mit.edu	37	1	27189941	27189941	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:27189941G>C	ENST00000339276.4	+	1	309	c.238G>C	c.(238-240)Gag>Cag	p.E80Q		NM_006142.3	NP_006133.1	Q9Y3B8	ORN_HUMAN	stratifin	0	Exonuclease.				nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide metabolic process (GO:0009117)	focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	9		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)		GAAGGGGCCCGAGGTGCGTGA	0.642																																							uc001bnc.1		NA																	0					0						c.(238-240)GAG>CAG		stratifin							69.0	77.0	74.0					1																	27189941		2203	4300	6503	SO:0001583	missense	2810				DNA damage response, signal transduction resulting in induction of apoptosis|negative regulation of caspase activity|release of cytochrome c from mitochondria	cytoplasm|extracellular space|nucleus	protein domain specific binding|protein kinase C inhibitor activity	g.chr1:27189941G>C	BC023552	CCDS288.1	1p36.11	2008-02-05			ENSG00000175793	ENSG00000175793			10773	protein-coding gene	gene with protein product	"""14-3-3 sigma"""	601290				8515476	Standard	NM_006142		Approved	YWHAS	uc001bnc.1	P31947	OTTHUMG00000004093	ENST00000339276.4:c.238G>C	1.37:g.27189941G>C	ENSP00000340989:p.Glu80Gln		Somatic				uc010ofi.1_RNA	p.E80Q	NM_006142	NP_006133	WXS	Illumina HiSeq	Unspecified	P31947	1433S_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)	1	309	+		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	80					B2R532|Q32Q18|Q53FT1|Q6FIC6|Q9UFY7	Missense_Mutation	SNP	ENST00000339276.4	37	c.238G>C	CCDS288.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213680	0.39102	.	.	ENSG00000175793	ENST00000339276;ENST00000538651	T	0.41065	1.01	5.96	5.96	0.96718	14-3-3 domain (4);	0.285343	0.32563	N	0.005929	T	0.19485	0.0468	N	0.02345	-0.59	0.24342	N	0.994952	B	0.12630	0.006	B	0.04013	0.001	T	0.10636	-1.0621	10	0.62326	D	0.03	-28.0296	9.7561	0.40504	0.0734:0.1419:0.7847:0.0	.	80	P31947	1433S_HUMAN	Q	80	ENSP00000340989:E80Q	ENSP00000340989:E80Q	E	+	1	0	SFN	27062528	0.999000	0.42202	0.970000	0.41538	0.827000	0.46813	3.411000	0.52672	2.813000	0.96785	0.655000	0.94253	GAG		0.642	SFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011709.1	NM_006142		4	111	0	0	0	0.000248	0	4	111				
ZSCAN20	7579	broad.mit.edu	37	1	33956887	33956887	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:33956887C>G	ENST00000361328.3	+	6	1182	c.1029C>G	c.(1027-1029)ttC>ttG	p.F343L	ZSCAN20_ENST00000373413.2_Missense_Mutation_p.F289L	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	343					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AATCTCCTTTCTCTGAAAAGC	0.522																																							uc001bxj.3		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1027-1029)TTC>TTG		zinc finger protein 31							61.0	67.0	65.0					1																	33956887		1956	4174	6130	SO:0001583	missense	7579				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:33956887C>G	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1029C>G	1.37:g.33956887C>G	ENSP00000355053:p.Phe343Leu		Somatic				ZSCAN20_uc001bxk.2_Missense_Mutation_p.F289L|ZSCAN20_uc009vui.2_Missense_Mutation_p.F343L	p.F343L	NM_145238	NP_660281	WXS	Illumina HiSeq	Unspecified	P17040	ZSC20_HUMAN			6	1196	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	343					A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	ENST00000361328.3	37	c.1029C>G	CCDS41300.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000382	0.74818	.	.	ENSG00000121903	ENST00000373411;ENST00000326544;ENST00000373413;ENST00000361328;ENST00000401072	T	0.38722	1.12	5.74	2.79	0.32731	SANT domain, DNA binding (1);	0.000000	0.64402	D	0.000004	T	0.64757	0.2627	M	0.88031	2.925	0.35442	D	0.794987	D;P;D	0.76494	0.999;0.884;0.999	D;P;D	0.79108	0.962;0.507;0.992	T	0.73745	-0.3886	10	0.72032	D	0.01	-17.8159	7.9961	0.30269	0.0:0.7233:0.0:0.2767	.	343;289;343	P17040-3;P17040-4;P17040	.;.;ZSC20_HUMAN	L	289;343;289;277;277	ENSP00000362512:F289L	ENSP00000324450:F343L	F	+	3	2	ZSCAN20	33729474	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.363000	0.20301	0.874000	0.35823	0.655000	0.94253	TTC		0.522	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238		17	130	0	0	0	0.00499	0	17	130				
ZSCAN20	7579	broad.mit.edu	37	1	33956899	33956899	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:33956899C>T	ENST00000361328.3	+	6	1194	c.1041C>T	c.(1039-1041)ctC>ctT	p.L347L	ZSCAN20_ENST00000373413.2_Silent_p.L293L	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	347					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CTGAAAAGCTCCGGACTTGTC	0.532																																							uc001bxj.3		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1039-1041)CTC>CTT		zinc finger protein 31							65.0	71.0	69.0					1																	33956899		1953	4158	6111	SO:0001819	synonymous_variant	7579				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:33956899C>T	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1041C>T	1.37:g.33956899C>T			Somatic				ZSCAN20_uc001bxk.2_Silent_p.L293L|ZSCAN20_uc009vui.2_Silent_p.L347L	p.L347L	NM_145238	NP_660281	WXS	Illumina HiSeq	Unspecified	P17040	ZSC20_HUMAN			6	1208	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	347					A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	37	c.1041C>T	CCDS41300.1																																																																																				0.532	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238		19	142	0	0	0	0.008871	0	19	142				
ZSCAN20	7579	broad.mit.edu	37	1	33956998	33956998	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:33956998C>T	ENST00000361328.3	+	6	1293	c.1140C>T	c.(1138-1140)gtC>gtT	p.V380V	ZSCAN20_ENST00000373413.2_Silent_p.V326V	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	380					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GCTATAGGGTCAAAAACCTCC	0.587																																							uc001bxj.3		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1138-1140)GTC>GTT		zinc finger protein 31							91.0	97.0	95.0					1																	33956998		1964	4155	6119	SO:0001819	synonymous_variant	7579				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:33956998C>T	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1140C>T	1.37:g.33956998C>T			Somatic				ZSCAN20_uc001bxk.2_Silent_p.V326V|ZSCAN20_uc009vui.2_Silent_p.V380V	p.V380V	NM_145238	NP_660281	WXS	Illumina HiSeq	Unspecified	P17040	ZSC20_HUMAN			6	1307	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	380					A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	37	c.1140C>T	CCDS41300.1																																																																																				0.587	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238		20	171	0	0	0	0.008871	0	20	171				
ZSCAN20	7579	broad.mit.edu	37	1	33957238	33957238	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:33957238C>T	ENST00000361328.3	+	6	1533	c.1380C>T	c.(1378-1380)gtC>gtT	p.V460V	ZSCAN20_ENST00000373413.2_Silent_p.V406V	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	460					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CTGGCCTGGTCAATGTTGAGT	0.547																																							uc001bxj.3		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1378-1380)GTC>GTT		zinc finger protein 31							120.0	132.0	128.0					1																	33957238		1938	4120	6058	SO:0001819	synonymous_variant	7579				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:33957238C>T	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1380C>T	1.37:g.33957238C>T			Somatic				ZSCAN20_uc001bxk.2_Silent_p.V406V|ZSCAN20_uc009vui.2_Silent_p.V460V	p.V460V	NM_145238	NP_660281	WXS	Illumina HiSeq	Unspecified	P17040	ZSC20_HUMAN			6	1547	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	460					A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	37	c.1380C>T	CCDS41300.1																																																																																				0.547	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238		33	150	0	0	0	0.002836	0	33	150				
ZSCAN20	7579	broad.mit.edu	37	1	33957289	33957289	+	Silent	SNP	C	C	T	rs372234933		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:33957289C>T	ENST00000361328.3	+	6	1584	c.1431C>T	c.(1429-1431)ttC>ttT	p.F477F	ZSCAN20_ENST00000373413.2_Silent_p.F423F	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	477					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CAGCTCTGTTCCAGAGTCGTA	0.547																																							uc001bxj.3		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1429-1431)TTC>TTT		zinc finger protein 31		C		0,3748		0,0,1874	100.0	106.0	104.0		1431	3.8	1.0	1		104	1,8183		0,1,4091	no	coding-synonymous	ZSCAN20	NM_145238.3		0,1,5965	TT,TC,CC		0.0122,0.0,0.0084		477/1044	33957289	1,11931	1874	4092	5966	SO:0001819	synonymous_variant	7579				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:33957289C>T	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1431C>T	1.37:g.33957289C>T			Somatic				ZSCAN20_uc001bxk.2_Silent_p.F423F|ZSCAN20_uc009vui.2_Silent_p.F477F	p.F477F	NM_145238	NP_660281	WXS	Illumina HiSeq	Unspecified	P17040	ZSC20_HUMAN			6	1598	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	477					A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	37	c.1431C>T	CCDS41300.1																																																																																				0.547	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238		32	158	0	0	0	0.005524	0	32	158				
YRDC	79693	broad.mit.edu	37	1	38272818	38272818	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:38272818C>T	ENST00000373044.2	-	2	463	c.459G>A	c.(457-459)atG>atA	p.M153I	C1orf122_ENST00000373042.4_5'Flank|C1orf122_ENST00000446260.2_5'Flank|C1orf122_ENST00000468084.1_5'Flank|C1orf122_ENST00000373043.1_5'UTR	NM_024640.3	NP_078916.3	Q86U90	YRDC_HUMAN	yrdC N(6)-threonylcarbamoyltransferase domain containing	153	YrdC-like. {ECO:0000255|PROSITE- ProRule:PRU00518}.				negative regulation of transport (GO:0051051)	membrane (GO:0016020)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)			lung(2)|upper_aerodigestive_tract(1)	3	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CCGAGCGTTCCATCACCAGGG	0.512																																							uc001cca.1		NA																	0					0						c.(457-459)ATG>ATA		ischemia/reperfusion inducible protein							102.0	101.0	101.0					1																	38272818		2203	4300	6503	SO:0001583	missense	79693				negative regulation of transport	membrane|mitochondrion		g.chr1:38272818C>T		CCDS30675.1	1p34.3	2013-09-12	2013-09-12		ENSG00000196449	ENSG00000196449			28905	protein-coding gene	gene with protein product	"""ischemia/reperfusion inducible protein"""	612276	"""yrdC domain containing (E.coli)"", ""yrdC domain containing (E. coli)"""			12730717	Standard	NM_024640		Approved	FLJ23476, IRIP, SUA5	uc001cca.1	Q86U90	OTTHUMG00000004318	ENST00000373044.2:c.459G>A	1.37:g.38272818C>T	ENSP00000362135:p.Met153Ile		Somatic				C1orf122_uc001ccb.1_5'UTR	p.M153I	NM_024640	NP_078916	WXS	Illumina HiSeq	Unspecified	Q86U90	YRDC_HUMAN			2	472	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)	153			YrdC-like.		Q4W4X8|Q6NVW3|Q7L4E4|Q7Z2I4|Q9H5F8	Missense_Mutation	SNP	ENST00000373044.2	37	c.459G>A	CCDS30675.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.493761	0.44352	.	.	ENSG00000196449	ENST00000373044	.	.	.	4.43	4.43	0.53597	DHBP synthase RibB-like alpha/beta domain (2);Sua5/YciO/YrdC, N-terminal (2);Sua5/YciO/YrdC/YwlC (1);	0.228496	0.46145	D	0.000308	T	0.45357	0.1338	L	0.28458	0.855	0.80722	D	1	B	0.06786	0.001	B	0.15052	0.012	T	0.45454	-0.9260	9	0.62326	D;D	0.03;0.03	.	11.777	0.51991	0.0:0.9125:0.0:0.0875	.	153	Q86U90	YRDC_HUMAN	I	153	.	ENSP00000362135:M153I;ENSP00000362135:M153I	M	-	3	0	YRDC	38045405	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	0.615000	0.24329	2.302000	0.77476	0.563000	0.77884	ATG		0.512	YRDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012470.1	NM_024640		7	113	0	0	0	0.000978	0	7	113				
FAM183A	440585	broad.mit.edu	37	1	43621967	43621967	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:43621967G>C	ENST00000335282.4	+	4	388	c.388G>C	c.(388-390)Gat>Cat	p.D130H	FAM183A_ENST00000409337.1_3'UTR|FAM183A_ENST00000410048.1_Missense_Mutation_p.D102H	NM_001101376.2	NP_001094846.2	A6NL82	F183A_HUMAN	family with sequence similarity 183, member A	130										kidney(1)|large_intestine(1)|lung(2)|ovary(3)	7						GGGCTTAGGAGATGATCACCA	0.473																																							uc009vwo.2		NA																	0				ovary(3)	3						c.(388-390)GAT>CAT		hCG23177							131.0	132.0	131.0					1																	43621967		2028	4184	6212	SO:0001583	missense	440585							g.chr1:43621967G>C	AI192630, AI375550, AL139138	CCDS44126.1	1p34.2	2008-08-11			ENSG00000186973	ENSG00000186973			34347	protein-coding gene	gene with protein product						11181995	Standard	NM_001101376		Approved	LOC440585, hCG23177	uc009vwo.3	A6NL82	OTTHUMG00000007286	ENST00000335282.4:c.388G>C	1.37:g.43621967G>C	ENSP00000334415:p.Asp130His		Somatic					p.D130H	NM_001101376	NP_001094846	WXS	Illumina HiSeq	Unspecified	A6NL82	F183A_HUMAN			4	417	+			130					B7ZBL8	Missense_Mutation	SNP	ENST00000335282.4	37	c.388G>C	CCDS44126.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.608574	0.28623	.	.	ENSG00000186973	ENST00000409706;ENST00000410048;ENST00000409337;ENST00000410025;ENST00000335282	.	.	.	3.93	2.83	0.33086	.	0.579406	0.15258	N	0.271967	T	0.24236	0.0587	N	0.14661	0.345	0.22880	N	0.998612	P	0.40875	0.731	B	0.44224	0.444	T	0.07966	-1.0745	9	0.87932	D	0	.	5.8114	0.18467	0.1862:0.0:0.8138:0.0	.	130	A6NL82	F183A_HUMAN	H	130;102;40;78;130	.	ENSP00000334415:D130H	D	+	1	0	FAM183A	43394554	0.516000	0.26218	0.823000	0.32752	0.120000	0.20174	0.870000	0.28010	0.992000	0.38840	0.655000	0.94253	GAT		0.473	FAM183A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019024.3	NM_001101376		15	125	0	0	0	0.003163	0	15	125				
DIO1	1733	broad.mit.edu	37	1	54360014	54360014	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:54360014T>C	ENST00000361921.3	+	1	155	c.131T>C	c.(130-132)aTg>aCg	p.M44T	DIO1_ENST00000524406.1_Intron|DIO1_ENST00000525202.1_Missense_Mutation_p.M44T|DIO1_ENST00000322679.6_Missense_Mutation_p.M44T|DIO1_ENST00000388876.3_Missense_Mutation_p.M44T|DIO1_ENST00000534069.1_3'UTR|DIO1_ENST00000532493.1_Missense_Mutation_p.M44T	NM_000792.5|NM_213593.3	NP_000783.2|NP_998758.1	P49895	IOD1_HUMAN	deiodinase, iodothyronine, type I	44					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)			cervix(1)|endometrium(2)|large_intestine(3)|lung(2)|skin(1)	9						ATCCTGGCCATGGGCGAGAAG	0.522																																							uc010onx.1		NA																	0					0						c.(130-132)ATG>ACG		deiodinase, iodothyronine, type I isoform a							179.0	147.0	158.0					1																	54360014		2203	4300	6503	SO:0001583	missense	1733				hormone biosynthetic process|thyroid hormone generation	endoplasmic reticulum membrane|integral to membrane|plasma membrane	selenium binding|thyroxine 5'-deiodinase activity	g.chr1:54360014T>C		CCDS30722.1, CCDS41339.1, CCDS41340.1, CCDS53320.1	1p33-p32	2012-03-01			ENSG00000211452	ENSG00000211452	1.97.1.10		2883	protein-coding gene	gene with protein product		147892		TXDI1		8964838	Standard	NM_000792		Approved		uc001cwb.3	P49895	OTTHUMG00000008435	ENST00000361921.3:c.131T>C	1.37:g.54360014T>C	ENSP00000354643:p.Met44Thr		Somatic				DIO1_uc010onw.1_Missense_Mutation_p.M44T|DIO1_uc009vzl.2_Missense_Mutation_p.M44T|DIO1_uc001cwb.2_Missense_Mutation_p.M44T|DIO1_uc010ony.1_Missense_Mutation_p.M44T|DIO1_uc001cwd.2_RNA|DIO1_uc001cwe.2_RNA|DIO1_uc001cwf.2_RNA|DIO1_uc001cwg.2_RNA	p.M44T	NM_000792	NP_000783	WXS	Illumina HiSeq	Unspecified	P49895	IOD1_HUMAN			1	154	+			44					Q1RN02|Q3KNP8|Q6Q4C1|Q6Q4C2|Q6Q4C3|Q6Q4C4|Q6Q4C5|Q6Q4C6|Q6Q4C7|Q6Q4C9|Q8WWC6	Missense_Mutation	SNP	ENST00000361921.3	37	c.131T>C	CCDS41339.1	.	.	.	.	.	.	.	.	.	.	T	11.03	1.518561	0.27211	.	.	ENSG00000211452	ENST00000529589;ENST00000361921;ENST00000322679;ENST00000532493;ENST00000525202;ENST00000388876	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.61	3.44	0.39384	.	0.276637	0.37437	N	0.002092	T	0.39462	0.1079	M	0.76574	2.34	0.28480	N	0.91502	P;P;B;P	0.47545	0.874;0.897;0.065;0.874	B;P;B;B	0.48488	0.443;0.579;0.035;0.443	T	0.37430	-0.9706	10	0.72032	D	0.01	.	8.1573	0.31176	0.3216:0.0:0.0:0.6784	.	44;44;44;44	P49895-5;P49895;P49895-2;P49895-4	.;IOD1_HUMAN;.;.	T	1;44;44;44;44;44	ENSP00000354643:M44T;ENSP00000323198:M44T;ENSP00000434758:M44T;ENSP00000373528:M44T	ENSP00000323198:M44T	M	+	2	0	DIO1	54132602	0.051000	0.20477	0.986000	0.45419	0.162000	0.22319	-0.073000	0.11468	0.762000	0.33152	0.533000	0.62120	ATG		0.522	DIO1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000023247.3			46	134	0	0	0	0.00361	0	46	134				
MROH7	374977	broad.mit.edu	37	1	55145070	55145070	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:55145070C>T	ENST00000421030.2	+	12	2469	c.2184C>T	c.(2182-2184)ctC>ctT	p.L728L	MROH7_ENST00000409996.1_Silent_p.L296L|MROH7_ENST00000339553.5_Silent_p.L728L|MROH7_ENST00000454855.2_Silent_p.L246L|MROH7_ENST00000395690.2_Silent_p.L728L|MROH7_ENST00000545244.1_Silent_p.L296L|MROH7-TTC4_ENST00000414150.2_Silent_p.L728L	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	728						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											AGGTCATGCTCAGCTCGGTGC	0.662																																							uc010ooe.1		NA																	0					0						c.(2182-2184)CTC>CTT		hypothetical protein LOC374977							33.0	41.0	39.0					1																	55145070		2085	4230	6315	SO:0001819	synonymous_variant	374977					integral to membrane	binding	g.chr1:55145070C>T	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2184C>T	1.37:g.55145070C>T			Somatic				C1orf175_uc001cxq.2_RNA|C1orf175_uc010ooc.1_Silent_p.L296L|C1orf175_uc001cxs.2_RNA|C1orf175_uc010ood.1_Silent_p.L246L|C1orf175_uc010oof.1_RNA|C1orf175_uc001cxr.1_RNA|C1orf175_uc010oog.1_Silent_p.L728L|C1orf175_uc010ooh.1_RNA|C1orf175_uc009vzq.1_RNA|C1orf175_uc001cxt.1_RNA	p.L728L	NM_001039464	NP_001034553	WXS	Illumina HiSeq	Unspecified	Q68CQ1	HEAT8_HUMAN			12	2508	+			728					A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Silent	SNP	ENST00000421030.2	37	c.2184C>T	CCDS41342.2																																																																																				0.662	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547		7	74	0	0	0	0.00308	0	7	74				
LRRC8D	55144	broad.mit.edu	37	1	90399987	90399987	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:90399987G>T	ENST00000337338.5	+	3	1767	c.1360G>T	c.(1360-1362)Gag>Tag	p.E454*	LRRC8D_ENST00000394593.3_Nonsense_Mutation_p.E454*	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	454					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		TTTGAACCATGAGTGGACATT	0.453																																							uc001dnm.2		NA																	0				ovary(2)	2						c.(1360-1362)GAG>TAG		leucine rich repeat containing 8 family, member							62.0	64.0	64.0					1																	90399987		2203	4300	6503	SO:0001587	stop_gained	55144					integral to membrane	protein binding	g.chr1:90399987G>T	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.1360G>T	1.37:g.90399987G>T	ENSP00000338887:p.Glu454*		Somatic				LRRC8D_uc001dnn.2_Nonsense_Mutation_p.E454*	p.E454*	NM_001134479	NP_001127951	WXS	Illumina HiSeq	Unspecified	Q7L1W4	LRC8D_HUMAN		all cancers(265;0.0109)|Epithelial(280;0.0427)	3	1785	+		all_lung(203;0.0894)|Lung NSC(277;0.227)	454					D3DT29|Q6UWB2|Q9NVW3	Nonsense_Mutation	SNP	ENST00000337338.5	37	c.1360G>T	CCDS726.1	.	.	.	.	.	.	.	.	.	.	G	39	7.642913	0.98406	.	.	ENSG00000171492	ENST00000337338;ENST00000394593	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	.	.	.	X	454	.	.	E	+	1	0	LRRC8D	90172575	1.000000	0.71417	0.988000	0.46212	0.992000	0.81027	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	GAG		0.453	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103		23	5	1	0	1.64293e-13	0.00333	2.68751e-13	23	5				
CDC7	8317	broad.mit.edu	37	1	91973869	91973869	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:91973869G>A	ENST00000428239.1	+	4	509	c.250G>A	c.(250-252)Gaa>Aaa	p.E84K	CDC7_ENST00000430031.2_Missense_Mutation_p.E56K|CDC7_ENST00000234626.6_Missense_Mutation_p.E84K|CDC7_ENST00000497611.1_3'UTR	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	84	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		AGTAGGACCTGAAGAGAAAAT	0.353																																							uc001doe.2		NA																	0				stomach(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	5						c.(250-252)GAA>AAA		cell division cycle 7							56.0	55.0	55.0					1																	91973869		2203	4300	6503	SO:0001583	missense	8317				cell cycle checkpoint|cell division|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|positive regulation of cell proliferation|regulation of S phase	cytoplasm|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr1:91973869G>A	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.250G>A	1.37:g.91973869G>A	ENSP00000393139:p.Glu84Lys		Somatic				CDC7_uc001dof.2_Missense_Mutation_p.E84K|CDC7_uc010osw.1_Missense_Mutation_p.E56K|CDC7_uc009wdc.2_Missense_Mutation_p.E84K	p.E84K	NM_003503	NP_003494	WXS	Illumina HiSeq	Unspecified	O00311	CDC7_HUMAN		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)	4	415	+		all_lung(203;0.0165)|Lung NSC(277;0.0562)	84			Protein kinase.		D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	37	c.250G>A	CCDS734.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626413	0.66901	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239;ENST00000426137	T;T;T;T	0.05925	3.37;3.37;3.37;3.37	6.07	6.07	0.98685	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.280714	0.45606	D	0.000343	T	0.02012	0.0063	N	0.11341	0.13	0.43025	D	0.994581	P;B	0.35174	0.488;0.032	B;B	0.37198	0.243;0.049	T	0.51100	-0.8748	10	0.08599	T	0.76	-4.7285	20.6593	0.99626	0.0:0.0:1.0:0.0	.	56;84	B7Z5H7;O00311	.;CDC7_HUMAN	K	56;84;84;84	ENSP00000407477:E56K;ENSP00000234626:E84K;ENSP00000393139:E84K;ENSP00000398077:E84K	ENSP00000234626:E84K	E	+	1	0	CDC7	91746457	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.008000	0.70739	2.885000	0.99019	0.655000	0.94253	GAA		0.353	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503		7	8	0	0	0	0.006214	0	7	8				
MTF2	22823	broad.mit.edu	37	1	93586141	93586141	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:93586141G>T	ENST00000370298.4	+	9	1122	c.833G>T	c.(832-834)aGt>aTt	p.S278I	MTF2_ENST00000370303.4_Missense_Mutation_p.S278I|MTF2_ENST00000471953.1_Intron|MTF2_ENST00000545708.1_Missense_Mutation_p.S176I|MTF2_ENST00000540243.1_Missense_Mutation_p.S176I	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	278					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		TACAACCTAAGTGTTATTCAT	0.353																																							uc009wdj.2		NA																	0				ovary(2)	2						c.(832-834)AGT>ATT		metal response element binding transcription							139.0	140.0	140.0					1																	93586141		2203	4300	6503	SO:0001583	missense	22823					nucleus	DNA binding|zinc ion binding	g.chr1:93586141G>T	AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.833G>T	1.37:g.93586141G>T	ENSP00000359321:p.Ser278Ile		Somatic				MTF2_uc010oth.1_Missense_Mutation_p.S176I|MTF2_uc009wdk.2_Missense_Mutation_p.S278I|MTF2_uc001dpi.3_Intron|MTF2_uc010oti.1_Missense_Mutation_p.S176I|MTF2_uc001dpj.3_Missense_Mutation_p.S176I|MTF2_uc001dpl.3_Missense_Mutation_p.S176I	p.S278I	NM_007358	NP_031384	WXS	Illumina HiSeq	Unspecified	Q9Y483	MTF2_HUMAN		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)	9	1125	+		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)	278					A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Missense_Mutation	SNP	ENST00000370298.4	37	c.833G>T	CCDS742.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203931	0.79127	.	.	ENSG00000143033	ENST00000545708;ENST00000540243;ENST00000370298;ENST00000537953;ENST00000370303	T;T;T;T	0.34072	1.38;1.38;1.78;1.82	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.33962	0.0881	L	0.55481	1.735	0.80722	D	1	P;B	0.37061	0.58;0.431	B;B	0.42771	0.397;0.269	T	0.05666	-1.0871	10	0.42905	T	0.14	-7.7075	20.181	0.98201	0.0:0.0:1.0:0.0	.	278;278	B1AKT6;Q9Y483	.;MTF2_HUMAN	I	176;176;278;176;278	ENSP00000444962:S176I;ENSP00000443295:S176I;ENSP00000359321:S278I;ENSP00000359326:S278I	ENSP00000359321:S278I	S	+	2	0	MTF2	93358729	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.586000	0.82596	2.840000	0.97914	0.655000	0.94253	AGT		0.353	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028075.3	NM_007358		13	25	1	0	2.68362e-12	0.001368	4.32316e-12	13	25				
SPAG17	200162	broad.mit.edu	37	1	118628577	118628577	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:118628577G>A	ENST00000336338.5	-	13	1795	c.1730C>T	c.(1729-1731)aCa>aTa	p.T577I		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	577						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTCATGAATTGTAGCTAGACG	0.398																																							uc001ehk.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(1729-1731)ACA>ATA		sperm associated antigen 17							174.0	172.0	173.0					1																	118628577		2203	4300	6503	SO:0001583	missense	200162					cilium|flagellar axoneme|microtubule		g.chr1:118628577G>A		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.1730C>T	1.37:g.118628577G>A	ENSP00000337804:p.Thr577Ile		Somatic					p.T577I	NM_206996	NP_996879	WXS	Illumina HiSeq	Unspecified	Q6Q759	SPG17_HUMAN		Lung(183;0.0858)	13	1798	-	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)	577					Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	c.1730C>T	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	2.194	-0.384601	0.04966	.	.	ENSG00000155761	ENST00000336338	T	0.17854	2.25	5.73	1.79	0.24919	.	0.510095	0.21740	N	0.069832	T	0.07143	0.0181	M	0.63428	1.95	0.09310	N	1	B	0.25743	0.133	B	0.30105	0.111	T	0.29397	-1.0013	10	0.51188	T	0.08	.	7.6097	0.28122	0.2682:0.1129:0.6189:0.0	.	577	Q6Q759	SPG17_HUMAN	I	577	ENSP00000337804:T577I	ENSP00000337804:T577I	T	-	2	0	SPAG17	118430100	0.989000	0.36119	0.015000	0.15790	0.109000	0.19521	1.709000	0.37909	-0.103000	0.12175	-1.761000	0.00669	ACA		0.398	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996		35	10	0	0	0	0.004878	0	35	10				
ITGA10	8515	broad.mit.edu	37	1	145536860	145536860	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:145536860C>T	ENST00000369304.3	+	18	2415	c.2240C>T	c.(2239-2241)tCa>tTa	p.S747L	ITGA10_ENST00000538811.1_Missense_Mutation_p.S616L|ITGA10_ENST00000539363.1_Missense_Mutation_p.S604L	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	747					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CAGGATACATCAGATTACCTC	0.468																																							uc001eoa.2		NA																	0				lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8						c.(2239-2241)TCA>TTA		integrin, alpha 10 precursor							188.0	173.0	178.0					1																	145536860		2203	4300	6503	SO:0001583	missense	8515				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity	g.chr1:145536860C>T	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.2240C>T	1.37:g.145536860C>T	ENSP00000358310:p.Ser747Leu		Somatic				NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Missense_Mutation_p.S616L|ITGA10_uc009wiw.2_Missense_Mutation_p.S604L|ITGA10_uc010oyw.1_Missense_Mutation_p.S692L	p.S747L	NM_003637	NP_003628	WXS	Illumina HiSeq	Unspecified	O75578	ITA10_HUMAN			18	2316	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		747			Extracellular (Potential).		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	c.2240C>T	CCDS918.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845137	0.51164	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.46819	0.86;0.86;0.86	5.16	5.16	0.70880	Integrin alpha-2 (1);	0.077674	0.53938	D	0.000049	T	0.39627	0.1085	L	0.29908	0.895	0.80722	D	1	B;B;D;B	0.54601	0.151;0.042;0.967;0.182	B;B;P;B	0.55508	0.155;0.07;0.777;0.241	T	0.17289	-1.0374	10	0.42905	T	0.14	.	14.0312	0.64617	0.0:1.0:0.0:0.0	.	713;616;604;747	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	L	747;713;604;616	ENSP00000358310:S747L;ENSP00000439894:S604L;ENSP00000440011:S616L	ENSP00000358310:S747L	S	+	2	0	ITGA10	144248217	0.985000	0.35326	1.000000	0.80357	0.625000	0.37756	4.485000	0.60279	2.690000	0.91761	0.455000	0.32223	TCA		0.468	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637		25	254	0	0	0	0.003954	0	25	254				
BCL9	607	broad.mit.edu	37	1	147086252	147086252	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:147086252T>A	ENST00000234739.3	+	6	1137	c.397T>A	c.(397-399)Tcc>Acc	p.S133T	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	133					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CCACATAAAGTCCCAGGATTC	0.458			T	"""IGH@, IGL@"""	B-ALL																																		uc001epq.2		NA		Dom	yes		1	1q21	607	T	B-cell CLL/lymphoma 9			L	IGH@|IGL@		B-ALL		0				ovary(2)|large_intestine(2)|breast(1)|skin(1)	6						c.(397-399)TCC>ACC		B-cell CLL/lymphoma 9							108.0	111.0	110.0					1																	147086252		2203	4300	6503	SO:0001583	missense	607				Wnt receptor signaling pathway	nucleus	protein binding	g.chr1:147086252T>A	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.397T>A	1.37:g.147086252T>A	ENSP00000234739:p.Ser133Thr		Somatic				BCL9_uc010ozr.1_Missense_Mutation_p.S59T	p.S133T	NM_004326	NP_004317	WXS	Illumina HiSeq	Unspecified	O00512	BCL9_HUMAN			6	1137	+	all_hematologic(923;0.115)		133					Q5T489	Missense_Mutation	SNP	ENST00000234739.3	37	c.397T>A	CCDS30833.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.305746	0.40795	.	.	ENSG00000116128	ENST00000234739	T	0.56776	0.44	5.55	-2.65	0.06095	.	0.414560	0.29293	N	0.012569	T	0.15825	0.0381	L	0.34521	1.04	0.29394	N	0.862396	B;B	0.11235	0.004;0.004	B;B	0.14023	0.01;0.01	T	0.17289	-1.0374	10	0.38643	T	0.18	-3.0457	6.8971	0.24262	0.0:0.4166:0.2407:0.3427	.	133;133	Q1JQ81;O00512	.;BCL9_HUMAN	T	133	ENSP00000234739:S133T	ENSP00000234739:S133T	S	+	1	0	BCL9	145552876	0.978000	0.34361	0.992000	0.48379	0.998000	0.95712	0.262000	0.18460	-0.328000	0.08539	0.533000	0.62120	TCC		0.458	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326		7	77	0	0	0	0.004482	0	7	77				
SV2A	9900	broad.mit.edu	37	1	149878386	149878386	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:149878386C>T	ENST00000369146.3	-	11	2191	c.1701G>A	c.(1699-1701)gtG>gtA	p.V567V	SV2A_ENST00000369145.1_Silent_p.V567V	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	567					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	GACGGCTGTTCACAAACTTGT	0.532																																							uc001etg.2		NA																	0				ovary(6)|pancreas(1)	7						c.(1699-1701)GTG>GTA		synaptic vesicle glycoprotein 2	Levetiracetam(DB01202)						93.0	80.0	85.0					1																	149878386		2203	4300	6503	SO:0001819	synonymous_variant	9900				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr1:149878386C>T	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1701G>A	1.37:g.149878386C>T			Somatic				SV2A_uc009wlk.2_Silent_p.V19V|SV2A_uc001eth.2_Silent_p.V567V	p.V567V	NM_014849	NP_055664	WXS	Illumina HiSeq	Unspecified	Q7L0J3	SV2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		11	2192	-	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		567			Extracellular (Potential).		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	ENST00000369146.3	37	c.1701G>A	CCDS940.1																																																																																				0.532	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1			8	60	0	0	0	0.00308	0	8	60				
HRNR	388697	broad.mit.edu	37	1	152193064	152193064	+	Silent	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:152193064G>T	ENST00000368801.2	-	3	1116	c.1041C>A	c.(1039-1041)ggC>ggA	p.G347G	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	347					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTGCCCAAAGCCAGAAGTCT	0.567																																							uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(1039-1041)GGC>GGA		hornerin							101.0	107.0	105.0					1																	152193064		2203	4300	6503	SO:0001819	synonymous_variant	388697				keratinization		calcium ion binding|protein binding	g.chr1:152193064G>T	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1041C>A	1.37:g.152193064G>T			Somatic					p.G347G	NM_001009931	NP_001009931	WXS	Illumina HiSeq	Unspecified	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	1117	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		347			3.		Q5DT20|Q5U1F4	Silent	SNP	ENST00000368801.2	37	c.1041C>A	CCDS30859.1																																																																																				0.567	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		108	77	1	0	1.54984e-59	0.00361	2.86208e-59	108	77				
F5	2153	broad.mit.edu	37	1	169510973	169510973	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:169510973G>A	ENST00000367797.3	-	13	3556	c.3355C>T	c.(3355-3357)Cag>Tag	p.Q1119*	F5_ENST00000367796.3_Nonsense_Mutation_p.Q1124*	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1119	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GGCACTGTCTGATAAAGACCT	0.478																																							uc001ggg.1		NA																	0				ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(3355-3357)CAG>TAG		coagulation factor V precursor	Drotrecogin alfa(DB00055)						135.0	137.0	136.0					1																	169510973		2203	4300	6503	SO:0001587	stop_gained	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169510973G>A	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3355C>T	1.37:g.169510973G>A	ENSP00000356771:p.Gln1119*		Somatic					p.Q1119*	NM_000130	NP_000121	WXS	Illumina HiSeq	Unspecified	P12259	FA5_HUMAN			13	3500	-	all_hematologic(923;0.208)		1119			B.		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Nonsense_Mutation	SNP	ENST00000367797.3	37	c.3355C>T	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	38	7.255984	0.98168	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	.	.	.	5.02	3.12	0.35913	.	1.123310	0.06625	N	0.758040	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-0.3968	3.6062	0.08043	0.0909:0.1696:0.5639:0.1757	.	.	.	.	X	1119;1124	.	ENSP00000356770:Q1124X	Q	-	1	0	F5	167777597	0.002000	0.14202	0.026000	0.17262	0.187000	0.23431	0.502000	0.22594	1.237000	0.43756	-0.284000	0.09977	CAG		0.478	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		13	161	0	0	0	0.001368	0	13	161				
SUCO	51430	broad.mit.edu	37	1	172543059	172543059	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:172543059C>G	ENST00000263688.3	+	10	1297	c.1078C>G	c.(1078-1080)Caa>Gaa	p.Q360E	SUCO_ENST00000367723.4_Missense_Mutation_p.Q518E|SUCO_ENST00000610051.1_Missense_Mutation_p.Q323E|SUCO_ENST00000608151.1_Missense_Mutation_p.Q519E	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	360	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											TGAACCAATTCAAGTAAAACA	0.274																																						Colon(43;174 953 11768 38880 47057)	uc001giq.3		NA																	0				ovary(2)	2						c.(1078-1080)CAA>GAA		chromosome 1 open reading frame 9 protein							56.0	60.0	58.0					1																	172543059		2198	4290	6488	SO:0001583	missense	51430				multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane		g.chr1:172543059C>G	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.1078C>G	1.37:g.172543059C>G	ENSP00000263688:p.Gln360Glu		Somatic				C1orf9_uc010pmm.1_Missense_Mutation_p.Q360E|C1orf9_uc009wwd.2_Missense_Mutation_p.Q323E|C1orf9_uc010pmn.1_Missense_Mutation_p.Q323E|C1orf9_uc010pmo.1_RNA	p.Q360E	NM_014283	NP_055098	WXS	Illumina HiSeq	Unspecified	Q9UBS9	OSPT_HUMAN		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)	10	1394	+		Breast(1374;0.212)	360			SUN.		B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	37	c.1078C>G	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562957	0.86335	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	T;T	0.42131	0.98;0.98	5.44	5.44	0.79542	Galactose-binding domain-like (1);Sad1/UNC-like, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.54382	0.1855	L	0.54323	1.7	0.80722	D	1	D;P;D;D	0.69078	0.985;0.932;0.997;0.997	D;D;D;D	0.80764	0.981;0.916;0.994;0.994	T	0.57406	-0.7817	10	0.87932	D	0	-13.7024	17.8266	0.88667	0.0:1.0:0.0:0.0	.	323;360;519;360	B4DYM4;B4DZJ3;Q5H945;Q9UBS9	.;.;.;OSPT_HUMAN	E	519;360	ENSP00000356696:Q519E;ENSP00000263688:Q360E	ENSP00000263688:Q360E	Q	+	1	0	C1orf9	170809682	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.814000	0.86154	2.542000	0.85734	0.467000	0.42956	CAA		0.274	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227		3	46	0	0	0	0.000248	0	3	46				
CFH	3075	broad.mit.edu	37	1	196706742	196706742	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:196706742G>A	ENST00000367429.4	+	17	2974	c.2734G>A	c.(2734-2736)Gaa>Aaa	p.E912K		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	912	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TGAAGAAAATGAAACAACATG	0.363																																							uc001gtj.3		NA																	0				skin(4)|ovary(1)|breast(1)	6						c.(2734-2736)GAA>AAA		complement factor H isoform a precursor							91.0	84.0	87.0					1																	196706742		2203	4300	6503	SO:0001583	missense	3075				complement activation, alternative pathway	extracellular space		g.chr1:196706742G>A	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2734G>A	1.37:g.196706742G>A	ENSP00000356399:p.Glu912Lys		Somatic					p.E912K	NM_000186	NP_000177	WXS	Illumina HiSeq	Unspecified	P08603	CFAH_HUMAN			17	2974	+			912			Sushi 15.		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	c.2734G>A	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	.	11.16	1.557929	0.27827	.	.	ENSG00000000971	ENST00000367429	T	0.63744	-0.06	6.04	4.16	0.48862	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.46814	0.1412	L	0.41961	1.31	0.20873	N	0.999835	B	0.29115	0.233	B	0.22386	0.039	T	0.31861	-0.9928	9	0.06494	T	0.89	.	9.2712	0.37673	0.1676:0.0:0.8324:0.0	.	912	P08603	CFAH_HUMAN	K	912	ENSP00000356399:E912K	ENSP00000356399:E912K	E	+	1	0	CFH	194973365	0.005000	0.15991	0.002000	0.10522	0.105000	0.19272	1.244000	0.32778	0.867000	0.35654	0.650000	0.86243	GAA		0.363	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186		8	52	0	0	0	0.004482	0	8	52				
LEMD1	93273	broad.mit.edu	37	1	205350899	205350899	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:205350899C>T	ENST00000367153.4	-	6	535	c.433G>A	c.(433-435)Gag>Aag	p.E145K	LEMD1_ENST00000476884.1_5'UTR|LEMD1_ENST00000367154.1_Silent_p.S97S|LEMD1_ENST00000367151.2_Missense_Mutation_p.E104K|LEMD1_ENST00000391936.2_Silent_p.S97S|LEMD1-AS1_ENST00000447832.1_RNA|LEMD1_ENST00000367152.1_Missense_Mutation_p.E104K|LEMD1_ENST00000367149.3_Silent_p.S56S	NM_001199050.1	NP_001185979.1	Q68G75	LEMD1_HUMAN	LEM domain containing 1	145						integral component of membrane (GO:0016021)				breast(1)|lung(2)	3	Breast(84;0.247)		BRCA - Breast invasive adenocarcinoma(75;0.0938)			CTCCAGCTCTCGATAGTCTGG	0.478																																							uc001hcj.1		NA																	0					0						c.(433-435)GAG>AAG		RecName: Full=LEM domain-containing protein 1;          Short=LEMP-1; AltName: Full=Cancer/testis antigen 50;          Short=CT50;							325.0	278.0	294.0					1																	205350899		2203	4300	6503	SO:0001583	missense	93273					integral to membrane|nuclear envelope		g.chr1:205350899C>T		CCDS30986.1, CCDS55677.1, CCDS55678.1, CCDS55679.1	1q32.1	2009-03-25			ENSG00000186007	ENSG00000186007			18725	protein-coding gene	gene with protein product	"""cancer/testis antigen 50"""	610480				15254688	Standard	NM_001199050		Approved	LEMP-1, CT50	uc001hcj.2	Q68G75	OTTHUMG00000037201	ENST00000367153.4:c.433G>A	1.37:g.205350899C>T	ENSP00000356121:p.Glu145Lys		Somatic				LEMD1_uc001hci.1_Silent_p.S97S|LEMD1_uc001hck.1_RNA|LEMD1_uc001hcl.1_Missense_Mutation_p.E104K|LEMD1_uc001hcm.1_RNA|LEMD1_uc001hcn.1_RNA|uc001hch.1_Intron	p.E145K			WXS	Illumina HiSeq	Unspecified	Q68G75	LEMD1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0938)		6	535	-	Breast(84;0.247)		145					Q6L9T9|Q6L9U0|Q6L9U1|Q6L9U2|Q6L9U3|Q6L9U4	Missense_Mutation	SNP	ENST00000367153.4	37	c.433G>A	CCDS55679.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869383	0.32977	.	.	ENSG00000186007	ENST00000367152;ENST00000367153;ENST00000367151	T;T;T	0.48836	0.8;0.81;0.8	4.92	2.34	0.29019	.	1.655090	0.03729	N	0.253107	T	0.35278	0.0926	.	.	.	0.09310	N	1	B;B	0.27117	0.168;0.105	B;B	0.19946	0.027;0.012	T	0.24154	-1.0168	9	0.44086	T	0.13	-22.133	5.9742	0.19369	0.0:0.6827:0.1878:0.1295	.	104;145	Q68G75-3;Q68G75	.;LEMD1_HUMAN	K	104;145;104	ENSP00000356120:E104K;ENSP00000356121:E145K;ENSP00000356119:E104K	ENSP00000356119:E104K	E	-	1	0	LEMD1	203617522	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.195000	0.17155	0.618000	0.30179	0.644000	0.83932	GAG		0.478	LEMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090401.1	NM_001001552		12	264	0	0	0	0.000978	0	12	264				
PROX1	5629	broad.mit.edu	37	1	214169925	214169925	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:214169925G>A	ENST00000366958.4	+	2	655	c.47G>A	c.(46-48)aGg>aAg	p.R16K	PROX1_ENST00000435016.1_Missense_Mutation_p.R16K|PROX1_ENST00000498508.2_Missense_Mutation_p.R16K|PROX1_ENST00000261454.4_Missense_Mutation_p.R16K	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	16	Interaction with RORG. {ECO:0000250|UniProtKB:P48437}.				aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CAAACCAAGAGGAGAAGAGTT	0.493																																							uc001hkh.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6						c.(46-48)AGG>AAG		prospero homeobox 1							110.0	94.0	100.0					1																	214169925		2203	4300	6503	SO:0001583	missense	5629				aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding	g.chr1:214169925G>A	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.47G>A	1.37:g.214169925G>A	ENSP00000355925:p.Arg16Lys		Somatic				PROX1_uc001hkg.1_Missense_Mutation_p.R16K	p.R16K	NM_002763	NP_002754	WXS	Illumina HiSeq	Unspecified	Q92786	PROX1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)	2	319	+			16					A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	ENST00000366958.4	37	c.47G>A	CCDS31021.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933821	0.73442	.	.	ENSG00000117707	ENST00000471129;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.52295	0.7;0.67;0.7;0.7	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.58278	0.2111	L	0.27053	0.805	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.60525	-0.7246	10	0.87932	D	0	-4.6795	20.1272	0.97986	0.0:0.0:1.0:0.0	.	16	Q92786	PROX1_HUMAN	K	16	ENSP00000420283:R16K;ENSP00000355925:R16K;ENSP00000400694:R16K;ENSP00000261454:R16K	ENSP00000261454:R16K	R	+	2	0	PROX1	212236548	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.500000	0.81588	2.828000	0.97474	0.655000	0.94253	AGG		0.493	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763		76	53	0	0	0	0.00361	0	76	53				
DUSP10	11221	broad.mit.edu	37	1	221875903	221875903	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:221875903C>G	ENST00000366899.3	-	4	1538	c.1300G>C	c.(1300-1302)Gct>Cct	p.A434P	DUSP10_ENST00000544095.1_Missense_Mutation_p.A92P|DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000323825.3_Missense_Mutation_p.A92P	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	434	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		AATTTATAAGCATCAGTCATG	0.507																																							uc001hmy.1		NA																	0				upper_aerodigestive_tract(1)|lung(1)	2						c.(1300-1302)GCT>CCT		dual specificity phosphatase 10 isoform a							204.0	184.0	191.0					1																	221875903		2203	4300	6503	SO:0001583	missense	11221				inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|negative regulation of stress-activated MAPK cascade	Golgi apparatus|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chr1:221875903C>G	AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.1300G>C	1.37:g.221875903C>G	ENSP00000355866:p.Ala434Pro		Somatic				DUSP10_uc001hmx.1_Missense_Mutation_p.A92P|DUSP10_uc001hmz.1_Missense_Mutation_p.A92P	p.A434P	NM_007207	NP_009138	WXS	Illumina HiSeq	Unspecified	Q9Y6W6	DUS10_HUMAN		GBM - Glioblastoma multiforme(131;0.0103)	4	1482	-			434			Tyrosine-protein phosphatase.		D3DTB4|Q6GSI4|Q9H9Z5	Missense_Mutation	SNP	ENST00000366899.3	37	c.1300G>C	CCDS1528.1	.	.	.	.	.	.	.	.	.	.	C	32	5.111177	0.94339	.	.	ENSG00000143507	ENST00000366899;ENST00000418487;ENST00000323825;ENST00000544095	D;D;D	0.92699	-3.09;-3.09;-3.09	5.72	5.72	0.89469	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.98311	0.9440	H	0.99634	4.67	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99075	1.0835	10	0.87932	D	0	.	20.2441	0.98394	0.0:1.0:0.0:0.0	.	434	Q9Y6W6	DUS10_HUMAN	P	434;379;92;92	ENSP00000355866:A434P;ENSP00000322015:A92P;ENSP00000441302:A92P	ENSP00000322015:A92P	A	-	1	0	DUSP10	219942526	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	5.914000	0.69964	2.865000	0.98341	0.655000	0.94253	GCT		0.507	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090716.1	NM_007207		96	82	0	0	0	0.00361	0	96	82				
OBSCN	84033	broad.mit.edu	37	1	228431126	228431126	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:228431126G>T	ENST00000422127.1	+	10	3216	c.3172G>T	c.(3172-3174)Ggc>Tgc	p.G1058C	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.G1058C|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.G1150C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1058	Ig-like 10.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGAGGCCAGGGGCCAGAGGGT	0.557																																							uc009xez.1		NA																	0				stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(3172-3174)GGC>TGC		obscurin, cytoskeletal calmodulin and							36.0	39.0	38.0					1																	228431126		2052	4185	6237	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228431126G>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.3172G>T	1.37:g.228431126G>T	ENSP00000409493:p.Gly1058Cys		Somatic				OBSCN_uc001hsn.2_Missense_Mutation_p.G1058C	p.G1058C	NM_001098623	NP_001092093	WXS	Illumina HiSeq	Unspecified	Q5VST9	OBSCN_HUMAN			10	3216	+		Prostate(94;0.0405)	1058			Ig-like 10.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.3172G>T	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	8.732	0.916938	0.17907	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.04970	3.52;3.52	5.11	4.2	0.49525	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.409820	0.20138	U	0.098458	T	0.27900	0.0687	M	0.86097	2.795	0.43771	D	0.996293	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.991	T	0.04767	-1.0928	10	0.66056	D	0.02	.	13.6196	0.62130	0.0754:0.0:0.9246:0.0	.	1058;1058	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	C	1058	ENSP00000284548:G1058C;ENSP00000409493:G1058C	ENSP00000284548:G1058C	G	+	1	0	OBSCN	226497749	0.489000	0.26004	0.858000	0.33744	0.075000	0.17131	2.600000	0.46240	1.147000	0.42369	0.460000	0.39030	GGC		0.557	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		15	40	1	0	1.56452e-12	0.007413	2.53577e-12	15	40				
GALNT2	2590	broad.mit.edu	37	1	230381813	230381813	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:230381813G>A	ENST00000366672.4	+	8	806	c.734G>A	c.(733-735)aGg>aAg	p.R245K	GALNT2_ENST00000541865.1_Missense_Mutation_p.R155K|GALNT2_ENST00000543760.1_Missense_Mutation_p.R207K	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	245			R -> H (in dbSNP:rs1923950).		cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				TTTTAGGACAGGACTCGGGTT	0.463																																							uc010pwa.1		NA																	0				ovary(2)	2						c.(733-735)AGG>AAG		polypeptide N-acetylgalactosaminyltransferase 2							150.0	142.0	145.0					1																	230381813		2203	4300	6503	SO:0001583	missense	2590				immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr1:230381813G>A	BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.734G>A	1.37:g.230381813G>A	ENSP00000355632:p.Arg245Lys		Somatic				GALNT2_uc010pvy.1_Missense_Mutation_p.R207K|GALNT2_uc010pvz.1_RNA	p.R245K	NM_004481	NP_004472	WXS	Illumina HiSeq	Unspecified	Q10471	GALT2_HUMAN			8	806	+	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)	245			Lumenal (Potential).		A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Missense_Mutation	SNP	ENST00000366672.4	37	c.734G>A	CCDS1582.1	.	.	.	.	.	.	.	.	.	.	G	6.968	0.548513	0.13312	.	.	ENSG00000143641	ENST00000543760;ENST00000366672;ENST00000543291;ENST00000541865	T;T;T	0.58210	0.35;0.35;0.35	5.17	4.14	0.48551	Glycosyl transferase, family 2 (1);	0.040549	0.85682	D	0.000000	T	0.33818	0.0876	L	0.33339	1.005	0.34574	D	0.713782	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.31336	-0.9947	10	0.09084	T	0.74	.	7.0833	0.25244	0.2325:0.0:0.7675:0.0	.	245;207	Q10471;G3V1S6	GALT2_HUMAN;.	K	207;245;126;155	ENSP00000445017:R207K;ENSP00000355632:R245K;ENSP00000444346:R155K	ENSP00000355632:R245K	R	+	2	0	GALNT2	228448436	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	3.093000	0.50217	2.415000	0.81967	0.313000	0.20887	AGG		0.463	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1	NM_004481		11	143	0	0	0	0.001368	0	11	143				
EXOC8	149371	broad.mit.edu	37	1	231472318	231472318	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:231472318C>G	ENST00000360394.2	-	1	1260	c.1174G>C	c.(1174-1176)Gag>Cag	p.E392Q	SPRTN_ENST00000008440.9_5'Flank|EXOC8_ENST00000366645.1_Missense_Mutation_p.E388Q|SPRTN_ENST00000295050.7_5'Flank|SPRTN_ENST00000391858.4_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	392					cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				ACTAGCACCTCAGTGAGCTGT	0.532																																							uc001huq.2		NA																	0				skin(1)	1						c.(1174-1176)GAG>CAG		exocyst complex 84-kDa subunit							63.0	62.0	62.0					1																	231472318		2203	4300	6503	SO:0001583	missense	149371				exocytosis|protein transport	growth cone|nucleus	protein binding	g.chr1:231472318C>G	AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.1174G>C	1.37:g.231472318C>G	ENSP00000353564:p.Glu392Gln		Somatic					p.E392Q	NM_175876	NP_787072	WXS	Illumina HiSeq	Unspecified	Q8IYI6	EXOC8_HUMAN			1	1261	-	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)	392					B3KU33|Q5TE82	Missense_Mutation	SNP	ENST00000360394.2	37	c.1174G>C	CCDS1593.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839024	0.51057	.	.	ENSG00000116903	ENST00000360394;ENST00000366645	T;T	0.78595	-1.19;-1.19	5.66	5.66	0.87406	Cullin repeat-like-containing domain (1);	0.121779	0.64402	D	0.000018	T	0.72471	0.3464	L	0.55743	1.74	0.80722	D	1	P	0.38395	0.629	B	0.32465	0.146	T	0.70160	-0.4948	10	0.17369	T	0.5	-20.4338	19.7362	0.96205	0.0:1.0:0.0:0.0	.	392	Q8IYI6	EXOC8_HUMAN	Q	392;388	ENSP00000353564:E392Q;ENSP00000355605:E388Q	ENSP00000353564:E392Q	E	-	1	0	EXOC8	229538941	1.000000	0.71417	0.963000	0.40424	0.653000	0.38743	6.084000	0.71335	2.661000	0.90470	0.655000	0.94253	GAG		0.532	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_175876		5	85	0	0	0	0.000602	0	5	85				
KIAA1804	84451	broad.mit.edu	37	1	233514969	233514969	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:233514969C>T	ENST00000366624.3	+	9	2478	c.2217C>T	c.(2215-2217)ctC>ctT	p.L739L	MLK4_ENST00000366622.1_Silent_p.L185L	NM_032435.2	NP_115811.2																					GACTGGACCTCAGAGAGCTTC	0.537																																							uc001hvt.3		NA																	0				lung(5)|central_nervous_system(2)|skin(1)	8						c.(2215-2217)CTC>CTT		mixed lineage kinase 4							68.0	74.0	72.0					1																	233514969		2203	4300	6503	SO:0001819	synonymous_variant	84451				activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity	g.chr1:233514969C>T																												ENST00000366624.3:c.2217C>T	1.37:g.233514969C>T			Somatic				KIAA1804_uc001hvu.3_Silent_p.L185L	p.L739L	NM_032435	NP_115811	WXS	Illumina HiSeq	Unspecified	Q5TCX8	M3KL4_HUMAN			9	2478	+		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)	739						Silent	SNP	ENST00000366624.3	37	c.2217C>T	CCDS1598.1																																																																																				0.537	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1			8	89	0	0	0	0.00308	0	8	89				
RBM34	23029	broad.mit.edu	37	1	235324510	235324510	+	Missense_Mutation	SNP	C	C	G	rs189294443	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:235324510C>G	ENST00000408888.3	-	1	262	c.32G>C	c.(31-33)aGa>aCa	p.R11T	RBM34_ENST00000366606.3_Missense_Mutation_p.R6T			P42696	RBM34_HUMAN	RNA binding motif protein 34	11						nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			ACTTCTCTTTCTCTTCCGTTT	0.622																																							uc001hwn.2		NA																	0				central_nervous_system(1)	1						c.(31-33)AGA>ACA		RNA binding motif protein 34 isoform 1							138.0	158.0	151.0					1																	235324510		2094	4197	6291	SO:0001583	missense	23029					nucleolus	nucleotide binding|RNA binding	g.chr1:235324510C>G		CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.32G>C	1.37:g.235324510C>G	ENSP00000386226:p.Arg11Thr		Somatic				RBM34_uc001hwo.2_RNA|ARID4B_uc001hwp.2_RNA|RBM34_uc010pxp.1_Missense_Mutation_p.R11T	p.R11T	NM_015014	NP_055829	WXS	Illumina HiSeq	Unspecified	P42696	RBM34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)		1	62	-	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	11					A8K8J7|Q8N2Z8|Q9H5A1	Missense_Mutation	SNP	ENST00000408888.3	37	c.32G>C	CCDS41477.2	.	.	.	.	.	.	.	.	.	.	C	13.58	2.279141	0.40294	.	.	ENSG00000188739	ENST00000408888;ENST00000366606;ENST00000400947;ENST00000447801;ENST00000429912	T;T;T	0.16324	2.42;2.35;2.4	5.07	-2.96	0.05547	.	0.510971	0.18330	N	0.144533	T	0.11623	0.0283	L	0.34521	1.04	0.23120	N	0.998261	P;B	0.36535	0.557;0.255	B;B	0.35971	0.215;0.071	T	0.13442	-1.0509	10	0.54805	T	0.06	-7.7149	11.6088	0.51047	0.0:0.6422:0.0:0.3578	.	11;11	P42696-2;P42696	.;RBM34_HUMAN	T	11;6;11;9;11	ENSP00000386226:R11T;ENSP00000355565:R6T;ENSP00000400000:R9T	ENSP00000355565:R6T	R	-	2	0	RBM34	233391133	0.002000	0.14202	0.003000	0.11579	0.008000	0.06430	-0.323000	0.07997	-0.506000	0.06558	-0.469000	0.05056	AGA		0.622	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100146.1	NM_015014		34	184	0	0	0	0.006999	0	34	184				
ARID4B	51742	broad.mit.edu	37	1	235416105	235416105	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:235416105C>G	ENST00000264183.3	-	6	791	c.294G>C	c.(292-294)gaG>gaC	p.E98D	ARID4B_ENST00000366603.2_Missense_Mutation_p.E98D|ARID4B_ENST00000349213.3_Missense_Mutation_p.E98D	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	98					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TCAGTGTCTTCTCATCTCCGT	0.358																																							uc001hwq.2		NA																	0				ovary(2)|lung(1)	3						c.(292-294)GAG>GAC		AT rich interactive domain 4B isoform 1							78.0	77.0	77.0					1																	235416105		2203	4300	6503	SO:0001583	missense	51742				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding	g.chr1:235416105C>G	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.294G>C	1.37:g.235416105C>G	ENSP00000264183:p.Glu98Asp		Somatic				ARID4B_uc001hwr.2_Missense_Mutation_p.E98D|ARID4B_uc001hws.3_Missense_Mutation_p.E98D|ARID4B_uc001hwu.1_Missense_Mutation_p.E98D	p.E98D	NM_016374	NP_057458	WXS	Illumina HiSeq	Unspecified	Q4LE39	ARI4B_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)		6	792	-	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	98					A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	ENST00000264183.3	37	c.294G>C	CCDS31061.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.505437	0.85282	.	.	ENSG00000054267	ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183;ENST00000439834;ENST00000418304	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.73	4.83	0.62350	Tudor domain (1);	0.000000	0.85682	D	0.000000	T	0.61426	0.2346	M	0.76002	2.32	0.58432	D	0.999995	D;D;D;D	0.71674	0.99;0.996;0.998;0.994	D;D;D;D	0.77557	0.971;0.987;0.99;0.97	T	0.63084	-0.6716	10	0.49607	T	0.09	-16.3884	10.4607	0.44578	0.0:0.8514:0.0:0.1486	.	98;98;98;98	F8WB31;Q4LE39-3;Q4LE39-2;Q4LE39	.;.;.;ARI4B_HUMAN	D	98	ENSP00000264184:E98D;ENSP00000355562:E98D;ENSP00000264183:E98D;ENSP00000391497:E98D	ENSP00000264183:E98D	E	-	3	2	ARID4B	233482728	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.111000	0.50360	1.444000	0.47605	0.655000	0.94253	GAG		0.358	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374		7	123	0	0	0	0.000978	0	7	123				
RYR2	6262	broad.mit.edu	37	1	237838040	237838040	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:237838040G>T	ENST00000366574.2	+	60	9041	c.8724G>T	c.(8722-8724)aaG>aaT	p.K2908N	RYR2_ENST00000542537.1_Missense_Mutation_p.K2892N|RYR2_ENST00000360064.6_Missense_Mutation_p.K2906N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2908	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGGATTTAAGGACCTGGAAC	0.383																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(8722-8724)AAG>AAT		cardiac muscle ryanodine receptor							77.0	70.0	73.0					1																	237838040		1840	4090	5930	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237838040G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8724G>T	1.37:g.237838040G>T	ENSP00000355533:p.Lys2908Asn		Somatic				RYR2_uc010pxz.1_Translation_Start_Site	p.K2908N	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		60	8844	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2908			Modulator (Potential).|Cytoplasmic (By similarity).|4 X approximate repeats.|4.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.8724G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.856222	0.32791	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;D;T	0.96830	-0.16;-4.14;-0.16	4.76	1.82	0.25136	.	0.171985	0.35179	U	0.003399	D	0.96941	0.9001	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.94957	0.8105	10	0.49607	T	0.09	.	8.0789	0.30733	0.3174:0.0:0.6826:0.0	.	2908	Q92736	RYR2_HUMAN	N	2908;2906;2892	ENSP00000355533:K2908N;ENSP00000353174:K2906N;ENSP00000443798:K2892N	ENSP00000353174:K2906N	K	+	3	2	RYR2	235904663	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.811000	0.38942	0.169000	0.19679	0.460000	0.39030	AAG		0.383	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		17	36	1	0	5.35267e-07	0.007413	8.15205e-07	17	36				
RYR2	6262	broad.mit.edu	37	1	237947744	237947744	+	Silent	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:237947744C>A	ENST00000366574.2	+	90	13049	c.12732C>A	c.(12730-12732)gcC>gcA	p.A4244A	RYR2_ENST00000542537.1_Silent_p.A4228A|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Silent_p.A4250A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4244					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCAGGTCGGCCCTGTTTGCGC	0.502																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(12730-12732)GCC>GCA		cardiac muscle ryanodine receptor							54.0	59.0	58.0					1																	237947744		1973	4146	6119	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237947744C>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12732C>A	1.37:g.237947744C>A			Somatic				RYR2_uc010pya.1_Silent_p.A659A	p.A4244A	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		90	12852	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4244			Helical; Name=M3; (Potential).		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.12732C>A	CCDS55691.1																																																																																				0.502	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		28	16	1	0	4.7796e-09	0.004656	7.51688e-09	28	16				
FMN2	56776	broad.mit.edu	37	1	240370837	240370837	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:240370837C>G	ENST00000319653.9	+	5	2955	c.2725C>G	c.(2725-2727)Cca>Gca	p.P909A		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	909	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AGAAATGCTGCCACCCCCTCC	0.662																																							uc010pyd.1		NA																	0				ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(2725-2727)CCA>GCA		formin 2							49.0	52.0	51.0					1																	240370837		2203	4299	6502	SO:0001583	missense	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240370837C>G	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2725C>G	1.37:g.240370837C>G	ENSP00000318884:p.Pro909Ala		Somatic				FMN2_uc010pye.1_Missense_Mutation_p.P913A	p.P909A	NM_020066	NP_064450	WXS	Illumina HiSeq	Unspecified	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		5	2950	+	Ovarian(103;0.127)	all_cancers(173;0.013)	909			Pro-rich.|FH1.		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	c.2725C>G	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	7.772	0.707628	0.15239	.	.	ENSG00000155816	ENST00000319653	T	0.26373	1.74	4.05	3.13	0.36017	Actin-binding FH2/DRF autoregulatory (1);	0.221828	0.31246	N	0.007990	T	0.18002	0.0432	L	0.43152	1.355	0.80722	D	1	P	0.42456	0.78	B	0.38106	0.265	T	0.01424	-1.1358	9	.	.	.	.	6.9284	0.24428	0.0:0.7473:0.0:0.2527	.	909	Q9NZ56	FMN2_HUMAN	A	909	ENSP00000318884:P909A	.	P	+	1	0	FMN2	238437460	0.007000	0.16637	0.874000	0.34290	0.429000	0.31625	1.218000	0.32467	2.256000	0.74724	0.484000	0.47621	CCA		0.662	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		74	56	0	0	0	0.00361	0	74	56				
OR2M1P	388762	broad.mit.edu	37	1	248285550	248285550	+	IGR	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:248285550C>T								OR2L13 (21326 upstream) : OR2M5 (22899 downstream)																							TTCTGTGTATCACTGCTTGGC	0.463																																							uc001idy.1		NA																	0					0						c.(112-114)TCA>TTA		RecName: Full=Olfactory receptor 2M5;																																				SO:0001628	intergenic_variant	388762							g.chr1:248285550C>T																													1.37:g.248285550C>T			Somatic					p.S38L	NR_002141		WXS	Illumina HiSeq	Unspecified					1	113	+									Missense_Mutation	SNP		37	c.113C>T																																																																																				0	0.463									29	417	0	0	0	0.007291	0	29	417				
OR2T4	127074	broad.mit.edu	37	1	248525221	248525221	+	Missense_Mutation	SNP	G	G	T	rs562694117		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:248525221G>T	ENST00000366475.1	+	1	339	c.339G>T	c.(337-339)atG>atT	p.M113I		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGCCCAAGATGCTCCTGGACC	0.488																																							uc001ieh.1		NA																	0				central_nervous_system(1)	1						c.(337-339)ATG>ATT		olfactory receptor, family 2, subfamily T,							254.0	193.0	214.0					1																	248525221		2203	4300	6503	SO:0001583	missense	127074				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248525221G>T	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.339G>T	1.37:g.248525221G>T	ENSP00000355431:p.Met113Ile		Somatic					p.M113I	NM_001004696	NP_001004696	WXS	Illumina HiSeq	Unspecified	Q8NH00	OR2T4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	339	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		113			Extracellular (Potential).		Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	c.339G>T	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	G	9.503	1.103776	0.20632	.	.	ENSG00000196944	ENST00000366475	T	0.05513	3.43	3.48	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.108384	0.41294	D	0.000908	T	0.08802	0.0218	L	0.60845	1.875	0.26174	N	0.979822	B	0.31077	0.307	B	0.35770	0.21	T	0.12837	-1.0532	10	0.66056	D	0.02	.	7.9987	0.30284	0.0:0.1709:0.6539:0.1752	.	113	Q8NH00	OR2T4_HUMAN	I	113	ENSP00000355431:M113I	ENSP00000355431:M113I	M	+	3	0	OR2T4	246591844	0.499000	0.26083	0.853000	0.33588	0.230000	0.25150	1.249000	0.32839	1.469000	0.48083	0.485000	0.47835	ATG		0.488	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696		120	133	1	0	3.58676e-45	0.00361	6.55511e-45	120	133				
OR2T34	127068	broad.mit.edu	37	1	248737411	248737411	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:248737411G>A	ENST00000328782.2	-	1	669	c.648C>T	c.(646-648)atC>atT	p.I216I		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGATGACCATGATGGGGGTGA	0.572																																							uc001iep.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(646-648)ATC>ATT		olfactory receptor, family 2, subfamily T,							182.0	200.0	194.0					1																	248737411		2154	4300	6454	SO:0001819	synonymous_variant	127068				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248737411G>A	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.648C>T	1.37:g.248737411G>A			Somatic					p.I216I	NM_001001821	NP_001001821	WXS	Illumina HiSeq	Unspecified	Q8NGX1	O2T34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	648	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		216			Helical; Name=5; (Potential).		B2RNJ8|Q6IEY5|Q96R31	Silent	SNP	ENST00000328782.2	37	c.648C>T	CCDS31120.1																																																																																				0.572	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821		154	330	0	0	0	0.00361	0	154	330				
OR2T11	127077	broad.mit.edu	37	1	248789953	248789953	+	Silent	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:248789953G>T	ENST00000330803.2	-	1	538	c.477C>A	c.(475-477)atC>atA	p.I159I		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I159I(1)		breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATTCATGGTGATGGGAGTGA	0.522																																							uc001ier.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(475-477)ATC>ATA		olfactory receptor, family 2, subfamily T,							53.0	60.0	58.0					1																	248789953		2050	4233	6283	SO:0001819	synonymous_variant	127077				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248789953G>T	BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.477C>A	1.37:g.248789953G>T			Somatic					p.I159I	NM_001001964	NP_001001964	WXS	Illumina HiSeq	Unspecified	Q8NH01	O2T11_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	477	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		159			Extracellular (Potential).		Q6IEY6	Silent	SNP	ENST00000330803.2	37	c.477C>A	CCDS31122.1																																																																																				0.522	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097134.1	NM_001001964		83	65	1	0	2.46668e-60	0.00361	4.57111e-60	83	65				
PGBD2	267002	broad.mit.edu	37	1	249211644	249211644	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:249211644G>A	ENST00000329291.5	+	3	1008	c.861G>A	c.(859-861)ggG>ggA	p.G287G	PGBD2_ENST00000539153.1_Silent_p.G284G|PGBD2_ENST00000355360.4_Silent_p.G36G	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	287										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TGCACAGGGGGAAGCCTGTGC	0.547																																							uc001ifh.2		NA																	0				ovary(1)	1						c.(859-861)GGG>GGA		hypothetical protein LOC267002 isoform a							79.0	85.0	83.0					1																	249211644		2203	4300	6503	SO:0001819	synonymous_variant	267002							g.chr1:249211644G>A	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.861G>A	1.37:g.249211644G>A			Somatic				PGBD2_uc001ifg.2_Silent_p.G36G|PGBD2_uc009xhd.2_Silent_p.G284G	p.G287G	NM_170725	NP_733843	WXS	Illumina HiSeq	Unspecified	Q6P3X8	PGBD2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		3	1008	+	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	287					B3KVR8|Q6MZF8	Silent	SNP	ENST00000329291.5	37	c.861G>A	CCDS31128.1																																																																																				0.547	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1			21	184	0	0	0	0.001523	0	21	184				
TUBB8	347688	broad.mit.edu	37	10	93453	93453	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:93453C>T	ENST00000309812.4	-	4	941	c.879G>A	c.(877-879)atG>atA	p.M293I	TUBB8_ENST00000413237.3_5'Flank|TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000447903.2_Missense_Mutation_p.M221I	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	293					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TAGCATCAAACATCTGCTGGG	0.617																																					Pancreas(192;2041 3010 9013 18103)	Pancreas(192;2041 3010 9013 18103)	uc001ifi.2		NA																	0				ovary(1)	1						c.(877-879)ATG>ATA		tubulin, beta 8 isoform 1							49.0	56.0	54.0					10																	93453		2147	4166	6313	SO:0001583	missense	347688				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr10:93453C>T	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.879G>A	10.37:g.93453C>T	ENSP00000311042:p.Met293Ile		Somatic				TUBB8_uc009xhe.2_Missense_Mutation_p.M256I|TUBB8_uc010pzs.1_Missense_Mutation_p.M221I	p.M293I	NM_177987	NP_817124	WXS	Illumina HiSeq	Unspecified	Q3ZCM7	TBB8_HUMAN		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)	4	879	-		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)	293					Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	c.879G>A	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	C	6.872	0.530229	0.13127	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.81247	-1.47	.	.	.	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.64402	U	0.000001	T	0.76521	0.3999	M	0.70842	2.15	0.34276	D	0.681597	B;B	0.16802	0.019;0.007	B;B	0.29663	0.01;0.105	T	0.73366	-0.4005	9	0.72032	D	0.01	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	256;293	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	I	221;259;256;293	ENSP00000403895:M221I	ENSP00000272035:M259I	M	-	3	0	RP11-631M21.2	83453	1.000000	0.71417	0.082000	0.20525	0.083000	0.17756	2.724000	0.47285	0.119000	0.18210	0.121000	0.15741	ATG		0.617	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987		15	214	0	0	0	0.004007	0	15	214				
CELF2	10659	broad.mit.edu	37	10	11047380	11047380	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:11047380G>A	ENST00000379261.4	+	1	122	c.30G>A	c.(28-30)atG>atA	p.M10I	CELF2_ENST00000416382.2_Missense_Mutation_p.M10I	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	10	Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						CTGTTACTATGAGAAATGAAG	0.413																																							uc001iki.3		NA																	0					0						c.(28-30)ATG>ATA		CUG triplet repeat, RNA binding protein 2							399.0	387.0	391.0					10																	11047380		1962	4156	6118	SO:0001583	missense	10659				mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding	g.chr10:11047380G>A	U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.30G>A	10.37:g.11047380G>A	ENSP00000368563:p.Met10Ile		Somatic				CELF2_uc010qbi.1_5'UTR|CELF2_uc010qbj.1_Missense_Mutation_p.M10I	p.M10I	NM_001025077	NP_001020248	WXS	Illumina HiSeq	Unspecified	O95319	CELF2_HUMAN			1	122	+			10			Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.		B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Missense_Mutation	SNP	ENST00000379261.4	37	c.30G>A	CCDS44354.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.645784	0.29246	.	.	ENSG00000048740	ENST00000379261;ENST00000416382	T;T	0.79247	-1.25;-1.25	5.26	5.26	0.73747	.	.	.	.	.	T	0.65760	0.2722	N	0.08118	0	0.80722	D	1	B;B	0.16603	0.018;0.018	B;B	0.28553	0.091;0.091	T	0.60910	-0.7169	9	0.39692	T	0.17	.	19.2148	0.93772	0.0:0.0:1.0:0.0	.	10;10	B4DS31;O95319	.;CELF2_HUMAN	I	10	ENSP00000368563:M10I;ENSP00000406451:M10I	ENSP00000368563:M10I	M	+	3	0	CELF2	11087386	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.502000	0.81614	2.600000	0.87896	0.655000	0.94253	ATG		0.413	CELF2-201	KNOWN	basic|CCDS	protein_coding	protein_coding				28	253	0	0	0	0.002096	0	28	253				
ST8SIA6	338596	broad.mit.edu	37	10	17362963	17362963	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:17362963G>A	ENST00000377602.4	-	8	1185	c.1111C>T	c.(1111-1113)Cag>Tag	p.Q371*		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	371					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						TTGGGCATCTGATGGAAACCA	0.403																																							uc001ipd.2		NA																	0				ovary(1)	1						c.(1111-1113)CAG>TAG		ST8 alpha-N-acetyl-neuraminide							258.0	242.0	247.0					10																	17362963		2203	4300	6503	SO:0001587	stop_gained	338596				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity	g.chr10:17362963G>A		CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.1111C>T	10.37:g.17362963G>A	ENSP00000366827:p.Gln371*		Somatic				ST8SIA6_uc010qce.1_RNA	p.Q371*	NM_001004470	NP_001004470	WXS	Illumina HiSeq	Unspecified	P61647	SIA8F_HUMAN			8	1111	-			371			Lumenal (Potential).		B0YJ97|B9EH72|Q5VZH4	Nonsense_Mutation	SNP	ENST00000377602.4	37	c.1111C>T	CCDS31158.1	.	.	.	.	.	.	.	.	.	.	G	36	5.807015	0.96967	.	.	ENSG00000148488	ENST00000377602	.	.	.	5.5	3.64	0.41730	.	0.273018	0.41605	D	0.000844	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-3.5386	9.4845	0.38922	0.0:0.6798:0.2304:0.0898	.	.	.	.	X	371	.	ENSP00000366827:Q371X	Q	-	1	0	ST8SIA6	17402969	1.000000	0.71417	0.989000	0.46669	0.949000	0.60115	2.690000	0.47001	0.866000	0.35629	0.650000	0.86243	CAG		0.403	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470		107	104	0	0	0	0.00361	0	107	104				
ZNF25	219749	broad.mit.edu	37	10	38246370	38246370	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:38246370G>T	ENST00000302609.7	-	3	332	c.120C>A	c.(118-120)aaC>aaA	p.N40K	ZNF25_ENST00000374633.1_5'UTR|AL117337.1_ENST00000582458.1_RNA	NM_145011.2	NP_659448.1	P17030	ZNF25_HUMAN	zinc finger protein 25	40	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				GGTGACTATAGTTTTCCAGCA	0.428																																							uc001ize.1		NA																	0				breast(2)|ovary(1)|central_nervous_system(1)	4						c.(118-120)AAC>AAA		zinc finger protein 25							150.0	135.0	140.0					10																	38246370		2203	4300	6503	SO:0001583	missense	219749				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:38246370G>T	AK056452	CCDS7195.1	10p11.2	2013-01-08	2006-05-10		ENSG00000175395	ENSG00000175395		"""Zinc fingers, C2H2-type"", ""-"""	13043	protein-coding gene	gene with protein product		194528	"""zinc finger protein 25 (KOX 19)"""			1639412, 8464732	Standard	NM_145011		Approved	KOX19, FLJ31890, Zfp9	uc001ize.1	P17030	OTTHUMG00000019344	ENST00000302609.7:c.120C>A	10.37:g.38246370G>T	ENSP00000302222:p.Asn40Lys		Somatic				ZNF25_uc001izf.1_Missense_Mutation_p.N4K	p.N40K	NM_145011	NP_659448	WXS	Illumina HiSeq	Unspecified	P17030	ZNF25_HUMAN			3	225	-		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)	40			KRAB.		A9Z1X5|Q8IYE3|Q8NDD6|Q96MU2	Missense_Mutation	SNP	ENST00000302609.7	37	c.120C>A	CCDS7195.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.675161	0.47781	.	.	ENSG00000175395	ENST00000302609;ENST00000374633	T	0.03607	3.87	4.36	3.46	0.39613	Krueppel-associated box (4);	0.180740	0.26959	N	0.021632	T	0.21718	0.0523	H	0.95004	3.61	0.26398	N	0.97647	D	0.71674	0.998	D	0.71184	0.972	T	0.10451	-1.0629	10	0.72032	D	0.01	-31.1773	8.1355	0.31052	0.1106:0.0:0.8894:0.0	.	40	P17030	ZNF25_HUMAN	K	40;4	ENSP00000302222:N40K	ENSP00000302222:N40K	N	-	3	2	ZNF25	38286376	0.997000	0.39634	0.981000	0.43875	0.890000	0.51754	0.311000	0.19380	1.189000	0.43028	0.561000	0.74099	AAC		0.428	ZNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051214.1	NM_145011, NM_006966		64	47	1	0	4.73848e-44	0.00361	8.63022e-44	64	47				
PCDH15	65217	broad.mit.edu	37	10	55569015	55569015	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:55569015C>T	ENST00000395445.1	-	36	5189	c.4795G>A	c.(4795-4797)Gag>Aag	p.E1599K	PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395440.1_Missense_Mutation_p.E533K|PCDH15_ENST00000395442.1_Missense_Mutation_p.E464K|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395446.1_Missense_Mutation_p.E795K|PCDH15_ENST00000409834.1_3'UTR	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GATTCCTCCTCTGATTCTACA	0.458										HNSCC(58;0.16)																													uc010qhs.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(4810-4812)GAG>AAG		protocadherin 15 isoform CD2-1 precursor							114.0	99.0	104.0					10																	55569015		1568	3582	5150	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55569015C>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.4795G>A	10.37:g.55569015C>T	ENSP00000378832:p.Glu1599Lys	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qht.1_Missense_Mutation_p.E1597K|PCDH15_uc010qhu.1_3'UTR	p.E1604K	NM_001142769	NP_001136241	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			37	5205	-		Melanoma(3;0.117)|Lung SC(717;0.238)	Error:Variant_position_missing_in_Q96QU1_after_alignment					A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000395445.1	37	c.4810G>A		.	.	.	.	.	.	.	.	.	.	C	15.87	2.959751	0.53400	.	.	ENSG00000150275	ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440	T;T;T;T	0.66815	-0.23;1.0;-0.23;-0.23	5.68	5.68	0.88126	.	.	.	.	.	T	0.54415	0.1857	N	0.14661	0.345	0.80722	D	1	P;P	0.43094	0.799;0.799	B;B	0.40066	0.318;0.318	T	0.59537	-0.7436	9	0.48119	T	0.1	.	19.3824	0.94542	0.0:1.0:0.0:0.0	.	1597;1599	C6ZEF5;A2A3E2	.;.	K	1599;795;464;533	ENSP00000378832:E1599K;ENSP00000378833:E795K;ENSP00000378829:E464K;ENSP00000378827:E533K	ENSP00000378827:E533K	E	-	1	0	PCDH15	55239021	1.000000	0.71417	0.955000	0.39395	0.056000	0.15407	7.487000	0.81328	2.673000	0.90976	0.655000	0.94253	GAG		0.458	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291335.1	NM_033056		46	25	0	0	0	0.00361	0	46	25				
PCDH15	65217	broad.mit.edu	37	10	55721652	55721652	+	Splice_Site	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:55721652C>A	ENST00000320301.6	-	22	3263	c.2869G>T	c.(2869-2871)Gga>Tga	p.G957*	PCDH15_ENST00000361849.3_Splice_Site_p.G957*|PCDH15_ENST00000395438.1_Splice_Site_p.G957*|PCDH15_ENST00000395433.1_Splice_Site_p.G935*|PCDH15_ENST00000414778.1_Splice_Site_p.G962*|PCDH15_ENST00000395445.1_Splice_Site_p.G964*|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395432.2_Splice_Site_p.G920*|PCDH15_ENST00000395430.1_Splice_Site_p.G957*|PCDH15_ENST00000373965.2_Splice_Site_p.G964*|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000409834.1_Splice_Site_p.G568*|PCDH15_ENST00000437009.1_Splice_Site_p.G886*	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	957	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.G957*(4)|p.G962*(4)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GCAGGTAATCCCtaaaataaa	0.313										HNSCC(58;0.16)																													uc001jju.1		NA																	8	Substitution - Nonsense(8)		lung(8)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(2869-2871)GGA>TGA		protocadherin 15 isoform CD1-4 precursor							53.0	54.0	53.0					10																	55721652		2203	4300	6503	SO:0001630	splice_region_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55721652C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2869-1G>T	10.37:g.55721652C>A		HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Nonsense_Mutation_p.G962*|PCDH15_uc010qhr.1_Nonsense_Mutation_p.G957*|PCDH15_uc010qhs.1_Nonsense_Mutation_p.G969*|PCDH15_uc010qht.1_Nonsense_Mutation_p.G964*|PCDH15_uc010qhu.1_Nonsense_Mutation_p.G957*|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Nonsense_Mutation_p.G957*|PCDH15_uc010qhw.1_Nonsense_Mutation_p.G920*|PCDH15_uc010qhx.1_Nonsense_Mutation_p.G886*|PCDH15_uc010qhy.1_Nonsense_Mutation_p.G962*|PCDH15_uc010qhz.1_Nonsense_Mutation_p.G957*|PCDH15_uc010qia.1_Nonsense_Mutation_p.G935*|PCDH15_uc010qib.1_Nonsense_Mutation_p.G935*	p.G957*	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			22	3264	-		Melanoma(3;0.117)|Lung SC(717;0.238)	957			Extracellular (Potential).|Cadherin 9.		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Nonsense_Mutation	SNP	ENST00000320301.6	37	c.2869G>T	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	43	10.334583	0.99385	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.0071	0.86396	0.0:1.0:0.0:0.0	.	.	.	.	X	964;962;957;957;568;964;920;957;935;957;957;962;886	.	ENSP00000322604:G957X	G	-	1	0	PCDH15	55391658	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	6.467000	0.73547	2.318000	0.78349	0.411000	0.27672	GGA		0.313	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	Nonsense_Mutation	21	22	1	0	7.45023e-12	0.001523	1.19655e-11	21	22				
PCDH15	65217	broad.mit.edu	37	10	55955638	55955638	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:55955638G>T	ENST00000320301.6	-	11	1504	c.1110C>A	c.(1108-1110)gaC>gaA	p.D370E	PCDH15_ENST00000361849.3_Missense_Mutation_p.D370E|PCDH15_ENST00000395438.1_Missense_Mutation_p.D370E|PCDH15_ENST00000395433.1_Missense_Mutation_p.D348E|PCDH15_ENST00000414778.1_Missense_Mutation_p.D375E|PCDH15_ENST00000395445.1_Missense_Mutation_p.D370E|PCDH15_ENST00000395440.1_Missense_Mutation_p.D370E|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373957.3_Missense_Mutation_p.D348E|PCDH15_ENST00000395432.2_Missense_Mutation_p.D333E|PCDH15_ENST00000395430.1_Missense_Mutation_p.D370E|PCDH15_ENST00000373955.1_Missense_Mutation_p.D370E|PCDH15_ENST00000373965.2_Missense_Mutation_p.D370E|PCDH15_ENST00000395446.1_Missense_Mutation_p.D370E|PCDH15_ENST00000409834.1_5'UTR|PCDH15_ENST00000437009.1_Missense_Mutation_p.D370E	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	370	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GATGACCATTGTCTTGTTCAG	0.343										HNSCC(58;0.16)																													uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(1108-1110)GAC>GAA		protocadherin 15 isoform CD1-4 precursor							98.0	96.0	96.0					10																	55955638		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55955638G>T	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1110C>A	10.37:g.55955638G>T	ENSP00000322604:p.Asp370Glu	HNSCC(58;0.16)	Somatic				PCDH15_uc010qhq.1_Missense_Mutation_p.D375E|PCDH15_uc010qhr.1_Missense_Mutation_p.D370E|PCDH15_uc010qhs.1_Missense_Mutation_p.D375E|PCDH15_uc010qht.1_Missense_Mutation_p.D370E|PCDH15_uc010qhu.1_Missense_Mutation_p.D370E|PCDH15_uc001jjv.1_Missense_Mutation_p.D348E|PCDH15_uc010qhv.1_Missense_Mutation_p.D370E|PCDH15_uc010qhw.1_Missense_Mutation_p.D333E|PCDH15_uc010qhx.1_Missense_Mutation_p.D370E|PCDH15_uc010qhy.1_Missense_Mutation_p.D375E|PCDH15_uc010qhz.1_Missense_Mutation_p.D370E|PCDH15_uc010qia.1_Missense_Mutation_p.D348E|PCDH15_uc010qib.1_Missense_Mutation_p.D348E|PCDH15_uc001jjw.2_Missense_Mutation_p.D370E	p.D370E	NM_033056	NP_149045	WXS	Illumina HiSeq	Unspecified	Q96QU1	PCD15_HUMAN			11	1505	-		Melanoma(3;0.117)|Lung SC(717;0.238)	370			Cadherin 3.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.1110C>A	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176678	0.57692	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2;2.47;1.2;1.2;1.2;1.2;1.2;1.2;1.2	5.17	1.86	0.25419	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.53948	0.1828	M	0.76328	2.33	0.29338	N	0.8662	D;P;P;P;D;P;D;D;D;P;D;D;D;D;P	0.89917	0.996;0.942;0.855;0.768;0.999;0.942;0.996;0.999;0.999;0.719;0.999;0.999;1.0;1.0;0.942	D;P;P;P;D;P;D;D;D;P;D;D;D;D;P	0.91635	0.992;0.684;0.573;0.517;0.997;0.684;0.992;0.986;0.97;0.573;0.986;0.978;0.999;0.997;0.816	T	0.47837	-0.9086	9	0.24483	T	0.36	.	8.9144	0.35572	0.3776:0.0:0.6223:0.0	.	348;370;370;375;370;333;370;370;370;370;370;375;370;348;370	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	E	370;375;370;370;370;370;370;333;370;348;348;370;370;375;370;370	ENSP00000363076:D370E;ENSP00000410304:D375E;ENSP00000378826:D370E;ENSP00000378832:D370E;ENSP00000378833:D370E;ENSP00000378827:D370E;ENSP00000378820:D333E;ENSP00000354950:D370E;ENSP00000378821:D348E;ENSP00000363068:D348E;ENSP00000322604:D370E;ENSP00000378818:D370E;ENSP00000412628:D370E;ENSP00000363066:D370E	ENSP00000322604:D370E	D	-	3	2	PCDH15	55625644	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.652000	0.37313	0.582000	0.29556	0.591000	0.81541	GAC		0.343	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		30	13	1	0	6.04164e-23	0.002096	1.04643e-22	30	13				
CCAR1	55749	broad.mit.edu	37	10	70548067	70548067	+	Silent	SNP	T	T	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:70548067T>C	ENST00000265872.6	+	23	3288	c.3169T>C	c.(3169-3171)Tta>Cta	p.L1057L	CCAR1_ENST00000535016.1_Silent_p.L1042L|CCAR1_ENST00000543719.1_Silent_p.L1042L	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	1057					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						GAAGCTGCAGTTACTAGAAGA	0.388																																							uc001joo.2		NA																	0				ovary(6)|large_intestine(1)	7						c.(3169-3171)TTA>CTA		cell-cycle and apoptosis regulatory protein 1							89.0	91.0	91.0					10																	70548067		2203	4300	6503	SO:0001819	synonymous_variant	55749				apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding	g.chr10:70548067T>C	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.3169T>C	10.37:g.70548067T>C			Somatic				CCAR1_uc010qiz.1_Silent_p.L1042L|CCAR1_uc010qjb.1_RNA	p.L1057L	NM_018237	NP_060707	WXS	Illumina HiSeq	Unspecified	Q8IX12	CCAR1_HUMAN			23	3288	+			1057			Potential.		A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Silent	SNP	ENST00000265872.6	37	c.3169T>C	CCDS7282.1																																																																																				0.388	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237		3	58	0	0	0	0.000248	0	3	58				
NOC3L	64318	broad.mit.edu	37	10	96121522	96121522	+	Silent	SNP	G	G	A	rs150977777		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:96121522G>A	ENST00000371361.3	-	2	217	c.117C>T	c.(115-117)ctC>ctT	p.L39L	NOC3L_ENST00000463649.1_5'UTR|NOC3L_ENST00000371350.1_Silent_p.L39L	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	39					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				GGTACTTCTTGAGAGTGCTTT	0.368																																							uc001kjq.1		NA																	0				ovary(1)	1						c.(115-117)CTC>CTT		nucleolar complex associated 3 homolog		G		1,4405	2.1+/-5.4	0,1,2202	261.0	229.0	240.0		117	3.2	1.0	10	dbSNP_134	240	0,8600		0,0,4300	no	coding-synonymous	NOC3L	NM_022451.9		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		39/801	96121522	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64318					nuclear speck|nucleolus	binding	g.chr10:96121522G>A	AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.117C>T	10.37:g.96121522G>A			Somatic				NOC3L_uc009xuk.1_5'UTR	p.L39L	NM_022451	NP_071896	WXS	Illumina HiSeq	Unspecified	Q8WTT2	NOC3L_HUMAN			2	205	-		Colorectal(252;0.0897)	39					Q9H5M6|Q9H9D8	Silent	SNP	ENST00000371361.3	37	c.117C>T	CCDS7433.1																																																																																				0.368	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451		12	145	0	0	0	0.000978	0	12	145				
PDZD7	79955	broad.mit.edu	37	10	102789858	102789858	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:102789858G>T	ENST00000370215.3	-	2	344	c.119C>A	c.(118-120)aCg>aAg	p.T40K	PDZD7_ENST00000470414.1_Missense_Mutation_p.T40K|SFXN3_ENST00000393459.1_5'Flank|SFXN3_ENST00000224807.5_5'Flank	NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	40						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CAGGTATCGCGTTGCGGTGGA	0.657																																							uc001kso.1		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(118-120)ACG>AAG		PDZ domain containing 7							57.0	61.0	59.0					10																	102789858		2203	4300	6503	SO:0001583	missense	79955					cilium|nucleus	protein binding	g.chr10:102789858G>T	AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.119C>A	10.37:g.102789858G>T	ENSP00000359234:p.Thr40Lys		Somatic				PDZD7_uc001ksn.2_Missense_Mutation_p.T40K|SFXN3_uc001ksp.2_5'Flank|SFXN3_uc001ksq.2_5'Flank|SFXN3_uc010qpx.1_5'Flank	p.T40K	NM_024895	NP_079171	WXS	Illumina HiSeq	Unspecified	Q9H5P4	PDZD7_HUMAN		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)	2	334	-			40					D5FJ77|Q8N321	Missense_Mutation	SNP	ENST00000370215.3	37	c.119C>A	CCDS31269.1	.	.	.	.	.	.	.	.	.	.	G	19.88	3.909263	0.72868	.	.	ENSG00000186862	ENST00000393462;ENST00000370215	T	0.12465	2.68	5.17	5.17	0.71159	.	0.896678	0.09422	N	0.804208	T	0.18676	0.0448	N	0.24115	0.695	0.34651	D	0.721601	P;D	0.53312	0.945;0.959	P;P	0.51550	0.472;0.673	T	0.14282	-1.0478	10	0.59425	D	0.04	.	14.0665	0.64834	0.0:0.0:0.8485:0.1515	.	40;40	Q9H5P4;Q9H5P4-2	PDZD7_HUMAN;.	K	40	ENSP00000359234:T40K	ENSP00000359234:T40K	T	-	2	0	PDZD7	102779848	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	3.825000	0.55730	2.388000	0.81334	0.448000	0.29417	ACG		0.657	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895		18	88	1	0	1.56452e-12	0.007413	2.53577e-12	18	88				
PLEKHS1	79949	broad.mit.edu	37	10	115535537	115535537	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:115535537G>C	ENST00000369310.3	+	10	1505	c.943G>C	c.(943-945)Gaa>Caa	p.E315Q	PLEKHS1_ENST00000369312.4_Missense_Mutation_p.E233Q|PLEKHS1_ENST00000361048.1_Missense_Mutation_p.E335Q|PLEKHS1_ENST00000369309.1_Missense_Mutation_p.E149Q|PLEKHS1_ENST00000354462.3_Missense_Mutation_p.E65Q	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	329																	TATCCCCGATGAAAGCCAAGT	0.433																																							uc001lat.1		NA																	0				central_nervous_system(1)	1						c.(943-945)GAA>CAA		hypothetical protein LOC79949							140.0	126.0	131.0					10																	115535537		2203	4300	6503	SO:0001583	missense	79949							g.chr10:115535537G>C	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.943G>C	10.37:g.115535537G>C	ENSP00000358316:p.Glu315Gln		Somatic				C10orf81_uc001lar.1_Missense_Mutation_p.E335Q|C10orf81_uc009xyc.1_Missense_Mutation_p.E233Q|C10orf81_uc001las.1_Missense_Mutation_p.E233Q|C10orf81_uc001lau.1_Missense_Mutation_p.E149Q	p.E315Q	NM_024889	NP_079165	WXS	Illumina HiSeq	Unspecified	Q5SXH7	CJ081_HUMAN		Epithelial(162;0.0181)|all cancers(201;0.0204)	10	1505	+		Colorectal(252;0.175)	329					A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Missense_Mutation	SNP	ENST00000369310.3	37	c.943G>C	CCDS53580.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.55|19.55	3.847957|3.847957	0.71603|0.71603	.|.	.|.	ENSG00000148735|ENSG00000148735	ENST00000361048;ENST00000369312;ENST00000369310;ENST00000369309;ENST00000354462|ENST00000448805	T;T;T;T;T|.	0.31769|.	1.48;1.48;1.48;1.48;1.48|.	6.04|6.04	6.04|6.04	0.98038|0.98038	.|.	0.225617|.	0.45126|.	D|.	0.000393|.	T|.	0.68559|.	0.3014|.	M|M	0.64997|0.64997	1.995|1.995	0.36488|0.36488	D|D	0.86824|0.86824	D;D;D;D|.	0.89917|.	0.997;1.0;0.998;1.0|.	D;D;D;D|.	0.74023|.	0.931;0.975;0.943;0.982|.	T|.	0.71251|.	-0.4648|.	10|.	0.66056|.	D|.	0.02|.	-20.1168|-20.1168	16.0793|16.0793	0.80989|0.80989	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	329;315;315;335|.	Q5SXH7;Q5SXH7-5;Q5SXH7-2;Q5SXH7-4|.	CJ081_HUMAN;.;.;.|.	Q|S	335;233;315;149;65|45	ENSP00000354332:E335Q;ENSP00000358318:E233Q;ENSP00000358316:E315Q;ENSP00000358315:E149Q;ENSP00000346451:E65Q|.	ENSP00000346451:E65Q|.	E|X	+|+	1|2	0|2	C10orf81|C10orf81	115525527|115525527	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.720000|0.720000	0.41350|0.41350	2.036000|2.036000	0.41165|0.41165	2.873000|2.873000	0.98535|0.98535	0.561000|0.561000	0.74099|0.74099	GAA|TGA		0.433	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889		27	98	0	0	0	0.004656	0	27	98				
PDZD8	118987	broad.mit.edu	37	10	119044119	119044119	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:119044119T>C	ENST00000334464.5	-	5	2364	c.2125A>G	c.(2125-2127)Agg>Ggg	p.R709G	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	709					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TTTAAGTACCTGTGACAGGCT	0.413																																							uc001lde.1		NA																	0					0						c.(2125-2127)AGG>GGG		PDZ domain containing 8							114.0	107.0	109.0					10																	119044119		2203	4300	6503	SO:0001583	missense	118987				intracellular signal transduction		metal ion binding	g.chr10:119044119T>C	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2125A>G	10.37:g.119044119T>C	ENSP00000334642:p.Arg709Gly		Somatic					p.R709G	NM_173791	NP_776152	WXS	Illumina HiSeq	Unspecified	Q8NEN9	PDZD8_HUMAN		all cancers(201;0.0121)	5	2324	-		Colorectal(252;0.19)	709					Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	c.2125A>G	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	T	11.98	1.799251	0.31869	.	.	ENSG00000165650	ENST00000334464	D	0.87029	-2.2	5.83	0.439	0.16567	.	0.151829	0.56097	D	0.000022	T	0.79251	0.4414	L	0.27053	0.805	0.31820	N	0.62614	P	0.43094	0.799	B	0.38562	0.276	T	0.79237	-0.1886	10	0.87932	D	0	-10.8188	15.9257	0.79615	0.0:0.0:0.6041:0.3959	.	709	Q8NEN9	PDZD8_HUMAN	G	709	ENSP00000334642:R709G	ENSP00000334642:R709G	R	-	1	2	PDZD8	119034109	0.999000	0.42202	0.666000	0.29783	0.935000	0.57460	1.711000	0.37930	-0.158000	0.11040	0.459000	0.35465	AGG		0.413	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791		60	60	0	0	0	0.00361	0	60	60				
DMBT1	1755	broad.mit.edu	37	10	124336136	124336136	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:124336136G>T	ENST00000338354.3	+	7	611	c.505G>T	c.(505-507)Gtg>Ttg	p.V169L	DMBT1_ENST00000359586.6_Missense_Mutation_p.V169L|DMBT1_ENST00000368909.3_Missense_Mutation_p.V169L|DMBT1_ENST00000330163.4_Missense_Mutation_p.V169L|DMBT1_ENST00000368956.2_Missense_Mutation_p.V169L|DMBT1_ENST00000344338.3_Missense_Mutation_p.V169L|DMBT1_ENST00000368955.3_Missense_Mutation_p.V169L			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	169	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CCTGGATGATGTGCGCTGCTC	0.587																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	0				central_nervous_system(7)	7						c.(505-507)GTG>TTG		deleted in malignant brain tumors 1 isoform b							151.0	147.0	148.0					10																	124336136		2068	4246	6314	SO:0001583	missense	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124336136G>T		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.505G>T	10.37:g.124336136G>T	ENSP00000342210:p.Val169Leu		Somatic				DMBT1_uc001lgl.1_Missense_Mutation_p.V169L|DMBT1_uc001lgm.1_Missense_Mutation_p.V169L|DMBT1_uc009xzz.1_Missense_Mutation_p.V169L|DMBT1_uc010qtx.1_Missense_Mutation_p.V169L|DMBT1_uc009yaa.1_Missense_Mutation_p.V21L	p.V169L	NM_007329	NP_015568	WXS	Illumina HiSeq	Unspecified	Q9UGM3	DMBT1_HUMAN			7	611	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	169			SRCR 1.		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37	c.505G>T		.	.	.	.	.	.	.	.	.	.	g	11.34	1.609275	0.28623	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12;0.12	4.63	0.548	0.17208	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.640783	0.11649	N	0.542959	T	0.66839	0.2830	M	0.62154	1.92	0.25676	N	0.985848	P;B;D;P;D;D	0.63880	0.879;0.134;0.992;0.537;0.98;0.993	B;B;P;B;D;P	0.66847	0.333;0.077;0.872;0.074;0.947;0.899	T	0.55082	-0.8196	10	0.33940	T	0.23	.	7.6675	0.28439	0.1418:0.2511:0.6071:0.0	.	169;169;169;169;169;169	F8WEF7;Q9UGM3-4;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;DMBT1_HUMAN	L	169	ENSP00000342210:V169L;ENSP00000343175:V169L;ENSP00000327747:V169L;ENSP00000357905:V169L;ENSP00000357951:V169L;ENSP00000357952:V169L;ENSP00000352593:V169L	ENSP00000331522:V169L	V	+	1	0	DMBT1	124326126	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	3.788000	0.55446	-0.092000	0.12417	-0.892000	0.02923	GTG		0.587	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		135	90	1	0	9.89263e-63	0.00361	1.84616e-62	135	90				
EDRF1	26098	broad.mit.edu	37	10	127414386	127414386	+	Silent	SNP	A	A	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:127414386A>G	ENST00000356792.4	+	6	1003	c.771A>G	c.(769-771)gaA>gaG	p.E257E	C10orf137_ENST00000337623.3_Silent_p.E257E	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		257					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CAGTTTCTGAAGATCCCAGTG	0.413																																							uc001liq.1		NA																	0				ovary(5)|large_intestine(3)|lung(2)	10						c.(769-771)GAA>GAG		erythroid differentiation-related factor 1							77.0	74.0	75.0					10																	127414386		2203	4300	6503	SO:0001819	synonymous_variant	26098				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding	g.chr10:127414386A>G																												ENST00000356792.4:c.771A>G	10.37:g.127414386A>G			Somatic				C10orf137_uc001lin.2_Silent_p.E257E|C10orf137_uc001lio.1_Silent_p.E257E|C10orf137_uc001lip.1_5'UTR	p.E257E	NM_015608	NP_056423	WXS	Illumina HiSeq	Unspecified	Q3B7T1	EDRF1_HUMAN			6	1064	+		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)	257					B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Silent	SNP	ENST00000356792.4	37	c.771A>G	CCDS55733.1																																																																																				0.413	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1			33	41	0	0	0	0.003755	0	33	41				
CFAP46	54777	broad.mit.edu	37	10	134627716	134627716	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:134627716C>T	ENST00000368586.5	-	54	7428	c.7328G>A	c.(7327-7329)aGa>aAa	p.R2443K	TTC40_ENST00000263170.5_Missense_Mutation_p.R604K	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GTCTTGGAATCTTTCCAAAAT	0.537																																							uc010qux.1		NA																	0					NA						c.(6505-6507)AGA>AAA		Homo sapiens cDNA, FLJ17989.							99.0	84.0	89.0					10																	134627716		2203	4300	6503	SO:0001583	missense	0							g.chr10:134627716C>T																												ENST00000368586.5:c.7328G>A	10.37:g.134627716C>T	ENSP00000357575:p.Arg2443Lys		Somatic					p.R2169K	NM_017609	NP_060079	WXS	Illumina HiSeq	Unspecified					46	6506	-									Missense_Mutation	SNP	ENST00000368586.5	37	c.6506G>A	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	C	1.494	-0.553741	0.03996	.	.	ENSG00000171811	ENST00000435957;ENST00000368586;ENST00000263170	T;T	0.32753	1.44;1.44	4.28	-0.21	0.13176	.	0.367853	0.22843	N	0.054948	T	0.14313	0.0346	L	0.32530	0.975	0.09310	N	0.999998	B	0.17038	0.02	B	0.13407	0.009	T	0.32455	-0.9906	10	0.02654	T	1	.	4.212	0.10515	0.1589:0.3877:0.0:0.4534	.	604	Q8IYW2	CJ092_HUMAN	K	26;2443;604	ENSP00000357575:R2443K;ENSP00000263170:R604K	ENSP00000263170:R604K	R	-	2	0	C10orf93	134477706	0.003000	0.15002	0.023000	0.16930	0.063000	0.16089	-0.112000	0.10791	0.002000	0.14630	0.655000	0.94253	AGA		0.537	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3			4	52	0	0	0	0.001168	0	4	52				
MUC5B	727897	broad.mit.edu	37	11	1262528	1262528	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:1262528G>A	ENST00000529681.1	+	31	4476	c.4418G>A	c.(4417-4419)aGc>aAc	p.S1473N	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.S1476N	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1473	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGACCCCGAGCATCCGGTCG	0.692																																							uc009ycr.1		NA																	0					0						c.(6496-6498)AGC>AAC		SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;							38.0	50.0	46.0					11																	1262528		2022	4143	6165	SO:0001583	missense	727897				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding	g.chr11:1262528G>A	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.4418G>A	11.37:g.1262528G>A	ENSP00000436812:p.Ser1473Asn		Somatic				MUC5B_uc001ltb.2_Missense_Mutation_p.S1476N	p.S2166N	NM_017511	NP_059981	WXS	Illumina HiSeq	Unspecified	Q9HC84	MUC5B_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	47	6623	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	1473			7 X Cys-rich subdomain repeats.|Thr-rich.		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	c.6497G>A	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	g	10.04	1.242751	0.22796	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.19250	2.16;2.35	2.98	-4.95	0.03048	.	.	.	.	.	T	0.10594	0.0259	L	0.27053	0.805	0.09310	N	1	P;P	0.49185	0.92;0.92	B;B	0.40901	0.26;0.343	T	0.13791	-1.0496	9	0.87932	D	0	.	1.9779	0.03420	0.2956:0.3805:0.2062:0.1178	.	2166;1476	A7Y9J9;E9PBJ0	.;.	N	1473;1476;1474;1543	ENSP00000436812:S1473N;ENSP00000415793:S1476N	ENSP00000343037:S1474N	S	+	2	0	MUC5B	1219104	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.421000	0.07053	-0.729000	0.04875	0.306000	0.20318	AGC		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093		4	6	0	0	0	0.000248	0	4	6				
KCNQ1	3784	broad.mit.edu	37	11	2592631	2592631	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:2592631C>T	ENST00000155840.5	+	4	789	c.681C>T	c.(679-681)atC>atT	p.I227I	KCNQ1_ENST00000335475.5_Silent_p.I100I	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	227					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	CGTCGGCCATCAGGTGCGTCT	0.677																																							uc001lwn.2		NA																	0				ovary(1)	1						c.(679-681)ATC>ATT		potassium voltage-gated channel, KQT-like	Bepridil(DB01244)|Indapamide(DB00808)						110.0	88.0	95.0					11																	2592631		2201	4299	6500	SO:0001819	synonymous_variant	3784				blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding	g.chr11:2592631C>T	AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.681C>T	11.37:g.2592631C>T			Somatic				KCNQ1_uc009ydp.1_Intron|KCNQ1_uc001lwo.2_Silent_p.I100I	p.I227I	NM_000218	NP_000209	WXS	Illumina HiSeq	Unspecified	P51787	KCNQ1_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	4	789	+		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)	227			Helical; Voltage-sensor; Name=Segment S4; (Potential).		O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Silent	SNP	ENST00000155840.5	37	c.681C>T	CCDS7736.1																																																																																				0.677	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218		7	29	0	0	0	0.001984	0	7	29				
USH1C	10083	broad.mit.edu	37	11	17553076	17553076	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:17553076C>G	ENST00000318024.4	-	3	226	c.118G>C	c.(118-120)Gcc>Ccc	p.A40P	USH1C_ENST00000005226.7_Missense_Mutation_p.A40P|USH1C_ENST00000527720.1_Missense_Mutation_p.A9P|USH1C_ENST00000527020.1_Missense_Mutation_p.A40P	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	40	N-terminal domain.				auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						ACGAGCACGGCCACGTCCATG	0.602																																							uc001mnf.2		NA																	0				ovary(1)	1						c.(118-120)GCC>CCC		harmonin isoform a							48.0	43.0	45.0					11																	17553076		2200	4293	6493	SO:0001583	missense	10083				equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding	g.chr11:17553076C>G	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.118G>C	11.37:g.17553076C>G	ENSP00000317018:p.Ala40Pro		Somatic				USH1C_uc001mne.2_Missense_Mutation_p.A40P|USH1C_uc009yhb.2_Missense_Mutation_p.A40P|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_Missense_Mutation_p.A4P	p.A40P	NM_005709	NP_005700	WXS	Illumina HiSeq	Unspecified	Q9Y6N9	USH1C_HUMAN			3	227	-			40					A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	ENST00000318024.4	37	c.118G>C	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	C	9.283	1.048604	0.19827	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226;ENST00000526181	T;T;T;T;T	0.25414	1.84;1.8;2.11;1.97;2.21	5.69	1.49	0.22878	.	0.390634	0.31188	N	0.008084	T	0.07593	0.0191	N	0.02539	-0.55	0.30461	N	0.774294	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.08764	-1.0706	10	0.35671	T	0.21	.	1.8812	0.03228	0.1542:0.4522:0.2327:0.1608	.	40;40;40	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	P	40;9;40;40;51	ENSP00000317018:A40P;ENSP00000432944:A9P;ENSP00000436934:A40P;ENSP00000005226:A40P;ENSP00000437128:A51P	ENSP00000005226:A40P	A	-	1	0	USH1C	17509652	1.000000	0.71417	0.757000	0.31301	0.975000	0.68041	2.139000	0.42149	0.765000	0.33221	0.561000	0.74099	GCC		0.602	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709		7	21	0	0	0	0.00308	0	7	21				
NELL1	4745	broad.mit.edu	37	11	20907031	20907031	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:20907031C>T	ENST00000357134.5	+	5	700	c.548C>T	c.(547-549)cCc>cTc	p.P183L	NELL1_ENST00000298925.5_Missense_Mutation_p.P211L|NELL1_ENST00000532434.1_Missense_Mutation_p.P183L|NELL1_ENST00000325319.5_Missense_Mutation_p.P126L	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	183	Laminin G-like.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						ACCAACCTTCCCCCAGGAATC	0.418																																							uc001mqe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(547-549)CCC>CTC		nel-like 1 isoform 1 precursor							112.0	106.0	108.0					11																	20907031		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:20907031C>T	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.548C>T	11.37:g.20907031C>T	ENSP00000349654:p.Pro183Leu		Somatic				NELL1_uc001mqf.2_Missense_Mutation_p.P183L|NELL1_uc009yid.2_Missense_Mutation_p.P211L|NELL1_uc010rdo.1_Missense_Mutation_p.P126L|NELL1_uc010rdp.1_Intron	p.P183L	NM_006157	NP_006148	WXS	Illumina HiSeq	Unspecified	Q92832	NELL1_HUMAN			5	701	+			183			TSP N-terminal.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.548C>T	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948344	0.73787	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.77877	-1.12;-1.12;-1.13;-1.12	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.204155	0.39407	N	0.001370	T	0.78960	0.4366	L	0.39898	1.24	0.51233	D	0.999911	B;P;P;P	0.48162	0.16;0.906;0.505;0.789	B;P;P;P	0.49922	0.082;0.626;0.568;0.531	T	0.78617	-0.2134	10	0.44086	T	0.13	-12.4231	19.0132	0.92882	0.0:1.0:0.0:0.0	.	126;211;183;183	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	L	211;183;126;183	ENSP00000298925:P211L;ENSP00000349654:P183L;ENSP00000317837:P126L;ENSP00000437170:P183L	ENSP00000298925:P211L	P	+	2	0	NELL1	20863607	0.679000	0.27596	0.998000	0.56505	0.917000	0.54804	2.080000	0.41586	2.574000	0.86865	0.655000	0.94253	CCC		0.418	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		8	27	0	0	0	0.00308	0	8	27				
OR5D14	219436	broad.mit.edu	37	11	55563503	55563503	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:55563503C>A	ENST00000335605.1	+	1	472	c.472C>A	c.(472-474)Ccc>Acc	p.P158T		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CATGTTTGGCCCCTTGGTACT	0.493																																							uc010rim.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(472-474)CCC>ACC		olfactory receptor, family 5, subfamily D,							158.0	153.0	154.0					11																	55563503		2200	4296	6496	SO:0001583	missense	219436				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55563503C>A	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.472C>A	11.37:g.55563503C>A	ENSP00000334456:p.Pro158Thr		Somatic					p.P158T	NM_001004735	NP_001004735	WXS	Illumina HiSeq	Unspecified	Q8NGL3	OR5DE_HUMAN			1	472	+		all_epithelial(135;0.196)	158			Helical; Name=4; (Potential).		Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	37	c.472C>A	CCDS31508.1	.	.	.	.	.	.	.	.	.	.	c	1.806	-0.475888	0.04414	.	.	ENSG00000186113	ENST00000335605	T	0.34667	1.35	4.94	0.825	0.18824	GPCR, rhodopsin-like superfamily (1);	0.155476	0.30383	N	0.009754	T	0.15132	0.0365	N	0.04705	-0.18	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.13899	-1.0492	10	0.54805	T	0.06	-8.1045	5.2517	0.15524	0.1329:0.5573:0.0:0.3097	.	158	Q8NGL3	OR5DE_HUMAN	T	158	ENSP00000334456:P158T	ENSP00000334456:P158T	P	+	1	0	OR5D14	55320079	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-1.227000	0.02950	-0.107000	0.12088	-0.275000	0.10095	CCC		0.493	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735		78	54	1	0	4.00405e-42	0.00361	7.24282e-42	78	54				
OR5T3	390154	broad.mit.edu	37	11	56019936	56019936	+	Missense_Mutation	SNP	C	C	A	rs534545230		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:56019936C>A	ENST00000303059.3	+	1	261	c.261C>A	c.(259-261)aaC>aaA	p.N87K		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					GGCTCCACAACCCCATGTATT	0.353																																							uc010rjd.1		NA																	0					0						c.(259-261)AAC>AAA		olfactory receptor, family 5, subfamily T,							98.0	97.0	98.0					11																	56019936		2201	4296	6497	SO:0001583	missense	390154				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56019936C>A	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.261C>A	11.37:g.56019936C>A	ENSP00000305403:p.Asn87Lys		Somatic					p.N87K	NM_001004747	NP_001004747	WXS	Illumina HiSeq	Unspecified	Q8NGG3	OR5T3_HUMAN			1	261	+	Esophageal squamous(21;0.00448)		87			Helical; Name=2; (Potential).		Q6IFC7	Missense_Mutation	SNP	ENST00000303059.3	37	c.261C>A	CCDS31524.1	.	.	.	.	.	.	.	.	.	.	c	5.273	0.235718	0.10023	.	.	ENSG00000172489	ENST00000303059	T	0.00392	7.58	4.55	-3.58	0.04597	GPCR, rhodopsin-like superfamily (1);	0.350744	0.20425	U	0.092594	T	0.00178	0.0005	N	0.21097	0.63	0.19575	N	0.999964	B	0.14438	0.01	B	0.20955	0.032	T	0.45411	-0.9263	10	0.72032	D	0.01	.	3.7582	0.08593	0.1032:0.3136:0.1018:0.4813	.	87	Q8NGG3	OR5T3_HUMAN	K	87	ENSP00000305403:N87K	ENSP00000305403:N87K	N	+	3	2	OR5T3	55776512	0.000000	0.05858	0.765000	0.31456	0.082000	0.17680	-2.373000	0.01072	-0.583000	0.05921	0.643000	0.83706	AAC		0.353	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	NM_001004747		14	55	1	0	7.93312e-07	0.00245	1.19788e-06	14	55				
OR8K3	219473	broad.mit.edu	37	11	56085785	56085785	+	Start_Codon_SNP	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:56085785G>T	ENST00000312711.1	+	1	3	c.3G>T	c.(1-3)atG>atT	p.M1I		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	1						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					GAACCTGGATGGAACAACACA	0.393																																							uc010rjf.1		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(1-3)ATG>ATT		olfactory receptor, family 8, subfamily K,							102.0	93.0	96.0					11																	56085785		2201	4295	6496	SO:0001582	initiator_codon_variant	219473				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56085785G>T	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.3G>T	11.37:g.56085785G>T	ENSP00000323555:p.Met1Ile		Somatic					p.M1I	NM_001005202	NP_001005202	WXS	Illumina HiSeq	Unspecified	Q8NH51	OR8K3_HUMAN			1	3	+	Esophageal squamous(21;0.00448)		1			Extracellular (Potential).		Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	37	c.3G>T	CCDS31527.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209773	0.39003	.	.	ENSG00000181689	ENST00000312711	T	0.01369	4.97	5.36	5.36	0.76844	.	0.162184	0.43416	D	0.000576	T	0.02304	0.0071	.	.	.	0.80722	D	1	B	0.28584	0.216	B	0.30782	0.12	T	0.55945	-0.8060	9	0.87932	D	0	.	14.9492	0.71057	0.0:0.0:1.0:0.0	.	1	Q8NH51	OR8K3_HUMAN	I	1	ENSP00000323555:M1I	ENSP00000323555:M1I	M	+	3	0	OR8K3	55842361	1.000000	0.71417	0.878000	0.34440	0.007000	0.05969	5.421000	0.66447	2.667000	0.90743	0.637000	0.83480	ATG		0.393	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202	Missense_Mutation	15	36	1	0	2.32078e-09	0.003163	3.68268e-09	15	36				
PYGM	5837	broad.mit.edu	37	11	64519513	64519513	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:64519513C>T	ENST00000164139.3	-	14	2049	c.1651G>A	c.(1651-1653)Gag>Aag	p.E551K	PYGM_ENST00000462303.1_5'Flank|PYGM_ENST00000377432.3_Missense_Mutation_p.E463K	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	551					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TATTCCCTCTCTAGGTAGGCA	0.512																																							uc001oax.3		NA																	0				ovary(2)	2						c.(1651-1653)GAG>AAG		muscle glycogen phosphorylase isoform 1	Pyridoxal Phosphate(DB00114)						207.0	175.0	186.0					11																	64519513		2201	4297	6498	SO:0001583	missense	5837				glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding	g.chr11:64519513C>T		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1651G>A	11.37:g.64519513C>T	ENSP00000164139:p.Glu551Lys		Somatic				PYGM_uc001oay.3_Missense_Mutation_p.E463K	p.E551K	NM_005609	NP_005600	WXS	Illumina HiSeq	Unspecified	P11217	PYGM_HUMAN			14	2468	-			551					A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	c.1651G>A	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491076	0.44249	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.92965	-3.08;-3.14	5.71	4.8	0.61643	.	0.000000	0.56097	D	0.000021	D	0.82287	0.5004	N	0.11818	0.18	0.80722	D	1	B;B	0.16396	0.017;0.001	B;B	0.17979	0.02;0.005	T	0.75491	-0.3299	10	0.09338	T	0.73	-39.7139	12.2433	0.54555	0.0:0.918:0.0:0.082	.	463;551	A6NDY6;P11217	.;PYGM_HUMAN	K	463;551;532	ENSP00000366650:E463K;ENSP00000164139:E551K	ENSP00000164139:E551K	E	-	1	0	PYGM	64276089	1.000000	0.71417	0.953000	0.39169	0.966000	0.64601	7.783000	0.85696	1.422000	0.47177	0.561000	0.74099	GAG		0.512	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609		17	104	0	0	0	0.006122	0	17	104				
CAPN5	726	broad.mit.edu	37	11	76829300	76829300	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:76829300G>C	ENST00000278559.3	+	8	1258	c.1069G>C	c.(1069-1071)Gcc>Ccc	p.A357P	CAPN5_ENST00000456580.2_Missense_Mutation_p.A397P|CAPN5_ENST00000529629.1_Missense_Mutation_p.A357P|CAPN5_ENST00000531028.1_Intron	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	357	Domain III.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						GTGGGAGGAGGCCCGGCTGCA	0.612																																							uc001oxx.2		NA																	0					0						c.(1069-1071)GCC>CCC		calpain 5							105.0	81.0	89.0					11																	76829300		2200	4292	6492	SO:0001583	missense	726				proteolysis|signal transduction	intracellular	calcium-dependent cysteine-type endopeptidase activity	g.chr11:76829300G>C		CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.1069G>C	11.37:g.76829300G>C	ENSP00000278559:p.Ala357Pro		Somatic				CAPN5_uc009yup.2_Missense_Mutation_p.A397P|CAPN5_uc009yuq.2_Missense_Mutation_p.A393P|CAPN5_uc001oxy.2_Missense_Mutation_p.A397P|CAPN5_uc001oya.2_5'Flank	p.A357P	NM_004055	NP_004046	WXS	Illumina HiSeq	Unspecified	O15484	CAN5_HUMAN			8	1254	+			357			Domain III.		O00263	Missense_Mutation	SNP	ENST00000278559.3	37	c.1069G>C	CCDS8248.1	.	.	.	.	.	.	.	.	.	.	G	32	5.128205	0.94473	.	.	ENSG00000149260	ENST00000278559;ENST00000360841;ENST00000529629;ENST00000456580;ENST00000544318	D;D;D	0.87412	-2.25;-2.25;-2.25	5.21	5.21	0.72293	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.290561	0.37053	N	0.002273	D	0.92528	0.7627	M	0.80746	2.51	0.58432	D	0.999999	D;P;P;P	0.53462	0.96;0.586;0.86;0.813	P;B;P;P	0.58077	0.832;0.436;0.637;0.681	D	0.92895	0.6334	10	0.52906	T	0.07	.	17.7421	0.88409	0.0:0.0:1.0:0.0	.	395;397;397;357	Q59GM2;E7EV01;Q6ZRM8;O15484	.;.;.;CAN5_HUMAN	P	357;397;357;397;397	ENSP00000278559:A357P;ENSP00000432332:A357P;ENSP00000409996:A397P	ENSP00000278559:A357P	A	+	1	0	CAPN5	76506948	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.975000	0.49281	2.437000	0.82529	0.561000	0.74099	GCC		0.612	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	NM_004055		14	14	0	0	0	0.004007	0	14	14				
PANX1	24145	broad.mit.edu	37	11	93862636	93862636	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:93862636C>T	ENST00000227638.3	+	1	543	c.158C>T	c.(157-159)gCc>gTc	p.A53V	PANX1_ENST00000436171.2_Missense_Mutation_p.A53V	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	53					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	ATCTCGCTGGCCTTCGCGCAG	0.662																																							uc001per.2		NA																	0					0						c.(157-159)GCC>GTC		pannexin 1							54.0	50.0	52.0					11																	93862636		2201	4298	6499	SO:0001583	missense	24145				positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding	g.chr11:93862636C>T	AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.158C>T	11.37:g.93862636C>T	ENSP00000227638:p.Ala53Val		Somatic				uc001pen.1_5'Flank|PANX1_uc001peq.2_Missense_Mutation_p.A53V	p.A53V	NM_015368	NP_056183	WXS	Illumina HiSeq	Unspecified	Q96RD7	PANX1_HUMAN			1	543	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	53			Helical; (Potential).		O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Missense_Mutation	SNP	ENST00000227638.3	37	c.158C>T	CCDS8296.1	.	.	.	.	.	.	.	.	.	.	C	33	5.229810	0.95173	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	T;T	0.22336	1.96;1.96	4.11	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.42944	0.1225	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.24368	-1.0162	10	0.22706	T	0.39	-16.6322	16.123	0.81375	0.0:1.0:0.0:0.0	.	53;53	Q96RD7;Q96RD7-2	PANX1_HUMAN;.	V	53	ENSP00000227638:A53V;ENSP00000411461:A53V	ENSP00000227638:A53V	A	+	2	0	PANX1	93502284	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	7.265000	0.78442	2.125000	0.65367	0.491000	0.48974	GCC		0.662	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396121.1	NM_015368		4	28	0	0	0	0.000248	0	4	28				
ENDOD1	23052	broad.mit.edu	37	11	94862354	94862354	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:94862354A>G	ENST00000278505.4	+	2	1232	c.1114A>G	c.(1114-1116)Ata>Gta	p.I372V		NM_015036.2	NP_055851.1	O94919	ENDD1_HUMAN	endonuclease domain containing 1	372						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				GATTAATGGCATAGAAAGTTG	0.443																																							uc001pfh.2		NA																	0					0						c.(1114-1116)ATA>GTA		endonuclease domain containing 1 precursor							119.0	107.0	111.0					11																	94862354		1946	4138	6084	SO:0001583	missense	23052					extracellular region	endonuclease activity|metal ion binding|nucleic acid binding	g.chr11:94862354A>G	BC026191	CCDS41699.1	11q21	2010-03-19			ENSG00000149218	ENSG00000149218			29129	protein-coding gene	gene with protein product						10048485	Standard	NM_015036		Approved	KIAA0830	uc001pfh.3	O94919	OTTHUMG00000167835	ENST00000278505.4:c.1114A>G	11.37:g.94862354A>G	ENSP00000278505:p.Ile372Val		Somatic					p.I372V	NM_015036	NP_055851	WXS	Illumina HiSeq	Unspecified	O94919	ENDD1_HUMAN			2	1189	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)	372					A8K6K8|Q6GQY5|Q8TAQ8	Missense_Mutation	SNP	ENST00000278505.4	37	c.1114A>G	CCDS41699.1	.	.	.	.	.	.	.	.	.	.	A	0.711	-0.787131	0.02907	.	.	ENSG00000149218	ENST00000278505	T	0.28255	1.62	6.03	-6.93	0.01638	.	0.645013	0.15027	N	0.284694	T	0.07773	0.0195	N	0.04880	-0.145	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33624	-0.9861	10	0.07482	T	0.82	-1.8123	2.781	0.05361	0.2217:0.3506:0.2839:0.1438	.	372	O94919	ENDD1_HUMAN	V	372	ENSP00000278505:I372V	ENSP00000278505:I372V	I	+	1	0	ENDOD1	94502002	0.000000	0.05858	0.000000	0.03702	0.181000	0.23173	-1.237000	0.02922	-0.712000	0.04988	-0.379000	0.06801	ATA		0.443	ENDOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396545.1	NM_015036		20	58	0	0	0	0.002299	0	20	58				
TRPC6	7225	broad.mit.edu	37	11	101341974	101341974	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:101341974C>A	ENST00000344327.3	-	9	2773	c.2349G>T	c.(2347-2349)tgG>tgT	p.W783C	TRPC6_ENST00000532133.1_Missense_Mutation_p.W705C|TRPC6_ENST00000348423.4_Missense_Mutation_p.W667C|TRPC6_ENST00000360497.4_Missense_Mutation_p.W728C	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	783					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GCTCAGAAATCCATTTTTTAA	0.398																																					Colon(166;1315 1927 11094 12848 34731)	Colon(166;1315 1927 11094 12848 34731)	uc001pgk.3		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(2347-2349)TGG>TGT		transient receptor potential cation channel,							115.0	122.0	120.0					11																	101341974		2203	4298	6501	SO:0001583	missense	7225				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding	g.chr11:101341974C>A	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.2349G>T	11.37:g.101341974C>A	ENSP00000340913:p.Trp783Cys		Somatic				TRPC6_uc009ywy.2_Missense_Mutation_p.W667C|TRPC6_uc009ywz.1_Missense_Mutation_p.W728C	p.W783C	NM_004621	NP_004612	WXS	Illumina HiSeq	Unspecified	Q9Y210	TRPC6_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0442)	9	2774	-		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)	783			Cytoplasmic (Potential).		Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	c.2349G>T	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.287695	0.23478	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58	5.79	5.79	0.91817	.	0.337754	0.33401	N	0.004954	T	0.71702	0.3371	N	0.14661	0.345	0.54753	D	0.999986	B;B;B	0.10296	0.002;0.003;0.001	B;B;B	0.09377	0.004;0.002;0.002	T	0.65356	-0.6188	10	0.31617	T	0.26	-2.6577	16.3064	0.82849	0.1327:0.8673:0.0:0.0	.	728;667;783	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	C	783;705;667;728	ENSP00000340913:W783C;ENSP00000435574:W705C;ENSP00000343672:W667C;ENSP00000353687:W728C	ENSP00000340913:W783C	W	-	3	0	TRPC6	100847184	0.993000	0.37304	0.999000	0.59377	0.997000	0.91878	1.400000	0.34577	2.733000	0.93635	0.655000	0.94253	TGG		0.398	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621		58	58	1	0	8.33888e-18	0.00361	1.39861e-17	58	58				
SCN2B	6327	broad.mit.edu	37	11	118038984	118038984	+	Silent	SNP	A	A	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:118038984A>G	ENST00000278947.5	-	3	505	c.264T>C	c.(262-264)atT>atC	p.I88I		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	88	Ig-like C2-type.				cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	GCTTCAGGTTAATGATCTTCA	0.562																																							uc001psf.2		NA																	0					0						c.(262-264)ATT>ATC		sodium channel, voltage-gated, type II, beta							75.0	66.0	69.0					11																	118038984		2200	4296	6496	SO:0001819	synonymous_variant	6327				synaptic transmission	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr11:118038984A>G	AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.264T>C	11.37:g.118038984A>G			Somatic					p.I88I	NM_004588	NP_004579	WXS	Illumina HiSeq	Unspecified	O60939	SCN2B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	3	455	-	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)	88			Ig-like C2-type.|Extracellular (Potential).		O75302|Q9UNN3	Silent	SNP	ENST00000278947.5	37	c.264T>C	CCDS8390.1																																																																																				0.562	SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109748.2	NM_004588		11	35	0	0	0	0.008291	0	11	35				
OR8B12	219858	broad.mit.edu	37	11	124412753	124412753	+	Silent	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:124412753G>T	ENST00000306842.2	-	1	822	c.798C>A	c.(796-798)ccC>ccA	p.P266P		NM_001005195.1	NP_001005195.1	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B, member 12	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		CTTGCTCGAGGGGCAGGATGG	0.443																																							uc010sam.1		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(796-798)CCC>CCA		olfactory receptor, family 8, subfamily B,							92.0	88.0	89.0					11																	124412753		2201	4299	6500	SO:0001819	synonymous_variant	219858				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124412753G>T		CCDS31711.1	11q24.2	2013-09-24			ENSG00000170953	ENSG00000170953		"""GPCR / Class A : Olfactory receptors"""	15307	protein-coding gene	gene with protein product							Standard	NM_001005195		Approved		uc010sam.2	Q8NGG6	OTTHUMG00000165922	ENST00000306842.2:c.798C>A	11.37:g.124412753G>T			Somatic					p.P266P	NM_001005195	NP_001005195	WXS	Illumina HiSeq	Unspecified	Q8NGG6	OR8BC_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)	1	798	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	266			Extracellular (Potential).		B2RNF6|Q6IEW8|Q96RC7	Silent	SNP	ENST00000306842.2	37	c.798C>A	CCDS31711.1																																																																																				0.443	OR8B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387061.1			11	38	1	0	7.03913e-09	0.001368	1.10377e-08	11	38				
ADAMTS15	170689	broad.mit.edu	37	11	130343387	130343387	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:130343387C>T	ENST00000299164.2	+	8	2524	c.2524C>T	c.(2524-2526)Cgc>Tgc	p.R842C		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	842	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GCCCCCTGCACGCTGGGTGGC	0.721																																							uc010scd.1		NA																	0				large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5						c.(2524-2526)CGC>TGC		a disintegrin-like and metalloprotease							28.0	35.0	33.0					11																	130343387		2183	4276	6459	SO:0001583	missense	170689				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr11:130343387C>T	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2524C>T	11.37:g.130343387C>T	ENSP00000299164:p.Arg842Cys		Somatic					p.R842C	NM_139055	NP_620686	WXS	Illumina HiSeq	Unspecified	Q8TE58	ATS15_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)	8	2524	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	842			TSP type-1 2.		Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	37	c.2524C>T	CCDS8488.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.227282	0.58668	.	.	ENSG00000166106	ENST00000299164	T	0.61392	0.11	5.69	5.69	0.88448	.	.	.	.	.	T	0.63319	0.2501	M	0.86573	2.825	0.49389	D	0.999783	D	0.58620	0.983	P	0.46208	0.507	T	0.71080	-0.4696	9	0.72032	D	0.01	.	5.9627	0.19308	0.186:0.7008:0.0:0.1132	.	842	Q8TE58	ATS15_HUMAN	C	842	ENSP00000299164:R842C	ENSP00000299164:R842C	R	+	1	0	ADAMTS15	129848597	0.791000	0.28800	0.959000	0.39883	0.806000	0.45545	1.360000	0.34125	2.696000	0.92011	0.655000	0.94253	CGC		0.721	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055		6	77	0	0	0	0.001168	0	6	77				
SNX19	399979	broad.mit.edu	37	11	130784592	130784592	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr11:130784592C>T	ENST00000265909.4	-	1	1812	c.1243G>A	c.(1243-1245)Gat>Aat	p.D415N	SNX19_ENST00000533318.1_Intron|SNX19_ENST00000528555.1_Intron|SNX19_ENST00000533214.1_Missense_Mutation_p.D415N|SNX19_ENST00000530356.1_5'UTR|SNX19_ENST00000539184.1_5'UTR	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	415					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		GCCTCACCATCTTTGGGTTCC	0.552																																							uc001qgk.3		NA																	0				ovary(2)|lung(2)	4						c.(1243-1245)GAT>AAT		sorting nexin 19							60.0	57.0	58.0					11																	130784592		2201	4297	6498	SO:0001583	missense	399979				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding	g.chr11:130784592C>T	D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.1243G>A	11.37:g.130784592C>T	ENSP00000265909:p.Asp415Asn		Somatic				SNX19_uc010sce.1_Intron|SNX19_uc010scf.1_5'UTR|SNX19_uc010scg.1_Intron|SNX19_uc001qgl.3_Missense_Mutation_p.D415N|SNX19_uc009zcx.1_Intron	p.D415N	NM_014758	NP_055573	WXS	Illumina HiSeq	Unspecified	Q92543	SNX19_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)	1	1791	-	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)	415					E9PKB9|Q8IV55	Missense_Mutation	SNP	ENST00000265909.4	37	c.1243G>A	CCDS31721.1	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554407	0.45487	.	.	ENSG00000120451	ENST00000265909;ENST00000533214	T;T	0.20069	2.1;2.1	5.1	4.17	0.49024	.	1.041630	0.07531	N	0.912172	T	0.21881	0.0527	L	0.32530	0.975	0.80722	D	1	P;P	0.48162	0.906;0.906	P;P	0.46585	0.521;0.521	T	0.02519	-1.1147	10	0.19147	T	0.46	-10.7249	10.6536	0.45663	0.1907:0.8093:0.0:0.0	.	415;415	E9PKB9;Q92543	.;SNX19_HUMAN	N	415	ENSP00000265909:D415N;ENSP00000435390:D415N	ENSP00000265909:D415N	D	-	1	0	SNX19	130289802	0.269000	0.24143	0.439000	0.26833	0.220000	0.24768	1.164000	0.31810	1.335000	0.45486	0.650000	0.86243	GAT		0.552	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758		17	17	0	0	0	0.001882	0	17	17				
WNK1	65125	broad.mit.edu	37	12	994563	994563	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:994563G>A	ENST00000315939.6	+	19	5236	c.4593G>A	c.(4591-4593)aaG>aaA	p.K1531K	WNK1_ENST00000530271.2_Silent_p.K2029K|WNK1_ENST00000537687.1_Silent_p.K1791K|WNK1_ENST00000340908.4_Silent_p.K1124K|WNK1_ENST00000535572.1_Silent_p.K1284K	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1531					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CACTAGATAAGACATCTCATA	0.478																																					Colon(19;451 567 6672 12618 28860)	Colon(19;451 567 6672 12618 28860)	uc001qio.3		NA																	0				stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23						c.(4591-4593)AAG>AAA		WNK lysine deficient protein kinase 1							419.0	374.0	389.0					12																	994563		2203	4300	6503	SO:0001819	synonymous_variant	65125				intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity	g.chr12:994563G>A	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.4593G>A	12.37:g.994563G>A			Somatic				WNK1_uc001qip.3_Silent_p.K1284K|WNK1_uc001qir.3_Silent_p.K704K	p.K1531K	NM_018979	NP_061852	WXS	Illumina HiSeq	Unspecified	Q9H4A3	WNK1_HUMAN	Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)		19	5100	+	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		1531					A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	ENST00000315939.6	37	c.4593G>A	CCDS8506.1																																																																																				0.478	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979		7	423	0	0	0	0.001984	0	7	423				
VWF	7450	broad.mit.edu	37	12	6143932	6143932	+	Silent	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:6143932C>G	ENST00000261405.5	-	20	2861	c.2607G>C	c.(2605-2607)acG>acC	p.T869T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	869	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CCATGCCGATCGTGGAGCACG	0.582																																							uc001qnn.1		NA																	0				skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12						c.(2605-2607)ACG>ACC		von Willebrand factor preproprotein	Antihemophilic Factor(DB00025)						186.0	147.0	160.0					12																	6143932		2203	4300	6503	SO:0001819	synonymous_variant	7450				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	g.chr12:6143932C>G		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2607G>C	12.37:g.6143932C>G			Somatic				VWF_uc010set.1_Intron	p.T869T	NM_000552	NP_000543	WXS	Illumina HiSeq	Unspecified	P04275	VWF_HUMAN			20	2857	-			869			VWFD 3.		Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	c.2607G>C	CCDS8539.1																																																																																				0.582	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		21	42	0	0	0	0.00278	0	21	42				
ATN1	1822	broad.mit.edu	37	12	7043174	7043174	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:7043174C>T	ENST00000356654.4	+	2	247	c.10C>T	c.(10-12)Cga>Tga	p.R4*	ATN1_ENST00000396684.2_Nonsense_Mutation_p.R4*	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	4					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						AATGAAGACACGACAGAATAA	0.498																																							uc001qrw.1		NA																	0				ovary(2)|breast(2)|pancreas(1)|skin(1)	6						c.(10-12)CGA>TGA		atrophin-1							40.0	40.0	40.0					12																	7043174		2203	4300	6503	SO:0001587	stop_gained	1822				cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding	g.chr12:7043174C>T	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.10C>T	12.37:g.7043174C>T	ENSP00000349076:p.Arg4*		Somatic				ATN1_uc001qrx.1_Nonsense_Mutation_p.R4*|ATN1_uc001qry.1_Nonsense_Mutation_p.R4*	p.R4*	NM_001007026	NP_001007027	WXS	Illumina HiSeq	Unspecified	P54259	ATN1_HUMAN			2	247	+			4					Q99495|Q99621|Q9UEK7	Nonsense_Mutation	SNP	ENST00000356654.4	37	c.10C>T	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	C	38	6.993704	0.97987	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325	.	.	.	4.81	4.81	0.61882	.	0.000000	0.25506	U	0.030205	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.7553	0.91830	0.0:1.0:0.0:0.0	.	.	.	.	X	4	.	ENSP00000349076:R4X	R	+	1	2	ATN1	6913435	0.997000	0.39634	1.000000	0.80357	0.990000	0.78478	3.572000	0.53849	2.606000	0.88127	0.442000	0.29010	CGA		0.498	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940		9	10	0	0	0	0.006214	0	9	10				
LRP6	4040	broad.mit.edu	37	12	12302005	12302005	+	Missense_Mutation	SNP	C	C	T	rs146852380	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:12302005C>T	ENST00000261349.4	-	14	3153	c.3077G>A	c.(3076-3078)cGc>cAc	p.R1026H	LRP6_ENST00000543091.1_Missense_Mutation_p.R1026H	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1026	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				GTAGATGTAGCGGCTGTAAAT	0.453													C|||	4	0.000798722	0.0	0.0	5008	,	,		19116	0.0		0.0	False		,,,				2504	0.0041						uc001rah.3		NA																	0				lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12						c.(3076-3078)CGC>CAC		low density lipoprotein receptor-related protein		C	HIS/ARG	0,4406		0,0,2203	243.0	238.0	240.0		3077	4.8	1.0	12	dbSNP_134	240	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRP6	NM_002336.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	1026/1614	12302005	1,13005	2203	4300	6503	SO:0001583	missense	4040				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding	g.chr12:12302005C>T	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3077G>A	12.37:g.12302005C>T	ENSP00000261349:p.Arg1026His		Somatic				BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.R1026H	p.R1026H	NM_002336	NP_002327	WXS	Illumina HiSeq	Unspecified	O75581	LRP6_HUMAN			14	3219	-		Prostate(47;0.0865)	1026			Extracellular (Potential).|LDL-receptor class B 17.|Beta-propeller 4.		Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	c.3077G>A	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558000	0.86231	0.0	1.16E-4	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.91740	-2.9;-2.9	5.71	4.83	0.62350	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	U	0.000009	D	0.89473	0.6725	L	0.45744	1.44	0.80722	D	1	D;P	0.54964	0.969;0.687	B;B	0.42827	0.399;0.133	D	0.89281	0.3612	10	0.49607	T	0.09	.	14.7678	0.69654	0.0:0.9306:0.0:0.0694	.	1026;1026	F5H7J9;O75581	.;LRP6_HUMAN	H	1026	ENSP00000261349:R1026H;ENSP00000442472:R1026H	ENSP00000261349:R1026H	R	-	2	0	LRP6	12193272	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.777000	0.68931	1.428000	0.47296	0.650000	0.86243	CGC		0.453	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1			79	138	0	0	0	0.00361	0	79	138				
ABCC9	10060	broad.mit.edu	37	12	22063859	22063859	+	Silent	SNP	T	T	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:22063859T>A	ENST00000261201.4	-	7	1064	c.1065A>T	c.(1063-1065)gcA>gcT	p.A355A	ABCC9_ENST00000345162.2_Silent_p.A355A|ABCC9_ENST00000261200.4_Silent_p.A355A	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	355	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	AGAGAAGAACTGCTAGAACGT	0.403																																							uc001rfi.1		NA																	0				ovary(4)|skin(2)	6						c.(1063-1065)GCA>GCT		ATP-binding cassette, sub-family C, member 9	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						94.0	95.0	95.0					12																	22063859		2203	4300	6503	SO:0001819	synonymous_variant	10060				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity	g.chr12:22063859T>A	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.1065A>T	12.37:g.22063859T>A			Somatic				ABCC9_uc001rfh.2_Silent_p.A355A|ABCC9_uc001rfj.1_Silent_p.A355A	p.A355A	NM_005691	NP_005682	WXS	Illumina HiSeq	Unspecified	O60706	ABCC9_HUMAN			7	1085	-			355			ABC transmembrane type-1 1.|Helical; Name=7; (Potential).		O60707	Silent	SNP	ENST00000261201.4	37	c.1065A>T	CCDS8694.1																																																																																				0.403	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691		28	44	0	0	0	0.00632	0	28	44				
NEUROD4	58158	broad.mit.edu	37	12	55421034	55421034	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:55421034C>G	ENST00000242994.3	+	2	1189	c.811C>G	c.(811-813)Cct>Gct	p.P271A		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	271					amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P271T(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						AGATGGGTCTCCTGACCTAGA	0.532																																							uc001sgp.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(811-813)CCT>GCT		neurogenic differentiation 4							157.0	151.0	153.0					12																	55421034		2203	4300	6503	SO:0001583	missense	58158				amacrine cell differentiation|positive regulation of cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr12:55421034C>G	AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.811C>G	12.37:g.55421034C>G	ENSP00000242994:p.Pro271Ala		Somatic					p.P271A	NM_021191	NP_067014	WXS	Illumina HiSeq	Unspecified	Q9HD90	NDF4_HUMAN			2	1189	+			271					B2RAC9	Missense_Mutation	SNP	ENST00000242994.3	37	c.811C>G	CCDS8886.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.427247	0.43122	.	.	ENSG00000123307	ENST00000242994	D	0.95482	-3.72	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.94847	0.8335	L	0.40543	1.245	0.58432	D	0.999997	D	0.55605	0.972	P	0.58013	0.831	D	0.91704	0.5376	10	0.15066	T	0.55	-11.168	13.604	0.62037	0.0:0.8446:0.1553:0.0	.	271	Q9HD90	NDF4_HUMAN	A	271	ENSP00000242994:P271A	ENSP00000242994:P271A	P	+	1	0	NEUROD4	53707301	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.242000	0.51384	2.941000	0.99782	0.655000	0.94253	CCT		0.532	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406104.1			31	117	0	0	0	0.007291	0	31	117				
SLC26A10	65012	broad.mit.edu	37	12	58018721	58018721	+	Missense_Mutation	SNP	C	C	T	rs146389619	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:58018721C>T	ENST00000320442.4	+	10	1611	c.1300C>T	c.(1300-1302)Cgc>Tgc	p.R434C	SLC26A10_ENST00000379218.2_3'UTR|SLC26A10_ENST00000490243.1_3'UTR	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	434	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.					integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					TGGGCAGTTTCGCTGCAACCT	0.572													C|||	3	0.000599042	0.0	0.0	5008	,	,		19160	0.001		0.002	False		,,,				2504	0.0						uc001spe.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(1300-1302)CGC>TGC		solute carrier family 26, member 10		C	CYS/ARG	0,4406		0,0,2203	102.0	103.0	103.0		1300	3.8	0.3	12	dbSNP_134	103	2,8598		0,2,4298	yes	missense	SLC26A10	NM_133489.2	180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	434/564	58018721	2,13004	2203	4300	6503	SO:0001583	missense	65012					integral to membrane	antiporter activity	g.chr12:58018721C>T		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1300C>T	12.37:g.58018721C>T	ENSP00000320217:p.Arg434Cys		Somatic				SLC26A10_uc001spf.2_RNA|SLC26A10_uc009zpz.1_RNA	p.R434C	NM_133489	NP_597996	WXS	Illumina HiSeq	Unspecified	Q8NG04	S2610_HUMAN			10	1611	+	Melanoma(17;0.122)		434			STAS.		A6NMJ2|B6ZDQ3|Q6ZWI7	Missense_Mutation	SNP	ENST00000320442.4	37	c.1300C>T	CCDS8949.2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	.	14.89	2.671831	0.47781	0.0	2.33E-4	ENSG00000135502	ENST00000320442	D	0.89485	-2.52	4.71	3.8	0.43715	Sulphate transporter/antisigma-factor antagonist STAS (4);	.	.	.	.	D	0.89921	0.6855	L	0.46157	1.445	0.23872	N	0.996605	D	0.76494	0.999	P	0.60886	0.88	T	0.80329	-0.1428	9	0.39692	T	0.17	.	8.9182	0.35594	0.0:0.8958:0.0:0.1042	.	434	Q8NG04	S2610_HUMAN	C	434	ENSP00000320217:R434C	ENSP00000320217:R434C	R	+	1	0	SLC26A10	56304988	0.058000	0.20735	0.308000	0.25141	0.732000	0.41865	1.001000	0.29783	2.448000	0.82819	0.561000	0.74099	CGC		0.572	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2			10	71	0	0	0	0.001855	0	10	71				
NAV3	89795	broad.mit.edu	37	12	78400423	78400423	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:78400423C>A	ENST00000397909.2	+	8	1278	c.1105C>A	c.(1105-1107)Cct>Act	p.P369T	NAV3_ENST00000536525.2_Missense_Mutation_p.P369T|NAV3_ENST00000266692.7_Missense_Mutation_p.P369T|NAV3_ENST00000228327.6_Missense_Mutation_p.P369T			Q8IVL0	NAV3_HUMAN	neuron navigator 3	369						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACTGAAGCCACCTGTCTCAGA	0.527										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(1105-1107)CCT>ACT		neuron navigator 3							52.0	56.0	55.0					12																	78400423		2013	4172	6185	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78400423C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.1105C>A	12.37:g.78400423C>A	ENSP00000381007:p.Pro369Thr	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.P369T	p.P369T	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			8	1278	+			369					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.1105C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.52|15.52	2.856928|2.856928	0.51376|0.51376	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692|ENST00000550503	T;T;T;T;T|.	0.62941|.	-0.01;1.64;1.63;1.63;1.53|.	5.61|5.61	3.78|3.78	0.43462|0.43462	.|.	0.000000|.	0.40064|.	U|.	0.001195|.	T|T	0.59101|0.59101	0.2169|0.2169	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	D;P|.	0.63880|.	0.993;0.493|.	P;B|.	0.56343|.	0.796;0.116|.	T|T	0.53975|0.53975	-0.8362|-0.8362	10|5	0.45353|.	T|.	0.12|.	-11.3404|-11.3404	12.893|12.893	0.58082|0.58082	0.1302:0.745:0.1248:0.0|0.1302:0.745:0.1248:0.0	.|.	369;369|.	Q8IVL0;Q8IVL0-2|.	NAV3_HUMAN;.|.	T|N	369|192	ENSP00000446628:P369T;ENSP00000446132:P369T;ENSP00000381007:P369T;ENSP00000228327:P369T;ENSP00000266692:P369T|.	ENSP00000228327:P369T|.	P|T	+|+	1|2	0|0	NAV3|NAV3	76924554|76924554	0.988000|0.988000	0.35896|0.35896	0.997000|0.997000	0.53966|0.53966	0.697000|0.697000	0.40408|0.40408	3.036000|3.036000	0.49767|0.49767	0.722000|0.722000	0.32252|0.32252	-0.268000|-0.268000	0.10319|0.10319	CCT|ACC		0.527	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		31	30	1	0	0.00127121	0.007291	0.00183581	31	30				
TRPV4	59341	broad.mit.edu	37	12	110236509	110236509	+	Silent	SNP	G	G	A	rs115446386	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:110236509G>A	ENST00000418703.2	-	5	1156	c.1062C>T	c.(1060-1062)gcC>gcT	p.A354A	TRPV4_ENST00000536838.1_Silent_p.A320A|TRPV4_ENST00000346520.2_Silent_p.A354A|TRPV4_ENST00000544971.1_Silent_p.A307A|TRPV4_ENST00000392719.2_Silent_p.A307A|TRPV4_ENST00000541794.1_Silent_p.A307A|TRPV4_ENST00000537083.1_Silent_p.A354A|TRPV4_ENST00000261740.2_Silent_p.A354A	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	354					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						GGAAGAGGCGGGCACACTTGA	0.592													G|||	2	0.000399361	0.0	0.0	5008	,	,		17250	0.0		0.002	False		,,,				2504	0.0						uc001tpj.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(1060-1062)GCC>GCT		transient receptor potential cation channel,		G	,,,,	0,4406		0,0,2203	113.0	81.0	92.0		921,960,921,1062,1062	0.5	1.0	12	dbSNP_132	92	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TRPV4	NM_001177428.1,NM_001177431.1,NM_001177433.1,NM_021625.4,NM_147204.2	,,,,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,,,	307/825,320/838,307/765,354/872,354/812	110236509	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	59341				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding	g.chr12:110236509G>A	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.1062C>T	12.37:g.110236509G>A			Somatic				TRPV4_uc001tpg.1_Silent_p.A320A|TRPV4_uc001tph.1_Silent_p.A307A|TRPV4_uc001tpi.1_Silent_p.A307A|TRPV4_uc001tpk.1_Silent_p.A354A|TRPV4_uc001tpl.1_Silent_p.A354A	p.A354A	NM_021625	NP_067638	WXS	Illumina HiSeq	Unspecified	Q9HBA0	TRPV4_HUMAN			5	1157	-			354			Cytoplasmic (Potential).		B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Silent	SNP	ENST00000418703.2	37	c.1062C>T	CCDS9134.1																																																																																				0.592	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625		16	25	0	0	0	0.003163	0	16	25				
GPN3	51184	broad.mit.edu	37	12	110891576	110891576	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:110891576C>T	ENST00000228827.3	-	7	826	c.764G>A	c.(763-765)gGa>gAa	p.G255E	GPN3_ENST00000543199.1_Missense_Mutation_p.G294E|GPN3_ENST00000537466.2_Missense_Mutation_p.G265E	NM_016301.3	NP_057385.3			GPN-loop GTPase 3											endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|urinary_tract(1)	8						TAGGTCTTCTCCATATTGAAT	0.358																																							uc001tqr.2		NA																	0					0						c.(763-765)GGA>GAA		GPN-loop GTPase 3 isoform 1							110.0	100.0	103.0					12																	110891576		2202	4300	6502	SO:0001583	missense	51184					protein complex	GTP binding	g.chr12:110891576C>T	BC008416	CCDS9147.1, CCDS53830.1, CCDS53831.1	12q24.11	2012-12-18	2008-04-30	2008-04-30	ENSG00000111231	ENSG00000111231		"""GPN-loop GTPases"""	30186	protein-coding gene	gene with protein product			"""ATP binding domain 1 family, member C"""	ATPBD1C		12975309	Standard	NM_016301		Approved	MGC14560	uc021rdu.1	Q9UHW5	OTTHUMG00000169524	ENST00000228827.3:c.764G>A	12.37:g.110891576C>T	ENSP00000228827:p.Gly255Glu		Somatic				GPN3_uc001tqs.2_Missense_Mutation_p.G265E	p.G255E	NM_016301	NP_057385	WXS	Illumina HiSeq	Unspecified	Q9UHW5	GPN3_HUMAN			7	820	-			255						Missense_Mutation	SNP	ENST00000228827.3	37	c.764G>A	CCDS9147.1	.	.	.	.	.	.	.	.	.	.	C	31	5.078739	0.94050	.	.	ENSG00000111231	ENST00000228827;ENST00000543199;ENST00000537466;ENST00000551079	T;T;T;T	0.53206	1.93;1.89;1.92;0.63	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.58736	0.2143	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.959	T	0.61802	-0.6988	10	0.72032	D	0.01	.	20.1338	0.98010	0.0:1.0:0.0:0.0	.	265;255	Q9UHW5-2;Q9UHW5	.;GPN3_HUMAN	E	255;294;265;91	ENSP00000228827:G255E;ENSP00000442770:G294E;ENSP00000443068:G265E;ENSP00000448159:G91E	ENSP00000228827:G255E	G	-	2	0	GPN3	109375959	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.400000	0.79949	2.770000	0.95276	0.655000	0.94253	GGA		0.358	GPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404607.1	NM_016301		10	35	0	0	0	0.006214	0	10	35				
LHX5	64211	broad.mit.edu	37	12	113907084	113907084	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:113907084G>A	ENST00000261731.3	-	2	813	c.240C>T	c.(238-240)gcC>gcT	p.A80A	LHX5_ENST00000557836.1_5'Flank|RP11-82C23.2_ENST00000551357.2_RNA	NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	80	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						CTTTGCTCCGGGCCTTGCGCA	0.592																																							uc001tvj.1		NA																	0					0						c.(238-240)GCC>GCT		LIM homeobox protein 5							103.0	93.0	96.0					12																	113907084		2203	4300	6503	SO:0001819	synonymous_variant	64211					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr12:113907084G>A	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.240C>T	12.37:g.113907084G>A			Somatic					p.A80A	NM_022363	NP_071758	WXS	Illumina HiSeq	Unspecified	Q9H2C1	LHX5_HUMAN			2	814	-			80			LIM zinc-binding 2.		Q32MA4	Silent	SNP	ENST00000261731.3	37	c.240C>T	CCDS9171.1																																																																																				0.592	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	NM_022363		34	45	0	0	0	0.005524	0	34	45				
DNAH10	196385	broad.mit.edu	37	12	124349195	124349195	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:124349195C>G	ENST00000409039.3	+	39	6633	c.6608C>G	c.(6607-6609)tCt>tGt	p.S2203C		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2203	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S2203F(2)|p.S795F(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AACATGAATTCTGTGATGGAT	0.473																																							uc001uft.3		NA																	4	Substitution - Missense(4)		large_intestine(2)|skin(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(6607-6609)TCT>TGT		dynein, axonemal, heavy chain 10							150.0	147.0	148.0					12																	124349195		2012	4188	6200	SO:0001583	missense	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124349195C>G	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6608C>G	12.37:g.124349195C>G	ENSP00000386770:p.Ser2203Cys		Somatic					p.S2203C	NM_207437	NP_997320	WXS	Illumina HiSeq	Unspecified	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	39	6633	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		2203			AAA 2 (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	c.6608C>G	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998668	0.93227	.	.	ENSG00000197653	ENST00000409039	D	0.89939	-2.59	5.46	5.46	0.80206	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.64402	U	0.000004	D	0.96731	0.8933	H	0.97077	3.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97878	1.0290	10	0.87932	D	0	.	19.3147	0.94207	0.0:1.0:0.0:0.0	.	2203	Q8IVF4	DYH10_HUMAN	C	2203	ENSP00000386770:S2203C	ENSP00000386770:S2203C	S	+	2	0	DNAH10	122915148	1.000000	0.71417	0.943000	0.38184	0.995000	0.86356	7.818000	0.86416	2.559000	0.86315	0.563000	0.77884	TCT		0.473	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			3	43	0	0	0	0.004672	0	3	43				
DNAH10	196385	broad.mit.edu	37	12	124379262	124379262	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:124379262C>A	ENST00000409039.3	+	53	8943	c.8918C>A	c.(8917-8919)tCc>tAc	p.S2973Y		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2973	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GTCGCAAAGTCCTTTCTAGGT	0.398																																							uc001uft.3		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(8917-8919)TCC>TAC		dynein, axonemal, heavy chain 10							97.0	99.0	98.0					12																	124379262		1896	4117	6013	SO:0001583	missense	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124379262C>A	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.8918C>A	12.37:g.124379262C>A	ENSP00000386770:p.Ser2973Tyr		Somatic					p.S2973Y	NM_207437	NP_997320	WXS	Illumina HiSeq	Unspecified	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	53	8943	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		2973			AAA 4 (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	c.8918C>A	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	0.235	-1.017964	0.02078	.	.	ENSG00000197653	ENST00000409039	T	0.43294	0.95	4.85	4.85	0.62838	Dynein heavy chain, P-loop containing D4 domain (1);	0.088479	0.48286	U	0.000190	T	0.31263	0.0791	L	0.43701	1.375	0.53005	D	0.999963	B	0.23249	0.082	B	0.24701	0.055	T	0.07986	-1.0744	10	0.02654	T	1	.	12.5689	0.56326	0.0:0.9205:0.0:0.0795	.	2973	Q8IVF4	DYH10_HUMAN	Y	2973	ENSP00000386770:S2973Y	ENSP00000386770:S2973Y	S	+	2	0	DNAH10	122945215	0.998000	0.40836	0.997000	0.53966	0.263000	0.26337	3.752000	0.55172	2.527000	0.85204	0.557000	0.71058	TCC		0.398	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			10	12	1	0	0.00010058	0.001368	0.000147666	10	12				
NCOR2	9612	broad.mit.edu	37	12	124857117	124857117	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr12:124857117G>C	ENST00000405201.1	-	20	2258	c.2258C>G	c.(2257-2259)tCt>tGt	p.S753C	NCOR2_ENST00000429285.2_Missense_Mutation_p.S735C|NCOR2_ENST00000397355.1_Missense_Mutation_p.S736C|NCOR2_ENST00000404621.1_Missense_Mutation_p.S735C|NCOR2_ENST00000356219.3_Missense_Mutation_p.S753C|NCOR2_ENST00000404121.2_Missense_Mutation_p.S306C			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	753					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		AGTGTGAGGAGAGGGGATGCT	0.672																																							uc010tba.1		NA																	0				skin(3)|ovary(1)	4						c.(2257-2259)TCT>TGT		nuclear receptor co-repressor 2 isoform 2							51.0	56.0	54.0					12																	124857117		2096	4213	6309	SO:0001583	missense	9612				cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity	g.chr12:124857117G>C	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.2258C>G	12.37:g.124857117G>C	ENSP00000384018:p.Ser753Cys		Somatic				NCOR2_uc010tay.1_Missense_Mutation_p.S753C|NCOR2_uc010taz.1_Missense_Mutation_p.S736C|NCOR2_uc010tbb.1_Missense_Mutation_p.S753C|NCOR2_uc010tbc.1_Missense_Mutation_p.S735C|NCOR2_uc001ugj.1_Missense_Mutation_p.S753C	p.S753C	NM_001077261	NP_001070729	WXS	Illumina HiSeq	Unspecified	Q9Y618	NCOR2_HUMAN		Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)	20	2375	-	all_neural(191;0.0804)|Medulloblastoma(191;0.163)		753					O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	37	c.2258C>G	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375080	0.24857	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234;ENST00000448614	T;T;T;T;T;T;T;T	0.40756	1.02;1.57;1.02;1.57;1.57;1.57;1.02;1.02	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.61236	0.2331	L	0.52905	1.665	0.58432	D	0.999999	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.994;0.994;0.997	T	0.65919	-0.6051	10	0.87932	D	0	-33.0317	17.4724	0.87649	0.0:0.0:1.0:0.0	.	735;736;753	C9J0Q5;C9J239;C9JFD3	.;.;.	C	753;735;753;736;753;306;735;753;126	ENSP00000384018:S753C;ENSP00000384202:S735C;ENSP00000348551:S753C;ENSP00000380513:S736C;ENSP00000385618:S306C;ENSP00000400281:S735C;ENSP00000402808:S753C;ENSP00000408247:S126C	ENSP00000348551:S753C	S	-	2	0	NCOR2	123423070	1.000000	0.71417	0.317000	0.25265	0.199000	0.23934	8.766000	0.91728	2.110000	0.64415	0.561000	0.74099	TCT		0.672	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312		32	47	0	0	0	0.002836	0	32	47				
MTUS2	23281	broad.mit.edu	37	13	29599154	29599154	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr13:29599154G>A	ENST00000431530.3	+	1	407	c.349G>A	c.(349-351)Gaa>Aaa	p.E117K		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	107						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CATTCAGAGGGAACTCAATGA	0.493																																							uc001usl.3		NA																	0					0						c.(349-351)GAA>AAA		hypothetical protein LOC23281 isoform a							72.0	70.0	71.0					13																	29599154		1955	4147	6102	SO:0001583	missense	23281					cytoplasm|microtubule	microtubule binding|protein homodimerization activity	g.chr13:29599154G>A	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.349G>A	13.37:g.29599154G>A	ENSP00000392057:p.Glu117Lys		Somatic					p.E117K	NM_001033602	NP_001028774	WXS	Illumina HiSeq	Unspecified	Q5JR59	MTUS2_HUMAN			1	407	+			107					A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	c.349G>A	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	g	14.11	2.437689	0.43224	.	.	ENSG00000132938	ENST00000431530	T	0.13196	2.61	5.37	4.5	0.54988	.	0.576969	0.15334	N	0.267854	T	0.12008	0.0292	L	0.29908	0.895	0.45567	D	0.998515	P	0.38078	0.617	B	0.37144	0.242	T	0.13495	-1.0507	9	.	.	.	.	14.7561	0.69567	0.0:0.1506:0.8494:0.0	.	107	Q5JR59	MTUS2_HUMAN	K	117	ENSP00000392057:E117K	.	E	+	1	0	MTUS2	28497154	0.346000	0.24844	0.009000	0.14445	0.039000	0.13416	2.964000	0.49192	1.211000	0.43351	0.563000	0.77884	GAA		0.493	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270		8	51	0	0	0	0.004482	0	8	51				
ELF1	1997	broad.mit.edu	37	13	41533103	41533103	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr13:41533103C>A	ENST00000239882.3	-	3	436	c.122G>T	c.(121-123)gGt>gTt	p.G41V	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.G41V	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	41					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		AATATCAGCACCAGGAACATG	0.423																																							uc001uxs.2		NA																	0				ovary(1)	1						c.(121-123)GGT>GTT		E74-like factor 1 (ets domain transcription							143.0	117.0	126.0					13																	41533103		2203	4300	6503	SO:0001583	missense	1997				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr13:41533103C>A	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.122G>T	13.37:g.41533103C>A	ENSP00000239882:p.Gly41Val		Somatic				ELF1_uc010tfc.1_Missense_Mutation_p.G41V|ELF1_uc010acd.2_5'UTR	p.G41V	NM_172373	NP_758961	WXS	Illumina HiSeq	Unspecified	P32519	ELF1_HUMAN		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)	3	495	-		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)	41					B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	37	c.122G>T	CCDS9374.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.332266	0.60853	.	.	ENSG00000120690	ENST00000442101;ENST00000239882	T;T	0.41758	0.99;0.99	5.87	5.87	0.94306	.	0.254172	0.35646	N	0.003076	T	0.49881	0.1583	L	0.36672	1.1	0.52501	D	0.99995	D;D	0.65815	0.993;0.995	P;D	0.64877	0.875;0.93	T	0.29761	-1.0001	10	0.26408	T	0.33	.	12.5077	0.55989	0.0:0.9245:0.0:0.0754	.	41;41	E9PDQ9;P32519	.;ELF1_HUMAN	V	41	ENSP00000405580:G41V;ENSP00000239882:G41V	ENSP00000239882:G41V	G	-	2	0	ELF1	40431103	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.941000	0.49011	2.780000	0.95670	0.655000	0.94253	GGT		0.423	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373		24	43	1	0	1.1804e-14	0.003954	1.94894e-14	24	43				
KBTBD6	89890	broad.mit.edu	37	13	41704721	41704721	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr13:41704721C>G	ENST00000379485.1	-	1	2161	c.1927G>C	c.(1927-1929)Gaa>Caa	p.E643Q	KBTBD6_ENST00000499385.2_Missense_Mutation_p.E577Q	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	643										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		AAGTCCCATTCAGTGCTAGAC	0.448																																							uc001uxu.1		NA																	0				ovary(1)|skin(1)	2						c.(1927-1929)GAA>CAA		kelch repeat and BTB (POZ) domain-containing 6							111.0	101.0	104.0					13																	41704721		2203	4300	6503	SO:0001583	missense	89890						protein binding	g.chr13:41704721C>G	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1927G>C	13.37:g.41704721C>G	ENSP00000368799:p.Glu643Gln		Somatic				KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Missense_Mutation_p.E577Q|uc001uxv.1_5'Flank	p.E643Q	NM_152903	NP_690867	WXS	Illumina HiSeq	Unspecified	Q86V97	KBTB6_HUMAN		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)	1	2216	-		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)	643			Kelch 6.		Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	ENST00000379485.1	37	c.1927G>C	CCDS9376.1	.	.	.	.	.	.	.	.	.	.	c	12.93	2.086629	0.36855	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.76316	-0.92;-1.01	3.79	2.92	0.33932	.	0.247996	0.30483	N	0.009523	T	0.64638	0.2616	N	0.19112	0.55	0.28403	N	0.918523	P;P	0.45827	0.867;0.534	P;B	0.44897	0.463;0.203	T	0.60084	-0.7332	10	0.46703	T	0.11	.	8.4917	0.33104	0.0:0.8775:0.0:0.1225	.	577;643	F5GZN7;Q86V97	.;KBTB6_HUMAN	Q	643;577	ENSP00000368799:E643Q;ENSP00000444326:E577Q	ENSP00000368799:E643Q	E	-	1	0	KBTBD6	40602721	1.000000	0.71417	0.278000	0.24718	0.888000	0.51559	3.451000	0.52964	0.914000	0.36822	0.455000	0.32223	GAA		0.448	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903		5	30	0	0	0	0.000602	0	5	30				
ITM2B	9445	broad.mit.edu	37	13	48832951	48832951	+	Nonsense_Mutation	SNP	C	C	T	rs11556901		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr13:48832951C>T	ENST00000378565.5	+	5	786	c.583C>T	c.(583-585)Cag>Tag	p.Q195*	ITM2B_ENST00000378549.5_Nonsense_Mutation_p.Q89*	NM_021999.4	NP_068839.1	Q9Y287	ITM2B_HUMAN	integral membrane protein 2B	195	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|nervous system development (GO:0007399)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle membrane (GO:0030660)|integral component of organelle membrane (GO:0031301)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;1.97e-06)		CTATTTGCCTCAGTCCTATCT	0.373																																							uc001vbz.3		NA																	0					0						c.(583-585)CAG>TAG		integral membrane protein 2B							166.0	137.0	147.0					13																	48832951		2203	4300	6503	SO:0001587	stop_gained	9445				nervous system development	Golgi membrane|integral to membrane|nucleus|plasma membrane	beta-amyloid binding	g.chr13:48832951C>T	AF092128	CCDS9409.1	13q14.2	2012-10-10			ENSG00000136156	ENSG00000136156		"""BRICHOS domain containing"""	6174	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2B"""	603904				9795190	Standard	NM_021999		Approved	BRI, E25B, E3-16, BRICD2B	uc001vbz.3	Q9Y287	OTTHUMG00000016894	ENST00000378565.5:c.583C>T	13.37:g.48832951C>T	ENSP00000367828:p.Gln195*		Somatic					p.Q195*	NM_021999	NP_068839	WXS	Illumina HiSeq	Unspecified	Q9Y287	ITM2B_HUMAN		GBM - Glioblastoma multiforme(144;1.97e-06)	5	806	+		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)	195			BRICHOS.|Lumenal (Potential).		Q5W0A3|Q96B24|Q9NYH1	Nonsense_Mutation	SNP	ENST00000378565.5	37	c.583C>T	CCDS9409.1	.	.	.	.	.	.	.	.	.	.	C	36	5.915117	0.97099	.	.	ENSG00000136156	ENST00000378565;ENST00000378549	.	.	.	5.63	5.63	0.86233	.	0.053246	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-2.8004	18.6843	0.91558	0.0:1.0:0.0:0.0	.	.	.	.	X	195;89	.	ENSP00000367811:Q89X	Q	+	1	0	ITM2B	47730952	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.436000	0.80404	2.654000	0.90174	0.650000	0.86243	CAG		0.373	ITM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044870.3	NM_021999		5	45	0	0	0	0.001168	0	5	45				
PCDH20	64881	broad.mit.edu	37	13	61986420	61986420	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr13:61986420C>G	ENST00000409186.1	-	5	3917	c.1812G>C	c.(1810-1812)aaG>aaC	p.K604N	PCDH20_ENST00000409204.4_Missense_Mutation_p.K604N			Q8N6Y1	PCD20_HUMAN	protocadherin 20	604	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TGTATCTGTACTTTTCTTTCT	0.453																																							uc001vid.3		NA																	0				ovary(4)|breast(1)|central_nervous_system(1)	6						c.(1810-1812)AAG>AAC		protocadherin 20							130.0	124.0	126.0					13																	61986420		2203	4300	6503	SO:0001583	missense	64881				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr13:61986420C>G	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.1812G>C	13.37:g.61986420C>G	ENSP00000386653:p.Lys604Asn		Somatic				PCDH20_uc010thj.1_Missense_Mutation_p.K604N	p.K604N	NM_022843	NP_073754	WXS	Illumina HiSeq	Unspecified	Q8N6Y1	PCD20_HUMAN		GBM - Glioblastoma multiforme(99;0.000118)	2	2176	-		Breast(118;0.195)|Prostate(109;0.229)	577			Extracellular (Potential).|Cadherin 4.		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	ENST00000409186.1	37	c.1812G>C	CCDS9442.2	.	.	.	.	.	.	.	.	.	.	C	12.53	1.965845	0.34659	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.01745	4.66;4.66	5.94	3.27	0.37495	.	0.087569	0.48767	D	0.000175	T	0.02380	0.0073	L	0.37750	1.13	0.42183	D	0.991696	D	0.53312	0.959	P	0.47603	0.551	T	0.65212	-0.6223	10	0.37606	T	0.19	.	7.9899	0.30235	0.0:0.5814:0.0:0.4186	.	604	A8K1K9	.	N	604;604;350	ENSP00000387250:K604N;ENSP00000386653:K604N	ENSP00000351500:K350N	K	-	3	2	PCDH20	60884421	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	0.752000	0.26362	0.846000	0.35142	0.557000	0.71058	AAG		0.453	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843		34	30	0	0	0	0.003755	0	34	30				
COL4A2	1284	broad.mit.edu	37	13	111160425	111160425	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr13:111160425G>C	ENST00000360467.5	+	47	5044	c.4738G>C	c.(4738-4740)Gag>Cag	p.E1580Q	COL4A2-AS1_ENST00000417970.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	1580	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GCCCGTGGCCGAGGACGAGAT	0.617																																							uc001vqx.2		NA																	0				skin(3)|central_nervous_system(2)|ovary(1)	6						c.(4738-4740)GAG>CAG		alpha 2 type IV collagen preproprotein							72.0	80.0	78.0					13																	111160425		2182	4284	6466	SO:0001583	missense	1284				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding	g.chr13:111160425G>C	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.4738G>C	13.37:g.111160425G>C	ENSP00000353654:p.Glu1580Gln		Somatic					p.E1580Q	NM_001846	NP_001837	WXS	Illumina HiSeq	Unspecified	P08572	CO4A2_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)		47	5027	+	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	1580			Collagen IV NC1.		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	37	c.4738G>C	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.287390	0.40494	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.94576	-3.46	4.94	4.94	0.65067	C-type lectin fold (1);	0.000000	0.56097	D	0.000028	D	0.93125	0.7811	L	0.56124	1.755	0.80722	D	1	B	0.28605	0.217	B	0.35353	0.201	D	0.90944	0.4800	10	0.18710	T	0.47	.	18.1809	0.89777	0.0:0.0:1.0:0.0	.	1580	P08572	CO4A2_HUMAN	Q	1580	ENSP00000353654:E1580Q	ENSP00000257309:E1580Q	E	+	1	0	COL4A2	109958426	1.000000	0.71417	1.000000	0.80357	0.423000	0.31445	7.474000	0.81024	2.256000	0.74724	0.655000	0.94253	GAG		0.617	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846		8	53	0	0	0	0.004482	0	8	53				
TMEM55B	90809	broad.mit.edu	37	14	20926779	20926779	+	Missense_Mutation	SNP	A	A	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:20926779A>C	ENST00000250489.4	-	7	1059	c.773T>G	c.(772-774)tTg>tGg	p.L258W	TMEM55B_ENST00000398020.4_Missense_Mutation_p.L265W|TMEM55B_ENST00000554028.1_Missense_Mutation_p.L91W			Q86T03	TM55B_HUMAN	transmembrane protein 55B	258						endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			endometrium(3)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	11	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)		AGCCCGGCCCAAACACAGCAC	0.557																																							uc001vxl.2		NA																	0					0						c.(772-774)TTG>TGG		transmembrane protein 55B isoform 2							75.0	66.0	69.0					14																	20926779		2203	4300	6503	SO:0001583	missense	90809					integral to membrane|late endosome membrane|lysosomal membrane	hydrolase activity	g.chr14:20926779A>C	BC002867	CCDS9551.1, CCDS41911.1	14q11.1	2002-11-27	2005-07-18	2005-07-18	ENSG00000165782	ENSG00000165782			19299	protein-coding gene	gene with protein product		609865	"""chromosome 14 open reading frame 9"""	C14orf9			Standard	NM_144568		Approved	MGC26684	uc001vxk.2	Q86T03	OTTHUMG00000029545	ENST00000250489.4:c.773T>G	14.37:g.20926779A>C	ENSP00000250489:p.Leu258Trp		Somatic				TMEM55B_uc001vxk.2_Missense_Mutation_p.L265W	p.L258W	NM_144568	NP_653169	WXS	Illumina HiSeq	Unspecified	Q86T03	TM55B_HUMAN	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	7	926	-	all_cancers(95;0.00123)	all_lung(585;0.235)	258			Helical; (Potential).		B2RA35|Q86U09|Q8WUC0|Q9BU67|Q9NSU8	Missense_Mutation	SNP	ENST00000250489.4	37	c.773T>G	CCDS9551.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.5|20.5	4.005829|4.005829	0.74932|0.74932	.|.	.|.	ENSG00000165782|ENSG00000165782	ENST00000553460|ENST00000250489;ENST00000398020;ENST00000554028	.|T	.|0.74842	.|-0.88	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	.|0.000000	.|0.64402	.|D	.|0.000007	D|D	0.83431|0.83431	0.5253|0.5253	M|M	0.64404|0.64404	1.975|1.975	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.72982	.|0.979;0.964	D|D	0.85387|0.85387	0.1123|0.1123	5|10	.|0.87932	.|D	.|0	-3.3565|-3.3565	13.8114|13.8114	0.63266|0.63266	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|258;265	.|Q86T03;Q86T03-2	.|TM55B_HUMAN;.	L|W	97|258;265;91	.|ENSP00000451350:L91W	.|ENSP00000250489:L258W	F|L	-|-	3|2	2|0	TMEM55B|TMEM55B	19996619|19996619	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.097000|8.097000	0.89539|0.89539	2.101000|2.101000	0.63845|0.63845	0.460000|0.460000	0.39030|0.39030	TTT|TTG		0.557	TMEM55B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000073643.3	NM_144568		23	38	0	0	0	0.00278	0	23	38				
AJUBA	84962	broad.mit.edu	37	14	23450742	23450742	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:23450742C>A	ENST00000262713.2	-	1	1109	c.734G>T	c.(733-735)gGa>gTa	p.G245V	RP11-298I3.4_ENST00000556503.1_RNA|RP11-298I3.4_ENST00000557615.1_RNA|AJUBA_ENST00000361265.4_Missense_Mutation_p.G245V|RP11-298I3.5_ENST00000555074.1_Intron|RP11-298I3.4_ENST00000555294.1_RNA	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	245	PreLIM.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										CGCTCCCACTCCGGCCCCGGC	0.736																																						Esophageal Squamous(134;328 1721 9795 37986 41605)	uc001whz.2		NA																	0					0						c.(733-735)GGA>GTA		ajuba isoform 1							4.0	6.0	5.0					14																	23450742		1758	3632	5390	SO:0001583	missense	84962				cell cycle|gene silencing by miRNA|positive regulation of protein complex assembly	cell-cell junction|cytoplasmic mRNA processing body|microtubule organizing center	alpha-catenin binding|zinc ion binding	g.chr14:23450742C>A	AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.734G>T	14.37:g.23450742C>A	ENSP00000262713:p.Gly245Val		Somatic					p.G245V	NM_032876	NP_116265	WXS	Illumina HiSeq	Unspecified	Q96IF1	JUB_HUMAN		GBM - Glioblastoma multiforme(265;0.0122)	1	1110	-	all_cancers(95;4.6e-05)		245			PreLIM.		A8MX18|D3DS37	Missense_Mutation	SNP	ENST00000262713.2	37	c.734G>T	CCDS9581.1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.317947	0.23994	.	.	ENSG00000129474	ENST00000262713;ENST00000361265	T;T	0.57273	0.41;0.41	4.72	-0.737	0.11129	.	0.987483	0.08225	N	0.978462	T	0.39708	0.1088	L	0.29908	0.895	0.38790	D	0.954954	B	0.09022	0.002	B	0.10450	0.005	T	0.15838	-1.0423	10	0.29301	T	0.29	.	11.2198	0.48848	0.1379:0.3566:0.5055:0.0	.	245	Q96IF1	JUB_HUMAN	V	245	ENSP00000262713:G245V;ENSP00000354491:G245V	ENSP00000262713:G245V	G	-	2	0	JUB	22520582	0.000000	0.05858	0.807000	0.32361	0.853000	0.48598	0.320000	0.19540	-0.353000	0.08224	-0.165000	0.13383	GGA		0.736	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071685.2			3	3	1	0	8.12818e-05	0.001984	0.000119998	3	3				
MBIP	51562	broad.mit.edu	37	14	36785917	36785917	+	Silent	SNP	T	T	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:36785917T>C	ENST00000416007.4	-	2	318	c.231A>G	c.(229-231)caA>caG	p.Q77Q	MBIP_ENST00000603913.1_5'Flank|MBIP_ENST00000318473.7_Silent_p.Q77Q|MBIP_ENST00000359527.7_Silent_p.Q77Q	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1	77					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|inactivation of MAPK activity involved in osmosensory signaling pathway (GO:0000173)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein kinase inhibitor activity (GO:0004860)			breast(2)|large_intestine(1)|lung(5)	8	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		ATAAAATGTGTTGTTCAAGTG	0.363																																							uc001wtm.2		NA																	0					0						c.(229-231)CAA>CAG		MAP3K12 binding inhibitory protein 1 isoform 1							67.0	68.0	68.0					14																	36785917		2203	4300	6503	SO:0001819	synonymous_variant	51562				histone H3 acetylation|inactivation of MAPK activity involved in osmosensory signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm|nucleolus	identical protein binding|protein kinase inhibitor activity	g.chr14:36785917T>C	BC016821	CCDS9658.1, CCDS45096.1	14q13.2	2005-01-10			ENSG00000151332	ENSG00000151332			20427	protein-coding gene	gene with protein product		609431				10801814	Standard	NM_016586		Approved		uc001wtm.2	Q9NS73	OTTHUMG00000140222	ENST00000416007.4:c.231A>G	14.37:g.36785917T>C			Somatic				MBIP_uc001wto.2_Silent_p.Q77Q|MBIP_uc010tpy.1_5'UTR|MBIP_uc001wtn.2_Silent_p.Q77Q	p.Q77Q	NM_016586	NP_057670	WXS	Illumina HiSeq	Unspecified	Q9NS73	MBIP1_HUMAN	Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)	2	319	-	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		77					Q86TZ2|Q96AS5|Q9BS93|Q9NZE1	Silent	SNP	ENST00000416007.4	37	c.231A>G	CCDS9658.1	.	.	.	.	.	.	.	.	.	.	T	7.913	0.736978	0.15574	.	.	ENSG00000151332	ENST00000553977	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	T	0.55893	0.1949	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55823	-0.8080	4	.	.	.	-21.4333	5.6708	0.17721	0.0:0.2198:0.0:0.7802	.	.	.	.	A	74	.	.	T	-	1	0	MBIP	35855668	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	0.587000	0.23909	2.028000	0.59812	0.477000	0.44152	ACA		0.363	MBIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276685.2	NM_016586		21	25	0	0	0	0.00278	0	21	25				
NKX2-8	26257	broad.mit.edu	37	14	37051560	37051560	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:37051560C>T	ENST00000258829.5	-	1	252	c.35G>A	c.(34-36)cGc>cAc	p.R12H		NM_014360.2	NP_055175.2	O15522	NKX28_HUMAN	NK2 homeobox 8	12					axonogenesis (GO:0007409)|liver development (GO:0001889)|lung development (GO:0030324)|negative regulation of epithelial cell proliferation (GO:0050680)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			upper_aerodigestive_tract(1)	1	Breast(36;0.143)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.0113)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0171)		TAGAAGGCTGCGCACGGTGAA	0.726																																							uc001wtx.2		NA																	0					0						c.(34-36)CGC>CAC		NK2 homeobox 8							24.0	25.0	25.0					14																	37051560		2203	4297	6500	SO:0001583	missense	26257				liver development|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr14:37051560C>T		CCDS9660.1	14q13.3	2012-03-09	2007-07-09	2002-10-04	ENSG00000136327	ENSG00000136327		"""Homeoboxes / ANTP class : NKL subclass"""	16364	protein-coding gene	gene with protein product		603245	"""NK-2 homolog H (Drosophila)"", ""NK2 transcription factor related, locus 8 (Drosophila)"""	NKX2H		9446603	Standard	NM_014360		Approved	NKX2.8, Nkx2-9	uc001wtx.3	O15522	OTTHUMG00000028772	ENST00000258829.5:c.35G>A	14.37:g.37051560C>T	ENSP00000258829:p.Arg12His		Somatic					p.R12H	NM_014360	NP_055175	WXS	Illumina HiSeq	Unspecified	O15522	NKX28_HUMAN	Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.0113)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0171)	1	227	-	Breast(36;0.143)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		12					Q8IUT7	Missense_Mutation	SNP	ENST00000258829.5	37	c.35G>A	CCDS9660.1	.	.	.	.	.	.	.	.	.	.	C	35	5.439437	0.96168	.	.	ENSG00000136327	ENST00000258829	D	0.90620	-2.7	5.41	5.41	0.78517	.	0.116074	0.56097	D	0.000024	D	0.93259	0.7852	L	0.36672	1.1	0.53688	D	0.999975	D	0.89917	1.0	D	0.87578	0.998	D	0.93932	0.7215	10	0.72032	D	0.01	.	19.2672	0.93993	0.0:1.0:0.0:0.0	.	12	O15522	NKX28_HUMAN	H	12	ENSP00000258829:R12H	ENSP00000258829:R12H	R	-	2	0	NKX2-8	36121311	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.129000	0.77225	2.538000	0.85594	0.549000	0.68633	CGC		0.726	NKX2-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071844.6			9	25	0	0	0	0.006214	0	9	25				
MDGA2	161357	broad.mit.edu	37	14	47530459	47530459	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:47530459G>T	ENST00000399232.2	-	7	1675	c.1311C>A	c.(1309-1311)agC>agA	p.S437R	MDGA2_ENST00000357362.3_Missense_Mutation_p.S208R|MDGA2_ENST00000426342.1_Missense_Mutation_p.S208R|MDGA2_ENST00000439988.3_Missense_Mutation_p.S506R	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	437					pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TACCTGTGCTGCTGGATATAT	0.318																																							uc001wwj.3		NA																	0				ovary(4)|large_intestine(1)|pancreas(1)	6						c.(1309-1311)AGC>AGA		MAM domain containing 1 isoform 1							106.0	98.0	100.0					14																	47530459		1897	4116	6013	SO:0001583	missense	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47530459G>T	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1311C>A	14.37:g.47530459G>T	ENSP00000382178:p.Ser437Arg		Somatic				MDGA2_uc001wwi.3_Missense_Mutation_p.S208R|MDGA2_uc010ani.2_Missense_Mutation_p.A6E	p.S437R	NM_001113498	NP_001106970	WXS	Illumina HiSeq	Unspecified	Q7Z553	MDGA2_HUMAN			7	1507	-			437					F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37	c.1311C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.5|25.5	4.649174|4.649174	0.87958|0.87958	.|.	.|.	ENSG00000139915|ENSG00000139915	ENST00000554762|ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	.|T;T;T;T	.|0.62788	.|0.13;0.34;-0.0;0.34	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	.|0.000000	.|0.64402	.|U	.|0.000007	T|T	0.76513|0.76513	0.3998|0.3998	M|M	0.67700|0.67700	2.07|2.07	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|D	.|0.63597	.|0.916	T|T	0.72991|0.72991	-0.4123|-0.4123	5|10	.|0.34782	.|T	.|0.22	.|.	18.7657|18.7657	0.91871|0.91871	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|437	.|Q7Z553	.|MDGA2_HUMAN	K|R	212|437;208;506;208	.|ENSP00000400011:S437R;ENSP00000405456:S208R;ENSP00000382178:S506R;ENSP00000349925:S208R	.|ENSP00000349925:S208R	Q|S	-|-	1|3	0|2	MDGA2|MDGA2	46600209|46600209	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.807000|9.807000	0.99171|0.99171	2.776000|2.776000	0.95493|0.95493	0.655000|0.655000	0.94253|0.94253	CAG|AGC		0.318	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		10	63	1	0	0.00621372	0.006214	0.00890073	10	63				
VTI1B	10490	broad.mit.edu	37	14	68123177	68123177	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:68123177C>G	ENST00000554659.1	-	4	837	c.496G>C	c.(496-498)Gag>Cag	p.E166Q	5S_rRNA_ENST00000607639.1_RNA	NM_006370.2	NP_006361.1	Q9UEU0	VTI1B_HUMAN	vesicle transport through interaction with t-SNAREs 1B	166					cell proliferation (GO:0008283)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			endometrium(1)|large_intestine(2)|stomach(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.000344)|OV - Ovarian serous cystadenocarcinoma(108;0.00212)|BRCA - Breast invasive adenocarcinoma(234;0.00941)		TCCCCCAGCTCTTCTATGATT	0.522																																							uc001xjt.2		NA																	0					0						c.(496-498)GAG>CAG		vesicle transport through interaction with							158.0	154.0	155.0					14																	68123177		2203	4300	6503	SO:0001583	missense	10490				cell proliferation|cellular membrane fusion|intracellular protein transport|vesicle docking involved in exocytosis	endomembrane system|integral to membrane		g.chr14:68123177C>G	AF060902	CCDS9786.1	14q23.3	2012-12-10	2012-12-10		ENSG00000100568	ENSG00000100568			17793	protein-coding gene	gene with protein product		603207	"""vesicle transport through interaction with t-SNAREs homolog 1B (yeast)"""			9636656, 9446565	Standard	NM_006370		Approved	VTI2	uc001xjt.3	Q9UEU0	OTTHUMG00000171251	ENST00000554659.1:c.496G>C	14.37:g.68123177C>G	ENSP00000450731:p.Glu166Gln		Somatic				VTI1B_uc010aqp.2_Missense_Mutation_p.E105Q|VTI1B_uc001xju.2_Missense_Mutation_p.E125Q	p.E166Q	NM_006370	NP_006361	WXS	Illumina HiSeq	Unspecified	Q9UEU0	VTI1B_HUMAN		all cancers(60;0.000344)|OV - Ovarian serous cystadenocarcinoma(108;0.00212)|BRCA - Breast invasive adenocarcinoma(234;0.00941)	4	892	-			166			Potential.|Cytoplasmic (Potential).		O43547|Q96J28	Missense_Mutation	SNP	ENST00000554659.1	37	c.496G>C	CCDS9786.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.369657|5.369657	0.95900|0.95900	.|.	.|.	ENSG00000100568|ENSG00000100568	ENST00000554659|ENST00000554636;ENST00000556461	T|.	0.76448|.	-1.02|.	5.49|5.49	5.49|5.49	0.81192|0.81192	Target SNARE coiled-coil domain (1);|.	0.099243|.	0.64402|.	D|.	0.000002|.	T|T	0.76314|0.76314	0.3970|0.3970	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.73962|0.73962	-0.3817|-0.3817	10|5	0.72032|.	D|.	0.01|.	.|.	19.5721|19.5721	0.95425|0.95425	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	166;166|.	A8K6M4;Q9UEU0|.	.;VTI1B_HUMAN|.	Q|T	166|64;82	ENSP00000450731:E166Q|.	ENSP00000216456:E166Q|.	E|R	-|-	1|2	0|0	VTI1B|VTI1B	67192930|67192930	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.499000|7.499000	0.81566|0.81566	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	GAG|AGA		0.522	VTI1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412558.2			4	152	0	0	0	0.001168	0	4	152				
SLC8A3	6547	broad.mit.edu	37	14	70512864	70512864	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:70512864C>T	ENST00000381269.2	-	8	3337	c.2584G>A	c.(2584-2586)Gcc>Acc	p.A862T	SLC8A3_ENST00000533541.1_3'UTR|SLC8A3_ENST00000357887.3_Missense_Mutation_p.A860T|SLC8A3_ENST00000534137.1_Missense_Mutation_p.A859T|SLC8A3_ENST00000394330.2_Missense_Mutation_p.A219T|SLC8A3_ENST00000528359.1_Missense_Mutation_p.A860T|SLC8A3_ENST00000356921.2_Missense_Mutation_p.A856T|SLC8A3_ENST00000216568.7_Missense_Mutation_p.A233T	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	862					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		ACGGAGAAGGCCAGTGTGCCG	0.647											OREG0022773	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001xly.2		NA																	0				skin(3)|ovary(2)|breast(2)	7						c.(2584-2586)GCC>ACC		solute carrier family 8 (sodium/calcium							50.0	47.0	48.0					14																	70512864		2203	4300	6503	SO:0001583	missense	6547				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding	g.chr14:70512864C>T	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.2584G>A	14.37:g.70512864C>T	ENSP00000370669:p.Ala862Thr		Somatic	OREG0022773	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1122	SLC8A3_uc001xlu.2_Missense_Mutation_p.A219T|SLC8A3_uc001xlv.2_Missense_Mutation_p.A233T|SLC8A3_uc001xlw.2_Missense_Mutation_p.A859T|SLC8A3_uc001xlx.2_Missense_Mutation_p.A860T|SLC8A3_uc001xlz.2_Missense_Mutation_p.A856T|SLC8A3_uc010ara.2_RNA|SLC8A3_uc001xma.2_3'UTR	p.A862T	NM_183002	NP_892114	WXS	Illumina HiSeq	Unspecified	P57103	NAC3_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)	8	3338	-			862			Helical; (Potential).		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	c.2584G>A	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.545622	0.65198	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000216568;ENST00000394330;ENST00000534137;ENST00000528359	T;T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	5.76	4.88	0.63580	Sodium/calcium exchanger membrane region (1);	0.052563	0.85682	N	0.000000	T	0.79633	0.4479	M	0.81682	2.555	0.80722	D	1	D;B;D;B;B	0.76494	0.999;0.022;0.997;0.008;0.107	D;B;D;B;B	0.80764	0.994;0.039;0.992;0.019;0.279	T	0.82333	-0.0509	10	0.59425	D	0.04	.	15.0881	0.72170	0.0:0.9319:0.0:0.0681	.	856;862;860;859;233	P57103-2;P57103;Q96QG2;Q96QG1;Q5K3P6	.;NAC3_HUMAN;.;.;.	T	856;862;860;233;219;859;860	ENSP00000349392:A856T;ENSP00000370669:A862T;ENSP00000350560:A860T;ENSP00000216568:A233T;ENSP00000377863:A219T;ENSP00000436688:A859T;ENSP00000433531:A860T	ENSP00000216568:A233T	A	-	1	0	SLC8A3	69582617	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	6.093000	0.71422	1.437000	0.47472	0.555000	0.69702	GCC		0.647	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1			20	23	0	0	0	0.008871	0	20	23				
GTF2A1	2957	broad.mit.edu	37	14	81659125	81659125	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:81659125T>A	ENST00000553612.1	-	7	1074	c.671A>T	c.(670-672)cAg>cTg	p.Q224L	GTF2A1_ENST00000434192.2_Missense_Mutation_p.Q185L	NM_001278940.1|NM_015859.3	NP_001265869.1|NP_056943.1	P52655	TF2AA_HUMAN	general transcription factor IIA, 1, 19/37kDa	224					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(234;0.0287)		TAAGATTTGCTGAGGCTGGAT	0.463																																							uc001xvf.1		NA																	0				breast(1)	1						c.(670-672)CAG>CTG		TFIIA alpha, p55 isoform 1							159.0	158.0	158.0					14																	81659125		2203	4300	6503	SO:0001583	missense	2957				regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|transcription factor TFIIA complex	DNA binding|protein binding|protein heterodimerization activity|TBP-class protein binding|transcription coactivator activity	g.chr14:81659125T>A	X75383	CCDS9873.1, CCDS9874.1	14q31	2010-03-23	2002-08-29					"""General transcription factors"""	4646	protein-coding gene	gene with protein product		600520	"""glucose regulated protein, 58kD pseudogene"""			8224848	Standard	NM_015859		Approved	TFIIA	uc001xvf.2	P52655		ENST00000553612.1:c.671A>T	14.37:g.81659125T>A	ENSP00000452454:p.Gln224Leu		Somatic				GTF2A1_uc010atb.1_Missense_Mutation_p.Q174L|GTF2A1_uc001xvg.1_Missense_Mutation_p.Q185L	p.Q224L	NM_015859	NP_056943	WXS	Illumina HiSeq	Unspecified	P52655	TF2AA_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0287)	7	1103	-			224					Q3KNQ9	Missense_Mutation	SNP	ENST00000553612.1	37	c.671A>T	CCDS9873.1	.	.	.	.	.	.	.	.	.	.	T	17.88	3.498116	0.64186	.	.	ENSG00000165417	ENST00000553612;ENST00000344860;ENST00000434192	T;T	0.49720	0.77;0.77	5.4	2.93	0.34026	.	0.051081	0.85682	D	0.000000	T	0.37100	0.0991	L	0.56769	1.78	0.58432	D	0.999992	P	0.37914	0.611	B	0.33846	0.171	T	0.20773	-1.0265	10	0.07030	T	0.85	-1.3854	12.435	0.55595	0.0:0.0:0.2651:0.7349	.	224	P52655	TF2AA_HUMAN	L	224;185;185	ENSP00000452454:Q224L;ENSP00000409492:Q185L	ENSP00000298173:Q224L	Q	-	2	0	GTF2A1	80728878	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.913000	0.69957	0.390000	0.25115	-0.316000	0.08728	CAG		0.463	GTF2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413309.1	NM_015859		103	92	0	0	0	0.00361	0	103	92				
DYNC1H1	1778	broad.mit.edu	37	14	102455115	102455115	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:102455115G>C	ENST00000360184.4	+	10	2958	c.2794G>C	c.(2794-2796)Gat>Cat	p.D932H		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	932	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ACAAGCTGAAGATAAAGCAGA	0.458																																							uc001yks.2		NA																	0				ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(2794-2796)GAT>CAT		cytoplasmic dynein 1 heavy chain 1							102.0	87.0	92.0					14																	102455115		2203	4300	6503	SO:0001583	missense	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102455115G>C	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.2794G>C	14.37:g.102455115G>C	ENSP00000348965:p.Asp932His		Somatic					p.D932H	NM_001376	NP_001367	WXS	Illumina HiSeq	Unspecified	Q14204	DYHC1_HUMAN			10	2958	+			932			Stem (By similarity).		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	c.2794G>C	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281926	0.80692	.	.	ENSG00000197102	ENST00000360184	T	0.30714	1.52	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.52757	0.1754	L	0.49126	1.545	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.44636	-0.9315	10	0.52906	T	0.07	.	20.1326	0.98004	0.0:0.0:1.0:0.0	.	932	Q14204	DYHC1_HUMAN	H	932	ENSP00000348965:D932H	ENSP00000348965:D932H	D	+	1	0	DYNC1H1	101524868	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.412000	0.97347	2.833000	0.97629	0.655000	0.94253	GAT		0.458	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		4	53	0	0	0	0.000602	0	4	53				
AHNAK2	113146	broad.mit.edu	37	14	105413076	105413076	+	Missense_Mutation	SNP	G	G	C	rs370995302		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:105413076G>C	ENST00000333244.5	-	7	8831	c.8712C>G	c.(8710-8712)ttC>ttG	p.F2904L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2904						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGGGCATCTTGAAACTGGGCA	0.647																																							uc010axc.1		NA																	0				ovary(1)	1						c.(8710-8712)TTC>TTG		AHNAK nucleoprotein 2							155.0	169.0	164.0					14																	105413076		1870	4076	5946	SO:0001583	missense	113146					nucleus		g.chr14:105413076G>C	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8712C>G	14.37:g.105413076G>C	ENSP00000353114:p.Phe2904Leu		Somatic				AHNAK2_uc001ypx.2_Missense_Mutation_p.F2804L	p.F2904L	NM_138420	NP_612429	WXS	Illumina HiSeq	Unspecified	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	8832	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	2904					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.8712C>G	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	7.966	0.747959	0.15710	.	.	ENSG00000185567	ENST00000333244	T	0.01197	5.19	4.24	1.17	0.20885	.	.	.	.	.	T	0.01061	0.0035	L	0.38692	1.165	0.20196	N	0.999922	B	0.02656	0.0	B	0.04013	0.001	T	0.48234	-0.9053	9	0.13108	T	0.6	.	6.6263	0.22830	0.1523:0.2947:0.553:0.0	.	2904	Q8IVF2	AHNK2_HUMAN	L	2904	ENSP00000353114:F2904L	ENSP00000353114:F2904L	F	-	3	2	AHNAK2	104484121	0.120000	0.22244	0.977000	0.42913	0.456000	0.32438	-0.319000	0.08039	0.214000	0.20742	0.485000	0.47835	TTC		0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		8	296	0	0	0	0.006214	0	8	296				
RASGRP1	10125	broad.mit.edu	37	15	38805044	38805044	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr15:38805044G>A	ENST00000310803.5	-	7	966	c.789C>T	c.(787-789)ctC>ctT	p.L263L	RASGRP1_ENST00000450598.2_Silent_p.L263L|RASGRP1_ENST00000561180.1_Silent_p.L314L|RASGRP1_ENST00000539159.1_Silent_p.L215L|RASGRP1_ENST00000558164.1_Silent_p.L263L|RASGRP1_ENST00000559830.1_Silent_p.L263L	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	263	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		TGGGGCGGCTGAGAACCATCA	0.502																																							uc001zke.3		NA																	0				large_intestine(1)|ovary(1)	2						c.(787-789)CTC>CTT		RAS guanyl releasing protein 1 isoform a							60.0	66.0	64.0					15																	38805044		1979	4163	6142	SO:0001819	synonymous_variant	10125				cell differentiation|platelet activation|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|lipid binding|protein binding	g.chr15:38805044G>A	AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.789C>T	15.37:g.38805044G>A			Somatic				RASGRP1_uc010bbe.2_RNA|RASGRP1_uc010bbf.2_Silent_p.L125L|RASGRP1_uc010bbg.2_Silent_p.L125L|RASGRP1_uc001zkd.3_Silent_p.L263L	p.L263L	NM_005739	NP_005730	WXS	Illumina HiSeq	Unspecified	O95267	GRP1_HUMAN		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)	7	967	-		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)	263			Ras-GEF.		Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Silent	SNP	ENST00000310803.5	37	c.789C>T	CCDS45222.1																																																																																				0.502	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418223.1	NM_005739		4	9	0	0	0	0.000248	0	4	9				
CATSPER2	117155	broad.mit.edu	37	15	43940128	43940128	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr15:43940128G>C	ENST00000321596.5	-	2	331	c.132C>G	c.(130-132)atC>atG	p.I44M	CATSPER2_ENST00000396879.1_Missense_Mutation_p.I44M|CATSPER2_ENST00000464721.1_Intron|CATSPER2_ENST00000355438.2_Missense_Mutation_p.I44M|CATSPER2_ENST00000381761.1_Missense_Mutation_p.I50M|CATSPER2_ENST00000354127.4_Missense_Mutation_p.I44M|STRC_ENST00000541030.1_Intron			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	44					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		GTAACTCCCTGATAGTGTGCC	0.453																																							uc001zsh.2		NA																	0				ovary(1)	1						c.(130-132)ATC>ATG		sperm-associated cation channel 2 isoform 2							118.0	123.0	122.0					15																	43940128		2199	4296	6495	SO:0001583	missense	117155				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity	g.chr15:43940128G>C	AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.132C>G	15.37:g.43940128G>C	ENSP00000321463:p.Ile44Met		Somatic				CATSPER2_uc010bdm.2_RNA|CATSPER2_uc001zsi.2_Missense_Mutation_p.I44M|CATSPER2_uc001zsj.2_Missense_Mutation_p.I44M|CATSPER2_uc001zsk.2_Missense_Mutation_p.I44M|CATSPER2_uc001zsl.1_Intron	p.I44M	NM_172095	NP_742093	WXS	Illumina HiSeq	Unspecified	Q96P56	CTSR2_HUMAN		GBM - Glioblastoma multiforme(94;3.56e-07)	2	347	-		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)	44			Cytoplasmic (Potential).		Q8NHT9|Q96P54|Q96P55	Missense_Mutation	SNP	ENST00000321596.5	37	c.132C>G	CCDS10099.1	.	.	.	.	.	.	.	.	.	.	G	8.497	0.863415	0.17250	.	.	ENSG00000166762	ENST00000396879;ENST00000299989;ENST00000381761;ENST00000321596;ENST00000354127;ENST00000355438;ENST00000432420;ENST00000409481;ENST00000419473	T;T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03;1.03	2.64	0.36	0.16097	.	1.189650	0.06769	U	0.783117	T	0.39384	0.1076	L	0.46157	1.445	0.22127	N	0.999349	P;B;B	0.50443	0.935;0.141;0.16	P;B;B	0.48738	0.588;0.078;0.036	T	0.28744	-1.0034	10	0.33940	T	0.23	.	3.3863	0.07273	0.1688:0.2739:0.5573:0.0	.	44;50;44	Q96P56-4;F8W9H2;Q96P56	.;.;CTSR2_HUMAN	M	44;44;50;44;44;44;44;44;44	ENSP00000380088:I44M;ENSP00000371180:I50M;ENSP00000321463:I44M;ENSP00000339137:I44M;ENSP00000347613:I44M;ENSP00000407694:I44M;ENSP00000386595:I44M	ENSP00000299989:I44M	I	-	3	3	CATSPER2	41727420	0.994000	0.37717	0.997000	0.53966	0.810000	0.45777	1.834000	0.39171	0.435000	0.26365	0.184000	0.17185	ATC		0.453	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133151.2	NM_054020		26	88	0	0	0	0.005443	0	26	88				
PKM	5315	broad.mit.edu	37	15	72495446	72495446	+	Intron	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr15:72495446G>A	ENST00000335181.5	-	9	1244				PKM_ENST00000449901.2_Intron|PKM_ENST00000568459.1_Silent_p.L408L|PKM_ENST00000568883.1_Silent_p.L243L|PKM_ENST00000565184.1_Silent_p.L408L|PKM_ENST00000389093.3_Silent_p.L408L|PKM_ENST00000565154.1_Silent_p.L408L|PKM_ENST00000319622.6_Silent_p.L408L	NM_002654.4	NP_002645.3	P14618	KPYM_HUMAN	pyruvate kinase, muscle						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|programmed cell death (GO:0012501)|small molecule metabolic process (GO:0044281)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			endometrium(1)|lung(7)	8					Pyruvic acid(DB00119)	TGGCTTCCATGAGGTCTGTGG	0.537																																							uc002atx.1		NA																	0				breast(1)	1						c.(1222-1224)CTC>CTT		pyruvate kinase, muscle isoform M1	Pyruvic acid(DB00119)						83.0	77.0	79.0					15																	72495446		2199	4297	6496	SO:0001627	intron_variant	5315				glycolysis|programmed cell death	cytosol|nucleus|plasma membrane	ATP binding|magnesium ion binding|potassium ion binding|protein binding|pyruvate kinase activity	g.chr15:72495446G>A	M23725	CCDS32284.1, CCDS32285.1, CCDS55972.1, CCDS73752.1	15q23	2012-10-02		2012-05-23	ENSG00000067225	ENSG00000067225	2.7.1.40		9021	protein-coding gene	gene with protein product		179050		PKM2		2040271	Standard	NM_002654		Approved	THBP1, OIP3, PK3	uc002atr.1	P14618	OTTHUMG00000172709	ENST00000335181.5:c.1141-485C>T	15.37:g.72495446G>A			Somatic				PKM2_uc002atr.1_5'Flank|PKM2_uc002ats.1_Intron|PKM2_uc002att.1_Silent_p.L174L|PKM2_uc002atu.1_Intron|PKM2_uc010bit.1_Silent_p.L413L|PKM2_uc010uki.1_Silent_p.L482L|PKM2_uc002atv.1_Silent_p.L443L|PKM2_uc002atw.1_Silent_p.L408L|PKM2_uc002aty.1_Intron|PKM2_uc010ukj.1_Intron|PKM2_uc010ukk.1_Intron|PKM2_uc010biu.1_Silent_p.L429L|PKM2_uc002atz.1_Intron	p.L408L	NM_182471	NP_872271	WXS	Illumina HiSeq	Unspecified	P14618	KPYM_HUMAN			9	1465	-			408			Intersubunit contact.|Interaction with POU5F1.		A6NFK3|B2R5N8|B3KRY0|B4DFX8|B4DUU6|P14786|Q53GK4|Q96E76|Q9BWB5|Q9UCV6|Q9UPF2	Silent	SNP	ENST00000335181.5	37	c.1224C>T	CCDS32284.1																																																																																				0.537	PKM-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420056.1			10	62	0	0	0	0.006214	0	10	62				
ABHD2	11057	broad.mit.edu	37	15	89719165	89719165	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr15:89719165C>A	ENST00000352732.5	+	6	1181	c.661C>A	c.(661-663)Cag>Aag	p.Q221K	ABHD2_ENST00000565973.1_Missense_Mutation_p.Q221K|ABHD2_ENST00000355100.3_Missense_Mutation_p.Q221K	NM_152924.4	NP_690888.1	P08910	ABHD2_HUMAN	abhydrolase domain containing 2	221					negative regulation of cell migration (GO:0030336)|response to wounding (GO:0009611)	integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|soft_tissue(1)	23	Lung NSC(78;0.0472)|all_lung(78;0.089)					GGGGGAGACTCAGGCAAACCA	0.552																																					Colon(11;252 417 24570 33239 41878)	Colon(11;252 417 24570 33239 41878)	uc002bnj.2		NA																	0				ovary(1)|lung(1)	2						c.(661-663)CAG>AAG		alpha/beta hydrolase domain containing protein							150.0	128.0	135.0					15																	89719165		2200	4299	6499	SO:0001583	missense	11057					integral to membrane	carboxylesterase activity	g.chr15:89719165C>A	X12433	CCDS10348.1	15q26.1	2006-10-06			ENSG00000140526	ENSG00000140526		"""Abhydrolase domain containing"""	18717	protein-coding gene	gene with protein product		612196					Standard	NM_152924		Approved	LABH2	uc002bnk.2	P08910	OTTHUMG00000148684	ENST00000352732.5:c.661C>A	15.37:g.89719165C>A	ENSP00000268129:p.Gln221Lys		Somatic				ABHD2_uc002bnk.2_Missense_Mutation_p.Q221K	p.Q221K	NM_007011	NP_008942	WXS	Illumina HiSeq	Unspecified	P08910	ABHD2_HUMAN			11	1578	+	Lung NSC(78;0.0472)|all_lung(78;0.089)		221					Q53G48|Q53GU0|Q5FVD9|Q8TC79	Missense_Mutation	SNP	ENST00000352732.5	37	c.661C>A	CCDS10348.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453436	0.63290	.	.	ENSG00000140526	ENST00000352732;ENST00000355100	T;T	0.61742	0.08;0.08	5.55	5.55	0.83447	Alpha/beta hydrolase fold-1 (1);	0.178707	0.49916	D	0.000130	T	0.39989	0.1099	N	0.04203	-0.255	0.58432	D	0.999996	B	0.19200	0.034	B	0.23018	0.043	T	0.21280	-1.0250	10	0.30854	T	0.27	1.7022	19.5044	0.95110	0.0:1.0:0.0:0.0	.	221	P08910	ABHD2_HUMAN	K	221	ENSP00000268129:Q221K;ENSP00000347217:Q221K	ENSP00000268129:Q221K	Q	+	1	0	ABHD2	87520169	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.811000	0.86092	2.591000	0.87537	0.643000	0.83706	CAG		0.552	ABHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309074.2			41	62	1	0	6.4771e-29	0.002522	1.14811e-28	41	62				
PRC1	9055	broad.mit.edu	37	15	91523510	91523510	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr15:91523510C>T	ENST00000361188.5	-	7	2143	c.932G>A	c.(931-933)aGc>aAc	p.S311N	PRC1-AS1_ENST00000554388.1_RNA|PRC1_ENST00000442656.2_Missense_Mutation_p.S270N|PRC1_ENST00000361919.3_Missense_Mutation_p.S311N|Y_RNA_ENST00000363272.1_RNA|PRC1_ENST00000394249.3_Missense_Mutation_p.S311N					protein regulator of cytokinesis 1											endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					CTGCTCCTGGCTATAAAAGCA	0.458																																							uc002bqm.2		NA																	0				ovary(1)|skin(1)	2						c.(931-933)AGC>AAC		protein regulator of cytokinesis 1 isoform 1							165.0	137.0	147.0					15																	91523510		2198	4298	6496	SO:0001583	missense	9055				cytokinesis|mitotic spindle elongation	cytoplasm|nucleus|spindle microtubule|spindle pole	protein binding	g.chr15:91523510C>T	AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.932G>A	15.37:g.91523510C>T	ENSP00000354679:p.Ser311Asn		Somatic				PRC1_uc002bqn.2_Missense_Mutation_p.S311N|PRC1_uc002bqo.2_Missense_Mutation_p.S311N|PRC1_uc010uqs.1_Missense_Mutation_p.S270N	p.S311N	NM_003981	NP_003972	WXS	Illumina HiSeq	Unspecified	O43663	PRC1_HUMAN			7	1089	-	Lung NSC(78;0.0987)|all_lung(78;0.175)		311			Dimerization.			Missense_Mutation	SNP	ENST00000361188.5	37	c.932G>A	CCDS45352.1	.	.	.	.	.	.	.	.	.	.	C	35	5.469111	0.96274	.	.	ENSG00000198901	ENST00000394249;ENST00000361919;ENST00000361188;ENST00000442656;ENST00000556982	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	6.17	6.17	0.99709	.	0.037821	0.85682	D	0.000000	T	0.77498	0.4139	M	0.85859	2.78	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.79108	0.986;0.986;0.991;0.992	T	0.77387	-0.2607	10	0.54805	T	0.06	.	20.4745	0.99168	0.0:1.0:0.0:0.0	.	270;311;311;311	O43663-3;F8W9B5;O43663-2;O43663	.;.;.;PRC1_HUMAN	N	311;311;311;270;85	ENSP00000377793:S311N;ENSP00000354618:S311N;ENSP00000354679:S311N;ENSP00000409549:S270N	ENSP00000354679:S311N	S	-	2	0	PRC1	89324514	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	5.730000	0.68546	2.941000	0.99782	0.655000	0.94253	AGC		0.458	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	NM_003981		40	49	0	0	0	0.00623	0	40	49				
SV2B	9899	broad.mit.edu	37	15	91835670	91835670	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr15:91835670C>T	ENST00000394232.1	+	13	2410	c.1940C>T	c.(1939-1941)tCt>tTt	p.S647F	SV2B_ENST00000330276.4_Missense_Mutation_p.S647F|SV2B_ENST00000545111.2_Missense_Mutation_p.S496F	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	647					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			ATCTTTGCTTCTTTTGTTGGG	0.488																																							uc002bqv.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(1939-1941)TCT>TTT		synaptic vesicle protein 2B homolog							153.0	141.0	145.0					15																	91835670		2198	4298	6496	SO:0001583	missense	9899				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr15:91835670C>T	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.1940C>T	15.37:g.91835670C>T	ENSP00000377779:p.Ser647Phe		Somatic				SV2B_uc010uqv.1_Missense_Mutation_p.S496F|SV2B_uc002bqu.3_RNA	p.S647F	NM_014848	NP_055663	WXS	Illumina HiSeq	Unspecified	Q7L1I2	SV2B_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0895)		12	2331	+	Lung NSC(78;0.0987)|all_lung(78;0.172)		647			Helical; (Potential).		B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	ENST00000394232.1	37	c.1940C>T	CCDS10370.1	.	.	.	.	.	.	.	.	.	.	.	34	5.329667	0.95733	.	.	ENSG00000185518	ENST00000545111;ENST00000394232;ENST00000330276	T;T;T	0.55052	0.54;0.54;0.54	6.12	6.12	0.99158	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.148807	0.64402	D	0.000007	T	0.69486	0.3116	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.60424	-0.7266	10	0.10111	T	0.7	-24.8671	19.4041	0.94641	0.0:1.0:0.0:0.0	.	647	Q7L1I2	SV2B_HUMAN	F	496;647;647	ENSP00000443243:S496F;ENSP00000377779:S647F;ENSP00000332818:S647F	ENSP00000332818:S647F	S	+	2	0	SV2B	89636674	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.588000	0.82629	2.932000	0.99384	0.644000	0.83932	TCT		0.488	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848		33	42	0	0	0	0.003271	0	33	42				
WASH3P	374666	broad.mit.edu	37	15	102514170	102514170	+	RNA	SNP	C	C	G	rs201086708	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr15:102514170C>G	ENST00000557932.1	+	0	763				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						ATGTTCCATCCTACCTGCCTG	0.582													c|||	134	0.0267572	0.0265	0.0144	5008	,	,		12142	0.001		0.008	False		,,,				2504	0.0818						uc002cdi.2		NA																	0					0						c.(139-141)TCC>TCG		RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;																																						374666							g.chr15:102514170C>G			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102514170C>G			Somatic				WASH3P_uc010utu.1_RNA|WASH3P_uc002cdl.2_Silent_p.S47S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Silent_p.S47S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_5'Flank	p.S47S	NR_003659		WXS	Illumina HiSeq	Unspecified					7	1561	+									Silent	SNP	ENST00000557932.1	37	c.141C>G																																																																																					0.582	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163		7	11	0	0	0	0.00308	0	7	11				
LUC7L	55692	broad.mit.edu	37	16	239225	239225	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr16:239225G>A	ENST00000293872.8	-	10	1198	c.1088C>T	c.(1087-1089)tCa>tTa	p.S363L	LUC7L_ENST00000337351.4_3'UTR|LUC7L_ENST00000397783.1_3'UTR|LA16c-OS12.2_ENST00000595428.1_lincRNA	NM_201412.1	NP_958815.1	Q9NQ29	LUC7L_HUMAN	LUC7-like (S. cerevisiae)	363					mRNA splice site selection (GO:0006376)|negative regulation of striated muscle tissue development (GO:0045843)	U1 snRNP (GO:0005685)	identical protein binding (GO:0042802)|mRNA binding (GO:0003729)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	11		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)				CTTCTCTTCTGACCTCCGTGA	0.572																																							uc002cgc.1		NA																	0				central_nervous_system(1)	1						c.(1087-1089)TCA>TTA		LUC7-like isoform b							102.0	116.0	111.0					16																	239225		2203	4300	6503	SO:0001583	missense	55692						metal ion binding	g.chr16:239225G>A	AY005111	CCDS10401.1, CCDS32348.1	16p13.3	2010-01-25	2001-11-28		ENSG00000007392	ENSG00000007392			6723	protein-coding gene	gene with protein product		607782	"""LUC7 (S. cerevisiae)-like"""				Standard	NM_201412		Approved	LUC7B1, hLuc7B1, Luc7	uc002cgc.1	Q9NQ29	OTTHUMG00000060730	ENST00000293872.8:c.1088C>T	16.37:g.239225G>A	ENSP00000293872:p.Ser363Leu		Somatic				LUC7L_uc002cga.1_3'UTR|LUC7L_uc002cgd.1_RNA|LUC7L_uc002cge.1_3'UTR|LUC7L_uc002cgb.1_Missense_Mutation_p.S277L	p.S363L	NM_201412	NP_958815	WXS	Illumina HiSeq	Unspecified	Q9NQ29	LUC7L_HUMAN			10	1199	-		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)	363					B8ZZ13|Q96S32|Q9NPH4	Missense_Mutation	SNP	ENST00000293872.8	37	c.1088C>T	CCDS32348.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758413	0.69763	.	.	ENSG00000007392	ENST00000293872;ENST00000429378	T	0.51817	0.69	5.1	5.1	0.69264	.	0.251958	0.33591	N	0.004748	T	0.42562	0.1208	L	0.54323	1.7	0.80722	D	1	P	0.43477	0.808	B	0.32864	0.154	T	0.54022	-0.8355	10	0.87932	D	0	.	17.5102	0.87758	0.0:0.0:1.0:0.0	.	363	Q9NQ29	LUC7L_HUMAN	L	363;162	ENSP00000413033:S162L	ENSP00000293872:S363L	S	-	2	0	LUC7L	179226	1.000000	0.71417	0.986000	0.45419	0.969000	0.65631	6.054000	0.71096	2.366000	0.80165	0.655000	0.94253	TCA		0.572	LUC7L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134239.1			9	171	0	0	0	0.008291	0	9	171				
PKD1	5310	broad.mit.edu	37	16	2153733	2153733	+	Silent	SNP	C	C	G	rs540387350	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr16:2153733C>G	ENST00000262304.4	-	23	8533	c.8325G>C	c.(8323-8325)acG>acC	p.T2775T	PKD1_ENST00000423118.1_Silent_p.T2775T|PKD1_ENST00000561991.1_5'UTR	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2775	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CGCCCGCCAGCGTCAGGGGCT	0.687																																							uc002cos.1		NA																	0				central_nervous_system(2)|skin(1)	3						c.(8323-8325)ACG>ACC		polycystin 1 isoform 1 precursor																																				SO:0001819	synonymous_variant	5310				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding	g.chr16:2153733C>G	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.8325G>C	16.37:g.2153733C>G			Somatic				PKD1_uc002cot.1_Silent_p.T2775T|PKD1_uc010bse.1_RNA	p.T2775T	NM_001009944	NP_001009944	WXS	Illumina HiSeq	Unspecified	P98161	PKD1_HUMAN			23	8534	-			2775			Extracellular (Potential).|REJ.		Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	c.8325G>C	CCDS32369.1																																																																																				0.687	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1			25	15	0	0	0	0.003954	0	25	15				
SRL	6345	broad.mit.edu	37	16	4254601	4254601	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr16:4254601C>A	ENST00000399609.3	-	2	108	c.96G>T	c.(94-96)ttG>ttT	p.L32F	SRL_ENST00000537996.1_5'UTR	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	491	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						AGCGGTCCCTCAATGGGGCTT	0.572																																							uc002cvz.3		NA																	0				ovary(3)|skin(2)	5						c.(94-96)TTG>TTT		sarcalumenin							138.0	135.0	136.0					16																	4254601		1937	4143	6080	SO:0001583	missense	6345					sarcoplasmic reticulum lumen	GTP binding|GTPase activity	g.chr16:4254601C>A	AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.96G>T	16.37:g.4254601C>A	ENSP00000382518:p.Leu32Phe		Somatic				SRL_uc002cvy.3_RNA	p.L32F	NM_001098814	NP_001092284	WXS	Illumina HiSeq	Unspecified	Q86TD4	SRCA_HUMAN			2	109	-			491						Missense_Mutation	SNP	ENST00000399609.3	37	c.96G>T	CCDS42113.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069992	0.36566	.	.	ENSG00000185739	ENST00000399609;ENST00000330063	T	0.33438	1.41	5.6	4.56	0.56223	.	0.987163	0.08216	U	0.979956	T	0.30103	0.0754	L	0.54323	1.7	0.80722	D	1	B	0.32467	0.372	B	0.27715	0.082	T	0.20571	-1.0271	10	0.59425	D	0.04	-1.7389	9.5826	0.39497	0.0:0.8136:0.0:0.1864	.	32	Q86TD4-2	.	F	32;490	ENSP00000382518:L32F	ENSP00000333285:L490F	L	-	3	2	SRL	4194602	1.000000	0.71417	0.996000	0.52242	0.654000	0.38779	2.457000	0.45005	2.640000	0.89533	0.655000	0.94253	TTG		0.572	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438087.1	XM_064152		15	72	1	0	0.000219431	0.00245	0.000321267	15	72				
SALL1	6299	broad.mit.edu	37	16	51174808	51174808	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr16:51174808G>A	ENST00000251020.4	-	2	1358	c.1325C>T	c.(1324-1326)tCc>tTc	p.S442F	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.S345F|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	442					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TGCCTCATCGGAAGTACTTTT	0.498																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	0				skin(5)|ovary(3)	8						c.(1324-1326)TCC>TTC		sal-like 1 isoform a							109.0	102.0	104.0					16																	51174808		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51174808G>A	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1325C>T	16.37:g.51174808G>A	ENSP00000251020:p.Ser442Phe		Somatic				SALL1_uc010vgr.1_Missense_Mutation_p.S345F|SALL1_uc010cbv.2_Intron	p.S442F	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	1356	-		all_cancers(37;0.0322)	442					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.1325C>T	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900789	0.72754	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.08807	3.05;3.06	5.18	5.18	0.71444	.	0.054146	0.85682	D	0.000000	T	0.26882	0.0658	M	0.74881	2.28	0.80722	D	1	D	0.64830	0.994	P	0.58077	0.832	T	0.01743	-1.1283	10	0.87932	D	0	.	18.685	0.91560	0.0:0.0:1.0:0.0	.	442	Q9NSC2	SALL1_HUMAN	F	442;345;406	ENSP00000251020:S442F;ENSP00000407914:S345F	ENSP00000251020:S442F	S	-	2	0	SALL1	49732309	1.000000	0.71417	0.807000	0.32361	0.971000	0.66376	9.864000	0.99589	2.386000	0.81285	0.563000	0.77884	TCC		0.498	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		6	95	0	0	0	0.001168	0	6	95				
RPGRIP1L	23322	broad.mit.edu	37	16	53726277	53726277	+	Splice_Site	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr16:53726277C>A	ENST00000379925.3	-	4	281		c.e4-1		RPGRIP1L_ENST00000564374.1_Splice_Site|RPGRIP1L_ENST00000563746.1_Splice_Site|RPGRIP1L_ENST00000262135.4_Splice_Site	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like						camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				GGTGGCCATTCTGGGGAAATA	0.433																																							uc002ehp.2		NA																	0				ovary(1)	1						c.e4-1		RPGRIP1-like isoform a							73.0	86.0	82.0					16																	53726277		2163	4290	6453	SO:0001630	splice_region_variant	23322				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding	g.chr16:53726277C>A		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.231-1G>T	16.37:g.53726277C>A			Somatic				RPGRIP1L_uc002eho.3_Splice_Site_p.R77_splice|RPGRIP1L_uc010vgy.1_Splice_Site_p.R77_splice|RPGRIP1L_uc010cbx.2_Splice_Site_p.R77_splice|RPGRIP1L_uc010vgz.1_Splice_Site_p.R77_splice|RPGRIP1L_uc002ehq.1_Splice_Site_p.R77_splice	p.R77_splice	NM_015272	NP_056087	WXS	Illumina HiSeq	Unspecified	Q68CZ1	FTM_HUMAN			4	295	-		all_cancers(37;0.0973)						A0PJ88|Q9Y2K8	Splice_Site	SNP	ENST00000379925.3	37	c.231_splice	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372757	0.61624	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1374	0.98035	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RPGRIP1L	52283778	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.982000	0.76173	2.763000	0.94921	0.563000	0.77884	.		0.433	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	Intron	15	92	1	0	4.7546e-09	0.004007	7.49982e-09	15	92				
CDK10	8558	broad.mit.edu	37	16	89762019	89762019	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr16:89762019C>T	ENST00000353379.7	+	13	1045	c.1002C>T	c.(1000-1002)ctC>ctT	p.L334L	CDK10_ENST00000505473.1_Intron|CDK10_ENST00000331006.8_Silent_p.L287L	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	334					negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		AGCCGGAGCTCATGCCGACCT	0.682																																							uc010cio.2		NA																	0				ovary(1)	1						c.(1000-1002)CTC>CTT		cyclin-dependent kinase 10 isoform a							19.0	25.0	23.0					16																	89762019		2189	4296	6485	SO:0001819	synonymous_variant	8558				negative regulation of cell proliferation|traversing start control point of mitotic cell cycle		ATP binding|cyclin-dependent protein kinase activity|protein binding	g.chr16:89762019C>T	L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.1002C>T	16.37:g.89762019C>T			Somatic				CDK10_uc002fod.2_Intron|CDK10_uc002foe.2_Silent_p.L263L|CDK10_uc002fof.2_Silent_p.L257L|CDK10_uc002fog.3_Intron|CDK10_uc002foh.3_Silent_p.L263L|CDK10_uc002foi.2_RNA	p.L334L	NM_052988	NP_443714	WXS	Illumina HiSeq	Unspecified	Q15131	CDK10_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0276)	13	1045	+		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)	334					A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Silent	SNP	ENST00000353379.7	37	c.1002C>T	CCDS10984.2																																																																																				0.682	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269925.2			3	8	0	0	0	0.004672	0	3	8				
METTL16	79066	broad.mit.edu	37	17	2367611	2367611	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:2367611G>C	ENST00000263092.6	-	6	746	c.619C>G	c.(619-621)Cct>Gct	p.P207A	METTL16_ENST00000571669.2_5'UTR|METTL16_ENST00000538844.1_5'UTR	NM_024086.3	NP_076991.3	Q86W50	MET16_HUMAN	methyltransferase like 16	207							methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(9)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	19						ACAGAACTAGGCGGAGGTCTT	0.398																																							uc002fut.2		NA																	0					0						c.(619-621)CCT>GCT		methyltransferase 10 domain containing							143.0	127.0	132.0					17																	2367611		1855	4087	5942	SO:0001583	missense	79066						methyltransferase activity	g.chr17:2367611G>C	AK027410	CCDS42232.1	17p13.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000127804	ENSG00000127804			28484	protein-coding gene	gene with protein product			"""methyltransferase 10 domain containing"""	METT10D		18021804	Standard	NM_024086		Approved	MGC3329	uc002fut.3	Q86W50		ENST00000263092.6:c.619C>G	17.37:g.2367611G>C	ENSP00000263092:p.Pro207Ala		Somatic				METT10D_uc002fuu.3_RNA|METT10D_uc010cka.2_RNA|METT10D_uc002fuv.2_Missense_Mutation_p.P207A|METT10D_uc010vqx.1_RNA|METT10D_uc010vqy.1_5'UTR	p.P207A	NM_024086	NP_076991	WXS	Illumina HiSeq	Unspecified	Q86W50	MET16_HUMAN			6	767	-			207					D3DTI8|Q86TE5|Q96T16|Q9BVG7	Missense_Mutation	SNP	ENST00000263092.6	37	c.619C>G	CCDS42232.1	.	.	.	.	.	.	.	.	.	.	G	31	5.063173	0.93898	.	.	ENSG00000127804	ENST00000263092;ENST00000399834	T	0.51325	0.71	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.66877	0.2834	M	0.64080	1.96	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.76071	0.987;0.98	T	0.66312	-0.5955	10	0.52906	T	0.07	-17.1227	17.3068	0.87197	0.0:0.0:1.0:0.0	.	207;207	Q86W50-2;Q86W50	.;MET16_HUMAN	A	207	ENSP00000263092:P207A	ENSP00000263092:P207A	P	-	1	0	METTL16	2314361	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.807000	0.99171	2.683000	0.91414	0.591000	0.81541	CCT		0.398	METTL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437653.2	NM_024086		16	24	0	0	0	0.004007	0	16	24				
ZZEF1	23140	broad.mit.edu	37	17	3917482	3917482	+	Splice_Site	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:3917482C>A	ENST00000381638.2	-	51	8439	c.8315G>T	c.(8314-8316)gGa>gTa	p.G2772V		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2772							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CAGAGTGTCTCCTAGGCACAC	0.547																																							uc002fxe.2		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(8314-8316)GGA>GTA		zinc finger, ZZ type with EF hand domain 1							82.0	68.0	72.0					17																	3917482		2203	4300	6503	SO:0001630	splice_region_variant	23140						calcium ion binding|zinc ion binding	g.chr17:3917482C>A	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.8315-1G>T	17.37:g.3917482C>A			Somatic				ZZEF1_uc002fxg.1_Missense_Mutation_p.G93V	p.G2772V	NM_015113	NP_055928	WXS	Illumina HiSeq	Unspecified	O43149	ZZEF1_HUMAN			51	8379	-			2772					A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	c.8315G>T	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.556853	0.86231	.	.	ENSG00000074755	ENST00000381638	T	0.29917	1.55	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.48077	0.1480	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.48547	-0.9026	10	0.87932	D	0	.	19.3539	0.94402	0.0:1.0:0.0:0.0	.	2772	O43149	ZZEF1_HUMAN	V	2772	ENSP00000371051:G2772V	ENSP00000371051:G2772V	G	-	2	0	ZZEF1	3864231	1.000000	0.71417	1.000000	0.80357	0.668000	0.39293	7.462000	0.80851	2.564000	0.86499	0.655000	0.94253	GGA		0.547	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	Missense_Mutation	7	18	1	0	0.00307968	0.00308	0.00442339	7	18				
SENP3	26168	broad.mit.edu	37	17	7468082	7468082	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:7468082C>T	ENST00000429205.2	+	3	905	c.856C>T	c.(856-858)Cag>Tag	p.Q286*	SENP3_ENST00000578868.1_3'UTR|SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000321337.7_Nonsense_Mutation_p.Q286*			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3	286						cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				GGAGCTTTTTCAGGGCTCAGA	0.617																																							uc002ghm.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(856-858)CAG>TAG		SUMO1/sentrin/SMT3 specific protease 3							42.0	47.0	45.0					17																	7468082		1967	4164	6131	SO:0001587	stop_gained	26168				proteolysis	MLL1 complex|nucleolus	cysteine-type peptidase activity	g.chr17:7468082C>T	AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.856C>T	17.37:g.7468082C>T	ENSP00000403712:p.Gln286*		Somatic				EIF4A1_uc002gho.1_5'Flank|SENP3_uc002ghn.1_Nonsense_Mutation_p.Q121*	p.Q286*	NM_015670	NP_056485	WXS	Illumina HiSeq	Unspecified	Q9H4L4	SENP3_HUMAN			3	1129	+		Prostate(122;0.157)	286					Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Nonsense_Mutation	SNP	ENST00000429205.2	37	c.856C>T		.	.	.	.	.	.	.	.	.	.	C	39	7.879583	0.98539	.	.	ENSG00000161956	ENST00000321337;ENST00000429205	.	.	.	5.98	5.98	0.97165	.	0.117651	0.38778	N	0.001579	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-4.314	15.9367	0.79717	0.0:1.0:0.0:0.0	.	.	.	.	X	286	.	ENSP00000314029:Q286X	Q	+	1	0	SENP3	7408806	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.750000	0.38329	2.837000	0.97791	0.591000	0.81541	CAG		0.617	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015670		7	38	0	0	0	0.00308	0	7	38				
MYH4	4622	broad.mit.edu	37	17	10363311	10363311	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:10363311G>T	ENST00000255381.2	-	14	1484	c.1374C>A	c.(1372-1374)taC>taA	p.Y458*	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	458	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CCCCGATGAAGTACTGCCTGG	0.498																																							uc002gmn.2		NA																	0				ovary(10)|skin(2)|central_nervous_system(1)	13						c.(1372-1374)TAC>TAA		myosin, heavy polypeptide 4, skeletal muscle							169.0	163.0	165.0					17																	10363311		2203	4297	6500	SO:0001587	stop_gained	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10363311G>T		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1374C>A	17.37:g.10363311G>T	ENSP00000255381:p.Tyr458*		Somatic				uc002gml.1_Intron	p.Y458*	NM_017533	NP_060003	WXS	Illumina HiSeq	Unspecified	Q9Y623	MYH4_HUMAN			14	1485	-			458			Myosin head-like.			Nonsense_Mutation	SNP	ENST00000255381.2	37	c.1374C>A	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	38	6.717386	0.97784	.	.	ENSG00000141048	ENST00000255381	.	.	.	5.34	3.1	0.35709	.	0.000000	0.34268	U	0.004106	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	9.0459	0.36347	0.2661:0.0:0.7339:0.0	.	.	.	.	X	458	.	ENSP00000255381:Y458X	Y	-	3	2	MYH4	10304036	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.991000	0.49409	0.567000	0.29293	0.650000	0.86243	TAC		0.498	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		46	77	1	0	1.07234e-20	0.00361	1.83336e-20	46	77				
MYH2	4620	broad.mit.edu	37	17	10426935	10426935	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:10426935G>A	ENST00000245503.5	-	37	5734	c.5350C>T	c.(5350-5352)Cac>Tac	p.H1784Y	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Missense_Mutation_p.H1784Y|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1784					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CGCTCCAGGTGGGCGCTGGTG	0.517																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(5350-5352)CAC>TAC		myosin heavy chain IIa							108.0	110.0	109.0					17																	10426935		2203	4298	6501	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10426935G>A		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5350C>T	17.37:g.10426935G>A	ENSP00000245503:p.His1784Tyr		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.H1784Y|MYH2_uc010coj.2_Intron	p.H1784Y	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			37	5478	-			1784			Potential.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.5350C>T	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592195	0.86953	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.79033	-1.23;-1.23	5.46	5.46	0.80206	Myosin tail (1);	0.000000	0.41396	U	0.000886	D	0.92344	0.7571	H	0.97158	3.95	0.58432	D	0.999999	D	0.60575	0.988	D	0.69142	0.962	D	0.94132	0.7389	10	0.72032	D	0.01	.	19.5721	0.95425	0.0:0.0:1.0:0.0	.	1784	Q9UKX2	MYH2_HUMAN	Y	1784	ENSP00000245503:H1784Y;ENSP00000380367:H1784Y	ENSP00000245503:H1784Y	H	-	1	0	MYH2	10367660	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.653000	0.98506	2.857000	0.98124	0.650000	0.86243	CAC		0.517	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		6	91	0	0	0	0.001168	0	6	91				
MYH2	4620	broad.mit.edu	37	17	10451137	10451137	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:10451137G>T	ENST00000245503.5	-	3	485	c.101C>A	c.(100-102)gCc>gAc	p.A34D	MYH2_ENST00000532183.2_Missense_Mutation_p.A34D|MYH2_ENST00000397183.2_Missense_Mutation_p.A34D|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	34					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						AGATGTTTTGGCATCAAAGGG	0.507																																							uc010coi.2		NA																	0				ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(100-102)GCC>GAC		myosin heavy chain IIa							110.0	104.0	106.0					17																	10451137		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10451137G>T		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.101C>A	17.37:g.10451137G>T	ENSP00000245503:p.Ala34Asp		Somatic				uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.A34D|MYH2_uc010coj.2_Missense_Mutation_p.A34D	p.A34D	NM_001100112	NP_001093582	WXS	Illumina HiSeq	Unspecified	Q9UKX2	MYH2_HUMAN			3	229	-			34			Myosin head-like.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.101C>A	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448512	0.84101	.	.	ENSG00000125414	ENST00000532288;ENST00000532183;ENST00000245503;ENST00000397183;ENST00000420805;ENST00000431502	D;D;D;T;T	0.87103	-2.21;-1.99;-1.99;-1.08;-1.39	5.67	5.67	0.87782	.	0.000000	0.39020	U	0.001488	D	0.85741	0.5767	L	0.43152	1.355	0.54753	D	0.999987	B;P	0.37548	0.399;0.599	B;B	0.39805	0.18;0.31	D	0.86585	0.1856	10	0.72032	D	0.01	.	18.7471	0.91797	0.0:0.0:1.0:0.0	.	34;34	Q567P6;Q9UKX2	.;MYH2_HUMAN	D	34	ENSP00000433944:A34D;ENSP00000245503:A34D;ENSP00000380367:A34D;ENSP00000399348:A34D;ENSP00000416072:A34D	ENSP00000245503:A34D	A	-	2	0	MYH2	10391862	0.985000	0.35326	1.000000	0.80357	0.930000	0.56654	2.633000	0.46519	2.670000	0.90874	0.650000	0.86243	GCC		0.507	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		6	63	1	0	0.00116845	0.001168	0.00169201	6	63				
DNAH9	1770	broad.mit.edu	37	17	11837248	11837248	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:11837248C>A	ENST00000262442.4	+	65	12417	c.12349C>A	c.(12349-12351)Cat>Aat	p.H4117N	DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000608377.1_Missense_Mutation_p.H429N|DNAH9_ENST00000454412.2_Missense_Mutation_p.H4041N	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	4117					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GTATGGAGGCCATATCACAGA	0.488																																							uc002gne.2		NA																	0				skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(12349-12351)CAT>AAT		dynein, axonemal, heavy chain 9 isoform 2							98.0	93.0	95.0					17																	11837248		2203	4300	6503	SO:0001583	missense	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11837248C>A	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.12349C>A	17.37:g.11837248C>A	ENSP00000262442:p.His4117Asn		Somatic				DNAH9_uc010coo.2_Missense_Mutation_p.H3335N|DNAH9_uc002gnf.2_Missense_Mutation_p.H429N	p.H4117N	NM_001372	NP_001363	WXS	Illumina HiSeq	Unspecified	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	65	12417	+		Breast(5;0.0122)|all_epithelial(5;0.131)	4117					A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	c.12349C>A	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.666425	0.88251	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001	T;T;T	0.09911	2.93;2.93;2.93	5.0	5.0	0.66597	Dynein heavy chain (1);	0.157692	0.56097	D	0.000025	T	0.52869	0.1761	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72937	-0.4140	10	0.87932	D	0	.	18.8498	0.92224	0.0:1.0:0.0:0.0	.	4117	Q9NYC9	DYH9_HUMAN	N	4117;4041;2623;429	ENSP00000262442:H4117N;ENSP00000414874:H4041N;ENSP00000379323:H429N	ENSP00000262442:H4117N	H	+	1	0	DNAH9	11777973	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	7.609000	0.82925	2.761000	0.94854	0.650000	0.86243	CAT		0.488	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		12	27	1	0	0.00010058	0.001368	0.000147666	12	27				
COPS3	8533	broad.mit.edu	37	17	17171207	17171207	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:17171207G>C	ENST00000268717.5	-	5	539	c.433C>G	c.(433-435)Ctc>Gtc	p.L145V	COPS3_ENST00000539941.2_Missense_Mutation_p.L125V|COPS3_ENST00000439936.2_Missense_Mutation_p.L125V	NM_003653.3	NP_003644.2	Q9UNS2	CSN3_HUMAN	COP9 signalosome subunit 3	145					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				NS(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						ACCTGGCAGAGATCAGCATGT	0.453																																							uc002grd.2		NA																	0				skin(1)	1						c.(433-435)CTC>GTC		COP9 constitutive photomorphogenic homolog							275.0	202.0	227.0					17																	17171207		2203	4300	6503	SO:0001583	missense	8533				cullin deneddylation|response to light stimulus|signal transduction	cytoplasm|signalosome	protein binding	g.chr17:17171207G>C	AF031647	CCDS11183.1, CCDS56022.1	17p11.2	2013-03-14	2013-03-14		ENSG00000141030	ENSG00000141030			2239	protein-coding gene	gene with protein product		604665	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 3"", ""COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)"""			9535219, 10191102	Standard	NM_003653		Approved	SGN3, CSN3	uc002grd.3	Q9UNS2	OTTHUMG00000059281	ENST00000268717.5:c.433C>G	17.37:g.17171207G>C	ENSP00000268717:p.Leu145Val		Somatic				COPS3_uc010vwv.1_Missense_Mutation_p.L125V|COPS3_uc010vww.1_Missense_Mutation_p.L15V	p.L145V	NM_003653	NP_003644	WXS	Illumina HiSeq	Unspecified	Q9UNS2	CSN3_HUMAN			5	524	-			145					B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	ENST00000268717.5	37	c.433C>G	CCDS11183.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438007	0.83885	.	.	ENSG00000141030	ENST00000268717;ENST00000539941;ENST00000417352;ENST00000439936	T;T;T	0.70045	-0.45;-0.45;-0.45	5.34	5.34	0.76211	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.70587	0.3241	M	0.72353	2.195	0.80722	D	1	P	0.42518	0.782	B	0.43194	0.411	T	0.72398	-0.4306	10	0.41790	T	0.15	-14.8112	18.0332	0.89291	0.0:0.0:1.0:0.0	.	145	Q9UNS2	CSN3_HUMAN	V	145;125;145;169	ENSP00000268717:L145V;ENSP00000437606:L125V;ENSP00000409028:L145V	ENSP00000268717:L145V	L	-	1	0	COPS3	17111932	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.746000	0.98859	2.485000	0.83878	0.650000	0.86243	CTC		0.453	COPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131603.2			29	34	0	0	0	0.008361	0	29	34				
BRCA1	672	broad.mit.edu	37	17	41226380	41226380	+	Missense_Mutation	SNP	G	G	A	rs273900737		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:41226380G>A	ENST00000357654.3	-	14	4761	c.4643C>T	c.(4642-4644)aCg>aTg	p.T1548M	BRCA1_ENST00000351666.3_Missense_Mutation_p.T365M|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000309486.4_Missense_Mutation_p.T1252M|BRCA1_ENST00000493795.1_Missense_Mutation_p.T1501M|BRCA1_ENST00000352993.3_Missense_Mutation_p.T406M|BRCA1_ENST00000346315.3_Intron|BRCA1_ENST00000491747.2_Missense_Mutation_p.T444M|BRCA1_ENST00000354071.3_Intron|BRCA1_ENST00000591534.1_Missense_Mutation_p.T39M|BRCA1_ENST00000471181.2_Missense_Mutation_p.T1569M|BRCA1_ENST00000468300.1_Missense_Mutation_p.T444M	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1548					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AGATGTTTCCGTCAAATCGTG	0.413			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													uc002icq.2		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	D|Mis|N|F|S	familial breast/ovarian cancer gene 1			E		breast|ovarian	ovarian		0				ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52						c.(4642-4644)ACG>ATG	Homologous_recombination	breast cancer 1, early onset isoform 1							138.0	145.0	142.0					17																	41226380		2203	4300	6503	SO:0001583	missense	672	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	Familial Cancer Database		androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr17:41226380G>A	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4643C>T	17.37:g.41226380G>A	ENSP00000350283:p.Thr1548Met	TCGA Ovarian(2;0.000030)	Somatic				BRCA1_uc010whp.1_Missense_Mutation_p.T397M|BRCA1_uc010whl.1_Missense_Mutation_p.T444M|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.T1477M|BRCA1_uc002icu.2_Missense_Mutation_p.T444M|BRCA1_uc010cyx.2_Missense_Mutation_p.T1501M|BRCA1_uc002ict.2_Missense_Mutation_p.T1569M|BRCA1_uc010whn.1_Missense_Mutation_p.T39M|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Missense_Mutation_p.T277M|BRCA1_uc002idc.1_Missense_Mutation_p.T444M|BRCA1_uc010whr.1_Missense_Mutation_p.T398M	p.T1548M	NM_007294	NP_009225	WXS	Illumina HiSeq	Unspecified	P38398	BRCA1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.126)	14	4875	-		Breast(137;0.000717)	1548					O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	c.4643C>T	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	G	3.615	-0.078762	0.07141	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000352993;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919	D;D;D;D;D;D;D;D;D;D	0.90444	-2.28;-2.36;-2.42;-2.18;-2.26;-2.67;-2.41;-2.14;-1.92;-2.34	5.21	0.285	0.15705	.	0.803958	0.11407	N	0.567154	T	0.72479	0.3465	N	0.04203	-0.255	0.09310	N	1	B;B;B;B;B;B;B;B	0.11235	0.0;0.001;0.0;0.004;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.08055	0.0;0.0;0.0;0.003;0.0;0.0;0.0;0.0	T	0.58612	-0.7606	10	0.20046	T	0.44	.	0.773	0.01027	0.486:0.168:0.1842:0.1618	.	444;397;443;445;444;1570;1548;1548	E7EUM2;B4DES0;E7ETR2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2	.;.;.;.;.;.;BRCA1_HUMAN;.	M	1548;1569;406;365;1252;444;397;1570;1501;443;444;319;398	ENSP00000350283:T1548M;ENSP00000312236:T406M;ENSP00000338007:T365M;ENSP00000310938:T1252M;ENSP00000417148:T444M;ENSP00000377294:T397M;ENSP00000418775:T1501M;ENSP00000420412:T444M;ENSP00000419481:T319M;ENSP00000418819:T398M	ENSP00000310938:T1252M	T	-	2	0	BRCA1	38479906	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	0.095000	0.15127	-0.064000	0.13043	-0.247000	0.11927	ACG		0.413	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		7	63	0	0	0	0.00308	0	7	63				
RSAD1	55316	broad.mit.edu	37	17	48560834	48560834	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:48560834G>A	ENST00000258955.2	+	6	1123	c.1038G>A	c.(1036-1038)ctG>ctA	p.L346L		NM_018346.1	NP_060816.1	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing 1	346					porphyrin-containing compound biosynthetic process (GO:0006779)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|coproporphyrinogen oxidase activity (GO:0004109)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GTGTCCCCCTGGGCAGGCTGG	0.577																																							uc002iqw.1		NA																	0					0						c.(1036-1038)CTG>CTA		radical S-adenosyl methionine domain containing							38.0	41.0	40.0					17																	48560834		2203	4300	6503	SO:0001819	synonymous_variant	55316				porphyrin biosynthetic process	mitochondrion	4 iron, 4 sulfur cluster binding|coproporphyrinogen oxidase activity|metal ion binding	g.chr17:48560834G>A	AK002026	CCDS11569.1	17q21.33	2004-11-08			ENSG00000136444	ENSG00000136444			25634	protein-coding gene	gene with protein product						12477932	Standard	NM_018346		Approved	FLJ11164	uc002iqw.1	Q9HA92	OTTHUMG00000162126	ENST00000258955.2:c.1038G>A	17.37:g.48560834G>A			Somatic				RSAD1_uc010wmq.1_RNA	p.L346L	NM_018346	NP_060816	WXS	Illumina HiSeq	Unspecified	Q9HA92	RSAD1_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.55e-09)		6	1094	+	Breast(11;1.93e-18)		346					B4DMW0|Q53HV8|Q86VC4|Q9BRY7|Q9NUS7	Silent	SNP	ENST00000258955.2	37	c.1038G>A	CCDS11569.1																																																																																				0.577	RSAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367413.1	NM_018346		11	10	0	0	0	0.001368	0	11	10				
HLF	3131	broad.mit.edu	37	17	53398181	53398181	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:53398181G>A	ENST00000226067.5	+	4	1302	c.829G>A	c.(829-831)Gag>Aag	p.E277K	HLF_ENST00000575307.1_3'UTR|HLF_ENST00000575345.1_Missense_Mutation_p.E192K|HLF_ENST00000430986.2_Missense_Mutation_p.E192K|HLF_ENST00000573945.1_Missense_Mutation_p.E192K	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	277	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(2)	3						CTTGAGGAAGGAGCTGGGCAA	0.582			T	TCF3	ALL																																		uc002iug.1		NA		Dom	yes		17	17q22	3131	T	hepatic leukemia factor			L	TCF3		ALL		0				ovary(2)	2						c.(829-831)GAG>AAG		hepatic leukemia factor							33.0	33.0	33.0					17																	53398181		2203	4300	6503	SO:0001583	missense	3131				multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:53398181G>A		CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.829G>A	17.37:g.53398181G>A	ENSP00000226067:p.Glu277Lys		Somatic				HLF_uc010dce.1_Missense_Mutation_p.E192K|HLF_uc002iuh.2_Missense_Mutation_p.E192K|HLF_uc010wni.1_Missense_Mutation_p.E224K	p.E277K	NM_002126	NP_002117	WXS	Illumina HiSeq	Unspecified	Q16534	HLF_HUMAN			4	1354	+			277					A8K1X8|Q6FHS9	Missense_Mutation	SNP	ENST00000226067.5	37	c.829G>A	CCDS11585.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258157	0.80246	.	.	ENSG00000108924	ENST00000226067;ENST00000430986	T;T	0.51817	0.69;0.69	5.77	4.8	0.61643	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.000000	0.85682	D	0.000000	T	0.73837	0.3638	M	0.91038	3.17	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.995;0.998	T	0.78807	-0.2059	10	0.46703	T	0.11	.	13.9362	0.64026	0.0727:0.0:0.9273:0.0	.	225;277	B4DIQ5;Q16534	.;HLF_HUMAN	K	277;192	ENSP00000226067:E277K;ENSP00000402496:E192K	ENSP00000226067:E277K	E	+	1	0	HLF	50753180	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.476000	0.97823	1.449000	0.47699	-0.140000	0.14226	GAG		0.582	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439185.1	NM_002126		4	33	0	0	0	0.000248	0	4	33				
LPO	4025	broad.mit.edu	37	17	56343594	56343594	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:56343594C>T	ENST00000262290.4	+	11	1916	c.1600C>T	c.(1600-1602)Ctg>Ttg	p.L534L	LPO_ENST00000421678.2_Silent_p.L451L|LPO_ENST00000543544.1_Silent_p.L475L|LPO_ENST00000582328.1_Silent_p.L451L	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	534					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						GACTGGAGAGCTGCGCAACAA	0.542																																							uc002ivt.2		NA																	0				ovary(1)|breast(1)	2						c.(1600-1602)CTG>TTG		lactoperoxidase isoform 1 preproprotein							66.0	58.0	61.0					17																	56343594		2203	4300	6503	SO:0001819	synonymous_variant	4025				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr17:56343594C>T	M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1600C>T	17.37:g.56343594C>T			Somatic				LPO_uc010wns.1_Silent_p.L475L|LPO_uc010dcp.2_Silent_p.L451L|LPO_uc010dcq.2_Silent_p.L205L|LPO_uc010dcr.2_Silent_p.L97L	p.L534L	NM_006151	NP_006142	WXS	Illumina HiSeq	Unspecified	P22079	PERL_HUMAN			11	1916	+			534					A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Silent	SNP	ENST00000262290.4	37	c.1600C>T	CCDS32689.1																																																																																				0.542	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443961.1			6	42	0	0	0	0.001168	0	6	42				
GRIN2C	2905	broad.mit.edu	37	17	72846028	72846028	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:72846028G>A	ENST00000293190.5	-	7	1682	c.1536C>T	c.(1534-1536)atC>atT	p.I512I	GRIN2C_ENST00000347612.4_Silent_p.I512I|GRIN2C_ENST00000578159.1_5'Flank	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	512					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTTCCTCATTGATGGTGAGGG	0.617																																							uc002jlt.1		NA																	0				ovary(2)|breast(2)	4						c.(1534-1536)ATC>ATT		N-methyl-D-aspartate receptor subunit 2C	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)						101.0	93.0	96.0					17																	72846028		2203	4300	6503	SO:0001819	synonymous_variant	2905				glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity	g.chr17:72846028G>A		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.1536C>T	17.37:g.72846028G>A			Somatic				GRIN2C_uc010wrh.1_RNA|GRIN2C_uc002jlu.1_Silent_p.I512I	p.I512I	NM_000835	NP_000826	WXS	Illumina HiSeq	Unspecified	Q14957	NMDE3_HUMAN			7	1692	-	all_lung(278;0.172)|Lung NSC(278;0.207)		512			Extracellular (Potential).		B2RTT1	Silent	SNP	ENST00000293190.5	37	c.1536C>T	CCDS32724.1																																																																																				0.617	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1			10	76	0	0	0	0.000978	0	10	76				
ITGB4	3691	broad.mit.edu	37	17	73736482	73736482	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:73736482G>A	ENST00000200181.3	+	21	2677	c.2490G>A	c.(2488-2490)gaG>gaA	p.E830E	ITGB4_ENST00000450894.3_Silent_p.E830E|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000449880.2_Silent_p.E830E|ITGB4_ENST00000339591.3_Silent_p.E830E|ITGB4_ENST00000579662.1_Silent_p.E830E	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	830					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTTGCACCGAGAACCTGCTGA	0.647																																							uc002jpg.2		NA																	0				lung(4)	4						c.(2488-2490)GAG>GAA		integrin beta 4 isoform 1 precursor							58.0	53.0	55.0					17																	73736482		2203	4300	6503	SO:0001819	synonymous_variant	3691				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity	g.chr17:73736482G>A		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.2490G>A	17.37:g.73736482G>A			Somatic				ITGB4_uc002jph.2_Silent_p.E830E|ITGB4_uc010dgo.2_Silent_p.E830E|ITGB4_uc002jpi.3_Silent_p.E830E|ITGB4_uc010dgp.1_Silent_p.E830E|ITGB4_uc002jpj.2_Silent_p.E830E	p.E830E	NM_000213	NP_000204	WXS	Illumina HiSeq	Unspecified	P16144	ITB4_HUMAN	all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)		21	2677	+	all_cancers(13;1.5e-07)		830			Cytoplasmic (Potential).		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Silent	SNP	ENST00000200181.3	37	c.2490G>A	CCDS11727.1																																																																																				0.647	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1			8	72	0	0	0	0.008291	0	8	72				
ACTG1	71	broad.mit.edu	37	17	79479022	79479022	+	Missense_Mutation	SNP	G	G	C	rs11549209		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:79479022G>C	ENST00000575842.1	-	2	696	c.270C>G	c.(268-270)ttC>ttG	p.F90L	ACTG1_ENST00000575087.1_Missense_Mutation_p.F90L|ACTG1_ENST00000573283.1_Missense_Mutation_p.F90L|RP13-766D20.2_ENST00000430912.1_RNA|ACTG1_ENST00000331925.2_Missense_Mutation_p.F90L|AC139149.1_ENST00000584254.1_RNA			P63261	ACTG_HUMAN	actin, gamma 1	90					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			GCTCGTTGTAGAAGGTGTGGT	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		18357	0.0		0.001	False		,,,				2504	0.0						uc002kaj.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(268-270)TTC>TTG		actin, gamma 1 propeptide							60.0	63.0	62.0					17																	79479022		2203	4300	6503	SO:0001583	missense	71				adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol	ATP binding|identical protein binding	g.chr17:79479022G>C		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.270C>G	17.37:g.79479022G>C	ENSP00000458162:p.Phe90Leu		Somatic				ACTG1_uc002kah.1_5'Flank|ACTG1_uc002kai.1_Missense_Mutation_p.F47L|ACTG1_uc002kak.1_Missense_Mutation_p.F90L|ACTG1_uc010wun.1_Missense_Mutation_p.F90L|ACTG1_uc002kal.1_Missense_Mutation_p.F90L|ACTG1_uc002kag.2_RNA	p.F90L	NM_001614	NP_001605	WXS	Illumina HiSeq	Unspecified	P63261	ACTG_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)		2	295	-	all_neural(118;0.0878)|Melanoma(429;0.242)		90					A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	c.270C>G	CCDS11782.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.61	1.398028	0.25205	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.97529	-4.42	3.99	2.0	0.26442	.	0.000000	0.85682	D	0.000000	D	0.98261	0.9424	M	0.90019	3.08	0.46954	D	0.99926	D	0.53151	0.958	D	0.74348	0.983	D	0.97799	1.0243	10	0.87932	D	0	.	9.0671	0.36469	0.1862:0.0:0.8138:0.0	.	90	P63261	ACTG_HUMAN	L	90	ENSP00000331514:F90L	ENSP00000331514:F90L	F	-	3	2	ACTG1	77093617	1.000000	0.71417	0.993000	0.49108	0.011000	0.07611	6.098000	0.71458	0.368000	0.24481	-0.244000	0.11960	TTC		0.612	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614		20	73	0	0	0	0.001523	0	20	73				
METRNL	284207	broad.mit.edu	37	17	81052032	81052032	+	Silent	SNP	C	C	T	rs142053233	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:81052032C>T	ENST00000320095.7	+	4	773	c.648C>T	c.(646-648)caC>caT	p.H216H	METRNL_ENST00000570778.1_Silent_p.H134H|METRNL_ENST00000571940.1_3'UTR|METRNL_ENST00000571814.1_Silent_p.H134H	NM_001004431.1	NP_001004431.1	Q641Q3	METRL_HUMAN	meteorin, glial cell differentiation regulator-like	216					brown fat cell differentiation (GO:0050873)|fat cell differentiation (GO:0045444)|negative regulation of inflammatory response (GO:0050728)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of energy homeostasis (GO:2000507)|response to cold (GO:0009409)|response to muscle activity (GO:0014850)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone activity (GO:0005179)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)		BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			AAGTTACCCACGAGCCTGAGC	0.632													c|||	21	0.00419329	0.003	0.0	5008	,	,		16425	0.0		0.0	False		,,,				2504	0.0174						uc002kgh.2		NA																	0					0						c.(646-648)CAC>CAT		meteorin, glial cell differentiation		C		4,4402	8.1+/-20.4	0,4,2199	74.0	72.0	73.0		648	-10.0	0.0	17	dbSNP_134	73	0,8592		0,0,4296	no	coding-synonymous	METRNL	NM_001004431.1		0,4,6495	TT,TC,CC		0.0,0.0908,0.0308		216/312	81052032	4,12994	2203	4296	6499	SO:0001819	synonymous_variant	284207					extracellular region		g.chr17:81052032C>T	AK093748	CCDS32779.1	17q25.3	2004-12-01				ENSG00000176845			27584	protein-coding gene	gene with protein product							Standard	NM_001004431		Approved		uc002kgh.3	Q641Q3		ENST00000320095.7:c.648C>T	17.37:g.81052032C>T			Somatic				METRNL_uc002kgi.2_Silent_p.H134H	p.H216H	NM_001004431	NP_001004431	WXS	Illumina HiSeq	Unspecified	Q641Q3	METRL_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)		4	773	+	Breast(20;0.000443)|all_neural(118;0.0779)		216					B3KSJ5|Q86VM0	Silent	SNP	ENST00000320095.7	37	c.648C>T	CCDS32779.1																																																																																				0.632	METRNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438902.1	NM_001004431		36	72	0	0	0	0.002522	0	36	72				
SLC39A6	25800	broad.mit.edu	37	18	33706278	33706278	+	Silent	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr18:33706278C>A	ENST00000590986.1	-	2	982	c.693G>T	c.(691-693)cgG>cgT	p.R231R	SLC39A6_ENST00000269187.5_Silent_p.R231R|SLC39A6_ENST00000440549.2_Intron			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	231					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						GCCGGCTCACCCGGCTCTTTG	0.468																																							uc010dmy.2		NA																	0				ovary(1)|pancreas(1)	2						c.(691-693)CGG>CGT		solute carrier family 39 (zinc transporter),							145.0	140.0	142.0					18																	33706278		1864	4084	5948	SO:0001819	synonymous_variant	25800					integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity	g.chr18:33706278C>A	U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.693G>T	18.37:g.33706278C>A			Somatic				SLC39A6_uc002kzj.2_Intron	p.R231R	NM_012319	NP_036451	WXS	Illumina HiSeq	Unspecified	Q13433	S39A6_HUMAN			2	983	-			231			Extracellular (Potential).		B4DR49|B4E224|Q8IXR3|Q96HP5	Silent	SNP	ENST00000590986.1	37	c.693G>T	CCDS42428.1																																																																																				0.468	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000444136.1			58	66	1	0	5.73376e-24	0.00361	9.99635e-24	58	66				
FHOD3	80206	broad.mit.edu	37	18	34335227	34335227	+	Missense_Mutation	SNP	G	G	T	rs571460399		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr18:34335227G>T	ENST00000359247.4	+	21	3802	c.3802G>T	c.(3802-3804)Gcc>Tcc	p.A1268S	FHOD3_ENST00000591635.1_Missense_Mutation_p.A481S|FHOD3_ENST00000590592.1_Missense_Mutation_p.A1460S|FHOD3_ENST00000592128.1_Missense_Mutation_p.A264S|FHOD3_ENST00000445677.1_Missense_Mutation_p.A1247S|FHOD3_ENST00000257209.4_Missense_Mutation_p.A1285S	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1268	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACAGAAACGGGCCAACCACAG	0.418																																							uc002kzt.1		NA																	0				skin(3)|large_intestine(2)|breast(2)|ovary(1)	8						c.(3802-3804)GCC>TCC		formin homology 2 domain containing 3							97.0	74.0	82.0					18																	34335227		2203	4300	6503	SO:0001583	missense	80206				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr18:34335227G>T	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3802G>T	18.37:g.34335227G>T	ENSP00000352186:p.Ala1268Ser		Somatic				FHOD3_uc002kzs.1_Missense_Mutation_p.A1285S|FHOD3_uc010dmz.1_Missense_Mutation_p.A1000S|FHOD3_uc010dnb.1_Missense_Mutation_p.A264S	p.A1268S	NM_025135	NP_079411	WXS	Illumina HiSeq	Unspecified	Q2V2M9	FHOD3_HUMAN			21	3899	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	1268			FH2.		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37	c.3802G>T		.	.	.	.	.	.	.	.	.	.	G	34	5.348733	0.95807	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.64438	-0.1;-0.1;-0.1	6.17	6.17	0.99709	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (2);	0.000000	0.85682	D	0.000000	T	0.81578	0.4852	M	0.79693	2.465	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.999;0.989	D;D;D;P	0.83275	0.937;0.996;0.991;0.882	T	0.81799	-0.0767	10	0.66056	D	0.02	.	19.4575	0.94900	0.0:0.0:1.0:0.0	.	489;1247;1268;1285	E7ETX5;Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;.;FHOD3_HUMAN;.	S	1285;1268;1247	ENSP00000257209:A1285S;ENSP00000352186:A1268S;ENSP00000411430:A1247S	ENSP00000257209:A1285S	A	+	1	0	FHOD3	32589225	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GCC		0.418	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		6	5	1	0	5.9392e-07	0.001168	9.01942e-07	6	5				
SETBP1	26040	broad.mit.edu	37	18	42532066	42532066	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr18:42532066C>T	ENST00000282030.5	+	4	3057	c.2761C>T	c.(2761-2763)Cat>Tat	p.H921Y		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	921						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CCGGCAAAAGCATCTCATTGT	0.532									Schinzel-Giedion syndrome																														uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(2761-2763)CAT>TAT		SET binding protein 1 isoform a							39.0	38.0	38.0					18																	42532066		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42532066C>T	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2761C>T	18.37:g.42532066C>T	ENSP00000282030:p.His921Tyr		Somatic					p.H921Y	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	3057	+			921					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.2761C>T	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675813	0.67928	.	.	ENSG00000152217	ENST00000282030	D	0.89485	-2.52	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.90614	0.7057	N	0.24115	0.695	0.49798	D	0.99982	D	0.62365	0.991	P	0.61874	0.895	D	0.90956	0.4809	10	0.66056	D	0.02	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	921	Q9Y6X0	SETBP_HUMAN	Y	921	ENSP00000282030:H921Y	ENSP00000282030:H921Y	H	+	1	0	SETBP1	40786064	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.924000	0.63418	2.941000	0.99782	0.655000	0.94253	CAT		0.532	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		15	22	0	0	0	0.00245	0	15	22				
STARD6	147323	broad.mit.edu	37	18	51863546	51863546	+	Silent	SNP	A	A	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr18:51863546A>G	ENST00000581310.1	-	6	589	c.216T>C	c.(214-216)atT>atC	p.I72I	STARD6_ENST00000580990.2_5'UTR|STARD6_ENST00000307844.3_Silent_p.I72I			P59095	STAR6_HUMAN	StAR-related lipid transfer (START) domain containing 6	72	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				lipid transport (GO:0006869)		lipid binding (GO:0008289)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)	8				Colorectal(16;0.021)|READ - Rectum adenocarcinoma(59;0.188)		TATCCCATGTAATTCTGTCTC	0.313																																							uc010xdt.1		NA																	0				ovary(1)	1						c.(214-216)ATT>ATC		START domain containing protein 6							133.0	124.0	127.0					18																	51863546		2202	4297	6499	SO:0001819	synonymous_variant	147323				lipid transport		lipid binding	g.chr18:51863546A>G	AF480305	CCDS11955.1	18q21.2	2011-09-12	2007-08-16		ENSG00000174448	ENSG00000174448		"""StAR-related lipid transfer (START) domain containing"""	18066	protein-coding gene	gene with protein product		607051	"""START domain containing 6"""			12011452	Standard	NM_139171		Approved		uc010xdt.2	P59095	OTTHUMG00000132702	ENST00000581310.1:c.216T>C	18.37:g.51863546A>G			Somatic					p.I72I	NM_139171	NP_631910	WXS	Illumina HiSeq	Unspecified	P59095	STAR6_HUMAN		Colorectal(16;0.021)|READ - Rectum adenocarcinoma(59;0.188)	3	216	-			72			START.			Silent	SNP	ENST00000581310.1	37	c.216T>C	CCDS11955.1																																																																																				0.313	STARD6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256000.3	NM_139171		20	25	0	0	0	0.007413	0	20	25				
ALPK2	115701	broad.mit.edu	37	18	56247303	56247303	+	Silent	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr18:56247303C>A	ENST00000361673.3	-	4	918	c.705G>T	c.(703-705)gtG>gtT	p.V235V	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	235						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CCATGGAATGCACTGTCTTGT	0.388																																							uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(703-705)GTG>GTT		heart alpha-kinase							181.0	178.0	179.0					18																	56247303		2203	4300	6503	SO:0001819	synonymous_variant	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56247303C>A	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.705G>T	18.37:g.56247303C>A			Somatic					p.V235V	NM_052947	NP_443179	WXS	Illumina HiSeq	Unspecified	Q86TB3	ALPK2_HUMAN			4	919	-			235					Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	c.705G>T	CCDS11966.2																																																																																				0.388	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		83	71	1	0	3.7744e-50	0.00361	6.94594e-50	83	71				
TMEM259	91304	broad.mit.edu	37	19	1011931	1011931	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:1011931C>T	ENST00000356663.3	-	6	1023	c.902G>A	c.(901-903)cGg>cAg	p.R301Q	TMEM259_ENST00000333175.5_Missense_Mutation_p.R301Q	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259	301						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											GTAGGACGTCCGCGCCATCCA	0.701																																							uc002lqr.1		NA																	0				pancreas(2)|breast(1)	3						c.(901-903)CGG>CAG		membralin isoform 1							25.0	28.0	27.0					19																	1011931		2201	4299	6500	SO:0001583	missense	91304					cytoplasm|integral to membrane		g.chr19:1011931C>T	BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3		ENST00000356663.3:c.902G>A	19.37:g.1011931C>T	ENSP00000349087:p.Arg301Gln		Somatic				uc002lqp.1_5'Flank|C19orf6_uc002lqq.1_RNA|C19orf6_uc002lqs.1_Missense_Mutation_p.R301Q	p.R301Q	NM_001033026	NP_001028198	WXS	Illumina HiSeq	Unspecified	Q4ZIN3	MBRL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.0252)|STAD - Stomach adenocarcinoma(1328;0.18)	6	1048	-		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)	301					O60392|Q8NF79|Q96H30	Missense_Mutation	SNP	ENST00000356663.3	37	c.902G>A	CCDS32862.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844212	0.71488	.	.	ENSG00000182087	ENST00000356663;ENST00000333175	.	.	.	4.28	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.79131	0.4394	M	0.81942	2.565	0.44531	D	0.997485	D;D	0.89917	1.0;1.0	D;D	0.77004	0.937;0.989	T	0.81011	-0.1126	9	0.44086	T	0.13	-7.8106	15.7055	0.77577	0.0:1.0:0.0:0.0	.	301;301	Q4ZIN3-2;Q4ZIN3	.;MBRL_HUMAN	Q	301	.	ENSP00000331423:R301Q	R	-	2	0	C19orf6	962931	1.000000	0.71417	0.944000	0.38274	0.030000	0.12068	7.245000	0.78237	1.938000	0.56188	0.462000	0.41574	CGG		0.701	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458236.1	NM_033420		4	18	0	0	0	0.000248	0	4	18				
INSR	3643	broad.mit.edu	37	19	7152778	7152778	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:7152778C>T	ENST00000302850.5	-	10	2332	c.2190G>A	c.(2188-2190)aaG>aaA	p.K730K	INSR_ENST00000341500.5_Silent_p.K730K	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	730					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CCTCAAACGTCTTCCTAAACG	0.542																																							uc002mgd.1		NA																	0				ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12						c.(2188-2190)AAG>AAA		insulin receptor isoform Long precursor	Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						191.0	168.0	176.0					19																	7152778		2203	4300	6503	SO:0001819	synonymous_variant	3643				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding	g.chr19:7152778C>T	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2190G>A	19.37:g.7152778C>T			Somatic				INSR_uc002mge.1_Silent_p.K730K|INSR_uc002mgf.2_Silent_p.K730K	p.K730K	NM_000208	NP_000199	WXS	Illumina HiSeq	Unspecified	P06213	INSR_HUMAN			10	2299	-			730					Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	ENST00000302850.5	37	c.2190G>A	CCDS12176.1																																																																																				0.542	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1			21	80	0	0	0	0.001882	0	21	80				
KEAP1	9817	broad.mit.edu	37	19	10599866	10599866	+	Splice_Site	SNP	A	A	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:10599866A>T	ENST00000171111.5	-	5	2256		c.e5+1		CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Splice_Site	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1						cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CCAGGGCCTCACCAAGGACGT	0.488																																							uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.e5+1		kelch-like ECH-associated protein 1							43.0	40.0	41.0					19																	10599866		2203	4300	6503	SO:0001630	splice_region_variant	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10599866A>T	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1708+1T>A	19.37:g.10599866A>T			Somatic				KEAP1_uc002mop.1_Intron|KEAP1_uc002mor.1_Splice_Site_p.G570_splice	p.G570_splice	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		5	1864	-								B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Splice_Site	SNP	ENST00000171111.5	37	c.1708_splice	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.043829	0.75732	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7181	0.62710	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KEAP1	10460866	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	8.804000	0.91921	2.133000	0.65898	0.378000	0.23410	.		0.488	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	Intron	14	4	0	0	0	0.003163	0	14	4				
DNM2	1785	broad.mit.edu	37	19	10906047	10906047	+	Splice_Site	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:10906047G>C	ENST00000355667.6	+	9	1208		c.e9-1		DNM2_ENST00000408974.4_Splice_Site|DNM2_ENST00000389253.4_Splice_Site|DNM2_ENST00000359692.6_Splice_Site|DNM2_ENST00000314646.5_Splice_Site|DNM2_ENST00000585892.1_Splice_Site	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			TCTCTTCTCAGATGGAGTTTG	0.552			"""F, N, Splice, Mis, O"""		ETP ALL																																		uc002mps.1		NA		Rec	yes		19	19p13.2	1785		dynamin 2			L					0				central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6						c.e9-1		dynamin 2 isoform 2							163.0	123.0	137.0					19																	10906047		2203	4300	6503	SO:0001630	splice_region_variant	1785				G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding	g.chr19:10906047G>C		CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.1129-1G>C	19.37:g.10906047G>C			Somatic				DNM2_uc010dxk.2_Splice_Site|DNM2_uc002mpt.1_Splice_Site_p.M377_splice|DNM2_uc002mpv.1_Splice_Site_p.M377_splice|DNM2_uc002mpu.1_Splice_Site_p.M377_splice|DNM2_uc010dxl.1_Splice_Site_p.M377_splice|DNM2_uc002mpw.2_Splice_Site_p.M110_splice	p.M377_splice	NM_001005361	NP_001005361	WXS	Illumina HiSeq	Unspecified	P50570	DYN2_HUMAN	Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)		9	1293	+								A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Splice_Site	SNP	ENST00000355667.6	37	c.1129_splice	CCDS45968.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.629210	0.87560	.	.	ENSG00000079805	ENST00000389252;ENST00000408974;ENST00000355667;ENST00000359692;ENST00000389253;ENST00000314646	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7396	0.88404	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNM2	10767047	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	9.835000	0.99442	2.489000	0.83994	0.655000	0.94253	.		0.552	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945	Intron	15	23	0	0	0	0.003163	0	15	23				
OR7C1	26664	broad.mit.edu	37	19	14910938	14910938	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:14910938C>T	ENST00000248073.2	-	1	85	c.11G>A	c.(10-12)gGa>gAa	p.G4E	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	4					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						TGTTTGATTTCCTGTTTCCAT	0.393																																							uc010xnz.1		NA																	0				ovary(2)	2						c.(10-12)GGA>GAA		olfactory receptor, family 7, subfamily C,							74.0	76.0	75.0					19																	14910938		2156	4207	6363	SO:0001583	missense	26664				sensory perception of smell|spermatogenesis	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:14910938C>T	X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.11G>A	19.37:g.14910938C>T	ENSP00000248073:p.Gly4Glu		Somatic					p.G4E	NM_198944	NP_945182	WXS	Illumina HiSeq	Unspecified	O76099	OR7C1_HUMAN			1	11	-			4			Extracellular (Potential).		Q15621|Q6IFP2|Q96R94	Missense_Mutation	SNP	ENST00000248073.2	37	c.11G>A	CCDS12317.1	.	.	.	.	.	.	.	.	.	.	c	2.616	-0.289653	0.05568	.	.	ENSG00000127530	ENST00000248073	T	0.00482	7.1	3.6	1.29	0.21616	.	0.745999	0.10947	N	0.616483	T	0.00210	0.0006	N	0.03999	-0.3	0.09310	N	1	B	0.14805	0.011	B	0.17979	0.02	T	0.20773	-1.0265	10	0.22706	T	0.39	.	6.8721	0.24127	0.0:0.7156:0.178:0.1064	.	4	O76099	OR7C1_HUMAN	E	4	ENSP00000248073:G4E	ENSP00000248073:G4E	G	-	2	0	OR7C1	14771938	0.000000	0.05858	0.002000	0.10522	0.033000	0.12548	-0.671000	0.05250	0.295000	0.22570	0.398000	0.26397	GGA		0.393	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466519.1			55	13	0	0	0	0.00361	0	55	13				
FCHO1	23149	broad.mit.edu	37	19	17885230	17885230	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:17885230C>A	ENST00000596536.1	+	13	1146	c.863C>A	c.(862-864)gCc>gAc	p.A288D	FCHO1_ENST00000389133.4_Missense_Mutation_p.A288D|FCHO1_ENST00000596951.1_Missense_Mutation_p.A288D|FCHO1_ENST00000252771.7_Missense_Mutation_p.A288D|FCHO1_ENST00000594202.1_Missense_Mutation_p.A288D|FCHO1_ENST00000597512.1_Missense_Mutation_p.A295D|FCHO1_ENST00000539407.1_Missense_Mutation_p.A288D|FCHO1_ENST00000595033.1_Missense_Mutation_p.A238D|FCHO1_ENST00000600676.1_Missense_Mutation_p.A288D	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	288	Mediates interaction with the adaptor protein complex AP-2.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						GGAGCCAAGGCCTTTCGCCTT	0.632																																							uc010ebb.2		NA																	0				breast(1)	1						c.(862-864)GCC>GAC		FCH domain only 1 isoform b							58.0	56.0	57.0					19																	17885230		2203	4300	6503	SO:0001583	missense	23149							g.chr19:17885230C>A	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.863C>A	19.37:g.17885230C>A	ENSP00000470731:p.Ala288Asp		Somatic				FCHO1_uc002nhg.3_Missense_Mutation_p.A288D|FCHO1_uc002nhh.2_Missense_Mutation_p.A288D|FCHO1_uc010xpw.1_Missense_Mutation_p.A238D|FCHO1_uc010ebc.1_Missense_Mutation_p.A295D	p.A288D	NM_001161358	NP_001154830	WXS	Illumina HiSeq	Unspecified	O14526	FCHO1_HUMAN			12	1052	+			288					A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	ENST00000596536.1	37	c.863C>A	CCDS32955.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285292	0.40394	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.34859	1.34;1.34;1.34	5.09	5.09	0.68999	.	0.180092	0.47852	D	0.000201	T	0.28566	0.0707	L	0.34521	1.04	0.38644	D	0.951672	B;B;P	0.35433	0.368;0.368;0.501	B;B;B	0.37780	0.159;0.131;0.258	T	0.08932	-1.0698	10	0.12103	T	0.63	-18.2022	13.9704	0.64237	0.0:1.0:0.0:0.0	.	238;288;288	B4E120;O14526;O14526-2	.;FCHO1_HUMAN;.	D	288	ENSP00000252771:A288D;ENSP00000373785:A288D;ENSP00000437978:A288D	ENSP00000252771:A288D	A	+	2	0	FCHO1	17746230	1.000000	0.71417	1.000000	0.80357	0.371000	0.29859	4.739000	0.62080	2.353000	0.79882	0.484000	0.47621	GCC		0.632	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466946.2	NM_015122		27	36	1	0	3.00307e-07	0.008361	4.60007e-07	27	36				
ZNF724P	440519	broad.mit.edu	37	19	23405372	23405372	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:23405372C>G	ENST00000418100.1	-	4	1792	c.1675G>C	c.(1675-1677)Gag>Cag	p.E559Q				A8MTY0	ZN724_HUMAN	zinc finger protein 724, pseudogene	559					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|lung(2)|ovary(2)	8						TAGGGTTTCTCTCCAGTATGA	0.368																																							uc010xri.1		NA																	0					NA						c.(1675-1677)GAG>CAG		SubName: Full=cDNA FLJ56866, moderately similar to Zinc finger protein 43;																																				SO:0001583	missense	0							g.chr19:23405372C>G			19p12	2014-02-14	2010-08-03		ENSG00000196081	ENSG00000196081			32460	pseudogene	pseudogene			"""zinc finger protein 724 pseudogene"", ""zinc finger protein 724 (pseudogene)"""				Standard	NR_045525		Approved		uc021uru.1	A8MTY0	OTTHUMG00000183231	ENST00000418100.1:c.1675G>C	19.37:g.23405372C>G	ENSP00000413411:p.Glu559Gln		Somatic					p.E559Q			WXS	Illumina HiSeq	Unspecified					4	1793	-									Missense_Mutation	SNP	ENST00000418100.1	37	c.1675G>C		.	.	.	.	.	.	.	.	.	.	C	19.38	3.816298	0.70912	.	.	ENSG00000196081	ENST00000418100	T	0.25912	1.77	1.08	1.08	0.20341	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31104	0.0786	.	.	.	0.33358	D	0.571911	D	0.62365	0.991	P	0.49799	0.622	T	0.50162	-0.8860	8	0.72032	D	0.01	.	8.9688	0.35894	0.0:1.0:0.0:0.0	.	559	A8MTY0	ZN724_HUMAN	Q	559	ENSP00000413411:E559Q	ENSP00000413411:E559Q	E	-	1	0	ZNF724P	23197212	0.931000	0.31567	0.749000	0.31150	0.730000	0.41778	2.049000	0.41288	0.482000	0.27582	0.484000	0.47621	GAG		0.368	ZNF724P-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000465743.1			15	22	0	0	0	0.00245	0	15	22				
ZNF91	7644	broad.mit.edu	37	19	23543433	23543433	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:23543433G>C	ENST00000300619.7	-	4	2553	c.2348C>G	c.(2347-2349)tCa>tGa	p.S783*	ZNF91_ENST00000397082.2_Nonsense_Mutation_p.S751*|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	783					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AGTTAGGGTTGAAGACCATAT	0.388																																							uc002nre.2		NA																	0					0						c.(2347-2349)TCA>TGA		zinc finger protein 91							55.0	60.0	58.0					19																	23543433		2146	4257	6403	SO:0001587	stop_gained	7644					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:23543433G>C	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2348C>G	19.37:g.23543433G>C	ENSP00000300619:p.Ser783*		Somatic				ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Nonsense_Mutation_p.S751*	p.S783*	NM_003430	NP_003421	WXS	Illumina HiSeq	Unspecified	Q05481	ZNF91_HUMAN			4	2461	-		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)	783			C2H2-type 23.		A8K5E1|B7Z6G6	Nonsense_Mutation	SNP	ENST00000300619.7	37	c.2348C>G	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699287	0.68501	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	.	.	.	1.52	0.0735	0.14391	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	8.5883	0.33670	0.0:0.2391:0.7608:0.0	.	.	.	.	X	783;751	.	ENSP00000300619:S783X	S	-	2	0	ZNF91	23335273	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-0.200000	0.09478	0.798000	0.33994	0.205000	0.17691	TCA		0.388	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430		5	61	0	0	0	0.000602	0	5	61				
ZNF536	9745	broad.mit.edu	37	19	30936464	30936464	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:30936464C>A	ENST00000355537.3	+	2	2142	c.1995C>A	c.(1993-1995)caC>caA	p.H665Q		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	665					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ATGGGCTGCACGTGGGCCTGG	0.692																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(1993-1995)CAC>CAA		zinc finger protein 536							43.0	48.0	46.0					19																	30936464		2203	4299	6502	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30936464C>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1995C>A	19.37:g.30936464C>A	ENSP00000347730:p.His665Gln		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.H665Q	p.H665Q	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			2	2133	+	Esophageal squamous(110;0.0834)		665					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.1995C>A	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.832681	0.00004	.	.	ENSG00000198597	ENST00000355537	T	0.06528	3.29	5.42	0.561	0.17285	.	0.159705	0.56097	N	0.000022	T	0.01765	0.0056	N	0.01874	-0.695	0.21604	N	0.999627	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.43909	-0.9362	10	0.19147	T	0.46	-28.3583	2.659	0.05020	0.1565:0.418:0.2708:0.1547	.	665;665	A7E228;O15090	.;ZN536_HUMAN	Q	665	ENSP00000347730:H665Q	ENSP00000347730:H665Q	H	+	3	2	ZNF536	35628304	0.700000	0.27796	0.809000	0.32408	0.425000	0.31504	0.435000	0.21510	0.013000	0.14918	-0.797000	0.03246	CAC		0.692	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		38	25	1	0	2.2871e-25	0.007835	4.01378e-25	38	25				
ANKRD27	84079	broad.mit.edu	37	19	33130317	33130317	+	Missense_Mutation	SNP	G	G	A	rs199860219		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:33130317G>A	ENST00000306065.4	-	12	1219	c.1061C>T	c.(1060-1062)tCa>tTa	p.S354L	ANKRD27_ENST00000587352.1_Missense_Mutation_p.S354L	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	354	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					AGCTTCGAATGAGGTCAGGCA	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		19194	0.0		0.001	False		,,,				2504	0.0						uc002ntn.1		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(1060-1062)TCA>TTA		ankyrin repeat domain 27 (VPS9 domain)							155.0	139.0	145.0					19																	33130317		2203	4300	6503	SO:0001583	missense	84079				early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity	g.chr19:33130317G>A	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.1061C>T	19.37:g.33130317G>A	ENSP00000304292:p.Ser354Leu		Somatic				ANKRD27_uc002nto.1_Missense_Mutation_p.S354L	p.S354L	NM_032139	NP_115515	WXS	Illumina HiSeq	Unspecified	Q96NW4	ANR27_HUMAN			12	1217	-	Esophageal squamous(110;0.137)		354			VPS9.		Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	37	c.1061C>T	CCDS32986.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	25.3	4.622465	0.87460	.	.	ENSG00000105186	ENST00000306065	T	0.31247	1.5	4.93	4.93	0.64822	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.000000	0.49305	D	0.000157	T	0.57725	0.2073	M	0.76838	2.35	0.51233	D	0.999913	D	0.76494	0.999	D	0.68621	0.959	T	0.62779	-0.6782	10	0.62326	D	0.03	-11.9984	18.5195	0.90947	0.0:0.0:1.0:0.0	.	354	Q96NW4	ANR27_HUMAN	L	354	ENSP00000304292:S354L	ENSP00000304292:S354L	S	-	2	0	ANKRD27	37822157	1.000000	0.71417	0.941000	0.38009	0.805000	0.45488	8.598000	0.90852	2.435000	0.82474	0.563000	0.77884	TCA		0.458	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139		9	69	0	0	0	0.004482	0	9	69				
NFKBID	84807	broad.mit.edu	37	19	36381384	36381384	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:36381384C>A	ENST00000396901.1	-	10	1188	c.615G>T	c.(613-615)aaG>aaT	p.K205N	NFKBID_ENST00000606253.1_Missense_Mutation_p.K205N|NFKBID_ENST00000340950.2_Missense_Mutation_p.K42N|NFKBID_ENST00000352614.2_Missense_Mutation_p.K357N	NM_139239.1	NP_640332.1	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta	205					inflammatory response (GO:0006954)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|positive regulation of thymocyte apoptotic process (GO:0070245)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	14						TCTTGTTGCTCTTGATCTCCT	0.597																																							uc002oci.1		NA																	0					0						c.(613-615)AAG>AAT		nuclear factor of kappa light polypeptide gene							79.0	84.0	82.0					19																	36381384		2056	4177	6233	SO:0001583	missense	84807				inflammatory response	nucleus		g.chr19:36381384C>A	AF385434	CCDS42552.1	19q13.12	2013-01-10				ENSG00000167604		"""Ankyrin repeat domain containing"""	15671	protein-coding gene	gene with protein product						12477932	Standard	NM_139239		Approved	TA-NFKBH, IkappaBNS	uc002oci.1	Q8NI38		ENST00000396901.1:c.615G>T	19.37:g.36381384C>A	ENSP00000380109:p.Lys205Asn		Somatic				NFKBID_uc002och.1_Missense_Mutation_p.K42N|NFKBID_uc002ocj.1_Missense_Mutation_p.K220N	p.K205N	NM_139239	NP_640332	WXS	Illumina HiSeq	Unspecified	Q8NI38	IKBD_HUMAN			10	1189	-			205					Q8NI39|Q9BRG9	Missense_Mutation	SNP	ENST00000396901.1	37	c.615G>T	CCDS42552.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356234	0.61293	.	.	ENSG00000167604	ENST00000352614;ENST00000396901;ENST00000340950	T;T;T	0.38077	1.16;1.16;2.31	4.77	0.233	0.15386	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.32941	0.0846	N	0.05414	-0.055	0.47621	D	0.999477	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.996;0.998;0.997	T	0.10064	-1.0646	10	0.46703	T	0.11	.	8.5352	0.33360	0.0:0.6799:0.0:0.3201	.	357;205;42	Q8NI38-2;Q8NI38;Q8NI38-3	.;IKBD_HUMAN;.	N	357;205;42	ENSP00000252985:K357N;ENSP00000380109:K205N;ENSP00000343093:K42N	ENSP00000343093:K42N	K	-	3	2	NFKBID	41073224	1.000000	0.71417	0.997000	0.53966	0.928000	0.56348	1.739000	0.38217	-0.118000	0.11851	0.462000	0.41574	AAG		0.597	NFKBID-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452927.3	NM_032721		47	49	1	0	2.46787e-29	0.00361	4.38917e-29	47	49				
ZNF568	374900	broad.mit.edu	37	19	37441787	37441787	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:37441787A>G	ENST00000333987.7	+	7	2238	c.1732A>G	c.(1732-1734)Aga>Gga	p.R578G	ZNF568_ENST00000415168.1_Missense_Mutation_p.R514G|ZNF568_ENST00000427117.1_Intron|ZNF568_ENST00000455427.2_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	578					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCTTCATGTGAGAAGTCACAC	0.378																																							uc002ofc.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1732-1734)AGA>GGA		zinc finger protein 568							73.0	84.0	80.0					19																	37441787		2194	4294	6488	SO:0001583	missense	374900				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37441787A>G	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.1732A>G	19.37:g.37441787A>G	ENSP00000334685:p.Arg578Gly		Somatic				ZNF568_uc010efg.2_Intron|ZNF568_uc010xtn.1_Intron|ZNF568_uc002ofd.2_Missense_Mutation_p.R502G|ZNF568_uc010efe.2_Missense_Mutation_p.R502G|ZNF568_uc010eff.1_Intron	p.R578G	NM_198539	NP_940941	WXS	Illumina HiSeq	Unspecified	Q3ZCX4	ZN568_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		7	2247	+	Esophageal squamous(110;0.183)		578			C2H2-type 13.		B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000333987.7	37	c.1732A>G	CCDS42558.1	.	.	.	.	.	.	.	.	.	.	A	11.75	1.731810	0.30684	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.24723	1.84;4.3	3.74	2.69	0.31865	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.193084	0.25801	N	0.028218	T	0.25606	0.0623	M	0.62209	1.925	0.80722	D	1	B	0.18863	0.031	B	0.19946	0.027	T	0.08046	-1.0741	10	0.87932	D	0	.	8.5147	0.33239	0.8031:0.1969:0.0:0.0	.	578	Q3ZCX4	ZN568_HUMAN	G	578;514	ENSP00000334685:R578G;ENSP00000394514:R514G	ENSP00000334685:R578G	R	+	1	2	ZNF568	42133627	0.000000	0.05858	0.584000	0.28653	0.997000	0.91878	-0.186000	0.09670	0.587000	0.29643	0.482000	0.46254	AGA		0.378	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109572.2	NM_198539		8	73	0	0	0	0.00308	0	8	73				
HNRNPL	3191	broad.mit.edu	37	19	39330868	39330868	+	Silent	SNP	T	T	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:39330868T>G	ENST00000221419.5	-	8	1467	c.1101A>C	c.(1099-1101)ccA>ccC	p.P367P	HNRNPL_ENST00000600873.1_Silent_p.P234P|AC104534.3_ENST00000594769.1_5'Flank	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	367	Pro-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)	p.P367P(1)|p.P234P(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GGGGAGGGGGTGGGGGGTGCC	0.642																																							uc010xul.1		NA																	2	Substitution - coding silent(2)		central_nervous_system(2)		0						c.(1099-1101)CCA>CCC		heterogeneous nuclear ribonucleoprotein L							7.0	9.0	8.0					19																	39330868		1496	3077	4573	SO:0001819	synonymous_variant	3191				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding	g.chr19:39330868T>G	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1101A>C	19.37:g.39330868T>G			Somatic				HNRNPL_uc010ege.1_Silent_p.P23P|HNRNPL_uc002ojj.1_Silent_p.P23P|HNRNPL_uc002ojo.1_5'Flank|HNRNPL_uc002ojk.2_Silent_p.P23P|HNRNPL_uc002ojl.2_Silent_p.P23P|HNRNPL_uc010xum.1_Silent_p.P234P|HNRNPL_uc002ojp.1_Silent_p.P23P|HNRNPL_uc010xun.1_Missense_Mutation_p.H75P	p.P367P	NM_001533	NP_001524	WXS	Illumina HiSeq	Unspecified	P14866	HNRPL_HUMAN	Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)		8	1112	-	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		367			Pro-rich.		A6ND69|A6NIT8|Q9H3P3	Silent	SNP	ENST00000221419.5	37	c.1101A>C	CCDS33015.1																																																																																				0.642	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1			3	11	0	0	0	0.001984	0	3	11				
FCGBP	8857	broad.mit.edu	37	19	40433630	40433630	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:40433630C>A	ENST00000221347.6	-	2	646	c.639G>T	c.(637-639)aaG>aaT	p.K213N		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	213	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TAGCTGTGACCTTTGACCCCG	0.557																																							uc002omp.3		NA																	0				ovary(4)|skin(4)|central_nervous_system(1)	9						c.(637-639)AAG>AAT		Fc fragment of IgG binding protein precursor							74.0	72.0	73.0					19																	40433630		2203	4300	6503	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40433630C>A	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.639G>T	19.37:g.40433630C>A	ENSP00000221347:p.Lys213Asn		Somatic					p.K213N	NM_003890	NP_003881	WXS	Illumina HiSeq	Unspecified	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		2	647	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		213			IgGFc-binding.		O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.639G>T	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	7.686	0.690124	0.15039	.	.	ENSG00000090920	ENST00000221347	T	0.20738	2.05	4.47	0.876	0.19138	.	0.253615	0.29830	N	0.011083	T	0.19967	0.0480	L	0.43923	1.385	0.21878	N	0.999491	D	0.53619	0.961	P	0.49637	0.617	T	0.07177	-1.0786	10	0.52906	T	0.07	.	4.5156	0.11934	0.0:0.4624:0.1564:0.3812	.	213	Q9Y6R7	FCGBP_HUMAN	N	213	ENSP00000221347:K213N	ENSP00000221347:K213N	K	-	3	2	FCGBP	45125470	0.000000	0.05858	0.953000	0.39169	0.125000	0.20455	-0.736000	0.04882	0.310000	0.22990	-0.768000	0.03414	AAG		0.557	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		35	47	1	0	1.42033e-22	0.004289	2.43617e-22	35	47				
SPTBN4	57731	broad.mit.edu	37	19	41081435	41081435	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:41081435G>A	ENST00000352632.3	+	36	7741	c.7655G>A	c.(7654-7656)aGg>aAg	p.R2552K	SPTBN4_ENST00000593816.1_3'UTR|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R2552K|SHKBP1_ENST00000600733.1_5'Flank|SHKBP1_ENST00000291842.5_5'Flank|SPTBN4_ENST00000392025.1_Missense_Mutation_p.R1295K			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2552					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AACCCTAAGAGGGAAGGCGGA	0.622																																							uc002ony.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(7654-7656)AGG>AAG		spectrin, beta, non-erythrocytic 4 isoform							48.0	36.0	40.0					19																	41081435		2203	4300	6503	SO:0001583	missense	57731				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton	g.chr19:41081435G>A	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.7655G>A	19.37:g.41081435G>A	ENSP00000263373:p.Arg2552Lys		Somatic				SPTBN4_uc002onz.2_Missense_Mutation_p.R2552K|SPTBN4_uc010egx.2_Missense_Mutation_p.R1295K|SHKBP1_uc002oob.2_5'Flank|SHKBP1_uc002ooc.2_5'Flank|SHKBP1_uc002ood.2_5'Flank|SHKBP1_uc010xvl.1_5'Flank|SHKBP1_uc002ooe.2_5'Flank|SHKBP1_uc002oof.2_5'Flank|SHKBP1_uc010xvm.1_5'Flank	p.R2552K	NM_020971	NP_066022	WXS	Illumina HiSeq	Unspecified	Q9H254	SPTN4_HUMAN	Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)		36	7741	+			2552					E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	c.7655G>A	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	7.813	0.716162	0.15306	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.78246	-1.16;0.18	4.65	3.54	0.40534	.	0.389519	0.21046	U	0.081097	T	0.58892	0.2154	N	0.08118	0	0.80722	D	1	B;B	0.26002	0.139;0.118	B;B	0.21151	0.025;0.033	T	0.59757	-0.7394	10	0.39692	T	0.17	.	14.2718	0.66155	0.0:0.1497:0.8503:0.0	.	1295;2552	C9JY79;Q9H254	.;SPTN4_HUMAN	K	2552;2552;1295	ENSP00000263373:R2552K;ENSP00000375879:R1295K	ENSP00000263373:R2552K	R	+	2	0	SPTBN4	45773275	1.000000	0.71417	0.919000	0.36401	0.433000	0.31745	4.586000	0.60984	2.296000	0.77279	0.462000	0.41574	AGG		0.622	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2			6	13	0	0	0	0.001984	0	6	13				
ZNF225	7768	broad.mit.edu	37	19	44635321	44635321	+	Missense_Mutation	SNP	T	T	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:44635321T>G	ENST00000262894.6	+	5	834	c.554T>G	c.(553-555)tTc>tGc	p.F185C	ZNF225_ENST00000590612.1_Missense_Mutation_p.F185C|ZNF225_ENST00000592780.1_3'UTR	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	185					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				GGAAAGAGTTTCTGTTATAGC	0.398																																							uc002oyj.1		NA																	0					0						c.(553-555)TTC>TGC		zinc finger protein 225							84.0	88.0	86.0					19																	44635321		2134	4269	6403	SO:0001583	missense	7768				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44635321T>G	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.554T>G	19.37:g.44635321T>G	ENSP00000262894:p.Phe185Cys		Somatic				ZNF225_uc010eje.1_Missense_Mutation_p.F102C|ZNF225_uc010ejf.1_Missense_Mutation_p.F185C	p.F185C	NM_013362	NP_037494	WXS	Illumina HiSeq	Unspecified	Q9UK10	ZN225_HUMAN			5	797	+		Prostate(69;0.0352)|all_neural(266;0.202)	185			C2H2-type 1.		A8K8S2|Q53F12|Q9NS46|Q9UID8	Missense_Mutation	SNP	ENST00000262894.6	37	c.554T>G	CCDS46100.1	.	.	.	.	.	.	.	.	.	.	T	17.31	3.357555	0.61293	.	.	ENSG00000256294	ENST00000262894;ENST00000544184	T	0.41758	0.99	2.97	2.97	0.34412	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.64271	0.2583	M	0.82433	2.59	0.23293	N	0.997965	D	0.89917	1.0	D	0.72338	0.977	T	0.52779	-0.8530	9	0.66056	D	0.02	.	10.4705	0.44633	0.0:0.0:0.0:1.0	.	185	Q9UK10	ZN225_HUMAN	C	185;149	ENSP00000262894:F185C	ENSP00000262894:F185C	F	+	2	0	ZNF225	49327161	0.001000	0.12720	0.013000	0.15412	0.336000	0.28762	0.402000	0.20965	1.342000	0.45619	0.459000	0.35465	TTC		0.398	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1			30	39	0	0	0	0.00632	0	30	39				
SCAF1	58506	broad.mit.edu	37	19	50156067	50156067	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:50156067C>T	ENST00000360565.3	+	7	2545	c.2421C>T	c.(2419-2421)ccC>ccT	p.P807P		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	807	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		CCTCAGGGCCCCCGCCAAAGC	0.652																																							uc002poq.2		NA																	0					0						c.(2419-2421)CCC>CCT		SR-related CTD-associated factor 1							46.0	58.0	54.0					19																	50156067		2201	4300	6501	SO:0001819	synonymous_variant	58506				mRNA processing|RNA splicing	nucleus	RNA binding	g.chr19:50156067C>T	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.2421C>T	19.37:g.50156067C>T			Somatic					p.P807P	NM_021228	NP_067051	WXS	Illumina HiSeq	Unspecified	Q9H7N4	SFR19_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)	7	2545	+		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)	807			Ser-rich.		Q7Z5V7|Q8WVA1|Q9NR59	Silent	SNP	ENST00000360565.3	37	c.2421C>T	CCDS33074.1																																																																																				0.652	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	NM_021228		16	5	0	0	0	0.007413	0	16	5				
NLRP12	91662	broad.mit.edu	37	19	54314303	54314303	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:54314303C>T	ENST00000324134.6	-	3	778	c.610G>A	c.(610-612)Gag>Aag	p.E204K	NLRP12_ENST00000351894.4_Missense_Mutation_p.E204K|NLRP12_ENST00000354278.3_Missense_Mutation_p.E204K|NLRP12_ENST00000391773.1_Missense_Mutation_p.E204K|NLRP12_ENST00000535162.1_Missense_Mutation_p.E204K|NLRP12_ENST00000391775.3_Missense_Mutation_p.E204K|NLRP12_ENST00000391772.1_Missense_Mutation_p.E204K|NLRP12_ENST00000345770.5_Missense_Mutation_p.E204K	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	204					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GGGCGCTCCTCGTCTGGCTCA	0.657																																							uc002qch.3		NA																	0				ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(610-612)GAG>AAG		NLR family, pyrin domain containing 12 isoform							100.0	81.0	87.0					19																	54314303		2203	4300	6503	SO:0001583	missense	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54314303C>T	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.610G>A	19.37:g.54314303C>T	ENSP00000319377:p.Glu204Lys		Somatic				NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.E204K|NLRP12_uc002qcj.3_Missense_Mutation_p.E204K|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.E204K	p.E204K	NM_144687	NP_653288	WXS	Illumina HiSeq	Unspecified	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	3	830	-	Ovarian(34;0.19)		204					A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	c.610G>A	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	C	9.233	1.036397	0.19669	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.74526	-0.78;-0.81;-0.85;-0.85;-0.83;-0.78;-0.82	4.25	4.25	0.50352	.	0.000000	0.43579	D	0.000543	T	0.76955	0.4060	L	0.55481	1.735	0.26893	N	0.967278	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	P;P;P;P	0.57620	0.771;0.771;0.771;0.824	T	0.67841	-0.5566	10	0.09338	T	0.73	.	14.5812	0.68292	0.0:1.0:0.0:0.0	.	204;204;204;204	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	K	204	ENSP00000319377:E204K;ENSP00000438030:E204K;ENSP00000340473:E204K;ENSP00000346231:E204K;ENSP00000375655:E204K;ENSP00000375653:E204K;ENSP00000375652:E204K	ENSP00000319377:E204K	E	-	1	0	NLRP12	59006115	0.000000	0.05858	0.913000	0.36048	0.103000	0.19146	0.245000	0.18142	2.113000	0.64589	0.306000	0.20318	GAG		0.657	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		5	76	0	0	0	0.001168	0	5	76				
LILRB1	10859	broad.mit.edu	37	19	55143594	55143594	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:55143594G>A	ENST00000396331.1	+	6	924	c.567G>A	c.(565-567)ccG>ccA	p.P189P	LILRB1_ENST00000418536.2_Silent_p.P189P|LILRB1_ENST00000396317.1_Silent_p.P189P|LILRB1_ENST00000427581.2_Silent_p.P225P|LILRB1_ENST00000396332.4_Silent_p.P189P|LILRB1_ENST00000434867.2_Silent_p.P189P|LILRB1_ENST00000396321.2_Silent_p.P189P|LILRB1_ENST00000396327.3_Silent_p.P189P|LILRB1_ENST00000324602.7_Silent_p.P189P|LILRB1_ENST00000448689.1_Silent_p.P189P|LILRB1_ENST00000396315.1_Silent_p.P189P|AC009892.1_ENST00000578908.1_RNA	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	189	Ig-like C2-type 2.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CCGTGAGCCCGAGTCGCAGGT	0.587										HNSCC(37;0.09)																													uc002qgj.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(565-567)CCG>CCA		leukocyte immunoglobulin-like receptor,							142.0	140.0	140.0					19																	55143594		2203	4300	6503	SO:0001819	synonymous_variant	10859				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity	g.chr19:55143594G>A	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.567G>A	19.37:g.55143594G>A		HNSCC(37;0.09)	Somatic				LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Silent_p.P189P|LILRB1_uc002qgk.2_Silent_p.P189P|LILRB1_uc002qgm.2_Silent_p.P189P|LILRB1_uc010erq.2_Silent_p.P189P|LILRB1_uc010err.2_RNA	p.P189P	NM_006669	NP_006660	WXS	Illumina HiSeq	Unspecified	Q8NHL6	LIRB1_HUMAN		GBM - Glioblastoma multiforme(193;0.0188)	6	907	+			189			Ig-like C2-type 2.|Extracellular (Potential).		A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	ENST00000396331.1	37	c.567G>A	CCDS42617.1																																																																																				0.587	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4			69	13	0	0	0	0.00361	0	69	13				
ZBTB45	84878	broad.mit.edu	37	19	59028515	59028515	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:59028515G>T	ENST00000594051.1	-	2	1006	c.526C>A	c.(526-528)Ccc>Acc	p.P176T	ZBTB45_ENST00000600990.1_Missense_Mutation_p.P176T|ZBTB45_ENST00000354590.3_Missense_Mutation_p.P176T			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	176	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		AAACGCGCGGGCTGGCGCTGC	0.716											OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(164;1383 2017 5233 27540 46677)	NSCLC(164;1383 2017 5233 27540 46677)	uc002qtd.2		NA																	0					0						c.(526-528)CCC>ACC		zinc finger and BTB domain containing 45							30.0	36.0	34.0					19																	59028515		2199	4291	6490	SO:0001583	missense	84878				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:59028515G>T	AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.526C>A	19.37:g.59028515G>T	ENSP00000469089:p.Pro176Thr		Somatic	OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1035	ZBTB45_uc002qte.2_Missense_Mutation_p.P176T|ZBTB45_uc002qtf.2_Missense_Mutation_p.P176T	p.P176T	NM_032792	NP_116181	WXS	Illumina HiSeq	Unspecified	Q96K62	ZBT45_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)	2	818	-		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)	176			Pro-rich.			Missense_Mutation	SNP	ENST00000594051.1	37	c.526C>A	CCDS12984.1	.	.	.	.	.	.	.	.	.	.	g	15.85	2.954642	0.53293	.	.	ENSG00000119574	ENST00000354590	T	0.11063	2.81	3.24	3.24	0.37175	.	0.111659	0.36066	N	0.002816	T	0.18002	0.0432	L	0.27053	0.805	0.39361	D	0.965918	D	0.76494	0.999	D	0.68765	0.96	T	0.03695	-1.1012	10	0.45353	T	0.12	.	12.7314	0.57201	0.0:0.0:1.0:0.0	.	176	Q96K62	ZBT45_HUMAN	T	176	ENSP00000346603:P176T	ENSP00000346603:P176T	P	-	1	0	ZBTB45	63720327	1.000000	0.71417	0.978000	0.43139	0.357000	0.29423	2.804000	0.47931	2.129000	0.65627	0.467000	0.42956	CCC		0.716	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467067.1	NM_032792		22	17	1	0	7.41877e-09	0.001882	1.15987e-08	22	17				
ASXL2	55252	broad.mit.edu	37	2	25965964	25965964	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:25965964G>A	ENST00000435504.4	-	13	3535	c.3242C>T	c.(3241-3243)tCa>tTa	p.S1081L	ASXL2_ENST00000272341.4_Intron|ASXL2_ENST00000404843.1_Intron|ASXL2_ENST00000336112.4_Missense_Mutation_p.S1053L			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	1081					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)	p.S1081L(2)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGGCACAACTGAGAGAAGATT	0.502																																							uc002rgs.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(3241-3243)TCA>TTA		additional sex combs like 2							140.0	136.0	137.0					2																	25965964		1974	4160	6134	SO:0001583	missense	55252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding	g.chr2:25965964G>A			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.3242C>T	2.37:g.25965964G>A	ENSP00000391447:p.Ser1081Leu		Somatic				ASXL2_uc002rgt.1_Intron	p.S1081L	NM_018263	NP_060733	WXS	Illumina HiSeq	Unspecified	Q76L83	ASXL2_HUMAN			12	3463	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1081					Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	37	c.3242C>T		.	.	.	.	.	.	.	.	.	.	G	8.890	0.953838	0.18431	.	.	ENSG00000143970	ENST00000435504;ENST00000336112	T;T	0.25085	1.82;1.82	6.07	6.07	0.98685	.	0.643074	0.17142	N	0.185385	T	0.35624	0.0938	M	0.66939	2.045	0.32977	D	0.52308	P	0.43094	0.799	B	0.40901	0.343	T	0.51020	-0.8758	10	0.87932	D	0	-1.3109	19.2077	0.93739	0.0:0.0:1.0:0.0	.	1081	Q76L83	ASXL2_HUMAN	L	1081;1053	ENSP00000391447:S1081L;ENSP00000337250:S1053L	ENSP00000337250:S1053L	S	-	2	0	ASXL2	25819468	0.996000	0.38824	0.010000	0.14722	0.676000	0.39594	6.505000	0.73708	2.884000	0.98904	0.655000	0.94253	TCA		0.502	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263		12	76	0	0	0	0.000978	0	12	76				
ARHGAP25	9938	broad.mit.edu	37	2	69053219	69053219	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:69053219C>A	ENST00000295381.3	+	11	2250	c.1831C>A	c.(1831-1833)Cgc>Agc	p.R611S	ARHGAP25_ENST00000479844.1_Missense_Mutation_p.R305S|ARHGAP25_ENST00000467265.1_Missense_Mutation_p.R572S|ARHGAP25_ENST00000409202.3_Missense_Mutation_p.R612S|ARHGAP25_ENST00000409220.1_Missense_Mutation_p.R605S|ARHGAP25_ENST00000409030.3_Missense_Mutation_p.R604S	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	611					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.R605C(1)|p.R612C(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						GATCAGCCTCCGCAACATGGA	0.483																																							uc002seu.2		NA																	2	Substitution - Missense(2)		endometrium(2)	ovary(2)|breast(2)	4						c.(1831-1833)CGC>AGC		Rho GTPase activating protein 25 isoform a							111.0	116.0	114.0					2																	69053219		2203	4300	6503	SO:0001583	missense	9938				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr2:69053219C>A	D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.1831C>A	2.37:g.69053219C>A	ENSP00000295381:p.Arg611Ser		Somatic				ARHGAP25_uc010fdg.2_Missense_Mutation_p.R612S|ARHGAP25_uc010yql.1_Missense_Mutation_p.R572S|ARHGAP25_uc002sew.2_Missense_Mutation_p.R604S|ARHGAP25_uc002sex.2_Missense_Mutation_p.R605S|ARHGAP25_uc002sey.2_Missense_Mutation_p.R338S	p.R611S	NM_001007231	NP_001007232	WXS	Illumina HiSeq	Unspecified	P42331	RHG25_HUMAN			11	2195	+			611			Potential.		A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Missense_Mutation	SNP	ENST00000295381.3	37	c.1831C>A		.	.	.	.	.	.	.	.	.	.	C	16.39	3.109109	0.56398	.	.	ENSG00000163219	ENST00000295381;ENST00000409202;ENST00000467265;ENST00000409030;ENST00000409220;ENST00000543533;ENST00000479844	T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63	5.95	5.95	0.96441	.	0.420768	0.26224	N	0.025620	T	0.50735	0.1633	L	0.46819	1.47	0.80722	D	1	P;P;B;B;P	0.46020	0.826;0.493;0.212;0.212;0.871	B;B;B;B;P	0.47430	0.206;0.138;0.087;0.059;0.547	T	0.52215	-0.8605	10	0.87932	D	0	.	14.8176	0.70048	0.1527:0.8473:0.0:0.0	.	572;612;605;604;611	E9PFQ7;P42331-4;G5E9G2;P42331-3;P42331	.;.;.;.;RHG25_HUMAN	S	611;612;572;604;605;596;305	ENSP00000295381:R611S;ENSP00000386911:R612S;ENSP00000420583:R572S;ENSP00000386863:R604S;ENSP00000386241:R605S;ENSP00000417467:R305S	ENSP00000295381:R611S	R	+	1	0	ARHGAP25	68906723	0.030000	0.19436	1.000000	0.80357	0.948000	0.59901	2.083000	0.41615	2.824000	0.97209	0.655000	0.94253	CGC		0.483	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014882		31	61	1	0	3.1745e-13	0.008361	5.17687e-13	31	61				
LRRTM4	80059	broad.mit.edu	37	2	77746052	77746052	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:77746052A>T	ENST00000409093.1	-	3	1279	c.943T>A	c.(943-945)Tgc>Agc	p.C315S	LRRTM4_ENST00000409884.1_Missense_Mutation_p.C315S|LRRTM4_ENST00000409911.1_Missense_Mutation_p.C316S|LRRTM4_ENST00000409282.1_Missense_Mutation_p.C316S|LRRTM4_ENST00000409088.3_Missense_Mutation_p.C315S			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	315	LRRCT.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		CTCCGACTGCATTCCCACATA	0.393																																							uc002snr.2		NA																	0				pancreas(3)|ovary(1)	4						c.(943-945)TGC>AGC		leucine rich repeat transmembrane neuronal 4							41.0	37.0	38.0					2																	77746052		1860	4098	5958	SO:0001583	missense	80059					integral to membrane		g.chr2:77746052A>T	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.943T>A	2.37:g.77746052A>T	ENSP00000386357:p.Cys315Ser		Somatic				LRRTM4_uc002snq.2_Missense_Mutation_p.C315S|LRRTM4_uc002sns.2_Missense_Mutation_p.C315S|LRRTM4_uc002snt.2_Missense_Mutation_p.C316S	p.C315S	NM_001134745	NP_001128217	WXS	Illumina HiSeq	Unspecified	Q86VH4	LRRT4_HUMAN		Colorectal(11;0.059)	3	1358	-			315			LRRCT.|Extracellular (Potential).		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	c.943T>A	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	A	17.74	3.464818	0.63513	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.05580	3.42;3.42;3.42;3.42;3.42	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.28599	0.0708	M	0.83118	2.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.02352	-1.1172	10	0.87932	D	0	.	15.0295	0.71696	1.0:0.0:0.0:0.0	.	316;315;315	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	S	316;315;315;315;316	ENSP00000387228:C316S;ENSP00000387297:C315S;ENSP00000386357:C315S;ENSP00000386236:C315S;ENSP00000386286:C316S	ENSP00000386236:C315S	C	-	1	0	LRRTM4	77599560	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.220000	0.72140	0.533000	0.62120	TGC		0.393	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		6	6	0	0	0	0.001984	0	6	6				
REG3A	5068	broad.mit.edu	37	2	79384745	79384745	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:79384745G>T	ENST00000409839.3	-	5	449	c.413C>A	c.(412-414)tCc>tAc	p.S138Y	REG3A_ENST00000393878.1_Missense_Mutation_p.S138Y|REG3A_ENST00000305165.2_Missense_Mutation_p.S138Y|AC011754.1_ENST00000415201.1_RNA	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	138	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						TGAGATGGTGGAGGGATTTCT	0.537																																							uc002sod.1		NA																	0				skin(1)	1						c.(412-414)TCC>TAC		pancreatitis-associated protein precursor							129.0	123.0	125.0					2																	79384745		2203	4300	6503	SO:0001583	missense	5068				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding	g.chr2:79384745G>T	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.413C>A	2.37:g.79384745G>T	ENSP00000386630:p.Ser138Tyr		Somatic				REG3A_uc002soe.1_Missense_Mutation_p.S138Y|REG3A_uc002sof.1_Missense_Mutation_p.S138Y	p.S138Y	NM_138938	NP_620355	WXS	Illumina HiSeq	Unspecified	Q06141	REG3A_HUMAN			4	668	-			138			C-type lectin.			Missense_Mutation	SNP	ENST00000409839.3	37	c.413C>A	CCDS1965.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489067	0.44249	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.21361	2.01;2.01;2.01	3.87	2.95	0.34219	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.902434	0.09402	N	0.807138	T	0.43122	0.1233	M	0.83692	2.655	0.09310	N	1	D	0.55385	0.971	P	0.57283	0.817	T	0.16958	-1.0385	10	0.56958	D	0.05	.	9.3292	0.38012	0.0:0.2193:0.7807:0.0	.	138	Q06141	REG3A_HUMAN	Y	138	ENSP00000386630:S138Y;ENSP00000377456:S138Y;ENSP00000304311:S138Y	ENSP00000304311:S138Y	S	-	2	0	REG3A	79238253	0.004000	0.15560	0.003000	0.11579	0.019000	0.09904	1.482000	0.35486	1.167000	0.42706	0.491000	0.48974	TCC		0.537	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580		46	37	1	0	5.20006e-24	0.002852	9.09582e-24	46	37				
ANKRD20A8P	729171	broad.mit.edu	37	2	95513900	95513900	+	RNA	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:95513900C>T	ENST00000432432.2	-	0	712				RNU6-1320P_ENST00000390838.1_RNA	NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		GAGAGCTGACCTAAAATAACA	0.353																																							uc010fhp.2		NA																	0					0						c.e5-1		Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.																																						729171							g.chr2:95513900C>T			2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95513900C>T			Somatic						NR_003366		WXS	Illumina HiSeq	Unspecified					5		-								A6NC18	Splice_Site	SNP	ENST00000432432.2	37	c.506_splice																																																																																					0.353	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	pseudogene	OTTHUMT00000451404.1			28	529	0	0	0	0.00623	0	28	529				
ANKRD36	375248	broad.mit.edu	37	2	97866080	97866080	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:97866080G>C	ENST00000461153.2	+	45	3009	c.2765G>C	c.(2764-2766)cGg>cCg	p.R922P	ANKRD36_ENST00000420699.2_Missense_Mutation_p.R922P			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	922										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GTGTCTTCTCGGAAAAAACCA	0.338																																							uc010yva.1		NA																	0					0						c.(2764-2766)CGG>CCG		ankyrin repeat domain 36							224.0	213.0	216.0					2																	97866080		692	1591	2283	SO:0001583	missense	375248							g.chr2:97866080G>C	BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2765G>C	2.37:g.97866080G>C	ENSP00000419530:p.Arg922Pro		Somatic				ANKRD36_uc002sxo.2_Missense_Mutation_p.R338P|ANKRD36_uc002sxp.3_RNA|ANKRD36_uc002sxq.1_RNA	p.R922P	NM_001164315	NP_001157787	WXS	Illumina HiSeq	Unspecified	A6QL64	AN36A_HUMAN			45	3009	+			922					B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	ENST00000461153.2	37	c.2765G>C	CCDS54379.1	.	.	.	.	.	.	.	.	.	.	.	7.373	0.627222	0.14257	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000393513;ENST00000461694	T;T	0.78364	-1.17;-1.17	0.42	-0.841	0.10752	.	.	.	.	.	T	0.70631	0.3246	N	0.14661	0.345	0.09310	N	1	D;B	0.56521	0.976;0.344	P;B	0.62560	0.904;0.058	T	0.59989	-0.7350	8	0.48119	T	0.1	.	.	.	.	.	922;338	A6QL64;F2Z332	AN36A_HUMAN;.	P	922;922;338;284	ENSP00000419530:R922P;ENSP00000391950:R922P	ENSP00000377149:R338P	R	+	2	0	ANKRD36	97229807	0.471000	0.25862	0.001000	0.08648	0.003000	0.03518	-0.019000	0.12546	-0.826000	0.04284	-1.252000	0.01501	CGG		0.338	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5			17	39	0	0	0	0.007413	0	17	39				
ST6GAL2	84620	broad.mit.edu	37	2	107459563	107459563	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:107459563G>T	ENST00000409382.3	-	2	1481	c.871C>A	c.(871-873)Cgc>Agc	p.R291S	ST6GAL2_ENST00000409087.3_Missense_Mutation_p.R291S|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.R291S|AC016994.2_ENST00000425419.1_RNA	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	291					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.R291C(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CGCAGGCCGCGGGGGTGCAGC	0.716																																							uc002tdq.2		NA																	1	Substitution - Missense(1)	p.R291C(1)|p.R291H(1)	ovary(1)	pancreas(6)|ovary(4)|skin(1)	11						c.(871-873)CGC>AGC		ST6 beta-galactosamide							7.0	8.0	8.0					2																	107459563		1687	3582	5269	SO:0001583	missense	84620				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	g.chr2:107459563G>T	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.871C>A	2.37:g.107459563G>T	ENSP00000386942:p.Arg291Ser		Somatic				ST6GAL2_uc002tdr.2_Missense_Mutation_p.R291S|ST6GAL2_uc002tds.3_Missense_Mutation_p.R291S	p.R291S	NM_001142351	NP_001135823	WXS	Illumina HiSeq	Unspecified	Q96JF0	SIAT2_HUMAN			2	990	-			291			Lumenal (Potential).		D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	c.871C>A	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404213	0.42613	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.27402	1.67;1.67;1.67	4.54	3.64	0.41730	.	0.589034	0.18186	N	0.148984	T	0.31263	0.0791	M	0.69463	2.115	0.19775	N	0.99995	B;B	0.33073	0.339;0.396	B;B	0.31442	0.13;0.078	T	0.11567	-1.0582	10	0.25751	T	0.34	-10.3825	13.2142	0.59849	0.0:0.0:0.8396:0.1604	.	291;291	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	S	291	ENSP00000355273:R291S;ENSP00000386942:R291S;ENSP00000387332:R291S	ENSP00000355273:R291S	R	-	1	0	ST6GAL2	106825995	0.000000	0.05858	0.332000	0.25469	0.576000	0.36127	0.801000	0.27055	1.001000	0.39076	0.563000	0.77884	CGC		0.716	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528		12	11	1	0	3.07112e-06	0.000978	4.598e-06	12	11				
SULT1C4	27233	broad.mit.edu	37	2	108999952	108999952	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:108999952G>A	ENST00000272452.2	+	5	927	c.601G>A	c.(601-603)Gag>Aag	p.E201K	SULT1C4_ENST00000409309.3_Missense_Mutation_p.E126K	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	201					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						TCTCTTCTATGAGGACATGAA	0.468																																							uc002tea.1		NA																	0					0						c.(601-603)GAG>AAG		sulfotransferase family, cytosolic, 1C, member							123.0	102.0	109.0					2																	108999952		2203	4300	6503	SO:0001583	missense	27233				3'-phosphoadenosine 5'-phosphosulfate metabolic process|sulfation|xenobiotic metabolic process	cytosol	sulfotransferase activity	g.chr2:108999952G>A	AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.601G>A	2.37:g.108999952G>A	ENSP00000272452:p.Glu201Lys		Somatic				SULT1C4_uc010ywr.1_RNA|SULT1C4_uc002teb.1_Missense_Mutation_p.E126K	p.E201K	NM_006588	NP_006579	WXS	Illumina HiSeq	Unspecified	O75897	ST1C4_HUMAN			5	974	+			201			PAPS.		Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000272452.2	37	c.601G>A	CCDS2077.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781769	0.90282	.	.	ENSG00000198075	ENST00000272452;ENST00000409309	T;T	0.07908	3.15;3.15	4.76	3.88	0.44766	Sulfotransferase domain (1);	0.000000	0.52532	D	0.000079	T	0.43166	0.1235	H	0.97732	4.065	0.45307	D	0.998301	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.64339	-0.6431	10	0.87932	D	0	.	13.8897	0.63731	0.0:0.0:0.8466:0.1534	.	126;201	Q08AS5;O75897	.;ST1C4_HUMAN	K	201;126	ENSP00000272452:E201K;ENSP00000387225:E126K	ENSP00000272452:E201K	E	+	1	0	SULT1C4	108366384	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	8.215000	0.89762	1.344000	0.45657	0.609000	0.83330	GAG		0.468	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253561.1	NM_006588		29	24	0	0	0	0.008361	0	29	24				
EDAR	10913	broad.mit.edu	37	2	109513632	109513632	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:109513632G>T	ENST00000258443.2	-	12	1508	c.1078C>A	c.(1078-1080)Ctc>Atc	p.L360I	EDAR_ENST00000376651.1_Missense_Mutation_p.L392I|EDAR_ENST00000409271.1_Missense_Mutation_p.L392I	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor	360	Death.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						GTGGAGCTGAGCATTCGGCTA	0.537																																							uc002teq.3		NA																	0				skin(1)	1						c.(1078-1080)CTC>ATC		ectodysplasin A receptor precursor							77.0	68.0	71.0					2																	109513632		2203	4300	6503	SO:0001583	missense	10913				apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity	g.chr2:109513632G>T	AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.1078C>A	2.37:g.109513632G>T	ENSP00000258443:p.Leu360Ile		Somatic				EDAR_uc010fjn.2_Missense_Mutation_p.L392I|EDAR_uc010yws.1_Missense_Mutation_p.L392I	p.L360I	NM_022336	NP_071731	WXS	Illumina HiSeq	Unspecified	Q9UNE0	EDAR_HUMAN			12	1509	-			360			Death.|Cytoplasmic (Potential).		B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Missense_Mutation	SNP	ENST00000258443.2	37	c.1078C>A	CCDS2081.1	.	.	.	.	.	.	.	.	.	.	G	35	5.445559	0.96187	.	.	ENSG00000135960	ENST00000409271;ENST00000258443;ENST00000376651	D;D;D	0.91945	-2.94;-2.94;-2.94	5.64	5.64	0.86602	DEATH-like (2);	0.000000	0.85682	D	0.000000	D	0.93245	0.7848	N	0.19112	0.55	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	D	0.94405	0.7626	10	0.87932	D	0	-32.5326	19.7209	0.96143	0.0:0.0:1.0:0.0	.	392;360	E9PC98;Q9UNE0	.;EDAR_HUMAN	I	392;360;392	ENSP00000386371:L392I;ENSP00000258443:L360I;ENSP00000365839:L392I	ENSP00000258443:L360I	L	-	1	0	EDAR	108880064	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.476000	0.97823	2.651000	0.90000	0.650000	0.86243	CTC		0.537	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253595.1			11	24	1	0	1.58986e-06	0.008291	2.38705e-06	11	24				
NCKAP5	344148	broad.mit.edu	37	2	133489398	133489398	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:133489398G>T	ENST00000409261.1	-	17	5728	c.5355C>A	c.(5353-5355)agC>agA	p.S1785R	NCKAP5_ENST00000405974.3_Missense_Mutation_p.S466R|NCKAP5_ENST00000409213.1_Missense_Mutation_p.S466R|NCKAP5_ENST00000317721.6_Missense_Mutation_p.S1785R|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1785										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GAACAATGGCGCTATCTGCAG	0.567																																							uc002ttp.2		NA																	0					0						c.(5353-5355)AGC>AGA		Nck-associated protein 5 isoform 1							83.0	87.0	86.0					2																	133489398		2051	4192	6243	SO:0001583	missense	344148						protein binding	g.chr2:133489398G>T	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.5355C>A	2.37:g.133489398G>T	ENSP00000387128:p.Ser1785Arg		Somatic				NCKAP5_uc002ttq.2_Missense_Mutation_p.S466R	p.S1785R	NM_207363	NP_997246	WXS	Illumina HiSeq	Unspecified	O14513	NCKP5_HUMAN			17	5729	-			1785					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.5355C>A	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249120	0.39797	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.46451	2.86;0.87;2.86;0.87	5.2	-2.69	0.06022	.	1.261980	0.06572	U	0.748662	T	0.25344	0.0616	N	0.24115	0.695	0.09310	N	1	B;B	0.15719	0.001;0.014	B;B	0.17722	0.003;0.019	T	0.27502	-1.0072	10	0.72032	D	0.01	.	2.6725	0.05071	0.4163:0.1101:0.3611:0.1125	.	466;1785	O14513-2;O14513	.;NCKP5_HUMAN	R	1785;466;1785;466;466	ENSP00000387128:S1785R;ENSP00000386952:S466R;ENSP00000380603:S1785R;ENSP00000385692:S466R	ENSP00000380603:S1785R	S	-	3	2	NCKAP5	133205868	0.000000	0.05858	0.000000	0.03702	0.164000	0.22412	-0.803000	0.04540	-0.819000	0.04323	0.655000	0.94253	AGC		0.567	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		56	49	1	0	8.44121e-28	0.00361	1.49128e-27	56	49				
GALNT5	11227	broad.mit.edu	37	2	158114729	158114729	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:158114729C>T	ENST00000259056.4	+	1	620	c.135C>T	c.(133-135)atC>atT	p.I45I		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	45					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						CTCGGGTCATCAAGGAAGACA	0.468																																							uc002tzg.2		NA																	0				breast(3)|skin(1)	4						c.(133-135)ATC>ATT		N-acetylgalactosaminyltransferase 5							125.0	130.0	128.0					2																	158114729		2203	4300	6503	SO:0001819	synonymous_variant	11227				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:158114729C>T	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.135C>T	2.37:g.158114729C>T			Somatic				GALNT5_uc010zci.1_RNA	p.I45I	NM_014568	NP_055383	WXS	Illumina HiSeq	Unspecified	Q7Z7M9	GALT5_HUMAN			1	390	+			45			Lumenal (Potential).		A5PKZ1|Q9UGK7|Q9UHL6	Silent	SNP	ENST00000259056.4	37	c.135C>T	CCDS2203.1																																																																																				0.468	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568		18	102	0	0	0	0.007413	0	18	102				
ITGB6	3694	broad.mit.edu	37	2	161052915	161052915	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:161052915G>C	ENST00000283249.2	-	3	395	c.158C>G	c.(157-159)tCt>tGt	p.S53C	ITGB6_ENST00000485635.1_5'UTR|ITGB6_ENST00000409872.1_Missense_Mutation_p.S53C|ITGB6_ENST00000409967.2_Missense_Mutation_p.S53C|ITGB6_ENST00000428609.2_Missense_Mutation_p.S11C	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	53					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						GCCAACTCCAGATGGATGAGT	0.318																																							uc002ubh.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(157-159)TCT>TGT		integrin, beta 6 precursor							100.0	110.0	107.0					2																	161052915		2203	4300	6503	SO:0001583	missense	3694				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity	g.chr2:161052915G>C		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.158C>G	2.37:g.161052915G>C	ENSP00000283249:p.Ser53Cys		Somatic				ITGB6_uc010fow.1_RNA|ITGB6_uc010fou.2_Missense_Mutation_p.S53C|ITGB6_uc010zcq.1_Missense_Mutation_p.S11C|ITGB6_uc010fov.1_Missense_Mutation_p.S53C	p.S53C	NM_000888	NP_000879	WXS	Illumina HiSeq	Unspecified	P18564	ITB6_HUMAN			3	174	-			53			Extracellular (Potential).		B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	c.158C>G	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.724201	0.48728	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11	5.88	4.06	0.47325	Integrin beta subunit, N-terminal (2);	0.182832	0.49916	D	0.000136	D	0.89022	0.6597	L	0.41824	1.3	0.35003	D	0.756153	P;B	0.36599	0.56;0.295	B;B	0.43536	0.423;0.423	D	0.90874	0.4748	10	0.59425	D	0.04	.	7.7842	0.29083	0.1329:0.0:0.7351:0.132	.	11;53	E9PEE8;P18564	.;ITB6_HUMAN	C	53;11;53;53	ENSP00000283249:S53C;ENSP00000408024:S11C;ENSP00000386828:S53C;ENSP00000386367:S53C	ENSP00000283249:S53C	S	-	2	0	ITGB6	160761161	0.995000	0.38212	0.973000	0.42090	0.959000	0.62525	2.114000	0.41911	1.476000	0.48215	0.655000	0.94253	TCT		0.318	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888		9	106	0	0	0	0.004482	0	9	106				
COL3A1	1281	broad.mit.edu	37	2	189860870	189860870	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:189860870G>A	ENST00000304636.3	+	23	1798	c.1628G>A	c.(1627-1629)gGa>gAa	p.G543E	COL3A1_ENST00000317840.5_Missense_Mutation_p.G543E	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	543	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GGAAGTCCAGGAGGACCAGGA	0.363																																							uc002uqj.1		NA																	0				central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(1627-1629)GGA>GAA		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						66.0	77.0	73.0					2																	189860870		2203	4300	6503	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189860870G>A	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.1628G>A	2.37:g.189860870G>A	ENSP00000304408:p.Gly543Glu		Somatic					p.G543E	NM_000090	NP_000081	WXS	Illumina HiSeq	Unspecified	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		23	1745	+			543			Triple-helical region.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.1628G>A	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446612	0.63178	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.99353	-5.77;-5.77	5.52	5.52	0.82312	.	0.000000	0.48286	D	0.000186	D	0.99715	0.9890	H	0.98276	4.19	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	D	0.97223	0.9879	10	0.87932	D	0	.	19.4179	0.94709	0.0:0.0:1.0:0.0	.	543	P02461	CO3A1_HUMAN	E	543	ENSP00000304408:G543E;ENSP00000315243:G543E	ENSP00000304408:G543E	G	+	2	0	COL3A1	189569115	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.451000	0.73481	2.595000	0.87683	0.462000	0.41574	GGA		0.363	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		4	58	0	0	0	0.000602	0	4	58				
COL6A3	1293	broad.mit.edu	37	2	238285718	238285718	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:238285718C>T	ENST00000295550.4	-	7	3219	c.2767G>A	c.(2767-2769)Gca>Aca	p.A923T	COL6A3_ENST00000347401.3_Missense_Mutation_p.A722T|COL6A3_ENST00000346358.4_Missense_Mutation_p.A723T|COL6A3_ENST00000392004.3_Missense_Mutation_p.A717T|COL6A3_ENST00000472056.1_Missense_Mutation_p.A316T|COL6A3_ENST00000409809.1_Missense_Mutation_p.A717T|COL6A3_ENST00000353578.4_Missense_Mutation_p.A717T|COL6A3_ENST00000392003.2_Missense_Mutation_p.A516T	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	923	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TACCTCTGTGCATAGTCCAGC	0.522																																							uc002vwl.2		NA																	0				ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(2767-2769)GCA>ACA		alpha 3 type VI collagen isoform 1 precursor							86.0	74.0	78.0					2																	238285718		2203	4300	6503	SO:0001583	missense	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238285718C>T	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.2767G>A	2.37:g.238285718C>T	ENSP00000295550:p.Ala923Thr		Somatic				COL6A3_uc002vwo.2_Missense_Mutation_p.A717T|COL6A3_uc010znj.1_Missense_Mutation_p.A316T|COL6A3_uc002vwq.2_Missense_Mutation_p.A717T|COL6A3_uc002vwr.2_Missense_Mutation_p.A516T|COL6A3_uc010znk.1_Missense_Mutation_p.A723T	p.A923T	NM_004369	NP_004360	WXS	Illumina HiSeq	Unspecified	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	7	3052	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	923			Nonhelical region.|VWFA 5.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	c.2767G>A	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190757	0.58017	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003	D;D;D;D;D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1	5.55	5.55	0.83447	von Willebrand factor, type A (3);	0.247109	0.28241	N	0.016077	D	0.91808	0.7408	L	0.57536	1.79	0.34492	D	0.705127	P;D;D;D;D;P	0.89917	0.822;0.999;0.975;0.997;1.0;0.822	B;D;D;D;D;B	0.81914	0.419;0.995;0.911;0.986;0.991;0.341	D	0.90693	0.4614	10	0.17832	T	0.49	.	19.4964	0.95075	0.0:1.0:0.0:0.0	.	723;316;516;717;717;923	E9PCV6;E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;.;CO6A3_HUMAN	T	923;722;717;316;717;723;717;516	ENSP00000295550:A923T;ENSP00000315609:A722T;ENSP00000315873:A717T;ENSP00000418285:A316T;ENSP00000386844:A717T;ENSP00000295546:A723T;ENSP00000375861:A717T;ENSP00000375860:A516T	ENSP00000295550:A923T	A	-	1	0	COL6A3	237950457	0.995000	0.38212	0.083000	0.20561	0.323000	0.28346	3.570000	0.53834	2.610000	0.88304	0.655000	0.94253	GCA		0.522	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		14	43	0	0	0	0.004007	0	14	43				
COL6A3	1293	broad.mit.edu	37	2	238287566	238287566	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:238287566C>G	ENST00000295550.4	-	6	2662	c.2210G>C	c.(2209-2211)aGc>aCc	p.S737T	COL6A3_ENST00000347401.3_Missense_Mutation_p.S536T|COL6A3_ENST00000346358.4_Intron|COL6A3_ENST00000392004.3_Missense_Mutation_p.S531T|COL6A3_ENST00000472056.1_Intron|COL6A3_ENST00000409809.1_Missense_Mutation_p.S531T|COL6A3_ENST00000353578.4_Missense_Mutation_p.S531T|COL6A3_ENST00000392003.2_Missense_Mutation_p.S330T	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	737	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ACGGATCCTGCTGCCGCCAGC	0.612																																							uc002vwl.2		NA																	0				ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(2209-2211)AGC>ACC		alpha 3 type VI collagen isoform 1 precursor							52.0	47.0	49.0					2																	238287566		2203	4300	6503	SO:0001583	missense	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238287566C>G	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.2210G>C	2.37:g.238287566C>G	ENSP00000295550:p.Ser737Thr		Somatic				COL6A3_uc002vwo.2_Missense_Mutation_p.S531T|COL6A3_uc010znj.1_Intron|COL6A3_uc002vwq.2_Missense_Mutation_p.S531T|COL6A3_uc002vwr.2_Missense_Mutation_p.S330T|COL6A3_uc010znk.1_Intron	p.S737T	NM_004369	NP_004360	WXS	Illumina HiSeq	Unspecified	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	6	2495	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	737			VWFA 4.|Nonhelical region.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	c.2210G>C	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.384256	0.82792	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000409809;ENST00000392004;ENST00000392003	D;D;D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87;-1.87;-1.87	5.52	5.52	0.82312	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000013	D	0.92293	0.7555	M	0.75777	2.31	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.999;0.999	D;D;D;D	0.91635	0.998;0.999;0.998;0.983	D	0.91396	0.5139	10	0.42905	T	0.14	.	19.4741	0.94979	0.0:1.0:0.0:0.0	.	330;531;531;737	A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;CO6A3_HUMAN	T	737;536;531;531;531;330	ENSP00000295550:S737T;ENSP00000315609:S536T;ENSP00000315873:S531T;ENSP00000386844:S531T;ENSP00000375861:S531T;ENSP00000375860:S330T	ENSP00000295550:S737T	S	-	2	0	COL6A3	237952305	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.039000	0.70972	2.595000	0.87683	0.655000	0.94253	AGC		0.612	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		3	36	0	0	0	0.000248	0	3	36				
GPR35	2859	broad.mit.edu	37	2	241569660	241569660	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:241569660G>A	ENST00000319838.5	+	6	1233	c.291G>A	c.(289-291)ctG>ctA	p.L97L	GPR35_ENST00000438013.2_Silent_p.L128L|GPR35_ENST00000403859.1_Silent_p.L97L|GPR35_ENST00000407714.1_Silent_p.L97L|GPR35_ENST00000430267.1_Silent_p.L97L	NM_001195381.1	NP_001182310.1	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	97					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|cervix(1)|endometrium(1)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	17		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)		GCATCTACCTGACCAACAGGT	0.677																																							uc002vzs.1		NA																	0				skin(2)|pancreas(1)	3						c.(289-291)CTG>CTA		G protein-coupled receptor 35							63.0	51.0	55.0					2																	241569660		2203	4300	6503	SO:0001819	synonymous_variant	2859					integral to plasma membrane	G-protein coupled receptor activity	g.chr2:241569660G>A		CCDS2541.1, CCDS56174.1	2q37.3	2012-08-21			ENSG00000178623	ENSG00000178623		"""GPCR / Class A : Orphans"""	4492	protein-coding gene	gene with protein product		602646				9479505	Standard	NM_005301		Approved		uc021vze.1	Q9HC97	OTTHUMG00000133356	ENST00000319838.5:c.291G>A	2.37:g.241569660G>A			Somatic				GPR35_uc010fzh.1_Silent_p.L128L|GPR35_uc010fzi.1_Silent_p.L128L	p.L97L	NM_005301	NP_005292	WXS	Illumina HiSeq	Unspecified	Q9HC97	GPR35_HUMAN		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)	1	866	+		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)	97			Helical; Name=3; (Potential).		J3KR30|O43495|Q17R58|Q4VBN5|Q4ZFV2|Q6FHI8|Q86UH4	Silent	SNP	ENST00000319838.5	37	c.291G>A	CCDS2541.1																																																																																				0.677	GPR35-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325631.1	NM_001195382		5	37	0	0	0	0.000602	0	5	37				
CPXM1	56265	broad.mit.edu	37	20	2776781	2776781	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr20:2776781C>A	ENST00000380605.2	-	10	1333	c.1269G>T	c.(1267-1269)gaG>gaT	p.E423D		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	423					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TCCAGCGGCCCTCGGCCCAGC	0.592																																							uc002wgu.2		NA																	0				ovary(2)|skin(2)	4						c.(1267-1269)GAG>GAT		carboxypeptidase X, member 1 precursor							70.0	72.0	71.0					20																	2776781		2203	4300	6503	SO:0001583	missense	56265				cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding	g.chr20:2776781C>A	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1269G>T	20.37:g.2776781C>A	ENSP00000369979:p.Glu423Asp		Somatic				CPXM1_uc010gas.2_Missense_Mutation_p.E423D	p.E423D	NM_019609	NP_062555	WXS	Illumina HiSeq	Unspecified	Q96SM3	CPXM1_HUMAN			10	1333	-			423					Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	37	c.1269G>T	CCDS13033.1	.	.	.	.	.	.	.	.	.	.	C	5.821	0.335795	0.11013	.	.	ENSG00000088882	ENST00000380605;ENST00000421947	T	0.10960	2.82	5.43	2.49	0.30216	Peptidase M14, carboxypeptidase A (2);	0.612520	0.18001	N	0.154900	T	0.06005	0.0156	N	0.21545	0.675	0.27915	N	0.938456	B;B	0.22080	0.061;0.064	B;B	0.22152	0.038;0.021	T	0.38373	-0.9664	10	0.19147	T	0.46	-33.3758	4.0937	0.09982	0.1618:0.5895:0.0:0.2486	.	423;423	Q8N2E1;Q96SM3	.;CPXM1_HUMAN	D	423;119	ENSP00000369979:E423D	ENSP00000369979:E423D	E	-	3	2	CPXM1	2724781	0.000000	0.05858	1.000000	0.80357	0.772000	0.43724	-0.216000	0.09266	0.430000	0.26230	0.655000	0.94253	GAG		0.592	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609		23	30	1	0	6.36457e-07	0.003954	9.63778e-07	23	30				
CSRP2BP	57325	broad.mit.edu	37	20	18163777	18163777	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr20:18163777G>A	ENST00000435364.3	+	8	2160	c.1819G>A	c.(1819-1821)Gaa>Aaa	p.E607K	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.E479K|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.E606K	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	607					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						GCGTGATTATGAAACAAAGCC	0.468																																							uc002wqj.2		NA																	0				lung(3)|ovary(2)|skin(1)	6						c.(1819-1821)GAA>AAA		CSRP2 binding protein							118.0	117.0	117.0					20																	18163777		2203	4300	6503	SO:0001583	missense	57325				histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity	g.chr20:18163777G>A	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.1819G>A	20.37:g.18163777G>A	ENSP00000392318:p.Glu607Lys		Somatic				CSRP2BP_uc002wqk.2_Missense_Mutation_p.E479K|CSRP2BP_uc010zru.1_Missense_Mutation_p.E478K	p.E607K	NM_020536	NP_065397	WXS	Illumina HiSeq	Unspecified	Q9H8E8	CSR2B_HUMAN			9	2441	+			607					A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	c.1819G>A	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	G	36	5.946386	0.97134	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.20200	2.09;2.09;2.09;2.09	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.47229	0.1434	M	0.69823	2.125	0.80722	D	1	D;D	0.64830	0.994;0.979	P;P	0.61940	0.896;0.791	T	0.31110	-0.9955	10	0.66056	D	0.02	-15.7522	20.5948	0.99439	0.0:0.0:1.0:0.0	.	479;607	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	K	607;606;607;479	ENSP00000278816:E607K;ENSP00000366909:E606K;ENSP00000392318:E607K;ENSP00000425909:E479K	ENSP00000278816:E607K	E	+	1	0	CSRP2BP	18111777	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.696000	0.84270	2.873000	0.98535	0.563000	0.77884	GAA		0.468	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536		12	101	0	0	0	0.000978	0	12	101				
TPX2	22974	broad.mit.edu	37	20	30359385	30359385	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr20:30359385G>C	ENST00000300403.6	+	7	1036	c.508G>C	c.(508-510)Gag>Cag	p.E170Q	TPX2_ENST00000340513.4_Missense_Mutation_p.E170Q	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	170					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			AAAGAAGCCAGAGGAAGAAGG	0.433																																							uc002wwp.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(508-510)GAG>CAG		TPX2, microtubule-associated protein homolog							92.0	86.0	88.0					20																	30359385		2203	4300	6503	SO:0001583	missense	22974				activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding	g.chr20:30359385G>C	AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.508G>C	20.37:g.30359385G>C	ENSP00000300403:p.Glu170Gln		Somatic				TPX2_uc010gdv.1_Missense_Mutation_p.E170Q	p.E170Q	NM_012112	NP_036244	WXS	Illumina HiSeq	Unspecified	Q9ULW0	TPX2_HUMAN	Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)		7	1206	+			170					Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Missense_Mutation	SNP	ENST00000300403.6	37	c.508G>C	CCDS13190.1	.	.	.	.	.	.	.	.	.	.	G	8.521	0.868845	0.17322	.	.	ENSG00000088325	ENST00000300403;ENST00000340513	T	0.34275	1.37	4.66	1.67	0.24075	.	0.449318	0.20547	N	0.090192	T	0.17023	0.0409	N	0.19112	0.55	0.18873	N	0.999988	B;B	0.30482	0.281;0.18	B;B	0.25405	0.06;0.037	T	0.17440	-1.0369	10	0.14656	T	0.56	-15.2125	6.0897	0.19987	0.3148:0.0:0.6852:0.0	.	170;170	Q96RR5;Q9ULW0	.;TPX2_HUMAN	Q	170	ENSP00000341145:E170Q	ENSP00000300403:E170Q	E	+	1	0	TPX2	29823046	0.834000	0.29399	0.748000	0.31131	0.830000	0.47004	1.822000	0.39052	0.697000	0.31718	0.511000	0.50034	GAG		0.433	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078569.2			4	41	0	0	0	0.000248	0	4	41				
MYLK2	85366	broad.mit.edu	37	20	30418882	30418882	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr20:30418882G>A	ENST00000375994.2	+	9	1635	c.1362G>A	c.(1360-1362)gtG>gtA	p.V454V	MYLK2_ENST00000375985.4_Silent_p.V454V|MYLK2_ENST00000468730.1_3'UTR			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	454	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CTGAGGTGGTGAATTATGACC	0.542																																							uc002wwq.2		NA																	0				lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6						c.(1360-1362)GTG>GTA		skeletal myosin light chain kinase							107.0	98.0	101.0					20																	30418882		2203	4300	6503	SO:0001819	synonymous_variant	85366				cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity	g.chr20:30418882G>A	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1362G>A	20.37:g.30418882G>A			Somatic				MYLK2_uc002wws.2_Silent_p.V71V|MYLK2_uc010gdw.1_RNA	p.V454V	NM_033118	NP_149109	WXS	Illumina HiSeq	Unspecified	Q9H1R3	MYLK2_HUMAN	Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)		10	1464	+			454			Protein kinase.		Q569L1|Q96I84	Silent	SNP	ENST00000375994.2	37	c.1362G>A	CCDS13191.1																																																																																				0.542	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2	NM_033118		27	86	0	0	0	0.003954	0	27	86				
KIAA1755	85449	broad.mit.edu	37	20	36841846	36841846	+	Silent	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr20:36841846G>T	ENST00000279024.4	-	14	3472	c.3201C>A	c.(3199-3201)cgC>cgA	p.R1067R		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	1067										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				TTCGTTCTGGGCGCGCTGAGT	0.632																																							uc002xhy.1		NA																	0				ovary(4)|pancreas(1)	5						c.(3199-3201)CGC>CGA		hypothetical protein LOC85449							36.0	28.0	30.0					20																	36841846		2203	4300	6503	SO:0001819	synonymous_variant	85449							g.chr20:36841846G>T	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.3201C>A	20.37:g.36841846G>T			Somatic				KIAA1755_uc002xhv.1_Silent_p.R131R|KIAA1755_uc002xhw.1_Silent_p.R122R|KIAA1755_uc002xhx.1_Silent_p.R345R	p.R1067R	NM_001029864	NP_001025035	WXS	Illumina HiSeq	Unspecified	Q5JYT7	K1755_HUMAN			14	3473	-		Myeloproliferative disorder(115;0.00874)	1067					Q9C0A8	Silent	SNP	ENST00000279024.4	37	c.3201C>A	CCDS33467.1																																																																																				0.632	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864		6	8	1	0	0.00116845	0.001168	0.00169201	6	8				
WISP2	8839	broad.mit.edu	37	20	43353466	43353466	+	Missense_Mutation	SNP	G	G	A	rs369394532		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr20:43353466G>A	ENST00000372868.2	+	4	708	c.365G>A	c.(364-366)cGc>cAc	p.R122H	RP11-445H22.4_ENST00000427303.1_RNA|RP11-445H22.4_ENST00000427598.1_RNA|WISP2_ENST00000190983.4_Missense_Mutation_p.R122H|WISP2_ENST00000372865.4_Intron|RP11-445H22.4_ENST00000445420.1_RNA|WISP2_ENST00000471629.1_3'UTR			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	122	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				ATCCGCTGCCGCTGCGAGGAC	0.687																																							uc002xmn.2		NA																	0				skin(1)	1						c.(364-366)CGC>CAC		WNT1 inducible signaling pathway protein 2							27.0	21.0	23.0					20																	43353466		2195	4291	6486	SO:0001583	missense	8839				cell adhesion|cell-cell signaling|signal transduction	extracellular region|soluble fraction	insulin-like growth factor binding	g.chr20:43353466G>A	AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.365G>A	20.37:g.43353466G>A	ENSP00000361959:p.Arg122His		Somatic				uc002xml.1_Intron|uc002xmm.1_Intron|WISP2_uc002xmp.2_Missense_Mutation_p.R122H|WISP2_uc002xmq.2_Intron	p.R122H	NM_003881	NP_003872	WXS	Illumina HiSeq	Unspecified	O76076	WISP2_HUMAN			4	718	+		Myeloproliferative disorder(115;0.0122)	122			VWFC.		B2R9N4|E1P612|Q6PEG3	Missense_Mutation	SNP	ENST00000372868.2	37	c.365G>A	CCDS13336.1	.	.	.	.	.	.	.	.	.	.	G	10.16	1.272704	0.23221	.	.	ENSG00000064205	ENST00000372868;ENST00000190983	T;T	0.72942	-0.7;-0.7	4.66	1.41	0.22369	von Willebrand factor, type C (4);	0.380726	0.30830	N	0.008799	T	0.50222	0.1603	L	0.29908	0.895	0.28853	N	0.895963	B	0.14805	0.011	B	0.14023	0.01	T	0.26360	-1.0105	10	0.19147	T	0.46	-8.8552	5.7497	0.18140	0.2918:0.0:0.5758:0.1324	.	122	O76076	WISP2_HUMAN	H	122	ENSP00000361959:R122H;ENSP00000190983:R122H	ENSP00000190983:R122H	R	+	2	0	WISP2	42786880	0.054000	0.20591	1.000000	0.80357	0.385000	0.30292	0.209000	0.17435	0.960000	0.38005	0.455000	0.32223	CGC		0.687	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127824.1	NM_003881		8	5	0	0	0	0.004482	0	8	5				
WFDC10B	280664	broad.mit.edu	37	20	44313526	44313526	+	Silent	SNP	T	T	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr20:44313526T>C	ENST00000330523.5	-	4	395	c.165A>G	c.(163-165)gaA>gaG	p.E55E	WFDC10B_ENST00000335769.2_Silent_p.E71E	NM_172006.2	NP_742003.1	Q8IUB3	WF10B_HUMAN	WAP four-disulfide core domain 10B	55	WAP. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)			lung(2)|ovary(1)|stomach(1)	4		Myeloproliferative disorder(115;0.0122)				TCTTATTTGTTTCACACTTTT	0.468																																							uc002xpb.2		NA																	0				ovary(1)	1						c.(163-165)GAA>GAG		WAP four-disulfide core domain 10B isoform a							195.0	154.0	168.0					20																	44313526		2203	4300	6503	SO:0001819	synonymous_variant	280664					extracellular region	peptidase inhibitor activity	g.chr20:44313526T>C	AF454506	CCDS13365.1, CCDS13366.1	20q13.12	2013-01-21			ENSG00000182931	ENSG00000182931		"""WAP four-disulfide core domain containing"""	20479	protein-coding gene	gene with protein product						12206714	Standard	NM_172006		Approved	WAP12	uc002xpb.3	Q8IUB3	OTTHUMG00000130227	ENST00000330523.5:c.165A>G	20.37:g.44313526T>C			Somatic				WFDC10B_uc002xpc.2_Silent_p.E71E	p.E55E	NM_172006	NP_742003	WXS	Illumina HiSeq	Unspecified	Q8IUB3	WF10B_HUMAN			4	396	-		Myeloproliferative disorder(115;0.0122)	55			WAP.		A6PVD7|Q0VAG0|Q0VAG1|Q5TGZ5|Q8IUB4	Silent	SNP	ENST00000330523.5	37	c.165A>G	CCDS13366.1																																																																																				0.468	WFDC10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252547.1			12	140	0	0	0	0.003163	0	12	140				
PTGIS	5740	broad.mit.edu	37	20	48124472	48124472	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr20:48124472G>T	ENST00000244043.4	-	10	1517	c.1488C>A	c.(1486-1488)taC>taA	p.Y496*	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	496					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	GGCGGATGCGGTAGCGGACGG	0.622																																							uc002xut.2		NA																	0				skin(2)|ovary(1)	3						c.(1486-1488)TAC>TAA		prostaglandin I2 synthase	Phenylbutazone(DB00812)						92.0	65.0	74.0					20																	48124472		2203	4300	6503	SO:0001587	stop_gained	5740				hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity	g.chr20:48124472G>T		CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.1488C>A	20.37:g.48124472G>T	ENSP00000244043:p.Tyr496*		Somatic				PTGIS_uc010zyi.1_Nonsense_Mutation_p.Y357*	p.Y496*	NM_000961	NP_000952	WXS	Illumina HiSeq	Unspecified	Q16647	PTGIS_HUMAN	BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		10	1542	-			496					Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Nonsense_Mutation	SNP	ENST00000244043.4	37	c.1488C>A	CCDS13419.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.975733	0.53720	.	.	ENSG00000124212	ENST00000244043	.	.	.	4.46	3.49	0.39957	.	0.068970	0.64402	D	0.000012	.	.	.	.	.	.	0.35749	D	0.8193	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.1929	9.7616	0.40534	0.1027:0.0:0.8973:0.0	.	.	.	.	X	496	.	ENSP00000244043:Y496X	Y	-	3	2	PTGIS	47557879	1.000000	0.71417	0.981000	0.43875	0.333000	0.28666	3.531000	0.53546	2.208000	0.71279	0.462000	0.41574	TAC		0.622	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080496.2			26	22	1	0	1.32181e-22	0.007291	2.28195e-22	26	22				
DIDO1	11083	broad.mit.edu	37	20	61512557	61512557	+	Missense_Mutation	SNP	C	C	T	rs372175100		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr20:61512557C>T	ENST00000266070.4	-	16	5076	c.4751G>A	c.(4750-4752)cGt>cAt	p.R1584H	DIDO1_ENST00000395343.1_Missense_Mutation_p.R1584H	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1584					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CTGGGCACCACGTGCCGAGAG	0.706																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	uc002ydr.1		NA																	0				ovary(3)|skin(3)	6						c.(4750-4752)CGT>CAT		death inducer-obliterator 1 isoform c		C	HIS/ARG,HIS/ARG	1,4143		0,1,2071	13.0	16.0	15.0		4751,4751	0.6	0.0	20		15	0,8184		0,0,4092	no	missense,missense	DIDO1	NM_001193369.1,NM_033081.2	29,29	0,1,6163	TT,TC,CC		0.0,0.0241,0.0081	benign,benign	1584/2241,1584/2241	61512557	1,12327	2072	4092	6164	SO:0001583	missense	11083				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr20:61512557C>T	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4751G>A	20.37:g.61512557C>T	ENSP00000266070:p.Arg1584His		Somatic				DIDO1_uc002yds.1_Missense_Mutation_p.R1584H	p.R1584H	NM_033081	NP_149072	WXS	Illumina HiSeq	Unspecified	Q9BTC0	DIDO1_HUMAN			16	5015	-	Breast(26;5.68e-08)		1584					A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	c.4751G>A	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014874	0.35511	2.41E-4	0.0	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.08282	3.11;3.11	4.59	0.559	0.17272	.	3.466110	0.02260	U	0.067445	T	0.04272	0.0118	N	0.08118	0	0.09310	N	1	P	0.34892	0.474	B	0.23574	0.047	T	0.27706	-1.0066	10	0.59425	D	0.04	2.2448	4.3592	0.11194	0.1617:0.6191:0.0:0.2192	.	1584	Q9BTC0	DIDO1_HUMAN	H	1584	ENSP00000266070:R1584H;ENSP00000378752:R1584H	ENSP00000266070:R1584H	R	-	2	0	DIDO1	60983002	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.405000	0.21015	-0.087000	0.12528	-0.367000	0.07326	CGT		0.706	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		5	29	0	0	0	0.000602	0	5	29				
CHODL	140578	broad.mit.edu	37	21	19632525	19632525	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr21:19632525C>T	ENST00000299295.2	+	4	947	c.556C>T	c.(556-558)Cca>Tca	p.P186S	CHODL_ENST00000543733.1_Missense_Mutation_p.P167S|CHODL_ENST00000400131.1_Missense_Mutation_p.P145S|CHODL_ENST00000400135.1_Missense_Mutation_p.P145S|CHODL_ENST00000338326.3_Missense_Mutation_p.P145S|CHODL_ENST00000400127.1_Missense_Mutation_p.P145S|CHODL_ENST00000400128.1_Missense_Mutation_p.P145S	NM_001204175.1|NM_024944.2	NP_001191104.1|NP_079220.2	Q9H9P2	CHODL_HUMAN	chondrolectin	186					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)			kidney(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		AGAGATTAATCCAACAGCCCC	0.289																																							uc002ykv.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(556-558)CCA>TCA		chondrolectin precursor							87.0	89.0	89.0					21																	19632525		2203	4300	6503	SO:0001583	missense	140578				muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding	g.chr21:19632525C>T	AF257472	CCDS13570.1, CCDS56208.1, CCDS56209.1, CCDS56210.1	21q11.2	2006-04-03	2002-07-04		ENSG00000154645	ENSG00000154645			17807	protein-coding gene	gene with protein product		607247	"""chromosome 21 open reading frame 68"""	C21orf68		12079284	Standard	NM_024944		Approved	FLJ12627, PRED12, MT75	uc021whs.1	Q9H9P2	OTTHUMG00000074519	ENST00000299295.2:c.556C>T	21.37:g.19632525C>T	ENSP00000299295:p.Pro186Ser		Somatic				CHODL_uc002ykr.2_Missense_Mutation_p.P145S|CHODL_uc002yks.2_Missense_Mutation_p.P145S|CHODL_uc002ykt.2_Missense_Mutation_p.P145S|CHODL_uc002yku.2_Missense_Mutation_p.P145S	p.P186S	NM_024944	NP_079220	WXS	Illumina HiSeq	Unspecified	Q9H9P2	CHODL_HUMAN		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)	4	947	+		all_epithelial(11;0.21)	186			Extracellular (Potential).		B2R9C0|B4DJB8|Q7Z798|Q7Z799|Q7Z7A0|Q9HCY3	Missense_Mutation	SNP	ENST00000299295.2	37	c.556C>T	CCDS13570.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848904	0.32699	.	.	ENSG00000154645	ENST00000400128;ENST00000400131;ENST00000400135;ENST00000400127;ENST00000299295;ENST00000338326;ENST00000543733	T;T;T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49;0.49;0.49	5.41	5.41	0.78517	.	0.496325	0.23300	N	0.049688	T	0.70518	0.3233	M	0.63428	1.95	0.45762	D	0.998653	B;D;P	0.89917	0.013;1.0;0.78	B;D;P	0.80764	0.009;0.994;0.563	T	0.68383	-0.5423	9	.	.	.	-11.5221	18.1415	0.89641	0.0:1.0:0.0:0.0	.	186;167;145	Q9H9P2;B4DJB8;Q9H9P2-3	CHODL_HUMAN;.;.	S	145;145;145;145;186;145;167	ENSP00000382993:P145S;ENSP00000382996:P145S;ENSP00000383001:P145S;ENSP00000382992:P145S;ENSP00000299295:P186S;ENSP00000339975:P145S;ENSP00000443566:P167S	.	P	+	1	0	CHODL	18554396	0.982000	0.34865	0.971000	0.41717	0.271000	0.26615	2.586000	0.46119	2.700000	0.92200	0.650000	0.86243	CCA		0.289	CHODL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158232.1	NM_024944		22	32	0	0	0	0.00278	0	22	32				
HUNK	30811	broad.mit.edu	37	21	33346965	33346965	+	Missense_Mutation	SNP	G	G	C	rs62221640		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr21:33346965G>C	ENST00000270112.2	+	7	1469	c.1109G>C	c.(1108-1110)cGc>cCc	p.R370P	HUNK_ENST00000465574.1_3'UTR	NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	370					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						CTCTCCAACCGCGCCTGCCAC	0.542																																							uc002yph.2		NA																	0				stomach(1)|skin(1)	2						c.(1108-1110)CGC>CCC		hormonally upregulated Neu-associated kinase							94.0	85.0	88.0					21																	33346965		2203	4300	6503	SO:0001583	missense	30811				multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity	g.chr21:33346965G>C	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1109G>C	21.37:g.33346965G>C	ENSP00000270112:p.Arg370Pro		Somatic					p.R370P	NM_014586	NP_055401	WXS	Illumina HiSeq	Unspecified	P57058	HUNK_HUMAN			7	1469	+			370						Missense_Mutation	SNP	ENST00000270112.2	37	c.1109G>C	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699116	0.88830	.	.	ENSG00000142149	ENST00000270112	T	0.70399	-0.48	4.51	4.51	0.55191	.	0.137836	0.44688	D	0.000440	T	0.76856	0.4046	L	0.29908	0.895	0.58432	D	0.999995	D	0.89917	1.0	D	0.75020	0.985	T	0.80146	-0.1504	10	0.72032	D	0.01	-22.4126	17.8055	0.88600	0.0:0.0:1.0:0.0	.	370	P57058	HUNK_HUMAN	P	370	ENSP00000270112:R370P	ENSP00000270112:R370P	R	+	2	0	HUNK	32268836	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	6.831000	0.75324	2.507000	0.84556	0.561000	0.74099	CGC		0.542	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586		46	14	0	0	0	0.00361	0	46	14				
RIPPLY3	53820	broad.mit.edu	37	21	38385891	38385891	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr21:38385891G>A	ENST00000329553.2	+	3	422	c.212G>A	c.(211-213)gGa>gAa	p.G71E	RIPPLY3_ENST00000485272.1_3'UTR	NM_018962.2	NP_061835.1	P57055	DSCR6_HUMAN	ripply transcriptional repressor 3	71					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pharyngeal system development (GO:0060037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											GGATCAAAGGGAGCCTTTGGG	0.413																																						Colon(134;194 1731 2725 51652 51982)	uc002yvv.2		NA																	0				breast(1)	1						c.(211-213)GGA>GAA		Down syndrome critical region protein 6							129.0	104.0	112.0					21																	38385891		2203	4300	6503	SO:0001583	missense	53820					nucleus		g.chr21:38385891G>A	AB037158	CCDS13648.1	21q22.2	2013-07-23	2013-07-23	2013-06-04	ENSG00000183145	ENSG00000183145			3047	protein-coding gene	gene with protein product		609892	"""Down syndrome critical region gene 6"", ""ripply3 homolog (zebrafish)"""	DSCR6		10814524, 22354841	Standard	NM_018962		Approved			P57055	OTTHUMG00000086639	ENST00000329553.2:c.212G>A	21.37:g.38385891G>A	ENSP00000331734:p.Gly71Glu		Somatic				DSCR6_uc011aec.1_5'UTR|DSCR6_uc010gnd.2_Intron	p.G71E	NM_018962	NP_061835	WXS	Illumina HiSeq	Unspecified	P57055	DSCR6_HUMAN			3	422	+		Myeloproliferative disorder(46;0.0632)	71						Missense_Mutation	SNP	ENST00000329553.2	37	c.212G>A	CCDS13648.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.581347	0.65992	.	.	ENSG00000183145	ENST00000329553	.	.	.	4.49	3.61	0.41365	.	0.000000	0.64402	D	0.000002	T	0.66117	0.2757	M	0.71581	2.175	0.44880	D	0.997898	D	0.54047	0.964	P	0.55577	0.779	T	0.68176	-0.5478	9	0.62326	D	0.03	-24.5864	9.0808	0.36550	0.1047:0.0:0.8953:0.0	.	71	P57055	DSCR6_HUMAN	E	71	.	ENSP00000331734:G71E	G	+	2	0	DSCR6	37307761	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	4.740000	0.62087	1.202000	0.43218	0.462000	0.41574	GGA		0.413	RIPPLY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194703.1			16	4	0	0	0	0.006122	0	16	4				
KRTAP10-6	386674	broad.mit.edu	37	21	46011946	46011946	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr21:46011946G>A	ENST00000400368.1	-	1	440	c.420C>T	c.(418-420)agC>agT	p.S140S	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	140	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						CTGACTGGCAGCTAGACTGCT	0.622																																							uc002zfm.2		NA																	0					0						c.(418-420)AGC>AGT		keratin associated protein 10-6							54.0	70.0	64.0					21																	46011946		2178	4287	6465	SO:0001819	synonymous_variant	386674					keratin filament		g.chr21:46011946G>A	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.420C>T	21.37:g.46011946G>A			Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.S140S	NM_198688	NP_941961	WXS	Illumina HiSeq	Unspecified	P60371	KR106_HUMAN			1	441	-			140			29 X 5 AA repeats of C-C-X(3).			Silent	SNP	ENST00000400368.1	37	c.420C>T	CCDS42959.1																																																																																				0.622	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688		76	18	0	0	0	0.00361	0	76	18				
OR11H1	81061	broad.mit.edu	37	22	16449094	16449094	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr22:16449094C>T	ENST00000252835.4	-	1	711	c.711G>A	c.(709-711)ctG>ctA	p.L237L		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		ACATAGCTTTCAGGACAAGAG	0.423																																							uc011agd.1		NA																	0					0						c.(709-711)CTG>CTA		olfactory receptor, family 11, subfamily H,							165.0	159.0	161.0					22																	16449094		2201	4298	6499	SO:0001819	synonymous_variant	81061				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr22:16449094C>T	AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.711G>A	22.37:g.16449094C>T			Somatic					p.L237L	NM_001005239	NP_001005239	WXS	Illumina HiSeq	Unspecified	Q8NG94	O11H1_HUMAN		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)	1	711	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)	237			Helical; Name=5; (Potential).		Q6IEX0|Q96R32	Silent	SNP	ENST00000252835.4	37	c.711G>A	CCDS33594.1																																																																																				0.423	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074923.2	NM_001005239		6	165	0	0	0	0.001984	0	6	165				
OSM	5008	broad.mit.edu	37	22	30660183	30660183	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr22:30660183T>A	ENST00000215781.2	-	3	488	c.448A>T	c.(448-450)Atc>Ttc	p.I150F	OSM_ENST00000403389.1_Missense_Mutation_p.I129F|OSM_ENST00000403463.1_3'UTR	NM_020530.4	NP_065391.1	P13725	ONCM_HUMAN	oncostatin M	150					behavioral response to pain (GO:0048266)|cell proliferation (GO:0008283)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|peripheral nervous system development (GO:0007422)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|response to heat (GO:0009408)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	extracellular space (GO:0005615)|oncostatin-M receptor complex (GO:0005900)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|oncostatin-M receptor binding (GO:0005147)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|skin(3)	11			Epithelial(10;0.206)			ATGCAGTAGATGTTGTTCCTG	0.647																																							uc003ahb.2		NA																	0				skin(1)	1						c.(448-450)ATC>TTC		oncostatin M precursor							45.0	37.0	40.0					22																	30660183		2203	4300	6503	SO:0001583	missense	5008				cell proliferation|immune response|negative regulation of cell proliferation|negative regulation of hormone secretion|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of MAPKKK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of growth	extracellular space|oncostatin-M receptor complex	cytokine activity|growth factor activity|oncostatin-M receptor binding	g.chr22:30660183T>A	AF129855	CCDS13873.1	22q12.2	2011-07-21			ENSG00000099985	ENSG00000099985			8506	protein-coding gene	gene with protein product		165095				1717982	Standard	NM_020530		Approved	MGC20461	uc003ahb.3	P13725	OTTHUMG00000150913	ENST00000215781.2:c.448A>T	22.37:g.30660183T>A	ENSP00000215781:p.Ile150Phe		Somatic					p.I150F	NM_020530	NP_065391	WXS	Illumina HiSeq	Unspecified	P13725	ONCM_HUMAN	Epithelial(10;0.206)		3	500	-			150					Q6FHP8|Q9UCP6	Missense_Mutation	SNP	ENST00000215781.2	37	c.448A>T	CCDS13873.1	.	.	.	.	.	.	.	.	.	.	T	15.44	2.834348	0.50951	.	.	ENSG00000099985	ENST00000215781;ENST00000403389	T	0.57595	0.39	3.97	-3.95	0.04118	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.700258	0.11827	N	0.525571	T	0.32704	0.0838	L	0.29908	0.895	0.19775	N	0.999955	P	0.37101	0.582	B	0.35971	0.215	T	0.21552	-1.0242	10	0.72032	D	0.01	-18.0707	5.254	0.15537	0.0:0.3166:0.3087:0.3747	.	150	P13725	ONCM_HUMAN	F	150;129	ENSP00000215781:I150F	ENSP00000215781:I150F	I	-	1	0	OSM	28990183	0.015000	0.18098	0.021000	0.16686	0.404000	0.30871	-1.045000	0.03528	-0.737000	0.04824	-1.215000	0.01618	ATC		0.647	OSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320512.1	NM_020530		16	1	0	0	0	0.004007	0	16	1				
FBXO7	25793	broad.mit.edu	37	22	32889176	32889176	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr22:32889176C>G	ENST00000266087.7	+	7	1379	c.1052C>G	c.(1051-1053)tCc>tGc	p.S351C	FBXO7_ENST00000382058.3_Missense_Mutation_p.S272C|FBXO7_ENST00000397426.1_Missense_Mutation_p.S237C	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	351	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GATGTTCGTTCCGTCTTGTCT	0.448																																							uc003amq.2		NA																	0				ovary(1)	1						c.(1051-1053)TCC>TGC		F-box only protein 7 isoform 1							347.0	285.0	306.0					22																	32889176		2203	4300	6503	SO:0001583	missense	25793				cell death|regulation of protein stability|ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr22:32889176C>G	AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.1052C>G	22.37:g.32889176C>G	ENSP00000266087:p.Ser351Cys		Somatic				FBXO7_uc003amr.2_Missense_Mutation_p.S237C|FBXO7_uc003ams.2_Missense_Mutation_p.S195C|FBXO7_uc003amt.2_Missense_Mutation_p.S272C|FBXO7_uc003amu.2_Missense_Mutation_p.S237C|FBXO7_uc003amv.2_Missense_Mutation_p.S50C	p.S351C	NM_012179	NP_036311	WXS	Illumina HiSeq	Unspecified	Q9Y3I1	FBX7_HUMAN			7	1335	+			351			F-box.		B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Missense_Mutation	SNP	ENST00000266087.7	37	c.1052C>G	CCDS13907.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411480	0.83340	.	.	ENSG00000100225	ENST00000266087;ENST00000382058;ENST00000397426	T;T;T	0.58652	0.32;0.32;0.32	6.08	6.08	0.98989	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.81754	0.4889	M	0.88310	2.945	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.83514	0.0082	10	0.87932	D	0	-22.5667	20.6634	0.99662	0.0:1.0:0.0:0.0	.	351;272;351	A8K7F7;Q9Y3I1-2;Q9Y3I1	.;.;FBX7_HUMAN	C	351;272;237	ENSP00000266087:S351C;ENSP00000371490:S272C;ENSP00000380571:S237C	ENSP00000266087:S351C	S	+	2	0	FBXO7	31219176	1.000000	0.71417	0.789000	0.31954	0.868000	0.49771	5.980000	0.70516	2.894000	0.99253	0.655000	0.94253	TCC		0.448	FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129001.1			5	79	0	0	0	0.000602	0	5	79				
SYNGR1	9145	broad.mit.edu	37	22	39770473	39770473	+	Silent	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr22:39770473G>T	ENST00000328933.5	+	2	267	c.252G>T	c.(250-252)ctG>ctT	p.L84L	SYNGR1_ENST00000381535.4_Silent_p.L85L|SYNGR1_ENST00000318801.4_Silent_p.L84L|SYNGR1_ENST00000216155.7_Silent_p.L84L|SYNGR1_ENST00000406293.3_Silent_p.L84L	NM_004711.4	NP_004702.2	O43759	SNG1_HUMAN	synaptogyrin 1	84	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				protein targeting (GO:0006605)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle membrane (GO:0030672)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	7	Melanoma(58;0.04)					CCTGCCTGCTGTACCTGGCCC	0.652																																							uc003axq.3		NA																	0					0						c.(250-252)CTG>CTT		synaptogyrin 1 isoform 1a							155.0	103.0	121.0					22																	39770473		2203	4300	6503	SO:0001819	synonymous_variant	9145				regulation of long-term neuronal synaptic plasticity|regulation of short-term neuronal synaptic plasticity	cell junction|integral to plasma membrane|melanosome		g.chr22:39770473G>T	AJ002303	CCDS13989.1, CCDS13990.1, CCDS13991.1	22q13	2008-06-10			ENSG00000100321	ENSG00000100321			11498	protein-coding gene	gene with protein product		603925				9760194, 10595519	Standard	NM_004711		Approved			O43759	OTTHUMG00000030978	ENST00000328933.5:c.252G>T	22.37:g.39770473G>T			Somatic				SYNGR1_uc003axo.3_Silent_p.L84L|SYNGR1_uc003axp.3_Missense_Mutation_p.C15F|TAB1_uc003axr.2_5'UTR|SYNGR1_uc003axs.3_Silent_p.L85L	p.L84L	NM_004711	NP_004702	WXS	Illumina HiSeq	Unspecified	O43759	SNG1_HUMAN			2	314	+	Melanoma(58;0.04)		84			Helical; (Potential).|MARVEL.		A6NP69|A8K0E2|O43757|O43758|Q53Y02|Q96J56|Q9UGZ4	Silent	SNP	ENST00000328933.5	37	c.252G>T	CCDS13989.1																																																																																				0.652	SYNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075866.2	NM_004711		59	9	1	0	2.02796e-37	0.00361	3.61892e-37	59	9				
GRAP2	9402	broad.mit.edu	37	22	40356136	40356136	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr22:40356136G>T	ENST00000344138.4	+	4	511	c.248G>T	c.(247-249)cGg>cTg	p.R83L	GRAP2_ENST00000399090.2_Silent_p.P26P|GRAP2_ENST00000540310.1_Intron|GRAP2_ENST00000478445.1_3'UTR|GRAP2_ENST00000543252.1_Intron|GRAP2_ENST00000407075.3_Missense_Mutation_p.R83L|RP3-370M22.8_ENST00000424496.1_RNA|GRAP2_ENST00000544756.1_Missense_Mutation_p.R11L	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	83	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						TTCATCATCCGGGCCAGCCAG	0.552																																							uc003ayh.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(247-249)CGG>CTG		GRB2-related adaptor protein 2							173.0	177.0	175.0					22																	40356136		2203	4300	6503	SO:0001583	missense	9402				cell-cell signaling|Ras protein signal transduction|T cell costimulation|T cell receptor signaling pathway	cytosol	SH3/SH2 adaptor activity	g.chr22:40356136G>T	AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.248G>T	22.37:g.40356136G>T	ENSP00000339186:p.Arg83Leu		Somatic				GRAP2_uc003ayi.2_RNA|GRAP2_uc011aom.1_Missense_Mutation_p.R57L|GRAP2_uc011aon.1_Intron|GRAP2_uc010gya.1_Missense_Mutation_p.R83L|GRAP2_uc011aoo.1_Missense_Mutation_p.R11L|GRAP2_uc011aop.1_Intron|GRAP2_uc011aoq.1_Silent_p.P26P|GRAP2_uc003ayj.1_Missense_Mutation_p.R83L	p.R83L	NM_004810	NP_004801	WXS	Illumina HiSeq	Unspecified	O75791	GRAP2_HUMAN			4	511	+			83			SH2.		B7Z8I3|O43726|Q9NRB7	Missense_Mutation	SNP	ENST00000344138.4	37	c.248G>T	CCDS13999.1	.	.	.	.	.	.	.	.	.	.	G	34	5.329503	0.95733	.	.	ENSG00000100351	ENST00000344138;ENST00000544006;ENST00000420971;ENST00000544756;ENST00000407075	D;D;D;D	0.99287	-5.69;-5.69;-5.69;-5.69	5.24	5.24	0.73138	SH2 motif (5);	0.064932	0.64402	D	0.000004	D	0.99622	0.9862	H	0.96080	3.765	0.80722	D	1	D;D	0.76494	0.986;0.999	P;D	0.69654	0.788;0.965	D	0.97729	1.0201	10	0.87932	D	0	-16.3171	18.8433	0.92194	0.0:0.0:1.0:0.0	.	57;83	B7Z8F8;O75791	.;GRAP2_HUMAN	L	83;57;83;11;83	ENSP00000339186:R83L;ENSP00000396355:R83L;ENSP00000442195:R11L;ENSP00000385607:R83L	ENSP00000339186:R83L	R	+	2	0	GRAP2	38686082	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.730000	0.98797	2.447000	0.82792	0.609000	0.83330	CGG		0.552	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321295.1	NM_004810		113	19	1	0	3.68091e-61	0.00361	6.8452e-61	113	19				
MEI1	150365	broad.mit.edu	37	22	42139103	42139103	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr22:42139103C>G	ENST00000401548.3	+	12	1391	c.1351C>G	c.(1351-1353)Cca>Gca	p.P451A	MEI1_ENST00000540833.1_Missense_Mutation_p.P191A|MEI1_ENST00000300398.4_5'UTR|MEI1_ENST00000400107.1_5'UTR	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TCAGAGCACTCCACCTGTGCA	0.542																																							uc003baz.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1351-1353)CCA>GCA		meiosis defective 1							97.0	96.0	96.0					22																	42139103		2003	4183	6186	SO:0001583	missense	150365						binding	g.chr22:42139103C>G	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.1351C>G	22.37:g.42139103C>G	ENSP00000384115:p.Pro451Ala		Somatic				WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc003bay.3_Missense_Mutation_p.P451A|MEI1_uc011apd.1_Intron	p.P451A	NM_152513	NP_689726	WXS	Illumina HiSeq	Unspecified	Q5TIA1	MEI1_HUMAN			12	1376	+			451						Missense_Mutation	SNP	ENST00000401548.3	37	c.1351C>G	CCDS46718.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.195869	0.38806	.	.	ENSG00000167077	ENST00000401548;ENST00000540833	T;T	0.04156	3.69;3.69	5.37	5.37	0.77165	Armadillo-like helical (1);Armadillo-type fold (1);	0.559094	0.17339	N	0.177803	T	0.06600	0.0169	L	0.34521	1.04	0.80722	D	1	P;P	0.42692	0.787;0.787	B;B	0.41510	0.254;0.359	T	0.48352	-0.9043	10	0.35671	T	0.21	.	16.9679	0.86291	0.0:1.0:0.0:0.0	.	451;451	Q5TIA1;Q5TIA1-4	MEI1_HUMAN;.	A	451;191	ENSP00000384115:P451A;ENSP00000444225:P191A	ENSP00000384115:P451A	P	+	1	0	MEI1	40469049	0.103000	0.21917	0.280000	0.24747	0.733000	0.41908	4.743000	0.62110	2.676000	0.91093	0.655000	0.94253	CCA		0.542	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000074937.3	NM_152513		6	9	0	0	0	0.00308	0	6	9				
TRANK1	9881	broad.mit.edu	37	3	36874921	36874921	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:36874921G>C	ENST00000429976.2	-	21	6268	c.6021C>G	c.(6019-6021)ttC>ttG	p.F2007L	TRANK1_ENST00000301807.6_Missense_Mutation_p.F1457L|TRANK1_ENST00000428977.2_Missense_Mutation_p.F1457L	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2007							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TGTCAAACTTGAAGAAGGCAT	0.547																																							uc003cgj.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(4369-4371)TTC>TTG		lupus brain antigen 1							28.0	28.0	28.0					3																	36874921		1945	4141	6086	SO:0001583	missense	9881				DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr3:36874921G>C	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.6021C>G	3.37:g.36874921G>C	ENSP00000416168:p.Phe2007Leu		Somatic					p.F1457L	NM_014831	NP_055646	WXS	Illumina HiSeq	Unspecified	O15050	TRNK1_HUMAN			12	4673	-			2007					Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	c.4371C>G	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	G	3.712	-0.059318	0.07317	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.28255	1.62;2.03;1.62	5.03	4.15	0.48705	.	0.482647	0.19080	N	0.123269	T	0.12178	0.0296	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29731	-1.0002	10	0.09843	T	0.71	.	4.7736	0.13167	0.0874:0.1603:0.6061:0.1462	.	2007	O15050	TRNK1_HUMAN	L	1457;2007;1457	ENSP00000416826:F1457L;ENSP00000416168:F2007L;ENSP00000301807:F1457L	ENSP00000301807:F1457L	F	-	3	2	TRANK1	36849925	0.001000	0.12720	0.979000	0.43373	0.862000	0.49288	0.659000	0.24994	1.250000	0.43966	0.555000	0.69702	TTC		0.547	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831		3	29	0	0	0	0.004672	0	3	29				
NBEAL2	23218	broad.mit.edu	37	3	47039673	47039673	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:47039673C>T	ENST00000450053.3	+	21	3254	c.3075C>T	c.(3073-3075)ttC>ttT	p.F1025F	NBEAL2_ENST00000292309.5_Silent_p.F1025F|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1025					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		ATTTGCTCTTCAACTTTCACC	0.607																																							uc003cqp.2		NA																	0				ovary(1)	1						c.(3073-3075)TTC>TTT		neurobeachin-like 2							45.0	51.0	49.0					3																	47039673		2027	4183	6210	SO:0001819	synonymous_variant	23218						binding	g.chr3:47039673C>T	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.3075C>T	3.37:g.47039673C>T			Somatic				NBEAL2_uc010hjm.1_Silent_p.F586F	p.F1025F	NM_015175	NP_055990	WXS	Illumina HiSeq	Unspecified	Q6ZNJ1	NBEL2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)	21	3254	+		Acute lymphoblastic leukemia(5;0.0534)	1025					O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	37	c.3075C>T	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.482697	0.26598	.	.	ENSG00000160796	ENST00000416683	.	.	.	5.74	4.87	0.63330	.	.	.	.	.	T	0.60805	0.2297	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59091	-0.7519	4	.	.	.	.	10.0697	0.42325	0.0:0.8446:0.0:0.1554	.	.	.	.	L	497	.	.	S	+	2	0	NBEAL2	47014677	0.999000	0.42202	1.000000	0.80357	0.982000	0.71751	0.686000	0.25392	1.430000	0.47334	0.561000	0.74099	TCA		0.607	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064		5	17	0	0	0	0.001168	0	5	17				
PRKAR2A	5576	broad.mit.edu	37	3	48884962	48884962	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:48884962C>T	ENST00000265563.8	-	1	317	c.68G>A	c.(67-69)cGa>cAa	p.R23Q	PRKAR2A-AS1_ENST00000435419.1_RNA|PRKAR2A-AS1_ENST00000431705.1_RNA|PRKAR2A_ENST00000454963.1_Missense_Mutation_p.R23Q|PRKAR2A-AS1_ENST00000416209.2_RNA|PRKAR2A_ENST00000296446.8_Missense_Mutation_p.R23Q|PRKAR2A-AS1_ENST00000412171.2_RNA	NM_004157.2	NP_004148.1	P13861	KAP2_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, alpha	23	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)		SLC26A6/PRKAR2A(2)	breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)		CGGCTGCTGTCGCAGCACCTC	0.711																																							uc010hki.1		NA																	0				ovary(1)	1						c.(67-69)CGA>CAA		cAMP-dependent protein kinase, regulatory							9.0	14.0	12.0					3																	48884962		2173	4238	6411	SO:0001583	missense	5576				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|membrane fraction	cAMP binding|cAMP-dependent protein kinase regulator activity	g.chr3:48884962C>T		CCDS2778.1	3p21.3-p21.2	2009-07-10			ENSG00000114302	ENSG00000114302	2.7.11.1		9391	protein-coding gene	gene with protein product		176910		PRKAR2		9676433	Standard	NM_004157		Approved		uc003cux.1	P13861	OTTHUMG00000133540	ENST00000265563.8:c.68G>A	3.37:g.48884962C>T	ENSP00000265563:p.Arg23Gln		Somatic				PRKAR2A_uc003cux.1_Missense_Mutation_p.R23Q|PRKAR2A_uc003cuy.1_Missense_Mutation_p.R23Q|uc003cuz.1_5'Flank	p.R23Q	NM_004157	NP_004148	WXS	Illumina HiSeq	Unspecified	P13861	KAP2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)	1	309	-			23			Dimerization and phosphorylation.		Q16823|Q9BUB1	Missense_Mutation	SNP	ENST00000265563.8	37	c.68G>A	CCDS2778.1	.	.	.	.	.	.	.	.	.	.	C	35	5.425308	0.96131	.	.	ENSG00000114302	ENST00000265563;ENST00000454963;ENST00000296446;ENST00000419216	D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51	3.66	3.66	0.41972	cAMP-dependent protein kinase, regulatory subunit, type I/II alpha/beta (3);	0.000000	0.47093	U	0.000249	D	0.88833	0.6544	M	0.87682	2.9	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.69479	0.964;0.964	D	0.87736	0.2582	10	0.15499	T	0.54	-0.0071	14.7187	0.69289	0.0:1.0:0.0:0.0	.	23;23	Q9BUB1;P13861	.;KAP2_HUMAN	Q	23	ENSP00000265563:R23Q;ENSP00000394041:R23Q;ENSP00000296446:R23Q;ENSP00000411432:R23Q	ENSP00000265563:R23Q	R	-	2	0	PRKAR2A	48859966	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.621000	0.74228	1.755000	0.51935	0.460000	0.39030	CGA		0.711	PRKAR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257518.1			3	9	0	0	0	0.000248	0	3	9				
ITIH1	3697	broad.mit.edu	37	3	52825615	52825615	+	Silent	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:52825615G>T	ENST00000273283.2	+	21	2601	c.2577G>T	c.(2575-2577)gtG>gtT	p.V859V	ITIH1_ENST00000540715.1_Silent_p.V717V|ITIH1_ENST00000542827.1_3'UTR|ITIH1_ENST00000537050.1_Silent_p.V571V|ITIH1_ENST00000405128.3_Silent_p.V225V	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	859	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		CCACGATGGTGGTGAGGAACC	0.582																																							uc003dfs.2		NA																	0				ovary(3)	3						c.(2575-2577)GTG>GTT		inter-alpha (globulin) inhibitor H1							71.0	72.0	72.0					3																	52825615		2203	4300	6503	SO:0001819	synonymous_variant	3697				hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity	g.chr3:52825615G>T		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2577G>T	3.37:g.52825615G>T			Somatic				ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_Silent_p.V460V|ITIH1_uc010hmo.1_Silent_p.V413V|ITIH1_uc003dfu.2_Silent_p.V225V	p.V859V	NM_002215	NP_002206	WXS	Illumina HiSeq	Unspecified	P19827	ITIH1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)	21	2601	+			859			Hyaluronan-binding.		A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Silent	SNP	ENST00000273283.2	37	c.2577G>T	CCDS2864.1																																																																																				0.582	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215		31	47	1	0	6.00712e-18	0.002445	1.01072e-17	31	47				
C3orf67	200844	broad.mit.edu	37	3	58855927	58855927	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:58855927C>T	ENST00000482387.1	-	4	545	c.449G>A	c.(448-450)aGa>aAa	p.R150K	C3orf67_ENST00000472469.1_Missense_Mutation_p.R70K|RP11-147N17.1_ENST00000492031.1_RNA|RP11-147N17.1_ENST00000493123.1_RNA|RP11-147N17.1_ENST00000482372.1_RNA|C3orf67_ENST00000295966.7_Missense_Mutation_p.R150K|RP11-147N17.1_ENST00000463703.1_RNA			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	150										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		GTTATTCCTTCTGCCAGAGAG	0.438																																							uc003dkt.1		NA																	0					0						c.(448-450)AGA>AAA		hypothetical protein LOC200844							168.0	141.0	150.0					3																	58855927		2203	4300	6503	SO:0001583	missense	200844							g.chr3:58855927C>T	AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.449G>A	3.37:g.58855927C>T	ENSP00000417122:p.Arg150Lys		Somatic				C3orf67_uc003dks.1_5'Flank|uc003dku.1_Intron|C3orf67_uc003dkv.1_5'UTR|C3orf67_uc003dkw.2_Missense_Mutation_p.R58K	p.R150K	NM_198463	NP_940865	WXS	Illumina HiSeq	Unspecified	Q6ZVT6	CC067_HUMAN		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)	8	858	-		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)	150					B9EKV6|Q6ZV69	Missense_Mutation	SNP	ENST00000482387.1	37	c.449G>A		.	.	.	.	.	.	.	.	.	.	C	33	5.245415	0.95272	.	.	ENSG00000163689	ENST00000295966;ENST00000482387;ENST00000472469	T;T;T	0.48522	0.81;0.81;0.81	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.70630	-0.4819	10	0.87932	D	0	-22.5484	18.8399	0.92180	0.0:1.0:0.0:0.0	.	70;150	C9J3M8;Q6ZVT6-2	.;.	K	150;150;70	ENSP00000295966:R150K;ENSP00000417122:R150K;ENSP00000417271:R70K	ENSP00000295966:R150K	R	-	2	0	C3orf67	58830967	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.581000	0.36558	2.885000	0.99019	0.655000	0.94253	AGA		0.438	C3orf67-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000353803.1	NM_198463		5	47	0	0	0	0.000602	0	5	47				
MITF	4286	broad.mit.edu	37	3	70014355	70014355	+	Silent	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:70014355C>A	ENST00000448226.2	+	10	1664	c.1537C>A	c.(1537-1539)Cgg>Agg	p.R513R	MITF_ENST00000394355.2_Silent_p.R482R|MITF_ENST00000314589.5_Silent_p.R491R|MITF_ENST00000328528.6_Silent_p.R506R|MITF_ENST00000352241.4_Silent_p.R507R|MITF_ENST00000314557.6_Silent_p.R400R|MITF_ENST00000394351.3_Silent_p.R406R|MITF_ENST00000472437.1_Silent_p.R455R|MITF_ENST00000531774.1_Silent_p.R344R			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	513					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		AACAAGCAGCCGGAGGAGCAG	0.522			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														Melanoma(29;269 969 31479 41502 42961)	Melanoma(29;269 969 31479 41502 42961)	uc003dnz.2		NA		Dom	yes		3	3p14.1	4286	A	microphthalmia-associated transcription factor	yes	Waardenburg syndrome type 2|Tietz syndrome	E			melanoma 		0				ovary(2)	2						c.(1519-1521)CGG>AGG		microphthalmia-associated transcription factor							92.0	97.0	95.0					3																	70014355		2203	4300	6503	SO:0001819	synonymous_variant	4286				melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription	g.chr3:70014355C>A		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.1537C>A	3.37:g.70014355C>A			Somatic				MITF_uc011bgb.1_Silent_p.R455R|MITF_uc003doa.2_Silent_p.R506R|MITF_uc003dob.2_Silent_p.R491R|MITF_uc003dod.2_Silent_p.R482R|MITF_uc003doe.2_Silent_p.R400R|MITF_uc003dof.2_Silent_p.R406R	p.R507R	NM_198159	NP_937802	WXS	Illumina HiSeq	Unspecified	O75030	MITF_HUMAN		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)	10	1635	+		Lung NSC(201;0.0384)|Prostate(884;0.0526)	513					B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	37	c.1519C>A																																																																																					0.522	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159		28	46	1	0	2.47511e-08	0.008361	3.83569e-08	28	46				
ZNF654	55279	broad.mit.edu	37	3	88189046	88189046	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:88189046G>A	ENST00000309495.5	+	1	793	c.586G>A	c.(586-588)Gaa>Aaa	p.E196K	CGGBP1_ENST00000462901.1_Intron	NM_018293.2	NP_060763.2	Q8IZM8	ZN654_HUMAN	zinc finger protein 654	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(3)	12		Lung NSC(201;0.0283)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		CACAGATCAAGAAGGAAACTT	0.348																																							uc003dqv.2		NA																	0				ovary(1)	1						c.(586-588)GAA>AAA		zinc finger protein 654							71.0	67.0	68.0					3																	88189046		1868	4106	5974	SO:0001583	missense	55279				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr3:88189046G>A	AF543494	CCDS46874.1	3p11.1	2005-01-10			ENSG00000175105	ENSG00000175105			25612	protein-coding gene	gene with protein product							Standard	NM_018293		Approved	FLJ10997, FLJ21142	uc003dqv.3	Q8IZM8	OTTHUMG00000159097	ENST00000309495.5:c.586G>A	3.37:g.88189046G>A	ENSP00000312141:p.Glu196Lys		Somatic				CGGBP1_uc003dqu.2_Intron	p.E196K	NM_018293	NP_060763	WXS	Illumina HiSeq	Unspecified	Q8IZM8	ZN654_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)	1	785	+		Lung NSC(201;0.0283)	196					Q9H791|Q9NV14	Missense_Mutation	SNP	ENST00000309495.5	37	c.586G>A	CCDS46874.1	.	.	.	.	.	.	.	.	.	.	G	9.647	1.140602	0.21205	.	.	ENSG00000175105	ENST00000309495	T	0.10573	2.86	5.83	3.0	0.34707	.	0.232460	0.34906	N	0.003590	T	0.07052	0.0179	N	0.19112	0.55	0.27903	N	0.938918	B	0.17852	0.024	B	0.15052	0.012	T	0.20174	-1.0283	10	0.56958	D	0.05	.	8.3802	0.32466	0.1605:0.2096:0.6299:0.0	.	196	Q8IZM8	ZN654_HUMAN	K	196	ENSP00000312141:E196K	ENSP00000312141:E196K	E	+	1	0	ZNF654	88271736	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.439000	0.35013	0.803000	0.34113	0.655000	0.94253	GAA		0.348	ZNF654-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353285.2	NM_018293		4	24	0	0	0	0.000602	0	4	24				
PROS1	5627	broad.mit.edu	37	3	93603605	93603605	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:93603605C>T	ENST00000394236.3	-	12	1775	c.1459G>A	c.(1459-1461)Ggt>Agt	p.G487S	PROS1_ENST00000407433.1_Missense_Mutation_p.G356S	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	487	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	ATTCCAGAACCAGGATAGTAG	0.318																																							uc003drb.3		NA																	0				large_intestine(1)	1	GRCh37	CD084192	PROS1	D		c.(1459-1461)GGT>AGT		protein S, alpha preproprotein	Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)						115.0	110.0	112.0					3																	93603605		2203	4300	6503	SO:0001583	missense	5627				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity	g.chr3:93603605C>T		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.1459G>A	3.37:g.93603605C>T	ENSP00000377783:p.Gly487Ser		Somatic				PROS1_uc010hoo.2_Missense_Mutation_p.G356S|PROS1_uc003dqz.3_Missense_Mutation_p.G356S	p.G487S	NM_000313	NP_000304	WXS	Illumina HiSeq	Unspecified	P07225	PROS_HUMAN			12	1800	-			487			Laminin G-like 2.		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	c.1459G>A	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474884	0.84640	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	D;D	0.82984	-1.67;-1.67	3.78	3.78	0.43462	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.055112	0.64402	D	0.000001	D	0.91683	0.7371	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93397	0.6757	10	0.72032	D	0.01	.	15.42	0.75003	0.0:1.0:0.0:0.0	.	487	P07225	PROS_HUMAN	S	487;356	ENSP00000377783:G487S;ENSP00000385794:G356S	ENSP00000377783:G487S	G	-	1	0	PROS1	95086295	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.314000	0.78988	1.950000	0.56595	0.561000	0.74099	GGT		0.318	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313		6	45	0	0	0	0.004482	0	6	45				
NSUN3	63899	broad.mit.edu	37	3	93812983	93812983	+	Splice_Site	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:93812983G>T	ENST00000314622.4	+	4	677		c.e4-1			NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3								methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						TTTTTATTTAGGTTATCTTCA	0.299																																							uc003drl.1		NA																	0				skin(1)	1						c.e4-1		NOL1/NOP2/Sun domain family, member 3							56.0	54.0	55.0					3																	93812983		2203	4300	6503	SO:0001630	splice_region_variant	63899						methyltransferase activity	g.chr3:93812983G>T	BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.467-1G>T	3.37:g.93812983G>T			Somatic					p.G156_splice	NM_022072	NP_071355	WXS	Illumina HiSeq	Unspecified	Q9H649	NSUN3_HUMAN			4	583	+								Q6PG41|Q8IXG9|Q9H6M2	Splice_Site	SNP	ENST00000314622.4	37	c.467_splice	CCDS2927.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.531542	0.27387	.	.	ENSG00000178694	ENST00000314622	.	.	.	5.98	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2548	0.73576	0.0669:0.0:0.9331:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NSUN3	95295673	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	8.517000	0.90555	1.541000	0.49316	-0.145000	0.13849	.		0.299	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352934.1	NM_022072	Intron	5	11	1	0	0.00116845	0.001168	0.00169201	5	11				
NFKBIZ	64332	broad.mit.edu	37	3	101576171	101576171	+	Silent	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:101576171C>A	ENST00000326172.5	+	11	2086	c.1971C>A	c.(1969-1971)gcC>gcA	p.A657A	NFKBIZ_ENST00000394054.2_Silent_p.A557A|NFKBIZ_ENST00000326151.5_Silent_p.A535A	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	657	Interaction with NFKB1/p50. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						ATGTTGCTGCCAGCTTGCAGT	0.478																																							uc003dvp.2		NA																	0				ovary(2)	2						c.(1969-1971)GCC>GCA		nuclear factor of kappa light polypeptide gene							103.0	98.0	100.0					3																	101576171		2203	4300	6503	SO:0001819	synonymous_variant	64332				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr3:101576171C>A	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1971C>A	3.37:g.101576171C>A			Somatic				NFKBIZ_uc003dvo.2_Silent_p.A557A|NFKBIZ_uc010hpo.2_Silent_p.A557A|NFKBIZ_uc003dvq.2_Silent_p.A535A	p.A657A	NM_031419	NP_113607	WXS	Illumina HiSeq	Unspecified	Q9BYH8	IKBZ_HUMAN			11	2086	+			657			Interaction with NFKB1/p50 (By similarity).|ANK 7.		B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Silent	SNP	ENST00000326172.5	37	c.1971C>A	CCDS2946.1	.	.	.	.	.	.	.	.	.	.	C	10.13	1.265021	0.23136	.	.	ENSG00000144802	ENST00000477601	.	.	.	5.98	5.1	0.69264	.	.	.	.	.	T	0.72851	0.3512	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72690	-0.4217	4	.	.	.	-16.6681	16.4553	0.84011	0.1323:0.8677:0.0:0.0	.	.	.	.	Q	69	.	.	P	+	2	0	NFKBIZ	103058861	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.971000	0.49248	1.495000	0.48549	0.591000	0.81541	CCA		0.478	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	NM_031419		43	58	1	0	4.01765e-15	0.002222	6.6751e-15	43	58				
BBX	56987	broad.mit.edu	37	3	107491703	107491703	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:107491703G>A	ENST00000325805.8	+	11	1422	c.1135G>A	c.(1135-1137)Gat>Aat	p.D379N	BBX_ENST00000415149.2_Missense_Mutation_p.D379N|BBX_ENST00000402543.1_Missense_Mutation_p.D379N|BBX_ENST00000406780.1_Missense_Mutation_p.D379N|BBX_ENST00000416476.2_Intron			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	379					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			ATTGCAAATAGATGACATAAT	0.313																																							uc010hpr.2		NA																	0				ovary(3)|skin(1)	4						c.(1135-1137)GAT>AAT		HMG-BOX transcription factor BBX isoform 1							58.0	67.0	64.0					3																	107491703		2202	4298	6500	SO:0001583	missense	56987				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr3:107491703G>A	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.1135G>A	3.37:g.107491703G>A	ENSP00000319974:p.Asp379Asn		Somatic				BBX_uc003dwk.3_Missense_Mutation_p.D379N|BBX_uc003dwl.3_Intron|BBX_uc010hps.1_Missense_Mutation_p.D400N|BBX_uc003dwm.3_Missense_Mutation_p.D379N|BBX_uc003dwo.3_5'Flank	p.D379N	NM_001142568	NP_001136040	WXS	Illumina HiSeq	Unspecified	Q8WY36	BBX_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;0.112)		11	1462	+			379					A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	37	c.1135G>A	CCDS46881.1	.	.	.	.	.	.	.	.	.	.	G	17.52	3.410567	0.62399	.	.	ENSG00000114439	ENST00000415149;ENST00000325767;ENST00000402543;ENST00000325805;ENST00000402163;ENST00000406780	D;D;D;D;D	0.98732	-4.57;-4.57;-4.57;-5.1;-4.57	6.16	6.16	0.99307	.	0.312486	0.39341	N	0.001390	D	0.97123	0.9060	L	0.32530	0.975	0.36223	D	0.852101	B;B;B	0.27656	0.072;0.145;0.184	B;B;B	0.33295	0.093;0.127;0.161	D	0.96891	0.9653	10	0.72032	D	0.01	-7.629	18.3537	0.90348	0.0:0.0:1.0:0.0	.	379;379;379	C9JA69;Q8WY36;Q8WY36-2	.;BBX_HUMAN;.	N	379;230;379;379;379;379	ENSP00000408358:D379N;ENSP00000385317:D379N;ENSP00000319974:D379N;ENSP00000385518:D379N;ENSP00000385530:D379N	ENSP00000319742:D230N	D	+	1	0	BBX	108974393	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	1.968000	0.40500	2.937000	0.99478	0.650000	0.86243	GAT		0.313	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235		6	70	0	0	0	0.001168	0	6	70				
CCDC80	151887	broad.mit.edu	37	3	112358314	112358314	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:112358314C>T	ENST00000206423.3	-	2	1392	c.439G>A	c.(439-441)Ggg>Agg	p.G147R	CCDC80_ENST00000439685.2_Missense_Mutation_p.G147R|CCDC80_ENST00000475181.1_5'UTR	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	147					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						CTGTTCTTCCCTGCAAAGCTG	0.562																																							uc003dzf.2		NA																	0				ovary(2)	2						c.(439-441)GGG>AGG		steroid-sensitive protein 1 precursor							79.0	73.0	75.0					3																	112358314		2203	4300	6503	SO:0001583	missense	151887							g.chr3:112358314C>T	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.439G>A	3.37:g.112358314C>T	ENSP00000206423:p.Gly147Arg		Somatic				CCDC80_uc011bhv.1_Missense_Mutation_p.G147R|CCDC80_uc003dzg.2_Missense_Mutation_p.G147R|CCDC80_uc003dzh.1_Missense_Mutation_p.G147R	p.G147R	NM_199512	NP_955806	WXS	Illumina HiSeq	Unspecified	Q76M96	CCD80_HUMAN			2	657	-			147					D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	c.439G>A	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	C	31	5.073703	0.94000	.	.	ENSG00000091986	ENST00000206423;ENST00000439685	T;T	0.45668	0.89;0.89	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.65270	0.2675	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.64968	-0.6282	10	0.72032	D	0.01	-33.4177	20.2227	0.98327	0.0:1.0:0.0:0.0	.	158;147;147	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	R	147	ENSP00000206423:G147R;ENSP00000411814:G147R	ENSP00000206423:G147R	G	-	1	0	CCDC80	113841004	1.000000	0.71417	0.956000	0.39512	0.966000	0.64601	7.786000	0.85741	2.778000	0.95560	0.650000	0.86243	GGG		0.562	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511		36	48	0	0	0	0.005524	0	36	48				
POLQ	10721	broad.mit.edu	37	3	121258347	121258347	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:121258347G>A	ENST00000264233.5	-	4	692	c.564C>T	c.(562-564)gtC>gtT	p.V188V		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	188	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CAATTGTGCAGACTGCAATAT	0.383								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	Pancreas(152;907 1925 26081 31236 36904)	uc003eee.3		NA																	0				ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(562-564)GTC>GTT	DNA_polymerases_(catalytic_subunits)	DNA polymerase theta							131.0	127.0	128.0					3																	121258347		2203	4300	6503	SO:0001819	synonymous_variant	10721				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity	g.chr3:121258347G>A	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.564C>T	3.37:g.121258347G>A			Somatic					p.V188V	NM_199420	NP_955452	WXS	Illumina HiSeq	Unspecified	O75417	DPOLQ_HUMAN		GBM - Glioblastoma multiforme(114;0.0915)	4	693	-			188			Helicase ATP-binding.		O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	37	c.564C>T	CCDS33833.1																																																																																				0.383	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		10	69	0	0	0	0.008291	0	10	69				
ATP1B3	483	broad.mit.edu	37	3	141622499	141622499	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:141622499C>T	ENST00000286371.3	+	2	335	c.147C>T	c.(145-147)ttC>ttT	p.F49F	ATP1B3_ENST00000539728.1_Silent_p.F35F|RNU6-509P_ENST00000363519.1_RNA|ATP1B3_ENST00000462082.1_Missense_Mutation_p.S3F	NM_001679.2	NP_001670.1	P54709	AT1B3_HUMAN	ATPase, Na+/K+ transporting, beta 3 polypeptide	49					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|transport (GO:0006810)	caveola (GO:0005901)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|sodium:potassium-exchanging ATPase activity (GO:0005391)			cervix(1)|endometrium(1)|lung(2)	4						TTTATGGGTTCCTGGCTGCAC	0.423																																							uc003eug.1		NA																	0					0						c.(145-147)TTC>TTT		Na+/K+ -ATPase beta 3 subunit							174.0	157.0	163.0					3																	141622499		2203	4300	6503	SO:0001819	synonymous_variant	483				ATP biosynthetic process|blood coagulation|leukocyte migration	melanosome|sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity	g.chr3:141622499C>T	BC011835	CCDS3121.1	3q23	2012-10-22			ENSG00000069849	ENSG00000069849		"""CD molecules"", ""ATPases / P-type"""	806	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-3"", ""sodium pump subunit beta-3"", ""sodium-potassium ATPase subunit beta 3 (non-catalytic)"""	601867				8798450, 9457675	Standard	NM_001679		Approved	FLJ29027, CD298	uc003eug.1	P54709	OTTHUMG00000159081	ENST00000286371.3:c.147C>T	3.37:g.141622499C>T			Somatic				ATP1B3_uc011bne.1_RNA|ATP1B3_uc003euh.1_Silent_p.F35F	p.F49F	NM_001679	NP_001670	WXS	Illumina HiSeq	Unspecified	P54709	AT1B3_HUMAN			2	321	+			49			Helical; Signal-anchor for type II membrane protein; (Potential).		B7Z1N7	Silent	SNP	ENST00000286371.3	37	c.147C>T	CCDS3121.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.538888	0.45176	.	.	ENSG00000069849	ENST00000462082	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	T	0.75421	0.3847	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73209	-0.4055	4	.	.	.	0.4384	19.6022	0.95568	0.0:1.0:0.0:0.0	.	.	.	.	F	3	.	.	S	+	2	0	ATP1B3	143105189	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.891000	0.48617	2.706000	0.92434	0.555000	0.69702	TCC		0.423	ATP1B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353218.1	NM_001679		10	93	0	0	0	0.000978	0	10	93				
PPM1L	151742	broad.mit.edu	37	3	160679533	160679533	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:160679533G>A	ENST00000498165.1	+	2	510	c.409G>A	c.(409-411)Gaa>Aaa	p.E137K	PPM1L_ENST00000295839.9_Missense_Mutation_p.E10K|PPM1L_ENST00000497343.1_Missense_Mutation_p.E137K|PPM1L_ENST00000480117.1_3'UTR|PPM1L_ENST00000464260.1_5'UTR	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	137	PP2C-like.				MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			GACTGCAGCTGAATATGTAAA	0.408																																					Pancreas(86;250 1994 13715 43211)	Pancreas(86;250 1994 13715 43211)	uc003fdr.2		NA																	0				breast(1)	1						c.(409-411)GAA>AAA		protein phosphatase 1 (formerly 2C)-like							59.0	58.0	58.0					3																	160679533		2203	4300	6503	SO:0001583	missense	151742				protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity	g.chr3:160679533G>A	AK055115	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	"""protein phosphatase 1 (formerly 2C)-like"""			12556533	Standard	XM_006713507		Approved	PP2CE	uc003fdr.3	Q5SGD2	OTTHUMG00000159048	ENST00000498165.1:c.409G>A	3.37:g.160679533G>A	ENSP00000417659:p.Glu137Lys		Somatic				PPM1L_uc003fds.2_5'UTR|PPM1L_uc003fdt.2_Missense_Mutation_p.E10K|PPM1L_uc010hwf.2_RNA	p.E137K	NM_139245	NP_640338	WXS	Illumina HiSeq	Unspecified	Q5SGD2	PPM1L_HUMAN	Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)		2	510	+			137			Cytoplasmic (Potential).|PP2C-like.		Q2M3J2|Q96NM7	Missense_Mutation	SNP	ENST00000498165.1	37	c.409G>A	CCDS33886.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363324	0.82353	.	.	ENSG00000163590	ENST00000497343;ENST00000498165;ENST00000295839	T;T;T	0.15952	2.38;2.38;2.38	5.53	5.53	0.82687	Protein phosphatase 2C-like (5);	0.174599	0.51477	D	0.000083	T	0.13628	0.0330	N	0.21508	0.67	0.58432	D	0.999996	P;B	0.37330	0.59;0.183	B;B	0.33254	0.16;0.089	T	0.04635	-1.0937	10	0.41790	T	0.15	.	18.4568	0.90724	0.0:0.0:1.0:0.0	.	10;137	Q5SGD2-3;Q5SGD2	.;PPM1L_HUMAN	K	137;137;10	ENSP00000420354:E137K;ENSP00000417659:E137K;ENSP00000295839:E10K	ENSP00000295839:E10K	E	+	1	0	PPM1L	162162227	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.777000	0.91781	2.614000	0.88457	0.557000	0.71058	GAA		0.408	PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353019.1	NM_139245		7	28	0	0	0	0.00308	0	7	28				
LRRIQ4	344657	broad.mit.edu	37	3	169540649	169540649	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:169540649C>G	ENST00000340806.6	+	1	940	c.940C>G	c.(940-942)Cat>Gat	p.H314D		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	314										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						AAGCCAGAACCATCTGCACCA	0.567																																							uc003fgb.2		NA																	0					0						c.(940-942)CAT>GAT		leucine-rich repeats and IQ motif containing 4							38.0	39.0	39.0					3																	169540649		2015	4186	6201	SO:0001583	missense	344657							g.chr3:169540649C>G		CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.940C>G	3.37:g.169540649C>G	ENSP00000342188:p.His314Asp		Somatic					p.H314D	NM_001080460	NP_001073929	WXS	Illumina HiSeq	Unspecified	A6NIV6	LRIQ4_HUMAN			1	940	+			314			LRR 13.			Missense_Mutation	SNP	ENST00000340806.6	37	c.940C>G	CCDS46951.1	.	.	.	.	.	.	.	.	.	.	C	5.819	0.335406	0.11013	.	.	ENSG00000188306	ENST00000340806	T	0.16897	2.31	5.69	1.3	0.21679	.	1.016920	0.07843	N	0.963402	T	0.10294	0.0252	N	0.25060	0.705	0.19575	N	0.999967	P	0.36874	0.572	B	0.33295	0.161	T	0.31166	-0.9953	10	0.28530	T	0.3	.	6.7594	0.23532	0.0:0.5676:0.1326:0.2998	.	314	A6NIV6	LRIQ4_HUMAN	D	314	ENSP00000342188:H314D	ENSP00000342188:H314D	H	+	1	0	LRRIQ4	171023343	0.000000	0.05858	0.687000	0.30102	0.007000	0.05969	-0.211000	0.09332	0.717000	0.32145	0.561000	0.74099	CAT		0.567	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378698.1	NM_001080460		13	20	0	0	0	0.00245	0	13	20				
ATP13A4	84239	broad.mit.edu	37	3	193156315	193156315	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:193156315G>A	ENST00000342695.4	-	23	2943	c.2621C>T	c.(2620-2622)tCa>tTa	p.S874L	ATP13A4_ENST00000392443.3_Missense_Mutation_p.S855L	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	874						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		AGTGAAAGGTGAGGCCACAGA	0.448																																							uc003ftd.2		NA																	0				ovary(2)	2						c.(2620-2622)TCA>TTA		ATPase type 13A4							149.0	129.0	136.0					3																	193156315		2203	4300	6503	SO:0001583	missense	84239				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:193156315G>A	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.2621C>T	3.37:g.193156315G>A	ENSP00000339182:p.Ser874Leu		Somatic				ATP13A4_uc010hzi.2_RNA	p.S874L	NM_032279	NP_115655	WXS	Illumina HiSeq	Unspecified	Q4VNC1	AT134_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)	23	2729	-	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		874			Extracellular (Potential).		B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	ENST00000342695.4	37	c.2621C>T	CCDS3304.2	.	.	.	.	.	.	.	.	.	.	G	35	5.497723	0.96355	.	.	ENSG00000127249	ENST00000392443;ENST00000342695	T;T	0.57907	0.37;0.37	5.87	5.87	0.94306	HAD-like domain (2);	0.000000	0.64402	D	0.000007	T	0.80628	0.4659	M	0.93978	3.48	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	D	0.84522	0.0628	10	0.87932	D	0	-15.2155	19.1458	0.93467	0.0:0.0:1.0:0.0	.	874	Q4VNC1	AT134_HUMAN	L	855;874	ENSP00000376238:S855L;ENSP00000339182:S874L	ENSP00000339182:S874L	S	-	2	0	ATP13A4	194639009	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.360000	0.97119	2.941000	0.99782	0.655000	0.94253	TCA		0.448	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279		6	28	0	0	0	0.001168	0	6	28				
BOD1L1	259282	broad.mit.edu	37	4	13600671	13600671	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr4:13600671G>C	ENST00000040738.5	-	10	7988	c.7853C>G	c.(7852-7854)tCt>tGt	p.S2618C		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2618						nucleus (GO:0005634)	DNA binding (GO:0003677)										TTTCTCAGCAGATGCTTGATC	0.413																																							uc003gmz.1		NA																	0				ovary(5)|breast(1)	6						c.(7852-7854)TCT>TGT		biorientation of chromosomes in cell division							178.0	156.0	164.0					4																	13600671		2203	4300	6503	SO:0001583	missense	259282						DNA binding	g.chr4:13600671G>C	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.7853C>G	4.37:g.13600671G>C	ENSP00000040738:p.Ser2618Cys		Somatic				BOD1L_uc010idr.1_Missense_Mutation_p.S1955C	p.S2618C	NM_148894	NP_683692	WXS	Illumina HiSeq	Unspecified	Q8NFC6	BOD1L_HUMAN			10	7970	-			2618					Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	c.7853C>G	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	G	14.16	2.454027	0.43634	.	.	ENSG00000038219	ENST00000040738	T	0.08807	3.05	4.87	3.81	0.43845	.	1.558500	0.04137	N	0.318921	T	0.09774	0.0240	N	0.19112	0.55	0.09310	N	1	D	0.64830	0.994	P	0.46975	0.533	T	0.29150	-1.0021	10	0.62326	D	0.03	.	8.9769	0.35941	0.1215:0.0:0.8785:0.0	.	2618	Q8NFC6	BOD1L_HUMAN	C	2618	ENSP00000040738:S2618C	ENSP00000040738:S2618C	S	-	2	0	BOD1L	13209769	0.000000	0.05858	0.003000	0.11579	0.044000	0.14063	-0.074000	0.11450	2.254000	0.74563	0.455000	0.32223	TCT		0.413	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894		12	104	0	0	0	0.000978	0	12	104				
SCFD2	152579	broad.mit.edu	37	4	54218830	54218830	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr4:54218830G>A	ENST00000401642.3	-	2	1075	c.942C>T	c.(940-942)ctC>ctT	p.L314L	SCFD2_ENST00000388940.4_Silent_p.L314L	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	314					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			GGAGTGCAGTGAGCGCTATCA	0.423																																							uc003gzu.2		NA																	0				ovary(2)|pancreas(1)	3						c.(940-942)CTC>CTT		sec1 family domain containing 2							183.0	158.0	166.0					4																	54218830		2203	4300	6503	SO:0001819	synonymous_variant	152579				protein transport|vesicle docking involved in exocytosis			g.chr4:54218830G>A	AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.942C>T	4.37:g.54218830G>A			Somatic				SCFD2_uc010igm.2_Silent_p.L314L	p.L314L	NM_152540	NP_689753	WXS	Illumina HiSeq	Unspecified	Q8WU76	SCFD2_HUMAN	GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)		2	1076	-			314					Q8N5F3|Q8N8H0|Q96ED3	Silent	SNP	ENST00000401642.3	37	c.942C>T	CCDS33984.1																																																																																				0.423	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540		4	42	0	0	0	0.000248	0	4	42				
SULT1B1	27284	broad.mit.edu	37	4	70615512	70615512	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr4:70615512G>A	ENST00000310613.3	-	4	599	c.302C>T	c.(301-303)cCa>cTa	p.P101L		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	101					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						CCGGGGTGATGGATTCTTCTC	0.383																																							uc003hen.2		NA																	0					0						c.(301-303)CCA>CTA		sulfotransferase family, cytosolic, 1B, member							145.0	149.0	148.0					4																	70615512		2203	4300	6503	SO:0001583	missense	27284				3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol		g.chr4:70615512G>A	D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.302C>T	4.37:g.70615512G>A	ENSP00000308770:p.Pro101Leu		Somatic					p.P101L	NM_014465	NP_055280	WXS	Illumina HiSeq	Unspecified	O43704	ST1B1_HUMAN			4	600	-			101					O15497|Q96FI1|Q9UK34	Missense_Mutation	SNP	ENST00000310613.3	37	c.302C>T	CCDS3530.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.364324	0.41902	.	.	ENSG00000173597	ENST00000310613;ENST00000510821	D;D	0.83075	-1.68;-1.68	4.69	4.69	0.59074	Sulfotransferase domain (1);	0.524687	0.17408	N	0.175289	D	0.93226	0.7842	H	0.94264	3.515	0.58432	D	0.999999	D	0.69078	0.997	D	0.68353	0.957	D	0.94767	0.7941	10	0.87932	D	0	.	15.4877	0.75578	0.0:0.0:1.0:0.0	.	101	O43704	ST1B1_HUMAN	L	101	ENSP00000308770:P101L;ENSP00000425464:P101L	ENSP00000308770:P101L	P	-	2	0	SULT1B1	70650101	0.998000	0.40836	0.907000	0.35723	0.226000	0.24999	2.786000	0.47790	2.340000	0.79590	0.460000	0.39030	CCA		0.383	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251563.2	NM_014465		13	57	0	0	0	0.004007	0	13	57				
THAP6	152815	broad.mit.edu	37	4	76442022	76442022	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr4:76442022G>A	ENST00000311638.3	+	3	189	c.121G>A	c.(121-123)Gca>Aca	p.A41T	RCHY1_ENST00000512706.1_5'Flank|RCHY1_ENST00000380840.2_5'Flank|RCHY1_ENST00000324439.5_5'Flank|THAP6_ENST00000508105.1_5'UTR|THAP6_ENST00000380837.3_Missense_Mutation_p.A41T|RCHY1_ENST00000514021.1_5'Flank|THAP6_ENST00000502620.1_5'UTR|RCHY1_ENST00000513257.1_5'Flank|RCHY1_ENST00000451788.1_5'Flank|THAP6_ENST00000507556.1_Missense_Mutation_p.A41T|THAP6_ENST00000514480.1_Missense_Mutation_p.A41T|THAP6_ENST00000504190.1_5'UTR|THAP6_ENST00000507885.1_5'UTR|THAP6_ENST00000507557.1_5'UTR	NM_144721.4	NP_653322.1	Q8TBB0	THAP6_HUMAN	THAP domain containing 6	41						microtubule cytoskeleton (GO:0015630)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(5)	5			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ATGGGTATTAGCAATGAAAAG	0.323																																							uc003him.2		NA																	0					0						c.(121-123)GCA>ACA		THAP domain containing 6							107.0	106.0	106.0					4																	76442022		2203	4300	6503	SO:0001583	missense	152815					microtubule cytoskeleton	DNA binding|metal ion binding	g.chr4:76442022G>A	BC022989	CCDS3568.1	4q21.21	2013-01-25			ENSG00000174796	ENSG00000174796		"""THAP (C2CH-type zinc finger) domain containing"""	23189	protein-coding gene	gene with protein product		612535				12575992	Standard	NM_144721		Approved	MGC30052	uc003him.3	Q8TBB0	OTTHUMG00000130108	ENST00000311638.3:c.121G>A	4.37:g.76442022G>A	ENSP00000309007:p.Ala41Thr		Somatic				RCHY1_uc003hij.2_5'Flank|RCHY1_uc003hik.2_5'Flank|RCHY1_uc003hil.2_5'Flank|RCHY1_uc010iip.2_5'Flank|RCHY1_uc010iiq.2_5'Flank|RCHY1_uc010iir.2_5'Flank|THAP6_uc010iis.1_5'UTR|THAP6_uc003hin.2_Missense_Mutation_p.A41T|THAP6_uc011cbm.1_Missense_Mutation_p.A41T|THAP6_uc010iiu.1_RNA|THAP6_uc003hio.1_RNA|THAP6_uc010iiv.2_Missense_Mutation_p.A41T	p.A41T	NM_144721	NP_653322	WXS	Illumina HiSeq	Unspecified	Q8TBB0	THAP6_HUMAN	Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)		3	218	+			41			THAP-type.		B4E146|Q5HYJ7|Q5JPC6	Missense_Mutation	SNP	ENST00000311638.3	37	c.121G>A	CCDS3568.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.746434	0.89663	.	.	ENSG00000174796	ENST00000506261;ENST00000311638;ENST00000380837;ENST00000507556;ENST00000514480	D;D;D;D;D	0.96554	-4.05;-4.05;-4.05;-4.05;-4.05	5.09	5.09	0.68999	Zinc finger, C2CH-type (4);	0.000000	0.64402	D	0.000018	D	0.97751	0.9262	M	0.82433	2.59	0.38350	D	0.944315	D;D;D	0.89917	1.0;0.996;0.997	D;D;D	0.91635	0.999;0.99;0.973	D	0.97292	0.9925	10	0.17832	T	0.49	-8.7422	14.7277	0.69357	0.0:0.0:1.0:0.0	.	41;41;41	B4E146;Q8TBB0-2;Q8TBB0	.;.;THAP6_HUMAN	T	41	ENSP00000422402:A41T;ENSP00000309007:A41T;ENSP00000370217:A41T;ENSP00000427651:A41T;ENSP00000423720:A41T	ENSP00000309007:A41T	A	+	1	0	THAP6	76661046	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.139000	0.64801	2.760000	0.94817	0.561000	0.74099	GCA		0.323	THAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252414.1	NM_144721		25	27	0	0	0	0.004656	0	25	27				
CCSER1	401145	broad.mit.edu	37	4	91229569	91229569	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr4:91229569C>T	ENST00000509176.1	+	2	422	c.134C>T	c.(133-135)tCt>tTt	p.S45F	CCSER1_ENST00000333691.8_Missense_Mutation_p.S45F|CCSER1_ENST00000432775.2_Missense_Mutation_p.S45F	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	45	Ser-rich.																CACAGTTCCTCTCCTTCCAGC	0.463																																							uc003hsv.3		NA																	0				large_intestine(1)|ovary(1)	2						c.(133-135)TCT>TTT		KIAA1680 protein isoform 1							119.0	111.0	114.0					4																	91229569		1983	4175	6158	SO:0001583	missense	401145							g.chr4:91229569C>T		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.134C>T	4.37:g.91229569C>T	ENSP00000425040:p.Ser45Phe		Somatic				FAM190A_uc003hsu.3_Missense_Mutation_p.S45F|FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Missense_Mutation_p.S45F	p.S45F	NM_001145065	NP_001138537	WXS	Illumina HiSeq	Unspecified	Q9C0I3	F190A_HUMAN			2	474	+			45			Ser-rich.		Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	c.134C>T	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306973	0.81247	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.62364	0.48;0.03;0.48	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.75591	0.3870	L	0.48642	1.525	0.48762	D	0.999704	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.933;0.999;0.999	T	0.77013	-0.2745	10	0.87932	D	0	-17.6256	19.5936	0.95526	0.0:1.0:0.0:0.0	.	45;45;45	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	F	45	ENSP00000425040:S45F;ENSP00000389283:S45F;ENSP00000329482:S45F	ENSP00000329482:S45F	S	+	2	0	FAM190A	91448592	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.221000	0.78016	2.793000	0.96121	0.655000	0.94253	TCT		0.463	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065		5	52	0	0	0	0.000602	0	5	52				
KLHL2	11275	broad.mit.edu	37	4	166200179	166200179	+	Intron	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr4:166200179G>C	ENST00000226725.6	+	6	803				KLHL2_ENST00000509028.1_Intron|KLHL2_ENST00000506761.1_Intron|KLHL2_ENST00000421009.2_Intron|KLHL2_ENST00000514860.1_Intron|KLHL2_ENST00000538127.1_Intron	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2						protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		ATGTTGAAAAGCATAGTCCTA	0.383																																							uc003ird.3		NA																	0					0						c.(619-621)CTT>GTT		glycerol kinase isoform b																																				SO:0001627	intron_variant	2713							g.chr4:166200179G>C	AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.545-15332G>C	4.37:g.166200179G>C			Somatic				KLHL2_uc003irb.2_Intron|KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	p.L207V	NM_000167	NP_000158	WXS	Illumina HiSeq	Unspecified					1	997	-								A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Missense_Mutation	SNP	ENST00000226725.6	37	c.619C>G	CCDS34094.1																																																																																				0.383	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364439.1			13	14	0	0	0	0.00245	0	13	14				
SLC12A7	10723	broad.mit.edu	37	5	1083927	1083927	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:1083927C>A	ENST00000264930.5	-	8	1105	c.1062G>T	c.(1060-1062)gaG>gaT	p.E354D		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	354					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GGATGAAGTACTCGTCACAGG	0.647																																							uc003jbu.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(1060-1062)GAG>GAT		solute carrier family 12 (potassium/chloride	Potassium Chloride(DB00761)						77.0	73.0	75.0					5																	1083927		2201	4299	6500	SO:0001583	missense	10723				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity	g.chr5:1083927C>A	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1062G>T	5.37:g.1083927C>A	ENSP00000264930:p.Glu354Asp		Somatic					p.E354D	NM_006598	NP_006589	WXS	Illumina HiSeq	Unspecified	Q9Y666	S12A7_HUMAN	Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		8	1128	-	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		354					A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	c.1062G>T	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	C	7.952	0.745133	0.15710	.	.	ENSG00000113504	ENST00000264930	D	0.81739	-1.53	3.67	-0.968	0.10313	.	0.604037	0.16898	N	0.195007	T	0.60392	0.2265	L	0.35414	1.06	0.36597	D	0.874429	B	0.02656	0.0	B	0.06405	0.002	T	0.42582	-0.9443	10	0.16896	T	0.51	.	0.8023	0.01077	0.1573:0.2274:0.3094:0.3058	.	354	Q9Y666	S12A7_HUMAN	D	354	ENSP00000264930:E354D	ENSP00000264930:E354D	E	-	3	2	SLC12A7	1136927	0.116000	0.22171	0.159000	0.22649	0.553000	0.35397	-0.710000	0.05024	0.139000	0.18822	0.471000	0.43371	GAG		0.647	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598		39	108	1	0	2.00842e-17	0.002522	3.35792e-17	39	108				
DNAH5	1767	broad.mit.edu	37	5	13870955	13870955	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:13870955T>C	ENST00000265104.4	-	24	3859	c.3755A>G	c.(3754-3756)gAt>gGt	p.D1252G	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1252	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AATCCGAATATCATCTAGGTC	0.368									Kartagener syndrome																														uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(3754-3756)GAT>GGT		dynein, axonemal, heavy chain 5							94.0	92.0	93.0					5																	13870955		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13870955T>C	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3755A>G	5.37:g.13870955T>C	ENSP00000265104:p.Asp1252Gly		Somatic					p.D1252G	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			24	3797	-	Lung NSC(4;0.00476)		1252			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.3755A>G	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	16.13	3.035434	0.54896	.	.	ENSG00000039139	ENST00000265104	T	0.24723	1.84	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.41834	0.1176	M	0.84773	2.715	0.80722	D	1	B	0.33528	0.416	B	0.40285	0.325	T	0.35674	-0.9779	10	0.36615	T	0.2	.	15.7563	0.78030	0.0:0.0:0.0:1.0	.	1252	Q8TE73	DYH5_HUMAN	G	1252	ENSP00000265104:D1252G	ENSP00000265104:D1252G	D	-	2	0	DNAH5	13923955	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	7.673000	0.83973	2.111000	0.64477	0.533000	0.62120	GAT		0.368	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		26	45	0	0	0	0.00632	0	26	45				
DROSHA	29102	broad.mit.edu	37	5	31464414	31464415	+	Nonsense_Mutation	DNP	TC	TC	AT			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:31464414_31464415TC>AT	ENST00000511367.2	-	19	2746_2747	c.2502_2503GA>AT	c.(2500-2505)atGAga>atATga	p.834_835MR>I*	DROSHA_ENST00000344624.3_Nonsense_Mutation_p.834_835MR>I*|DROSHA_ENST00000442743.1_Nonsense_Mutation_p.797_798MR>I*|DROSHA_ENST00000513349.1_Nonsense_Mutation_p.797_798MR>I*	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	834	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						ACTTCTCGTCTCATTGTATTCT	0.421																																							uc003jhg.2		NA																	0					0						c.(2500-2505)ATGAGA>ATATGA		ribonuclease III, nuclear isoform 1																																				SO:0001587	stop_gained	29102				gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity	g.chr5:31464414_31464415TC>AT	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.2502_2503delinsAT	5.37:g.31464414_31464415delinsAT	ENSP00000425979:p.M834_R835delinsI*		Somatic				RNASEN_uc003jhh.2_Nonsense_Mutation_p.797_798MR>I*|RNASEN_uc003jhi.2_Nonsense_Mutation_p.797_798MR>I*	p.834_835MR>I*	NM_013235	NP_037367	WXS	Illumina HiSeq	Unspecified	Q9NRR4	RNC_HUMAN			19	2861_2862	-			834_835			Necessary for interaction with DGCR8 and pri-miRNA processing activity.		E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Nonsense_Mutation	DNP	ENST00000511367.2	37	c.2502_2503GA>AT	CCDS47195.1																																																																																				0.421	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235		25	31	0	0	0	0.004672	0	25	31				
SPEF2	79925	broad.mit.edu	37	5	35628627	35628627	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:35628627G>A	ENST00000356031.3	+	2	278	c.124G>A	c.(124-126)Gaa>Aaa	p.E42K	SPEF2_ENST00000282469.6_Missense_Mutation_p.E42K|SPEF2_ENST00000509059.1_Missense_Mutation_p.E42K|SPEF2_ENST00000440995.2_Missense_Mutation_p.E42K	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	42	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACACAAGTTTGAACTTCAGGA	0.348																																							uc003jjo.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(124-126)GAA>AAA		KPL2 protein isoform 1							142.0	140.0	141.0					5																	35628627		2203	4300	6503	SO:0001583	missense	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35628627G>A	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.124G>A	5.37:g.35628627G>A	ENSP00000348314:p.Glu42Lys		Somatic				SPEF2_uc003jjn.1_Missense_Mutation_p.E42K|SPEF2_uc003jjq.3_Missense_Mutation_p.E42K	p.E42K	NM_024867	NP_079143	WXS	Illumina HiSeq	Unspecified	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		2	235	+	all_lung(31;7.56e-05)		42			CH.		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	c.124G>A	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270816	0.80469	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000510777;ENST00000440995	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	5.64	5.64	0.86602	Calponin homology domain (1);	0.292353	0.32068	N	0.006628	T	0.37293	0.0998	L	0.54323	1.7	0.80722	D	1	D;P;P	0.56746	0.977;0.939;0.617	P;P;B	0.51453	0.67;0.67;0.124	T	0.03684	-1.1013	10	0.46703	T	0.11	.	16.4177	0.83748	0.0:0.0:1.0:0.0	.	42;42;42	D6REZ4;Q9C093;Q9C093-3	.;SPEF2_HUMAN;.	K	42	ENSP00000282469:E42K;ENSP00000348314:E42K;ENSP00000421593:E42K;ENSP00000426259:E42K;ENSP00000412125:E42K	ENSP00000282469:E42K	E	+	1	0	SPEF2	35664384	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.900000	0.48687	2.658000	0.90341	0.655000	0.94253	GAA		0.348	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		5	84	0	0	0	0.001168	0	5	84				
BDP1	55814	broad.mit.edu	37	5	70806371	70806371	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:70806371G>C	ENST00000358731.4	+	17	3715	c.3452G>C	c.(3451-3453)aGa>aCa	p.R1151T	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1151	9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		ACTGGAAGAAGAGAAATATCC	0.473																																							uc003kbp.1		NA																	0				skin(2)	2						c.(3451-3453)AGA>ACA		transcription factor-like nuclear regulator							82.0	83.0	83.0					5																	70806371		1841	4081	5922	SO:0001583	missense	55814				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding	g.chr5:70806371G>C	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.3452G>C	5.37:g.70806371G>C	ENSP00000351575:p.Arg1151Thr		Somatic				BDP1_uc003kbn.1_Missense_Mutation_p.R1151T|BDP1_uc003kbo.2_Missense_Mutation_p.R1151T	p.R1151T	NM_018429	NP_060899	WXS	Illumina HiSeq	Unspecified	A6H8Y1	BDP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)	17	3715	+		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)	1151			7.|9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	c.3452G>C	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.080254	0.36662	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.20738	2.05	3.15	0.137	0.14787	.	3.771160	0.00754	N	0.001099	T	0.17408	0.0418	N	0.17474	0.49	0.24863	N	0.992336	P;P;P	0.50819	0.939;0.939;0.939	P;P;P	0.48063	0.565;0.565;0.484	T	0.07366	-1.0776	10	0.62326	D	0.03	.	2.458	0.04534	0.2772:0.0:0.4856:0.2373	.	1151;1151;1151	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	T	1151;731	ENSP00000351575:R1151T	ENSP00000351575:R1151T	R	+	2	0	BDP1	70842127	0.000000	0.05858	0.235000	0.24058	0.045000	0.14185	-0.014000	0.12656	0.005000	0.14708	0.205000	0.17691	AGA		0.473	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429		11	45	0	0	0	0.000978	0	11	45				
EDIL3	10085	broad.mit.edu	37	5	83476317	83476317	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:83476317G>T	ENST00000296591.5	-	4	667	c.249C>A	c.(247-249)tgC>tgA	p.C83*	EDIL3_ENST00000380138.3_Nonsense_Mutation_p.C73*	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	83	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		CTCCATTATGGCATGGATTAG	0.378																																							uc003kio.1		NA																	0				skin(2)	2						c.(247-249)TGC>TGA		EGF-like repeats and discoidin I-like							93.0	84.0	87.0					5																	83476317		2203	4300	6503	SO:0001587	stop_gained	10085				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding	g.chr5:83476317G>T	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.249C>A	5.37:g.83476317G>T	ENSP00000296591:p.Cys83*		Somatic				EDIL3_uc003kip.1_Nonsense_Mutation_p.C73*	p.C83*	NM_005711	NP_005702	WXS	Illumina HiSeq	Unspecified	O43854	EDIL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)	4	668	-		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)	83			EGF-like 2.		B2R763|O43855|Q5D094|Q8N610	Nonsense_Mutation	SNP	ENST00000296591.5	37	c.249C>A	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	G	41	8.642248	0.98897	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	.	.	.	5.35	4.48	0.54585	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.9216	8.8826	0.35384	0.2252:0.0:0.7748:0.0	.	.	.	.	X	83;73	.	ENSP00000296591:C83X	C	-	3	2	EDIL3	83512073	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	2.481000	0.45215	1.395000	0.46643	-0.251000	0.11542	TGC		0.378	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711		8	4	1	0	3.86212e-05	0.008291	5.74978e-05	8	4				
ADAMTS19	171019	broad.mit.edu	37	5	128932353	128932353	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:128932353C>G	ENST00000274487.4	+	8	1601	c.1456C>G	c.(1456-1458)Cac>Gac	p.H486D	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	486	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TGAAATGGGTCACAAGTAAGT	0.313																																							uc003kvb.1		NA																	0				ovary(5)|breast(2)|lung(1)|skin(1)	9						c.(1456-1458)CAC>GAC		ADAM metallopeptidase with thrombospondin type 1							146.0	151.0	149.0					5																	128932353		2203	4300	6503	SO:0001583	missense	171019				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:128932353C>G	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1456C>G	5.37:g.128932353C>G	ENSP00000274487:p.His486Asp		Somatic				ADAMTS19_uc010jdh.1_RNA	p.H486D	NM_133638	NP_598377	WXS	Illumina HiSeq	Unspecified	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)	8	1456	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	486			Peptidase M12B.	Zinc; catalytic (By similarity).		Missense_Mutation	SNP	ENST00000274487.4	37	c.1456C>G	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035326	0.75617	.	.	ENSG00000145808	ENST00000274487	D	0.98701	-5.08	3.92	3.92	0.45320	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000002	D	0.99336	0.9767	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98440	1.0586	9	.	.	.	.	17.2537	0.87049	0.0:1.0:0.0:0.0	.	486	Q8TE59	ATS19_HUMAN	D	486	ENSP00000274487:H486D	.	H	+	1	0	ADAMTS19	128960252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.555000	0.73928	2.506000	0.84524	0.557000	0.71058	CAC		0.313	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638		40	13	0	0	0	0.006999	0	40	13				
P4HA2	8974	broad.mit.edu	37	5	131534590	131534590	+	Silent	SNP	C	C	T	rs141851075		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:131534590C>T	ENST00000401867.1	-	12	1855	c.1287G>A	c.(1285-1287)ccG>ccA	p.P429P	P4HA2_ENST00000379100.2_Silent_p.P429P|P4HA2_ENST00000379086.1_Silent_p.P429P|P4HA2_ENST00000166534.4_Silent_p.P429P|P4HA2_ENST00000360568.3_Silent_p.P429P|P4HA2_ENST00000379104.2_Silent_p.P429P			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	429	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	AGTCGAAGTGCGGTTCATACT	0.483													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22400	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(68;117 1135 17362 19256 34242)	Esophageal Squamous(68;117 1135 17362 19256 34242)	uc003kwh.2		NA																	0					0						c.(1285-1287)CCG>CCA		prolyl 4-hydroxylase, alpha II subunit isoform 1	L-Proline(DB00172)|Succinic acid(DB00139)	C	,,,,	2,4404	4.2+/-10.8	0,2,2201	132.0	112.0	119.0		1287,1287,1287,1287,1287	-8.1	0.7	5	dbSNP_134	119	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	P4HA2	NM_001017973.1,NM_001017974.1,NM_001142598.1,NM_001142599.1,NM_004199.2	,,,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,,,	429/534,429/534,429/534,429/536,429/536	131534590	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	8974					endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding	g.chr5:131534590C>T	U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.1287G>A	5.37:g.131534590C>T			Somatic				P4HA2_uc003kwg.2_Silent_p.P429P|P4HA2_uc003kwi.2_Silent_p.P429P|P4HA2_uc003kwk.2_Silent_p.P429P|P4HA2_uc003kwl.2_Silent_p.P429P|P4HA2_uc003kwj.2_Silent_p.P429P	p.P429P	NM_004199	NP_004190	WXS	Illumina HiSeq	Unspecified	O15460	P4HA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		11	1851	-		all_cancers(142;0.103)|Breast(839;0.198)	429			Fe2OG dioxygenase.		D3DQ85|D3DQ86|Q8WWN0	Silent	SNP	ENST00000401867.1	37	c.1287G>A	CCDS4151.1																																																																																				0.483	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132653.4	NM_004199		17	8	0	0	0	0.007413	0	17	8				
LECT2	3950	broad.mit.edu	37	5	135288629	135288629	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:135288629C>T	ENST00000274507.1	-	2	274	c.74G>A	c.(73-75)tGt>tAt	p.C25Y	FBXL21_ENST00000467490.1_RNA|LECT2_ENST00000471827.1_5'UTR|LECT2_ENST00000512872.1_De_novo_Start_OutOfFrame|LECT2_ENST00000514447.2_Missense_Mutation_p.C25Y|LECT2_ENST00000522943.1_Missense_Mutation_p.C25Y	NM_002302.2	NP_002293.2	O14960	LECT2_HUMAN	leukocyte cell-derived chemotaxin 2	25					chemotaxis (GO:0006935)|negative regulation of Wnt signaling pathway (GO:0030178)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	identical protein binding (GO:0042802)	p.C25Y(1)		large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTTGCCAGCACATATATTAGC	0.517																																							uc003lbe.1		NA																	1	Substitution - Missense(1)		upper_aerodigestive_tract(1)	ovary(1)	1						c.(73-75)TGT>TAT		leukocyte cell-derived chemotaxin 2 precursor							151.0	142.0	145.0					5																	135288629		2203	4300	6503	SO:0001583	missense	3950				chemotaxis|skeletal system development	cytoplasm|extracellular space		g.chr5:135288629C>T	AB007546	CCDS4190.1	5q31.1	2008-05-15			ENSG00000145826	ENSG00000145826			6550	protein-coding gene	gene with protein product		602882				9545637	Standard	NM_002302		Approved	chm-II, chm2	uc003lbe.1	O14960	OTTHUMG00000129146	ENST00000274507.1:c.74G>A	5.37:g.135288629C>T	ENSP00000274507:p.Cys25Tyr		Somatic					p.C25Y	NM_002302	NP_002293	WXS	Illumina HiSeq	Unspecified	O14960	LECT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		2	275	-			25					B2RA90|O14565|Q52M49	Missense_Mutation	SNP	ENST00000274507.1	37	c.74G>A	CCDS4190.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.469216	0.63625	.	.	ENSG00000145826	ENST00000522943;ENST00000274507;ENST00000514447	T;T;T	0.09255	3.0;3.0;3.0	5.96	5.1	0.69264	.	0.042993	0.85682	N	0.000000	T	0.31167	0.0788	M	0.74647	2.275	0.58432	D	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.03695	-1.1012	10	0.87932	D	0	-8.5927	10.8827	0.46948	0.0:0.9144:0.0:0.0856	.	25	O14960	LECT2_HUMAN	Y	25	ENSP00000429618:C25Y;ENSP00000274507:C25Y;ENSP00000421123:C25Y	ENSP00000274507:C25Y	C	-	2	0	LECT2	135316528	1.000000	0.71417	0.994000	0.49952	0.714000	0.41099	2.712000	0.47186	1.525000	0.49052	0.650000	0.86243	TGT		0.517	LECT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251209.1	NM_002302		6	79	0	0	0	0.001984	0	6	79				
PCDHA3	56145	broad.mit.edu	37	5	140182020	140182020	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:140182020T>A	ENST00000522353.2	+	1	1238	c.1238T>A	c.(1237-1239)cTg>cAg	p.L413Q	PCDHA3_ENST00000532566.2_Missense_Mutation_p.L413Q|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	413	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACAGCCCTCTGGACCGCGAG	0.637																																							uc003lhf.2		NA																	0				ovary(6)|skin(2)	8						c.(1237-1239)CTG>CAG		protocadherin alpha 3 isoform 1 precursor							150.0	139.0	143.0					5																	140182020		2203	4300	6503	SO:0001583	missense	56145				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140182020T>A	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1238T>A	5.37:g.140182020T>A	ENSP00000429808:p.Leu413Gln		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.L413Q	p.L413Q	NM_018906	NP_061729	WXS	Illumina HiSeq	Unspecified	Q9Y5H8	PCDA3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1238	+			413			Cadherin 4.|Extracellular (Potential).		O75286	Missense_Mutation	SNP	ENST00000522353.2	37	c.1238T>A	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	t	14.82	2.648901	0.47362	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.75154	-0.91;-0.91	4.79	4.79	0.61399	Cadherin (4);Cadherin-like (1);	0.252515	0.19366	U	0.116006	D	0.92322	0.7564	H	0.99435	4.565	0.37749	D	0.92589	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.96227	0.9165	10	0.87932	D	0	.	14.6095	0.68507	0.0:0.0:0.0:1.0	.	413;413	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	Q	413	ENSP00000429808:L413Q;ENSP00000434086:L413Q	ENSP00000429808:L413Q	L	+	2	0	PCDHA3	140162204	1.000000	0.71417	0.820000	0.32676	0.218000	0.24690	6.176000	0.71955	1.925000	0.55765	0.383000	0.25322	CTG		0.637	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		135	113	0	0	0	0.00361	0	135	113				
PCDHB3	56132	broad.mit.edu	37	5	140480363	140480363	+	Silent	SNP	T	T	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:140480363T>C	ENST00000231130.2	+	1	130	c.130T>C	c.(130-132)Tta>Cta	p.L44L	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	44	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAGGGCTTTTTAATAGCCAA	0.502																																							uc003lio.2		NA																	0				ovary(1)|pancreas(1)	2						c.(130-132)TTA>CTA		protocadherin beta 3 precursor							54.0	63.0	60.0					5																	140480363		2203	4300	6503	SO:0001819	synonymous_variant	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140480363T>C	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.130T>C	5.37:g.140480363T>C			Somatic				uc003lin.2_Intron	p.L44L	NM_018937	NP_061760	WXS	Illumina HiSeq	Unspecified	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	130	+			44			Extracellular (Potential).|Cadherin 1.		B2R8P2	Silent	SNP	ENST00000231130.2	37	c.130T>C	CCDS4245.1																																																																																				0.502	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		21	92	0	0	0	0.008871	0	21	92				
PCDHB8	56128	broad.mit.edu	37	5	140558514	140558514	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:140558514G>A	ENST00000239444.2	+	1	1144	c.899G>A	c.(898-900)gGa>gAa	p.G300E	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	300	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCTTGACAGGAGAAATTCGA	0.408																																							uc011dai.1		NA																	0				skin(4)	4						c.(898-900)GGA>GAA		protocadherin beta 8 precursor							119.0	176.0	156.0					5																	140558514		2203	4300	6503	SO:0001583	missense	56128				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140558514G>A	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.899G>A	5.37:g.140558514G>A	ENSP00000239444:p.Gly300Glu		Somatic				PCDHB16_uc003liv.2_5'Flank	p.G300E	NM_019120	NP_061993	WXS	Illumina HiSeq	Unspecified	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1085	+			300			Cadherin 3.|Extracellular (Potential).		B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	c.899G>A	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.655914	0.47467	.	.	ENSG00000120322	ENST00000239444	D	0.91464	-2.85	4.25	4.25	0.50352	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.97685	0.9241	H	0.99732	4.735	0.46356	D	0.999009	D	0.89917	1.0	D	0.85130	0.997	D	0.99839	1.1060	9	0.87932	D	0	.	16.2711	0.82622	0.0:0.0:1.0:0.0	.	300	Q9UN66	PCDB8_HUMAN	E	300	ENSP00000239444:G300E	ENSP00000239444:G300E	G	+	2	0	PCDHB8	140538698	1.000000	0.71417	0.653000	0.29593	0.163000	0.22366	9.420000	0.97426	1.911000	0.55334	0.585000	0.79938	GGA		0.408	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120		6	134	0	0	0	0.001168	0	6	134				
PCDHB8	56128	broad.mit.edu	37	5	140558698	140558698	+	Silent	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:140558698G>T	ENST00000239444.2	+	1	1328	c.1083G>T	c.(1081-1083)gcG>gcT	p.A361A	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	361	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGAGAATGCGCCTGAAACTG	0.448																																							uc011dai.1		NA																	0				skin(4)	4						c.(1081-1083)GCG>GCT		protocadherin beta 8 precursor							227.0	296.0	272.0					5																	140558698		2203	4300	6503	SO:0001819	synonymous_variant	56128				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140558698G>T	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1083G>T	5.37:g.140558698G>T			Somatic				PCDHB16_uc003liv.2_5'Flank	p.A361A	NM_019120	NP_061993	WXS	Illumina HiSeq	Unspecified	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1269	+			361			Cadherin 4.|Extracellular (Potential).		B9EGV1	Silent	SNP	ENST00000239444.2	37	c.1083G>T	CCDS4250.1																																																																																				0.448	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120		74	155	1	0	1.10345e-40	0.00361	1.98248e-40	74	155				
PCDHB8	56128	broad.mit.edu	37	5	140559035	140559035	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:140559035G>A	ENST00000239444.2	+	1	1665	c.1420G>A	c.(1420-1422)Gtc>Atc	p.V474I	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	474	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V474I(2)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CATCGGCAGCGTCAGCGCCAC	0.662																																							uc011dai.1		NA																	2	Substitution - Missense(2)		endometrium(1)|kidney(1)	skin(4)	4						c.(1420-1422)GTC>ATC		protocadherin beta 8 precursor							80.0	122.0	108.0					5																	140559035		2203	4293	6496	SO:0001583	missense	56128				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140559035G>A	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1420G>A	5.37:g.140559035G>A	ENSP00000239444:p.Val474Ile		Somatic				PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	p.V474I	NM_019120	NP_061993	WXS	Illumina HiSeq	Unspecified	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1606	+			474			Cadherin 5.|Extracellular (Potential).		B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	c.1420G>A	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	G	10.11	1.260842	0.23051	.	.	ENSG00000120322	ENST00000239444	T	0.02787	4.16	4.26	1.9	0.25705	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.03520	0.0101	L	0.51853	1.615	0.09310	N	0.999999	B	0.21071	0.051	B	0.24006	0.05	T	0.43081	-0.9413	9	0.25106	T	0.35	.	7.5775	0.27944	0.4462:0.0:0.5538:0.0	.	474	Q9UN66	PCDB8_HUMAN	I	474	ENSP00000239444:V474I	ENSP00000239444:V474I	V	+	1	0	PCDHB8	140539219	0.020000	0.18652	0.998000	0.56505	0.970000	0.65996	0.204000	0.17335	0.466000	0.27193	0.305000	0.20034	GTC		0.662	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120		35	165	0	0	0	0.005524	0	35	165				
JAKMIP2	9832	broad.mit.edu	37	5	147051334	147051334	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:147051334G>A	ENST00000265272.5	-	2	503	c.36C>T	c.(34-36)ccC>ccT	p.P12P	JAKMIP2_ENST00000507386.1_Silent_p.P12P|JAKMIP2_ENST00000333010.6_Intron	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	12						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGTGCCTCGGGCTTCTCGC	0.473																																							uc003loq.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(34-36)CCC>CCT		janus kinase and microtubule interacting protein							147.0	134.0	138.0					5																	147051334		2203	4300	6503	SO:0001819	synonymous_variant	9832					Golgi apparatus		g.chr5:147051334G>A	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.36C>T	5.37:g.147051334G>A			Somatic				JAKMIP2_uc011dbx.1_Intron|JAKMIP2_uc003lor.1_Silent_p.P12P|JAKMIP2_uc010jgo.1_Silent_p.P12P	p.P12P	NM_014790	NP_055605	WXS	Illumina HiSeq	Unspecified	Q96AA8	JKIP2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		2	418	-			12					A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Silent	SNP	ENST00000265272.5	37	c.36C>T	CCDS4285.1																																																																																				0.473	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790		33	36	0	0	0	0.002836	0	33	36				
PDE6A	5145	broad.mit.edu	37	5	149314157	149314157	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:149314157C>A	ENST00000255266.5	-	2	718	c.599G>T	c.(598-600)gGa>gTa	p.G200V		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	200	GAF 1.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	GAAGTGGGATCCATCCACTTT	0.458																																							uc003lrg.3		NA																	0				ovary(1)|pancreas(1)	2						c.(598-600)GGA>GTA		phosphodiesterase 6A							151.0	127.0	135.0					5																	149314157		2203	4300	6503	SO:0001583	missense	5145				cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr5:149314157C>A		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.599G>T	5.37:g.149314157C>A	ENSP00000255266:p.Gly200Val		Somatic					p.G200V	NM_000440	NP_000431	WXS	Illumina HiSeq	Unspecified	P16499	PDE6A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		2	719	-			200			GAF 1.		Q0P638	Missense_Mutation	SNP	ENST00000255266.5	37	c.599G>T	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504837	0.64410	.	.	ENSG00000132915	ENST00000255266	T	0.73469	-0.75	5.99	0.823	0.18812	GAF (2);	0.284322	0.37955	N	0.001876	D	0.83613	0.5292	M	0.89658	3.05	0.49389	D	0.999784	D	0.56746	0.977	P	0.62560	0.904	T	0.80774	-0.1232	10	0.66056	D	0.02	.	5.988	0.19444	0.0:0.4978:0.2643:0.2378	.	200	P16499	PDE6A_HUMAN	V	200	ENSP00000255266:G200V	ENSP00000255266:G200V	G	-	2	0	PDE6A	149294350	0.027000	0.19231	0.738000	0.30950	0.812000	0.45895	0.446000	0.21694	0.073000	0.16731	0.655000	0.94253	GGA		0.458	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2			37	51	1	0	3.33393e-15	0.004878	5.55656e-15	37	51				
TIGD6	81789	broad.mit.edu	37	5	149375450	149375450	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:149375450C>G	ENST00000296736.3	-	2	1236	c.462G>C	c.(460-462)aaG>aaC	p.K154N	TIGD6_ENST00000515406.2_Missense_Mutation_p.K154N	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	154						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			ACTCATTAATCTTATCTATTC	0.413																																							uc003lri.2		NA																	0				ovary(1)	1						c.(460-462)AAG>AAC		hypothetical protein LOC81789							190.0	201.0	197.0					5																	149375450		2203	4300	6503	SO:0001583	missense	81789				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding	g.chr5:149375450C>G	AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.462G>C	5.37:g.149375450C>G	ENSP00000296736:p.Lys154Asn		Somatic				TIGD6_uc003lrj.2_Missense_Mutation_p.K154N	p.K154N	NM_030953	NP_112215	WXS	Illumina HiSeq	Unspecified	Q17RP2	TIGD6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		2	1224	-			154					B3KTZ8|Q96MQ4|Q9H0X7	Missense_Mutation	SNP	ENST00000296736.3	37	c.462G>C	CCDS4301.1	.	.	.	.	.	.	.	.	.	.	C	9.529	1.110340	0.20714	.	.	ENSG00000164296	ENST00000296736;ENST00000515406	T;T	0.16324	2.35;2.35	4.69	2.91	0.33838	.	0.000000	0.36066	U	0.002806	T	0.12263	0.0298	N	0.08118	0	0.22096	N	0.99937	D	0.62365	0.991	P	0.58013	0.831	T	0.13548	-1.0505	10	0.17832	T	0.49	.	4.3987	0.11376	0.1778:0.6341:0.0:0.1881	.	154	Q17RP2	TIGD6_HUMAN	N	154	ENSP00000296736:K154N;ENSP00000425318:K154N	ENSP00000296736:K154N	K	-	3	2	TIGD6	149355643	0.821000	0.29204	0.999000	0.59377	0.966000	0.64601	0.062000	0.14389	0.711000	0.32018	0.650000	0.86243	AAG		0.413	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252324.1	NM_030953		124	123	0	0	0	0.00361	0	124	123				
GABRG2	2566	broad.mit.edu	37	5	161524807	161524807	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:161524807C>T	ENST00000361925.4	+	4	711	c.491C>T	c.(490-492)aCc>aTc	p.T164I	GABRG2_ENST00000393933.4_Missense_Mutation_p.T69I|GABRG2_ENST00000414552.2_Missense_Mutation_p.T164I|GABRG2_ENST00000356592.3_Missense_Mutation_p.T164I			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	164					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CACTGGATCACCACCCCCAAC	0.423																																							uc003lyz.3		NA																	0				ovary(4)|skin(1)	5						c.(490-492)ACC>ATC		gamma-aminobutyric acid A receptor, gamma 2							99.0	98.0	99.0					5																	161524807		2203	4300	6503	SO:0001583	missense	2566				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chr5:161524807C>T		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.491C>T	5.37:g.161524807C>T	ENSP00000354651:p.Thr164Ile		Somatic				GABRG2_uc010jjc.2_Missense_Mutation_p.T164I|GABRG2_uc003lyy.3_Missense_Mutation_p.T164I|GABRG2_uc011dej.1_Missense_Mutation_p.T69I	p.T164I	NM_000816	NP_000807	WXS	Illumina HiSeq	Unspecified	P18507	GBRG2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	4	849	+	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	164			Extracellular (Probable).		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	c.491C>T	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890760	0.91889	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933;ENST00000522053	T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49	5.82	5.82	0.92795	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.90762	0.7100	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.995;0.998;0.997	D	0.91085	0.4902	10	0.87932	D	0	.	20.1086	0.97902	0.0:1.0:0.0:0.0	.	164;164;164	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	I	164;164;164;69;69	ENSP00000349000:T164I;ENSP00000410732:T164I;ENSP00000354651:T164I;ENSP00000377510:T69I;ENSP00000430182:T69I	ENSP00000349000:T164I	T	+	2	0	GABRG2	161457385	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.677000	0.84024	2.756000	0.94617	0.563000	0.77884	ACC		0.423	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1			5	92	0	0	0	0.000602	0	5	92				
GABRG2	2566	broad.mit.edu	37	5	161569228	161569228	+	Silent	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:161569228C>A	ENST00000361925.4	+	7	1048	c.828C>A	c.(826-828)acC>acA	p.T276T	GABRG2_ENST00000393933.4_Silent_p.T181T|GABRG2_ENST00000414552.2_Silent_p.T316T|GABRG2_ENST00000356592.3_Silent_p.T276T			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	276					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GATACTTTACCATCCAGACCT	0.433																																							uc003lyz.3		NA																	0				ovary(4)|skin(1)	5						c.(826-828)ACC>ACA		gamma-aminobutyric acid A receptor, gamma 2							313.0	269.0	284.0					5																	161569228		2203	4300	6503	SO:0001819	synonymous_variant	2566				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chr5:161569228C>A		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.828C>A	5.37:g.161569228C>A			Somatic				GABRG2_uc010jjc.2_Silent_p.T316T|GABRG2_uc003lyy.3_Silent_p.T276T|GABRG2_uc011dej.1_Silent_p.T181T	p.T276T	NM_000816	NP_000807	WXS	Illumina HiSeq	Unspecified	P18507	GBRG2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	7	1186	+	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	276			Helical; (Probable).		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Silent	SNP	ENST00000361925.4	37	c.828C>A	CCDS4358.1																																																																																				0.433	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1			92	66	1	0	6.21051e-42	0.00361	1.11958e-41	92	66				
DOCK2	1794	broad.mit.edu	37	5	169174491	169174491	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:169174491A>T	ENST00000256935.8	+	23	2439	c.2359A>T	c.(2359-2361)Act>Tct	p.T787S	DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.T279S	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	787					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCAATACAAAACTACCATCCT	0.358																																							uc003maf.2		NA																	0				ovary(5)|pancreas(2)	7						c.(2359-2361)ACT>TCT		dedicator of cytokinesis 2							89.0	83.0	85.0					5																	169174491		2203	4300	6503	SO:0001583	missense	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169174491A>T	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2359A>T	5.37:g.169174491A>T	ENSP00000256935:p.Thr787Ser		Somatic				DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.T279S	p.T787S	NM_004946	NP_004937	WXS	Illumina HiSeq	Unspecified	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		23	2439	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	787					Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	c.2359A>T	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.320892	0.23994	.	.	ENSG00000134516	ENST00000256935;ENST00000343291;ENST00000520908	T;T	0.19394	2.15;2.15	5.57	5.57	0.84162	.	0.098404	0.64402	D	0.000002	T	0.10637	0.0260	N	0.12887	0.27	0.80722	D	1	B;B	0.31383	0.181;0.321	B;B	0.23852	0.024;0.049	T	0.12116	-1.0560	10	0.07644	T	0.81	.	14.7076	0.69203	1.0:0.0:0.0:0.0	.	279;787	E7ERW7;Q92608	.;DOCK2_HUMAN	S	787;168;279	ENSP00000256935:T787S;ENSP00000429283:T279S	ENSP00000256935:T787S	T	+	1	0	DOCK2	169107069	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.502000	0.81614	2.120000	0.65058	0.459000	0.35465	ACT		0.358	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		19	15	0	0	0	0.001523	0	19	15				
LCP2	3937	broad.mit.edu	37	5	169697723	169697723	+	Splice_Site	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:169697723C>T	ENST00000046794.5	-	7	1138	c.523G>A	c.(523-525)Gac>Aac	p.D175N		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	175					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		GGGCCCTTACCGATGTACATG	0.582																																							uc003man.1		NA																	0				ovary(1)	1						c.(523-525)GAC>AAC		lymphocyte cytosolic protein 2							92.0	104.0	100.0					5																	169697723		2078	4197	6275	SO:0001630	splice_region_variant	3937				immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding	g.chr5:169697723C>T		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.523+1G>A	5.37:g.169697723C>T			Somatic				LCP2_uc011det.1_Missense_Mutation_p.D4N|LCP2_uc010jjo.1_5'Flank	p.D175N	NM_005565	NP_005556	WXS	Illumina HiSeq	Unspecified	Q13094	LCP2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)	7	730	-	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	175					A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	37	c.523G>A	CCDS47339.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055584	0.75960	.	.	ENSG00000043462	ENST00000046794	T	0.56275	0.47	5.4	4.54	0.55810	.	0.326162	0.27725	N	0.018109	T	0.51312	0.1667	L	0.57536	1.79	0.80722	D	1	D	0.64830	0.994	P	0.46253	0.509	T	0.51980	-0.8636	9	.	.	.	-26.6066	10.3699	0.44046	0.0:0.9092:0.0:0.0908	.	175	Q13094	LCP2_HUMAN	N	175	ENSP00000046794:D175N	.	D	-	1	0	LCP2	169630301	0.997000	0.39634	0.976000	0.42696	0.790000	0.44656	4.175000	0.58263	1.410000	0.46936	0.655000	0.94253	GAC		0.582	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	Missense_Mutation	13	85	0	0	0	0.003163	0	13	85				
ZNF354C	30832	broad.mit.edu	37	5	178506767	178506767	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr5:178506767G>A	ENST00000315475.6	+	5	1640	c.1334G>A	c.(1333-1335)tGt>tAt	p.C445Y		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	445					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		TGTGAGGAATGTGGGAAAGCC	0.398																																							uc003mju.2		NA																	0				ovary(1)	1						c.(1333-1335)TGT>TAT		zinc finger protein 354C							65.0	72.0	69.0					5																	178506767		2203	4300	6503	SO:0001583	missense	30832				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr5:178506767G>A		CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.1334G>A	5.37:g.178506767G>A	ENSP00000324064:p.Cys445Tyr		Somatic					p.C445Y	NM_014594	NP_055409	WXS	Illumina HiSeq	Unspecified	Q86Y25	Z354C_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)	5	1449	+	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	445			C2H2-type 9.		Q6P4P9|Q8NFX1	Missense_Mutation	SNP	ENST00000315475.6	37	c.1334G>A	CCDS4443.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861483	0.71949	.	.	ENSG00000177932	ENST00000315475	D	0.85861	-2.04	4.22	4.22	0.49857	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94532	0.8239	H	0.95982	3.75	0.52501	D	0.999954	D	0.89917	1.0	D	0.97110	1.0	D	0.95961	0.8962	9	0.87932	D	0	-12.5436	14.4881	0.67631	0.0:0.0:1.0:0.0	.	445	Q86Y25	Z354C_HUMAN	Y	445	ENSP00000324064:C445Y	ENSP00000324064:C445Y	C	+	2	0	ZNF354C	178439373	1.000000	0.71417	0.979000	0.43373	0.962000	0.63368	9.235000	0.95353	2.330000	0.79161	0.591000	0.81541	TGT		0.398	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253473.2			6	80	0	0	0	0.001168	0	6	80				
HUS1B	135458	broad.mit.edu	37	6	656554	656554	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:656554C>A	ENST00000380907.2	-	1	409	c.391G>T	c.(391-393)Gat>Tat	p.D131Y	EXOC2_ENST00000230449.4_Intron|EXOC2_ENST00000448181.3_Intron	NM_148959.3	NP_683762.2	Q8NHY5	HUS1B_HUMAN	HUS1 checkpoint homolog b (S. pombe)	131					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)	checkpoint clamp complex (GO:0030896)|nucleolus (GO:0005730)				endometrium(3)|large_intestine(1)|lung(7)	11	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)		ACGGGCAGATCGTGCACCACG	0.731																																							uc003mtg.2		NA																	0					0						c.(391-393)GAT>TAT		HUS1 checkpoint protein B							17.0	21.0	20.0					6																	656554		2191	4278	6469	SO:0001583	missense	135458							g.chr6:656554C>A	AF508547	CCDS4470.1	6p25.3	2008-08-08	2001-11-28		ENSG00000188996	ENSG00000188996			16485	protein-coding gene	gene with protein product		609713	"""HUS1 (S. pombe) checkpoint homolog b"""			11944979	Standard	NM_148959		Approved		uc003mtg.3	Q8NHY5	OTTHUMG00000090059	ENST00000380907.2:c.391G>T	6.37:g.656554C>A	ENSP00000370293:p.Asp131Tyr		Somatic				EXOC2_uc003mtd.2_Intron|EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	p.D131Y	NM_148959	NP_683762	WXS	Illumina HiSeq	Unspecified	Q8NHY5	HUS1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)	1	411	-	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)	131					Q5T4Z2	Missense_Mutation	SNP	ENST00000380907.2	37	c.391G>T	CCDS4470.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898750	0.52227	.	.	ENSG00000188996	ENST00000380907	T	0.14022	2.54	3.44	2.53	0.30540	.	0.066079	0.56097	U	0.000024	T	0.20007	0.0481	M	0.79011	2.435	0.23685	N	0.997118	D	0.89917	1.0	D	0.78314	0.991	T	0.02691	-1.1123	10	0.87932	D	0	.	7.967	0.30104	0.2446:0.7554:0.0:0.0	.	131	Q8NHY5	HUS1B_HUMAN	Y	131	ENSP00000370293:D131Y	ENSP00000370293:D131Y	D	-	1	0	HUS1B	601554	0.008000	0.16893	0.001000	0.08648	0.012000	0.07955	1.338000	0.33873	0.738000	0.32606	0.561000	0.74099	GAT		0.731	HUS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205617.2	NM_148959		25	12	1	0	2.48779e-11	0.005443	3.98348e-11	25	12				
CDYL	9425	broad.mit.edu	37	6	4954210	4954210	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:4954210G>A	ENST00000328908.5	+	9	1848	c.1717G>A	c.(1717-1719)Gtg>Atg	p.V573M	CDYL_ENST00000397588.3_Missense_Mutation_p.V519M|CDYL_ENST00000343762.5_Missense_Mutation_p.V387M|CDYL_ENST00000449732.2_Missense_Mutation_p.V387M|CDYL_ENST00000472453.1_3'UTR			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	573					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		GGAGTGTGAGGTGCTGAAGAA	0.562																																							uc003mwi.2		NA																	0					0						c.(1717-1719)GTG>ATG		chromodomain protein, Y chromosome-like isoform							92.0	82.0	86.0					6																	4954210		2203	4300	6503	SO:0001583	missense	9425				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity	g.chr6:4954210G>A	AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.1717G>A	6.37:g.4954210G>A	ENSP00000330512:p.Val573Met		Somatic				CDYL_uc003mwj.2_Missense_Mutation_p.V519M|CDYL_uc003mwk.2_Missense_Mutation_p.V284M|CDYL_uc011dhx.1_Missense_Mutation_p.V387M|CDYL_uc011dhy.1_Missense_Mutation_p.V387M	p.V573M	NM_001143971	NP_001137443	WXS	Illumina HiSeq	Unspecified	Q9Y232	CDYL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.182)	9	1848	+	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)	573					A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Missense_Mutation	SNP	ENST00000328908.5	37	c.1717G>A		.	.	.	.	.	.	.	.	.	.	G	12.61	1.990229	0.35131	.	.	ENSG00000153046	ENST00000328908;ENST00000397588;ENST00000449732;ENST00000343762	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	5.31	4.42	0.53409	.	0.271186	0.35805	N	0.002978	T	0.37046	0.0989	N	0.25245	0.725	0.46241	D	0.998947	B;B	0.29552	0.055;0.248	B;B	0.34489	0.045;0.184	T	0.24368	-1.0162	10	0.12430	T	0.62	.	13.9715	0.64242	0.0771:0.0:0.9229:0.0	.	519;573	Q9Y232-2;Q9Y232	.;CDYL1_HUMAN	M	573;519;387;387	ENSP00000330512:V573M;ENSP00000380718:V519M;ENSP00000394076:V387M;ENSP00000340908:V387M	ENSP00000330512:V573M	V	+	1	0	CDYL	4899209	1.000000	0.71417	0.954000	0.39281	0.943000	0.58893	7.653000	0.83643	2.631000	0.89168	0.655000	0.94253	GTG		0.562	CDYL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000039736.1	NM_004824		7	44	0	0	0	0.001984	0	7	44				
HIVEP1	3096	broad.mit.edu	37	6	12136102	12136102	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:12136102A>T	ENST00000379388.2	+	7	6796	c.6464A>T	c.(6463-6465)gAt>gTt	p.D2155V	HIVEP1_ENST00000541134.1_Intron	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2155					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GGTTTAATAGATGAACAGGAT	0.343																																							uc003nac.2		NA																	0				ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(6463-6465)GAT>GTT		human immunodeficiency virus type I enhancer							155.0	141.0	145.0					6																	12136102		1839	4095	5934	SO:0001583	missense	3096				transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:12136102A>T	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.6464A>T	6.37:g.12136102A>T	ENSP00000368698:p.Asp2155Val		Somatic				HIVEP1_uc011diq.1_Intron	p.D2155V	NM_002114	NP_002105	WXS	Illumina HiSeq	Unspecified	P15822	ZEP1_HUMAN			7	6643	+	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)	2155					B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	c.6464A>T	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.379199	0.82682	.	.	ENSG00000095951	ENST00000379388;ENST00000442081;ENST00000542327	T	0.11930	2.73	5.73	5.73	0.89815	.	0.000000	0.37530	N	0.002044	T	0.24967	0.0606	M	0.81802	2.56	0.80722	D	1	D	0.56968	0.978	P	0.55222	0.771	T	0.03784	-1.1004	10	0.72032	D	0.01	-17.251	16.0221	0.80506	1.0:0.0:0.0:0.0	.	2155	P15822	ZEP1_HUMAN	V	2155;82;137	ENSP00000368698:D2155V	ENSP00000368698:D2155V	D	+	2	0	HIVEP1	12244088	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.190000	0.69967	0.528000	0.53228	GAT		0.343	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114		26	67	0	0	0	0.003954	0	26	67				
CAP2	10486	broad.mit.edu	37	6	17539531	17539531	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:17539531C>G	ENST00000229922.2	+	8	1200	c.668C>G	c.(667-669)tCt>tGt	p.S223C	CAP2_ENST00000493172.1_Intron|CAP2_ENST00000378990.2_Missense_Mutation_p.S197C|CAP2_ENST00000465994.1_Missense_Mutation_p.S159C|CAP2_ENST00000489374.1_Missense_Mutation_p.S111C	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	223					activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			TCAGCGTTTTCTGTCCTCTCC	0.552																																							uc003ncb.2		NA																	0				ovary(1)	1						c.(667-669)TCT>TGT		adenylyl cyclase-associated protein 2							254.0	217.0	230.0					6																	17539531		2203	4300	6503	SO:0001583	missense	10486				activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding	g.chr6:17539531C>G	BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.668C>G	6.37:g.17539531C>G	ENSP00000229922:p.Ser223Cys		Somatic				CAP2_uc010jpk.1_RNA|CAP2_uc011dja.1_Missense_Mutation_p.S197C|CAP2_uc011djb.1_Missense_Mutation_p.S159C|CAP2_uc011djc.1_Missense_Mutation_p.S111C|CAP2_uc011djd.1_Intron	p.S223C	NM_006366	NP_006357	WXS	Illumina HiSeq	Unspecified	P40123	CAP2_HUMAN	all cancers(50;0.194)|Epithelial(50;0.227)		8	911	+	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	223					B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Missense_Mutation	SNP	ENST00000229922.2	37	c.668C>G	CCDS4539.1	.	.	.	.	.	.	.	.	.	.	c	17.44	3.389707	0.61956	.	.	ENSG00000112186	ENST00000229922;ENST00000489374;ENST00000378990;ENST00000465994	T;T;T;T	0.13196	2.61;2.61;2.61;2.61	5.23	5.23	0.72850	Adenylate cyclase-associated CAP, N-terminal (2);	0.461376	0.23561	N	0.046858	T	0.22513	0.0543	L	0.56199	1.76	0.19575	N	0.999961	D;D;D;B	0.71674	0.991;0.998;0.996;0.016	P;D;D;B	0.64506	0.873;0.911;0.926;0.016	T	0.02263	-1.1186	10	0.87932	D	0	-11.6564	18.7919	0.91976	0.0:1.0:0.0:0.0	.	111;159;197;223	B7Z385;B7Z1C4;E9PDI2;P40123	.;.;.;CAP2_HUMAN	C	223;111;197;159	ENSP00000229922:S223C;ENSP00000417705:S111C;ENSP00000368275:S197C;ENSP00000418604:S159C	ENSP00000229922:S223C	S	+	2	0	CAP2	17647510	0.962000	0.33011	0.018000	0.16275	0.163000	0.22366	3.914000	0.56401	2.420000	0.82092	0.655000	0.94253	TCT		0.552	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039952.2			6	172	0	0	0	0.001168	0	6	172				
HIST1H3C	8352	broad.mit.edu	37	6	26045759	26045759	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:26045759C>T	ENST00000540144.1	+	1	121	c.121C>T	c.(121-123)Cgc>Tgc	p.R41C	HIST1H2BB_ENST00000357905.2_5'Flank	NM_003531.2	NP_003522.1	P68431	H31_HUMAN	histone cluster 1, H3c	41					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.R41C(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|skin(1)	8						GAAACCTCATCGCTACCGCCC	0.642																																							uc003nfv.2		NA																	1	Substitution - Missense(1)		NS(1)	ovary(1)	1						c.(121-123)CGC>TGC		histone cluster 1, H3c							45.0	48.0	47.0					6																	26045759		2203	4300	6503	SO:0001583	missense	8352				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26045759C>T	X57128	CCDS4576.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196532	ENSG00000278272		"""Histones / Replication-dependent"""	4768	protein-coding gene	gene with protein product		602812	"""H3 histone family, member C"", ""histone 1, H3c"""	H3FC		8227173, 9119399, 12408966	Standard	NM_003531		Approved	H3/c, H3.1	uc003nfv.3	P68431	OTTHUMG00000014416	ENST00000540144.1:c.121C>T	6.37:g.26045759C>T	ENSP00000439493:p.Arg41Cys		Somatic				HIST1H2BB_uc003nfu.2_5'Flank	p.R41C	NM_003531	NP_003522	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	121	+			41					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000540144.1	37	c.121C>T	CCDS4576.1	.	.	.	.	.	.	.	.	.	.	C	9.158	1.017931	0.19355	.	.	ENSG00000196532	ENST00000540144	T	0.52295	0.67	4.67	4.67	0.58626	.	.	.	.	.	T	0.51024	0.1650	.	.	.	0.49582	D	0.999805	.	.	.	.	.	.	T	0.54470	-0.8289	6	0.62326	D	0.03	.	12.5388	0.56156	0.1667:0.8332:0.0:0.0	.	.	.	.	C	41	ENSP00000439493:R41C	ENSP00000439493:R41C	R	+	1	0	HIST1H3C	26153738	1.000000	0.71417	1.000000	0.80357	0.020000	0.10135	5.818000	0.69236	2.529000	0.85273	0.591000	0.81541	CGC		0.642	HIST1H3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040078.1	NM_003531		12	77	0	0	0	0.000978	0	12	77				
HIST1H1E	3008	broad.mit.edu	37	6	26157077	26157077	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:26157077G>A	ENST00000304218.3	+	1	519	c.459G>A	c.(457-459)aaG>aaA	p.K153K	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	153					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.K153N(1)		NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GCGCCAAGAAGACCCCAAAGA	0.602																																							uc003ngq.2		NA																	1	Substitution - Missense(1)		skin(1)	large_intestine(1)|ovary(1)	2						c.(457-459)AAG>AAA		histone cluster 1, H1e																																				SO:0001819	synonymous_variant	3008				nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding	g.chr6:26157077G>A	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.459G>A	6.37:g.26157077G>A			Somatic				HIST1H2BD_uc003ngr.2_5'Flank|HIST1H2BD_uc003ngs.2_5'Flank	p.K153K	NM_005321	NP_005312	WXS	Illumina HiSeq	Unspecified	P10412	H14_HUMAN			1	519	+			153					Q4VB25	Silent	SNP	ENST00000304218.3	37	c.459G>A	CCDS4586.1																																																																																				0.602	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321		5	22	0	0	0	0.000602	0	5	22				
HIST1H2BL	8340	broad.mit.edu	37	6	27775480	27775480	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:27775480C>T	ENST00000377401.2	-	1	229	c.205G>A	c.(205-207)Gac>Aac	p.D69N	HIST1H3H_ENST00000369163.2_5'Flank|HIST1H2AI_ENST00000358739.3_5'Flank	NM_003519.3	NP_003510.1	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	69					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						TCGAAGATGTCGTTGACGAAG	0.597																																							uc003njl.2		NA																	0					0						c.(205-207)GAC>AAC		histone cluster 1, H2bl							174.0	164.0	168.0					6																	27775480		2203	4300	6503	SO:0001583	missense	8340				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27775480C>T	Z83740	CCDS4625.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000185130	ENSG00000185130		"""Histones / Replication-dependent"""	4748	protein-coding gene	gene with protein product		602800	"""H2B histone family, member C"", ""histone 1, H2bl"""	H2BFC		9439656, 12408966	Standard	NM_003519		Approved	H2B/c, dJ97D16.4	uc003njl.3	Q99880	OTTHUMG00000014485	ENST00000377401.2:c.205G>A	6.37:g.27775480C>T	ENSP00000366618:p.Asp69Asn		Somatic				HIST1H3H_uc003njm.2_5'Flank	p.D69N	NM_003519	NP_003510	WXS	Illumina HiSeq	Unspecified	Q99880	H2B1L_HUMAN			1	230	-			69					B2R5A3|Q52LW9	Missense_Mutation	SNP	ENST00000377401.2	37	c.205G>A	CCDS4625.1	.	.	.	.	.	.	.	.	.	.	.	21.4	4.151079	0.78001	.	.	ENSG00000185130	ENST00000377401	T	0.28454	1.61	4.35	4.35	0.52113	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.38214	0.1032	H	0.94658	3.565	0.45150	D	0.998166	B	0.16603	0.018	B	0.22880	0.042	T	0.54296	-0.8315	9	0.62326	D	0.03	.	16.7577	0.85504	0.0:1.0:0.0:0.0	.	69	Q99880	H2B1L_HUMAN	N	69	ENSP00000366618:D69N	ENSP00000366618:D69N	D	-	1	0	HIST1H2BL	27883459	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.227000	0.58612	2.335000	0.79485	0.655000	0.94253	GAC		0.597	HIST1H2BL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040153.1	NM_003519		27	229	0	0	0	0.003954	0	27	229				
PPP1R10	5514	broad.mit.edu	37	6	30570166	30570166	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:30570166G>A	ENST00000376511.2	-	19	2812	c.2260C>T	c.(2260-2262)Cac>Tac	p.H754Y		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	754	Gly-rich.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						GGGCCTTCGTGAGGACGATGC	0.677																																							uc003nqn.1		NA																	0				ovary(2)|lung(1)|kidney(1)	4						c.(2260-2262)CAC>TAC		protein phosphatase 1, regulatory subunit 10							115.0	127.0	123.0					6																	30570166		1510	2707	4217	SO:0001583	missense	5514				protein import into nucleus|transcription, DNA-dependent	PTW/PP1 phosphatase complex	DNA binding|protein phosphatase inhibitor activity|RNA binding|zinc ion binding	g.chr6:30570166G>A	Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.2260C>T	6.37:g.30570166G>A	ENSP00000365694:p.His754Tyr		Somatic				PPP1R10_uc010jsc.1_Missense_Mutation_p.H408Y	p.H754Y	NM_002714	NP_002705	WXS	Illumina HiSeq	Unspecified	Q96QC0	PP1RA_HUMAN			19	2812	-			754			Gly-rich.		O00405	Missense_Mutation	SNP	ENST00000376511.2	37	c.2260C>T	CCDS4681.1	.	.	.	.	.	.	.	.	.	.	G	3.343	-0.134097	0.06711	.	.	ENSG00000204569	ENST00000376511	T	0.61859	0.07	4.09	2.13	0.27403	.	0.262560	0.31450	N	0.007625	T	0.09642	0.0237	N	0.08118	0	0.25585	N	0.98676	B	0.02656	0.0	B	0.01281	0.0	T	0.37641	-0.9697	10	0.02654	T	1	-7.5273	6.2863	0.21035	0.1043:0.0:0.7128:0.1828	.	754	Q96QC0	PP1RA_HUMAN	Y	754	ENSP00000365694:H754Y	ENSP00000365694:H754Y	H	-	1	0	PPP1R10	30678145	0.930000	0.31532	0.937000	0.37676	0.306000	0.27790	2.364000	0.44187	1.097000	0.41459	0.485000	0.47835	CAC		0.677	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076556.2	NM_002714		14	159	0	0	0	0.00245	0	14	159				
MDC1	9656	broad.mit.edu	37	6	30672754	30672754	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:30672754C>T	ENST00000376406.3	-	10	4853	c.4206G>A	c.(4204-4206)aaG>aaA	p.K1402K	MDC1_ENST00000376405.2_Silent_p.K1138K|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1402	Interaction with the PRKDC complex.|Pro-rich.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						TTTCAGGGGTCTTGCCAGAGG	0.587								Other conserved DNA damage response genes																															uc003nrg.3		NA																	0				breast(2)|ovary(1)|kidney(1)	4						c.(4204-4206)AAG>AAA	Other_conserved_DNA_damage_response_genes	mediator of DNA-damage checkpoint 1							92.0	100.0	98.0					6																	30672754		2203	4300	6503	SO:0001819	synonymous_variant	9656				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding	g.chr6:30672754C>T	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4206G>A	6.37:g.30672754C>T			Somatic				MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Silent_p.K1009K	p.K1402K	NM_014641	NP_055456	WXS	Illumina HiSeq	Unspecified	Q14676	MDC1_HUMAN			10	4646	-			1402			Pro-rich.|Interaction with the PRKDC complex.		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Silent	SNP	ENST00000376406.3	37	c.4206G>A	CCDS34384.1																																																																																				0.587	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641		41	131	0	0	0	0.007835	0	41	131				
MICB	4277	broad.mit.edu	37	6	31477606	31477606	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:31477606G>A	ENST00000252229.6	+	6	1151	c.1072G>A	c.(1072-1074)Gac>Aac	p.D358N	MICB_ENST00000538442.1_Missense_Mutation_p.D326N|MICB_ENST00000399150.3_Missense_Mutation_p.D315N	NM_005931.3	NP_005922.2			MHC class I polypeptide-related sequence B											NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	13						TGGGACAGGAGACCACAGGGA	0.562																																							uc003ntn.3		NA																	0					0						c.(1072-1074)GAC>AAC		MHC class I polypeptide-related sequence B							113.0	115.0	114.0					6																	31477606		1271	2586	3857	SO:0001583	missense	4277				antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid	integral to plasma membrane|MHC class I protein complex	natural killer cell lectin-like receptor binding	g.chr6:31477606G>A		CCDS43449.1, CCDS75422.1, CCDS75423.1	6p21.3	2013-01-11			ENSG00000204516	ENSG00000204516		"""Immunoglobulin superfamily / C1-set domain containing"""	7091	protein-coding gene	gene with protein product		602436				8022771	Standard	NM_005931		Approved	PERB11.2	uc003ntn.4	Q29980	OTTHUMG00000031074	ENST00000252229.6:c.1072G>A	6.37:g.31477606G>A	ENSP00000252229:p.Asp358Asn		Somatic				MICB_uc011dnm.1_Missense_Mutation_p.D326N|MICB_uc003nto.3_Missense_Mutation_p.D315N	p.D358N	NM_005931	NP_005922	WXS	Illumina HiSeq	Unspecified	Q29980	MICB_HUMAN			6	1188	+			358			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000252229.6	37	c.1072G>A	CCDS43449.1	.	.	.	.	.	.	.	.	.	.	N	12.91	2.080451	0.36662	.	.	ENSG00000204516	ENST00000538442;ENST00000399150;ENST00000252229	T;T;T	0.01133	5.3;5.29;5.41	1.02	0.096	0.14488	.	.	.	.	.	T	0.00967	0.0032	L	0.32530	0.975	0.09310	N	1	D;D;D	0.69078	0.996;0.997;0.997	D;D;D	0.77004	0.987;0.989;0.989	T	0.52586	-0.8556	9	0.87932	D	0	.	3.3075	0.07005	0.3021:0.0:0.6979:0.0	.	326;315;358	F5H7Q8;A2AC57;Q29980	.;.;MICB_HUMAN	N	326;315;358	ENSP00000442345:D326N;ENSP00000382103:D315N;ENSP00000252229:D358N	ENSP00000252229:D358N	D	+	1	0	MICB	31585585	0.000000	0.05858	0.001000	0.08648	0.100000	0.18952	-0.444000	0.06854	0.015000	0.14971	0.313000	0.20887	GAC		0.562	MICB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076102.3	NM_005931		14	93	0	0	0	0.00245	0	14	93				
BTNL2	56244	broad.mit.edu	37	6	32372761	32372761	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:32372761C>T	ENST00000374993.1	-	2	381	c.382G>A	c.(382-384)Gat>Aat	p.D128N	BTNL2_ENST00000454136.3_Missense_Mutation_p.D128N|BTNL2_ENST00000544175.1_Intron|BTNL2_ENST00000540315.1_Intron|BTNL2_ENST00000374995.3_Missense_Mutation_p.D128N|BTNL2_ENST00000414363.1_Intron|BTNL2_ENST00000429232.2_Missense_Mutation_p.D128N	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	128	Ig-like V-type 1.					integral component of membrane (GO:0016021)				central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						TAGTTCCCATCCTGGAAATGG	0.458																																							uc003obg.1		NA																	0				central_nervous_system(1)	1						c.(382-384)GAT>AAT		butyrophilin-like 2							240.0	217.0	225.0					6																	32372761		1511	2709	4220	SO:0001583	missense	56244					integral to membrane		g.chr6:32372761C>T	AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.382G>A	6.37:g.32372761C>T	ENSP00000364132:p.Asp128Asn		Somatic				BTNL2_uc010jty.1_Intron|BTNL2_uc010jtz.1_Intron|BTNL2_uc010jua.1_Intron	p.D128N	NM_019602	NP_062548	WXS	Illumina HiSeq	Unspecified	Q9UIR0	BTNL2_HUMAN			2	382	-			128			Ig-like V-type 1.|Extracellular (Potential).		A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Missense_Mutation	SNP	ENST00000374993.1	37	c.382G>A		.	.	.	.	.	.	.	.	.	.	C	15.49	2.847876	0.51164	.	.	ENSG00000204290	ENST00000468270;ENST00000374995;ENST00000374993;ENST00000429232	T;T;T	0.01359	4.98;4.98;4.98	4.91	4.03	0.46877	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.625195	0.14300	N	0.328360	T	0.01029	0.0034	L	0.43152	1.355	0.19300	N	0.999978	P	0.43938	0.822	P	0.47941	0.562	T	0.51442	-0.8705	10	0.66056	D	0.02	.	5.8081	0.18452	0.1933:0.7112:0.0:0.0955	.	128	Q9UIR0	BTNL2_HUMAN	N	128	ENSP00000364134:D128N;ENSP00000364132:D128N;ENSP00000411166:D128N	ENSP00000364132:D128N	D	-	1	0	BTNL2	32480739	0.158000	0.22850	0.963000	0.40424	0.313000	0.28021	0.916000	0.28651	2.755000	0.94549	0.632000	0.83419	GAT		0.458	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_019602		8	138	0	0	0	0.004482	0	8	138				
ZNF292	23036	broad.mit.edu	37	6	87969704	87969704	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:87969704G>T	ENST00000369577.3	+	8	6400	c.6357G>T	c.(6355-6357)caG>caT	p.Q2119H	ZNF292_ENST00000339907.4_Missense_Mutation_p.Q2114H	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2119						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GTGTTCACCAGGGATGCTTTG	0.428																																							uc003plm.3		NA																	0				ovary(4)	4						c.(6355-6357)CAG>CAT		zinc finger protein 292							89.0	90.0	90.0					6																	87969704		1912	4115	6027	SO:0001583	missense	23036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:87969704G>T	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.6357G>T	6.37:g.87969704G>T	ENSP00000358590:p.Gln2119His		Somatic					p.Q2119H	NM_015021	NP_055836	WXS	Illumina HiSeq	Unspecified	O60281	ZN292_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0199)	8	6398	+		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)	2119			C2H2-type 11.		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	c.6357G>T	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220740	0.58560	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.42131	0.98;0.98	5.54	3.73	0.42828	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.054273	0.64402	D	0.000001	T	0.42562	0.1208	L	0.51422	1.61	0.37325	D	0.909716	D	0.71674	0.998	D	0.68192	0.956	T	0.47749	-0.9093	10	0.72032	D	0.01	.	8.7852	0.34816	0.2884:0.0:0.7116:0.0	.	2119	O60281	ZN292_HUMAN	H	2119;2114	ENSP00000358590:Q2119H;ENSP00000342847:Q2114H	ENSP00000342847:Q2114H	Q	+	3	2	ZNF292	88026423	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.583000	0.36579	1.325000	0.45301	0.591000	0.81541	CAG		0.428	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021		11	32	1	0	1.61879e-10	0.001368	2.57646e-10	11	32				
MDN1	23195	broad.mit.edu	37	6	90400442	90400442	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:90400442C>T	ENST00000369393.3	-	64	10814	c.10699G>A	c.(10699-10701)Gag>Aag	p.E3567K	MDN1_ENST00000428876.1_Missense_Mutation_p.E3567K			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3567	Poly-Glu.				ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCCTCCTCCTCTTCACTCAGG	0.517																																							uc003pnn.1		NA																	0				ovary(8)|skin(2)	10						c.(10699-10701)GAG>AAG		MDN1, midasin homolog							138.0	108.0	118.0					6																	90400442		2203	4300	6503	SO:0001583	missense	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90400442C>T	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.10699G>A	6.37:g.90400442C>T	ENSP00000358400:p.Glu3567Lys		Somatic					p.E3567K	NM_014611	NP_055426	WXS	Illumina HiSeq	Unspecified	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	64	10815	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	3567			Poly-Glu.		O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	c.10699G>A	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.100600	0.56183	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.04970	3.52;3.52	5.82	5.82	0.92795	.	0.057671	0.64402	D	0.000003	T	0.09512	0.0234	M	0.70595	2.14	0.48040	D	0.99957	P	0.52463	0.953	P	0.45829	0.494	T	0.02404	-1.1164	10	0.66056	D	0.02	.	20.0809	0.97775	0.0:1.0:0.0:0.0	.	3567	Q9NU22	MDN1_HUMAN	K	3567	ENSP00000358400:E3567K;ENSP00000413970:E3567K	ENSP00000358400:E3567K	E	-	1	0	MDN1	90457163	1.000000	0.71417	1.000000	0.80357	0.053000	0.15095	5.414000	0.66405	2.753000	0.94483	0.460000	0.39030	GAG		0.517	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			4	22	0	0	0	0.000602	0	4	22				
MMS22L	253714	broad.mit.edu	37	6	97613332	97613332	+	Splice_Site	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:97613332C>A	ENST00000275053.4	-	21	3276	c.3011G>T	c.(3010-3012)gGc>gTc	p.G1004V	MMS22L_ENST00000369251.2_Splice_Site_p.G964V	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	1004					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						GATACACATGCCCTACAAGGA	0.348																																							uc003ppb.2		NA																	0					0						c.(3010-3012)GGC>GTC		hypothetical protein LOC253714							56.0	51.0	53.0					6																	97613332		2203	4300	6503	SO:0001630	splice_region_variant	253714				double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding	g.chr6:97613332C>A		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.3010-1G>T	6.37:g.97613332C>A			Somatic				C6orf167_uc011eaf.1_Missense_Mutation_p.G964V	p.G1004V	NM_198468	NP_940870	WXS	Illumina HiSeq	Unspecified	Q6ZRQ5	MMS22_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0457)	21	3277	-		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)	1004					D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	c.3011G>T	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624971	0.66901	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.39406	1.08;1.08	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.61223	0.2330	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.63514	-0.6620	10	0.87932	D	0	-10.9753	19.8919	0.96932	0.0:1.0:0.0:0.0	.	964;1004	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	V	1004;964	ENSP00000275053:G1004V;ENSP00000358254:G964V	ENSP00000275053:G1004V	G	-	2	0	MMS22L	97720053	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	5.386000	0.66238	2.699000	0.92147	0.655000	0.94253	GGC		0.348	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	Missense_Mutation	6	3	1	0	8.12818e-05	0.001984	0.000119998	6	3				
PRDM1	639	broad.mit.edu	37	6	106554955	106554955	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:106554955A>T	ENST00000369096.4	+	7	2306	c.2072A>T	c.(2071-2073)cAg>cTg	p.Q691L	PRDM1_ENST00000369091.2_Missense_Mutation_p.Q655L|PRDM1_ENST00000369089.3_Missense_Mutation_p.Q557L	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	691					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		AAGTGCTCCCAGTGCCACAAG	0.597			"""D, N, Mis, F, S"""		DLBCL																																		uc003prd.2		NA		Rec	yes		6	6q21	639	D|N|Mis|F|S	"""PR domain containing 1, with ZNF domain"""			L			DLBCL		0				haematopoietic_and_lymphoid_tissue(54)|ovary(1)|skin(1)	56						c.(2071-2073)CAG>CTG		PR domain containing 1, with ZNF domain isoform							125.0	139.0	134.0					6																	106554955		2203	4300	6503	SO:0001583	missense	639				negative regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr6:106554955A>T		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.2072A>T	6.37:g.106554955A>T	ENSP00000358092:p.Gln691Leu		Somatic				PRDM1_uc003pre.2_Missense_Mutation_p.Q557L	p.Q691L	NM_001198	NP_001189	WXS	Illumina HiSeq	Unspecified	O75626	PRDM1_HUMAN		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)	7	2306	+	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)	691					B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	ENST00000369096.4	37	c.2072A>T	CCDS5054.2	.	.	.	.	.	.	.	.	.	.	A	11.13	1.548512	0.27652	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000369089	T;T;T	0.05786	3.39;3.39;3.39	5.93	5.93	0.95920	Zinc finger, C2H2-like (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.094109	0.64402	D	0.000001	T	0.03783	0.0107	L	0.39397	1.21	0.40581	D	0.981396	B;B	0.06786	0.001;0.0	B;B	0.12156	0.007;0.002	T	0.21759	-1.0236	10	0.72032	D	0.01	-19.3656	16.3756	0.83387	1.0:0.0:0.0:0.0	.	557;691	Q86WM7;O75626	.;PRDM1_HUMAN	L	655;691;654;557	ENSP00000358087:Q655L;ENSP00000358092:Q691L;ENSP00000358085:Q557L	ENSP00000358085:Q557L	Q	+	2	0	PRDM1	106661648	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.522000	0.81844	2.270000	0.75569	0.460000	0.39030	CAG		0.597	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3			37	77	0	0	0	0.005524	0	37	77				
AMD1	262	broad.mit.edu	37	6	111211547	111211547	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:111211547G>T	ENST00000368885.3	+	4	751	c.415G>T	c.(415-417)Gca>Tca	p.A139S	AMD1_ENST00000368876.1_Missense_Mutation_p.A70S|AMD1_ENST00000451850.2_Intron|AMD1_ENST00000368882.3_Intron|AMD1_ENST00000368877.5_Missense_Mutation_p.A110S	NM_001634.4	NP_001625.2	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1	139					cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|S-adenosylmethioninamine biosynthetic process (GO:0006557)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)	adenosylmethionine decarboxylase activity (GO:0004014)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	GTTTCTTAATGCAATTTTCCC	0.333																																							uc003puk.1		NA																	0				upper_aerodigestive_tract(1)	1						c.(415-417)GCA>TCA		adenosylmethionine decarboxylase 1 isoform 1	S-Adenosylmethionine(DB00118)						45.0	51.0	49.0					6																	111211547		2201	4300	6501	SO:0001583	missense	262				spermidine biosynthetic process|spermine biosynthetic process	cytosol	adenosylmethionine decarboxylase activity	g.chr6:111211547G>T	M88006	CCDS5086.1, CCDS75504.1, CCDS75505.1	6q21	2014-05-13			ENSG00000123505	ENSG00000123505	4.1.1.50		457	protein-coding gene	gene with protein product		180980	"""S-adenosylmethionine decarboxylase 1"""				Standard	NM_001634		Approved	SAMDC	uc003puk.1	P17707	OTTHUMG00000015369	ENST00000368885.3:c.415G>T	6.37:g.111211547G>T	ENSP00000357880:p.Ala139Ser		Somatic				AMD1_uc011eay.1_Missense_Mutation_p.A70S|AMD1_uc011eaz.1_Missense_Mutation_p.A110S|AMD1_uc011eba.1_Intron|AMD1_uc003pul.1_Intron	p.A139S	NM_001634	NP_001625	WXS	Illumina HiSeq	Unspecified	P17707	DCAM_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	4	737	+		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)	139					E1P5F7|Q5VXN4|Q5VXN6|Q9BWK4	Missense_Mutation	SNP	ENST00000368885.3	37	c.415G>T	CCDS5086.1	.	.	.	.	.	.	.	.	.	.	G	5.750	0.322873	0.10900	.	.	ENSG00000123505	ENST00000368885;ENST00000368877;ENST00000368876	.	.	.	5.75	4.87	0.63330	S-adenosylmethionine decarboxylase, core (2);	0.155164	0.64402	D	0.000019	T	0.11580	0.0282	N	0.04245	-0.25	0.37757	D	0.926176	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.14952	-1.0454	9	0.02654	T	1	.	15.1391	0.72595	0.0:0.2679:0.7321:0.0	.	110;139	A6NNH3;P17707	.;DCAM_HUMAN	S	139;110;70	.	ENSP00000357870:A70S	A	+	1	0	AMD1	111318240	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.535000	0.67173	1.411000	0.46957	-0.175000	0.13238	GCA		0.333	AMD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041816.1			16	17	1	0	1.00905e-13	0.008871	1.65571e-13	16	17				
HEY2	23493	broad.mit.edu	37	6	126080669	126080669	+	Silent	SNP	C	C	T	rs144879330	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:126080669C>T	ENST00000368364.3	+	5	932	c.735C>T	c.(733-735)agC>agT	p.S245S	HEY2_ENST00000368365.1_Silent_p.S199S	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	245					anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		CCACGGGCAGCGTCGCCCCCT	0.662																																							uc003qad.2		NA																	0				breast(1)	1						c.(733-735)AGC>AGT		hairy/enhancer-of-split related with YRPW motif		C		0,4406		0,0,2203	172.0	153.0	160.0		735	-7.6	0.0	6	dbSNP_134	160	6,8590	4.3+/-15.6	0,6,4292	no	coding-synonymous	HEY2	NM_012259.2		0,6,6495	TT,TC,CC		0.0698,0.0,0.0461		245/338	126080669	6,12996	2203	4298	6501	SO:0001819	synonymous_variant	23493				negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription initiation from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|smooth muscle cell differentiation|transcription, DNA-dependent	transcriptional repressor complex	histone deacetylase binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding	g.chr6:126080669C>T	AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.735C>T	6.37:g.126080669C>T			Somatic				HEY2_uc011ebr.1_Silent_p.S199S	p.S245S	NM_012259	NP_036391	WXS	Illumina HiSeq	Unspecified	Q9UBP5	HEY2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)	5	926	+			245						Silent	SNP	ENST00000368364.3	37	c.735C>T	CCDS5131.1																																																																																				0.662	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042077.1			7	165	0	0	0	0.004482	0	7	165				
MYB	4602	broad.mit.edu	37	6	135509014	135509014	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:135509014G>A	ENST00000367814.4	+	3	370	c.184G>A	c.(184-186)Gac>Aac	p.D62N	MYB_ENST00000420123.2_Intron|MYB_ENST00000525369.1_Missense_Mutation_p.D62N|MYB_ENST00000316528.8_Missense_Mutation_p.D62N|MYB_ENST00000341911.5_Missense_Mutation_p.D62N|MYB_ENST00000442647.2_Missense_Mutation_p.D62N|MYB_ENST00000534044.1_Missense_Mutation_p.D62N|MYB_ENST00000534121.1_Missense_Mutation_p.D62N|MYB_ENST00000527615.1_Missense_Mutation_p.D62N|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000528774.1_Missense_Mutation_p.D62N|MYB_ENST00000533624.1_Missense_Mutation_p.D62N	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	62	HTH myb-type 1. {ECO:0000255|PROSITE- ProRule:PRU00625}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		TGGAACAGATGACTGGAAAGT	0.333			T	NFIB	adenoid cystic carcinoma																																		uc003qfc.2		NA		Dom	yes		6	6q22-23	4602	T	v-myb myeloblastosis viral oncogene homolog			E	NFIB		adenoid cystic carcinoma		0				lung(1)	1						c.(184-186)GAC>AAC		v-myb myeloblastosis viral oncogene homolog							86.0	93.0	91.0					6																	135509014		2203	4299	6502	SO:0001583	missense	4602				blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding	g.chr6:135509014G>A		CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.184G>A	6.37:g.135509014G>A	ENSP00000356788:p.Asp62Asn		Somatic				MYB_uc003qfh.2_Missense_Mutation_p.D62N|MYB_uc003qfi.2_Missense_Mutation_p.D62N|MYB_uc010kgi.2_Missense_Mutation_p.D62N|MYB_uc003qfq.2_Missense_Mutation_p.D62N|MYB_uc010kgj.2_Missense_Mutation_p.D62N|MYB_uc003qfo.2_Missense_Mutation_p.D62N|MYB_uc003qfu.2_Missense_Mutation_p.D62N|MYB_uc003qfl.2_RNA|MYB_uc003qfv.2_RNA|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_RNA|MYB_uc003qga.2_RNA|MYB_uc003qgb.2_RNA|MYB_uc010kgk.2_RNA|MYB_uc003qfd.2_RNA|MYB_uc003qfe.2_RNA|MYB_uc003qfg.2_RNA|MYB_uc003qff.2_RNA|MYB_uc003qfj.2_RNA|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_RNA|MYB_uc003qfk.2_RNA|MYB_uc003qfr.2_RNA|MYB_uc003qfs.2_5'UTR|MYB_uc003qft.2_Intron|MYB_uc003qfw.2_Intron|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_RNA|MYB_uc003qfb.1_Missense_Mutation_p.D62N|MYB_uc003qgd.1_5'UTR	p.D62N	NM_005375	NP_005366	WXS	Illumina HiSeq	Unspecified	P10242	MYB_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)	3	383	+	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)	62			HTH myb-type 1.		E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	ENST00000367814.4	37	c.184G>A	CCDS5174.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.242110	0.58995	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000525369;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000533624;ENST00000430686	T;T;T;T;T;T;T;T;T;T;T	0.39056	2.66;2.17;2.17;2.16;1.4;1.89;2.66;2.64;1.84;2.18;1.1	5.27	5.27	0.74061	Transcription regulator HTH, Myb-type, DNA-binding (1);Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.30417	0.0764	N	0.02412	-0.56	0.80722	D	1	D;B;B;B;B;B;B;B;B	0.69078	0.997;0.014;0.006;0.004;0.103;0.005;0.03;0.019;0.032	D;B;B;B;B;B;B;B;B	0.63597	0.916;0.02;0.012;0.019;0.261;0.028;0.012;0.04;0.033	T	0.58132	-0.7690	10	0.87932	D	0	-4.0175	19.2499	0.93919	0.0:0.0:1.0:0.0	.	62;62;62;62;62;62;62;62;62	E9PI07;E9PLZ5;P10242-2;E9PNL6;E9PRS2;E9PNA4;P10242-4;P10242;Q708E1	.;.;.;.;.;.;.;MYB_HUMAN;.	N	62;62;62;62;62;62;62;62;62;62;62;16	ENSP00000339992:D62N;ENSP00000410825:D62N;ENSP00000326328:D62N;ENSP00000356788:D62N;ENSP00000433227:D62N;ENSP00000435938:D62N;ENSP00000434723:D62N;ENSP00000432851:D62N;ENSP00000435055:D62N;ENSP00000436605:D62N;ENSP00000390460:D16N	ENSP00000237302:D62N	D	+	1	0	MYB	135550707	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.809000	0.99208	2.604000	0.88044	0.650000	0.86243	GAC		0.333	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042347.4			8	15	0	0	0	0.006214	0	8	15				
ECT2L	345930	broad.mit.edu	37	6	139206649	139206649	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:139206649G>A	ENST00000423192.1	+	16	2196	c.2035G>A	c.(2035-2037)Gaa>Aaa	p.E679K	ECT2L_ENST00000541398.1_Intron|ECT2L_ENST00000367682.2_Missense_Mutation_p.E679K			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	679	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						TTAGTGCAGAGAAATGATACC	0.438			"""N, Splice, Mis"""		ETP ALL																																		uc003qif.1		NA		Rec	yes		6	6q24.1	345930		epithelial cell transforming sequence 2 oncogene-like			L					0					0						c.(2035-2037)GAA>AAA		epithelial cell transforming sequence 2							102.0	96.0	98.0					6																	139206649		1915	4121	6036	SO:0001583	missense	345930				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr6:139206649G>A		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.2035G>A	6.37:g.139206649G>A	ENSP00000387388:p.Glu679Lys		Somatic				ECT2L_uc011edq.1_Intron	p.E679K	NM_001077706	NP_001071174	WXS	Illumina HiSeq	Unspecified	Q008S8	ECT2L_HUMAN			15	2138	+			679			DH.		B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Missense_Mutation	SNP	ENST00000423192.1	37	c.2035G>A	CCDS43508.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260474	0.80246	.	.	ENSG00000203734	ENST00000423192;ENST00000367682	T;T	0.27256	1.68;1.68	5.3	5.3	0.74995	Dbl homology (DH) domain (5);	0.000000	0.42053	U	0.000780	T	0.26738	0.0654	L	0.28400	0.85	0.80722	D	1	D	0.65815	0.995	D	0.69307	0.963	T	0.01814	-1.1268	10	0.28530	T	0.3	-2.2552	15.8981	0.79350	0.0:0.0:1.0:0.0	.	679	Q008S8	ECT2L_HUMAN	K	679	ENSP00000387388:E679K;ENSP00000356655:E679K	ENSP00000356655:E679K	E	+	1	0	ECT2L	139248342	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	5.684000	0.68197	2.488000	0.83962	0.655000	0.94253	GAA		0.438	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706		5	24	0	0	0	0.001168	0	5	24				
SASH1	23328	broad.mit.edu	37	6	148867274	148867274	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:148867274C>A	ENST00000367467.3	+	19	3947	c.3472C>A	c.(3472-3474)Cgc>Agc	p.R1158S		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	1158					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)	p.R1158C(1)		breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GAAGCAGCACCGCATGGCGGT	0.582																																							uc003qme.1		NA																	1	Substitution - Missense(1)		breast(1)	central_nervous_system(1)	1						c.(3472-3474)CGC>AGC		SAM and SH3 domain containing 1							60.0	52.0	55.0					6																	148867274		2203	4300	6503	SO:0001583	missense	23328						protein binding	g.chr6:148867274C>A	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.3472C>A	6.37:g.148867274C>A	ENSP00000356437:p.Arg1158Ser		Somatic				SASH1_uc003qmf.1_Missense_Mutation_p.R568S	p.R1158S	NM_015278	NP_056093	WXS	Illumina HiSeq	Unspecified	O94885	SASH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)	19	3947	+		Ovarian(120;0.0169)	1158					Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	c.3472C>A	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854266	0.91355	.	.	ENSG00000111961	ENST00000367467;ENST00000537769	T	0.53423	0.62	5.46	5.46	0.80206	.	0.097447	0.64402	D	0.000001	T	0.52757	0.1754	L	0.29908	0.895	0.54753	D	0.999984	D	0.89917	1.0	D	0.85130	0.997	T	0.58509	-0.7624	10	0.87932	D	0	-27.6489	19.3156	0.94211	0.0:1.0:0.0:0.0	.	1158	O94885	SASH1_HUMAN	S	1158;568	ENSP00000356437:R1158S	ENSP00000356437:R1158S	R	+	1	0	SASH1	148908967	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.474000	0.66781	2.567000	0.86603	0.655000	0.94253	CGC		0.582	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278		9	14	1	0	0.00136819	0.001368	0.0019705	9	14				
PLG	5340	broad.mit.edu	37	6	161128812	161128812	+	Missense_Mutation	SNP	G	G	C	rs143079629	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:161128812G>C	ENST00000308192.9	+	3	329	c.266G>C	c.(265-267)aGa>aCa	p.R89T	PLG_ENST00000462918.1_3'UTR|PLG_ENST00000366924.2_Missense_Mutation_p.R89T	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	89	PAN. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ATTAGGATGAGAGATGTAGTT	0.413																																							uc003qtm.3		NA																	0				skin(3)|ovary(1)	4						c.(265-267)AGA>ACA		plasminogen	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)						204.0	193.0	197.0					6																	161128812		2203	4300	6503	SO:0001583	missense	5340				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity	g.chr6:161128812G>C	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.266G>C	6.37:g.161128812G>C	ENSP00000308938:p.Arg89Thr		Somatic					p.R89T	NM_000301	NP_000292	WXS	Illumina HiSeq	Unspecified	P00747	PLMN_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	3	329	+			89			PAN.		Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	c.266G>C	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	.	5.013	0.188043	0.09547	.	.	ENSG00000122194	ENST00000366924;ENST00000308192;ENST00000418964	D;D;D	0.88818	-2.43;-2.43;-2.43	4.32	4.32	0.51571	PAN-1 domain (1);Apple-like (2);Kringle-like fold (1);	0.180298	0.26314	U	0.025084	T	0.75406	0.3845	L	0.49126	1.545	0.30470	N	0.773412	B	0.14012	0.009	B	0.16722	0.016	T	0.64241	-0.6454	10	0.22706	T	0.39	.	10.5491	0.45077	0.0:0.1963:0.8037:0.0	.	89	P00747	PLMN_HUMAN	T	89;89;106	ENSP00000355891:R89T;ENSP00000308938:R89T;ENSP00000389424:R106T	ENSP00000308938:R89T	R	+	2	0	PLG	161048802	1.000000	0.71417	0.897000	0.35233	0.289000	0.27227	2.522000	0.45572	2.376000	0.81061	0.655000	0.94253	AGA		0.413	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301		39	76	0	0	0	0.007835	0	39	76				
AGPAT4	56895	broad.mit.edu	37	6	161567586	161567586	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:161567586C>T	ENST00000320285.4	-	7	1025	c.813G>A	c.(811-813)tcG>tcA	p.S271S	AGPAT4_ENST00000366908.5_3'UTR|AGPAT4_ENST00000457520.2_Silent_p.S109S|AGPAT4_ENST00000366911.5_3'UTR	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	271					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		GCAGCCAGGCCGAGCACTCGT	0.597																																							uc003qtr.1		NA																	0					0						c.(811-813)TCG>TCA		1-acylglycerol-3-phosphate O-acyltransferase 4							132.0	103.0	113.0					6																	161567586		2203	4300	6503	SO:0001819	synonymous_variant	56895				phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding	g.chr6:161567586C>T	AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.813G>A	6.37:g.161567586C>T			Somatic				AGPAT4_uc003qts.1_Silent_p.S131S|AGPAT4_uc011egb.1_Silent_p.S109S	p.S271S	NM_020133	NP_064518	WXS	Illumina HiSeq	Unspecified	Q9NRZ5	PLCD_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)	7	1040	-		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)	271					B4DSF9|Q5TEF0	Silent	SNP	ENST00000320285.4	37	c.813G>A	CCDS5280.1	.	.	.	.	.	.	.	.	.	.	C	3.287	-0.145843	0.06627	.	.	ENSG00000026652	ENST00000437165	.	.	.	4.95	-9.9	0.00461	.	.	.	.	.	T	0.18130	0.0435	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56854	-0.7910	4	.	.	.	-27.6991	3.0781	0.06253	0.1863:0.0836:0.3875:0.3426	.	.	.	.	Q	50	.	.	R	-	2	0	AGPAT4	161487576	0.000000	0.05858	0.005000	0.12908	0.446000	0.32137	-3.911000	0.00336	-4.808000	0.00031	-0.367000	0.07326	CGG		0.597	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042983.1	NM_020133		5	59	0	0	0	0.000602	0	5	59				
C6orf118	168090	broad.mit.edu	37	6	165715467	165715467	+	Missense_Mutation	SNP	T	T	A	rs138289053		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:165715467T>A	ENST00000230301.8	-	2	364	c.344A>T	c.(343-345)cAc>cTc	p.H115L	C6orf118_ENST00000543069.1_Missense_Mutation_p.H11L	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	115										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		CAGGGCCGTGTGGATGGTGAA	0.657																																							uc003qum.3		NA																	0					0						c.(343-345)CAC>CTC		hypothetical protein LOC168090		T	LEU/HIS	1,4405	2.1+/-5.4	0,1,2202	66.0	69.0	68.0		344	4.1	0.0	6	dbSNP_134	68	0,8600		0,0,4300	no	missense	C6orf118	NM_144980.3	99	0,1,6502	AA,AT,TT		0.0,0.0227,0.0077	benign	115/470	165715467	1,13005	2203	4300	6503	SO:0001583	missense	168090							g.chr6:165715467T>A		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.344A>T	6.37:g.165715467T>A	ENSP00000230301:p.His115Leu		Somatic				C6orf118_uc011egi.1_RNA	p.H115L	NM_144980	NP_659417	WXS	Illumina HiSeq	Unspecified	Q5T5N4	CF118_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)	2	380	-		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)	115					Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	37	c.344A>T	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	T	9.176	1.022382	0.19433	2.27E-4	0.0	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.14022	2.78;2.54	5.31	4.11	0.48088	.	0.466513	0.23151	N	0.051359	T	0.04724	0.0128	L	0.44542	1.39	0.09310	N	1	P	0.42248	0.774	B	0.39419	0.299	T	0.21075	-1.0256	10	0.59425	D	0.04	.	7.2411	0.26098	0.0:0.1761:0.0:0.8239	.	115	Q5T5N4	CF118_HUMAN	L	115;11	ENSP00000230301:H115L;ENSP00000439288:H11L	ENSP00000230301:H115L	H	-	2	0	C6orf118	165635457	0.183000	0.23186	0.002000	0.10522	0.013000	0.08279	0.779000	0.26746	0.811000	0.34303	0.533000	0.62120	CAC		0.657	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980		26	30	0	0	0	0.008361	0	26	30				
C6orf118	168090	broad.mit.edu	37	6	165723069	165723069	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr6:165723069C>A	ENST00000230301.8	-	1	27	c.7G>T	c.(7-9)Gag>Tag	p.E3*	C6orf118_ENST00000543069.1_5'Flank	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	3										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		TCCCGCTCCTCCGCCATCGCT	0.567																																							uc003qum.3		NA																	0					0						c.(7-9)GAG>TAG		hypothetical protein LOC168090							81.0	74.0	76.0					6																	165723069		2203	4300	6503	SO:0001587	stop_gained	168090							g.chr6:165723069C>A		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.7G>T	6.37:g.165723069C>A	ENSP00000230301:p.Glu3*		Somatic				C6orf118_uc011egi.1_5'Flank	p.E3*	NM_144980	NP_659417	WXS	Illumina HiSeq	Unspecified	Q5T5N4	CF118_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)	1	43	-		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)	3					Q8TC11	Nonsense_Mutation	SNP	ENST00000230301.8	37	c.7G>T	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	c	15.79	2.937175	0.52972	.	.	ENSG00000112539	ENST00000230301	.	.	.	2.65	-5.29	0.02747	.	2.098700	0.02266	N	0.067994	.	.	.	.	.	.	0.22745	N	0.998783	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	5.6336	0.17524	0.0:0.2266:0.4025:0.3709	.	.	.	.	X	3	.	ENSP00000230301:E3X	E	-	1	0	C6orf118	165643059	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.976000	0.03786	-1.882000	0.01122	-1.744000	0.00683	GAG		0.567	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980		15	12	1	0	3.52763e-06	0.00499	5.26661e-06	15	12				
MICALL2	79778	broad.mit.edu	37	7	1477738	1477738	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:1477738T>A	ENST00000297508.7	-	12	2481	c.2306A>T	c.(2305-2307)gAg>gTg	p.E769V	MICALL2_ENST00000405088.4_Missense_Mutation_p.E557V|MICALL2_ENST00000471899.1_5'UTR	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	769	Forms an intramolecular interaction with the N-terminal CH and LIM zinc-binding domains-containing region keeping the protein in a closed conformation. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		CTCACCTCCCTCGGCCGCCCG	0.726																																							uc003skj.3		NA																	0				central_nervous_system(1)	1						c.(2305-2307)GAG>GTG		MICAL-like 2 isoform 1							7.0	8.0	8.0					7																	1477738		2071	4087	6158	SO:0001583	missense	79778					cytoplasm|cytoskeleton	zinc ion binding	g.chr7:1477738T>A	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.2306A>T	7.37:g.1477738T>A	ENSP00000297508:p.Glu769Val		Somatic				MICALL2_uc003skh.3_5'UTR|MICALL2_uc003ski.3_Missense_Mutation_p.E256V	p.E769V	NM_182924	NP_891554	WXS	Illumina HiSeq	Unspecified	Q8IY33	MILK2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)	12	2453	-		Ovarian(82;0.0253)	769			Potential.		D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Missense_Mutation	SNP	ENST00000297508.7	37	c.2306A>T	CCDS5324.1	.	.	.	.	.	.	.	.	.	.	T	15.47	2.843752	0.51164	.	.	ENSG00000164877	ENST00000405088;ENST00000297508	T;T	0.45668	0.89;0.89	3.96	3.96	0.45880	Domain of unknown function DUF3585 (1);	0.000000	0.35262	N	0.003321	T	0.58061	0.2096	L	0.60957	1.885	0.49483	D	0.999791	D;D	0.89917	0.999;1.0	D;D	0.77004	0.989;0.989	T	0.61559	-0.7038	10	0.72032	D	0.01	.	11.7964	0.52102	0.0:0.0:0.0:1.0	.	769;557	Q8IY33;D3YTD2	MILK2_HUMAN;.	V	557;769	ENSP00000385928:E557V;ENSP00000297508:E769V	ENSP00000297508:E769V	E	-	2	0	MICALL2	1444264	1.000000	0.71417	0.927000	0.36925	0.531000	0.34715	2.992000	0.49417	1.654000	0.50703	0.379000	0.24179	GAG		0.726	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924		3	2	0	0	0	0.004672	0	3	2				
BRAT1	221927	broad.mit.edu	37	7	2577957	2577957	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:2577957C>T	ENST00000340611.4	-	14	2468	c.2212G>A	c.(2212-2214)Gag>Aag	p.E738K	BRAT1_ENST00000473879.1_5'Flank	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	738					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						CCCCTGGCCTCCCGCAGGCTG	0.662																																							uc003smi.2		NA																	0					0						c.(2212-2214)GAG>AAG		hypothetical protein LOC221927 precursor							36.0	41.0	39.0					7																	2577957		2203	4298	6501	SO:0001583	missense	221927				response to ionizing radiation	nucleus	protein binding	g.chr7:2577957C>T	BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.2212G>A	7.37:g.2577957C>T	ENSP00000339637:p.Glu738Lys		Somatic				C7orf27_uc003smh.3_Missense_Mutation_p.E170K	p.E738K	NM_152743	NP_689956	WXS	Illumina HiSeq	Unspecified	Q6PJG6	BRAT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;2.91e-14)	14	2254	-		Ovarian(82;0.0779)	738					A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	ENST00000340611.4	37	c.2212G>A	CCDS5334.1	.	.	.	.	.	.	.	.	.	.	C	9.265	1.044133	0.19748	.	.	ENSG00000106009	ENST00000340611	T	0.34667	1.35	5.27	4.36	0.52297	.	1.043540	0.07438	N	0.896751	T	0.36496	0.0969	M	0.62723	1.935	0.09310	N	1	B	0.33694	0.421	B	0.28139	0.086	T	0.33033	-0.9884	10	0.66056	D	0.02	-9.1949	8.6058	0.33773	0.0:0.628:0.2929:0.0791	.	738	Q6PJG6	BRAT1_HUMAN	K	738	ENSP00000339637:E738K	ENSP00000339637:E738K	E	-	1	0	BRAT1	2544483	0.013000	0.17824	0.037000	0.18230	0.041000	0.13682	2.061000	0.41403	1.164000	0.42652	0.561000	0.74099	GAG		0.662	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239305.2	NM_152743		10	48	0	0	0	0.008291	0	10	48				
AP5Z1	9907	broad.mit.edu	37	7	4828518	4828518	+	Missense_Mutation	SNP	G	G	A	rs200224845		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:4828518G>A	ENST00000348624.4	+	13	1737	c.1643G>A	c.(1642-1644)cGc>cAc	p.R548H	AP5Z1_ENST00000401897.1_Missense_Mutation_p.R548H|MIR4656_ENST00000579503.1_RNA	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	548					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R392H(1)|p.R1259H(1)									GGCTGTGCCCGCGTGGCCCAG	0.697																																							uc003sne.2		NA																	2	Substitution - Missense(2)		endometrium(2)	central_nervous_system(1)	1						c.(1642-1644)CGC>CAC		hypothetical protein LOC9907		G	HIS/ARG	1,4357		0,1,2178	16.0	19.0	18.0		1643	5.1	1.0	7		18	3,8541		0,3,4269	yes	missense	KIAA0415	NM_014855.2	29	0,4,6447	AA,AG,GG		0.0351,0.0229,0.031	probably-damaging	548/808	4828518	4,12898	2179	4272	6451	SO:0001583	missense	9907				cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding	g.chr7:4828518G>A	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1643G>A	7.37:g.4828518G>A	ENSP00000297562:p.Arg548His		Somatic				KIAA0415_uc010ksp.2_RNA|KIAA0415_uc003snf.2_5'UTR	p.R548H	NM_014855	NP_055670	WXS	Illumina HiSeq	Unspecified	O43299	K0415_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)	13	1726	+		Ovarian(82;0.0175)	548					Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	37	c.1643G>A	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338179	0.81911	2.29E-4	3.51E-4	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.68765	-0.35;-0.04	5.1	5.1	0.69264	.	0.058552	0.64402	D	0.000004	D	0.82476	0.5045	M	0.84846	2.72	0.58432	D	0.999991	D	0.89917	1.0	D	0.66084	0.941	D	0.85764	0.1351	10	0.87932	D	0	.	15.7282	0.77780	0.0:0.0:1.0:0.0	.	548	O43299	K0415_HUMAN	H	548	ENSP00000297562:R548H;ENSP00000384980:R548H	ENSP00000297562:R548H	R	+	2	0	KIAA0415	4795044	1.000000	0.71417	0.952000	0.39060	0.445000	0.32107	8.677000	0.91203	2.377000	0.81083	0.472000	0.43445	CGC		0.697	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1			5	27	0	0	0	0.001168	0	5	27				
ICA1	3382	broad.mit.edu	37	7	8198169	8198169	+	Silent	SNP	T	T	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:8198169T>A	ENST00000402384.3	-	7	959	c.693A>T	c.(691-693)ctA>ctT	p.L231L	ICA1_ENST00000406470.2_Silent_p.L231L|ICA1_ENST00000422063.2_Silent_p.L231L|ICA1_ENST00000396675.3_Silent_p.L231L|ICA1_ENST00000401396.1_Silent_p.L219L|ICA1_ENST00000265577.7_Silent_p.L230L|ICA1_ENST00000407906.1_Silent_p.L231L			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa	231	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		GGTATGTTGCTAGCATGTGAG	0.368																																							uc003srm.2		NA																	0				central_nervous_system(1)	1						c.(691-693)CTA>CTT		islet cell autoantigen 1							146.0	128.0	134.0					7																	8198169		2203	4300	6503	SO:0001819	synonymous_variant	3382				neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane		g.chr7:8198169T>A		CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.693A>T	7.37:g.8198169T>A			Somatic				ICA1_uc010ktr.2_Silent_p.L231L|ICA1_uc003srl.2_Silent_p.L219L|ICA1_uc003srn.3_Silent_p.L157L|ICA1_uc003srp.3_Silent_p.L230L|ICA1_uc010kts.2_RNA|ICA1_uc003srq.2_Silent_p.L231L|ICA1_uc003srr.2_Silent_p.L230L|ICA1_uc003sro.3_Silent_p.L231L|ICA1_uc011jxg.1_Silent_p.L231L|ICA1_uc003srs.1_Silent_p.L231L	p.L231L	NM_022307	NP_071682	WXS	Illumina HiSeq	Unspecified	Q05084	ICA69_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)	7	760	-		Ovarian(82;0.0612)	231			AH.		A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Silent	SNP	ENST00000402384.3	37	c.693A>T	CCDS34602.1																																																																																				0.368	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324793.1	NM_004968		25	41	0	0	0	0.005443	0	25	41				
FAM188B	84182	broad.mit.edu	37	7	30830881	30830881	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:30830881C>T	ENST00000265299.6	+	5	841	c.764C>T	c.(763-765)aCc>aTc	p.T255I	INMT-FAM188B_ENST00000458257.1_3'UTR	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	255										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTTGTCTGCACCCAACAGGAC	0.557																																							uc003tbt.2		NA																	0					0						c.(763-765)ACC>ATC		hypothetical protein LOC84182							94.0	103.0	100.0					7																	30830881		1972	4151	6123	SO:0001583	missense	84182							g.chr7:30830881C>T	AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.764C>T	7.37:g.30830881C>T	ENSP00000265299:p.Thr255Ile		Somatic				FAM188B_uc010kwe.2_Missense_Mutation_p.T226I	p.T255I	NM_032222	NP_115598	WXS	Illumina HiSeq	Unspecified	Q4G0A6	F188B_HUMAN			5	841	+			255					Q71AZ7|Q9H6D2	Missense_Mutation	SNP	ENST00000265299.6	37	c.764C>T	CCDS43565.1	.	.	.	.	.	.	.	.	.	.	C	8.388	0.839087	0.16891	.	.	ENSG00000106125	ENST00000265299	T	0.27890	1.64	3.88	1.96	0.26148	.	1.005660	0.08006	N	0.989552	T	0.26738	0.0654	L	0.53249	1.67	0.09310	N	1	P	0.37864	0.61	B	0.33690	0.168	T	0.26608	-1.0098	10	0.87932	D	0	.	5.1146	0.14827	0.0:0.6673:0.2137:0.119	.	255	Q4G0A6	F188B_HUMAN	I	255	ENSP00000265299:T255I	ENSP00000265299:T255I	T	+	2	0	FAM188B	30797406	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	1.725000	0.38074	0.384000	0.24942	0.563000	0.77884	ACC		0.557	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327962.1	NM_032222		15	101	0	0	0	0.003163	0	15	101				
PDE1C	5137	broad.mit.edu	37	7	31917635	31917635	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:31917635G>A	ENST00000396191.1	-	5	895	c.440C>T	c.(439-441)aCa>aTa	p.T147I	PDE1C_ENST00000396182.2_Missense_Mutation_p.T147I|PDE1C_ENST00000396193.1_Missense_Mutation_p.T207I|PDE1C_ENST00000321453.7_Missense_Mutation_p.T147I|PDE1C_ENST00000396184.3_Missense_Mutation_p.T147I	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	147					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	CATGTTTGATGTCCGTCTATA	0.343																																							uc003tcm.1		NA																	0				skin(3)|central_nervous_system(1)	4						c.(439-441)ACA>ATA		phosphodiesterase 1C							116.0	107.0	110.0					7																	31917635		2203	4300	6503	SO:0001583	missense	5137				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr7:31917635G>A	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.440C>T	7.37:g.31917635G>A	ENSP00000379494:p.Thr147Ile		Somatic				PDE1C_uc003tcn.1_Missense_Mutation_p.T147I|PDE1C_uc003tco.1_Missense_Mutation_p.T207I|PDE1C_uc003tcr.2_Missense_Mutation_p.T147I|PDE1C_uc003tcs.2_Missense_Mutation_p.T147I	p.T147I	NM_005020	NP_005011	WXS	Illumina HiSeq	Unspecified	Q14123	PDE1C_HUMAN	GBM - Glioblastoma multiforme(11;0.216)		5	909	-			147					B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	37	c.440C>T	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843223	0.71488	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.72;-0.72	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.81138	0.4760	M	0.74881	2.28	0.80722	D	1	P;P;P	0.42483	0.517;0.781;0.726	P;B;B	0.46452	0.517;0.298;0.186	T	0.82456	-0.0448	10	0.62326	D	0.03	.	19.5356	0.95253	0.0:0.0:1.0:0.0	.	147;207;147	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	I	207;147;147;147;147	ENSP00000379496:T207I;ENSP00000379494:T147I;ENSP00000318105:T147I;ENSP00000379487:T147I;ENSP00000379485:T147I	ENSP00000318105:T147I	T	-	2	0	PDE1C	31884160	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.633000	0.98432	2.716000	0.92895	0.650000	0.86243	ACA		0.343	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1			20	25	0	0	0	0.002299	0	20	25				
ABCA13	154664	broad.mit.edu	37	7	48259079	48259079	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:48259079G>T	ENST00000435803.1	+	4	440	c.416G>T	c.(415-417)tGg>tTg	p.W139L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	139					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AAAAGACTTTGGGTAGAACGA	0.438																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(415-417)TGG>TTG		ATP binding cassette, sub-family A (ABC1),							130.0	123.0	125.0					7																	48259079		1884	4119	6003	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48259079G>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.416G>T	7.37:g.48259079G>T	ENSP00000411096:p.Trp139Leu		Somatic				ABCA13_uc003top.2_Missense_Mutation_p.W139L|ABCA13_uc010kyr.2_5'UTR	p.W139L	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			4	441	+			139					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.416G>T	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.966203	0.53507	.	.	ENSG00000179869	ENST00000435803	T	0.31510	1.49	5.58	5.58	0.84498	.	0.000000	0.45361	D	0.000379	T	0.51160	0.1658	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.29305	-1.0016	10	0.22706	T	0.39	.	15.4217	0.75018	0.0:0.0:1.0:0.0	.	139;139	Q86UQ4;Q86UQ4-2	ABCAD_HUMAN;.	L	139	ENSP00000411096:W139L	ENSP00000409268:W139L	W	+	2	0	ABCA13	48229625	1.000000	0.71417	0.760000	0.31359	0.136000	0.21042	4.715000	0.61909	2.778000	0.95560	0.655000	0.94253	TGG		0.438	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		73	91	1	0	1.38806e-43	0.00361	2.51942e-43	73	91				
ABCA13	154664	broad.mit.edu	37	7	48315194	48315194	+	Silent	SNP	A	A	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:48315194A>T	ENST00000435803.1	+	17	5955	c.5931A>T	c.(5929-5931)ctA>ctT	p.L1977L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1977					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTGACAAACTAAGTAGTTTAA	0.299																																							uc003toq.2		NA																	0				ovary(5)|central_nervous_system(4)|skin(1)	10						c.(5929-5931)CTA>CTT		ATP binding cassette, sub-family A (ABC1),							31.0	29.0	29.0					7																	48315194		1811	4073	5884	SO:0001819	synonymous_variant	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48315194A>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.5931A>T	7.37:g.48315194A>T			Somatic				ABCA13_uc010kyr.2_Silent_p.L1480L	p.L1977L	NM_152701	NP_689914	WXS	Illumina HiSeq	Unspecified	Q86UQ4	ABCAD_HUMAN			17	5956	+			1977					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	c.5931A>T	CCDS47584.1																																																																																				0.299	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		14	17	0	0	0	0.001855	0	14	17				
GRM3	2913	broad.mit.edu	37	7	86468393	86468393	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:86468393G>C	ENST00000361669.2	+	4	2662	c.1563G>C	c.(1561-1563)atG>atC	p.M521I	GRM3_ENST00000536043.1_Missense_Mutation_p.M393I|GRM3_ENST00000394720.2_Intron|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000546348.1_Missense_Mutation_p.M113I	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	521					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TGAAGAATATGCAACCAGGGG	0.522																																					GBM(52;969 1098 3139 52280)	GBM(52;969 1098 3139 52280)	uc003uid.2		NA																	0				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13						c.(1561-1563)ATG>ATC		glutamate receptor, metabotropic 3 precursor	Acamprosate(DB00659)|Nicotine(DB00184)						110.0	100.0	103.0					7																	86468393		2203	4300	6503	SO:0001583	missense	2913				synaptic transmission	integral to plasma membrane		g.chr7:86468393G>C		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1563G>C	7.37:g.86468393G>C	ENSP00000355316:p.Met521Ile		Somatic				GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Missense_Mutation_p.M393I|GRM3_uc010leh.2_Missense_Mutation_p.M113I	p.M521I	NM_000840	NP_000831	WXS	Illumina HiSeq	Unspecified	Q14832	GRM3_HUMAN			4	2662	+	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)		521			Extracellular (Potential).		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	37	c.1563G>C	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	G	10.58	1.390236	0.25118	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.89123	-2.47;-2.47;-2.47	6.17	6.17	0.99709	GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	T	0.80481	0.4631	N	0.12920	0.275	0.80722	D	1	B;B;B	0.17268	0.021;0.007;0.001	B;B;B	0.19148	0.018;0.014;0.024	T	0.74699	-0.3577	10	0.06757	T	0.87	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	113;393;521	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	I	521;113;393	ENSP00000355316:M521I;ENSP00000444064:M113I;ENSP00000441407:M393I	ENSP00000355316:M521I	M	+	3	0	GRM3	86306329	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.062000	0.89475	2.941000	0.99782	0.655000	0.94253	ATG		0.522	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2			54	82	0	0	0	0.00361	0	54	82				
ABCB1	5243	broad.mit.edu	37	7	87160773	87160773	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:87160773G>T	ENST00000265724.3	-	22	2939	c.2522C>A	c.(2521-2523)gCa>gAa	p.A841E	ABCB1_ENST00000543898.1_Missense_Mutation_p.A777E|ABCB1_ENST00000488737.2_5'UTR	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	841	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CCCAAGATTTGCTATATTCTG	0.348																																							uc003uiz.1		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(2521-2523)GCA>GAA		ATP-binding cassette, subfamily B, member 1	Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)						94.0	93.0	93.0					7																	87160773		2203	4300	6503	SO:0001583	missense	5243				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity	g.chr7:87160773G>T	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2522C>A	7.37:g.87160773G>T	ENSP00000265724:p.Ala841Glu		Somatic				ABCB1_uc011khc.1_Missense_Mutation_p.A777E	p.A841E	NM_000927	NP_000918	WXS	Illumina HiSeq	Unspecified	P08183	MDR1_HUMAN			22	2940	-	Esophageal squamous(14;0.00164)		841			Helical; (Potential).|ABC transmembrane type-1 2.		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	c.2522C>A	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718132	0.89205	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.90788	-2.73;-2.73	5.43	5.43	0.79202	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.653207	0.16695	N	0.203367	D	0.96503	0.8859	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.97110	0.927;1.0	D	0.96582	0.9431	10	0.66056	D	0.02	-19.3342	19.5966	0.95541	0.0:0.0:1.0:0.0	.	777;841	B5AK60;P08183	.;MDR1_HUMAN	E	622;841;777	ENSP00000265724:A841E;ENSP00000444095:A777E	ENSP00000265724:A841E	A	-	2	0	ABCB1	86998709	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.738000	0.91569	2.710000	0.92621	0.491000	0.48974	GCA		0.348	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927		33	40	1	0	1.42033e-22	0.004289	2.43617e-22	33	40				
ZNF804B	219578	broad.mit.edu	37	7	88964048	88964048	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:88964048C>T	ENST00000333190.4	+	4	2361	c.1752C>T	c.(1750-1752)ctC>ctT	p.L584L		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	584							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CTCTTTACCTCAACACATCTC	0.378										HNSCC(36;0.09)																													uc011khi.1		NA																	0				ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11						c.(1750-1752)CTC>CTT		zinc finger protein 804B							48.0	51.0	50.0					7																	88964048		2200	4299	6499	SO:0001819	synonymous_variant	219578					intracellular	zinc ion binding	g.chr7:88964048C>T	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1752C>T	7.37:g.88964048C>T		HNSCC(36;0.09)	Somatic					p.L584L	NM_181646	NP_857597	WXS	Illumina HiSeq	Unspecified	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)		4	2290	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		584					B2RTV2|Q7Z714|Q96MN7	Silent	SNP	ENST00000333190.4	37	c.1752C>T	CCDS5613.1																																																																																				0.378	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		7	39	0	0	0	0.001984	0	7	39				
ZNF789	285989	broad.mit.edu	37	7	99084416	99084416	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:99084416C>T	ENST00000331410.5	+	5	853	c.583C>T	c.(583-585)Ctc>Ttc	p.L195F	ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_Intron|ZNF789_ENST00000448667.1_3'UTR	NM_213603.2	NP_998768.2	Q5FWF6	ZN789_HUMAN	zinc finger protein 789	195					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)	11	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TGAGCGAATTCTCACAAGAGC	0.413																																							uc003uqq.1		NA																	0					0						c.(583-585)CTC>TTC		zinc finger protein 789 isoform 1							113.0	111.0	111.0					7																	99084416		2203	4300	6503	SO:0001583	missense	285989				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:99084416C>T	AK093141	CCDS34693.1, CCDS34694.1	7q22.1	2013-01-08			ENSG00000198556	ENSG00000198556		"""Zinc fingers, C2H2-type"", ""-"""	27801	protein-coding gene	gene with protein product						12477932	Standard	XM_005250281		Approved		uc003uqq.1	Q5FWF6	OTTHUMG00000154601	ENST00000331410.5:c.583C>T	7.37:g.99084416C>T	ENSP00000331927:p.Leu195Phe		Somatic				ZNF789_uc010lfw.1_Missense_Mutation_p.L100F|ZNF789_uc003uqr.1_Missense_Mutation_p.L137F	p.L195F	NM_213603	NP_998768	WXS	Illumina HiSeq	Unspecified	Q5FWF6	ZN789_HUMAN			5	802	+	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		195					A4D282|A6NH61|Q6ZMZ9	Missense_Mutation	SNP	ENST00000331410.5	37	c.583C>T	CCDS34693.1	.	.	.	.	.	.	.	.	.	.	C	13.38	2.220378	0.39201	.	.	ENSG00000198556	ENST00000331410	T	0.15372	2.43	3.74	2.79	0.32731	.	.	.	.	.	T	0.15392	0.0371	L	0.43152	1.355	0.24301	N	0.995126	B	0.09022	0.002	B	0.04013	0.001	T	0.20538	-1.0272	9	0.87932	D	0	.	8.4278	0.32739	0.0:0.8688:0.0:0.1312	.	195	Q5FWF6	ZN789_HUMAN	F	195	ENSP00000331927:L195F	ENSP00000331927:L195F	L	+	1	0	ZNF789	98922352	0.010000	0.17322	0.005000	0.12908	0.459000	0.32528	2.474000	0.45154	0.614000	0.30107	-0.355000	0.07637	CTC		0.413	ZNF789-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336266.1	NM_213603		32	45	0	0	0	0.001786	0	32	45				
CUX1	1523	broad.mit.edu	37	7	101747651	101747651	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:101747651G>A	ENST00000292535.7	+	6	480	c.442G>A	c.(442-444)Gaa>Aaa	p.E148K	CUX1_ENST00000393824.3_Missense_Mutation_p.E122K|CUX1_ENST00000360264.3_Missense_Mutation_p.E159K|CUX1_ENST00000437600.4_Missense_Mutation_p.E159K|CUX1_ENST00000549414.2_Missense_Mutation_p.E148K|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000550008.2_Missense_Mutation_p.E148K|CUX1_ENST00000546411.2_Missense_Mutation_p.E148K|CUX1_ENST00000547394.2_Missense_Mutation_p.E143K|CUX1_ENST00000425244.2_Missense_Mutation_p.E113K|CUX1_ENST00000556210.1_Missense_Mutation_p.E148K|CUX1_ENST00000292538.4_Missense_Mutation_p.E159K	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	148					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GAAAATCCGAGAATATGAACA	0.388																																							uc003uyx.3		NA																	0				ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						c.(442-444)GAA>AAA		cut-like homeobox 1 isoform a							159.0	152.0	155.0					7																	101747651		2203	4300	6503	SO:0001583	missense	1523				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:101747651G>A	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.442G>A	7.37:g.101747651G>A	ENSP00000292535:p.Glu148Lys		Somatic				CUX1_uc003uys.3_Missense_Mutation_p.E159K|CUX1_uc003uyt.2_Missense_Mutation_p.E159K|CUX1_uc011kkn.1_Missense_Mutation_p.E122K|CUX1_uc003uyw.2_Missense_Mutation_p.E113K|CUX1_uc003uyv.2_Missense_Mutation_p.E143K|CUX1_uc003uyu.2_Missense_Mutation_p.E159K	p.E148K	NM_181552	NP_853530	WXS	Illumina HiSeq	Unspecified	P39880	CUX1_HUMAN			6	480	+			148			Potential.		B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	c.442G>A	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985850	0.93044	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;1.47;0.99;0.99;0.99;0.99;0.99;0.99	5.8	5.8	0.92144	.	0.113719	0.56097	D	0.000021	T	0.47563	0.1452	L	0.43923	1.385	0.80722	D	1	B;P;P;P;P;P;P	0.52316	0.172;0.682;0.877;0.532;0.952;0.567;0.787	B;B;B;B;P;B;B	0.49085	0.062;0.197;0.339;0.19;0.6;0.191;0.359	T	0.19844	-1.0293	10	0.32370	T	0.25	-12.8129	20.0537	0.97638	0.0:0.0:1.0:0.0	.	122;148;113;143;159;159;159	B4DZZ2;P39880;B3KV79;G3V1Z6;Q13948-2;Q13948;P39880-3	.;CUX1_HUMAN;.;.;.;CASP_HUMAN;.	K	159;143;159;113;159;148;148;148;148;148	ENSP00000292538:E159K;ENSP00000449371:E143K;ENSP00000353401:E159K;ENSP00000409745:E113K;ENSP00000414091:E159K;ENSP00000292535:E148K;ENSP00000446630:E148K;ENSP00000447373:E148K;ENSP00000450125:E148K;ENSP00000451558:E148K	ENSP00000292535:E148K	E	+	1	0	CUX1	101534371	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.504000	0.97986	2.758000	0.94735	0.561000	0.74099	GAA		0.388	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913		19	135	0	0	0	0.007413	0	19	135				
SH2B2	10603	broad.mit.edu	37	7	101957803	101957803	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:101957803C>T	ENST00000536178.1	+	8	1492	c.1447C>T	c.(1447-1449)Caa>Taa	p.Q483*	SH2B2_ENST00000306803.8_Nonsense_Mutation_p.Q445*			O14492	SH2B2_HUMAN	SH2B adaptor protein 2	446	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191, ECO:0000305}.				actin cytoskeleton organization (GO:0030036)|antigen receptor-mediated signaling pathway (GO:0050851)|B-1 B cell homeostasis (GO:0001922)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cytokine-mediated signaling pathway (GO:0019221)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|regulation of JAK-STAT cascade (GO:0046425)|regulation of metabolic process (GO:0019222)|regulation of Ras protein signal transduction (GO:0046578)|signal transduction (GO:0007165)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stress fiber (GO:0001725)	JAK pathway signal transduction adaptor activity (GO:0008269)|SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	9						CGTGATCCGCCAAAGTGAGAC	0.647																																							uc011kko.1		NA																	0					0						c.(1465-1467)CAA>TAA		SH2B adaptor protein 2							28.0	32.0	30.0					7																	101957803		2013	4165	6178	SO:0001587	stop_gained	10603				blood coagulation|insulin receptor signaling pathway|intracellular signal transduction	cytosol|plasma membrane	JAK pathway signal transduction adaptor activity|SH3/SH2 adaptor activity|signal transducer activity	g.chr7:101957803C>T	AB000520		7q22.1	2013-02-14			ENSG00000160999	ENSG00000160999		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	17381	protein-coding gene	gene with protein product	"""adaptor protein with pleckstrin homology and src"""	605300				9233773	Standard	XM_005276976		Approved	APS	uc011kko.2	O14492	OTTHUMG00000150652	ENST00000536178.1:c.1447C>T	7.37:g.101957803C>T	ENSP00000440273:p.Gln483*		Somatic					p.Q489*	NM_020979	NP_066189	WXS	Illumina HiSeq	Unspecified	O14492	SH2B2_HUMAN			5	1510	+			446			SH2.		A6ND74	Nonsense_Mutation	SNP	ENST00000536178.1	37	c.1465C>T		.	.	.	.	.	.	.	.	.	.	.	39	7.513944	0.98332	.	.	ENSG00000160999	ENST00000536178;ENST00000306803	.	.	.	4.66	4.66	0.58398	.	0.061348	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-21.0113	16.7203	0.85409	0.0:1.0:0.0:0.0	.	.	.	.	X	483;445	.	ENSP00000304701:Q445X	Q	+	1	0	SH2B2	101744523	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.315000	0.78998	2.415000	0.81967	0.561000	0.74099	CAA		0.647	SH2B2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_020979		13	20	0	0	0	0.00245	0	13	20				
RELN	5649	broad.mit.edu	37	7	103293132	103293132	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:103293132C>T	ENST00000428762.1	-	14	1788	c.1629G>A	c.(1627-1629)aaG>aaA	p.K543K	RELN_ENST00000343529.5_Silent_p.K543K|RELN_ENST00000424685.2_Silent_p.K543K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	543					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CTTGATGGTTCTTTTGCCTGA	0.418																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(1627-1629)AAG>AAA		reelin isoform a							141.0	142.0	142.0					7																	103293132		2203	4300	6503	SO:0001819	synonymous_variant	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103293132C>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.1629G>A	7.37:g.103293132C>T			Somatic				RELN_uc010liz.2_Silent_p.K543K	p.K543K	NM_005045	NP_005036	WXS	Illumina HiSeq	Unspecified	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	14	1789	-			543					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	c.1629G>A	CCDS47680.1																																																																																				0.418	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		6	106	0	0	0	0.001984	0	6	106				
MDFIC	29969	broad.mit.edu	37	7	114582368	114582368	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:114582368C>G	ENST00000393486.1	+	3	723	c.133C>G	c.(133-135)Caa>Gaa	p.Q45E	MDFIC_ENST00000257724.3_Missense_Mutation_p.Q154E	NM_001166345.1|NM_199072.4	NP_001159817.1|NP_951038.1			MyoD family inhibitor domain containing											breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	8						AGATATAACTCAAGCTACCAA	0.308																																							uc003vhf.2		NA																	0				ovary(1)	1						c.(460-462)CAA>GAA		MyoD family inhibitor domain containing protein							61.0	58.0	59.0					7																	114582368		2203	4300	6503	SO:0001583	missense	29969				activation of JUN kinase activity|interspecies interaction between organisms|negative regulation of protein import into nucleus|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|regulation of Wnt receptor signaling pathway|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleolus|nucleolus|nucleus	cyclin binding|Tat protein binding	g.chr7:114582368C>G	AF054589	CCDS34737.1, CCDS55155.1	7q31.1-q31.2	2006-01-11			ENSG00000135272	ENSG00000135272			28870	protein-coding gene	gene with protein product		614511				10671520	Standard	NM_199072		Approved	HIC	uc003vhf.3	Q9P1T7	OTTHUMG00000023647	ENST00000393486.1:c.133C>G	7.37:g.114582368C>G	ENSP00000377126:p.Gln45Glu		Somatic					p.Q154E	NM_199072	NP_951038	WXS	Illumina HiSeq	Unspecified	Q9P1T7	MDFIC_HUMAN			3	723	+			45						Missense_Mutation	SNP	ENST00000393486.1	37	c.460C>G	CCDS55155.1	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.530051	0.00951	.	.	ENSG00000135272	ENST00000257724;ENST00000393486;ENST00000427207	.	.	.	5.73	4.84	0.62591	.	0.956729	0.08721	N	0.903481	T	0.43366	0.1244	L	0.60455	1.87	0.19775	N	0.999952	B	0.09022	0.002	B	0.08055	0.003	T	0.46911	-0.9157	9	0.02654	T	1	-10.6815	13.51	0.61506	0.0:0.7027:0.2973:0.0	.	45	Q9P1T7	MDFIC_HUMAN	E	154;45;31	.	ENSP00000257724:Q154E	Q	+	1	0	MDFIC	114369604	0.013000	0.17824	0.011000	0.14972	0.415000	0.31203	0.836000	0.27545	1.528000	0.49103	0.655000	0.94253	CAA		0.308	MDFIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059968.4	NM_199072		7	25	0	0	0	0.001984	0	7	25				
CPA1	1357	broad.mit.edu	37	7	130021969	130021969	+	Silent	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:130021969G>T	ENST00000011292.3	+	4	552	c.402G>T	c.(400-402)ctG>ctT	p.L134L	CPA1_ENST00000484324.1_Silent_p.L46L	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	134					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					TCCTGGACCTGCTGGTGGCGG	0.542											OREG0018314	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003vpx.2		NA																	0				ovary(1)	1						c.(400-402)CTG>CTT		carboxypeptidase A1 precursor							97.0	80.0	86.0					7																	130021969		2203	4300	6503	SO:0001819	synonymous_variant	1357				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding	g.chr7:130021969G>T		CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.402G>T	7.37:g.130021969G>T			Somatic	OREG0018314	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1576	CPA1_uc011kpf.1_Silent_p.L46L|CPA1_uc003vpw.2_Intron	p.L134L	NM_001868	NP_001859	WXS	Illumina HiSeq	Unspecified	P15085	CBPA1_HUMAN			4	474	+	Melanoma(18;0.0435)		134					A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Silent	SNP	ENST00000011292.3	37	c.402G>T	CCDS5820.1																																																																																				0.542	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868		26	42	1	0	1.5548e-18	0.005443	2.63273e-18	26	42				
CNTNAP2	26047	broad.mit.edu	37	7	146825926	146825926	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:146825926G>T	ENST00000361727.3	+	7	1597	c.1081G>T	c.(1081-1083)Gtg>Ttg	p.V361L		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	361	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GCCCTCAAATGTGGTAAGGAT	0.343										HNSCC(39;0.1)																													uc003weu.1		NA																	0				ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(1081-1083)GTG>TTG		cell recognition molecule Caspr2 precursor							91.0	95.0	93.0					7																	146825926		2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:146825926G>T	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1081G>T	7.37:g.146825926G>T	ENSP00000354778:p.Val361Leu	HNSCC(39;0.1)	Somatic					p.V361L	NM_014141	NP_054860	WXS	Illumina HiSeq	Unspecified	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		7	1597	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	361			Laminin G-like 1.|Extracellular (Potential).		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.1081G>T	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428795	0.43122	.	.	ENSG00000174469	ENST00000361727	D	0.88818	-2.43	5.64	4.75	0.60458	Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.238372	0.29093	N	0.013163	D	0.83399	0.5246	L	0.54323	1.7	0.80722	D	1	B	0.19935	0.04	B	0.16289	0.015	T	0.75202	-0.3401	10	0.09590	T	0.72	.	10.0454	0.42184	0.1572:0.0:0.8428:0.0	.	361	Q9UHC6	CNTP2_HUMAN	L	361	ENSP00000354778:V361L	ENSP00000354778:V361L	V	+	1	0	CNTNAP2	146456859	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.753000	0.62183	1.367000	0.46095	0.655000	0.94253	GTG		0.343	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			58	72	1	0	2.34445e-45	0.00361	4.29951e-45	58	72				
AOC1	26	broad.mit.edu	37	7	150553968	150553968	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:150553968C>T	ENST00000493429.1	+	4	994	c.410C>T	c.(409-411)tCc>tTc	p.S137F	AOC1_ENST00000467291.1_Missense_Mutation_p.S137F|AOC1_ENST00000360937.4_Missense_Mutation_p.S137F|AOC1_ENST00000416793.2_Missense_Mutation_p.S137F			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	137					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)	p.S137F(1)								Amiloride(DB00594)	TACCAGTCCTCCTGGGCATCG	0.617																																						Pancreas(195;1227 3054 24912 28503)	uc003why.1		NA																	1	Substitution - Missense(1)		upper_aerodigestive_tract(1)	ovary(2)|breast(2)|skin(2)	6						c.(409-411)TCC>TTC		amiloride binding protein 1 precursor	Amiloride(DB00594)|Spermine(DB00127)						61.0	64.0	63.0					7																	150553968		2008	4165	6173	SO:0001583	missense	26				amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding	g.chr7:150553968C>T	AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.410C>T	7.37:g.150553968C>T	ENSP00000418614:p.Ser137Phe		Somatic				ABP1_uc003whz.1_Missense_Mutation_p.S137F|ABP1_uc003wia.1_Missense_Mutation_p.S137F	p.S137F	NM_001091	NP_001082	WXS	Illumina HiSeq	Unspecified	P19801	ABP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	4628	+	all_neural(206;0.219)		137					C9J690|Q16683|Q16684|Q56II4|Q6GU42	Missense_Mutation	SNP	ENST00000493429.1	37	c.410C>T	CCDS43679.1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.893134	0.33442	.	.	ENSG00000002726	ENST00000493429;ENST00000467291;ENST00000460213;ENST00000360937;ENST00000416793;ENST00000437714;ENST00000483043	T;T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09;2.09	5.22	5.22	0.72569	Copper amine oxidase, N2/N3-terminal (1);Copper amine oxidase, N-terminal (2);	0.494827	0.22939	N	0.053805	T	0.35128	0.0921	M	0.78223	2.4	0.34976	D	0.753615	P;D	0.63880	0.902;0.993	P;P	0.50314	0.553;0.637	T	0.53358	-0.8450	10	0.49607	T	0.09	-7.3225	12.06	0.53557	0.0:0.8261:0.1739:0.0	.	137;137	C9J690;P19801	.;ABP1_HUMAN	F	137;137;137;137;137;13;137	ENSP00000418614:S137F;ENSP00000418328:S137F;ENSP00000418557:S137F;ENSP00000354193:S137F;ENSP00000411613:S137F;ENSP00000417392:S137F	ENSP00000354193:S137F	S	+	2	0	ABP1	150184901	0.001000	0.12720	0.977000	0.42913	0.306000	0.27790	0.867000	0.27968	2.444000	0.82710	0.655000	0.94253	TCC		0.617	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1	NM_001091		13	77	0	0	0	0.001855	0	13	77				
KMT2C	58508	broad.mit.edu	37	7	151849853	151849853	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:151849853G>A	ENST00000262189.6	-	49	12681	c.12463C>T	c.(12463-12465)Ccc>Tcc	p.P4155S	KMT2C_ENST00000355193.2_Missense_Mutation_p.P4212S|KMT2C_ENST00000485241.1_5'Flank	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4155					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ACTAATCTGGGAGGGTTTGCA	0.502																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(12463-12465)CCC>TCC		myeloid/lymphoid or mixed-lineage leukemia 3							122.0	115.0	118.0					7																	151849853		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151849853G>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12463C>T	7.37:g.151849853G>A	ENSP00000262189:p.Pro4155Ser		Somatic				MLL3_uc003wkz.2_Missense_Mutation_p.P3273S|MLL3_uc003wkx.2_Missense_Mutation_p.P313S|MLL3_uc003wky.2_Missense_Mutation_p.P1719S	p.P4155S	NM_170606	NP_733751	WXS	Illumina HiSeq	Unspecified	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	49	12682	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	4155					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.12463C>T	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.26|11.26	1.585249|1.585249	0.28268|0.28268	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	D;D;D|.	0.87491|.	-1.62;-1.61;-2.26|.	5.71|5.71	2.67|2.67	0.31697|0.31697	.|.	0.371604|.	0.19141|.	N|.	0.121689|.	T|T	0.56978|0.56978	0.2022|0.2022	L|L	0.45581|0.45581	1.43|1.43	0.80722|0.80722	D|D	1|1	P;B;B|.	0.35077|.	0.483;0.019;0.019|.	B;B;B|.	0.24974|.	0.057;0.011;0.011|.	T|T	0.51228|0.51228	-0.8732|-0.8732	10|5	0.22706|.	T|.	0.39|.	.|.	11.1|11.1	0.48168|0.48168	0.0812:0.4008:0.518:0.0|0.0812:0.4008:0.518:0.0	.|.	4155;3273;4212|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	S|F	4155;4212;772|1715	ENSP00000262189:P4155S;ENSP00000347325:P4212S;ENSP00000410411:P772S|.	ENSP00000262189:P4155S|.	P|S	-|-	1|2	0|0	MLL3|MLL3	151480786|151480786	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	1.706000|1.706000	0.37878|0.37878	0.737000|0.737000	0.32582|0.32582	-0.145000|-0.145000	0.13849|0.13849	CCC|TCC		0.502	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			11	110	0	0	0	0.000978	0	11	110				
LMBR1	64327	broad.mit.edu	37	7	156619369	156619369	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr7:156619369G>C	ENST00000353442.5	-	4	485	c.249C>G	c.(247-249)atC>atG	p.I83M	LMBR1_ENST00000540390.1_Missense_Mutation_p.I62M|LMBR1_ENST00000354505.4_Missense_Mutation_p.I83M	NM_022458.3	NP_071903.2	Q8WVP7	LMBR1_HUMAN	limb development membrane protein 1	83					embryonic digit morphogenesis (GO:0042733)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	18	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		TTTCATTGCTGATGATTGAGA	0.408																																							uc003wmw.3		NA																	0					0						c.(247-249)ATC>ATG		limb region 1 protein							67.0	64.0	65.0					7																	156619369		2203	4300	6503	SO:0001583	missense	64327					integral to membrane	receptor activity	g.chr7:156619369G>C	AF107454	CCDS5945.1	7q36.3	2013-08-05	2013-08-05	2005-07-25	ENSG00000105983	ENSG00000105983			13243	protein-coding gene	gene with protein product		605522	"""chromosome 7 open reading frame 2"", ""limb region 1 homolog (mouse)"""	C7orf2		10329000, 11090342	Standard	NM_022458		Approved	ACHP, FLJ11665, ZRS	uc003wmw.4	Q8WVP7	OTTHUMG00000151510	ENST00000353442.5:c.249C>G	7.37:g.156619369G>C	ENSP00000326604:p.Ile83Met		Somatic				LMBR1_uc003wmx.3_Translation_Start_Site|LMBR1_uc010lqn.2_Missense_Mutation_p.I83M|LMBR1_uc011kvx.1_Missense_Mutation_p.I62M|LMBR1_uc010lqo.2_RNA	p.I83M	NM_022458	NP_071903	WXS	Illumina HiSeq	Unspecified	Q8WVP7	LMBR1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)	4	464	-	Ovarian(565;0.218)	all_hematologic(28;0.0592)	83			Helical; (Potential).		A4D242|Q8N3E3|Q96QZ5|Q9H5N0|Q9HAG9|Q9UDN5|Q9Y6U2	Missense_Mutation	SNP	ENST00000353442.5	37	c.249C>G	CCDS5945.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.317186	0.81469	.	.	ENSG00000105983	ENST00000353442;ENST00000415428;ENST00000354505;ENST00000540390;ENST00000347571	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.48	5.48	0.80851	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.60599	0.2281	M	0.67397	2.05	0.80722	D	1	P;D;P	0.65815	0.922;0.995;0.846	P;D;B	0.69824	0.717;0.966;0.36	T	0.62455	-0.6851	10	0.72032	D	0.01	-13.8237	19.3709	0.94484	0.0:0.0:1.0:0.0	.	62;83;83	B7Z633;Q8WVP7-3;Q8WVP7	.;.;LMBR1_HUMAN	M	83;81;83;62;83	ENSP00000326604:I83M;ENSP00000408256:I81M;ENSP00000346500:I83M;ENSP00000445509:I62M	ENSP00000337803:I83M	I	-	3	3	LMBR1	156312130	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	5.300000	0.65721	2.576000	0.86940	0.655000	0.94253	ATC		0.408	LMBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347939.3	NM_022458		5	31	0	0	0	0.001168	0	5	31				
DLGAP2	9228	broad.mit.edu	37	8	1626417	1626417	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:1626417G>T	ENST00000421627.2	+	9	2220	c.2086G>T	c.(2086-2088)Gcc>Tcc	p.A696S		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	775					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CGTCACGGCCGCCGTCCAAGC	0.572																																							uc003wpl.2		NA																	0					0						c.(2086-2088)GCC>TCC		discs large-associated protein 2							55.0	61.0	59.0					8																	1626417		2099	4198	6297	SO:0001583	missense	9228				neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding	g.chr8:1626417G>T	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2086G>T	8.37:g.1626417G>T	ENSP00000400258:p.Ala696Ser		Somatic				DLGAP2_uc003wpm.2_Missense_Mutation_p.A682S	p.A696S	NM_004745	NP_004736	WXS	Illumina HiSeq	Unspecified	Q9P1A6	DLGP2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)	9	2183	+		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)	775					A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	c.2086G>T	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	18.34	3.602435	0.66445	.	.	ENSG00000198010	ENST00000356067;ENST00000421627	T	0.17691	2.26	4.85	4.85	0.62838	.	0.148893	0.64402	D	0.000012	T	0.29458	0.0734	L	0.56199	1.76	0.31091	N	0.710848	P;P	0.47910	0.805;0.902	B;P	0.52554	0.374;0.702	T	0.09058	-1.0692	10	0.26408	T	0.33	-3.1007	17.9665	0.89100	0.0:0.0:1.0:0.0	.	761;775	Q9P1A6-2;Q9P1A6	.;DLGP2_HUMAN	S	727;696	ENSP00000400258:A696S	ENSP00000348366:A727S	A	+	1	0	DLGAP2	1613824	0.999000	0.42202	0.005000	0.12908	0.939000	0.58152	7.479000	0.81095	2.231000	0.72958	0.557000	0.71058	GCC		0.572	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		26	36	1	0	1.5548e-18	0.005443	2.63273e-18	26	36				
CSMD1	64478	broad.mit.edu	37	8	2807771	2807771	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:2807771G>C	ENST00000520002.1	-	68	10854	c.10299C>G	c.(10297-10299)aaC>aaG	p.N3433K	CSMD1_ENST00000542608.1_Missense_Mutation_p.N3255K|CSMD1_ENST00000537824.1_Missense_Mutation_p.N3432K|CSMD1_ENST00000602557.1_Missense_Mutation_p.N3433K|CSMD1_ENST00000400186.3_Missense_Mutation_p.N3256K|CSMD1_ENST00000602723.1_Missense_Mutation_p.N3256K			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3433						integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTAGTCCCCAGTTGTCATTTT	0.433																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(10297-10299)AAC>AAG		CUB and Sushi multiple domains 1 precursor							171.0	170.0	170.0					8																	2807771		1857	4094	5951	SO:0001583	missense	64478					integral to membrane		g.chr8:2807771G>C			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.10299C>G	8.37:g.2807771G>C	ENSP00000430733:p.Asn3433Lys		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.N2747K|CSMD1_uc010lrg.2_Missense_Mutation_p.N1324K	p.N3433K	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	67	10689	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	3433			Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.10299C>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.47|14.47	2.546512|2.546512	0.45383|0.45383	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.|T;T;T;T	.|0.25414	.|1.8;1.93;1.96;1.8	5.14|5.14	4.25|4.25	0.50352|0.50352	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.17704|0.17704	0.0425|0.0425	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.13594	.|0.007;0.001;0.008	.|B;B;B	.|0.17722	.|0.004;0.002;0.019	T|T	0.05784|0.05784	-1.0864|-1.0864	5|10	.|0.23891	.|T	.|0.37	.|.	8.9651|8.9651	0.35872|0.35872	0.0807:0.1463:0.773:0.0|0.0807:0.1463:0.773:0.0	.|.	.|3433;3433;3255	.|E5RIG2;Q96PZ7;F5H2I8	.|.;CSMD1_HUMAN;.	V|K	2835|3256;3433;3294;3432;3255	.|ENSP00000383047:N3256K;ENSP00000430733:N3433K;ENSP00000441462:N3432K;ENSP00000446243:N3255K	.|ENSP00000320445:N3294K	L|N	-|-	1|3	2|2	CSMD1|CSMD1	2795178|2795178	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.873000|0.873000	0.50193|0.50193	5.125000|5.125000	0.64715|0.64715	2.375000|2.375000	0.81037|0.81037	0.643000|0.643000	0.83706|0.83706	CTG|AAC		0.433	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		67	91	0	0	0	0.00361	0	67	91				
CSMD1	64478	broad.mit.edu	37	8	3047486	3047486	+	Missense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:3047486C>G	ENST00000520002.1	-	35	5904	c.5349G>C	c.(5347-5349)caG>caC	p.Q1783H	CSMD1_ENST00000542608.1_Missense_Mutation_p.Q1782H|CSMD1_ENST00000539096.1_Missense_Mutation_p.Q1782H|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000537824.1_Missense_Mutation_p.Q1782H|CSMD1_ENST00000602557.1_Missense_Mutation_p.Q1783H|CSMD1_ENST00000400186.3_Missense_Mutation_p.Q1783H|CSMD1_ENST00000602723.1_Missense_Mutation_p.Q1783H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1783	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGGGCACGGACTGGCAGTGGA	0.612																																							uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(5347-5349)CAG>CAC		CUB and Sushi multiple domains 1 precursor							45.0	51.0	49.0					8																	3047486		2016	4156	6172	SO:0001583	missense	64478					integral to membrane		g.chr8:3047486C>G			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5349G>C	8.37:g.3047486C>G	ENSP00000430733:p.Gln1783His		Somatic				CSMD1_uc011kwj.1_Missense_Mutation_p.Q1175H|CSMD1_uc003wqe.2_Missense_Mutation_p.Q939H|CSMD1_uc010lrg.2_5'Flank	p.Q1783H	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	34	5739	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	1783			Sushi 10.|Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.5349G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.39|13.39	2.223888|2.223888	0.39300|0.39300	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.68025|.	-0.3;-0.3;-0.3;-0.3;-0.3|.	5.34|5.34	4.45|4.45	0.53987|0.53987	Complement control module (2);Sushi/SCR/CCP (3);|.	0.077681|.	0.52532|.	U|.	0.000063|.	T|T	0.66839|0.66839	0.2830|0.2830	M|M	0.77103|0.77103	2.36|2.36	0.40956|0.40956	D|D	0.984584|0.984584	P;B;B|.	0.48764|.	0.915;0.0;0.0|.	P;B;B|.	0.51895|.	0.683;0.009;0.005|.	T|T	0.68318|0.68318	-0.5440|-0.5440	10|5	0.42905|.	T|.	0.14|.	.|.	7.8319|7.8319	0.29347|0.29347	0.1374:0.7241:0.0:0.1384|0.1374:0.7241:0.0:0.1384	.|.	1783;1783;1783|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	H|L	1783;1783;1645;1782;1782;1782|1263	ENSP00000383047:Q1783H;ENSP00000430733:Q1783H;ENSP00000441462:Q1782H;ENSP00000446243:Q1782H;ENSP00000441675:Q1782H|.	ENSP00000320445:Q1645H|.	Q|V	-|-	3|1	2|0	CSMD1|CSMD1	3034893|3034893	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.579000|0.579000	0.36224|0.36224	0.738000|0.738000	0.26158|0.26158	2.653000|2.653000	0.90120|0.90120	0.544000|0.544000	0.68410|0.68410	CAG|GTC		0.612	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		9	4	0	0	0	0.000978	0	9	4				
MSR1	4481	broad.mit.edu	37	8	16035465	16035465	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:16035465C>T	ENST00000262101.5	-	2	154	c.33G>A	c.(31-33)caG>caA	p.Q11Q	MSR1_ENST00000445506.2_Silent_p.Q29Q|MSR1_ENST00000350896.3_Silent_p.Q11Q|MSR1_ENST00000355282.2_Silent_p.Q11Q|MSR1_ENST00000536385.1_5'UTR|MSR1_ENST00000381998.4_Silent_p.Q11Q			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	11					cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CAGTGTCCTCCTGTTGATTGT	0.433																																							uc003wwz.2		NA																	0				ovary(1)	1						c.(31-33)CAG>CAA		macrophage scavenger receptor 1 isoform type 1							89.0	79.0	83.0					8																	16035465		2203	4300	6503	SO:0001819	synonymous_variant	4481				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity	g.chr8:16035465C>T	D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.33G>A	8.37:g.16035465C>T			Somatic				MSR1_uc010lsu.2_Silent_p.Q29Q|MSR1_uc003wxa.2_Silent_p.Q11Q|MSR1_uc003wxb.2_Silent_p.Q11Q|MSR1_uc011kxz.1_5'UTR	p.Q11Q	NM_138715	NP_619729	WXS	Illumina HiSeq	Unspecified	P21757	MSRE_HUMAN		Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)	2	231	-			11			Cytoplasmic (Potential).		D3DSP3|O60505|P21759|Q45F10	Silent	SNP	ENST00000262101.5	37	c.33G>A	CCDS5995.1																																																																																				0.433	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2			13	31	0	0	0	0.004007	0	13	31				
FGL1	2267	broad.mit.edu	37	8	17731590	17731590	+	Missense_Mutation	SNP	A	A	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:17731590A>G	ENST00000398056.2	-	7	1255	c.440T>C	c.(439-441)tTt>tCt	p.F147S	FGL1_ENST00000427924.1_Missense_Mutation_p.F147S|FGL1_ENST00000381841.2_Missense_Mutation_p.F147S|FGL1_ENST00000381840.2_Missense_Mutation_p.F147S|FGL1_ENST00000398054.1_Missense_Mutation_p.F147S|FGL1_ENST00000518650.1_Missense_Mutation_p.F147S|FGL1_ENST00000522444.1_Missense_Mutation_p.F147S			Q08830	FGL1_HUMAN	fibrinogen-like 1	147	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				adipose tissue development (GO:0060612)|cholesterol metabolic process (GO:0008203)|regulation of glucose metabolic process (GO:0010906)|response to stilbenoid (GO:0035634)	extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)	13				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		TTTTTGGACAAAATTTCCAAA	0.368																																							uc003wxx.2		NA																	0					0						c.(439-441)TTT>TCT		fibrinogen-like 1 precursor							71.0	76.0	74.0					8																	17731590		2203	4300	6503	SO:0001583	missense	2267				signal transduction	fibrinogen complex	receptor binding	g.chr8:17731590A>G	D14446	CCDS6004.1	8p22	2013-02-06			ENSG00000104760	ENSG00000104760		"""Fibrinogen C domain containing"""	3695	protein-coding gene	gene with protein product		605776				8390249	Standard	NM_004467		Approved	HFREP-1	uc003wyb.3	Q08830	OTTHUMG00000096989	ENST00000398056.2:c.440T>C	8.37:g.17731590A>G	ENSP00000381133:p.Phe147Ser		Somatic				FGL1_uc003wxy.2_Missense_Mutation_p.F147S|FGL1_uc003wxz.2_Missense_Mutation_p.F147S|FGL1_uc003wya.2_Missense_Mutation_p.F147S|FGL1_uc003wyb.2_Missense_Mutation_p.F147S|FGL1_uc003wyc.2_Missense_Mutation_p.F147S|FGL1_uc003wyd.2_RNA|FGL1_uc003wye.2_Missense_Mutation_p.F197S|FGL1_uc003wyf.2_Missense_Mutation_p.F117S	p.F147S	NM_201553	NP_963847	WXS	Illumina HiSeq	Unspecified	Q08830	FGL1_HUMAN		Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)	6	764	-			147			Fibrinogen C-terminal.		A6NKU4|Q4PJH9|Q53YF1|Q8NG32|Q96KW6|Q96QM6	Missense_Mutation	SNP	ENST00000398056.2	37	c.440T>C	CCDS6004.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.097212	0.76870	.	.	ENSG00000104760	ENST00000221204;ENST00000398056;ENST00000521427;ENST00000522444;ENST00000381841;ENST00000427924;ENST00000398054;ENST00000381840;ENST00000518650	T;T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	5.23	4.07	0.47477	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.089611	0.85682	D	0.000000	D	0.82499	0.5050	L	0.61036	1.89	0.44142	D	0.99693	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.72075	0.976;0.955;0.966	T	0.83048	-0.0154	10	0.72032	D	0.01	.	11.2352	0.48936	0.9276:0.0:0.0724:0.0	.	117;147;147	E7ERS0;Q8NG32;Q08830	.;.;FGL1_HUMAN	S	147;147;117;147;147;147;147;147;147	ENSP00000381133:F147S;ENSP00000429757:F147S;ENSP00000371263:F147S;ENSP00000401952:F147S;ENSP00000381131:F147S;ENSP00000371262:F147S;ENSP00000428430:F147S	ENSP00000221204:F147S	F	-	2	0	FGL1	17775870	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.498000	0.73679	0.952000	0.37798	0.529000	0.55759	TTT		0.368	FGL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375254.1	NM_004467		23	31	0	0	0	0.003954	0	23	31				
POTEA	340441	broad.mit.edu	37	8	43147734	43147734	+	RNA	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:43147734G>T	ENST00000522175.2	+	0	109							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A									p.R36M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CCCTGCTGCAGGGGAAGCGGC	0.592																																							uc003xpz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(106-108)AGG>ATG		POTE ankyrin domain family, member A isoform 2							55.0	59.0	57.0					8																	43147734		2203	4300	6503			340441							g.chr8:43147734G>T	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43147734G>T			Somatic				POTEA_uc003xqa.1_Missense_Mutation_p.R36M	p.R36M	NM_001005365	NP_001005365	WXS	Illumina HiSeq	Unspecified	Q6S8J7	POTEA_HUMAN			1	150	+			36					A6ND17|A6ND71|Q6S8J6	Missense_Mutation	SNP	ENST00000522175.2	37	c.107G>T																																																																																					0.592	POTEA-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000383492.1	NM_001002920		39	4	1	0	1.69901e-12	0.005524	2.74535e-12	39	4				
OPRK1	4986	broad.mit.edu	37	8	54163445	54163445	+	Silent	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:54163445G>C	ENST00000265572.3	-	2	450	c.153C>G	c.(151-153)ccC>ccG	p.P51P	OPRK1_ENST00000520287.1_Silent_p.P51P	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	51					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AGATGTGCGCGGGCTCCAGCT	0.687																																							uc003xrh.1		NA																	0				ovary(1)|skin(1)	2						c.(151-153)CCC>CCG		opioid receptor, kappa 1	Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)						29.0	23.0	25.0					8																	54163445		2201	4299	6500	SO:0001819	synonymous_variant	4986				behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding	g.chr8:54163445G>C		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.153C>G	8.37:g.54163445G>C			Somatic				OPRK1_uc003xri.1_Silent_p.P51P|OPRK1_uc010lyc.1_5'UTR	p.P51P	NM_000912	NP_000903	WXS	Illumina HiSeq	Unspecified	P41145	OPRK_HUMAN			1	528	-		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)	51			Extracellular (Potential).		E5RHC9|Q499G4	Silent	SNP	ENST00000265572.3	37	c.153C>G	CCDS6152.1																																																																																				0.687	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1			14	11	0	0	0	0.00499	0	14	11				
CHD7	55636	broad.mit.edu	37	8	61655605	61655605	+	Silent	SNP	A	A	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:61655605A>T	ENST00000423902.2	+	2	2093	c.1614A>T	c.(1612-1614)gcA>gcT	p.A538A	CHD7_ENST00000525508.1_Silent_p.A538A|CHD7_ENST00000524602.1_Silent_p.A538A	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	538	Pro-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AGCCTTGGGCACAGCTCCACC	0.567																																							uc003xue.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(1612-1614)GCA>GCT		chromodomain helicase DNA binding protein 7							79.0	91.0	87.0					8																	61655605		2125	4228	6353	SO:0001819	synonymous_variant	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61655605A>T	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.1614A>T	8.37:g.61655605A>T			Somatic					p.A538A	NM_017780	NP_060250	WXS	Illumina HiSeq	Unspecified	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		2	2091	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	538			Pro-rich.		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	37	c.1614A>T	CCDS47865.1																																																																																				0.567	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		8	22	0	0	0	0.004482	0	8	22				
CSPP1	79848	broad.mit.edu	37	8	68066321	68066321	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:68066321G>A	ENST00000262210.5	+	17	2207	c.2176G>A	c.(2176-2178)Gaa>Aaa	p.E726K	CSPP1_ENST00000412460.1_Missense_Mutation_p.E381K	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	761					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GCCTCCAACTGAACTTCAGAT	0.338																																							uc003xxi.2		NA																	0				ovary(3)|breast(2)	5						c.(2281-2283)GAA>AAA		centrosome spindle pole associated protein 1							102.0	98.0	99.0					8																	68066321		1821	4078	5899	SO:0001583	missense	79848					centrosome|microtubule|spindle		g.chr8:68066321G>A	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.2176G>A	8.37:g.68066321G>A	ENSP00000262210:p.Glu726Lys		Somatic				CSPP1_uc003xxg.1_Missense_Mutation_p.E753K|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Missense_Mutation_p.E726K|CSPP1_uc003xxk.2_Missense_Mutation_p.E381K	p.E761K	NM_001077204	NP_001070672	WXS	Illumina HiSeq	Unspecified	Q1MSJ5	CSPP1_HUMAN	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)		19	2312	+	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	761					A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	ENST00000262210.5	37	c.2281G>A	CCDS43744.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480554	0.84747	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.34275	1.39;1.37;1.37	5.77	4.84	0.62591	.	0.325028	0.31648	N	0.007288	T	0.49830	0.1580	L	0.43152	1.355	0.30022	N	0.814287	D;D;D;D	0.71674	0.998;0.974;0.988;0.988	D;P;P;P	0.66084	0.941;0.546;0.829;0.829	T	0.42649	-0.9439	10	0.42905	T	0.14	-16.047	15.715	0.77661	0.0:0.2047:0.7953:0.0	.	381;726;761;761	Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5;F8W7C3	.;.;CSPP1_HUMAN;.	K	726;761;381;381	ENSP00000262210:E726K;ENSP00000415782:E381K;ENSP00000430092:E381K	ENSP00000262210:E726K	E	+	1	0	CSPP1	68228875	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.147000	0.42226	2.890000	0.99128	0.585000	0.79938	GAA		0.338	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790		21	20	0	0	0	0.00278	0	21	20				
RIMS2	9699	broad.mit.edu	37	8	104831791	104831791	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:104831791G>T	ENST00000507740.1	+	1	292	c.56G>T	c.(55-57)gGg>gTg	p.G19V	RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000522174.1_3'UTR|RIMS2_ENST00000262231.10_Missense_Mutation_p.G19V	NM_014677.4	NP_055492.3	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CATTTTCATGGGGTTTTTTCA	0.348										HNSCC(12;0.0054)																													uc003ylw.2		NA																	0				ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(55-57)GGG>GTG		regulating synaptic membrane exocytosis 2							104.0	103.0	103.0					8																	104831791		1812	4083	5895	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104831791G>T	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000507740.1:c.56G>T	8.37:g.104831791G>T	ENSP00000423559:p.Gly19Val	HNSCC(12;0.0054)	Somatic				RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylq.2_Missense_Mutation_p.G19V|RIMS2_uc003ylr.2_Missense_Mutation_p.G19V	p.G19V	NM_014677	NP_055492	WXS	Illumina HiSeq	Unspecified	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		1	376	+			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000507740.1	37	c.56G>T	CCDS43761.1	.	.	.	.	.	.	.	.	.	.	G	12.50	1.955625	0.34471	.	.	ENSG00000176406	ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894	T;T;T;T	0.24723	1.84;1.88;1.89;1.86	5.71	5.71	0.89125	.	.	.	.	.	T	0.21145	0.0509	N	0.08118	0	0.80722	D	1	P;P	0.50272	0.933;0.933	P;P	0.49853	0.624;0.624	T	0.05194	-1.0900	9	0.87932	D	0	.	13.0997	0.59212	0.0731:0.0:0.9269:0.0	.	19;19	Q9UQ26-1;Q9UQ26-3	.;.	V	19	ENSP00000425205:G19V;ENSP00000262231:G19V;ENSP00000423559:G19V;ENSP00000386228:G19V	ENSP00000262231:G19V	G	+	2	0	RIMS2	104900967	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.554000	0.82212	2.685000	0.91497	0.585000	0.79938	GGG		0.348	RIMS2-005	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367215.1	NM_001100117		17	34	1	0	1.15088e-07	0.004007	1.76801e-07	17	34				
CSMD3	114788	broad.mit.edu	37	8	113249457	113249457	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:113249457G>T	ENST00000297405.5	-	67	10833	c.10589C>A	c.(10588-10590)gCa>gAa	p.A3530E	CSMD3_ENST00000343508.3_Missense_Mutation_p.A3490E|CSMD3_ENST00000455883.2_Missense_Mutation_p.A3361E|CSMD3_ENST00000352409.3_Missense_Mutation_p.A3460E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3530						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GCTCAGTGTTGCGTTAACTCT	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(10588-10590)GCA>GAA		CUB and Sushi multiple domains 3 isoform 1							215.0	196.0	203.0					8																	113249457		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113249457G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10589C>A	8.37:g.113249457G>T	ENSP00000297405:p.Ala3530Glu	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.A2732E|CSMD3_uc003ynt.2_Missense_Mutation_p.A3490E|CSMD3_uc011lhx.1_Missense_Mutation_p.A3361E	p.A3530E	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			67	10748	-			3530			Extracellular (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.10589C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266884	0.80469	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.30448	1.87;1.87;1.89;1.53;1.88	4.87	4.87	0.63330	.	0.111740	0.43260	D	0.000587	T	0.43964	0.1271	L	0.55990	1.75	0.48185	D	0.999603	P;P;D	0.54047	0.893;0.828;0.964	P;B;P	0.52217	0.566;0.341;0.693	T	0.43621	-0.9380	10	0.72032	D	0.01	.	18.1948	0.89818	0.0:0.0:1.0:0.0	.	3361;3530;3490	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	3490;3530;2800;3361;3460	ENSP00000345799:A3490E;ENSP00000297405:A3530E;ENSP00000341558:A2800E;ENSP00000412263:A3361E;ENSP00000343124:A3460E	ENSP00000297405:A3530E	A	-	2	0	CSMD3	113318633	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	3.555000	0.53727	2.514000	0.84764	0.467000	0.42956	GCA		0.363	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		59	66	1	0	4.83814e-26	0.00361	8.51898e-26	59	66				
TRPS1	7227	broad.mit.edu	37	8	116632277	116632277	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:116632277C>T	ENST00000220888.5	-	2	168	c.9G>A	c.(7-9)cgG>cgA	p.R3R	TRPS1_ENST00000395715.3_Silent_p.R16R|TRPS1_ENST00000519674.1_Silent_p.R3R|TRPS1_ENST00000520276.1_Silent_p.R7R|TRPS1_ENST00000519076.1_Silent_p.R3R			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	3					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GGTTCTTTTTCCGGACCATAT	0.413									Langer-Giedion syndrome																														uc003ynz.2		NA																	0				ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(7-9)CGG>CGA		zinc finger transcription factor TRPS1							54.0	51.0	52.0					8																	116632277		1831	4087	5918	SO:0001819	synonymous_variant	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116632277C>T	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.9G>A	8.37:g.116632277C>T			Somatic				TRPS1_uc011lhy.1_Silent_p.R7R|TRPS1_uc003yny.2_Silent_p.R16R|TRPS1_uc010mcy.2_Silent_p.R3R	p.R3R	NM_014112	NP_054831	WXS	Illumina HiSeq	Unspecified	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		2	468	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		3					B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	37	c.9G>A																																																																																					0.413	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		4	85	0	0	0	0.000248	0	4	85				
DSCC1	79075	broad.mit.edu	37	8	120854054	120854054	+	Missense_Mutation	SNP	T	T	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:120854054T>C	ENST00000313655.4	-	7	1118	c.904A>G	c.(904-906)Act>Gct	p.T302A		NM_024094.2	NP_076999.2	Q9BVC3	DCC1_HUMAN	DNA replication and sister chromatid cohesion 1	302					DNA replication (GO:0006260)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|pancreas(1)	9	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TCAAGACTAGTTACCATTCCT	0.408																																							uc003yov.2		NA																	0				pancreas(1)	1						c.(904-906)ACT>GCT		defective in sister chromatid cohesion 1							116.0	90.0	99.0					8																	120854054		2203	4300	6503	SO:0001583	missense	79075				DNA replication|maintenance of mitotic sister chromatid cohesion|post-translational protein acetylation|regulation of DNA replication	chromatin|chromosome, centromeric region|nucleoplasm	DNA binding|protein binding	g.chr8:120854054T>C		CCDS6330.1	8q24.12	2013-05-24	2013-05-24		ENSG00000136982	ENSG00000136982			24453	protein-coding gene	gene with protein product	"""defective in sister chromatid cohesion homolog 1 (S. cerevisiae)"""	613203	"""defective in sister chromatid cohesion 1 homolog (S. cerevisiae)"""			12766176, 20826785	Standard	NM_024094		Approved	DCC1, hDCC1, MGC5528	uc003yov.3	Q9BVC3	OTTHUMG00000165010	ENST00000313655.4:c.904A>G	8.37:g.120854054T>C	ENSP00000322180:p.Thr302Ala		Somatic					p.T302A	NM_024094	NP_076999	WXS	Illumina HiSeq	Unspecified	Q9BVC3	DCC1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00185)		7	1039	-	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		302					Q969N5	Missense_Mutation	SNP	ENST00000313655.4	37	c.904A>G	CCDS6330.1	.	.	.	.	.	.	.	.	.	.	t	22.3	4.272852	0.80580	.	.	ENSG00000136982	ENST00000313655	T	0.41400	1.0	6.14	6.14	0.99180	.	0.000000	0.85682	D	0.000000	T	0.50565	0.1623	L	0.52759	1.655	0.54753	D	0.999985	D	0.58970	0.984	P	0.58577	0.841	T	0.44003	-0.9356	10	0.05721	T	0.95	-18.9113	16.7937	0.85596	0.0:0.0:0.0:1.0	.	302	Q9BVC3	DCC1_HUMAN	A	302	ENSP00000322180:T302A	ENSP00000322180:T302A	T	-	1	0	DSCC1	120923235	1.000000	0.71417	0.146000	0.22360	0.795000	0.44927	4.161000	0.58170	2.364000	0.80123	0.524000	0.50904	ACT		0.408	DSCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381443.1	NM_024094		17	11	0	0	0	0.001523	0	17	11				
MTBP	27085	broad.mit.edu	37	8	121531029	121531029	+	Missense_Mutation	SNP	T	T	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:121531029T>A	ENST00000305949.1	+	20	2627	c.2582T>A	c.(2581-2583)cTc>cAc	p.L861H		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	861	Interaction with MDM2. {ECO:0000250}.				cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			AGCCAGCGTCTCTTTGAAATC	0.353																																							uc003ypc.1		NA																	0				skin(2)|ovary(1)	3						c.(2581-2583)CTC>CAC		Mdm2, transformed 3T3 cell double minute 2, p53							134.0	125.0	128.0					8																	121531029		2203	4300	6503	SO:0001583	missense	27085				cell cycle arrest			g.chr8:121531029T>A		CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.2582T>A	8.37:g.121531029T>A	ENSP00000303398:p.Leu861His		Somatic					p.L861H	NM_022045	NP_071328	WXS	Illumina HiSeq	Unspecified	Q96DY7	MTBP_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)		20	2627	+	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		861			Interaction with MDM2 (By similarity).		B4DUR5|Q9HA89	Missense_Mutation	SNP	ENST00000305949.1	37	c.2582T>A	CCDS6333.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.569434	0.86439	.	.	ENSG00000172167	ENST00000305949	.	.	.	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000001	T	0.79393	0.4438	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81870	-0.0734	9	0.87932	D	0	-9.28	16.1547	0.81649	0.0:0.0:0.0:1.0	.	861	Q96DY7	MTBP_HUMAN	H	861	.	ENSP00000303398:L861H	L	+	2	0	MTBP	121600210	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.835000	0.75344	2.221000	0.72209	0.528000	0.53228	CTC		0.353	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381530.1	NM_022045		24	18	0	0	0	0.003954	0	24	18				
BAI1	575	broad.mit.edu	37	8	143607977	143607977	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:143607977G>A	ENST00000517894.1	+	24	4281	c.3387G>A	c.(3385-3387)aaG>aaA	p.K1129K	BAI1_ENST00000323289.5_Silent_p.K1129K			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1129					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					AGAAGCTGAAGGAGCGGGCAG	0.642																																							uc003ywm.2		NA																	0				lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8						c.(3385-3387)AAG>AAA		brain-specific angiogenesis inhibitor 1							34.0	40.0	38.0					8																	143607977		1989	4155	6144	SO:0001819	synonymous_variant	575				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding	g.chr8:143607977G>A	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3387G>A	8.37:g.143607977G>A			Somatic					p.K1129K	NM_001702	NP_001693	WXS	Illumina HiSeq	Unspecified	O14514	BAI1_HUMAN			23	3570	+	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)		1129			Cytoplasmic (Potential).			Silent	SNP	ENST00000517894.1	37	c.3387G>A																																																																																					0.642	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702		6	8	0	0	0	0.00308	0	6	8				
SCRIB	23513	broad.mit.edu	37	8	144890795	144890795	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:144890795G>A	ENST00000320476.3	-	15	2105	c.2099C>T	c.(2098-2100)tCt>tTt	p.S700F	SCRIB_ENST00000377533.3_Missense_Mutation_p.S619F|SCRIB_ENST00000356994.2_Missense_Mutation_p.S700F	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	700	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)		p.S700F(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			AGAGGGCGCAGAAACCACGGC	0.652																																					Pancreas(51;966 1133 10533 14576 29674)	Pancreas(51;966 1133 10533 14576 29674)	uc003yzp.1		NA																	1	Substitution - Missense(1)	p.S700F(1)	pancreas(1)	urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5						c.(2098-2100)TCT>TTT		scribble isoform b							153.0	131.0	138.0					8																	144890795		2203	4300	6503	SO:0001583	missense	23513				activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding	g.chr8:144890795G>A	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.2099C>T	8.37:g.144890795G>A	ENSP00000322938:p.Ser700Phe		Somatic				SCRIB_uc003yzo.1_Missense_Mutation_p.S700F	p.S700F	NM_015356	NP_056171	WXS	Illumina HiSeq	Unspecified	Q14160	SCRIB_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)		15	2106	-	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		700			Potential.|Sufficient for targeting to adherens junction and to inhibit cell proliferation.		Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	37	c.2099C>T	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	g	12.91	2.079560	0.36662	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533;ENST00000377539;ENST00000531942	T;T;T;T	0.37915	1.4;1.37;1.17;1.82	4.2	4.2	0.49525	PDZ/DHR/GLGF (1);	.	.	.	.	T	0.21550	0.0519	N	0.08118	0	0.20074	N	0.999939	P;P	0.42296	0.666;0.775	B;B	0.38056	0.202;0.264	T	0.11916	-1.0568	9	0.72032	D	0.01	.	13.6545	0.62330	0.0:0.0:1.0:0.0	.	700;700	Q14160;Q14160-3	SCRIB_HUMAN;.	F	700;700;619;69;18	ENSP00000349486:S700F;ENSP00000322938:S700F;ENSP00000366756:S619F;ENSP00000433546:S18F	ENSP00000322938:S700F	S	-	2	0	SCRIB	144962783	0.101000	0.21875	0.009000	0.14445	0.059000	0.15707	1.526000	0.35964	2.074000	0.62210	0.401000	0.26515	TCT		0.652	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356		11	25	0	0	0	0.001855	0	11	25				
GPAA1	8733	broad.mit.edu	37	8	145138897	145138897	+	Silent	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr8:145138897G>C	ENST00000355091.4	+	5	691	c.570G>C	c.(568-570)ctG>ctC	p.L190L	GPAA1_ENST00000527144.1_3'UTR|GPAA1_ENST00000361036.6_Silent_p.L130L	NM_003801.3	NP_003792.1	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment 1	190					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein complex assembly (GO:0006461)|protein retention in ER lumen (GO:0006621)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	tubulin binding (GO:0015631)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(2)	19	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ATGACCTTCTGGGCACTGAGG	0.552																																							uc003zax.2		NA																	0					0						c.(568-570)CTG>CTC		glycosylphosphatidylinositol anchor attachment							110.0	118.0	115.0					8																	145138897		2119	4233	6352	SO:0001819	synonymous_variant	8733				attachment of GPI anchor to protein|C-terminal protein lipidation|protein complex assembly|protein retention in ER lumen	GPI-anchor transamidase complex	tubulin binding	g.chr8:145138897G>C	AB006969	CCDS43776.1	8q24.3	2012-12-10	2012-12-10		ENSG00000197858	ENSG00000197858			4446	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	603048	"""anchor attachment protein 1 (Gaa1p, yeast) homolog"", ""GPAA1P anchor attachment protein 1 homolog (yeast)"", ""glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)"""			9828142	Standard	NM_003801		Approved	GAA1, hGAA1	uc003zax.3	O43292	OTTHUMG00000165438	ENST00000355091.4:c.570G>C	8.37:g.145138897G>C			Somatic				GPAA1_uc003zav.1_Silent_p.L68L|GPAA1_uc003zaw.1_Silent_p.L130L	p.L190L	NM_003801	NP_003792	WXS	Illumina HiSeq	Unspecified	O43292	GPAA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		5	680	+	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		190			Lumenal (Potential).		Q9NSS0|Q9UQ31	Silent	SNP	ENST00000355091.4	37	c.570G>C	CCDS43776.1																																																																																				0.552	GPAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384070.1	NM_003801		60	45	0	0	0	0.00361	0	60	45				
SPATA6L	55064	broad.mit.edu	37	9	4661977	4661977	+	Silent	SNP	G	G	A	rs386731946|rs186090330	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:4661977G>A	ENST00000454239.2	-	3	344	c.99C>T	c.(97-99)ctC>ctT	p.L33L	SPATA6L_ENST00000223517.5_5'UTR|SPATA6L_ENST00000475086.1_Silent_p.L33L|PPAPDC2_ENST00000381883.2_5'Flank|SPATA6L_ENST00000381895.5_5'UTR|SPATA6L_ENST00000381890.5_Silent_p.L33L			Q8N4H0	SPA6L_HUMAN	spermatogenesis associated 6-like	33																	ACTGATTCATGAGGTAGACCC	0.443											OREG0019084	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	2	0.000399361	0.0015	0.0	5008	,	,		18488	0.0		0.0	False		,,,				2504	0.0						uc011llz.1		NA																	0					0						c.(97-99)CTC>CTT		hypothetical protein LOC55064		G		4,3764		0,4,1880	94.0	88.0	90.0		99	2.9	1.0	9		90	0,8230		0,0,4115	no	coding-synonymous	C9orf68	NM_001039395.3		0,4,5995	AA,AG,GG		0.0,0.1062,0.0333		33/335	4661977	4,11994	1884	4115	5999	SO:0001819	synonymous_variant	55064							g.chr9:4661977G>A	AK000920	CCDS43785.1, CCDS43785.2	9p24.2	2012-03-15	2012-03-15	2012-03-15	ENSG00000106686	ENSG00000106686			25472	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 68"""	C9orf68			Standard	NM_001039395		Approved	FLJ10058	uc011llz.2	Q8N4H0	OTTHUMG00000019469	ENST00000454239.2:c.99C>T	9.37:g.4661977G>A			Somatic	OREG0019084	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	620	C9orf68_uc003zik.2_RNA|C9orf68_uc003zil.2_RNA|C9orf68_uc010mhj.2_Silent_p.L33L|C9orf68_uc011lly.1_5'UTR|C9orf68_uc003zim.2_Silent_p.L33L|PPAPDC2_uc003zin.2_5'Flank	p.L33L	NM_001039395	NP_001034484	WXS	Illumina HiSeq	Unspecified	B4DIY4	B4DIY4_HUMAN		GBM - Glioblastoma multiforme(50;0.0222)	3	337	-		Breast(48;0.0456)	33					B4DIY4|Q5JVJ5|Q8IY90	Silent	SNP	ENST00000454239.2	37	c.99C>T																																																																																					0.443	SPATA6L-202	KNOWN	basic	protein_coding	protein_coding		NM_017985		4	16	0	0	0	0.000248	0	4	16				
KIAA2026	158358	broad.mit.edu	37	9	5921793	5921793	+	Silent	SNP	A	A	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:5921793A>G	ENST00000399933.3	-	8	4202	c.4203T>C	c.(4201-4203)atT>atC	p.I1401I	KIAA2026_ENST00000381461.2_Silent_p.I1371I	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1401	Ser-rich.									breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TACTAGAACAAATAGAGGACT	0.388																																							uc003zjq.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(4201-4203)ATT>ATC		hypothetical protein LOC158358							154.0	146.0	148.0					9																	5921793		1891	4113	6004	SO:0001819	synonymous_variant	158358							g.chr9:5921793A>G	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.4203T>C	9.37:g.5921793A>G			Somatic				KIAA2026_uc010mht.2_Silent_p.I576I	p.I1401I	NM_001017969	NP_001017969	WXS	Illumina HiSeq	Unspecified	Q5HYC2	K2026_HUMAN		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)	8	4419	-		Acute lymphoblastic leukemia(23;0.158)	1401			Ser-rich.		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37	c.4203T>C																																																																																					0.388	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969		3	94	0	0	0	0.004672	0	3	94				
DENND4C	55667	broad.mit.edu	37	9	19296154	19296154	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:19296154C>G	ENST00000380432.2	+	2	275	c.242C>G	c.(241-243)tCa>tGa	p.S81*	DENND4C_ENST00000434457.2_Nonsense_Mutation_p.S317*|DENND4C_ENST00000602925.1_Nonsense_Mutation_p.S317*			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	81	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TGTTTACTCTCACACTGGCCT	0.378																																							uc003znq.2		NA																	0				ovary(1)|skin(1)	2						c.(241-243)TCA>TGA		DENN/MADD domain containing 4C							162.0	150.0	154.0					9																	19296154		1838	4091	5929	SO:0001587	stop_gained	55667					integral to membrane		g.chr9:19296154C>G	AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.242C>G	9.37:g.19296154C>G	ENSP00000369797:p.Ser81*		Somatic				DENND4C_uc011lnc.1_5'UTR	p.S81*	NM_017925	NP_060395	WXS	Illumina HiSeq	Unspecified	Q5VZ89	DEN4C_HUMAN			2	275	+			81			DENN.		A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Nonsense_Mutation	SNP	ENST00000380432.2	37	c.242C>G		.	.	.	.	.	.	.	.	.	.	C	37	5.981502	0.97168	.	.	ENSG00000137145	ENST00000380437	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.3436	18.2302	0.89933	0.0:1.0:0.0:0.0	.	.	.	.	X	81	.	ENSP00000369802:S81X	S	+	2	0	DENND4C	19286154	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.593000	0.82686	2.529000	0.85273	0.591000	0.81541	TCA		0.378	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925		10	107	0	0	0	0.006214	0	10	107				
ACO1	48	broad.mit.edu	37	9	32421015	32421015	+	Silent	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:32421015G>A	ENST00000309951.6	+	8	1098	c.960G>A	c.(958-960)ctG>ctA	p.L320L	ACO1_ENST00000379923.1_Silent_p.L320L|ACO1_ENST00000541043.1_Silent_p.L221L	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	320					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TCACGTACCTGGTGCAAACAG	0.478																																							uc003zqw.3		NA																	0					0						c.(958-960)CTG>CTA		aconitase 1							153.0	147.0	149.0					9																	32421015		2203	4300	6503	SO:0001819	synonymous_variant	48				citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding	g.chr9:32421015G>A	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.960G>A	9.37:g.32421015G>A			Somatic				ACO1_uc010mjh.1_Silent_p.L154L|ACO1_uc003zqx.3_Silent_p.L320L|ACO1_uc003zqy.3_RNA	p.L320L	NM_002197	NP_002188	WXS	Illumina HiSeq	Unspecified	P21399	ACOC_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)	8	1115	+			320					D3DRK7|Q14652|Q5VZA7	Silent	SNP	ENST00000309951.6	37	c.960G>A	CCDS6525.1																																																																																				0.478	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197		21	180	0	0	0	0.001882	0	21	180				
TAF1L	138474	broad.mit.edu	37	9	32633430	32633431	+	Missense_Mutation	DNP	TG	TG	AT			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:32633430_32633431TG>AT	ENST00000242310.4	-	1	2236_2237	c.2147_2148CA>AT	c.(2146-2148)gCA>gAT	p.A716D	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	716					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTATCTTGGTTGCCATGCCAAC	0.416																																							uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(2146-2148)GCA>GAT		TBP-associated factor RNA polymerase 1-like																																				SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32633430_32633431TG>AT	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2147_2148delinsAT	9.37:g.32633430_32633431delinsAT	ENSP00000418379:p.Ala716Asp		Somatic				uc003zrh.1_5'Flank	p.A716D	NM_153809	NP_722516	WXS	Illumina HiSeq	Unspecified	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	2237_2238	-			716					Q0VG57	Missense_Mutation	DNP	ENST00000242310.4	37	c.2147_2148CA>AT	CCDS35003.1																																																																																				0.416	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			42	75	0	0	0	0.004672	0	42	75				
RUSC2	9853	broad.mit.edu	37	9	35548239	35548239	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:35548239C>T	ENST00000455600.1	+	2	2290	c.1721C>T	c.(1720-1722)tCa>tTa	p.S574L		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	574						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CAGGAGTTCTCACCCATCCAA	0.627																																							uc003zww.2		NA																	0				ovary(1)	1						c.(1720-1722)TCA>TTA		RUN and SH3 domain containing 2							27.0	29.0	28.0					9																	35548239		2203	4300	6503	SO:0001583	missense	9853					cytosol		g.chr9:35548239C>T	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.1721C>T	9.37:g.35548239C>T	ENSP00000393922:p.Ser574Leu		Somatic				RUSC2_uc010mkq.2_Intron|RUSC2_uc003zwx.3_Missense_Mutation_p.S574L	p.S574L	NM_014806	NP_055621	WXS	Illumina HiSeq	Unspecified	Q8N2Y8	RUSC2_HUMAN	Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)		2	1976	+			574					A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	37	c.1721C>T	CCDS35008.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230326	0.79688	.	.	ENSG00000198853	ENST00000361226;ENST00000455600;ENST00000543478	T;T	0.40756	1.02;1.02	5.86	5.86	0.93980	.	0.061549	0.64402	D	0.000002	T	0.38799	0.1054	L	0.29908	0.895	0.53005	D	0.999962	P	0.43352	0.804	B	0.41412	0.356	T	0.27262	-1.0079	10	0.66056	D	0.02	-8.8321	19.1701	0.93574	0.0:1.0:0.0:0.0	.	574	Q8N2Y8	RUSC2_HUMAN	L	574	ENSP00000355177:S574L;ENSP00000393922:S574L	ENSP00000355177:S574L	S	+	2	0	RUSC2	35538239	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.144000	0.64832	2.777000	0.95525	0.655000	0.94253	TCA		0.627	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462		10	25	0	0	0	0.006214	0	10	25				
Unknown	0	broad.mit.edu	37	9	69440254	69440254	+	IGR	SNP	A	A	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:69440254A>T								ANKRD20A4 (14694 upstream) : AL445665.2 (147123 downstream)																							TATAAATTGGAGCTAGATGAA	0.294																																							uc010mnx.1		NA																	0					NA						c.(337-339)GAG>GTG		coiled-coil domain containing 29							15.0	17.0	16.0					9																	69440254		1148	2895	4043	SO:0001628	intergenic_variant	0							g.chr9:69440254A>T																													9.37:g.69440254A>T			Somatic					p.E113V	NM_001098806	NP_001092276	WXS	Illumina HiSeq	Unspecified					3	507	+									Missense_Mutation	SNP		37	c.338A>T																																																																																				0	0.294									18	9	0	0	0	0.001523	0	18	9				
PCSK5	5125	broad.mit.edu	37	9	78749031	78749031	+	Silent	SNP	T	T	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:78749031T>C	ENST00000545128.1	+	10	1753	c.1215T>C	c.(1213-1215)ttT>ttC	p.F405F	PCSK5_ENST00000376767.3_Silent_p.F405F|PCSK5_ENST00000376752.4_Silent_p.F405F	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	405	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						CCAGTCCGTTTCTGACCTGGA	0.418																																							uc004ajz.2		NA																	0				ovary(2)|skin(1)	3						c.(1213-1215)TTT>TTC		proprotein convertase subtilisin/kexin type 5							120.0	111.0	114.0					9																	78749031		2203	4300	6503	SO:0001819	synonymous_variant	5125				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity	g.chr9:78749031T>C		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1215T>C	9.37:g.78749031T>C			Somatic				PCSK5_uc004ajy.2_Silent_p.F405F|PCSK5_uc004aka.2_Intron	p.F405F	NM_006200	NP_006191	WXS	Illumina HiSeq	Unspecified	Q92824	PCSK5_HUMAN			10	1753	+			405			Catalytic.		F5H2G7|Q13527|Q96EP4	Silent	SNP	ENST00000545128.1	37	c.1215T>C	CCDS55320.1																																																																																				0.418	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				35	30	0	0	0	0.003755	0	35	30				
SPATA31D1	389763	broad.mit.edu	37	9	84606679	84606680	+	Missense_Mutation	DNP	GG	GG	TT	rs548268085		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:84606679_84606680GG>TT	ENST00000344803.2	+	4	1341_1342	c.1294_1295GG>TT	c.(1294-1296)GGa>TTa	p.G432L		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	432					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GAAAGAAAATGGAAAGAAACCA	0.411																																							uc004amn.2		NA																	0					0						c.(1294-1296)GGA>TTA		hypothetical protein LOC389763																																				SO:0001583	missense	389763					integral to membrane		g.chr9:84606679_84606680GG>TT		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	Exception_encountered	9.37:g.84606679_84606680delinsTT	ENSP00000341988:p.Gly432Leu		Somatic					p.G432L	NM_001001670	NP_001001670	WXS	Illumina HiSeq	Unspecified	Q6ZQQ2	F75D1_HUMAN			4	1341_1342	+			432						Missense_Mutation	DNP	ENST00000344803.2	37	c.1294_1295GG>TT	CCDS47986.1																																																																																				0.411	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		20	23	0	0	0	0.004672	0	20	23				
NR4A3	8013	broad.mit.edu	37	9	102595602	102595602	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:102595602C>T	ENST00000395097.2	+	5	1849	c.1120C>T	c.(1120-1122)Ctg>Ttg	p.L374L	NR4A3_ENST00000330847.1_Silent_p.L385L|NR4A3_ENST00000338488.4_Silent_p.L374L	NM_006981.3|NM_173200.2	NP_008912.2|NP_775292.1	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	374					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)		TCF12/NR4A3(2)|TAF15/NR4A3(33)|EWSR1/NR4A3(146)|TFG/NR4A3(2)				Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				GAGAGGTCGTCTGCCTTCCAA	0.453			T	EWSR1	extraskeletal myxoid chondrosarcoma																																		uc004baf.1		NA		Dom	yes		9	9q22	8013	T	"""nuclear receptor subfamily 4, group A, member 3 (NOR1)"""			M	EWSR1		extraskeletal myxoid chondrosarcoma	EWSR1/NR4A3(140)|TAF15/NR4A3(33)	0				bone(173)	173						c.(1120-1122)CTG>TTG		nuclear receptor subfamily 4, group A, member 3							198.0	171.0	180.0					9																	102595602		2203	4300	6503	SO:0001819	synonymous_variant	8013				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding	g.chr9:102595602C>T	U12767	CCDS6742.1, CCDS6743.1, CCDS6744.1	9q22	2013-01-16			ENSG00000119508	ENSG00000119508		"""Nuclear hormone receptors"""	7982	protein-coding gene	gene with protein product		600542				8614405	Standard	NM_006981		Approved	CSMF, CHN, NOR1, MINOR	uc004baf.1	Q92570	OTTHUMG00000021030	ENST00000395097.2:c.1120C>T	9.37:g.102595602C>T			Somatic				NR4A3_uc004bae.2_Silent_p.L374L|NR4A3_uc004bag.1_Silent_p.L374L|NR4A3_uc004bai.2_Silent_p.L385L	p.L374L	NM_006981	NP_008912	WXS	Illumina HiSeq	Unspecified	Q92570	NR4A3_HUMAN			5	1849	+		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)	374					A2A3I7|Q12935|Q14979|Q16420|Q4VXA8|Q4VXA9|Q9UEK2|Q9UEK3	Silent	SNP	ENST00000395097.2	37	c.1120C>T	CCDS6743.1																																																																																				0.453	NR4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055482.1			7	58	0	0	0	0.00308	0	7	58				
RNF20	56254	broad.mit.edu	37	9	104307162	104307162	+	Nonsense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:104307162C>T	ENST00000389120.3	+	6	832	c.742C>T	c.(742-744)Cag>Tag	p.Q248*		NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	248					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		CACCATGTCTCAGGAGGTACT	0.468																																							uc004bbn.2		NA																	0				ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8						c.(742-744)CAG>TAG		ring finger protein 20							144.0	144.0	144.0					9																	104307162		2203	4300	6503	SO:0001587	stop_gained	56254				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:104307162C>T	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.742C>T	9.37:g.104307162C>T	ENSP00000373772:p.Gln248*		Somatic					p.Q248*	NM_019592	NP_062538	WXS	Illumina HiSeq	Unspecified	Q5VTR2	BRE1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)	6	832	+		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)	248			Potential.		A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Nonsense_Mutation	SNP	ENST00000389120.3	37	c.742C>T	CCDS35084.1	.	.	.	.	.	.	.	.	.	.	C	37	6.516213	0.97629	.	.	ENSG00000155827	ENST00000389120	.	.	.	5.86	5.86	0.93980	.	0.102975	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-28.45	20.1581	0.98126	0.0:1.0:0.0:0.0	.	.	.	.	X	248	.	ENSP00000373772:Q248X	Q	+	1	0	RNF20	103346983	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.109000	0.57824	2.937000	0.99478	0.650000	0.86243	CAG		0.468	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592		20	146	0	0	0	0.001882	0	20	146				
BRINP1	1620	broad.mit.edu	37	9	121929547	121929547	+	Missense_Mutation	SNP	C	C	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:121929547C>A	ENST00000265922.3	-	8	2562	c.2101G>T	c.(2101-2103)Gac>Tac	p.D701Y	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	701					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											TTAATTCGGTCCCGAATATCC	0.572																																							uc004bkc.2		NA																	0				skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						c.(2101-2103)GAC>TAC		deleted in bladder cancer 1 precursor							105.0	106.0	106.0					9																	121929547		2203	4300	6503	SO:0001583	missense	1620				cell cycle arrest|cell death	cytoplasm	protein binding	g.chr9:121929547C>A	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.2101G>T	9.37:g.121929547C>A	ENSP00000265922:p.Asp701Tyr		Somatic					p.D701Y	NM_014618	NP_055433	WXS	Illumina HiSeq	Unspecified	O60477	DBC1_HUMAN			8	2557	-			701					Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	c.2101G>T	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.736691	0.49045	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.17370	2.28	5.73	5.73	0.89815	.	0.045204	0.85682	D	0.000000	T	0.25044	0.0608	L	0.28400	0.85	0.80722	D	1	P	0.51791	0.948	P	0.51453	0.67	T	0.00279	-1.1853	10	0.59425	D	0.04	-29.7525	20.2921	0.98543	0.0:1.0:0.0:0.0	.	701	O60477	DBC1_HUMAN	Y	701	ENSP00000265922:D701Y	ENSP00000265922:D701Y	D	-	1	0	DBC1	120969368	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.743000	0.85020	2.879000	0.98667	0.650000	0.86243	GAC		0.572	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618		30	70	1	0	3.80469e-20	0.001786	6.48388e-20	30	70				
NR5A1	2516	broad.mit.edu	37	9	127245274	127245274	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:127245274G>C	ENST00000373588.4	-	7	1345	c.1149C>G	c.(1147-1149)ttC>ttG	p.F383L		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	383	Important for dimerization.				adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						GGTTATTCAGGAACTTCAAAT	0.572																																							uc004boo.1		NA																	0					0						c.(1147-1149)TTC>TTG		nuclear receptor subfamily 5, group A, member 1							138.0	129.0	132.0					9																	127245274		2203	4300	6503	SO:0001583	missense	2516				cell-cell signaling|male gonad development|positive regulation of transcription from RNA polymerase II promoter|primary sex determination|regulation of steroid biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|phospholipid binding|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding	g.chr9:127245274G>C	D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.1149C>G	9.37:g.127245274G>C	ENSP00000362690:p.Phe383Leu		Somatic					p.F383L	NM_004959	NP_004950	WXS	Illumina HiSeq	Unspecified	Q13285	STF1_HUMAN			7	1336	-			383			Important for dimerization.		O15196|Q5T6F5	Missense_Mutation	SNP	ENST00000373588.4	37	c.1149C>G	CCDS6856.1	.	.	.	.	.	.	.	.	.	.	G	4.415	0.076770	0.08485	.	.	ENSG00000136931	ENST00000373588;ENST00000373587	D;D	0.98585	-5.01;-1.78	5.17	2.27	0.28462	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.179231	0.49916	N	0.000132	D	0.90535	0.7034	N	0.02247	-0.625	0.39588	D	0.969549	B	0.02656	0.0	B	0.04013	0.001	T	0.81295	-0.0997	10	0.11485	T	0.65	.	8.2016	0.31428	0.196:0.1194:0.6846:0.0	.	383	Q13285	STF1_HUMAN	L	383;167	ENSP00000362690:F383L;ENSP00000362689:F167L	ENSP00000362689:F167L	F	-	3	2	NR5A1	126285095	1.000000	0.71417	0.997000	0.53966	0.276000	0.26787	0.756000	0.26419	-0.027000	0.13873	-1.462000	0.01023	TTC		0.572	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054029.1	NM_004959		5	111	0	0	0	0.000602	0	5	111				
NAIF1	203245	broad.mit.edu	37	9	130825923	130825923	+	Missense_Mutation	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:130825923C>T	ENST00000373078.4	-	2	987	c.768G>A	c.(766-768)atG>atA	p.M256I	NAIF1_ENST00000488519.1_5'UTR	NM_197956.3	NP_931045.1	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	256					negative regulation of cell growth (GO:0030308)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AGCGGCGGATCATCTGCAGTA	0.632																																							uc004bta.2		NA																	0					0						c.(766-768)ATG>ATA		nuclear apoptosis inducing factor 1							112.0	96.0	101.0					9																	130825923		2203	4300	6503	SO:0001583	missense	203245				apoptosis|induction of apoptosis	nucleus		g.chr9:130825923C>T	AK122729	CCDS6889.1	9q34.11	2008-04-10	2008-04-10	2008-04-10	ENSG00000171169	ENSG00000171169			25446	protein-coding gene	gene with protein product	"""nuclear apoptosis-inducing factor 1"""	610673	"""chromosome 9 open reading frame 90"""	C9orf90		14702039, 16378748	Standard	NM_197956		Approved	DKFZp762G199, bA379C10.2	uc004bta.3	Q69YI7	OTTHUMG00000020727	ENST00000373078.4:c.768G>A	9.37:g.130825923C>T	ENSP00000362170:p.Met256Ile		Somatic				NAIF1_uc004bsz.2_RNA	p.M256I	NM_197956	NP_931045	WXS	Illumina HiSeq	Unspecified	Q69YI7	NAIF1_HUMAN			2	987	-			256					B3KV81|Q8WU12	Missense_Mutation	SNP	ENST00000373078.4	37	c.768G>A	CCDS6889.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077040	0.76415	.	.	ENSG00000171169	ENST00000373078	.	.	.	5.27	5.27	0.74061	.	0.039808	0.85682	D	0.000000	T	0.47783	0.1464	L	0.29908	0.895	0.80722	D	1	B	0.30281	0.275	B	0.24155	0.051	T	0.51196	-0.8736	9	0.72032	D	0.01	-12.0201	17.8545	0.88759	0.0:1.0:0.0:0.0	.	256	Q69YI7	NAIF1_HUMAN	I	256	.	ENSP00000362170:M256I	M	-	3	0	NAIF1	129865744	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.298000	0.78815	2.452000	0.82932	0.563000	0.77884	ATG		0.632	NAIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054330.1	NM_197956		12	72	0	0	0	0.000978	0	12	72				
OBP2A	29991	broad.mit.edu	37	9	138439091	138439091	+	Missense_Mutation	SNP	G	G	A	rs368244666		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:138439091G>A	ENST00000539850.1	+	3	300	c.274G>A	c.(274-276)Gcc>Acc	p.A92T	OBP2A_ENST00000340780.3_Missense_Mutation_p.A92T|OBP2A_ENST00000342114.4_Missense_Mutation_p.R47H|OBP2A_ENST00000371776.1_Missense_Mutation_p.A92T			Q9NY56	OBP2A_HUMAN	odorant binding protein 2A	92					response to stimulus (GO:0050896)|sensory perception of chemical stimulus (GO:0007606)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)			endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		CAAATTCAGCGCCTGTGAGCC	0.642																																							uc004cgb.2		NA																	0					0						c.(274-276)GCC>ACC		odorant binding protein 2A precursor							73.0	68.0	70.0					9																	138439091		2203	4300	6503	SO:0001583	missense	29991				response to stimulus|sensory perception of smell	extracellular region	odorant binding|transporter activity	g.chr9:138439091G>A	AJ251029	CCDS6992.1	9q34	2014-01-22			ENSG00000122136	ENSG00000122136		"""Lipocalins"""	23380	protein-coding gene	gene with protein product		164320					Standard	NM_014582		Approved	hOBPIIa, OBP, LCN13	uc004cgb.3	Q9NY56	OTTHUMG00000020909	ENST00000539850.1:c.274G>A	9.37:g.138439091G>A	ENSP00000441028:p.Ala92Thr		Somatic				OBP2A_uc004cgc.2_Missense_Mutation_p.A92T|OBP2A_uc010nau.2_RNA|OBP2A_uc010nav.2_Missense_Mutation_p.R47H	p.A92T	NM_014582	NP_055397	WXS	Illumina HiSeq	Unspecified	Q9NY56	OBP2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)	3	316	+			92					Q5T8A3|Q9NY50|Q9NY53|Q9NY54|Q9NY55	Missense_Mutation	SNP	ENST00000539850.1	37	c.274G>A	CCDS6992.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	7.761|7.761	0.705325|0.705325	0.15172|0.15172	.|.	.|.	ENSG00000122136|ENSG00000122136	ENST00000340780;ENST00000371776;ENST00000539850|ENST00000342114	T;T;T|T	0.07908|0.08546	3.15;3.15;3.15|3.08	2.55|2.55	-3.74|-3.74	0.04385|0.04385	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);|.	0.949950|.	0.08647|.	N|.	0.914645|.	T|T	0.05868|0.05868	0.0153|0.0153	L|L	0.37630|0.37630	1.12|1.12	0.09310|0.09310	N|N	1|1	B;P|B	0.40794|0.10296	0.256;0.729|0.003	B;B|B	0.33295|0.06405	0.024;0.161|0.002	T|T	0.38887|0.38887	-0.9640|-0.9640	10|9	0.21014|0.66056	T|D	0.42|0.02	-9.8158|-9.8158	3.6723|3.6723	0.08279|0.08279	0.4954:0.0:0.3253:0.1793|0.4954:0.0:0.3253:0.1793	.|.	92;92|47	Q5T8A5;Q9NY56|Q5T8A4	.;OBP2A_HUMAN|.	T|H	92|47	ENSP00000342097:A92T;ENSP00000360841:A92T;ENSP00000441028:A92T|ENSP00000340950:R47H	ENSP00000342097:A92T|ENSP00000340950:R47H	A|R	+|+	1|2	0|0	OBP2A|OBP2A	137578912|137578912	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-1.094000|-1.094000	0.03359|0.03359	-0.986000|-0.986000	0.03498|0.03498	-0.480000|-0.480000	0.04831|0.04831	GCC|CGC		0.642	OBP2A-006	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397904.1	NM_014582		24	28	0	0	0	0.003954	0	24	28				
PRKX	5613	broad.mit.edu	37	X	3533909	3533909	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chrX:3533909G>C	ENST00000262848.5	-	7	1252	c.898C>G	c.(898-900)Cat>Gat	p.H300D	PRKX_ENST00000425240.1_5'UTR	NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	300	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				AACCACCGATGATGCTTCACA	0.473																																							uc010nde.2		NA																	0				skin(2)|lung(1)	3						c.(898-900)CAT>GAT		protein kinase, X-linked							131.0	82.0	99.0					X																	3533909		2202	4300	6502	SO:0001583	missense	5613						ATP binding|cAMP-dependent protein kinase activity	g.chrX:3533909G>C		CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.898C>G	X.37:g.3533909G>C	ENSP00000262848:p.His300Asp		Somatic					p.H300D	NM_005044	NP_005035	WXS	Illumina HiSeq	Unspecified	P51817	PRKX_HUMAN			7	1265	-		all_lung(23;0.000396)|Lung NSC(23;0.00123)	300			Protein kinase.			Missense_Mutation	SNP	ENST00000262848.5	37	c.898C>G	CCDS14125.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.246697	0.39697	.	.	ENSG00000183943	ENST00000262848	T	0.11495	2.77	3.69	3.69	0.42338	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.34048	0.0884	M	0.81614	2.55	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.28202	-1.0051	10	0.87932	D	0	-19.8668	13.6885	0.62531	0.0:0.0:1.0:0.0	.	300	P51817	PRKX_HUMAN	D	300	ENSP00000262848:H300D	ENSP00000262848:H300D	H	-	1	0	PRKX	3543909	1.000000	0.71417	0.023000	0.16930	0.007000	0.05969	7.174000	0.77620	1.479000	0.48272	0.589000	0.80489	CAT		0.473	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055659.1	NM_005044		3	7	0	0	0	0.000248	0	3	7				
TLR7	51284	broad.mit.edu	37	X	12905433	12905433	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chrX:12905433G>A	ENST00000380659.3	+	3	1945	c.1806G>A	c.(1804-1806)atG>atA	p.M602I		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	602					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	AGAAACTGATGATGAACGACA	0.383																																							uc004cvc.2		NA																	0				ovary(2)|lung(2)|breast(1)	5						c.(1804-1806)ATG>ATA		toll-like receptor 7 precursor	Imiquimod(DB00724)						85.0	86.0	85.0					X																	12905433		2203	4300	6503	SO:0001583	missense	51284				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity	g.chrX:12905433G>A	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.1806G>A	X.37:g.12905433G>A	ENSP00000370034:p.Met602Ile		Somatic					p.M602I	NM_016562	NP_057646	WXS	Illumina HiSeq	Unspecified	Q9NYK1	TLR7_HUMAN			3	1945	+			602			LRR 20.|Extracellular (Potential).		D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	37	c.1806G>A	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	G	5.265	0.234252	0.09969	.	.	ENSG00000196664	ENST00000380659	T	0.79033	-1.23	5.83	4.96	0.65561	.	0.265971	0.41823	D	0.000820	T	0.62563	0.2438	N	0.22421	0.69	0.40253	D	0.97809	B	0.09022	0.002	B	0.10450	0.005	T	0.58086	-0.7698	10	0.24483	T	0.36	.	9.8123	0.40831	0.0772:0.1382:0.7846:0.0	.	602	Q9NYK1	TLR7_HUMAN	I	602	ENSP00000370034:M602I	ENSP00000370034:M602I	M	+	3	0	TLR7	12815354	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	1.297000	0.33400	2.465000	0.83290	0.594000	0.82650	ATG		0.383	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562		10	64	0	0	0	0.008291	0	10	64				
BCOR	54880	broad.mit.edu	37	X	39933360	39933360	+	Silent	SNP	T	T	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chrX:39933360T>A	ENST00000378444.4	-	4	1467	c.1239A>T	c.(1237-1239)acA>acT	p.T413T	BCOR_ENST00000397354.3_Silent_p.T413T|BCOR_ENST00000378455.4_Silent_p.T413T|BCOR_ENST00000342274.4_Silent_p.T413T	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	413					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CTTGAACCGCTGTCTTCCGGG	0.582			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																uc004den.3		NA		Rec	yes		X	Xp11.4	54880		BCL6 corepressor	yes							0				ovary(2)|kidney(1)|central_nervous_system(1)	4						c.(1237-1239)ACA>ACT		BCL-6 interacting corepressor isoform c							46.0	36.0	39.0					X																	39933360		2202	4299	6501	SO:0001819	synonymous_variant	54880				heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chrX:39933360T>A	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.1239A>T	X.37:g.39933360T>A			Somatic				BCOR_uc004dep.3_Silent_p.T413T|BCOR_uc004deo.3_Silent_p.T413T|BCOR_uc004dem.3_Silent_p.T413T|BCOR_uc004deq.3_Silent_p.T413T	p.T413T	NM_001123385	NP_001116857	WXS	Illumina HiSeq	Unspecified	Q6W2J9	BCOR_HUMAN			4	1531	-			413					D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	37	c.1239A>T	CCDS48093.1																																																																																				0.582	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745		19	2	0	0	0	0.008871	0	19	2				
SYN1	6853	broad.mit.edu	37	X	47435805	47435805	+	Splice_Site	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chrX:47435805C>T	ENST00000295987.7	-	8	1105	c.981G>A	c.(979-981)atG>atA	p.M327I	SYN1_ENST00000340666.4_Splice_Site_p.M327I	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	327	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						CTGACGTCCTCCTGGGGGACA	0.597																																							uc004die.2		NA																	0				ovary(1)	1						c.(979-981)ATG>ATA		synapsin I isoform Ia							71.0	62.0	65.0					X																	47435805		2203	4300	6503	SO:0001630	splice_region_variant	6853					cell junction|Golgi apparatus	actin binding|ATP binding|ligase activity|transporter activity	g.chrX:47435805C>T		CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.981-1G>A	X.37:g.47435805C>T			Somatic				SYN1_uc004did.2_Missense_Mutation_p.M327I	p.M327I	NM_006950	NP_008881	WXS	Illumina HiSeq	Unspecified	P17600	SYN1_HUMAN			8	1110	-			327			C; actin-binding and synaptic-vesicle binding.		B1AJQ1|O75825|Q5H9A9	Missense_Mutation	SNP	ENST00000295987.7	37	c.981G>A	CCDS14280.1	.	.	.	.	.	.	.	.	.	.	c	16.05	3.011951	0.54468	.	.	ENSG00000008056	ENST00000295987;ENST00000340666	T;T	0.36340	1.74;1.26	4.05	4.05	0.47172	ATP-grasp fold, subdomain 2 (1);Synapsin, ATP-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.51652	0.1687	M	0.66939	2.045	0.80722	D	1	B;P	0.44380	0.161;0.834	B;P	0.57244	0.168;0.816	T	0.55218	-0.8175	10	0.87932	D	0	.	10.6179	0.45462	0.0:1.0:0.0:0.0	.	327;327	P17600;P17600-2	SYN1_HUMAN;.	I	327	ENSP00000295987:M327I;ENSP00000343206:M327I	ENSP00000295987:M327I	M	-	3	0	SYN1	47320749	1.000000	0.71417	0.998000	0.56505	0.190000	0.23558	7.248000	0.78268	1.867000	0.54127	0.525000	0.51046	ATG		0.597	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056445.1	NM_006950	Missense_Mutation	6	25	0	0	0	0.001984	0	6	25				
CLCN5	1184	broad.mit.edu	37	X	49853484	49853484	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chrX:49853484G>A	ENST00000307367.2	+	9	1768	c.1477G>A	c.(1477-1479)Gga>Aga	p.G493R	CLCN5_ENST00000376088.3_Missense_Mutation_p.G563R|CLCN5_ENST00000376108.3_Missense_Mutation_p.G493R|CLCN5_ENST00000376091.3_Missense_Mutation_p.G563R			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	493					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					GTGTAGTCAGGGAGCTGATTG	0.507																																							uc004dos.1		NA																	0				ovary(2)|lung(1)|central_nervous_system(1)	4						c.(1477-1479)GGA>AGA		chloride channel 5 isoform b							129.0	115.0	120.0					X																	49853484		2203	4300	6503	SO:0001583	missense	1184				excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding	g.chrX:49853484G>A	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1477G>A	X.37:g.49853484G>A	ENSP00000304257:p.Gly493Arg		Somatic				CLCN5_uc004dor.1_Missense_Mutation_p.G563R|CLCN5_uc004doq.1_Missense_Mutation_p.G563R|CLCN5_uc004dot.1_Missense_Mutation_p.G493R	p.G493R	NM_000084	NP_000075	WXS	Illumina HiSeq	Unspecified	P51795	CLCN5_HUMAN			9	1725	+	Ovarian(276;0.236)		493					A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	37	c.1477G>A	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.527032	0.85706	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.94092	-3.35;-3.35;-3.35;-3.35	5.54	5.54	0.83059	Chloride channel, core (2);	0.093532	0.64402	N	0.000001	D	0.96599	0.8890	M	0.87456	2.885	0.80722	D	1	P;D	0.57257	0.585;0.979	B;P	0.59546	0.291;0.859	D	0.96740	0.9546	10	0.54805	T	0.06	7.537	17.459	0.87615	0.0:0.0:1.0:0.0	.	493;563	P51795;P51795-2	CLCN5_HUMAN;.	R	563;395;563;493;493	ENSP00000365256:G563R;ENSP00000365259:G563R;ENSP00000365276:G493R;ENSP00000304257:G493R	ENSP00000304257:G493R	G	+	1	0	CLCN5	49740224	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.592000	0.98245	2.480000	0.83734	0.523000	0.50628	GGA		0.507	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1			9	71	0	0	0	0.004482	0	9	71				
SMC1A	8243	broad.mit.edu	37	X	53409204	53409204	+	Missense_Mutation	SNP	G	G	A			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chrX:53409204G>A	ENST00000322213.4	-	22	3513	c.3386C>T	c.(3385-3387)tCa>tTa	p.S1129L	SMC1A_ENST00000469129.1_5'UTR	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	1129	Ala/Asp-rich (DA-box).				DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						CTCCCCGCCTGACAAGTTGTC	0.572																																							uc004dsg.2		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(3385-3387)TCA>TTA		structural maintenance of chromosomes 1A							74.0	56.0	62.0					X																	53409204		2203	4300	6503	SO:0001583	missense	8243				cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity	g.chrX:53409204G>A	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.3386C>T	X.37:g.53409204G>A	ENSP00000323421:p.Ser1129Leu		Somatic				SMC1A_uc011moe.1_Missense_Mutation_p.S1107L	p.S1129L	NM_006306	NP_006297	WXS	Illumina HiSeq	Unspecified	Q14683	SMC1A_HUMAN			22	3455	-			1129			Ala/Asp-rich (DA-box).		O14995|Q16351|Q2M228	Missense_Mutation	SNP	ENST00000322213.4	37	c.3386C>T	CCDS14352.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.255931	0.80135	.	.	ENSG00000072501	ENST00000322213	D	0.98947	-5.26	5.04	5.04	0.67666	RecF/RecN/SMC (1);	0.153917	0.44688	D	0.000439	D	0.99378	0.9781	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98616	1.0665	10	0.87932	D	0	.	16.5604	0.84551	0.0:0.0:1.0:0.0	.	1129	Q14683	SMC1A_HUMAN	L	1129	ENSP00000323421:S1129L	ENSP00000323421:S1129L	S	-	2	0	SMC1A	53425929	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	9.526000	0.98042	2.254000	0.74563	0.600000	0.82982	TCA		0.572	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306		10	20	0	0	0	0.000978	0	10	20				
PAGE5	90737	broad.mit.edu	37	X	55249155	55249155	+	Missense_Mutation	SNP	G	G	C			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chrX:55249155G>C	ENST00000289619.5	+	4	597	c.352G>C	c.(352-354)Gat>Cat	p.D118H	PAGE5_ENST00000374952.1_Missense_Mutation_p.D81H|PAGE5_ENST00000374955.3_Missense_Mutation_p.D98H	NM_130467.3	NP_569734.2	Q96GU1	PAGE5_HUMAN	P antigen family, member 5 (prostate associated)	118										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8						GCCCACTTTTGATCCCACTAA	0.423																																							uc004duj.2		NA																	0					0						c.(352-354)GAT>CAT		P antigen family, member 5 isoform 1							158.0	138.0	145.0					X																	55249155		2203	4300	6503	SO:0001583	missense	90737							g.chrX:55249155G>C	AJ344352	CCDS14368.1, CCDS35306.1	Xp11.22	2009-08-18			ENSG00000158639	ENSG00000158639			29992	protein-coding gene	gene with protein product	"""cancer/testis antigen family 16, member 1"", ""cancer/testis antigen family 16, member 2"""					11920606, 11992404	Standard	XM_006724613		Approved	PAGE-5, CT16.1, CT16.2	uc004duk.3	Q96GU1	OTTHUMG00000021650	ENST00000289619.5:c.352G>C	X.37:g.55249155G>C	ENSP00000289619:p.Asp118His		Somatic				PAGE5_uc004duk.2_Missense_Mutation_p.D98H	p.D118H	NM_130467	NP_569734	WXS	Illumina HiSeq	Unspecified	Q96GU1	GGEE1_HUMAN			4	594	+			118					Q2NL97|Q5JUL0|Q8WWL9	Missense_Mutation	SNP	ENST00000289619.5	37	c.352G>C	CCDS14368.1	.	.	.	.	.	.	.	.	.	.	.	9.354	1.066244	0.20067	.	.	ENSG00000158639	ENST00000289619;ENST00000374955;ENST00000374952	T;T;T	0.11604	2.76;2.76;2.76	1.44	-0.609	0.11608	.	.	.	.	.	T	0.21022	0.0506	M	0.65975	2.015	0.09310	N	1	D	0.65815	0.995	P	0.62649	0.905	T	0.13019	-1.0525	9	0.87932	D	0	.	2.5125	0.04660	0.2357:0.3191:0.4452:0.0	.	118	Q96GU1	GGEE1_HUMAN	H	118;98;81	ENSP00000289619:D118H;ENSP00000364093:D98H;ENSP00000364090:D81H	ENSP00000289619:D118H	D	+	1	0	PAGE5	55265880	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.134000	0.10436	-0.303000	0.08856	0.502000	0.49764	GAT		0.423	PAGE5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056861.1	NM_130467		55	8	0	0	0	0.00361	0	55	8				
PCDH19	57526	broad.mit.edu	37	X	99551623	99551623	+	Silent	SNP	C	C	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chrX:99551623C>T	ENST00000373034.4	-	6	4774	c.3099G>A	c.(3097-3099)ctG>ctA	p.L1033L	PCDH19_ENST00000255531.7_Silent_p.L986L|PCDH19_ENST00000420881.2_Silent_p.L985L|PCDH19_ENST00000464981.1_5'Flank	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	1033					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TCTTGCCTTTCAGGGTAGGCC	0.582																																							uc010nmz.2		NA																	0				ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						c.(3097-3099)CTG>CTA		protocadherin 19 isoform b							68.0	69.0	69.0					X																	99551623		2145	4216	6361	SO:0001819	synonymous_variant	57526				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chrX:99551623C>T	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.3099G>A	X.37:g.99551623C>T			Somatic				PCDH19_uc004efw.3_Silent_p.L985L|PCDH19_uc004efx.3_Silent_p.L986L	p.L1033L	NM_020766	NP_001098713	WXS	Illumina HiSeq	Unspecified	Q8TAB3	PCD19_HUMAN			6	4775	-			1033			Cytoplasmic (Potential).		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Silent	SNP	ENST00000373034.4	37	c.3099G>A	CCDS55462.1																																																																																				0.582	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766		15	19	0	0	0	0.004007	0	15	19				
NXF3	56000	broad.mit.edu	37	X	102339309	102339309	+	Missense_Mutation	SNP	G	G	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chrX:102339309G>T	ENST00000395065.3	-	3	413	c.312C>A	c.(310-312)aaC>aaA	p.N104K	NXF3_ENST00000425644.1_5'UTR|NXF3_ENST00000425463.2_Missense_Mutation_p.N15K	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	104					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						CATCCGGCATGTTCCCCTCCA	0.473																																							uc004eju.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(310-312)AAC>AAA		nuclear RNA export factor 3							222.0	174.0	190.0					X																	102339309		2203	4300	6503	SO:0001583	missense	56000					cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|protein binding	g.chrX:102339309G>T	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.312C>A	X.37:g.102339309G>T	ENSP00000378504:p.Asn104Lys		Somatic				NXF3_uc010noi.1_5'Flank|NXF3_uc011mrw.1_Missense_Mutation_p.N104K|NXF3_uc011mrx.1_Missense_Mutation_p.N15K	p.N104K	NM_022052	NP_071335	WXS	Illumina HiSeq	Unspecified	Q9H4D5	NXF3_HUMAN			3	383	-			104					B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	ENST00000395065.3	37	c.312C>A	CCDS14503.1	.	.	.	.	.	.	.	.	.	.	G	7.544	0.661225	0.14645	.	.	ENSG00000147206	ENST00000395065;ENST00000425463	T;T	0.44881	0.91;0.91	3.57	-7.14	0.01527	Nuclear RNA export factor Tap, RNA-binding domain (1);	0.905437	0.09548	N	0.787301	T	0.19366	0.0465	L	0.50333	1.59	0.09310	N	1	P;B	0.40834	0.73;0.053	B;B	0.31751	0.135;0.025	T	0.34900	-0.9810	10	0.06365	T	0.9	-0.4249	1.5679	0.02608	0.1706:0.3194:0.1271:0.383	.	104;104	B4DYI1;Q9H4D5	.;NXF3_HUMAN	K	104;15	ENSP00000378504:N104K;ENSP00000404347:N15K	ENSP00000378504:N104K	N	-	3	2	NXF3	102225965	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.756000	0.00789	-3.192000	0.00219	-0.330000	0.08379	AAC		0.473	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052		52	4	1	0	4.25531e-23	0.00361	7.39448e-23	52	4				
PCDH11Y	83259	broad.mit.edu	37	Y	4967015	4967015	+	Missense_Mutation	SNP	A	A	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chrY:4967015A>T	ENST00000333703.4	+	5	1876	c.1363A>T	c.(1363-1365)Att>Ttt	p.I455F	PCDH11Y_ENST00000362095.5_Missense_Mutation_p.I466F|PCDH11Y_ENST00000215473.6_Missense_Mutation_p.I466F	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	466	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						AGAATATGCCATTAAATTACT	0.393																																							uc004fqo.2		NA																	0					0						c.(1396-1398)ATT>TTT		protocadherin 11 Y-linked isoform c																																				SO:0001583	missense	83259				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chrY:4967015A>T	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.1363A>T	Y.37:g.4967015A>T	ENSP00000330552:p.Ile455Phe		Somatic				PCDH11Y_uc010nwg.1_Missense_Mutation_p.I455F|PCDH11Y_uc004fql.1_Missense_Mutation_p.I455F|PCDH11Y_uc004fqm.1_Missense_Mutation_p.I455F|PCDH11Y_uc004fqn.1_Missense_Mutation_p.I466F|PCDH11Y_uc004fqp.1_Missense_Mutation_p.I237F	p.I466F	NM_032973	NP_116755	WXS	Illumina HiSeq	Unspecified	Q9BZA8	PC11Y_HUMAN			2	2130	+			466			Cadherin 4.|Extracellular (Potential).		Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	c.1396A>T	CCDS14776.1																																																																																				0.393	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973		2	0	0	0	0	0.004672	0	2	0				
ESPNP	284729	broad.mit.edu	37	1	17034125	17034126	+	RNA	INS	-	-	AGCT	rs141324796|rs79472512	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:17034125_17034126insAGCT	ENST00000492551.1	-	0	477_478					NR_026567.1				espin pseudogene																		CAGCAGCAGCCAGCTGAGCACC	0.718														1500	0.299521	0.1188	0.3444	5008	,	,		24180	0.4177		0.3101	False		,,,				2504	0.3793						uc001azn.1		NA																	0					0						c.(364-366)TGGfs		RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;																																						284729							g.chr1:17034125_17034126insAGCT	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17034126_17034129dupAGCT			Somatic				ESPNP_uc010ocj.1_Frame_Shift_Ins_p.W52fs	p.W122fs	NR_026567		WXS	Illumina HiSeq	Unspecified					3	478_479	-									Frame_Shift_Ins	INS	ENST00000492551.1	37	c.364_365insAGCT																																																																																					0.718	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1			7	12	NA	NA	NA	NA	NA	7	12	---	---	---	---
TPR	7175	broad.mit.edu	37	1	186313522	186313525	+	Frame_Shift_Del	DEL	TCTT	TCTT	-	rs200011256	byFrequency	TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	TCTT	TCTT	-	-	TCTT	TCTT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr1:186313522_186313525delTCTT	ENST00000367478.4	-	25	3695_3698	c.3399_3402delAAGA	c.(3397-3402)gaaagafs	p.ER1135fs		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1135					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		ACATTCTCTCTCTTTCCTCCCAAG	0.353			T	NTRK1	papillary thyroid																																		uc001grv.2		NA		Dom	yes		1	1q25	7175	T	translocated promoter region			E	NTRK1		papillary thyroid		0				ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7						c.(3397-3402)GAAAGAfs		nuclear pore complex-associated protein TPR																																				SO:0001589	frameshift_variant	7175				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity	g.chr1:186313522_186313525delTCTT	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.3399_3402delAAGA	1.37:g.186313522_186313525delTCTT	ENSP00000356448:p.Glu1135fs		Somatic					p.E1133fs	NM_003292	NP_003283	WXS	Illumina HiSeq	Unspecified	P12270	TPR_HUMAN		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)	25	3696_3699	-		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)	1133_1134			Potential.		Q15655|Q5SWY0|Q99968	Frame_Shift_Del	DEL	ENST00000367478.4	37	c.3399_3402delAAGA	CCDS41446.1																																																																																				0.353	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292		32	261	NA	NA	NA	NA	NA	32	261	---	---	---	---
MYO3A	53904	broad.mit.edu	37	10	26377188	26377189	+	Frame_Shift_Ins	INS	-	-	T			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr10:26377188_26377189insT	ENST00000265944.5	+	15	1582_1583	c.1416_1417insT	c.(1417-1419)tttfs	p.F473fs	MYO3A_ENST00000543632.1_Frame_Shift_Ins_p.F473fs	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	473	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TGGTAGAAGCCTTTGGCAATGC	0.317																																							uc001isn.2		NA																	0				ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						c.(1414-1419)GCCTTTfs		myosin IIIA																																				SO:0001589	frameshift_variant	53904				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity	g.chr10:26377188_26377189insT	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1419dupT	10.37:g.26377191_26377191dupT	ENSP00000265944:p.Phe473fs		Somatic				MYO3A_uc009xko.1_Frame_Shift_Ins_p.A472fs|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Frame_Shift_Ins_p.A472fs	p.A472fs	NM_017433	NP_059129	WXS	Illumina HiSeq	Unspecified	Q8NEV4	MYO3A_HUMAN			15	1776_1777	+			472_473			Myosin head-like.		Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Frame_Shift_Ins	INS	ENST00000265944.5	37	c.1416_1417insT	CCDS7148.1																																																																																				0.317	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433		17	51	NA	NA	NA	NA	NA	17	51	---	---	---	---
INF2	64423	broad.mit.edu	37	14	105179550	105179550	+	Frame_Shift_Del	DEL	A	A	-			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr14:105179550delA	ENST00000392634.4	+	19	2894	c.2782delA	c.(2782-2784)aagfs	p.K928fs	INF2_ENST00000330634.7_Frame_Shift_Del_p.K928fs	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	928	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		GCAGGAGAACAAGGACCGGAA	0.706																																							uc001ypb.2		NA																	0					0						c.(2782-2784)AAGfs		inverted formin 2 isoform 1							26.0	38.0	34.0					14																	105179550		2113	4204	6317	SO:0001589	frameshift_variant	64423				actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding	g.chr14:105179550delA	AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.2782delA	14.37:g.105179550delA	ENSP00000376410:p.Lys928fs		Somatic				INF2_uc010tyi.1_Frame_Shift_Del_p.K928fs|INF2_uc001ypc.2_Frame_Shift_Del_p.K928fs|INF2_uc010awz.1_RNA	p.K928fs	NM_022489	NP_071934	WXS	Illumina HiSeq	Unspecified	Q27J81	INF2_HUMAN	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)	19	2925	+		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	928			Potential.|FH2.		Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Frame_Shift_Del	DEL	ENST00000392634.4	37	c.2782delA	CCDS9989.2																																																																																				0.706	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074371.4	NM_022489		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
ITGAL	3683	broad.mit.edu	37	16	30531249	30531251	+	In_Frame_Del	DEL	GCT	GCT	-	rs374222520		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	GCT	GCT	-	-	GCT	GCT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr16:30531249_30531251delGCT	ENST00000356798.6	+	30	3480_3482	c.3300_3302delGCT	c.(3298-3303)gggctg>ggg	p.L1106del	ITGAL_ENST00000433423.2_In_Frame_Del_p.L340del|ITGAL_ENST00000358164.5_In_Frame_Del_p.L1022del	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	1106					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GCATCGGGGGGCTGCTGCTGCTG	0.601																																					NSCLC(110;1462 1641 3311 33990 49495)	NSCLC(110;1462 1641 3311 33990 49495)	uc002dyi.3		NA																	0				ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10						c.(3298-3303)GGGCTG>GGG		integrin alpha L isoform a precursor	Efalizumab(DB00095)																																			SO:0001651	inframe_deletion	3683				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity	g.chr16:30531249_30531251delGCT		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.3300_3302delGCT	16.37:g.30531258_30531260delGCT	ENSP00000349252:p.Leu1106del		Somatic				ITGAL_uc002dyj.3_In_Frame_Del_p.L1022del|ITGAL_uc010vev.1_In_Frame_Del_p.L340del	p.L1106del	NM_002209	NP_002200	WXS	Illumina HiSeq	Unspecified	P20701	ITAL_HUMAN			30	3476_3478	+			1106			Helical; (Potential).		O43746|Q45H73|Q96HB1|Q9UBC8	In_Frame_Del	DEL	ENST00000356798.6	37	c.3300_3302delGCT	CCDS32433.1																																																																																				0.601	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2			8	224	NA	NA	NA	NA	NA	8	224	---	---	---	---
ALOX12B	242	broad.mit.edu	37	17	7980316	7980316	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr17:7980316delG	ENST00000319144.4	-	9	1527	c.1267delC	c.(1267-1269)ctcfs	p.L423fs	ALOX12B_ENST00000577351.1_5'UTR|AC129492.6_ENST00000399413.3_5'Flank	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	423	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						ACCTTGTAGAGGGGGTGGCAC	0.627										Multiple Myeloma(8;0.094)																													uc002gjy.1		NA																	0					0						c.(1267-1269)CTCfs		arachidonate 12-lipoxygenase, 12R type							30.0	28.0	28.0					17																	7980316		2203	4300	6503	SO:0001589	frameshift_variant	242				epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity	g.chr17:7980316delG	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.1267delC	17.37:g.7980316delG	ENSP00000315167:p.Leu423fs	Multiple Myeloma(8;0.094)	Somatic				uc010cnq.1_5'Flank	p.L423fs	NM_001139	NP_001130	WXS	Illumina HiSeq	Unspecified	O75342	LX12B_HUMAN			9	1528	-			423			Lipoxygenase.			Frame_Shift_Del	DEL	ENST00000319144.4	37	c.1267delC	CCDS11129.1																																																																																				0.627	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226984.3			8	13	NA	NA	NA	NA	NA	8	13	---	---	---	---
PPP5C	5536	broad.mit.edu	37	19	46850393	46850393	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr19:46850393delC	ENST00000012443.4	+	1	143	c.40delC	c.(40-42)cccfs	p.P15fs	PPP5C_ENST00000391919.1_5'UTR	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	15					cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)	p.R16fs*7(1)		endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		GTGTGCTGAGCCCCCCCGGGA	0.687											OREG0025570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002pem.2		NA																	1	Insertion - Frameshift(1)		ovary(1)	lung(1)|pancreas(1)	2						c.(40-42)CCCfs		protein phosphatase 5, catalytic subunit							25.0	23.0	24.0					19																	46850393		2197	4298	6495	SO:0001589	frameshift_variant	5536				mitosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein dephosphorylation|transcription, DNA-dependent	Golgi apparatus|nucleus	metal ion binding|protein binding|protein serine/threonine phosphatase activity|signal transducer activity	g.chr19:46850393delC		CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.40delC	19.37:g.46850393delC	ENSP00000012443:p.Pro15fs		Somatic	OREG0025570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	942	PPP5C_uc010xya.1_5'UTR|PPP5C_uc002pen.2_Frame_Shift_Del_p.P14fs	p.P14fs	NM_006247	NP_006238	WXS	Illumina HiSeq	Unspecified	P53041	PPP5_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)	1	100	+		Ovarian(192;0.0731)|all_neural(266;0.196)	14					Q16722|Q53XV2	Frame_Shift_Del	DEL	ENST00000012443.4	37	c.40delC	CCDS12684.1																																																																																				0.687	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247		7	1	NA	NA	NA	NA	NA	7	1	---	---	---	---
KCNH7	90134	broad.mit.edu	37	2	163361086	163361104	+	Frame_Shift_Del	DEL	ATCTTGTTAATGGTGCTGT	ATCTTGTTAATGGTGCTGT	-			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	ATCTTGTTAATGGTGCTGT	ATCTTGTTAATGGTGCTGT	-	-	ATCTTGTTAATGGTGCTGT	ATCTTGTTAATGGTGCTGT	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr2:163361086_163361104delATCTTGTTAATGGTGCTGT	ENST00000332142.5	-	6	1076_1094	c.977_995delACAGCACCATTAACAAGAT	c.(976-996)tacagcaccattaacaagattfs	p.YSTINKI326fs	KCNH7_ENST00000328032.4_Frame_Shift_Del_p.YSTINKI319fs|KCNH7_ENST00000477019.1_5'UTR	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	326					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GAGCTGTGGAATCTTGTTAATGGTGCTGTATTTGTTGAG	0.356																																					GBM(196;1492 2208 17507 24132 45496)	GBM(196;1492 2208 17507 24132 45496)	uc002uch.1		NA																	0				ovary(3)|skin(2)	5						c.(976-996)TACAGCACCATTAACAAGATTfs		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)																																			SO:0001589	frameshift_variant	90134				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity	g.chr2:163361086_163361104delATCTTGTTAATGGTGCTGT	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.977_995delACAGCACCATTAACAAGAT	2.37:g.163361086_163361104delATCTTGTTAATGGTGCTGT	ENSP00000331727:p.Tyr326fs		Somatic				KCNH7_uc002uci.2_Frame_Shift_Del_p.Y319fs	p.Y326fs	NM_033272	NP_150375	WXS	Illumina HiSeq	Unspecified	Q9NS40	KCNH7_HUMAN			6	1189_1207	-			326_332			Cytoplasmic (Potential).		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Frame_Shift_Del	DEL	ENST00000332142.5	37	c.977_995delACAGCACCATTAACAAGAT	CCDS2219.1																																																																																				0.356	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		17	34	NA	NA	NA	NA	NA	17	34	---	---	---	---
DNMT3B	1789	broad.mit.edu	37	20	31384616	31384617	+	Frame_Shift_Ins	INS	-	-	G	rs150851562		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr20:31384616_31384617insG	ENST00000328111.2	+	13	1639_1640	c.1318_1319insG	c.(1318-1320)aggfs	p.R440fs	DNMT3B_ENST00000344505.4_Frame_Shift_Ins_p.R420fs|DNMT3B_ENST00000456297.2_Frame_Shift_Ins_p.R344fs|DNMT3B_ENST00000201963.3_Frame_Shift_Ins_p.R432fs|DNMT3B_ENST00000353855.2_Frame_Shift_Ins_p.R420fs|DNMT3B_ENST00000375623.4_Splice_Site|DNMT3B_ENST00000443239.3_Frame_Shift_Ins_p.R378fs|DNMT3B_ENST00000348286.2_Frame_Shift_Ins_p.R420fs	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	440	ADD. {ECO:0000255|PROSITE- ProRule:PRU00865}.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GTCTTGTGGCAGGAAAAACCCC	0.559																																							uc002wyc.2		NA																	0				lung(3)|ovary(2)	5						c.(1318-1320)AGGfs		DNA cytosine-5 methyltransferase 3 beta isoform																																				SO:0001589	frameshift_variant	1789				negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity	g.chr20:31384616_31384617insG		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.1320dupG	20.37:g.31384618_31384618dupG	ENSP00000328547:p.Arg440fs		Somatic				DNMT3B_uc010ztx.1_RNA|DNMT3B_uc010zty.1_Splice_Site|DNMT3B_uc002wyd.2_Frame_Shift_Ins_p.R420fs|DNMT3B_uc002wye.2_Frame_Shift_Ins_p.R420fs|DNMT3B_uc010gee.2_RNA|DNMT3B_uc010gef.2_RNA|DNMT3B_uc010ztz.1_Frame_Shift_Ins_p.R378fs|DNMT3B_uc010zua.1_Frame_Shift_Ins_p.R344fs|DNMT3B_uc002wyf.2_Frame_Shift_Ins_p.R432fs|DNMT3B_uc002wyg.2_Frame_Shift_Ins_p.R139fs	p.R440fs	NM_006892	NP_008823	WXS	Illumina HiSeq	Unspecified	Q9UBC3	DNM3B_HUMAN			13	1639_1640	+			440			GATA-type; atypical.|ADD.|Interaction with the PRC2/EED-EZH2 complex (By similarity).		A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Frame_Shift_Ins	INS	ENST00000328111.2	37	c.1318_1319insG	CCDS13205.1																																																																																				0.559	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892		10	121	NA	NA	NA	NA	NA	10	121	---	---	---	---
TOP2B	7155	broad.mit.edu	37	3	25654107	25654107	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr3:25654107delG	ENST00000264331.4	-	28	3684	c.3685delC	c.(3685-3687)cagfs	p.Q1229fs	TOP2B_ENST00000435706.2_Frame_Shift_Del_p.Q1224fs|TOP2B_ENST00000475717.1_5'UTR|TOP2B_ENST00000540199.1_Frame_Shift_Del_p.Q81fs|TOP2B_ENST00000542520.1_Frame_Shift_Del_p.Q81fs	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	1229					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	TCTTCCAACTGGAGTTTCTTC	0.403																																							uc011awn.1		NA																	0				breast(2)|ovary(1)|lung(1)|skin(1)	5						c.(3685-3687)CAGfs		DNA topoisomerase II, beta isozyme							187.0	184.0	185.0					3																	25654107		1869	4094	5963	SO:0001589	frameshift_variant	7155				DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity	g.chr3:25654107delG	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.3685delC	3.37:g.25654107delG	ENSP00000264331:p.Gln1229fs		Somatic				TOP2B_uc003cdj.2_Frame_Shift_Del_p.Q1224fs|TOP2B_uc011awm.1_Frame_Shift_Del_p.Q81fs|TOP2B_uc010hff.1_Frame_Shift_Del_p.Q90fs	p.Q1229fs	NM_001068	NP_001059	WXS	Illumina HiSeq	Unspecified	Q02880	TOP2B_HUMAN			28	3728	-			1229					Q13600|Q9UMG8|Q9UQP8	Frame_Shift_Del	DEL	ENST00000264331.4	37	c.3685delC																																																																																					0.403	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				17	148	NA	NA	NA	NA	NA	17	148	---	---	---	---
CNOT6L	246175	broad.mit.edu	37	4	78697452	78697453	+	Frame_Shift_Ins	INS	-	-	T	rs200743940		TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr4:78697452_78697453insT	ENST00000504123.1	-	2	229_230	c.99_100insA	c.(97-102)aaatctfs	p.S34fs	CNOT6L_ENST00000506166.1_5'UTR|CNOT6L_ENST00000264903.4_Frame_Shift_Ins_p.S34fs			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	34	Required for interaction with CNOT1, CNOT3 and CNOT7.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						GCCCAGTGAGATTTTTTCCCAT	0.371																																							uc011ccd.1		NA																	0				large_intestine(1)	1						c.(97-102)AAATCTfs		CCR4-NOT transcription complex, subunit 6-like																																				SO:0001589	frameshift_variant	246175				nuclear-transcribed mRNA poly(A) tail shortening	cytosol	exonuclease activity|protein binding	g.chr4:78697452_78697453insT	AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.100dupA	4.37:g.78697458_78697458dupT	ENSP00000424896:p.Ser34fs		Somatic				CNOT6L_uc003hks.2_Frame_Shift_Ins_p.K33fs|CNOT6L_uc011cce.1_Frame_Shift_Ins_p.K33fs	p.K33fs	NM_144571	NP_653172	WXS	Illumina HiSeq	Unspecified	Q96LI5	CNO6L_HUMAN			2	230_231	-			33_34					Q9UF92	Frame_Shift_Ins	INS	ENST00000504123.1	37	c.99_100insA																																																																																					0.371	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000362515.1			25	106	NA	NA	NA	NA	NA	25	106	---	---	---	---
ECM2	1842	broad.mit.edu	37	9	95272282	95272282	+	Frame_Shift_Del	DEL	C	C	-			TCGA-55-6972-01A-11D-1945-08	TCGA-55-6972-11A-01D-1945-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	46693a2b-5105-4770-a9e1-031dfedeb694	32fe5a7b-6f0d-4245-86b9-35055cbd71f7	g.chr9:95272282delC	ENST00000344604.5	-	6	1354	c.1205delG	c.(1204-1206)ggafs	p.G402fs	ECM2_ENST00000444490.2_Frame_Shift_Del_p.G380fs|CENPP_ENST00000375587.3_Intron	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	402					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						CAAATTATTTCCATCCATATT	0.318																																							uc004ash.2		NA																	0				ovary(1)|skin(1)	2						c.(1204-1206)GGAfs		extracellular matrix protein 2 precursor							85.0	84.0	84.0					9																	95272282		2201	4298	6499	SO:0001589	frameshift_variant	1842				cell-matrix adhesion		integrin binding	g.chr9:95272282delC	AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.1205delG	9.37:g.95272282delC	ENSP00000344758:p.Gly402fs		Somatic				CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Frame_Shift_Del_p.G380fs|ECM2_uc011lty.1_Frame_Shift_Del_p.G402fs|ECM2_uc004asg.2_Frame_Shift_Del_p.G380fs	p.G402fs	NM_001393	NP_001384	WXS	Illumina HiSeq	Unspecified	O94769	ECM2_HUMAN			6	1270	-			402			LRR 2.		B2R730|E2PU11|Q5T9F2|Q7Z3D0	Frame_Shift_Del	DEL	ENST00000344604.5	37	c.1205delG	CCDS6698.1																																																																																				0.318	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053091.1	NM_001393		16	27	NA	NA	NA	NA	NA	16	27	---	---	---	---
